WorldWideScience

Sample records for mycobacterial hsp65 gene

  1. Ubiquitin-fusion degradation pathway: A new strategy for inducing CD8 cells specific for mycobacterial HSP65

    International Nuclear Information System (INIS)

    The ubiquitin-proteasome system (UPS) plays an indispensable role in inducing MHC class I-restricted CD8+ T cells. In this study, we exploited UPS to induce CD8+ T cells specific for mycobacterial HSP65 (mHSP65), one of the leading vaccine candidates against infection with Mycobacterium tuberculosis. A chimeric DNA termed pU-HSP65 encoding a fusion protein between murine ubiquitin and mHSP65 was constructed, and C57BL/6 (B6) mice were immunized with the DNA using gene gun bombardment. Mice immunized with the chimeric DNA acquired potent resistance against challenge with the syngeneic B16F1 melanoma cells transfected with the mHSP65 gene (HSP65/B16F1), compared with those immunized with DNA encoding only mHSP65. Splenocytes from the former group of mice showed a higher grade of cytotoxic activity against HSP65/B16F1 cells and contained a larger number of granzyme B- or IFN-γ-producing CD8+ T cells compared with those from the latter group of mice

  2. Matrix metalloproteinase proteolysis of the mycobacterial HSP65 protein as a potential source of immunogenic peptides in human tuberculosis.

    Science.gov (United States)

    Shiryaev, Sergey A; Cieplak, Piotr; Aleshin, Alexander E; Sun, Qing; Zhu, Wenhong; Motamedchaboki, Khatereh; Sloutsky, Alexander; Strongin, Alex Y

    2011-09-01

    Mycobacterium tuberculosis is the causative agent of human tuberculosis (TB). Mycobacterial secretory protein ESAT-6 induces matrix metalloproteinase (MMP)-9 in epithelial cells neighboring infected macrophages. MMP-9 then enhances recruitment of uninfected macrophages, which contribute to nascent granuloma maturation and bacterial growth. Disruption of MMP-9 function attenuates granuloma formation and bacterial growth. The abundant mycobacterial 65 kDa heat shock protein (HSP65) chaperone is the major target for the immune response and a critical component in M. tuberculosis adhesion to macrophages. We hypothesized that HSP65 is susceptible to MMP-9 proteolysis and that the resulting HSP65 immunogenic peptides affect host adaptive immunity. To identify MMPs that cleave HSP65, we used MMP-2 and MMP-9 gelatinases, the simple hemopexin domain MMP-8, membrane-associated MMP-14, MMP-15, MMP-16 and MMP-24, and glycosylphosphatidylinositol-linked MMP-17 and MMP-25. We determined both the relative cleavage efficiency of MMPs against the HSP65 substrate and the peptide sequence of the cleavage sites. Cleavage of the unstructured PAGHG474L C-terminal region initiates the degradation of HSP65 by MMPs. This initial cleavage destroys the substrate-binding capacity of the HSP65 chaperone. Multiple additional cleavages of the unfolded HSP65 then follow. MMP-2, MMP-8, MMP-14, MMP-15 and MMP-16, in addition to MMP-9, generate the known highly immunogenic N-terminal peptide of HSP65. Based on our biochemical data, we now suspect that MMP proteolysis of HSP65 in vivo, including MMP-9 proteolysis, also results in the abundant generation of the N-terminal immunogenic peptide and that this peptide, in addition to intact HSP65, contributes to the complex immunomodulatory interplay in the course of TB infection. PMID:21752195

  3. Mycobacterial Hsp65 potentially cross-reacts with autoantibodies of diabetes sera and also induces (in vitro) cytokine responses relevant to diabetes mellitus.

    Science.gov (United States)

    Rani, Pittu Sandhya; Babajan, Banaganapalli; Tulsian, Nikhil K; Begum, Mahabubunnisa; Kumar, Ashutosh; Ahmed, Niyaz

    2013-11-01

    Diabetes mellitus is a multifactorial disease and its incidence is increasing worldwide. Among the two types of diabetes, type-2 accounts for about 90% of all diabetic cases, whereas type-1 or juvenile diabetes is less prevalent and presents with humoral immune responses against some of the autoantigens. We attempted to test whether the sera of type-1 diabetes patients cross-react with mycobacterial heat shock protein 65 (Hsp65) due to postulated epitope homologies between mycobacterial Hsp65 and an important autoantigen of type-1 diabetes, glutamic acid decarboxylase-65 (GAD65). In our study, we used either recombinant mycobacterial Hsp65 protein or synthetic peptides corresponding to some of the potential epitopes of mycobacterial Hsp65 that are shared with GAD65 or human Hsp60, and a control peptide sourced from mycobacterial Hsp65 which is not shared with GAD65, Hsp60 and other autoantigens of type-1 diabetes. The indirect ELISA results indicated that both type-1 diabetes and type-2 diabetes sera cross-react with conserved mycobacterial Hsp65 peptides and recombinant mycobacterial Hsp65 protein but do not do so with the control peptide. Our results suggest that cross-reactivity of mycobacterial Hsp65 with autoantibodies of diabetes sera could be due to the presence of significantly conserved peptides between mycobacterial Hsp65 and human Hsp60 rather than between mycobacterial Hsp65 and GAD65. The treatment of human peripheral blood mononuclear cells (PBMCs) with recombinant mycobacterial Hsp65 protein or the synthetic peptides resulted in a significant increase in the secretion of cytokines such as IL-1β, IL-8, IL-6, TNF-α and IL-10. Taken together, these findings point towards a dual role for mycobacterial Hsp65: in inducing autoimmunity and in inflammation, the two cardinal features of diabetes mellitus.

  4. Matrix metalloproteinase proteolysis of the mycobacterial HSP65 protein as a potential source of immunogenic peptides in human tuberculosis

    OpenAIRE

    Sergey A Shiryaev; Cieplak, Piotr; Aleshin, Alexander E.; Sun, Qing; Zhu, Wenhong; Motamedchaboki, Khatereh; Sloutsky, Alexander; Strongin, Alex Y.

    2011-01-01

    Mycobacterium tuberculosis is the causative agent of human tuberculosis (TB). Mycobacterial secretory protein ESAT-6 induces MMP-9 in epithelial cells neighboring infected macrophages. MMP-9 then enhances recruitment of uninfected macrophages, which contribute to nascent granuloma maturation and bacterial growth. Disruption of MMP-9 function attenuates granuloma formation and bacterial growth. The abundant mycobacterial HSP65 chaperone is the major target for immune response and a critical co...

  5. Combined rpoB duplex PCR and hsp65 PCR restriction fragment length polymorphism with capillary electrophoresis as an effective algorithm for identification of Mycobacterial species from clinical isolates

    Directory of Open Access Journals (Sweden)

    Huang Chen-Cheng

    2012-07-01

    Full Text Available Abstract Background Mycobacteria can be quickly and simply identified by PCR restriction-enzyme analysis (PRA, but misidentification can occur because of similarities in band sizes that are critical for discriminating among species. Capillary electrophoresis can provide computer-aided band discrimination. The aim of this research was to develop an algorithm for identifying mycobacteria by combined rpoB duplex PRA (DPRA and hsp65 PRA with capillary electrophoresis. Results Three hundred and seventy-six acid-fast bacillus smear-positive BACTEC cultures, including 200 Mycobacterium tuberculosis complexes (MTC and 176 non-tuberculous mycobacteria (NTM were analyzed. With combined hsp65 and rpoB DPRA, the accuracy rate was 100% (200 isolates for the MTC and 91.4% (161 isolates for the NTM. Among the discordant results (8.6% for the NTM, one isolate of Mycobacterial species and an isolate of M. flavescens were found as new sub-types in hsp65 PRA. Conclusions This effective and novel identification algorithm using combined rpoB DPRA and hsp65 PRA with capillary electrophoresis can rapidly identify mycobacteria and find new sub-types in hsp65 PRA. In addition, it is complementary to 16 S rDNA sequencing.

  6. Análise de restrição enzimática do gene hsp65 de isolados clínicos de pacientes com suspeita de tuberculose pulmonar em Teresina, Piauí Restriction enzyme analysis of the hsp65 gene in clinical isolates from patients suspected of having pulmonary tuberculosis in Teresina, Brazil

    Directory of Open Access Journals (Sweden)

    Maria das Graças Motta e Bona

    2011-10-01

    Full Text Available OBJETIVO: Identificar as espécies de micobactérias encontradas no escarro de pacientes com suspeita de tuberculose pulmonar e analisar o impacto dessas identificações na abordagem terapêutica. MÉTODOS: Foram avaliados 106 pacientes com suspeita de tuberculose pulmonar encaminhados para o serviço de pneumologia de um hospital público em Teresina, Piauí. Espécimes de escarro matinal foram avaliados quanto à presença de micobactérias por baciloscopia e cultura. Foram utilizadas PCR e análise de restrição enzimática do gene hsp65 (PRA-hsp65 para a identificação das cepas de micobactérias isoladas em cultura. RESULTADOS: Foram analisadas 206 amostras de escarro. A idade dos pacientes variou de 15 a 87 anos, sendo 67% do gênero masculino. Tosse ocorreu em 100% dos casos. O padrão radiográfico predominante foi de lesão moderada, observada em 70%. A positividade no esfregaço foi de 76%, e isolamento em cultura ocorreu em 91% das culturas executadas. Testes tradicionais identificaram micobactérias não tuberculosas (MNT em 9% dos isolados. O método PRA-hsp65 confirmou esses dados, mostrando sete padrões de bandas capazes de identificar as espécies de MNT isoladas: Mycobacterium kansasii; M. abscessus 1; M. abscessus 2; M. smegmatis; M. flavescens 1; M. gordonae 5 e M. gordonae 7. Todos os pacientes com MNT tinham mais de 60 anos, e observaram-se bronquiectasias em 88% das radiografias. Houve dois casos de reinfecção, identificados inicialmente como infecção por M. abscessus e M. kansasii. CONCLUSÕES: As MNT causam infecção pulmonar em pacientes imunocompetentes, e a identificação das MNT é importante para estabelecer o diagnóstico correto e a decisão terapêutica mais adequada. O método PRA-hsp65 é útil para identificar espécies de MNT e pode ser implantado em laboratórios de biologia molecular não especializados em micobactérias.OBJECTIVE: To identify mycobacterial species in the sputum of patients

  7. Administration of Mycobacterium leprae rHsp65 aggravates experimental autoimmune uveitis in mice.

    Directory of Open Access Journals (Sweden)

    Eliana B Marengo

    Full Text Available The 60 kDa heat shock protein family, Hsp60, constitutes an abundant and highly conserved class of molecules that are highly expressed in chronic-inflammatory and autoimmune processes. Experimental autoimmune uveitis [EAU] is a T cell mediated intraocular inflammatory disease that resembles human uveitis. Mycobacterial and homologous Hsp60 peptides induces uveitis in rats, however their participation in aggravating the disease is poorly known. We here evaluate the effects of the Mycobacterium leprae Hsp65 in the development/progression of EAU and the autoimmune response against the eye through the induction of the endogenous disequilibrium by enhancing the entropy of the immunobiological system with the addition of homologous Hsp. B10.RIII mice were immunized subcutaneously with interphotoreceptor retinoid-binding protein [IRBP], followed by intraperitoneally inoculation of M. leprae recombinant Hsp65 [rHsp65]. We evaluated the proliferative response, cytokine production and the percentage of CD4(+IL-17(+, CD4(+IFN-gamma(+ and CD4(+Foxp3(+ cells ex vivo, by flow cytometry. Disease severity was determined by eye histological examination and serum levels of anti-IRBP and anti-Hsp60/65 measured by ELISA. EAU scores increased in the Hsp65 group and were associated with an expansion of CD4(+IFN-gamma(+ and CD4(+IL-17(+ T cells, corroborating with higher levels of IFN-gamma. Our data indicate that rHsp65 is one of the managers with a significant impact over the immune response during autoimmunity, skewing it to a pathogenic state, promoting both Th1 and Th17 commitment. It seems comprehensible that the specificity and primary function of Hsp60 molecules can be considered as a potential pathogenic factor acting as a whistleblower announcing chronic-inflammatory diseases progression.

  8. Recurrent nontuberculous mycobacterial endophthalmitis: a diagnostic conundrum

    Directory of Open Access Journals (Sweden)

    Venkateswaran N

    2014-05-01

    Full Text Available Nandini Venkateswaran,1 Gabrielle Yeaney,2 Mina Chung,3,4 Holly B Hindman3,41University of Rochester School of Medicine and Dentistry, University of Rochester, 2Department of Pathology and Laboratory Medicine, 3Flaum Eye Institute, 4Center for Visual Science, University of Rochester School of Medicine and Dentistry, Rochester, NY, USAObjective: To report a case of recurrent nontuberculous mycobacterial endophthalmitis in the context of neurotrophic keratopathy secondary to herpes zoster ophthalmicus that had an atypical presentation and complex course, and highlights the challenges of causative organism identification and therapeutic interventions in this condition.Methods: A retrospective chart review was conducted to determine the visual outcomes of the patient.Results: A 68-year-old pseudophakic male with long-standing neurotrophic keratopathy and perforated descemetocele managed with cyanoacrylate glue and a contact bandage lens in the left eye, began experiencing recurrent episodes of endophthalmitis after undergoing a penetrating keratoplasty. Several therapeutic procedures including an anterior chamber washout, two pars plana vitrectomies, explantation of the posterior chamber intraocular lens and capsular bag, and multiple intravitreal antimicrobial injections, were performed to which he has ultimately responded favorably, with no signs of infection to date and stable visual acuity. The causative organism of his recurrent infections was initially identified as Mycobacterium abscessus through biochemical testing and 16S ribosomal ribonucleic acid gene sequencing; however, repeat polymerase chain reaction (PCR and sequencing of the 65 kDa heat shock protein (hsp65 gene for experimental purposes confirmed the accurate identification of the organism to be Mycobacterium chelonae. Given the greater reliability of PCR and sequencing of the hsp65 gene over traditional biochemical tests and culture techniques, M. chelonae was likely the

  9. Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

    International Nuclear Information System (INIS)

    In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis

  10. Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, C.D.; Trombone, A.P.F.; Lorenzi, J.C.C.; Almeida, L.P.; Gembre, A.F.; Padilha, E. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Ramos, S.G. [Departamento de Patologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Silva, C.L.; Coelho-Castelo, A.A.M. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

    2012-09-21

    In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

  11. Web-Accessible Database of hsp65 Sequences from Mycobacterium Reference Strains▿†

    OpenAIRE

    Dai, Jianli; Chen, Yuansha; Lauzardo, Michael

    2011-01-01

    Mycobacteria include a large number of pathogens. Identification to species level is important for diagnoses and treatments. Here, we report the development of a Web-accessible database of the hsp65 locus sequences (http://msis.mycobacteria.info) from 149 out of 150 Mycobacterium species/subspecies. This database can serve as a reference for identifying Mycobacterium species.

  12. Administration of M. leprae Hsp65 interferes with the murine lupus progression.

    Directory of Open Access Journals (Sweden)

    Eliana B Marengo

    Full Text Available The heat shock protein [Hsp] family guides several steps during protein synthesis, are abundant in prokaryotic and eukaryotic cells, and are highly conserved during evolution. The Hsp60 family is involved in assembly and transport of proteins, and is expressed at very high levels during autoimmunity or autoinflammatory phenomena. Here, the pathophysiological role of the wild type [WT] and the point mutated K(409A recombinant Hsp65 of M. leprae in an animal model of Systemic Lupus Erythematosus [SLE] was evaluated in vivo using the genetically homogeneous [NZBxNZW]F(1 mice. Anti-DNA and anti-Hsp65 antibodies responsiveness was individually measured during the animal's life span, and the mean survival time [MST] was determined. The treatment with WT abbreviates the MST in 46%, when compared to non-treated mice [p<0.001]. An increase in the IgG2a/IgG1 anti-DNA antibodies ratio was also observed in animals injected with the WT Hsp65. Incubation of BALB/c macrophages with F(1 serum from WT treated mice resulted in acute cell necrosis; treatment of these cells with serum from K(409A treated mice did not cause any toxic effect. Moreover, the involvement of WT correlates with age and is dose-dependent. Our data suggest that Hsp65 may be a central molecule intervening in the progression of the SLE, and that the point mutated K(409A recombinant immunogenic molecule, that counteracts the deleterious effect of WT, may act mitigating and delaying the development of SLE in treated mice. This study gives new insights into the general biological role of Hsp and the significant impact of environmental factors during the pathogenesis of this autoimmune process.

  13. Evaluation of conventional molecular diagnosis of Mycobacterium tuberculosis in clinical specimens from Morocco%基于hsp65基因的PCR技术在检测临床标本中结核杆菌的应用

    Institute of Scientific and Technical Information of China (English)

    谭笑

    2012-01-01

    Objective To evaluate the hsp65 gene-based polymerase chain reaction (PCR) in as a rapid and direct molecular method for detection of Mycobacterium tuberculosis (MTB). Methods MTB genome was extracted from 80 clinical specimens (68 sputum samples, 10 cerebrospinal fluids, and 2 biopsies), and specific primers for hsp65 gene was designed. After PCR reaction was finished, products were analyzed by agarose gel electrophoresis, and some of the products was sequenced. Results The sensitivity of PCR was 86.44%, with specificity of 90.48%; the positive and negative predictive values were 96.23% and 70.37%, respectively. Conclusion The hsp65 gene sequence can be used to differentiate the members of MTB complex from non-tuberculosis mycobacteria, and can be carried out easily.%目的:评价基于hsp65的多聚酶链反应(PCR)在快速检测结核分枝杆菌(MTB)中的应用.方法:从80例临床标本(68份痰标本,10份脑脊液,2份活检标本)中提取MTB基因DNA,设计针对hsp65基因的特异性引物,PCR扩增hsp65基因后用于琼脂糖凝胶电泳观察,同时选择部分阳性产物进行测序.结果:本方法的敏感性为86.44%,特异性为90.48%,阳性和阴性预测值分别为96.23%和70.37%.结论:基于hsp65的PCR能有效区分结核分枝杆菌和非结核分枝杆菌,是一种简单有效的方法.

  14. Comparative Study on the Immunogenicity between Hsp70 DNA Vaccine and Hsp65 DNA Vaccine in Human Mycobacterium Tuberculosis

    Institute of Scientific and Technical Information of China (English)

    DAI; Wuxing; HUANG; Hailang; YUAN; Ye; HU; Jiajie; HUANGFU; Yongmu

    2001-01-01

    The BALB/c mice were immunized with Hsp70 DNA and Hsp65 DNA vaccines in human Mycobacterium tuberculosis. Eight weeks after immunization, the eyeballs were removed, blood and spleen taken, and intraperitoneal macrophages were harvested. The lymphocytic stimulating index(SI) was used to measure the cellular proliferating ability and NO release to measure the phagocytic activity of the macrophages. With ELISA kit, the levels of interleukin-2 (IL-2) and interferon-γ(IFN-γ) in serum and the splenic lymphocytic cultured supernatant were detected. The results showed that after the mice were immunized with 100 μg/mouse of Hsp70 DNA vaccine intramuscularly, the splenic lymphocytic proliferating ability in the mice was significantly increased as compared with that in the control group, vector group and Hsp65 DNA vaccine group (P<0. 01); The contents of NO in the intraperitoneal macrophages of the mice were significantly lower than in the control group and Hsp65 DNA vaccine group (P<0. 01); The levels of serum IL-2 in the mice were significantly higher than in the control group, but there was no statistical difference between Hsp65 DNA group and vector group (P>0. 05); The contents of serum IFN-γ in the mice were significantly higher than in the control group, but significantly lower than in the Hsp65 DNA vaccine group (P<0. 05). It was indicated that immunization with Hsp70 DNA vaccine could obviously enhance the immune response, but its intensity seemed inferior to Hsp65 DNA vaccine. The anti-infection mechanisms and clinical use in the future of the vaccines of Hsp70 DNA and Hsp65 DNA are worth further studying.

  15. Gene chip array for differentiation of mycobacterial species and detection of drug resistance

    Institute of Scientific and Technical Information of China (English)

    SHI Xiao-chun; LIU Xiao-qing; XIE Xiu-li; XU Ying-chun; ZHAO Zhi-xian

    2012-01-01

    Background Gene chip array can differentiate isolated mycobacterial strains using vadous mycobacterium specific probes simultaneously.Gene chip array can evaluate drug resistance to isoniazid and rifampin of tuberculosis strains by detecting drug resistance related gene mutation.This technique has great potential for clinical application.We performed a retrospective study to investigate the capability of gene chip array in the rapid differentiation of species and detection of drug resistance in mycobacterium,and to evaluate its clinical efficacy.Methods We selected 39 patients (54 clinical mycobacterium isolates),used gene chip array to identify the species of these isolates and detect drug resistance to isoniazid and rifampin in Mycobacterium tuberculosis isolates.Meanwhile,these patients' clinical data were analyzed retrospectively.Results Among these 39 patients whose mycopacterium culture were positive,32 patients' isolates were identified as Mycobacterium tubercu/osis, all of them were clinical infection. Seven patients' isolates were identified as non-tuberculosis mycobacterium.Analyzed with their clinical data,only two patients were considered as clinical infection,both of them were diagnosed as hematogenous disseminated Mycobacterium introcellulare infection.The other five patients' isolates were of no clinical significance; their clinical samples were all respiratory specimens.Clinical manifestations of tuberculosis and non-tuberculous mycobacterial infections were similar.Isoniazid resistance was detected in two tuberculosis patients,while rifampin resistance was detected in one tuberculosis patient; there was another patient whose Mycobacterium tuberculosis isolate was resistant to both isoniazid and rifampin (belongs to multidrug resistance tuberculosis).The fact that this patient did not respond to routine anti-tuberculosis chemotherapy also confirmed this result.Conclusions Gene chip array may be a simple,rapid,and reliable method for the

  16. A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages.

    Science.gov (United States)

    Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

    2016-09-01

    Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in Raw264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of Raw264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the Raw264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

  17. A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages

    Science.gov (United States)

    Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

    2016-01-01

    Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in RAW264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of RAW264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the RAW264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

  18. A comparison of the sensitivity of three gel electrophoresis methods for the RFLP analysis of mycobacterial heat shock protein 65 gene%三种凝胶电泳分析分枝杆菌热休克蛋白65基因酶切片段的灵敏度比较

    Institute of Scientific and Technical Information of China (English)

    张彩萍; 王洪生; 冯雨苗; 林麟; 崔盘根; 陈敏; 吴勤学

    2013-01-01

    Objective To compare the performance of 2% (w/v) agarose gel,2% (w/v) Metaphor agarose gel and 10%(w/v) nondenaturating polyacrylamide gel in the PCR-restriction fragment length polymorphism (RFLP) analysis of mycobacterial heat shock protein 65 (hsp65) gene.Methods This study included 8 Mycobacteria strains,including clinical isolates and standard strains of Mycobacteria tuberculosis and Mycobacterium intracellulare.Bacterialsuspension of these strains was prepared with the concentration of bacterial cells varying from 10 to 106per milliliter.PCR was performed to amplify the hsp65 gene with a pair of universal primers followed by the digestion of amplicons with two restriction endonucleases,BstE Ⅱ and Hae Ⅲ.Then,the restriction enzyme-digested fragments were subjected to electrophoresis in 2% agarose gel,2% Metaphor agarose gel and 10% nondenaturating polyacrylamide gel respectively.Results As analysis of variance showed,the three gel electrophoresis methods were statistically different in sensitivity for the RFLP analysis of mycobacterial hsp65 gene (F =36.379,P < 0.01).Least significance difference (LSD) procedure revealed that the 2% agarose gel-based electrophoresis was less sensitive than the 2% Metaphor agarose gel-and 10% non-denaturing polyacrylamide gel-based electrophoresis (both P < 0.01),and no significant differences were observed between the 2% Metaphor agarose gel-and 10% non-denaturing polyacrylamide gel-based electrophoresis (P > 0.05).Conclusion The 2% Metaphor agarose gel-and 10%nondenaturating polyacrylamide gel-based electrophoresis methods appear to be more sensitive than the 2% agarose gel-based electrophoresis method for the PCR-RFLP analysis of mycobacterial hsp65 gene.%目的 比较2%(w/v)琼脂糖凝胶、2% (w/v)Metaphor琼脂糖凝胶和10%(w/v)非变性聚丙烯酰胺凝胶分析分枝杆菌热休克蛋白65(hsp65)基因酶切片段的灵敏度.方法 分枝杆菌8株,分别制成106~101

  19. Novel mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infections

    DEFF Research Database (Denmark)

    Storgaard, M; Varming, K; Herlin, Troels;

    2006-01-01

    In 1981 we presented a patient with Mycobacterium intracellulare osteomyelitis and depressed monocyte cytotoxicity. It is now demonstrated that the molecular defect was a never-before-described nucleotide deletion at position 794 (794delT) in the interferon-gamma-receptor alpha-1 gene. The genetic...... defect was passed on to his daughter who was diagnosed with non-tuberculous mycobacterial osteomyelitis at the age of 7 years....

  20. Expanding the mycobacterial diversity of metalworking fluids (MWFs): evidence showing MWF colonization by Mycobacterium abscessus.

    Science.gov (United States)

    Kapoor, Renuka; Yadav, Jagjit S

    2012-02-01

    Nontuberculous mycobacteria (NTM) have been associated with hypersensitivity pneumonitis in machinists. Only two species of NTM, namely Mycobacterium immunogenum and Mycobacterium chelonae, have been reported thus far to have the ability to colonize contaminated metalworking fluids (MWFs). Here, we report, for the first time, the presence and characterization (phenotypic and genotypic) of a third species, Mycobacterium abscessus, colonizing these harsh alkaline machining fluids. Two Mycobacterium morphotypes, smooth (S) and rough (R), were isolated (two isolates each) from an in-use industrial MWFs. Biocide susceptibility analysis using triclosan as a model yielded the same minimal inhibitory concentration for the two morphotypes. PCR-restriction analysis-based speciation of the morphotypes confirmed their identity as M. abscessus. Genotyping based on partial DNA sequences corresponding to the variable regions of the hsp65 gene and 16S-23S rRNA operon internal transcribed spacer region and randomly amplified polymorphic DNA-PCR analysis showed that both morphotypes belong to a single genotype. In addition, we isolated and confirmed two novel mycobacterial genotypes, one each of M. immunogenum and M. chelonae from additional in-use MWF screening. Taken together, this study expands the known mycobacterial species- and strain-diversity colonizing MWF. Furthermore, the study emphasizes the need for including M. abscessus species in the existing mycobacterial screening of contaminated MWF. PMID:22092754

  1. Non mycobacterial virulence genes in the genome of the emerging pathogen Mycobacterium abscessus.

    Directory of Open Access Journals (Sweden)

    Fabienne Ripoll

    Full Text Available Mycobacterium abscessus is an emerging rapidly growing mycobacterium (RGM causing a pseudotuberculous lung disease to which patients with cystic fibrosis (CF are particularly susceptible. We report here its complete genome sequence. The genome of M. abscessus (CIP 104536T consists of a 5,067,172-bp circular chromosome including 4920 predicted coding sequences (CDS, an 81-kb full-length prophage and 5 IS elements, and a 23-kb mercury resistance plasmid almost identical to pMM23 from Mycobacterium marinum. The chromosome encodes many virulence proteins and virulence protein families absent or present in only small numbers in the model RGM species Mycobacterium smegmatis. Many of these proteins are encoded by genes belonging to a "mycobacterial" gene pool (e.g. PE and PPE proteins, MCE and YrbE proteins, lipoprotein LpqH precursors. However, many others (e.g. phospholipase C, MgtC, MsrA, ABC Fe(3+ transporter appear to have been horizontally acquired from distantly related environmental bacteria with a high G+C content, mostly actinobacteria (e.g. Rhodococcus sp., Streptomyces sp. and pseudomonads. We also identified several metabolic regions acquired from actinobacteria and pseudomonads (relating to phenazine biosynthesis, homogentisate catabolism, phenylacetic acid degradation, DNA degradation not present in the M. smegmatis genome. Many of the "non mycobacterial" factors detected in M. abscessus are also present in two of the pathogens most frequently isolated from CF patients, Pseudomonas aeruginosa and Burkholderia cepacia. This study elucidates the genetic basis of the unique pathogenicity of M. abscessus among RGM, and raises the question of similar mechanisms of pathogenicity shared by unrelated organisms in CF patients.

  2. Fusion protein His-Hsp65-6IA2P2 prevents type 1 diabetes through nasal immunization in NOD Mice.

    Science.gov (United States)

    Lu, Shiping; Li, Guoliang; Liu, Kunfeng; Yang, Xue; Cao, Rongyue; Zong, Li; Long, Jun; Jin, Liang; Wu, Jie

    2016-06-01

    Human heat shock protein 60 (Hsp60), is an endogenous β-cells autoantigen, it could postpone the onset of insulitis and sooner type 1 diabetes mellitus. P277 is one of Hsp65 determinants at position 437-469 of amino acids cascaded. Meanwhile, it's already well-known that there were several better anti-diabetic B epitopes, such as insulinoma antigen-2 (IA-2). Currently, fusion protein IA2P2 has constructed in order to enhance its pharmacological efficacy. In addition, added homologous bacterial-derived Hsp65 and His tag were beneficial to protein immunogenicity and purification separately. So, finally we examined a fusion protein His-Hsp65-6IA2P2 could regulate Th2 immune response and reduce natural diabetic incidence in NOD mice. We constructed two express vector pET28a-His-Hsp65-6P277 and pET28a-His-Hsp65-6IA2P2. After purification, we observed that triple intranasal administration of these two fusion protein in 4-week-old NOD mice maintained normal blood glucose and weight, with a lower diabetic or insulitis incidence. Consistent with induced splenic T cells proliferation and tolerance, His-Hsp65-6IA2P2-treated mice performed reduced IFN-γ and increased IL-10 level. In conclusion, we suggested that fusion protein His-Hsp65-6IA2P2 could be reconstructed and purified successively. Furthermore, nasal administration of this fusion protein could rebalance T cells population and prevent T1DM.

  3. Massive gene acquisitions in Mycobacterium indicus pranii provide a perspective on mycobacterial evolution.

    Science.gov (United States)

    Saini, Vikram; Raghuvanshi, Saurabh; Khurana, Jitendra P; Ahmed, Niyaz; Hasnain, Seyed E; Tyagi, Akhilesh K; Tyagi, Anil K

    2012-11-01

    Understanding the evolutionary and genomic mechanisms responsible for turning the soil-derived saprophytic mycobacteria into lethal intracellular pathogens is a critical step towards the development of strategies for the control of mycobacterial diseases. In this context, Mycobacterium indicus pranii (MIP) is of specific interest because of its unique immunological and evolutionary significance. Evolutionarily, it is the progenitor of opportunistic pathogens belonging to M. avium complex and is endowed with features that place it between saprophytic and pathogenic species. Herein, we have sequenced the complete MIP genome to understand its unique life style, basis of immunomodulation and habitat diversification in mycobacteria. As a case of massive gene acquisitions, 50.5% of MIP open reading frames (ORFs) are laterally acquired. We show, for the first time for Mycobacterium, that MIP genome has mosaic architecture. These gene acquisitions have led to the enrichment of selected gene families critical to MIP physiology. Comparative genomic analysis indicates a higher antigenic potential of MIP imparting it a unique ability for immunomodulation. Besides, it also suggests an important role of genomic fluidity in habitat diversification within mycobacteria and provides a unique view of evolutionary divergence and putative bottlenecks that might have eventually led to intracellular survival and pathogenic attributes in mycobacteria. PMID:22965120

  4. Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework

    Indian Academy of Sciences (India)

    VARUN MEHRA; TARINI SHANKAR GHOSH; SHARMILA S MANDE

    2016-09-01

    Horizontal Gene Transfer (HGT) events, initially thought to be rare in Mycobacterium tuberculosis, have recentlybeen shown to be involved in the acquisition of virulence operons in M. tuberculosis. We have developed a newpartitioning framework based HGT prediction algorithm, called Grid3M, and applied the same for the prediction ofHGTs in Mycobacteria. Validation and testing using simulated and real microbial genomes indicated better performanceof Grid3M as compared with other widely used HGT prediction methods. Specific analysis of the genesbelonging to dormancy/reactivation regulons across 14 mycobacterial genomes indicated that horizontal acquisition isspecifically restricted to important accessory proteins. The results also revealed Burkholderia species to be a probablesource of HGT genes belonging to these regulons. The current study provides a basis for similar analyses investigatingthe functional/evolutionary aspects of HGT genes in other pathogens. A database of Grid3M predicted HGTs incompletely sequenced genomes is available at https://metagenomics.atc.tcs.com/Grid3M/.

  5. Improved diagnosis of mycobacterial infections in formalin-fixed and paraffin-embedded sections with nested polymerase chain reaction.

    Science.gov (United States)

    Azov, Andrey G; Koch, Jørn; Hamilton-Dutoit, Stephen J

    2005-09-01

    Traditional histological diagnosis of mycobacterial infection in formalin-fixed and paraffin-embedded (FFPE) tissues is insensitive and poorly specific. To improve this, we developed nested polymerase chain reaction (PCR) protocols for detecting a Mycobacterium genus-specific 65-kDa heat shock protein (HSP65) sequence and the M. tuberculosis complex-specific insertion sequence IS6110 in FFPE sections. Protocols were optimized on tissues from 20 patients with a final clinical diagnosis of mycobacterial infection. Amplicons were controlled by sequencing and restriction endonuclease digestion. PCR could detect as few as three mycobacterial genomes per reaction. Assays showed 100% sensitivity and specificity for both M. tuberculosis complex and M. avium complex infection. Paraffin blocks from a second group of 26 patients with histological evidence of necrotizing granulomas of unknown etiology were then analyzed as a surrogate group to test the assay under conditions similar to those applying during routine diagnosis. Twenty-three of these blocks contained amplifiable DNA; nine were positive for M. tuberculosis complex DNA and four for other types of mycobacterial DNA. Furthermore, digestion of HSP65 amplicons with NarI could distinguish M. tuberculosis from M. avium complex. In conclusion, our nested PCR assays can be used as reliable tools for the detection of mycobacterial infections in FFPE tissues. The assays are simple and rapid to perform and show improved sensitivity and specificity compared to previously reported protocols.

  6. 鼻粘膜免疫融合蛋白Hsp65-6×p277预防NOD小鼠1型糖尿病的发生%Intranasal vaccination with p277 tandem repeat sequences carried by Hsp65 prevented type 1 diabetes in NOD mice

    Institute of Scientific and Technical Information of China (English)

    金亮; 王宇; 朱爱华; 刘景晶

    2006-01-01

    目的:提高多肽p277的免疫原性,从而提高其对自身免疫性糖尿病的预防作用.方法:将p277 6次重复与Hsp 65融合置于pET28a中构建重组Hsp 65-6×p277表达质粒.该重组质粒在大肠杆菌BL21中以高效可溶形式表达.依次通过细胞裂解、硫酸铵沉淀、双蒸水透析、DEAE纤维素52柱层析纯化获得目的蛋白.用纯化后的融合蛋白Hsp 65-6×p277通过鼻腔给药方式,在不添加任何佐剂的情况下3次免疫4周龄雌性NOD小鼠.每月眼角取血,检测抗体和血糖浓度.结果:初步药效学实验表明融合蛋白Hsp 65-6×p277可抑制NOD小鼠中1型糖尿病的发生.结论:融合蛋白Hsp 65-6×p277有可能发展成为一种具有防治胰岛素依赖性糖尿病作用的疫苗.%AIM: To improve the prevent efficacy of peptide p277 in autoimmune diabetes. METHODS: The recombinant expression plasmid pET28-Hsp65-6×p277 was constructed by inserting 6×p277 which were amplified by PCR into the vector pET28-Hsp65. The plasmid pET28-Hsp65-6×p277 was transformed into E.coli BL21 (DE3) and the fusion protein (Hsp65-6×p277) was expressed effectively as soluble protein after inducing by lactose. The fusion protein was purified and then used to immunize 4-week old female NOD mice with three times of i.n. inoculations in the absence of adjuvants. Serum samples from the immunized mice were collected at monthly interval. The concentrations of blood glucose and antibodies were measured by automatic analyzer. RESULTS: Administration with the Hsp65-6×p277 to NOD mice could prevent the development of diabetes. CONCLUSION: The fusion protein Hsp65-6×p277 might be further developed to a vaccine against insulin-dependent diabetes mellitus.

  7. Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework.

    Science.gov (United States)

    Mehra, Varun; Ghosh, Tarini Shankar; Mande, Sharmila S

    2016-09-01

    Horizontal Gene Transfer (HGT) events, initially thought to be rare in Mycobacterium tuberculosis, have recently been shown to be involved in the acquisition of virulence operons in M. tuberculosis. We have developed a new partitioning framework based HGT prediction algorithm, called Grid3M, and applied the same for the prediction of HGTs in Mycobacteria. Validation and testing using simulated and real microbial genomes indicated better performance of Grid3M as compared with other widely used HGT prediction methods. Specific analysis of the genes belonging to dormancy/reactivation regulons across 14 mycobacterial genomes indicated that horizontal acquisition is specifically restricted to important accessory proteins. The results also revealed Burkholderia species to be a probable source of HGT genes belonging to these regulons. The current study provides a basis for similar analyses investigating the functional/evolutionary aspects of HGT genes in other pathogens. A database of Grid3M predicted HGTs in completely sequenced genomes is available at https://metagenomics.atc.tcs.com/Grid3M/. PMID:27581938

  8. Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

    Directory of Open Access Journals (Sweden)

    Joan Joseph

    2010-01-01

    Full Text Available Mycobacterium bovis Bacillus Calmette-Guérin (BCG as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261 and Mycobacteria spp. α-antigen promoter (in plasmid pJH222. Among 14 rBCG:HIV-1gp120 (pMV261 colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222 colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors.

  9. Monstrous Mycobacterial Lipids.

    Science.gov (United States)

    Seeliger, Jessica; Moody, D Branch

    2016-02-18

    When it comes to lipid diversity, no bacterial genus approaches Mycobacterium. In this issue of Cell Chemical Biology, Burbaud et al. (2016) provide a multi-genic working model for the biosynthesis of trehalose polyphleate (TPP), one of the largest known lipids in mycobacteria. They demonstrate that this lipid is made by diverse mycobacterial species, including those of medical importance. PMID:26971870

  10. Novel Selection for Isoniazid (INH) Resistance Genes Supports a Role for NAD+-Binding Proteins in Mycobacterial INH Resistance

    OpenAIRE

    CHEN, PING; Bishai, William R.

    1998-01-01

    The genetic basis of isoniazid (INH) resistance remains unknown for a significant proportion of clinical isolates. To identify genes which might confer resistance by detoxifying or sequestering INH, we transformed the Escherichia coli oxyR mutant, which is relatively sensitive to INH, with a Mycobacterium tuberculosis plasmid library and selected for INH-resistant clones. Three genes were identified and called ceo for their ability to complement the Escherichia coli oxyR mutant. ceoA was the ...

  11. Mycobacterial Infections in AIDS

    Directory of Open Access Journals (Sweden)

    A Ross Hill

    1991-01-01

    Full Text Available Tuberculosis (TB remains uniquely important among acquired immune deficiency syndrome (AIDS-associated opportunistic infections: it presents the greatest public health hazard worldwide, is the most readily curable, and is largely preventable with existing means. Given the expanding pool of human immunodeficiency virus (HIV seropositive persons, particularly in developing nations where Mycobacterium tuberculosis remains a leading health problem, one can expect a continued rise in TB cases during the 1990s. Global efforts to eliminate TB are now inextricably entwined with the effectiveness of measures to curtail the HIV epidemic. Mycobacterium avium complex infection, currently an intractable late complication of aids, may increase in clinical importance as success in managing other opportunistic infections and HIV disease itself improves. Understanding of the pathogenesis and management of mycobacterial diseases should increase rapidly given the renewed research spurred on by the advent of HIV.

  12. [Biologics and mycobacterial diseases].

    Science.gov (United States)

    Tsuyuguchi, Kazunari; Matsumoto, Tomoshige

    2013-03-01

    Various biologics such as TNF-alpha inhibitor or IL-6 inhibitor are now widely used for treatment of rheumatoid arthritis. Many reports suggested that one of the major issues is high risk of developing tuberculosis (TB) associated with using these agents, which is especially important in Japan where tuberculosis still remains endemic. Another concern is the risk of development of nontuberculous mycobacterial (NTM) diseases and we have only scanty information about it. The purpose of this symposium is to elucidate the role of biologics in the development of mycobacterial diseases and to establish the strategy to control them. First, Dr. Tohma showed the epidemiologic data of TB risks associated with using biologics calculated from the clinical database on National Database of Rheumatic Diseases by iR-net in Japan. He estimated TB risks in rheumatoid arthritis (RA) patients to be about four times higher compared with general populations and to become even higher by using biologics. He also pointed out a low rate of implementation of QuantiFERON test (QFT) as screening test for TB infection. Next, Dr. Tokuda discussed the issue of NTM disease associated with using biologics. He suggested the airway disease in RA patients might play some role in the development of NTM disease, which may conversely lead to overdiagnosis of NTM disease in RA patients. He suggested that NTM disease should not be uniformly considered a contraindication to treatment with biologics, considering from the results of recent multicenter study showing relatively favorable outcome of NTM patients receiving biologics. Patients with latent tuberculosis infection (LTBI) should receive LTBI treatment before starting biologics. Dr. Kato, a chairperson of the Prevention Committee of the Japanese Society for Tuberculosis, proposed a new LTBI guideline including active implementation of LTBI treatment, introducing interferon gamma release assay, and appropriate selection of persons at high risk for

  13. Identification of Mycobacterium marinum 65 kD heat shock protein gene by polymerase chain reaction restriction analysis from lesions of swimming pool granuloma

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Background Nontuberculous mycobacterium (NTM) had been reported to cause cutaneous infections which are difficult to interpret due to the variability of the clinical manifestations. Among NTM infections, Mycobacterium marinum (M. marinum) are mostly seen to cause skin infection. It is therefore important to establish a rapid approach for detection and identification of M. marinum from lesions of patients with suspected M. marinum infections. Methods Specimens were obtained from 5 patients with swimming pool granuloma. DNA was extracted and polymerase chain reaction (PCR) was performed. PCR products were digested with Hae III and BstE II, then analysed by pattern restriction analysis to detect heat shock protein (hsp) 65 kD gene. Results The 65 kD hsp gene was found in all specimens from patients with swimming pool granuloma. PCR restriction analysis (PRA) identified all 5 samples to be M. marinum infections, and the result was consistent with that of routine bacteriological identification. The lesions subsided or markedly improved upon treatment. Conclusions PRA is a sensitive, specific and rapid method in identification of mycobacteria. Application of this method will be helpful for early diagnosis of mycobacterial skin infections.

  14. Murine T-lymphocyte activation by mycobacterial antigens

    International Nuclear Information System (INIS)

    There has been renewed interest in the diagnosis of tuberculosis and other mycobacterial infections in the United States. Effective immunity to mycobacterial infections, as well as diagnosis by the skin test, involves T-cells rather than antibodies. Studies currently underway use the new technologies of monoclonal antibodies and recombinant DNA to define better mycobacterial antigens for T-cell activation, in the hope of identifying species specific antigens. Lymph node cells from mice sensitized to Mycobacterium intracellulare and Mycobacterium avium were assayed for activation by mycobacterial fractions, and cell lines and clones were generated. Comparing BALB/c and B10 mice indicated better responses to M. avium sonicate by B10 mice. A recombinant gene product containing a M. intracellulare peptide was assayed with lymph node cells and indicated excellent T-cell stimulation in BALB/c lymph node cells and cell lines. However, assays using B10 T-cell clones have yet to detect responders to the recombinant protein. Future studies using synthetic epitopes produced by recombinant DNA techniques and defined by monoclonal antibodies are necessary for the identification of reactive T-cell epitopes that are potentially species specific. 4 refs, 7 figs, 1 tab

  15. [Molecular diagnosis of mycobacterial infections].

    Science.gov (United States)

    Fend, F; Langer, R; Hann von Weyhern, C W; Schulz, S; Miethke, T

    2007-01-01

    Tuberculosis remains a leading cause of morbidity and mortality worldwide. A rapid and reliable diagnosis and discrimination from infections with nontuberculous mycobacteria (NTM) is critical. Frequently, formalin-fixed, paraffin-embedded (FFPE) tissues remain the only source for detection of micro-organisms in suspected cases of mycobacterial infection. Recently, numerous methods, including PCR assays, in situ hybridization and immunohistochemistry have been developed for detection of mycobacteria in FFPE samples. PCR-based assays are directed either against M.tbc.-specific sequences, such as IS6110, or amplify regions common to many mycobacterial species, e.g. the 65 kDa antigen, and then require sequencing or restriction fragment length polymorphism for species identification. Whereas the detection of DNA of M.tbc. in the correct setting is always of clinical relevance, the presence of various NTM species has to be interpreted with great caution due to their ubiquitous nature. However, the routine application of molecular tests has demonstrated that NTM infections are more common than previously thought, even in non-immunosuppressed hosts. The introduction of real-time PCR technology allows precise quantification of mycobacterial DNA and can be used for species identification through melting point analysis or appropriate DNA probes. Application of these assays originally developed for clinical microbiology offer a great opportunity for diagnostic improvement in molecular pathology as compared to qualitative PCR, mainly due to an increased specificity and a lower risk of contamination. Given the clinical impact of a positive molecular result for M. tbc., future efforts have to be aimed at standardization and quality control. PMID:18314607

  16. [Molecular diagnosis of mycobacterial infections].

    Science.gov (United States)

    Fend, F; Langer, R; Hann von Weyhern, C W; Schulz, S; Miethke, T

    2007-01-01

    Tuberculosis remains a leading cause of morbidity and mortality worldwide. A rapid and reliable diagnosis and discrimination from infections with nontuberculous mycobacteria (NTM) is critical. Frequently, formalin-fixed, paraffin-embedded (FFPE) tissues remain the only source for detection of micro-organisms in suspected cases of mycobacterial infection. Recently, numerous methods, including PCR assays, in situ hybridization and immunohistochemistry have been developed for detection of mycobacteria in FFPE samples. PCR-based assays are directed either against M.tbc.-specific sequences, such as IS6110, or amplify regions common to many mycobacterial species, e.g. the 65 kDa antigen, and then require sequencing or restriction fragment length polymorphism for species identification. Whereas the detection of DNA of M.tbc. in the correct setting is always of clinical relevance, the presence of various NTM species has to be interpreted with great caution due to their ubiquitous nature. However, the routine application of molecular tests has demonstrated that NTM infections are more common than previously thought, even in non-immunosuppressed hosts. The introduction of real-time PCR technology allows precise quantification of mycobacterial DNA and can be used for species identification through melting point analysis or appropriate DNA probes. Application of these assays originally developed for clinical microbiology offer a great opportunity for diagnostic improvement in molecular pathology as compared to qualitative PCR, mainly due to an increased specificity and a lower risk of contamination. Given the clinical impact of a positive molecular result for M. tbc., future efforts have to be aimed at standardization and quality control.

  17. Mycobacterial mutants with defective control of phagosomal acidification.

    Directory of Open Access Journals (Sweden)

    2005-11-01

    Full Text Available The pathogenesis of mycobacterial infection is associated with an ability to interfere with maturation of the phagosomal compartment after ingestion by macrophages. Identification of the mycobacterial components that contribute to this phenomenon will allow rational design of novel approaches to the treatment and prevention of tuberculosis. Microarray-based screening of a transposon library was used to identify mutations that influence the fate of Mycobacterium bovis bacille Calmette-Guérin (BCG following uptake by macrophages. A screen based on bacterial survival during a 3-d infection highlighted genes previously implicated in growth of Mycobacterium tuberculosis in macrophages and in mice, together with a number of other virulence genes including a locus encoding virulence-associated membrane proteins and a series of transporter molecules. A second screen based on separation of acidified and non-acidified phagosomes by flow cytometry identified genes involved in mycobacterial control of early acidification. This included the KefB potassium/proton antiport. Mutants unable to control early acidification were significantly attenuated for growth during 6-d infections of macrophages. Early acidification of the phagosome is associated with reduced survival of BCG in macrophages. A strong correlation exists between genes required for intracellular survival of BCG and those required for growth of M. tuberculosis in mice. In contrast, very little correlation exists between genes required for intracellular survival of BCG and those that are up-regulated during intracellular adaptation of M. tuberculosis. This study has identified targets for interventions to promote immune clearance of tuberculosis infection. The screening technologies demonstrated in this study will be useful to the study of pathogenesis in many other intracellular microorganisms.

  18. Characterization of the Mycobacterial NER System Reveals Novel Functions of the uvrD1 Helicase

    OpenAIRE

    Guthlein, C.; Wanner, R M; Sander, P; Davis, E O; Bosshard, M.; Jiricny, J; Bottger, E. C.; Springer, B.

    2008-01-01

    In this study, we investigated the role of the nucleotide excision repair (NER) pathway in mycobacterial DNA repair. Mycobacterium smegmatis lacking the NER excinuclease component uvrB or the helicase uvrD1 gene and a double knockout lacking both genes were constructed, and their sensitivities to a series of DNA-damaging agents were analyzed. As anticipated, the mycobacterial NER system was shown to be involved in the processing of bulky DNA adducts and interstrand cross-links. In addition, i...

  19. Mycobacterial species as case-study of comparative genome analysis.

    Science.gov (United States)

    Zakham, F; Belayachi, L; Ussery, D; Akrim, M; Benjouad, A; El Aouad, R; Ennaji, M M

    2011-02-08

    The genus Mycobacterium represents more than 120 species including important pathogens of human and cause major public health problems and illnesses. Further, with more than 100 genome sequences from this genus, comparative genome analysis can provide new insights for better understanding the evolutionary events of these species and improving drugs, vaccines, and diagnostics tools for controlling Mycobacterial diseases. In this present study we aim to outline a comparative genome analysis of fourteen Mycobacterial genomes: M. avium subsp. paratuberculosis K—10, M. bovis AF2122/97, M. bovis BCG str. Pasteur 1173P2, M. leprae Br4923, M. marinum M, M. sp. KMS, M. sp. MCS, M. tuberculosis CDC1551, M. tuberculosis F11, M. tuberculosis H37Ra, M. tuberculosis H37Rv, M. tuberculosis KZN 1435 , M. ulcerans Agy99,and M. vanbaalenii PYR—1, For this purpose a comparison has been done based on their length of genomes, GC content, number of genes in different data bases (Genbank, Refseq, and Prodigal). The BLAST matrix of these genomes has been figured to give a lot of information about the similarity between species in a simple scheme. As a result of multiple genome analysis, the pan and core genome have been defined for twelve Mycobacterial species. We have also introduced the genome atlas of the reference strain M. tuberculosis H37Rv which can give a good overview of this genome. And for examining the phylogenetic relationships among these bacteria, a phylogenic tree has been constructed from 16S rRNA gene for tuberculosis and non tuberculosis Mycobacteria to understand the evolutionary events of these species.

  20. MENDELIAN SUSCEPTIBILITY TO MYCOBACTERIAL DISEASE IN EGYPTIAN CHILDREN

    Directory of Open Access Journals (Sweden)

    Nermeen Galal

    2012-05-01

    Full Text Available Background: Tuberculosis remains a major health problem in developing countries especially with the emergence of multidrug resistant strains. Mendelian Susceptibility to Mycobacterial Disease (MSMD is a rare disorder with impaired immunity against mycobacterial pathogens. Reported MSMD etiologies highlight the crucial role of the Interferon gamma /Interleukin 12 (IFN-g/ IL-12 axis and the phagocyte respiratory burst axis. Purpose: Screen patients with possible presentations for MSMD. Methods: Patients with disseminated BCG infection following vaccination, atypical mycobacterial infections or recurrent tuberculosis infections were recruited from the Primary Immune Deficiency Clinic at Cairo University Specialized Pediatric Hospital, Egypt and immune and genetic laboratory investigations were conducted at Human Genetic of Infectious Diseases laboratory in Necker Medical School, France from 2005-2009. IFN-g level in patient’s plasma as well as mutations in the eight previously identified MSMD-causing genes were explored. Results: Nine cases from eight (unrelated kindreds were evaluated in detail. We detected a high level of IFN-g in plasma in one patient. Through Sanger sequencing, a homozygous mutation in the IFNGR1 gene at position 485 corresponding to an amino acid change from serine to phenylalanine (S485F, was detected in this patient. Conclusion: We report the first identified cases of MSMD among Egyptian patients, including in particular a new IFNGR1 mutation underlying IFN-gR1 deficiency. The eight remaining patients need to be explored further. These findings have implications regarding the compulsory Bacillus Calmette Guerin vaccination policy in Egypt, especially given the high consanguinity rate. Keywords: Interferon gamma axis, mycobacterium tuberculosis, BCG, consanguinity

  1. MENDELIAN SUSCEPTIBILITY TO MYCOBACTERIAL DISEASE IN EGYPTIAN CHILDREN

    Directory of Open Access Journals (Sweden)

    Nermeen Galal

    2012-01-01

    Full Text Available

    Background: Tuberculosis remains a major health problem in developing countries especially with the emergence of multidrug resistant strains. Mendelian Susceptibility to Mycobacterial Disease (MSMD is a rare disorder with impaired immunity against mycobacterial pathogens. Reported MSMD etiologies highlight the crucial role of the Interferon gamma /Interleukin 12 (IFN-g/ IL-12 axis and the phagocyte respiratory burst axis.

    Purpose: Screen patients with possible presentations for MSMD.

    Methods: Patients with disseminated BCG infection following vaccination, atypical mycobacterial infections or recurrent tuberculosis infections were recruited from the Primary Immune Deficiency Clinic at Cairo University Specialized Pediatric Hospital, Egypt and immune and genetic laboratory investigations were conducted at Human Genetic of Infectious Diseases laboratory in Necker Medical School, France from 2005-2009. IFN-g level in patient’s plasma as well as mutations in the eight previously identified MSMD-causing genes were explored.

    Results: Nine cases from eight (unrelated kindreds were evaluated in detail. We detected a high level of IFN-g in plasma in one patient. Through Sanger sequencing, a homozygous mutation in the IFNGR1 gene at position 485 corresponding to an amino acid change from serine to phenylalanine (S485F, was detected in this patient.

    Conclusion: We report the first identified cases of MSMD among Egyptian patients, including in particular a new IFNGR1 mutation underlying IFN-gR1 deficiency. The eight remaining patients need to be explored further. These findings have implications regarding the compulsory Bacillus Calmette Guerin vaccination policy in Egypt, especially given the high consanguinity rate.

    Keywords: Interferon gamma axis, mycobacterium tuberculosis, BCG, consanguinity

  2. Nontuberculous mycobacterial ocular infections--comparing the clinical and microbiological characteristics between Mycobacterium abscessus and Mycobacterium massiliense.

    Directory of Open Access Journals (Sweden)

    Hsiao-Sang Chu

    Full Text Available To analyze the clinical characteristics of nontuberculous mycobacterial (NTM ocular infections and the species-specific in vitro antimicrobial susceptibility.In 2000 to 2011 at the National Taiwan University Hospital, multilocus sequencing of rpoB, hsp65 and secA was used to identify NTM isolates from ocular infections. The clinical presentation and treatment outcomes were retrospectively compared between species. Broth microdilution method was used to determine the minimum inhibitory concentrations of amikacin (AMK, clarithromycin (CLA, ciprofloxacin (CPF, levofloxacin (LVF, moxifloxacin (MXF and gatifloxacin (GAF against all strains. The activities of antimicrobial combinations were assessed by the checkerboard titration method.A total of 24 NTM strains (13 Mycobacterium abscessus and 11 Mycobacterium massiliense were isolated from 13 keratitis, 10 buckle infections, and 1 canaliculitis cases. Clinically, manifestations and outcomes caused by these two species were similar and surgical intervention was necessary for medically unresponsive NTM infection. Microbiologically, 100% of M. abscessus and 90.9% of M. massiliense ocular isolates were susceptible to amikacin but all were resistant to fluoroquinolones. Inducible clarithromycin resistance existed in 69.3% of M. abscessus but not in M. massiliense isolates. None of the AMK-CLA, AMK-MXF, AMK-GAF, CLA-MXF and CLA-GAF combinations showed synergistic or antagonistic effect against both species in vitro.M. abscessus and M. massiliense are the most commonly identified species for NTM ocular infections in Taiwan. Both species were resistant to fluoroquinolones, susceptible to amikacin, and differ in clarithromycin resistance. Combined antimicrobial treatments showed no interaction in vitro but could be considered in combination with surgical interventions for eradication of this devastating ocular infection.

  3. Simple sequence repeats in mycobacterial genomes

    Indian Academy of Sciences (India)

    Vattipally B Sreenu; Pankaj Kumar; Javaregowda Nagaraju; Hampapathalu A Nagarajaram

    2007-01-01

    Simple sequence repeats (SSRs) or microsatellites are the repetitive nucleotide sequences of motifs of length 1–6 bp. They are scattered throughout the genomes of all the known organisms ranging from viruses to eukaryotes. Microsatellites undergo mutations in the form of insertions and deletions (INDELS) of their repeat units with some bias towards insertions that lead to microsatellite tract expansion. Although prokaryotic genomes derive some plasticity due to microsatellite mutations they have in-built mechanisms to arrest undue expansions of microsatellites and one such mechanism is constituted by post-replicative DNA repair enzymes MutL, MutH and MutS. The mycobacterial genomes lack these enzymes and as a null hypothesis one could expect these genomes to harbour many long tracts. It is therefore interesting to analyse the mycobacterial genomes for distribution and abundance of microsatellites tracts and to look for potentially polymorphic microsatellites. Available mycobacterial genomes, Mycobacterium avium, M. leprae, M. bovis and the two strains of M. tuberculosis (CDC1551 and H37Rv) were analysed for frequencies and abundance of SSRs. Our analysis revealed that the SSRs are distributed throughout the mycobacterial genomes at an average of 220–230 SSR tracts per kb. All the mycobacterial genomes contain few regions that are conspicuously denser or poorer in microsatellites compared to their expected genome averages. The genomes distinctly show scarcity of long microsatellites despite the absence of a post-replicative DNA repair system. Such severe scarcity of long microsatellites could arise as a result of strong selection pressures operating against long and unstable sequences although influence of GC-content and role of point mutations in arresting microsatellite expansions can not be ruled out. Nonetheless, the long tracts occasionally found in coding as well as non-coding regions may account for limited genome plasticity in these genomes.

  4. The Changing Pattern of Nontuberculous Mycobacterial Disease

    Directory of Open Access Journals (Sweden)

    Joseph O Falkinham

    2003-01-01

    Full Text Available Nontuberculous mycobacteria are human opportunistic pathogens whose source of infection is the environment. These include both slow-growing (eg, Mycobacterium kansasii and Mycobacterium avium and rapid-growing (eg, Mycobacterium abscessus and Mycobacterium fortuitum species. Transmission is through ingestion or inhalation of water, particulate matter or aerosols, or through trauma. The historic presentation of pulmonary disease in older individuals with predisposing lung conditions and in children has been changing. Pulmonary disease in elderly individuals who lack the classic predisposing lung conditions is increasing. Pulmonary disease and hypersensitivity pneumonitis have been linked with occupational or home exposures to nontuberculous mycobacteria. There has been a shift from Mycobacterium scrofulaceum to M avium in children with cervical lymphadenitis. Further, individuals who are immunosuppressed due to therapy or HIV-infection are at a greatly increased risk for nontuberculous mycobacterial infection. The changing pattern of nontuberculous mycobacterial disease is due in part to the ability of these pathogens to survive and proliferate in habitats that they share with humans, such as drinking water. The advent of an aging population and an increase in the proportion of immunosuppressed individuals suggest that the prevalence of nontuberculous mycobacterial disease will increase.

  5. Computed Tomographic Findings in Cats with Mycobacterial Infection

    OpenAIRE

    Major, Alison; Holmes, Andrea; Warren-Smith, Christopher; Lalor, Stephanie; Littler, Rebecca; Schwarz, Tobias; Gunn-Moore, Danielle

    2016-01-01

    Objectives: The objective of this study was to describe the CT imaging findings associated with confirmed mycobacterial infection in cats.Methods: CT images from 20 cats with confirmed mycobacterial disease were retrospectively reviewed. Five cats underwent conscious full-body CT in a VetMouseTrapTM device. All other cats had thoracic CT performed under general anaesthesia, with the addition of CT investigation of the head/neck, abdomen and limbs in some cases.Results: Mycobacterial infection...

  6. Mycobacterial infection and atopy in childhood : A systematic review

    NARCIS (Netherlands)

    Obihara, Charles C.; Bollen, Casper W.; Beyers, Nulda; Kimpen, Jan L. L.

    2007-01-01

    The epidemiological relation between mycobacterial infection and the prevalence of atopic disease in humans is still unclear. This is in contrast to studies in murine models in which a clear suppression of atopic symptoms was observed after exposure to mycobacteria or mycobacterial products. We ther

  7. Boromycin Kills Mycobacterial Persisters without Detectable Resistance

    Science.gov (United States)

    Moreira, Wilfried; Aziz, Dinah B.; Dick, Thomas

    2016-01-01

    Boromycin is a boron-containing polyether macrolide antibiotic isolated from Streptomyces antibioticus. It was shown to be active against Gram positive bacteria and to act as an ionophore for potassium ions. The antibiotic is ineffective against Gram negative bacteria where the outer membrane appears to block access of the molecule to the cytoplasmic membrane. Here we asked whether boromycin is active against Mycobacterium tuberculosis which, similar to Gram negative bacteria, possesses an outer membrane. The results show that boromycin is a potent inhibitor of mycobacterial growth (MIC50 = 80 nM) with strong bactericidal activity against growing and non-growing drug tolerant persister bacilli. Exposure to boromycin resulted in a rapid loss of membrane potential, reduction of the intracellular ATP level and leakage of cytoplasmic protein. Consistent with boromycin acting as a potassium ionophore, addition of KCl to the medium blocked its antimycobacterial activity. In contrast to the potent antimycobacterial activities of the polyether macrolide, its cytotoxicity and haemolytic activity were low (CC50 = 30 μM, HC50 = 40 μM) with a selectivity index of more than 300. Spontaneous resistant mutants could not be isolated suggesting a mutation frequency of less than 10-9/CFU. Taken together, the results suggests that targeting mycobacterial transmembrane ion gradients may be an attractive chemotherapeutic intervention level to kill otherwise drug tolerant persister bacilli, and to slow down the development of genetic antibiotic resistance. PMID:26941723

  8. Tetrahydrolipstatin Inhibition, Functional Analyses, and Three-dimensional Structure of a Lipase Essential for Mycobacterial Viability

    Energy Technology Data Exchange (ETDEWEB)

    Crellin, Paul K.; Vivian, Julian P.; Scoble, Judith; Chow, Frances M.; West, Nicholas P.; Brammananth, Rajini; Proellocks, Nicholas I.; Shahine, Adam; Le Nours, Jerome; Wilce, Matthew C.J.; Britton, Warwick J.; Coppel, Ross L.; Rossjohn, Jamie; Beddoe, Travis (Monash); (Centenary)

    2010-09-17

    The highly complex and unique mycobacterial cell wall is critical to the survival of Mycobacteria in host cells. However, the biosynthetic pathways responsible for its synthesis are, in general, incompletely characterized. Rv3802c from Mycobacterium tuberculosis is a partially characterized phospholipase/thioesterase encoded within a genetic cluster dedicated to the synthesis of core structures of the mycobacterial cell wall, including mycolic acids and arabinogalactan. Enzymatic assays performed with purified recombinant proteins Rv3802c and its close homologs from Mycobacterium smegmatis (MSMEG{_}6394) and Corynebacterium glutamicum (NCgl2775) show that they all have significant lipase activities that are inhibited by tetrahydrolipstatin, an anti-obesity drug that coincidently inhibits mycobacterial cell wall biosynthesis. The crystal structure of MSMEG{_}6394, solved to 2.9 {angstrom} resolution, revealed an {alpha}/{beta} hydrolase fold and a catalytic triad typically present in esterases and lipases. Furthermore, we demonstrate direct evidence of gene essentiality in M. smegmatis and show the structural consequences of loss of MSMEG{_}6394 function on the cellular integrity of the organism. These findings, combined with the predicted essentiality of Rv3802c in M. tuberculosis, indicate that the Rv3802c family performs a fundamental and indispensable lipase-associated function in mycobacteria.

  9. Control of Mycobacterial Infections in Mice Expressing Human Tumor Necrosis Factor (TNF) but Not Mouse TNF.

    Science.gov (United States)

    Olleros, Maria L; Chavez-Galan, Leslie; Segueni, Noria; Bourigault, Marie L; Vesin, Dominique; Kruglov, Andrey A; Drutskaya, Marina S; Bisig, Ruth; Ehlers, Stefan; Aly, Sahar; Walter, Kerstin; Kuprash, Dmitry V; Chouchkova, Miliana; Kozlov, Sergei V; Erard, François; Ryffel, Bernard; Quesniaux, Valérie F J; Nedospasov, Sergei A; Garcia, Irene

    2015-09-01

    Tumor necrosis factor (TNF) is an important cytokine for host defense against pathogens but is also associated with the development of human immunopathologies. TNF blockade effectively ameliorates many chronic inflammatory conditions but compromises host immunity to tuberculosis. The search for novel, more specific human TNF blockers requires the development of a reliable animal model. We used a novel mouse model with complete replacement of the mouse TNF gene by its human ortholog (human TNF [huTNF] knock-in [KI] mice) to determine resistance to Mycobacterium bovis BCG and M. tuberculosis infections and to investigate whether TNF inhibitors in clinical use reduce host immunity. Our results show that macrophages from huTNF KI mice responded to BCG and lipopolysaccharide similarly to wild-type macrophages by NF-κB activation and cytokine production. While TNF-deficient mice rapidly succumbed to mycobacterial infection, huTNF KI mice survived, controlling the bacterial burden and activating bactericidal mechanisms. Administration of TNF-neutralizing biologics disrupted the control of mycobacterial infection in huTNF KI mice, leading to an increased bacterial burden and hyperinflammation. Thus, our findings demonstrate that human TNF can functionally replace murine TNF in vivo, providing mycobacterial resistance that could be compromised by TNF neutralization. This new animal model will be helpful for the testing of specific biologics neutralizing human TNF. PMID:26123801

  10. Nontuberculous mycobacterial pulmonary disease mimicking lung cancer

    Science.gov (United States)

    Hong, Su Jin; Kim, Tae Jung; Lee, Jae-Ho; Park, Jeong-Soo

    2016-01-01

    Abstract To describe the features and clinical implications of computed tomography (CT), positron emission tomography (PET), and percutaneous needle aspiration biopsy (PCNB) in pulmonary nontuberculous mycobacterial (NTM) disease manifesting as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. Among a cohort of 388 patients with NTM pulmonary disease, 14 patients with clinically and radiologically suspected lung cancer were included in our study. Two chest radiologists evaluated CT features, including lesion type (nodule, mass, or mass-like consolidation), morphologic features (margin, degree of enhancement, calcification), and presence of accompanying findings suggestive of NTM pulmonary disease (bronchiectasis with clustered centrilobular nodules or upper-lobe cavitary lesions) by consensus. Diagnostic procedures for microbiologic diagnosis of NTM disease and clinical outcome were reviewed. Incidence of NTM pulmonary disease presenting as solitary nodule/mass (n = 8) or mass-like consolidation (n = 6) was 3.6% (14 of 388). Most lesions were detected incidentally during routine health check-up or evaluation of other disease (11 of 14, 79%). Lesions typically showed poor contrast-enhancement (9 of 12) and internal calcification (6 of 14). No lesions had CT features suggestive of NTM pulmonary disease. All 4 lesions for which PET/CT imaging was performed showed strong fluorodeoxyglucose uptake simulating malignant lesions (mean, 4.9; range, 3.6–7.8). PCNB revealed mycobacterial histology in 6 of 11 specimens and positive culture results were obtained for 7 of 7 specimens. NTM pulmonary disease may present as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. CT features and PCNB are important to diagnose NTM disease mimicking lung cancer to avoid unnecessary surgery. PMID:27367996

  11. Mycobacterial infections in a large Virginia hospital, 2001-2009

    Directory of Open Access Journals (Sweden)

    Scully Kenneth W

    2011-05-01

    Full Text Available Abstract Background In areas where both tuberculosis (TB and nontuberculous mycobacteria (NTM are prevalent, descriptive studies of the clinical features of individual mycobacteria are needed to inform clinical triage. Methods We queried the University of Virginia Clinical Data Repository for all mycobacterial infections from 2001-2009. Results Of 494 mycobacterial infections in 467 patients there were 22 species. Patients with pulmonary Tb were more likely to be reported as immigrants (p M. kansasii, M. xenopi, and M. fortuitum were more likely than MAC to have cavities. There were at least 83 patients that met criteria for NTM lung disease and these were caused by 9 species. M. abscessus infection was associated with cystic fibrosis and M. xenopi infection was associated with male gender. Conclusions In our center mycobacterial infections were common and of diverse species. Immigrant status, cavities, and effusion were associated with TB vs. NTM.

  12. Complete Genome Sequences of 17 Rapidly Growing Nontuberculous Mycobacterial Strains

    Science.gov (United States)

    Spilker, Theodore; LiPuma, John J.

    2016-01-01

    We report the complete genome sequences of 17 rapidly growing nontuberculous mycobacterial (NTM) strains, including 16 Mycobacterium abscessus complex strains and one M. immunogenum strain. These sequences add value to studies of the genetic diversity of rapidly growing NTM strains recovered from human specimens. PMID:27660787

  13. Complete Genome Sequences of 17 Rapidly Growing Nontuberculous Mycobacterial Strains.

    Science.gov (United States)

    Caverly, Lindsay J; Spilker, Theodore; LiPuma, John J

    2016-01-01

    We report the complete genome sequences of 17 rapidly growing nontuberculous mycobacterial (NTM) strains, including 16 Mycobacterium abscessus complex strains and one M. immunogenum strain. These sequences add value to studies of the genetic diversity of rapidly growing NTM strains recovered from human specimens. PMID:27660787

  14. Mycobacterial infections in striped bass from Delaware Bay

    Science.gov (United States)

    Ottinger, C.A.; Brown, J.J.; Densmore, Christine L.; Starliper, C.E.; Blazer, V.S.; Weyers, H.S.; Beauchamp, K.A.; Rhodes, M.W.; Kator, H.; Gauthier, David T.; Vogelbein, W.K.

    2007-01-01

    Eighty striped bass Morone saxatilis were obtained from Delaware Bay using commercial gill nets set adjacent to Woodland Beach (n = 70) and Bowers Beach (n = 10) in December 2003. Fish were examined for gross lesions. Total lengths (TLs) and eviscerated weights were determined to calculate condition factors (K). Portions of spleens were aseptically harvested for bacterial culture, and portions of spleens, kidneys (anterior and posterior), livers, and gonads were obtained for histological examination. The size distribution of the striped bass was relatively homogeneous; the mean TL was about 600 mm for all samples. Mean K exceeded 0.95 in all samples and was not significantly different (P > 0.05) among samples. Significant differences in mycobacterial infection prevalence (P ??? 0.05) were observed among samples; samples obtained at Woodland Beach (WB) on December 10 (53.8%, n = 13) and December 17 (7.1%, n = 42) exhibited the most striking differences in prevalence. Mycobacterial infection intensity ranged from 1 ?? 102 to 1 ?? 107 colony-forming units per gram of spleen. Acanthocephalan infection prevalence and intensity, non-acid-fast bacterial infection prevalence, and fish sex ratio were also significantly different among the samples (P ??? 0.05). Similar to the mycobacterial infections, differences in sex ratio, acanthocephalan infection, and non-acid-fast bacterial infection were observed between the WB samples taken on December 10 and 17. However, no significant associations (P > 0.05) were observed between sex ratio or these infections and mycobacterial infection. The differences in bacterial and parasite infection prevalence and intensity and fish sex ratio in some samples indicate that these fish had a different history and that the epizootiology of mycobacterial infection in striped bass from Delaware Bay may be relatively complex. ?? Copyright by the American Fisheries Society 2007.

  15. Comparison of restriction enzyme pattern analysis and full gene sequencing of 16S rRNA gene for Nocardia species identification, the first report of Nocardia transvalensis isolated of sputum from Iran, and review of the literature.

    Science.gov (United States)

    Fatahi-Bafghi, Mehdi; Heidarieh, Parvin; Rasouli-Nasab, Masoumeh; Habibnia, Shadi; Hashemi-Shahraki, Abdorazagh; Eshraghi, Seyyed Saeed

    2016-10-01

    Nocardial infections occur in different organs of the body and are common in immune disorder diseases of individuals. The aim of this study was to assess Nocardia species identification by phenotypic tests and molecular techniques applied to nocardiosis in Iranian patients. In the current study, various clinical samples were collected and cultured on conventional media and using the paraffin baiting method. Various phenotypic tests were performed. For accurate identification at the species level, restriction fragment length polymorphisms (RFLP) in the hsp65 and partial 16S rRNA genes and full gene sequencing of the 16S rRNA gene were used. Twenty-seven Nocardia spp. were isolated and analysis of phenotypic tests results showed Nocardia asteroides complex, Nocardia otitidiscaviarum, Nocardia nova, and Nocardia spp. New RFLP patterns of Nocardia strains with hsp65 and partial 16S rRNA genes were obtained. Full gene sequencing of the 16S rRNA gene identified Nocardia cyriacigeorgica, N. otitidiscaviarum, Nocardia farcinica, Nocardia transvalensis, and N. nova. Nocardia infections are rarely reported and this genus is the cause of various illnesses. Accurate identification of Nocardia spp. is important for epidemiology studies and treatment. It should also be noted that some species may have similar RFLP patterns; therefore, full gene sequencing of the 16S rRNA gene is necessary for confirmation.

  16. Vaccination Against Tuberculosis With Whole-Cell Mycobacterial Vaccines.

    Science.gov (United States)

    Scriba, Thomas J; Kaufmann, Stefan H E; Henri Lambert, Paul; Sanicas, Melvin; Martin, Carlos; Neyrolles, Olivier

    2016-09-01

    Live attenuated and killed whole-cell vaccines (WCVs) offer promising vaccination strategies against tuberculosis. A number of WCV candidates, based on recombinant bacillus Calmette-Guerin (BCG), attenuated Mycobacterium tuberculosis, or related mycobacterial species are in various stages of preclinical or clinical development. In this review, we discuss the vaccine candidates and key factors shaping the development pathway for live and killed WCVs and provide an update on progress. PMID:27247343

  17. Mycobacterial Prevalence and Antibiotic Resistance Frequency Trends in Taiwan of Mycobacterial Clinical Isolates From 2002 to 2014.

    Science.gov (United States)

    Shiau, Ming-Yuh; Lee, Ming-Shih; Huang, Tian-Lin; Tsai, Jen-Ning; Chang, Yih-Hsin

    2016-03-01

    Tuberculosis, caused by Mycobacterium tuberculosis complex (MTBC) infections, is one of the most widespread infectious diseases worldwide. Nontuberculous mycobacteria (NTM) also cause chronic pulmonary infections, however, NTM infection is generally overlooked.This study analyzed the frequencies of MTBC and NTM clinical isolates from 181,132 specimens obtained from patients in Taiwan suspected of having a pulmonary mycobacterial infection from 2002 to 2014. The resistant rates to 4 first-line antibiotics (isoniazid, ethambutol, rifampicin, and streptomycin) of 9079 clinical MTBC isolates were also examined by the modified agar proportion method.Overall, the mycobacterial isolation rate was 8.65%, and this consisted of MTBC isolation rate of 5.01% and NTM isolation rate of 3.63%. The prevalence of MTBC isolates among the identified mycobacterial strains could be seen to decrease significantly from 82.5% in 2002 to 41.18% in 2014. Notably, the corresponding NTM prevalence increased 3.36 fold from 17.54% in 2002 to 58.82% in 2014. The frequencies of MTBC and NTM isolates showed a reciprocal trend with the crossing over occurring in the years 2010 and 2011. Although the resistance rates of the MTBC isolates to isoniazid and streptomycin were relatively stable over the study period, resistance rates of the MTBC isolates against rifampicin and ethambutol fluctuated across the study period. Overall, the incidence of multidrug resistance was relatively consistent at about 1.74%.The diagnosis, identification, and susceptibility tests for NTM should be standardized and integrated into appropriate clinical settings to cope with the increase in NTM infections. In addition, the documentation of the antibiotic resistance rates of MTBC clinical isolates to the antibiotic treatments most often clinically prescribed over a decade provides valuable clues and reference points for effective mycobacterial control. PMID:27015168

  18. Mendelian Susceptibility to Mycobacterial Disease due to IL-12Rβ1 Deficiency in Three Iranian Children

    Directory of Open Access Journals (Sweden)

    Shokouh azam SARRAFZADEH

    2016-02-01

    Full Text Available Mendelian susceptibility to mycobacterial diseases (MSMD is a rare inheritance syndrome, characterized by a disseminated infection with mycobacterium in children following BCG vaccination at birth. Regarding the vaccination program in Iran, it may consider as a public health problem. The pathogenesis of MSMD is dependent on either insufficient production of IFN-gamma (γ or inadequate response to it. Here, we want to introduce three cases including two siblings and one girl from two unrelated families with severe mycobacterial infections referred to Immunology, Asthma and Allergy Research Institute (IAARI, from 2013 to 2015; their MSMD was confirmed by both cytokine assessment and genetic analysis. Regarding the clinical features of the patients, cell proliferation against a mitogen and BCG antigen was ordered in a lymphocyte transformation test (LTT setting. ELISA was performed for the measurement of IL-12p70 and IFN- γ in whole blood samples activated by BCG + recombinant human IFN-γ and BCG + recombinant human IL-12, respectively. In contrast to mitogen, the antigen-dependent proliferation activity of the patients’ leukocytes was significantly lower than that in normal range. We identified a homozygous mutation in IL12RB1 gene for two kindred who had a homozygous mutation affecting an essential splice site. For the third patient, a novel frameshift deletion in IL12RB1 gene was found. The genetic study results confirmed the impaired function of stimulated lymphocytes to release IFN-γ following stimulation with BCG+IL-12 while the response to rhIFN-γ for IL-12p70 production was relatively intact. Our findings show that cellular and molecular assessments are needed for precise identification of immunodeficiency disorders especially those without clear-cut diagnostic criteria. Keywords: Mendelian, IL-12Rβ1 Deficiency, Interfron-gamma, Interleukin 12, Mycobacterium

  19. Polyphenolic acetates : A newer anti-Mycobacterial therapeutic option

    Directory of Open Access Journals (Sweden)

    Santram

    2014-01-01

    Full Text Available The objective of our research project was screening of various highly specific substrates of Acetoxy Drug: Protein Transacytylase (M.TAase for antimycobacterial activity. Mycobacterial culture was done in Middlebrook’s 7H9 media. Protein purification (Mycobacterial Tranacetylase, M.TAase was done by ion exchange chromatography and its demonstration was done on SDS- polyacrylamide gel electrophoresis (SDS-PAGE and western blot. Middlebrook’s 7H9 broth was procured from Becton Dickinson. CM-Sepharose, DEAE-Sepharose and Q-Sephharose were purchased from Amersham Pharmacia. Anti acetyl lysine polyclonal antibody was purchased from Cell Signaling. The Middlebrook 7H9 medium was used for M. smegmatis culture. The media was prepared according to the manufacturer’s instructions. The various Polyphenol acetate compounds were tested for their antimycobacterial activities. Minimal inhibitory concentrations (MIC were calculated by Alamar blue dye assay method. The GST protein was used as a receptor protein and purified Mycobacterial Glutamine Synthetase (GS as TAase for acetylation by DAMC. To demonstrate the TAase catalyzed acetylation of GST by DAMC, purified M.TAase (GS was preincubated with GST and DAMC followed by western blot using anti acetyl lysine antibody, which avidly react with the acetylated proteins. The growth pattern of M. smegmatis was diminished under the influence of various polyphenolic acetates (PA tested for their anti-mycobacterial activity. DAMC and DAMC-5-carboxylic acid was found to have MIC of 40μg/ml whereas DAMC-6-carboxylic acid was reported to have MIC value of 35μg/ml and for ellagic acid tetra acetate (EATA it was 60μg/ml. Previous work in our lab has led to discovery of a novel enzyme acetoxy drug: protein transacetylase (TAase, catalyzing transfer of acetyl group from various polyphenolic peracetate (PA to certain receptor proteins such as cytochromes P-450, NADPH cytochrome reductase, nitric oxide synthase (NOS

  20. Catalytic and non-catalytic roles for the mono-ADP-ribosyltransferase Arr in the mycobacterial DNA damage response.

    Directory of Open Access Journals (Sweden)

    Christina L Stallings

    Full Text Available Recent evidence indicates that the mycobacterial response to DNA double strand breaks (DSBs differs substantially from previously characterized bacteria. These differences include the use of three DSB repair pathways (HR, NHEJ, SSA, and the CarD pathway, which integrates DNA damage with transcription. Here we identify a role for the mono-ADP-ribosyltransferase Arr in the mycobacterial DNA damage response. Arr is transcriptionally induced following DNA damage and cellular stress. Although Arr is not required for induction of a core set of DNA repair genes, Arr is necessary for suppression of a set of ribosomal protein genes and rRNA during DNA damage, placing Arr in a similar pathway as CarD. Surprisingly, the catalytic activity of Arr is not required for this function, as catalytically inactive Arr was still able to suppress ribosomal protein and rRNA expression during DNA damage. In contrast, Arr substrate binding and catalytic activities were required for regulation of a small subset of other DNA damage responsive genes, indicating that Arr has both catalytic and noncatalytic roles in the DNA damage response. Our findings establish an endogenous cellular function for a mono-ADP-ribosyltransferase apart from its role in mediating Rifampin resistance.

  1. Catalytic and non-catalytic roles for the mono-ADP-ribosyltransferase Arr in the mycobacterial DNA damage response.

    Science.gov (United States)

    Stallings, Christina L; Chu, Linda; Li, Lucy X; Glickman, Michael S

    2011-01-01

    Recent evidence indicates that the mycobacterial response to DNA double strand breaks (DSBs) differs substantially from previously characterized bacteria. These differences include the use of three DSB repair pathways (HR, NHEJ, SSA), and the CarD pathway, which integrates DNA damage with transcription. Here we identify a role for the mono-ADP-ribosyltransferase Arr in the mycobacterial DNA damage response. Arr is transcriptionally induced following DNA damage and cellular stress. Although Arr is not required for induction of a core set of DNA repair genes, Arr is necessary for suppression of a set of ribosomal protein genes and rRNA during DNA damage, placing Arr in a similar pathway as CarD. Surprisingly, the catalytic activity of Arr is not required for this function, as catalytically inactive Arr was still able to suppress ribosomal protein and rRNA expression during DNA damage. In contrast, Arr substrate binding and catalytic activities were required for regulation of a small subset of other DNA damage responsive genes, indicating that Arr has both catalytic and noncatalytic roles in the DNA damage response. Our findings establish an endogenous cellular function for a mono-ADP-ribosyltransferase apart from its role in mediating Rifampin resistance.

  2. A comparative analysis of the DNA recombination repair pathway in mycobacterial genomes.

    Science.gov (United States)

    Singh, Amandeep; Bhagavat, Raghu; Vijayan, M; Chandra, Nagasuma

    2016-07-01

    In prokaryotes, repair by homologous recombination provides a major means to reinstate the genetic information lost in DNA damage. Recombination repair pathway in mycobacteria has multiple differences as compared to that in Escherichia coli. Of about 20 proteins known to be involved in the pathway, a set of 9 proteins, namely, RecF, RecO, RecR, RecA, SSBa, RuvA, RuvB and RuvC was found to be indispensable among the 43 mycobacterial strains. A domain level analysis indicated that most domains involved in recombination repair are unique to these proteins and are present as single copies in the genomes. Synteny analysis reveals that the gene order of proteins involved in the pathway is not conserved, suggesting that they may be regulated differently in different species. Sequence conservation among the same protein from different strains suggests the importance of RecO-RecA and RecFOR-RecA presynaptic pathways in the repair of double strand-breaks and single strand-breaks respectively. New annotations obtained from the analysis, include identification of a protein with a probable Holliday junction binding role present in 41 mycobacterial genomes and that of a RecB-like nuclease, containing a cas4 domain, present in 42 genomes. New insights into the binding of small molecules to the relevant proteins are provided by binding pocket analysis using three dimensional structural models. Analysis of the various features of the recombination repair pathway, presented here, is likely to provide a framework for further exploring stress response and emergence of drug resistance in mycobacteria. PMID:27450012

  3. Production of matrix metalloproteinases in response to mycobacterial infection.

    Science.gov (United States)

    Quiding-Järbrink, M; Smith, D A; Bancroft, G J

    2001-09-01

    Matrix metalloproteinases (MMPs) constitute a large family of enzymes with specificity for the various proteins of the extracellular matrix which are implicated in tissue remodeling processes and chronic inflammatory conditions. To investigate the role of MMPs in immunity to mycobacterial infections, we incubated murine peritoneal macrophages with viable Mycobacterium bovis BCG or Mycobacterium tuberculosis H37Rv and assayed MMP activity in the supernatants by zymography. Resting macrophages secreted only small amounts of MMP-9 (gelatinase B), but secretion increased dramatically in a dose-dependent manner in response to either BCG or M. tuberculosis in vitro. Incubation with mycobacteria also induced increased MMP-2 (gelatinase A) activity. Neutralization of tumor necrosis alpha (TNF-alpha), and to a lesser extent interleukin 18 (IL-18), substantially reduced MMP production in response to mycobacteria. Exogenous addition of TNF-alpha or IL-18 induced macrophages to express MMPs, even in the absence of bacteria. The immunoregulatory cytokines gamma interferon (IFN-gamma), IL-4, and IL-10 all suppressed BCG-induced MMP production, but through different mechanisms. IFN-gamma treatment increased macrophage secretion of TNF-alpha but still reduced their MMP activity. Conversely, IL-4 and IL-10 seemed to act by reducing the amount of TNF-alpha available to the macrophages. Finally, infection of BALB/c or severe combined immunodeficiency (SCID) mice with either BCG or M. tuberculosis induced substantial increases in MMP-9 activity in infected tissues. In conclusion, we show that mycobacterial infection induces MMP-9 activity both in vitro and in vivo and that this is regulated by TNF-alpha, IL-18, and IFN-gamma. These findings indicate a possible contribution of MMPs to tissue remodeling processes that occur in mycobacterial infections.

  4. microRNAs in mycobacterial disease: friend or foe?

    OpenAIRE

    Mehta, Manali D.; Liu, Philip T.

    2014-01-01

    As the role of microRNA in all aspects of biology continues to be unraveled, the interplay between microRNAs and human disease is becoming clearer. It should come of no surprise that microRNAs play a major part in the outcome of infectious diseases, since early work has implicated microRNAs as regulators of the immune response. Here, we provide a review on how microRNAs influence the course of mycobacterial infections, which cause two of humanity’s most ancient infectious diseases: tuberculos...

  5. Partial overlap of anti-mycobacterial, and anti-Saccharomyces cerevisiae mannan antibodies in Crohn's disease

    Institute of Scientific and Technical Information of China (English)

    Stefan Müller; Thomas Schaffer; Alain M Schoepfer; Annamarie Hilty; Thomas Bodmer; Frank Seibold

    2008-01-01

    AIM: To test whether humoral immune reaction against mycobacteria may play a role in anti-Saccharomyces cerevisiae antibodies (ASCA) generation in Crohn's disease (CD) and/or whether it correlates with clinical subtypes.METHODS: The dominant ASCA epitope was detected by Galanthus nivalis lectin (GNL)-binding assay. ASCA and IgG against mycobacterial lysates (M avium, M smegmatis, M chelonae, M bovis BCG, M avium ssp. paratuberculosis (MAP)] or purified lipoarabinomannans (LAM) were detected by ELISA. ASCA and anti-mycobacterial antibodies were affinity purified to assess cross-reactivities. Anti-mycobacterial IgG were induced by BCG-infection of mice.RESULTS: GNL bound to different extents to mycobacterial lysates, abundantly to purified mannose-capped (Man) I_AM from M tuberculosis, but not to uncapped LAM from M smegmatis. Fifteen to 45% of CD patients but only 0%-6% of controls were seropositive against different mycobacterial antigens. Anti-mycobacterial IgG correlated with ASCA (r=0.37-0.64; P=0.003-P<0.001). ASCA-positivity and deficiency for mannan-binding lectin synergistically associated with anti-mycobacterial IgG. In some patients, anti-mycobacterial antibodies represent cross-reactive ASCA. Vice-versa, the predominant fraction of ASCA did not cross-react with mycobacteria. Finally, fistulizing disease associated with antibodies against M avium, M smegmatis and MAP (P=0.024,0.004 and 0.045, respectively).CONCLUSION: Similar to ASCA, seroreactivity against mycobacteria may define CD patients with complicated disease and a predisposition for immune responses against ubiquitous antigens. While in some patients anti-mycobacterial antibodies strongly cross-react with yeast mannan; these cross-reactive antibodies only represent a minor fraction of total ASCA. Thus, mycobacterial infection unlikely plays a role in ASCA induction.

  6. Structure-Activity Analysis of Gram-positive Bacterium-producing Lasso Peptides with Anti-mycobacterial Activity

    Science.gov (United States)

    Inokoshi, Junji; Koyama, Nobuhiro; Miyake, Midori; Shimizu, Yuji; Tomoda, Hiroshi

    2016-07-01

    Lariatin A, an 18-residue lasso peptide encoded by the five-gene cluster larABCDE, displays potent and selective anti-mycobacterial activity. The structural feature is an N-terminal macrolactam ring, through which the C-terminal passed to form the rigid lariat-protoknot structure. In the present study, we established a convergent expression system by the strategy in which larA mutant gene-carrying plasmids were transformed into larA-deficient Rhodococcus jostii, and generated 36 lariatin variants of the precursor protein LarA to investigate the biosynthesis and the structure-activity relationships. The mutational analysis revealed that four amino acid residues (Gly1, Arg7, Glu8, and Trp9) in lariatin A are essential for the maturation and production in the biosynthetic machinery. Furthermore, the study on structure-activity relationships demonstrated that Tyr6, Gly11, and Asn14 are responsible for the anti-mycobacterial activity, and the residues at positions 15, 16 and 18 in lariatin A are critical for enhancing the activity. This study will not only provide a useful platform for genetically engineering Gram-positive bacterium-producing lasso peptides, but also an important foundation to rationally design more promising drug candidates for combatting tuberculosis.

  7. The mycobacterial DNA-binding protein 1 (MDP1 from Mycobacterium bovis BCG influences various growth characteristics

    Directory of Open Access Journals (Sweden)

    Maurischat Sven

    2008-06-01

    Full Text Available Abstract Background Pathogenic mycobacteria such as M. tuberculosis, M. bovis or M. leprae are characterised by their extremely slow growth rate which plays an important role in mycobacterial virulence and eradication of the bacteria. Various limiting factors influence the generation time of mycobacteria, and the mycobacterial DNA-binding protein 1 (MDP1 has also been implicated in growth regulation. Our strategy to investigate the role of MDP1 in mycobacterial growth consisted in the generation and characterisation of a M. bovis BCG derivative expressing a MDP1-antisense gene. Results The expression rate of the MDP1 protein in the recombinant M. bovis BCG containing the MDP1-antisense plasmid was reduced by about 50% compared to the reference strain M. bovis BCG containing the empty vector. In comparison to this reference strain, the recombinant M. bovis BCG grew faster in broth culture and reached higher cell masses in stationary phase. Likewise its intracellular growth in mouse and human macrophages was ameliorated. Bacterial clumping in broth culture was reduced by the antisense plasmid. The antisense plasmid increased the susceptibility of the bacteria towards Ampicillin. 2-D protein gels of bacteria maintained under oxygen-poor conditions demonstrated a reduction in the number and the intensity of many protein spots in the antisense strain compared to the reference strain. Conclusion The MDP1 protein has a major impact on various growth characteristics of M. bovis BCG. It plays an important role in virulence-related traits such as aggregate formation and intracellular multiplication. Its impact on the protein expression in a low-oxygen atmosphere indicates a role in the adaptation to the hypoxic conditions present in the granuloma.

  8. Growth detection failures by the nonradiometric Bactec MGIT 960 mycobacterial culture system.

    Science.gov (United States)

    Peña, Jeremy A; Ferraro, Mary Jane; Hoffman, Colleen G; Branda, John A

    2012-06-01

    Mycobacterial growth in liquid culture can go undetected by automated, nonradiometric growth detection systems. In our laboratory, instrument-negative tubes from the Bactec MGIT 960 system are inspected visually for clumps suggestive of mycobacterial growth, which (if present) are examined by acid-fast smear analysis. A 3-year review demonstrated that ∼1% of instrument-negative MGIT cultures contained mycobacterial growth and that 10% of all cultures yielding mycobacteria were instrument negative. Isolates from instrument-negative MGIT cultures included both tuberculous and nontuberculous mycobacteria.

  9. microRNAs in mycobacterial disease: friend or foe?

    Directory of Open Access Journals (Sweden)

    Manali D Mehta

    2014-07-01

    Full Text Available As the role of microRNA in all aspects of biology continues to be unraveled, the interplay between microRNAs and human disease is becoming clearer. It should come of no surprise that microRNAs play a major part in the outcome of infectious diseases, since early work has implicated microRNAs as regulators of the immune response. Here, we provide a review on how microRNAs influence the course of mycobacterial infections, which cause two of humanity’s most ancient infectious diseases: tuberculosis and leprosy. Evidence derived from profiling and functional experiments suggests that regulation of specific microRNAs during infection can either enhance the immune response or facilitate pathogen immune evasion. Now, it remains to be seen if the manipulation of host cell microRNA profiles can be an opportunity for therapeutic intervention for these difficult-to-treat diseases.

  10. Biomarker discovery in subclinical mycobacterial infections of cattle.

    Directory of Open Access Journals (Sweden)

    Meetu Seth

    Full Text Available BACKGROUND: Bovine tuberculosis is a highly prevalent infectious disease of cattle worldwide; however, infection in the United States is limited to 0.01% of dairy herds. Thus detection of bovine TB is confounded by high background infection with M. avium subsp. paratuberculosis. The present study addresses variations in the circulating peptidome based on the pathogenesis of two biologically similar mycobacterial diseases of cattle. METHODOLOGY/PRINCIPAL FINDINGS: We hypothesized that serum proteomes of animals in response to either M. bovis or M. paratuberculosis infection will display several commonalities and differences. Sera prospectively collected from animals experimentally infected with either M. bovis or M. paratuberculosis were analyzed using high-resolution proteomics approaches. iTRAQ, a liquid chromatography and tandem mass spectrometry approach, was used to simultaneously identify and quantify peptides from multiple infections and contemporaneous uninfected control groups. Four comparisons were performed: 1 M. bovis infection versus uninfected controls, 2 M. bovis versus M. paratuberculosis infection, 3 early, and 4 advanced M. paratuberculosis infection versus uninfected controls. One hundred and ten differentially elevated proteins (P < or = 0.05 were identified. Vitamin D binding protein precursor (DBP, alpha-1 acid glycoprotein, alpha-1B glycoprotein, fetuin, and serine proteinase inhibitor were identified in both infections. Transthyretin, retinol binding proteins, and cathelicidin were identified exclusively in M. paratuberculosis infection, while the serum levels of alpha-1-microglobulin/bikunin precursor (AMBP protein, alpha-1 acid glycoprotein, fetuin, and alpha-1B glycoprotein were elevated exclusively in M. bovis infected animals. CONCLUSIONS/SIGNIFICANCE: The discovery of these biomarkers has significant impact on the elucidation of pathogenesis of two mycobacterial diseases at the cellular and the molecular level and

  11. Platensimycin activity against mycobacterial beta-ketoacyl-ACP synthases.

    Directory of Open Access Journals (Sweden)

    Alistair K Brown

    Full Text Available BACKGROUND: There is an urgent need for the discovery and development of new drugs against Mycobacterium tuberculosis, the causative agent of tuberculosis, especially due to the recent emergence of multi-drug and extensively-drug resistant strains. Herein, we have examined the susceptibility of mycobacteria to the natural product platensimycin. METHODS AND FINDINGS: We have demonstrated that platensimycin has bacteriostatic activity against the fast growing Mycobacterium smegmatis (MIC = 14 microg/ml and against Mycobacterium tuberculosis (MIC = 12 microg/ml. Growth in the presence of paltensimycin specifically inhibited the biosynthesis of mycolic acids suggesting that the antibiotic targeted the components of the mycolate biosynthesis complex. Given the inhibitory activity of platensimycin against beta-ketoacyl-ACP synthases from Staphylococcus aureus, M. tuberculosis KasA, KasB or FabH were overexpressed in M. smegmatis to establish whether these mycobacterial KAS enzymes were targets of platensimycin. In M. smegmatis overexpression of kasA or kasB increased the MIC of the strains from 14 microg/ml, to 30 and 124 microg/ml respectively. However, overexpression of fabH on did not affect the MIC. Additionally, consistent with the overexpression data, in vitro assays using purified proteins demonstrated that platensimycin inhibited Mt-KasA and Mt-KasB, but not Mt-FabH. SIGNIFICANCE: Our results have shown that platensimycin is active against mycobacterial KasA and KasB and is thus an exciting lead compound against M. tuberculosis and the development of new synthetic analogues.

  12. Molecular-based mycobacterial identification in a clinical laboratory setting: a comparison of two methods.

    LENUS (Irish Health Repository)

    O'Donnell, N

    2012-01-01

    Many mycobacterial species are pathogenic to humans, with infection occurring worldwide. Infection with Mycobacterium tuberculosis is a well-described global phenomenon, but other mycobacterial species are increasingly shown to be the cause of both pulmonary and extrapulmonary infection and are managed differently from M. tuberculosis infection. Rapid and accurate differentiation of mycobacterial species is, therefore, critical to guide timely and appropriate therapeutic and public health management. This study evaluates two commercially available DNA strip assays, the Genotype Common Mycobacteria (CM) assay (Hain Lifescience, Nehren, Germany) and the Speed-oligo Mycobacteria assay (Vircell, Spain) for their usefulness in a clinical laboratory setting. Both assays were evaluated on 71 clinical mycobacterial isolates, previously identified using Gen-Probe AccuProbe and through a UK mycobacteriology reference laboratory, as well as 29 non-mycobacterial isolates. Concordant results were obtained for 98% of isolates using both assays. The sensitivity was 97% (95% confidence interval [CI]: 93.3-100%) for the CM assay and 98.6% (95% CI: 95.9-100%) for the Speed-oligo assay. Overall, both assays proved to be useful tools for rapid and sensitive mycobacterial species identification, although interpretation of results was easier with the CM assay. Finally, results were available within one day, compared to current identification times which range between seven days and four weeks.

  13. The essential mycobacterial amidotransferase GatCAB is a modulator of specific translational fidelity.

    Science.gov (United States)

    Su, Hong-Wei; Zhu, Jun-Hao; Li, Hao; Cai, Rong-Jun; Ealand, Christopher; Wang, Xun; Chen, Yu-Xiang; Kayani, Masood Ur Rehman; Zhu, Ting F; Moradigaravand, Danesh; Huang, Hairong; Kana, Bavesh D; Javid, Babak

    2016-01-01

    Although regulation of translation fidelity is an essential process(1-7), diverse organisms and organelles have differing requirements of translational accuracy(8-15), and errors in gene translation serve an adaptive function under certain conditions(16-20). Therefore, optimal levels of fidelity may vary according to context. Most bacteria utilize a two-step pathway for the specific synthesis of aminoacylated glutamine and/or asparagine tRNAs, involving the glutamine amidotransferase GatCAB(21-25), but it had not been appreciated that GatCAB may play a role in modulating mistranslation rates. Here, by using a forward genetic screen, we show that the mycobacterial GatCAB enzyme complex mediates the translational fidelity of glutamine and asparagine codons. We identify mutations in gatA that cause partial loss of function in the holoenzyme, with a consequent increase in rates of mistranslation. By monitoring single-cell transcription dynamics, we demonstrate that reduced gatCAB expression leads to increased mistranslation rates, which result in enhanced rifampicin-specific phenotypic resistance. Consistent with this, strains with mutations in gatA from clinical isolates of Mycobacterium tuberculosis show increased mistranslation, with associated antibiotic tolerance, suggesting a role for mistranslation as an adaptive strategy in tuberculosis. Together, our findings demonstrate a potential role for the indirect tRNA aminoacylation pathway in regulating translational fidelity and adaptive mistranslation. PMID:27564922

  14. Species distribution in human immunodeficiency virus-related mycobacterial infections: implications for selection of initial treatment.

    Science.gov (United States)

    Montessori, V; Phillips, P; Montaner, J; Haley, L; Craib, K; Bessuille, E; Black, W

    1996-06-01

    Management of mycobacterial infection is species specific; however, treatment is prompted by positive smears or cultures, often several weeks before species identification. The objective of this study was to determine the species distribution of mycobacterial isolates from various body sites in patients infected with human immunodeficiency virus (HIV). All mycobacterial isolates recovered at St. Paul's Hospital (Vancouver, British Columbia, Canada) from April 1989 to March 1993 were reviewed. Among 357 HIV-positive patients with mycobacterial infections, 64% (96) of the sputum isolates were Mycobacterium avium complex (MAC), 18% were Mycobacterium tuberculosis, and 17% were Mycobacterium kansasii. Lymph node involvement (25 patients) was due to either MAC (72%) or M. tuberculosis (24%). Two hundred ninety-eight episodes of mycobacteremia were due to MAC (98%), M. tuberculosis (1%), and M. kansasii (1%). Similarly, cultures of 84 bone marrow biopsy specimens (99%), 19 intestinal biopsy specimens (100%), and 30 stool specimens (97%) yielded predominantly MAC. These results have implications for initial therapy, particularly in areas where rapid methods for species identification are not readily available. Because of considerable geographic variation, development of guidelines for selection of initial therapy depends on regional determination of species distribution in HIV-related mycobacterial infections. PMID:8783698

  15. PPARγ Expression and Function in Mycobacterial Infection: Roles in Lipid Metabolism, Immunity, and Bacterial Killing

    Directory of Open Access Journals (Sweden)

    Patricia E. Almeida

    2012-01-01

    Full Text Available Tuberculosis continues to be a global health threat, with drug resistance and HIV coinfection presenting challenges for its control. Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a highly adapted pathogen that has evolved different strategies to subvert the immune and metabolic responses of host cells. Although the significance of peroxisome proliferator-activated receptor gamma (PPARγ activation by mycobacteria is not fully understood, recent findings are beginning to uncover a critical role for PPARγ during mycobacterial infection. Here, we will review the molecular mechanisms that regulate PPARγ expression and function during mycobacterial infection. Current evidence indicates that mycobacterial infection causes a time-dependent increase in PPARγ expression through mechanisms that involve pattern recognition receptor activation. Mycobacterial triggered increased PPARγ expression and activation lead to increased lipid droplet formation and downmodulation of macrophage response, suggesting that PPARγ expression might aid the mycobacteria in circumventing the host response acting as an escape mechanism. Indeed, inhibition of PPARγ enhances mycobacterial killing capacity of macrophages, suggesting a role of PPARγ in favoring the establishment of chronic infection. Collectively, PPARγ is emerging as a regulator of tuberculosis pathogenesis and an attractive target for the development of adjunctive tuberculosis therapies.

  16. Pulmonary chondroid hamartoma with nontuberculous mycobacterial infection: two case reports.

    Science.gov (United States)

    Lee, Yong Chul; Moon, Jin Chang; Gang, Su Jin; Park, Seung Yong; Kim, So Ri

    2015-04-01

    Solitary pulmonary nodules (SPNs) can be manifested in a variety of disorders including neoplasms, infection, inflammation, and vascular or congenital abnormalities. In addition, they are often accompanied with other pulmonary pathologic lesions such as consolidations and several pulmonary disorders present as similar pulmonary nodular lesions simultaneously. Diagnostic workup is important for these SPNs; however, many physicians often miss the second diagnosis for multiple pulmonary lesions with SPNs due to lack of clinical suspicion that each pulmonary nodule or pathologic lesion can have each other's diagnosis. Herein, we report 2 cases of coexistence of pulmonary chondroid hamartoma with nontuberculous mycobacterial (NTM) infection presenting as pulmonary nodules and multiple consolidative lesions. A 60-year-old man was admitted for the evaluation of multifocal pulmonary lesions including SPN with chronic exertional dyspnea. Multiple lung tissues were obtained from each lesion through percutaneous transthoracic needle biopsy (PTNB). At the same time, bacteriologic examination was performed using respiratory samples obtained by bronchoscopy. Based on pathologic and microbiologic results, the patient diagnosed as pulmonary chondroid hamartoma with pulmonary NTM infectious disease. In addition, a 56-year-old woman visited for the evaluation of a small SPN. The SPN was resected surgically for the pathologic examination and turned out to be pulmonary chondroid hamartoma. Interestingly, the diagnostic workup revealed that the patient had Lady Windermere syndrome which is one of features for Mycobacterium avium complex (MAC) pulmonary disease. Both patients were treated with the standard antibiotics against MAC as recommended by the ATS/IDSA guideline. This is the first report of 2 patients, as far as we know, that chondroid hamartoma and NTM disease develop simultaneously in the lung. This report emphasizes that physicians should endeavor to confirm the individual

  17. A Mycobacterial Perspective on Tuberculosis in West Africa: Significant Geographical Variation of M. africanum and Other M. tuberculosis Complex Lineages

    OpenAIRE

    Florian Gehre; Samrat Kumar; Lindsay Kendall; Mebrat Ejo; Oumie Secka; Boatema Ofori-Anyinam; Emmanuel Abatih; Martin Antonio; Dirk Berkvens; Bouke C de Jong

    2016-01-01

    Background Phylogenetically distinct Mycobacterium tuberculosis lineages differ in their phenotypes and pathogenicity. Consequently, understanding mycobacterial population structures phylogeographically is essential for design, interpretation and generalizability of clinical trials. Comprehensive efforts are lacking to date to establish the West African mycobacterial population structure on a sub-continental scale, which has diagnostic implications and can inform the design of clinical TB tri...

  18. Specific detection of the cleavage activity of mycobacterial enzymes using a quantum dot based DNA nanosensor

    Science.gov (United States)

    Jepsen, Morten Leth; Harmsen, Charlotte; Godbole, Adwait Anand; Nagaraja, Valakunja; Knudsen, Birgitta R.; Ho, Yi-Ping

    2015-12-01

    We present a quantum dot based DNA nanosensor specifically targeting the cleavage step in the reaction cycle of the essential DNA-modifying enzyme, mycobacterial topoisomerase I. The design takes advantages of the unique photophysical properties of quantum dots to generate visible fluorescence recovery upon specific cleavage by mycobacterial topoisomerase I. This report, for the first time, demonstrates the possibility to quantify the cleavage activity of the mycobacterial enzyme without the pre-processing sample purification or post-processing signal amplification. The cleavage induced signal response has also proven reliable in biological matrices, such as whole cell extracts prepared from Escherichia coli and human Caco-2 cells. It is expected that the assay may contribute to the clinical diagnostics of bacterial diseases, as well as the evaluation of treatment outcomes.We present a quantum dot based DNA nanosensor specifically targeting the cleavage step in the reaction cycle of the essential DNA-modifying enzyme, mycobacterial topoisomerase I. The design takes advantages of the unique photophysical properties of quantum dots to generate visible fluorescence recovery upon specific cleavage by mycobacterial topoisomerase I. This report, for the first time, demonstrates the possibility to quantify the cleavage activity of the mycobacterial enzyme without the pre-processing sample purification or post-processing signal amplification. The cleavage induced signal response has also proven reliable in biological matrices, such as whole cell extracts prepared from Escherichia coli and human Caco-2 cells. It is expected that the assay may contribute to the clinical diagnostics of bacterial diseases, as well as the evaluation of treatment outcomes. Electronic supplementary information (ESI) available: Characterization of the QD-based DNA Nanosensor. See DOI: 10.1039/c5nr06326d

  19. Characterisation of the mycobacterial NER system reveals novel functions of uvrD1 helicase

    OpenAIRE

    Güthlein, C; Wanner, R M; Sander, P; Davis, E O; Bosshard, M.; Jiricny, J; Böttger, E C; Springer, B.

    2009-01-01

    In this study, we investigated the role of the nucleotide excision repair (NER) pathway in mycobacterial DNA repair. Mycobacterium smegmatis lacking the NER excinuclease component uvrB, the helicase uvrD1 and a double knock-out lacking both proteins were constructed and their sensitivity to a series of DNA damaging agents wa analysed. As anticipated, the mycobacterial NER system was shown to be involved in the processing of bulky DNA adducts and inter-strand cross-links. In addition, it coul...

  20. Conserved immune recognition hierarchy of mycobacterial PE/PPE proteins during infection in natural hosts.

    Directory of Open Access Journals (Sweden)

    H Martin Vordermeier

    Full Text Available The Mycobacterium tuberculosis genome contains two large gene families encoding proteins of unknown function, characterized by conserved N-terminal proline and glutamate (PE and PPE motifs. The presence of a large number of PE/PPE proteins with repetitive domains and evidence of strain variation has given rise to the suggestion that these proteins may play a role in immune evasion via antigenic variation, while emerging data suggests that some family members may play important roles in mycobacterial pathogenesis. In this study, we examined cellular immune responses to a panel of 36 PE/PPE proteins during human and bovine infection. We observed a distinct hierarchy of immune recognition, reflected both in the repertoire of PE/PPE peptide recognition in individual cows and humans and in the magnitude of IFN-γ responses elicited by stimulation of sensitized host cells. The pattern of immunodominance was strikingly similar between cattle that had been experimentally infected with Mycobacterium bovis and humans naturally infected with clinical isolates of M. tuberculosis. The same pattern was maintained as disease progressed throughout a four-month course of infection in cattle, and between humans with latent as well as active tuberculosis. Detailed analysis of PE/PPE responses at the peptide level suggests that antigenic cross-reactivity amongst related family members is a major determinant in the observed differences in immune hierarchy. Taken together, these results demonstrate that a subset of PE/PPE proteins are major targets of the cellular immune response to tuberculosis, and are recognized at multiple stages of infection and in different disease states. Thus this work identifies a number of novel antigens that could find application in vaccine development, and provides new insights into PE/PPE biology.

  1. Non-major histocompatibility complex-restricted cytotoxic activity of blood mononuclear cells stimulated with secreted mycobacterial proteins and other mycobacterial antigens

    DEFF Research Database (Denmark)

    Ravn, P; Pedersen, B K

    1994-01-01

    Several observations indicate that non-major histocompatibility complex (MHC)-restricted cytotoxicity, mediated for example by natural killer cells and lymphokine-activated killer cells, may serve as an important antimicrobial defense mechanism. The purpose of the present study was to investigate...... the influences of different mycobacterial antigens on non-MHC-restricted cytotoxicity and further to investigate the ways by which various lymphocyte subpopulations contribute to the development of this cytotoxicity. Non-MHC-restricted cytotoxicity was induced following stimulation of mononuclear cells......+ cells proliferated and expressed interleukin-2 receptors following stimulation with mycobacterial antigens. Depletion studies after antigen stimulation showed that the cytotoxic effector cells were CD16+ CD56+ and CD4-; the CD4+ cells alone did not mediate non-MHC-restricted cytotoxicity. To evaluate...

  2. Non-major histocompatibility complex-restricted cytotoxic activity of blood mononuclear cells stimulated with secreted mycobacterial proteins and other mycobacterial antigens

    DEFF Research Database (Denmark)

    Ravn, P; Pedersen, B K

    1994-01-01

    Several observations indicate that non-major histocompatibility complex (MHC)-restricted cytotoxicity, mediated for example by natural killer cells and lymphokine-activated killer cells, may serve as an important antimicrobial defense mechanism. The purpose of the present study was to investigate...... the influences of different mycobacterial antigens on non-MHC-restricted cytotoxicity and further to investigate the ways by which various lymphocyte subpopulations contribute to the development of this cytotoxicity. Non-MHC-restricted cytotoxicity was induced following stimulation of mononuclear...... interferon. The CD4+ cells proliferated and expressed interleukin-2 receptors following stimulation with mycobacterial antigens.Depletion studies after antigen stimulation showed that the cytotoxic effector cells were CD16+ CD56+ and CD4-; the CD4+ cells alone did not mediate non-MHC-restricted cytotoxicity...

  3. Polymerase chain reaction amplifying mycobacterial DNA from aspirates obtained by endoscopic ultrasound allows accurate diagnosis of mycobacterial disease in HIV-positive patients with abdominal lymphadenopathy.

    Science.gov (United States)

    Nieuwoudt, Martin; Lameris, Roeland; Corcoran, Craig; Rossouw, Theresa M; Slavik, Tomas; Du Plessis, Johannie; Omoshoro-Jones, Jones A O; Stivaktas, Paraskevi; Potgieter, Fritz; Van der Merwe, Schalk W

    2014-09-01

    Abdominal lymphadenopathy in human immunodeficiency virus (HIV) infection remains a diagnostic challenge. We performed a prospective cohort study by recruiting 31 symptomatic HIV + patients with abdominal lymphadenopathy and assessing the diagnostic yield of endoscopic ultrasound fine-needle aspiration (EUS-FNA). Mean age was 38 years; 52% were female; and mean CD4 count and viral load were 124 cells/μL and 4 log, respectively. EUS confirmed additional mediastinal nodes in 26%. The porta hepatis was the most common abdominal site. Aspirates obtained by EUS-FNA were subjected to cytology, culture and polymerase chain reaction (PCR) analysis. Mycobacterial infections were confirmed in 67.7%, and 31% had reactive lymphadenopathy. Cytology and culture had low sensitivity, whereas PCR identified 90% of mycobacterial infections. By combining the appearance of aspirates obtained by EUS-FNA and cytologic specimens, we developed a diagnostic algorithm to indicate when analysis with PCR would be useful. PCR performed on material obtained by EUS-FNA was highly accurate in confirming mycobacterial disease and determining genotypic drug resistance.

  4. Mycobacterial antigen 85 complex (Ag85) as a target for ficolins and mannose-binding lectin.

    Science.gov (United States)

    Świerzko, Anna S; Bartłomiejczyk, Marcin A; Brzostek, Anna; Łukasiewicz, Jolanta; Michalski, Mateusz; Dziadek, Jarosław; Cedzyński, Maciej

    2016-06-01

    The pattern recognition molecules (PRMs) able to activate complement via the lectin pathway are suspected to be involved in the interaction between pathogenic Mycobacteria and the host immune response. Recently, we have found strong interactions between 25 and 35kDa mycobacterial cell fractions and mannose-binding lectin (MBL) and ficolins. Here we demonstrate that two biologically important mycobacterial structures, mannosylated lipoarabinomannan (ManLAM) and the antigen 85 (Ag85) complex, induce activation of the lectin pathway of complement. The strong interaction of recombinant MBL with purified ManLAM was confirmed, but no binding of recombinant ficolins (ficolin-1, -2, -3) with this structure was observed. Interestingly, all PRMs tested reacted with the mycobacterial antigen 85 (Ag85) complex. Based on the use of specific inhibitors (mannan for MBL, acetylated bovine serum albumin for ficolin-1 and -2, Hafnia alvei PCM 1200 lipopolysaccharide for ficolin-3), we concluded that carbohydrate-recognition (MBL) and fibrinogen-like domains (ficolins) were involved in these interactions. Our results indicate that the mycobacterial antigen 85 complex is a target for ficolins and MBL. Furthermore, those PRMs also bound to fibronectin and therefore might influence the Ag85 complex-dependent interaction of Mycobacterium with the extracellular matrix. PMID:27141819

  5. Nontuberculous Mycobacterial Disease Is Not a Contraindication to Lung Transplantation in Patients With Cystic Fibrosis

    DEFF Research Database (Denmark)

    Qvist, Tavs; Pressler, Tanja; Thomsen, V O;

    2013-01-01

    Whether nontuberculous mycobacterial (NTM) disease is a contraindication to lung transplantation remains controversial. We conducted a nationwide study to evaluate the clinical importance of NTM infection among lung transplant patients with cystic fibrosis (CF) in Denmark and to determine if NTM...

  6. Nontuberculous Mycobacterial Tenosynovitis: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Liang-De Jiang

    2015-12-01

    Full Text Available Nontuberculous mycobacteria tenosynovitis is a rare clinical condition that commonly affects the hand and wrist. It is also a condition that is difficult to diagnose through clinical and roentgenological methods. In this study, a case of nontuberculous mycobacterial tenosynovitis infected by Mycobacterium marinum, which can be easily misdiagnosed, was reported and its imaging findings discussed.

  7. New live mycobacterial vaccines: the Geneva consensus on essential steps towards clinical development

    NARCIS (Netherlands)

    Kamath, A.T.; Fruth, U.; Brennan, M.; Dobbelaer, R.; Hubrechts, P.; Ho, M.M.; Mayner, R.E.; Thole, J.E.R.; Walker, K.B.; Liu, C.M.; Lambert, P.H.

    2005-01-01

    As the disease caused by Mycobacterium tuberculosis continues to be a burden, which the world continues to suffer, there is a concerted effort to find new vaccines to combat this problem. Of the various vaccines strategies, one viable option is the development of live mycobacterial vaccines. A meeti

  8. Multiplex PCR assay for immediate identification of the infecting species in patients with mycobacterial disease.

    Science.gov (United States)

    Kox, L F; Jansen, H M; Kuijper, S; Kolk, A H

    1997-01-01

    Rapid identification of infecting mycobacterial species enables appropriate medical care decisions to be made. Our aim was to demonstrate the clinical usefulness of the multiplex PCR assay, a test based on PCR, which permits direct identification of 12 mycobacterial species in clinical specimens. A total of 259 specimens from 177 patients who had clinical symptoms of mycobacterial disease but for whom there were difficulties in diagnosis were tested. Specimens were analyzed within 48 h of receipt of the sample. Mycobacteria were identified in 102 specimens; 66 specimens contained nontuberculous mycobacteria, and 36 specimens contained Mycobacterium tuberculosis complex mycobacteria. The PCR assay identified the mycobacterial species in 43 (97.7%) of 44 microscopy- and culture-positive specimens and in 15 (93.8%) of 16 culture-positive, microscopy-negative specimens. It also permitted species identification in infections caused by more than one mycobacterial species. For 56 (96.5%) of the 58 specimens from patients with infections caused by opportunistic mycobacteria, the organisms were identified with the PCR assay. The test was useful also for the identification of fastidious mycobacteria, e.g., M. genavense, and those that cannot be cultured, e.g., M. leprae. After resolution of discrepant results, the sensitivity of the PCR assay was 97.9%, the specificity was 96.9%, the positive predictive value was 95.0%, and the negative predictive value was 98.7%. For culture these values were 60.8, 100, 100, and 81.0%, respectively. Thus, the multiplex PCR assay enables prompt diagnosis when rapid identification of infecting mycobacteria is necessary. PMID:9163468

  9. A SHORT INTERFERING RNA MOLECULAR BEACON FOR THE ATTENUATION OF MYCOBACTERIAL INFECTION

    Directory of Open Access Journals (Sweden)

    Remo George

    2014-01-01

    Full Text Available The ability of the pathogen Mycobacterium Tuberculosis (MTB to invade and survive within macrophages of granulomas is attributed to the product of the Mammalian Cell Entry (MCE operon whose gene, mce4A, encodes a cholesterol transporter that transports host lipids into the bacterium that allows the bacterium to survive during chronic infection. Here, we proposed and tested the hypothesis that a mce4A siRNA molecular beacon can be used to attenuate mycobacterial infection in macrophages. Mce4A gene was cloned and expressed in E. coli (E. coli-4A and differentiated U937 cells were transduced with piLenti-siRNA-GFP phage expressing the mce4A siRNA for 24 h. This was followed by infection with either E. coli-4A or M. smegmatis for 3 h followed by incubation for 0, 3, 6, 24 and 48 h. The cells were lysed and the lysates were plated on LB agar plates containing ampicillin (100 µg mL-1 or on 7H11 media and incubated at 37°C overnight. Our results showed that the siRNA treatment attenuated E.coli-4A infection in macrophages at 3, 6, 24 and 48 h by 0, 77, 59.6 and 99.7%, respectively. Our results also showed that the siRNA treatment attenuated M. smegmatis infection in macrophages at 3, 6, 24 and 48 h. by 94.8, 70.3, 98.9 and 93.4%, respectively. In conclusion, a mce4A siRNA molecular beacon was successfully delivered and stably expressed in macrophages which attenuated E. coli expressing mce4A (E. coli-4A and M. smegmatis infection in macrophages.

  10. Molecular and Physiological Effects of Mycobacterial oxyR Inactivation

    OpenAIRE

    Pagán-Ramos, Eileen; Master, Sharon S.; Pritchett, Christopher L.; Reimschuessel, Renate; Trucksis, Michele; Timmins, Graham S.; Deretic, Vojo

    2006-01-01

    The majority of slow-growing mycobacteria have a functional oxyR, the central regulator of the bacterial oxidative stress response. In contrast, this gene has been inactivated during the evolution of Mycobacterium tuberculosis. Here we inactivated the oxyR gene in Mycobacterium marinum, an organism used to model M. tuberculosis pathogenesis. Inactivation of oxyR abrogated induction of ahpC, a gene encoding alkylhydroperoxide reductase, normally activated upon peroxide challenge. The absence o...

  11. Missense splice variant (g.20746A>G, p.Ile183Val) of interferon gamma receptor 1 (IFNGR1) coincidental with mycobacterial osteomyelitis - a screen of osteoarticular lesions.

    Science.gov (United States)

    Bińczak-Kuleta, Agnieszka; Szwed, Aleksander; Walter, Mark R; Kołban, Maciej; Ciechanowicz, Andrzej; Clark, Jeremy S C

    2016-08-01

    Previously, dominant partial interferon-gamma receptor 1 (IFN-g-R1) susceptibility to environmental mycobacteria was found with IFNGR1 deletions or premature stop. Our aim was to search for IFNGR1 variants in patients with mycobacterial osteoarticular lesions. Biopsies from the patients were examined for acid-fast bacilli, inflammatory cell infiltration, and mycobacterial niacin. Mycobacterial rRNA was analyzed using a target-amplified rRNA probe test. Peripheral-blood-leukocyte genomic DNA was isolated from 19 patients using the QIAamp DNA Mini Kit, and all IFNGR1 exons were sequenced using an ABIPRISM 3130 device. After the discovery of an exon 5 variant, a Polish newborn population sample (n = 100) was assayed for the discovered variant. Splice sites and putative amino acid interactions were analyzed. All patients tested were positive for mycobacteria; one was heterozygous for the IFNGR1 exon 5 single-nucleotide-missense substitution (g.20746A>G, p.Ile183Val). No other variant was found. The splice analysis indicated the creation of an exonic splicing silencer, and alternatively, molecular graphics indicated that the p.Ile183Val might alter beta-strand packing (loss of van der Waals contacts; Val183/Pro205), possibly altering the IFN-g-R1/IFN-g-R2 interaction. The probability of non-deleterious variant was estimated as genes affecting Type 1 T-helper-cell-mediated immunity. PMID:27483180

  12. Isolation of Mycobacterium fortuitum from fish tanks in Alborz, Iran.

    Directory of Open Access Journals (Sweden)

    Shirin Akbari

    2014-08-01

    Full Text Available Fish mycobacteriosis is caused by the non-tuberculous mycobacteria. Infected fish are normally the primary source of infection, although non-tuberculous Mycobacteria can be found in the environment. The present study was designed to investigate the few recently found suspected cases of mycobacteriosis in Iranian ornamental fish tanks.Pathological specimens including granolumas from autopsied fish were used to inoculate Lowenstein-Jensen medium. Genomic material was extracted from all acid-fast positive cultures. The mycobacterial identity of bacterial isolates was authenticated using a PCR assessment targeting a 543 bp-long stretch of 16Sr RNA gene. Further more, a PCR assessment targeting a 294 bp-long stretch of heat shock protein hsp65 was performed and the amplicons were sequenced to identify the isolates.Characteristic mycobacterial bacilli were identified both in light and fluorescent microscopy of bacterial culture from all the suspected specimens. PCR-amplification of DNA templates from all isolates successfully resulted in production of the expected products. Existence of Mycobacterium fortuitum was confirmed by comparison analysis of nucleotide sequencing at hsp65 gene.The present work clearly shows mycobacteria are important in pathology of ornamental fish diseases. People who are keeping fish as pet in their homes should be cantioned about the bacterial contamination risks arise from close contact with exotic ornamental species of fish.

  13. Six recommendations for improving monitoring of diseases shared with wildlife: examples regarding mycobacterial infections in Spain

    OpenAIRE

    Boadella, Mariana; Gortazar, Christian; Acevedo, Pelayo; Carta, Tania; Martín-Hernando, María Paz; Fuente, José; Vicente, Joaquín

    2011-01-01

    Abstract Monitoring is needed to identify changes in disease occurrence and to measure the impact of intervention. Using mycobacterial diseases as an example, we discuss herein the pros and cons of the current Spanish Wildlife Disease Surveillance Scheme providing suggestions for monitoring relevant diseases shared with wildlife in other regions facing similar challenges. Six points should be considered. This includes: (1) making sure the disease is properly monitored in the releva...

  14. Acid-Fast Staining and Petroff Hausser Chamber Counting of Mycobacterial Cells in Liquid Suspension

    OpenAIRE

    Treuer, Robin; Haydel, Shelley E.

    2011-01-01

    Accurate and rapid cell counts of mycobacterial species in culture are difficult to obtain. Here, a method using modified Kinyoun acid-fast staining was adapted for use with a Petroff-Hausser sperm and bacteria cell counting chamber by using a liquid suspension staining technique. Cell counts obtained by this method were compared to viable cell counts by agar plate counting, revealing accurate correlation.

  15. Optimizing Mycobacterial Culture in Smear-Negative, Human Immunodeficiency Virus-Infected Tuberculosis Cases

    OpenAIRE

    Ismail, N. A.; Said, H. M.; Pinini, Z.; S.V. Omar; Beyers, N; Naidoo, P

    2015-01-01

    Introduction Tuberculosis (TB) is a significant public health problem and the diagnosis in human immunodeficiency virus (HIV)—infected individuals is challenging. The use of mycobacterial culture remains an important complementary tool and optimizing it has important benefits. We sought to determine the effect of an increase in the number of specimens evaluated, addition of nutritional supplementation to the culture medium, sputum appearance and volume on diagnostic yield and time to detectio...

  16. Blood neutrophil counts in HIV-infected patients with pulmonary tuberculosis: association with sputum mycobacterial load.

    Directory of Open Access Journals (Sweden)

    Andrew D Kerkhoff

    Full Text Available BACKGROUND: Increasing evidence suggests that neutrophils play a role in the host response to Mycobacterium tuberculosis. We determined whether neutrophil counts in peripheral blood are associated with tuberculosis (TB and with mycobacterial load in sputum in HIV-infected patients. METHODOLOGY/PRINCIPAL FINDINGS: Adults enrolling in an antiretroviral treatment (ART clinic in a Cape Town township were screened for TB regardless of symptoms. Paired sputum samples were examined using liquid culture, fluorescence microscopy, and the Xpert MTB/RIF assay. Absolute neutrophil counts (ANC were measured in blood samples. Of 602 HIV-infected patients screened, 523 produced one or more sputum samples and had complete results available for analysis. Among these 523 patients, the median CD4 count was 169×10(9/L (IQR, 96-232 and median ANC was 2.6×10(9/L (IQR, 1.9-3.6. Culture-positive pulmonary tuberculosis was diagnosed in 89 patients. Patients with TB had a median ANC of 3.4×10(9/L (IQR, 2.4-5.1 compared to 2.5×10(9/L (IQR, 1.8-3.4 among those who were culture negative (p7.5×10(9/L; p = 0.0005. Patients were then classified into four mutually exclusive groups with increasing sputum mycobacterial load as defined by the results of culture, Xpert MTB/RIF and sputum smear microscopy. Multivariable analyses demonstrated that increasing sputum mycobacterial load was positively associated with blood ANC ≥2.6×10(9/L and with neutrophilia. CONCLUSIONS/SIGNIFICANCE: Increased blood neutrophil counts were independently associated with pulmonary TB and sputum mycobacterial burden in this HIV-infected patient group. This observation supports the growing body of literature regarding the potential role for neutrophils in the host response to TB.

  17. Osteopontin Expression Correlates with Clinical Outcome in Patients with Mycobacterial Infection

    OpenAIRE

    Nau, Gerard J.; Chupp, Geoffrey L.; Emile, Jean-François; Jouanguy, Emmanuelle; Berman, Jeffrey S.; Casanova, Jean-Laurent; Young, Richard A.

    2000-01-01

    Osteopontin (OPN) is a protein that is expressed in chronic inflammatory diseases including tuberculosis, and its deficiency predisposes to more severe mycobacterial infections in mice. However, no reports have identified altered OPN expression in, or correlated these alterations to, infections in humans. The data presented herein identify alterations in the tissue expression of OPN protein and describe an inverse correlation between these levels and disease progression after inoculation of M...

  18. Development of a Murine Mycobacterial Growth Inhibition Assay for Evaluating Vaccines against Mycobacterium tuberculosis▿ †

    OpenAIRE

    Parra, Marcela; Yang, Amy L.; Lim, Jaehyun; Kolibab, Kristopher; Derrick, Steven; Cadieux, Nathalie; Perera, Liyanage P.; Jacobs, William R.; Brennan, Michael; Morris, Sheldon L.

    2009-01-01

    The development and characterization of new tuberculosis (TB) vaccines has been impeded by the lack of reproducible and reliable in vitro assays for measuring vaccine activity. In this study, we developed a murine in vitro mycobacterial growth inhibition assay for evaluating TB vaccines that directly assesses the capacity of immune splenocytes to control the growth of Mycobacterium tuberculosis within infected macrophages. Using this in vitro assay, protective immune responses induced by immu...

  19. T-Cell Recognition of Mycobacterial GroES Peptides in Thai Leprosy Patients and Contacts

    OpenAIRE

    Chua-Intra, Boosbun; Peerapakorn, Somchai; Davey, Nick; Jurcevic, Stipo; Busson, Marc; Vordermeier, H. Martin; Pirayavaraporn, Charoon; Ivanyi, Juraj

    1998-01-01

    We report here the mapping of T-cell-stimulatory determinants of the GroES 10-kDa heat shock protein homologues from Mycobacterium leprae and Mycobacterium tuberculosis, which are known as major immunogens in mycobacterial infections. Peripheral blood mononuclear cells (PBMC) from treated tuberculoid leprosy or lepromatous leprosy patients and from healthy household or hospital staff contacts of the patients were cultured with 20 16-mer peptides covering the entire sequences of both M. leprae...

  20. Relationships between Mycobacterium Isolates from Patients with Pulmonary Mycobacterial Infection and Potting Soils▿ †

    OpenAIRE

    De Groote, Mary Ann; Pace, Norman R.; Fulton, Kayte; Joseph O. Falkinham

    2006-01-01

    High numbers of mycobacteria, including known pathogenic species such as Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium chelonae, were recovered from aerosols produced by pouring commercial potting soil products and potting soil samples provided by patients with pulmonary mycobacterial infections. The dominant mycobacteria in the soil samples corresponded to the dominant species implicated clinically. Profiles of large restriction fragments obtained by pulsed-field gel e...

  1. Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis

    OpenAIRE

    Roland eLang

    2013-01-01

    The world’s most successful intracellular bacterial pathogen, Mycobacterium tuberculosis (MTB), survives inside macrophages by blocking phagosome maturation and establishes chronic infection characterized by the formation of granulomas. Trehalose-6,6-dimycolate (TDM), the mycobacterial cord factor, is the most abundant cell wall lipid of virulent mycobacteria, is sufficient to cause granuloma formation, and has long been known to be a major virulence factor of MTB. Recently, TDM has been show...

  2. Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis

    OpenAIRE

    Lang, Roland

    2013-01-01

    The world's most successful intracellular bacterial pathogen, Mycobacterium tuberculosis (MTB), survives inside macrophages by blocking phagosome maturation and establishes chronic infection characterized by the formation of granulomas. Trehalose-6,6-dimycolate (TDM), the mycobacterial cord factor, is the most abundant cell wall lipid of virulent mycobacteria, is sufficient to cause granuloma formation, and has long been known to be a major virulence factor of MTB. Recently, TDM has been show...

  3. Ubiquitination as a Mechanism To Transport Soluble Mycobacterial and Eukaryotic Proteins to Exosomes.

    Science.gov (United States)

    Smith, Victoria L; Jackson, Liam; Schorey, Jeffrey S

    2015-09-15

    Exosomes are extracellular vesicles of endocytic origin that function in intercellular communication. Our previous studies indicate that exosomes released from Mycobacterium tuberculosis-infected macrophages contain soluble mycobacterial proteins. However, it was unclear how these secreted proteins were targeted to exosomes. In this study, we determined that exosome production by the murine macrophage cell line RAW264.7 requires the endosomal sorting complexes required for transport and that trafficking of mycobacterial proteins from phagocytosed bacilli to exosomes was dependent on protein ubiquitination. Moreover, soluble mycobacterial proteins, when added exogenously to RAW264.7 or human HEK293 cells, were endocytosed, ubiquitinated, and released via exosomes. This suggested that endocytosed proteins could be recycled from cells through exosomes. This hypothesis was supported using the tumor-associated protein He4, which, when endocytosed by RAW264.7 or HEK293 cells, was transported to exosomes in a ubiquitin-dependent manner. Our data suggest that ubiquitination is a modification sufficient for trafficking soluble proteins within the phagocytic/endocytic network to exosomes.

  4. Gamma Interferon Production by Bovine γδ T Cells following Stimulation with Mycobacterial Mycolylarabinogalactan Peptidoglycan

    Science.gov (United States)

    Vesosky, B.; Turner, O. C.; Turner, J.; Orme, I. M.

    2004-01-01

    A large percentage of lymphocytes in the blood of cattle express the γδ T-cell receptor, but specific functions for these cells have not yet been clearly defined. There is evidence, however, that human, murine, and bovine γδ T cells have a role in the immune response to mycobacteria. This study investigated the ability of bovine γδ T cells to expand and produce gamma interferon (IFN-γ) in response to stimulation with mycobacterial products. Bovine γδ T cells, isolated from the peripheral blood of healthy cattle, expanded following in vitro stimulation with live mycobacteria, mycobacterial crude cell wall extract, and Mycobacterium bovis culture filtrate proteins. In addition, purified γδ T cells, cocultured with purified monocytes and interleukin-2, consistently produced significant amounts of IFN-γ in response to mycobacterial cell wall. The IFN-γ-inducing component of the cell wall was further identified as a proteolytically resistant, non-sodium dodecyl sulfate-soluble component of the mycolylarabinogalactan peptidoglycan. PMID:15271921

  5. Rapid detection and differentiation of mycobacterial species using a multiplex PCR system

    Directory of Open Access Journals (Sweden)

    Andrea Santos Lima

    2013-07-01

    Full Text Available Introduction The early diagnosis of mycobacterial infections is a critical step for initiating treatment and curing the patient. Molecular analytical methods have led to considerable improvements in the speed and accuracy of mycobacteria detection. Methods The purpose of this study was to evaluate a multiplex polymerase chain reaction system using mycobacterial strains as an auxiliary tool in the differential diagnosis of tuberculosis and diseases caused by nontuberculous mycobacteria (NTM Results Forty mycobacterial strains isolated from pulmonary and extrapulmonary origin specimens from 37 patients diagnosed with tuberculosis were processed. Using phenotypic and biochemical characteristics of the 40 mycobacteria isolated in LJ medium, 57.5% (n=23 were characterized as the Mycobacterium tuberculosis complex (MTBC and 20% (n=8 as nontuberculous mycobacteria (NTM, with 22.5% (n=9 of the results being inconclusive. When the results of the phenotypic and biochemical tests in 30 strains of mycobacteria were compared with the results of the multiplex PCR, there was 100% concordance in the identification of the MTBC and NTM species, respectively. A total of 32.5% (n=13 of the samples in multiplex PCR exhibited a molecular pattern consistent with NTM, thus disagreeing with the final diagnosis from the attending physician. Conclusions Multiplex PCR can be used as a differential method for determining TB infections caused by NTM a valuable tool in reducing the time necessary to make clinical diagnoses and begin treatment. It is also useful for identifying species that were previously not identifiable using conventional biochemical and phenotypic techniques.

  6. Use of Molecular Methods To Identify the Mycobacterium tuberculosis Complex (MTBC) and Other Mycobacterial Species and To Detect Rifampin Resistance in MTBC Isolates following Growth Detection with the BACTEC MGIT 960 System

    OpenAIRE

    Somoskovi, Akos; Song, Qunfeng; Mester, Judit; Tanner, Charise; Hale, Yvonne M.; Linda M. Parsons; Salfinger, Max

    2003-01-01

    A prospective study was organized by using a total of 1,585 consecutive clinical specimens to determine whether biomass obtained from positive growth in the MGIT 960 system could be used directly in AccuProbe DNA hybridization tests, the PCR-based Inno-LiPA Rif.TB (LiPA) assay, and a PCR-based DNA sequencing of the rpoB gene for the rapid identification of the Mycobacterium tuberculosis complex (MTBC) and other mycobacterial species and for the determination of rifampin (RIF) resistance in MT...

  7. Chronic mycobacterial meningitis due to Mycobacterium chelonae: a case report.

    Science.gov (United States)

    Salmanzadeh, Shokrallah; Honarvar, Negin; Goodarzi, Hamed; Khosravi, Azar Dokht; Nashibi, Roohangiz; Serajian, Amir Arsalan; Hashemzadeh, Mohammad

    2014-10-01

    We report a case of chronic meningitis due to Mycobacterium chelonae. This organism is a rapidly growing Mycobacterium (RGM) and can be found worldwide in environmental sources such as soil, dust, and water. M. chelonae is an uncommon cause of meningitis; the majority of infections caused by this organism are localized cutaneous or soft tissue infections, and rarely lung infections. The organism is indistinguishable phenotypically, so we applied PCR based on the rpoB gene sequence followed by restriction fragment length polymorphism (RFLP) for molecular identification. The subsequent sequencing of RFLP products revealed 99.7% similarity with M. chelonae.

  8. Identification of drug susceptibility pattern and mycobacterial species in sputum smear positive pulmonary tuberculosis patients with and without HIV co-infection in north west Ethiopia

    DEFF Research Database (Denmark)

    Mekonen, Mekdem; Abate, Ebba; Aseffa, Abraham;

    2010-01-01

    Ethiopia is among the high-burden countries of tuberculosis (TB) in the world Since mycobacterial culture and susceptibility testing are not routinely performed in Ethiopia, recent data on susceptibility patterns and the mycobacterial species cultured from sputum smear positive patients are limited....

  9. Human TYK2 deficiency: Mycobacterial and viral infections without hyper-IgE syndrome.

    Science.gov (United States)

    Kreins, Alexandra Y; Ciancanelli, Michael J; Okada, Satoshi; Kong, Xiao-Fei; Ramírez-Alejo, Noé; Kilic, Sara Sebnem; El Baghdadi, Jamila; Nonoyama, Shigeaki; Mahdaviani, Seyed Alireza; Ailal, Fatima; Bousfiha, Aziz; Mansouri, Davood; Nievas, Elma; Ma, Cindy S; Rao, Geetha; Bernasconi, Andrea; Sun Kuehn, Hye; Niemela, Julie; Stoddard, Jennifer; Deveau, Paul; Cobat, Aurelie; El Azbaoui, Safa; Sabri, Ayoub; Lim, Che Kang; Sundin, Mikael; Avery, Danielle T; Halwani, Rabih; Grant, Audrey V; Boisson, Bertrand; Bogunovic, Dusan; Itan, Yuval; Moncada-Velez, Marcela; Martinez-Barricarte, Ruben; Migaud, Melanie; Deswarte, Caroline; Alsina, Laia; Kotlarz, Daniel; Klein, Christoph; Muller-Fleckenstein, Ingrid; Fleckenstein, Bernhard; Cormier-Daire, Valerie; Rose-John, Stefan; Picard, Capucine; Hammarstrom, Lennart; Puel, Anne; Al-Muhsen, Saleh; Abel, Laurent; Chaussabel, Damien; Rosenzweig, Sergio D; Minegishi, Yoshiyuki; Tangye, Stuart G; Bustamante, Jacinta; Casanova, Jean-Laurent; Boisson-Dupuis, Stéphanie

    2015-09-21

    Autosomal recessive, complete TYK2 deficiency was previously described in a patient (P1) with intracellular bacterial and viral infections and features of hyper-IgE syndrome (HIES), including atopic dermatitis, high serum IgE levels, and staphylococcal abscesses. We identified seven other TYK2-deficient patients from five families and four different ethnic groups. These patients were homozygous for one of five null mutations, different from that seen in P1. They displayed mycobacterial and/or viral infections, but no HIES. All eight TYK2-deficient patients displayed impaired but not abolished cellular responses to (a) IL-12 and IFN-α/β, accounting for mycobacterial and viral infections, respectively; (b) IL-23, with normal proportions of circulating IL-17(+) T cells, accounting for their apparent lack of mucocutaneous candidiasis; and (c) IL-10, with no overt clinical consequences, including a lack of inflammatory bowel disease. Cellular responses to IL-21, IL-27, IFN-γ, IL-28/29 (IFN-λ), and leukemia inhibitory factor (LIF) were normal. The leukocytes and fibroblasts of all seven newly identified TYK2-deficient patients, unlike those of P1, responded normally to IL-6, possibly accounting for the lack of HIES in these patients. The expression of exogenous wild-type TYK2 or the silencing of endogenous TYK2 did not rescue IL-6 hyporesponsiveness, suggesting that this phenotype was not a consequence of the TYK2 genotype. The core clinical phenotype of TYK2 deficiency is mycobacterial and/or viral infections, caused by impaired responses to IL-12 and IFN-α/β. Moreover, impaired IL-6 responses and HIES do not appear to be intrinsic features of TYK2 deficiency in humans. PMID:26304966

  10. Solar disinfection of MODS mycobacterial cultures in resource-poor settings.

    Directory of Open Access Journals (Sweden)

    Ruvandhi Nathavitharana

    Full Text Available INTRODUCTION: Safe disposal of TB culture material in which the infectious burden of clinical samples has been greatly amplified is an important challenge in resource-limited settings. The bactericidal capacity of solar cookers has been demonstrated previously for conventional bacteria and contaminated clinical waste. We investigated the use of a simple solar cooker for the sterilization of mycobacterial broth cultures from the microscopic observation drug susceptibility assay (MODS. METHODS: Simulated TB culture materials were prepared by inoculating 24-well MODS plates with 500 microL of a known concentration of Mycobacterium bovis BCG. In a series of experiments, samples were simultaneously placed inside a box-type solar cooker and control box and removed at timepoints between 15 minutes and 6 hours. Quantitative cultures were performed using retrieved samples to determine sterilization effect. RESULTS: All cultures from the control box were positive at or within 1-4 logs of inoculation concentration. Simulated culture plates at concentrations from 10(3 colony-forming-units (CFU/ml to 10(7 CFU/ml were completely sterilized after only one hour of cooker exposure, at temperatures between 50-102 degrees C. At 10(9 CFU/ml (far in excess of diagnostic cultures, it was only possible to recover mycobacterial growth in plates removed after 15 minutes. By 30 minutes all plates were effectively sterilized. DISCUSSION: Solar disinfection provides a very effective, safe and low-cost alternative to conventional equipment used for disposal of mycobacterial culture material. Effect of climatic conditions and optimal operating procedure remain to be defined.

  11. Characterization and comparison of mycobacterial antigens by two-dimensional immunoelectrophoresis.

    Science.gov (United States)

    Roberts, D B; Wright, G L; Affronti, L F; Reich, M

    1972-10-01

    Two-dimensional immunoelectrophoresis (2D-IEP), in which a complex of antigens is subjected to electrophoresis first through an agarose matrix in one direction and secondly through an antiserum-agarose matrix at right angles to the first direction, was evaluated as a tool for analysis of mycobacterial antigens. Cell extracts from four species of mycobacteria, Mycobacterium tuberculosis (four strains), M. bovis strain BCG, M. scrofulaceum, and M. phlei, were assayed by 2D-IEP with four anti-mycobacterial antisera. Besides displaying the precipitin curves in a more easily interpreted format than did conventional immunoelectrophoresis (IEP), 2D-IEP offered greater sensitivity in terms of numbers of precipitin curves when like reactions were compared with IEP patterns. As many as 60 immunoprecipitates were observed on 2D-IEP slides compared to 18 on comparable IEP plates. Technical reproducibility of patterns from run to run was excellent. Other parameters, such as the influence of using different batches of antigen on the pattern, are discussed. Each of the cell extract antigens gave a unique pattern of precipitin peaks which could be easily differentiated from the patterns given by the other mycobacterial cell extracts when reacted with any of the antisera in 2D-IEP. Since both the species and strains of mycobacteria could be easily and reproducibly differentiated solely on the basis of two-dimensional immunoelectrophoretic patterns obtained with any of the antisera employed in this study, it may be possible, by using IEP, to differentiate and identify all species and strains of mycobacteria with one standard, highly sensitive antiserum, rather than a battery of antisera.

  12. Antibodies against Mycobacterial Proteins as Biomarkers for HIV-Associated Smear-Negative Tuberculosis

    OpenAIRE

    Siev, Michael; Wilson, Douglas; Kainth, Supreet; Kasprowicz, Victoria O.; Feintuch, Catherine M.; Jenny-Avital, Elizabeth R.; Achkar, Jacqueline M.

    2014-01-01

    Serology data are limited for patients with sputum smear-negative HIV-associated active tuberculosis (TB). We evaluated the serum antibody responses against the mycobacterial proteins MPT51, MS, and echA1 and the 38-kDa protein via enzyme-linked immunosorbent assay (ELISA) in South African (S.A.) HIV-positive (HIV+) smear-negative TB patients (n = 56), U.S. HIV+ controls with a positive tuberculin skin test (TST+; n = 21), and S.A. HIV-negative (HIV−) (n = 18) and HIV+ (n = 24) controls. TB p...

  13. Prevalence of non-tuberculous mycobacterial infections among tuberculosis suspects in Nigeria.

    Directory of Open Access Journals (Sweden)

    Gambo Aliyu

    Full Text Available BACKGROUND: Nigeria is ranked in the top five countries for tuberculosis deaths worldwide. This study investigated the mycobacterial agents associated with presumptive clinical pulmonary tuberculosis (TB in Nigeria and evaluated the pattern and frequency of mycobacterial infections over twelve calendar months period. METHODS: Sputum samples from 1,603 consecutive new cases with presumptive diagnosis of TB were collected from August 2010 to July 2011. All sputum samples were incubated for detection of mycobacterial growth and those with positive acid fast bacilli (AFB growth were tested to detect mycobacterium tuberculosis (MTB complex and characterized to differentiate between MTB complex species. Cultures suggestive of Non-tuberculous mycobacterial infections (NTM were sub-cultured and characterized. RESULTS: Of the 1,603 patients screened, 444 (28% culture-positive cases of pulmonary tuberculosis were identified. Of these, 375 (85% were due to strains of MTB complex (354 cases of M. tuberculosis, 20 M. africanum and one case of M. bovis and 69 (15% were due to infection with NTM. In contrast to the MTB complex cases, the NTM cases were more likely to have been diagnosed during the calendar months of the Harmattan dust season (OR = 2.34, 1.28-4.29; p = 0.01, and aged older than 35 years (OR = 2.77, 1.52-5.02, p = 0.0007, but less likely to have AFB identified on their sputum smear (OR = 0.06, 0.02-0.14, p<0.0001. Among those with NTM infection, cases 35 years or younger were more likely to have co-infection with HIV (3.76, 1.72-8.22; p = 0.0009 compared to those older than 35 years. INTERPRETATION: The high proportion of younger patients with clinical pulmonary TB due to NTM and co-infection with HIV and the likely role of the seasonal dust exposure in the occurrence of the disease, present novel public health challenges for prevention and treatment.

  14. Domain Requirements for DNA Unwinding by Mycobacterial UvrD2, an Essential DNA Helicase†

    OpenAIRE

    Sinha, Krishna Murari; Stephanou, Nicolas C.; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart

    2008-01-01

    Mycobacterial UvrD2 is a DNA-dependent ATPase with 3′ to 5′ helicase activity. UvrD2 is an atypical helicase, insofar as its N-terminal ATPase domain resembles the superfamily I helicases UvrD/PcrA, yet it has a C-terminal HRDC domain, which is a feature of RecQ-type superfamily II helicases. The ATPase and HRDC domains are connected by a CxxC-(14)-CxxC tetracysteine module that defines a new clade of UvrD2-like bacterial helicases found only in Actinomycetales. By characterizing truncated ve...

  15. Lipase Activity of Guinea Pig Peritoneal Macrophages and Mycobacterial Lipase Inhibitor

    OpenAIRE

    Kiyotani, Katsuhiro; Tasaka, Hiromichi; Tsukiyama, Fumiaki; Matsuo, Yoshiyasu

    1983-01-01

    The interaction of mycobacterial lipase inhibitor (MLI), isolated from culture supernatant fluid of Mycobacterium tuberculosis strain H37Rv, and lipase from guinea pig peritoneal macrophages (GP-PMφs) was investigated fluorimetrically by the modified lipase assay system which had previously been proposed. Two peaks of lipase activity were observed in the enzyme preparation from GPPMφs. The activity of MLI against lipase from GP-PMφs was significantly high at acidic pH less than 5.0, and t...

  16. Characterization of two heparan sulphate-binding sites in the mycobacterial adhesin Hlp

    Directory of Open Access Journals (Sweden)

    Previato Jose O

    2008-05-01

    Full Text Available Abstract Background The histone-like Hlp protein is emerging as a key component in mycobacterial pathogenesis, being involved in the initial events of host colonization by interacting with laminin and glycosaminoglycans (GAGs. In the present study, nuclear magnetic resonance (NMR was used to map the binding site(s of Hlp to heparan sulfate and identify the nature of the amino acid residues directly involved in this interaction. Results The capacity of a panel of 30 mer synthetic peptides covering the full length of Hlp to bind to heparin/heparan sulfate was analyzed by solid phase assays, NMR, and affinity chromatography. An additional active region between the residues Gly46 and Ala60 was defined at the N-terminal domain of Hlp, expanding the previously defined heparin-binding site between Thr31 and Phe50. Additionally, the C-terminus, rich in Lys residues, was confirmed as another heparan sulfate binding region. The amino acids in Hlp identified as mediators in the interaction with heparan sulfate were Arg, Val, Ile, Lys, Phe, and Thr. Conclusion Our data indicate that Hlp interacts with heparan sulfate through two distinct regions of the protein. Both heparan sulfate-binding regions here defined are preserved in all mycobacterial Hlp homologues that have been sequenced, suggesting important but possibly divergent roles for this surface-exposed protein in both pathogenic and saprophic species.

  17. Rapid susceptibility testing of Mycobacterium tuberculosis by bioluminescence assay of mycobacterial ATP

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson, L.E.; Hoffner, S.E.; Ansehn, S.

    1988-08-01

    Mycobacterial growth was monitored by bioluminescence assay of mycobacterial ATP. Cultures of Mycobacterium tuberculosis H37Rv and of 25 clinical isolates of the same species were exposed to serial dilutions of ethambutol, isoniazid, rifampin, and streptomycin. A suppression of ATP, indicating growth inhibition, occurred for susceptible but not resistant strains within 5 to 7 days of incubation. Breakpoint concentrations between susceptibility and resistance were determined by comparing these results with those obtained by reference techniques. Full agreement was found in 99% of the assays with the resistance ratio method on Lowenstein-Jensen medium, and 98% of the assays were in full agreement with the radiometric system (BACTEC). A main advantage of the bioluminescence method is its rapidity, with results available as fast as with the radiometric system but at a lower cost and without the need for radioactive culture medium. The method provides kinetic data concerning drug effects within available in vivo drug concentrations and has great potential for both rapid routine susceptibility testing and research applications in studies of drug effects on mycobacteria.

  18. Development of a murine mycobacterial growth inhibition assay for evaluating vaccines against Mycobacterium tuberculosis.

    Science.gov (United States)

    Parra, Marcela; Yang, Amy L; Lim, JaeHyun; Kolibab, Kristopher; Derrick, Steven; Cadieux, Nathalie; Perera, Liyanage P; Jacobs, William R; Brennan, Michael; Morris, Sheldon L

    2009-07-01

    The development and characterization of new tuberculosis (TB) vaccines has been impeded by the lack of reproducible and reliable in vitro assays for measuring vaccine activity. In this study, we developed a murine in vitro mycobacterial growth inhibition assay for evaluating TB vaccines that directly assesses the capacity of immune splenocytes to control the growth of Mycobacterium tuberculosis within infected macrophages. Using this in vitro assay, protective immune responses induced by immunization with five different types of TB vaccine preparations (Mycobacterium bovis BCG, an attenuated M. tuberculosis mutant strain, a DNA vaccine, a modified vaccinia virus strain Ankara [MVA] construct expressing four TB antigens, and a TB fusion protein formulated in adjuvant) can be detected. Importantly, the levels of vaccine-induced mycobacterial growth-inhibitory responses seen in vitro after 1 week of coculture correlated with the protective immune responses detected in vivo at 28 days postchallenge in a mouse model of pulmonary tuberculosis. In addition, similar patterns of cytokine expression were evoked at day 7 of the in vitro culture by immune splenocytes taken from animals immunized with the different TB vaccines. Among the consistently upregulated cytokines detected in the immune cocultures are gamma interferon, growth differentiation factor 15, interleukin-21 (IL-21), IL-27, and tumor necrosis factor alpha. Overall, we have developed an in vitro functional assay that may be useful for screening and comparing new TB vaccine preparations, investigating vaccine-induced protective mechanisms, and assessing manufacturing issues, including product potency and stability. PMID:19458207

  19. Mycobacterial spindle cell pseudotumor of the appendix vermiformis in a patient with AIDS

    Directory of Open Access Journals (Sweden)

    Basílio-de-Oliveira Carlos Alberto

    2001-01-01

    Full Text Available Mycobacterial pseudotumor (MP is a rare pathologic presentation of both Mycobacterium tuberculosis and non-tuberculous mycobacterial disease, hitherto reported to occur only in immunosuppressed patients with or without human immunodeficiency virus infection. This lesion shares close pathologic resemblance to certain mesenchymal neoplasms, particularly Kaposi's sarcoma (KS, from which it must be properly differentiated due to distinct prognosis and therapy. We report a case of MP obliterating the lumen of the appendix vermiformis in a 34-year-old patient who died of complications of AIDS at our hospital in Rio de Janeiro. A total of 24 cases of MP (including our patient have been described in the literature. MP has been found especially in lymph nodes, but extranodal lesions have been described in the skin, spleen, lung, bone marrow, brain and, in our patient, the appendix vermiformis. We offer a review of the other 23 published case reports of MP in both HIV-infected and uninfected patients and discuss the pathologic features that differentiate MP from KS.

  20. Macrophage and T cell dynamics during the development and disintegration of mycobacterial granulomas.

    Science.gov (United States)

    Egen, Jackson G; Rothfuchs, Antonio Gigliotti; Feng, Carl G; Winter, Nathalie; Sher, Alan; Germain, Ronald N

    2008-02-01

    Granulomas play a key role in host protection against mycobacterial pathogens, with their breakdown contributing to exacerbated disease. To better understand the initiation and maintenance of these structures, we employed both high-resolution multiplex static imaging and intravital multiphoton microscopy of Mycobacterium bovis BCG-induced liver granulomas. We found that Kupffer cells directly capture blood-borne bacteria and subsequently nucleate formation of a nascent granuloma by recruiting both uninfected liver-resident macrophages and blood-derived monocytes. Within the mature granuloma, these myeloid cell populations formed a relatively immobile cellular matrix that interacted with a highly dynamic effector T cell population. The efficient recruitment of these T cells was highly dependent on TNF-alpha-derived signals, which also maintained the granuloma structure through preferential effects on uninfected macrophage populations. By characterizing the migration of both innate and adaptive immune cells throughout the process of granuloma development, these studies provide a new perspective on the cellular events involved in mycobacterial containment and escape.

  1. Rapid susceptibility testing of Mycobacterium tuberculosis by bioluminescence assay of mycobacterial ATP

    International Nuclear Information System (INIS)

    Mycobacterial growth was monitored by bioluminescence assay of mycobacterial ATP. Cultures of Mycobacterium tuberculosis H37Rv and of 25 clinical isolates of the same species were exposed to serial dilutions of ethambutol, isoniazid, rifampin, and streptomycin. A suppression of ATP, indicating growth inhibition, occurred for susceptible but not resistant strains within 5 to 7 days of incubation. Breakpoint concentrations between susceptibility and resistance were determined by comparing these results with those obtained by reference techniques. Full agreement was found in 99% of the assays with the resistance ratio method on Lowenstein-Jensen medium, and 98% of the assays were in full agreement with the radiometric system (BACTEC). A main advantage of the bioluminescence method is its rapidity, with results available as fast as with the radiometric system but at a lower cost and without the need for radioactive culture medium. The method provides kinetic data concerning drug effects within available in vivo drug concentrations and has great potential for both rapid routine susceptibility testing and research applications in studies of drug effects on mycobacteria

  2. Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis

    Directory of Open Access Journals (Sweden)

    Roland eLang

    2013-01-01

    Full Text Available The world’s most successful intracellular bacterial pathogen, Mycobacterium tuberculosis (MTB, survives inside macrophages by blocking phagosome maturation and establishes chronic infection characterized by the formation of granulomas. Trehalose-6,6-dimycolate (TDM, the mycobacterial cord factor, is the most abundant cell wall lipid of virulent mycobacteria, is sufficient to cause granuloma formation, and has long been known to be a major virulence factor of MTB. Recently, TDM has been shown to activate the Syk-Card9 signaling pathway in macrophages through binding to the C-type lectin receptor Mincle. The Mincle-Card9 pathway is required for activation of macrophages by TDM in vitro and for granuloma formation in vivo following injection of TDM. Whether this pathway is also exploited by MTB to reprogram the macrophage into a comfortable niche has not been explored yet. Several recent studies have investigated the phenotype of Mincle-deficient mice in mycobacterial infection, yielding divergent results in terms of a role for Mincle in host resistance. Here, we review these studies, discuss possible reasons for discrepant results and highlight open questions in the role of Mincle and other C-type lectin receptors in the infection biology of MTB.

  3. Complications after video-assisted thoracic surgery in patients with pulmonary nontuberculous mycobacterial lung disease who underwent preoperative pulmonary rehabilitation

    OpenAIRE

    Morino, Akira; Murase, Kazuma; Yamada, Katsuo

    2015-01-01

    [Purpose] Video-assisted thoracic surgery and preoperative pulmonary rehabilitation are effective in preventing postoperative complications in patients with cardiopulmonary disease. The present study aims to elucidate the presence of postoperative pneumonia and atelectasis in patients with nontuberculous mycobacterial lung disease who underwent lung resection with video-assisted thoracic surgery and preoperative pulmonary rehabilitation. [Subjects and Methods] Nineteen patients with nontuberc...

  4. Playing hide-and-seek with host macrophages through the use of mycobacterial cell envelope phthiocerol dimycocerosates and phenolic glycolipids

    Directory of Open Access Journals (Sweden)

    Ainhoa eARBUES

    2014-12-01

    Full Text Available Mycobacterial pathogens, including Mycobacterium tuberculosis, the etiological agent of tuberculosis (TB, have evolved a remarkable ability to evade the immune system in order to survive and to colonize the host. Among the most important evasion strategies is the capacity of these bacilli to parasitize host macrophages, since these are major effector cells against intracellular pathogens that can be used as long-term cellular reservoirs. Mycobacterial pathogens employ an array of virulence factors that manipulate macrophage function to survive and establish infection. Until recently, however, the role of mycobacterial cell envelope lipids as virulence factors in macrophage subversion has remained elusive. Here, we will address exclusively the proposed role for phthiocerol dimycocerosates (DIM in the modulation of the resident macrophage response and that of phenolic glycolipids (PGL in the regulation of the recruitment and phenotype of incoming macrophage precursors to the site of infection. We will provide a unique perspective of potential additional functions for these lipids, and highlight obstacles and opportunities to further understand their role in the pathogenesis of TB and other mycobacterial diseases.

  5. Improved detection of mycobacterial DNA by PCR in formalin-fixed, paraffin-embedded tissues using thin sections.

    Science.gov (United States)

    Loeschke, S; Goldmann, T; Vollmer, E

    2005-01-01

    PCR is a unique methodology allowing for the sensitive detection of mycobacterial DNA-sequences in cases in which no fresh material can be obtained for classic analyses. Despite the limitations of this technique, for example the less satisfactory quality of DNA from paraffin-embedded specimens and the high effort necessary to control contamination, PCR still represents a useful additional tool for routine diagnostic examinations of mycobacterial infections. Fragmentation of the DNA extracted from formalin-fixed, paraffin-embedded samples on the one hand and the rigid cell wall of mycobacteria on the other hand are obstacles to detecting the DNA of these microorganisms by PCR. Here, we describe a simple mechanical procedure that allows us to improve the detection of mycobacterial DNA with the use of thin (1 microm) sections instead of thicker sections. This could be explained by a gentle, mechanical opening of the acid fast mycobacterial cell wall. Thus, even the application of heat/cold shock treatments is not necessary. This inexpensive fast procedure can also be used for the detection of other infectious agents. PMID:15807309

  6. Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Liu, Huicong; Yang, Min; He, Zheng-Guo

    2016-01-01

    Transport-related genes significantly affect bacterial antibiotic resistance. However, the effects of these genes and their regulation of bacterial drug resistance in several mycobacterial species, including the fast-growing Mycobacterium smegmatis, the pathogen M. tuberculosis and M. avium have not been clearly characterized. We identified Ms4022 (MSMEG_4022) as a novel TetR family regulator that activates the expression of seven transport-related genes and affects drug resistance in M. smegmatis. Overexpression of Ms4022 inhibited M. smegmatis growth and enhanced mycobacterial resistance to the anti-tuberculosis drug rifampicin (RIF). By contrast, the Ms4022-deleted mycobacterial strain has shown sensitive to RIF. Ms4022 recognized three 19 bp non-palindromic motifs containing a 9 bp conserved region at their 5' end and it directly regulated seven transport-related genes, which affects mycobacterial resistance to RIF. Overexpression of three of seven transport-related genes (Ms1448, Ms1613, and Ms5278) inhibited the growth of M. smegmatis. This study improves our understanding of the function of mycobacterial transport-related genes and their regulation of bacterial drug resistance. PMID:27271013

  7. Experienced and Perceived Risks of Mycobacterial Diseases: A Cross Sectional Study among Agropastoral Communities in Northern Tanzania.

    Directory of Open Access Journals (Sweden)

    Andrew Martin Kilale

    Full Text Available The current study was conducted to assess experienced risk factors and perceptions of mycobacterial diseases in communities in northern Tanzania.We conducted a cross-sectional study in Arusha and Manyara regions in Northern Tanzania. We enrolled tuberculosis (TB patients attending Mount Meru Hospital, Enduleni Hospital and Haydom Lutheran Hospitals in Arusha municipality, Ngorongoro and Mbulu districts, respectively. Patient addresses were recorded during their first visit to the hospitals. Patients with confirmed diagnosis of TB by sputum smear microscopy and/or culture at central laboratory were followed up and interviewed using pre-tested questionnaires, and selected relatives and neighbors were also interviewed. The study was conducted between June 2011 and May 2013.The study involved 164 respondents: 41(25% were TB patients, 68(41.5% were their relatives and 55(33.5% their neighbors. Sixty four (39% knew a risk factor for mycobacterial disease. Overall, 64(39% perceived to be at risk of mycobacterial diseases. Exposure to potential risks of mycobacterial diseases were: keeping livestock, not boiling drinking water, large family, smoking and sharing dwelling with TB patients. Rural dwellers were more often livestock keepers (p<0.01, more often shared dwelling with livestock (p<0.01 than urban dwellers. More primary school leavers reported sharing dwelling with TB patients than participants with secondary and higher education (p = 0.01.Livestock keeping, sharing dwelling with livestock, sharing household with a TB patient were perceived risk factors for mycobacterial diseases and the participants were exposed to some of these risk factors. Improving knowledge about the risk factors may protect them from these serious diseases.

  8. Immune reconstitution inflammatory syndrome in HIV-infected patients with mycobacterial infections starting highly active anti-retroviral therapy

    International Nuclear Information System (INIS)

    AIM: To describe the radiological appearances of immune reconstitution inflammatory syndrome (IRIS) in human immunodeficiency virus (HIV)-infected patients with mycobacterial infections starting highly active anti-retroviral therapy (HAART). MATERIALS AND METHODS: Five consecutive HIV infected patients with IRIS due to mycobacterial infection were studied. Intercurrent infection and poor drug compliance were excluded as causes of presentation. The chest radiological appearances at the time of starting HAART and at the time of diagnosis of IRIS were compared. RESULTS: In these five patients there was clinical and radiological deterioration, occurring between 10 days and 7 months after starting HAART, leading to unmasking of previously undiagnosed mycobacterial infection or to worsening of mycobacterial disease. All five patients had HAART-induced increases in CD4+ T lymphocyte counts and reductions in peripheral blood HIV 'viral load'. Chest radiographic abnormalities due to IRIS included marked mediastinal lymphadenopathy in three patients--severe enough to produce tracheal compression in two patients (one of whom had stridor)--and was associated with new pulmonary infiltrates in two patients. The other two patients had new infiltrates, which in one patient was associated with a pleural effusion. CONCLUSION: These cases illustrate the diverse chest radiographic appearances of IRIS occurring after HAART in patients with mycobacterial and HIV co-infection. Marked mediastinal lymphadenopathy occurred in three of these five patients (with associated tracheal narrowing in two patients); four patients developed pulmonary infiltrates and one had an effusion. The cases further highlight that the onset of IRIS may be delayed for several months after HAART is started

  9. Immune reconstitution inflammatory syndrome in HIV-infected patients with mycobacterial infections starting highly active anti-retroviral therapy

    Energy Technology Data Exchange (ETDEWEB)

    Buckingham, S.J.; Haddow, L.J.; Shaw, P.J.; Miller, R.F. E-mail: rmiller@gum.ucl.ac.uk

    2004-06-01

    AIM: To describe the radiological appearances of immune reconstitution inflammatory syndrome (IRIS) in human immunodeficiency virus (HIV)-infected patients with mycobacterial infections starting highly active anti-retroviral therapy (HAART). MATERIALS AND METHODS: Five consecutive HIV infected patients with IRIS due to mycobacterial infection were studied. Intercurrent infection and poor drug compliance were excluded as causes of presentation. The chest radiological appearances at the time of starting HAART and at the time of diagnosis of IRIS were compared. RESULTS: In these five patients there was clinical and radiological deterioration, occurring between 10 days and 7 months after starting HAART, leading to unmasking of previously undiagnosed mycobacterial infection or to worsening of mycobacterial disease. All five patients had HAART-induced increases in CD4+ T lymphocyte counts and reductions in peripheral blood HIV 'viral load'. Chest radiographic abnormalities due to IRIS included marked mediastinal lymphadenopathy in three patients--severe enough to produce tracheal compression in two patients (one of whom had stridor)--and was associated with new pulmonary infiltrates in two patients. The other two patients had new infiltrates, which in one patient was associated with a pleural effusion. CONCLUSION: These cases illustrate the diverse chest radiographic appearances of IRIS occurring after HAART in patients with mycobacterial and HIV co-infection. Marked mediastinal lymphadenopathy occurred in three of these five patients (with associated tracheal narrowing in two patients); four patients developed pulmonary infiltrates and one had an effusion. The cases further highlight that the onset of IRIS may be delayed for several months after HAART is started.

  10. The Host Response to a Clinical MDR Mycobacterial Strain Cultured in a Detergent-Free Environment: A Global Transcriptomics Approach.

    Science.gov (United States)

    Leisching, Gina; Pietersen, Ray-Dean; Mpongoshe, Vuyiseka; van Heerden, Carel; van Helden, Paul; Wiid, Ian; Baker, Bienyameen

    2016-01-01

    During Mycobacterium tuberculosis (M.tb) infection, the initial interactions between the pathogen and the host cell determines internalization and innate immune response events. It is established that detergents such as Tween alter the mycobacterial cell wall and solubilize various lipids and proteins. The implication of this is significant since induced changes on the cell wall affect macrophage uptake and the immune response to M.tb. Importantly, during transmission between hosts, aerosolized M.tb enters the host in its native form, i.e. in a detergent-free environment, thus in vitro and in vivo studies should mimic this as closely as possible. To this end, we have optimized a procedure for growing and processing detergent-free M.tb and assessed the response of murine macrophages (BMDM) infected with multi drug-resistant M.tb (R179 Beijing 220 clinical isolate) using RNAseq. We compared the effects of the host response to M.tb cultured under standard laboratory conditions (Tween 80 containing medium -R179T), or in detergent-free medium (R179NT). RNAseq comparisons reveal 2651 differentially expressed genes in BMDMs infected with R179T M.tb vs. BMDMs infected with R179NT M.tb. A range of differentially expressed genes involved in BMDM receptor interaction with M.tb (Mrc1, Ifngr1, Tlr9, Fpr1 and Itgax) and pro-inflammatory cytokines/chemokines (Il6, Il1b, Tnf, Ccl5 and Cxcl14) were selected for analysis through qPCR. BMDMs infected with R179NT stimulate a robust inflammatory response. Interestingly, R179NT M.tb induce transcription of Fpr1, a receptor which detects bacterial formyl peptides and initiates a myriad of immune responses. Additionally we show that the host components Cxcl14, with an unknown role in M.tb infection, and Tlr9, an emerging role player, are only stimulated by infection with R179NT M.tb. Taken together, our results suggest that the host response differs significantly in response to Tween 80 cultured M.tb and should therefore not be used in

  11. Coupling of Petri Net Models of the Mycobacterial Infection Process and Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Rafael V. Carvalho

    2015-04-01

    Full Text Available Computational and mathematical modeling is important in support of a better understanding of complex behavior in biology. For the investigation of biological systems, researchers have used computers to construct, verify, and validate models that describe the mechanisms behind biological processes in multi-scale representations. In this paper we combine Petri net models that represent the mycobacterial infection process and innate immune response at various levels of organization, from molecular interaction to granuloma dissemination. In addition to the conventional graphical representation of the Petri net, the outcome of the model is projected onto a 3D model representing the zebrafish embryo. In this manner we provide a visualization of the process in a simulation framework that portrays the infection in the living system.

  12. Asymmetry and aging of mycobacterial cells lead to variable growth and antibiotic susceptibility.

    Science.gov (United States)

    Aldridge, Bree B; Fernandez-Suarez, Marta; Heller, Danielle; Ambravaneswaran, Vijay; Irimia, Daniel; Toner, Mehmet; Fortune, Sarah M

    2012-01-01

    Cells use both deterministic and stochastic mechanisms to generate cell-to-cell heterogeneity, which enables the population to better withstand environmental stress. Here we show that, within a clonal population of mycobacteria, there is deterministic heterogeneity in elongation rate that arises because mycobacteria grow in an unusual, unipolar fashion. Division of the asymmetrically growing mother cell gives rise to daughter cells that differ in elongation rate and size. Because the mycobacterial cell division cycle is governed by time, not cell size, rapidly elongating cells do not divide more frequently than slowly elongating cells. The physiologically distinct subpopulations of cells that arise through asymmetric growth and division are differentially susceptible to clinically important classes of antibiotics. PMID:22174129

  13. Two episodes of cutaneous non-tuberculous mycobacterial infection in a patient with psoriasis

    Directory of Open Access Journals (Sweden)

    Wai Sze Agnes Chan

    2015-06-01

    Full Text Available Non-tuberculous mycobacteria (NTM are a group of environmental pathogens, which cause a broad spectrum of disease. The incidence of NTM infection is increasing, especially in immunocompromized patients. The past three decades also saw a rapid increase in the incidence of NTM infection involving otherwise healthy subjects. We report a case of cutaneous NTM infection in a 79-year-old Chinese woman, who was receiving methotrexate for psoriasis. Mycobacterial culture grew Mycobacterium abscessus, and the lesions cleared with a combination of oral clarithromycin, ciprofloxacin and doxycycline. Interestingly, she then developed a second episode of cutaneous NTM infection with Mycobacterium haemophilum over the same body region, five years after stoppage of methotrexate. Both episodes were separated in time and involved different species, indicating that they were independent from each other. We further discuss the risk factors for cutaneous NTM infection, treatment, and highlight the need for diagnostic vigilance.

  14. Mycobacterium tuberculosis phosphoribosylpyrophosphate synthetase: biochemical features of a crucial enzyme for mycobacterial cell wall biosynthesis.

    Directory of Open Access Journals (Sweden)

    Anna P Lucarelli

    Full Text Available The selection and soaring spread of Mycobacterium tuberculosis multidrug-resistant (MDR-TB and extensively drug-resistant strains (XDR-TB is a severe public health problem. Currently, there is an urgent need for new drugs for tuberculosis treatment, with novel mechanisms of action and, moreover, the necessity to identify new drug targets. Mycobacterial phosphoribosylpyrophosphate synthetase (MtbPRPPase is a crucial enzyme involved in the biosynthesis of decaprenylphosphoryl-arabinose, an essential precursor for the mycobacterial cell wall biosynthesis. Moreover, phosphoribosylpyrophosphate, which is the product of the PRPPase catalyzed reaction, is the precursor for the biosynthesis of nucleotides and of some amino acids such as histidine and tryptophan. In this context, the elucidation of the molecular and functional features of MtbPRPPase is mandatory. MtbPRPPase was obtained as a recombinant form, purified to homogeneity and characterized. According to its hexameric form, substrate specificity and requirement of phosphate for activity, the enzyme proved to belong to the class I of PRPPases. Although the sulfate mimicked the phosphate, it was less effective and required higher concentrations for the enzyme activation. MtbPRPPase showed hyperbolic response to ribose 5-phosphate, but sigmoidal behaviour towards Mg-ATP. The enzyme resulted to be allosterically activated by Mg(2+ or Mn(2+ and inhibited by Ca(2+ and Cu(2+ but, differently from other characterized PRPPases, it showed a better affinity for the Mn(2+ and Cu(2+ ions, indicating a different cation binding site geometry. Moreover, the enzyme from M. tuberculosis was allosterically inhibited by ADP, but less sensitive to inhibition by GDP. The characterization of M. tuberculosis PRPPase provides the starting point for the development of inhibitors for antitubercular drug design.

  15. Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination.

    Science.gov (United States)

    Markova, Nadya; Slavchev, Georgi; Michailova, Lilia

    2015-01-01

    Possible persistence of bacteria in human blood as cell wall deficient forms (L-forms) represents a top research priority for microbiologists. Application of live BCG vaccine and L-form transformation of vaccine strain may display a new intriguing aspect concerning the opportunity for occurrence of unpredictable colonization inside the human body by unusual microbial life forms. L-form cultures were isolated from 141 blood samples of people previously vaccinated with BCG, none with a history of exposure to tuberculosis. Innovative methodology to access the unusual L-form elements derived from human blood was developed. The methodology outlines the path of transformation of non- cultivable L-form element to cultivable bacteria and their adaptation for growth in vitro. All isolates showed typical L-forms growth features ("fried eggs" colonies and biofilm). Electron microscopy revealed morphology evidencing peculiar characteristics of bacterial L-form population (cell wall deficient polymorphic elements of variable shape and size). Regular detection of acid fast bacteria in smears of isolated blood L-form cultures, led us to start their identification by using specific Mycobactrium spp. genetic tests. Forty five of 97 genetically tested blood cultures provided specific positive signals for mycobacteria, confirmed by at least one of the 3 specific assays (16S rRNA PCR; IS6110 Real Time PCR and spoligotyping). In conclusion, the obtained genetic evidence suggests that these L-forms are of mycobacterial origin. As the investigated people had been vaccinated with BCG, we can assume that the identified mycobacterial L-forms may be produced by persisting live BCG vaccine. PMID:25874947

  16. Nontuberculous mycobacterial pulmonary disease mimicking lung cancer: Clinicoradiologic features and diagnostic implications.

    Science.gov (United States)

    Hong, Su Jin; Kim, Tae Jung; Lee, Jae-Ho; Park, Jeong-Soo

    2016-06-01

    To describe the features and clinical implications of computed tomography (CT), positron emission tomography (PET), and percutaneous needle aspiration biopsy (PCNB) in pulmonary nontuberculous mycobacterial (NTM) disease manifesting as a solitary nodule, mass, or mass-like consolidation mimicking malignancy.Among a cohort of 388 patients with NTM pulmonary disease, 14 patients with clinically and radiologically suspected lung cancer were included in our study. Two chest radiologists evaluated CT features, including lesion type (nodule, mass, or mass-like consolidation), morphologic features (margin, degree of enhancement, calcification), and presence of accompanying findings suggestive of NTM pulmonary disease (bronchiectasis with clustered centrilobular nodules or upper-lobe cavitary lesions) by consensus. Diagnostic procedures for microbiologic diagnosis of NTM disease and clinical outcome were reviewed.Incidence of NTM pulmonary disease presenting as solitary nodule/mass (n = 8) or mass-like consolidation (n = 6) was 3.6% (14 of 388). Most lesions were detected incidentally during routine health check-up or evaluation of other disease (11 of 14, 79%). Lesions typically showed poor contrast-enhancement (9 of 12) and internal calcification (6 of 14). No lesions had CT features suggestive of NTM pulmonary disease. All 4 lesions for which PET/CT imaging was performed showed strong fluorodeoxyglucose uptake simulating malignant lesions (mean, 4.9; range, 3.6-7.8). PCNB revealed mycobacterial histology in 6 of 11 specimens and positive culture results were obtained for 7 of 7 specimens.NTM pulmonary disease may present as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. CT features and PCNB are important to diagnose NTM disease mimicking lung cancer to avoid unnecessary surgery. PMID:27367996

  17. Drug resistance pattern of mycobacterial isolates in HIV and non-HIV population in South India

    Directory of Open Access Journals (Sweden)

    Umamaheshwari Shivaswamy

    2016-01-01

    Full Text Available Background: Emergence of drug resistance has complicated the treatment of tuberculosis (TB. WHO reports India to be one among 27 “high burden” multidrug-resistant (MDR TB countries. Objective: To diagnose TB and detect drug resistance of mycobacterial isolates in acid-fast bacilli (AFB smear negative HIV reactive patients (Group A and compare them with HIV seropositive AFB smear positive (Group B and HIV-seronegative AFB positive cases (Group C. Materials and Methods: Clinical specimens collected in all groups were processed as per the standard protocol except blood, which was processed by lysis centrifugation technique. They were then inoculated with Lowenstein-Jensen media and the isolates obtained were subjected to drug susceptibility test (DST by proportion method and genotype MTBDR plus assay. Results: In Group A, 162 patients were included. Of the 443 clinical samples collected, 76 mycobacterial strains were obtained from 67 (41% patients. Of these, 50 (65.8% were sensitive to all drugs and 26 (34.2% resistant to one or more anti-tubercular drugs. Antibiogram of Group A when compared with Group B and C showed that the MDR rate 6.6%, 6.7% and 8% respectively did not differ much; but resistance to at least single drug was (26 [34.2%], 3 [10%], and 8 [16%], respectively. Conclusion: Our study suggests that HIV has no influence on the anti-tubercular resistance pattern, but increased MDR rate along with HIV in high TB burden setting stresses the need for early diagnosis and DST in providing proper regimens and improve prognosis.

  18. Detection of 2-eicosanol by gas chromatography-mass spectrometry in sputa from patients with pulmonary mycobacterial infections.

    OpenAIRE

    Alugupalli, S; Olsson, B; Larsson, L.

    1993-01-01

    A total of 96 sputum specimens from patients with suspected or known mycobacterial and nonmycobacterial pulmonary infections were analyzed by gas chromatography-mass spectrometry for the presence of 2-eicosanol. This secondary alcohol was detected in all of the 25 sputum specimens culture positive for Mycobacterium tuberculosis, in 7 of the 9 sputum specimens culture positive for M. avium complex, and in all 3 of the studied sputum specimens associated with M. malmoense. The alcohol was not d...

  19. Functional capacity of Mycobacterium tuberculosis-specific T cell responses in humans is associated with mycobacterial load1

    OpenAIRE

    Day, Cheryl L.; Abrahams, Deborah A.; Lerumo, Lesedi; van Rensburg, Esme Janse; Stone, Lynnett; O’rie, Terrence; Pienaar, Bernadette; de Kock, Marwou; Kaplan, Gilla; Mahomed, Hassan; Dheda, Keertan; Hanekom, Willem A.

    2011-01-01

    High antigen load in chronic viral infections has been associated with impairment of antigen-specific T cell responses; however, the relationship between antigen load in chronic Mycobacterium tuberculosis (Mtb) infection and functional capacity of Mtb-specific T cells in humans is not clear. We compared Mtb-specific T cell-associated cytokine production and proliferative capacity in peripheral blood from adults with progressively higher mycobacterial loads, i.e., persons with latent Mtb infec...

  20. Relationship Between Blood Concentrations of Hepcidin and Anemia Severity, Mycobacterial Burden, and Mortality Among Patients With HIV-Associated Tuberculosis

    OpenAIRE

    Kerkhoff, AD; Meintjes, G.; Burton, R; Vogt, M.; Wood, R.; Lawn, SD

    2015-01-01

    Background Anemia is very common in patients with human immunodeficiency virus (HIV)–associated tuberculosis, and hepcidin may be key in mediating this. We explored the relationship between blood hepcidin concentrations and anemia severity, mycobacterial burden and mortality in patients with HIV-associated tuberculosis. Methods Consecutive unselected HIV-infected adults in South Africa were systematically investigated for tuberculosis. Three groups were studied: 116 hospitalized inpatients wi...

  1. A Mycobacterial Perspective on Tuberculosis in West Africa: Significant Geographical Variation of M. africanum and Other M. tuberculosis Complex Lineages.

    Directory of Open Access Journals (Sweden)

    Florian Gehre

    2016-03-01

    Full Text Available Phylogenetically distinct Mycobacterium tuberculosis lineages differ in their phenotypes and pathogenicity. Consequently, understanding mycobacterial population structures phylogeographically is essential for design, interpretation and generalizability of clinical trials. Comprehensive efforts are lacking to date to establish the West African mycobacterial population structure on a sub-continental scale, which has diagnostic implications and can inform the design of clinical TB trials.We collated novel and published genotyping (spoligotyping data and classified spoligotypes into mycobacterial lineages/families using TBLineage and Spotclust, followed by phylogeographic analyses using statistics (logistic regression and lineage axis plot analysis in GenGIS, in which a phylogenetic tree constructed in MIRU-VNTRplus was analysed. Combining spoligotyping data from 16 previously published studies with novel data from The Gambia, we obtained a total of 3580 isolates from 12 countries and identified 6 lineages comprising 32 families. By using stringent analytical tools we demonstrate for the first time a significant phylogeographic separation between western and eastern West Africa not only of the two M. africanum (West Africa 1 and 2 but also of several major M. tuberculosis sensu stricto families, such as LAM10 and Haarlem 3. Moreover, in a longitudinal logistic regression analysis for grouped data we showed that M. africanum West Africa 2 remains a persistent health concern.Because of the geographical divide of the mycobacterial populations in West Africa, individual research findings from one country cannot be generalized across the whole region. The unequal geographical family distribution should be considered in placement and design of future clinical trials in West Africa.

  2. Rapid Diagnosis of Mycobacterial Infections and Quantitation of Mycobacterium tuberculosis Load by Two Real-Time Calibrated PCR Assays

    Science.gov (United States)

    Broccolo, Francesco; Scarpellini, Paolo; Locatelli, Giuseppe; Zingale, Anna; Brambilla, Anna M.; Cichero, Paola; Sechi, Leonardo A.; Lazzarin, Adriano; Lusso, Paolo; Malnati, Mauro S.

    2003-01-01

    Sensitive and specific techniques to detect and identify Mycobacterium tuberculosis directly in clinical specimens are important for the diagnosis and management of patients with tuberculosis (TB). We developed two real-time PCR assays, based on the IS6110 multicopy element and on the senX3-regX3 intergenic region, which provide a rapid method for the diagnosis of mycobacterial infections. The sensitivity and specificity of both assays were established by using purified DNA from 71 clinical isolates and 121 clinical samples collected from 83 patients, 20 of whom were affected by TB. Both assays are accurate, sensitive, and specific, showing a complementary pattern of Mycobacterium recognition: broader for the IS6110-based assay and restricted to the M. tuberculosis complex for the senX3-regX3-based assay. Moreover, the addition of a synthetic DNA calibrator prior to DNA extraction allowed us to measure the efficiency of DNA recovery and to control for the presence of PCR inhibitors. The mycobacterial burden of the clinical samples, as assessed by direct microscopy, correlates with the M. tuberculosis DNA load measured by the senX3-regX3-based assay. In addition, reduced levels of M. tuberculosis DNA load are present in those patients subjected to successful therapy, suggesting a potential use of this assay for monitoring treatment efficacy. Therefore, these assays represent a fully controlled high-throughput system for the evaluation of mycobacterial burden in clinical specimens. PMID:14532183

  3. Structure of the mycobacterial ATP synthase Fo rotor ring in complex with the anti-TB drug bedaquiline.

    Science.gov (United States)

    Preiss, Laura; Langer, Julian D; Yildiz, Özkan; Eckhardt-Strelau, Luise; Guillemont, Jérôme E G; Koul, Anil; Meier, Thomas

    2015-05-01

    Multidrug-resistant tuberculosis (MDR-TB) is more prevalent today than at any other time in human history. Bedaquiline (BDQ), a novel Mycobacterium-specific adenosine triphosphate (ATP) synthase inhibitor, is the first drug in the last 40 years to be approved for the treatment of MDR-TB. This bactericidal compound targets the membrane-embedded rotor (c-ring) of the mycobacterial ATP synthase, a key metabolic enzyme required for ATP generation. We report the x-ray crystal structures of a mycobacterial c9 ring without and with BDQ bound at 1.55- and 1.7-Å resolution, respectively. The structures and supporting functional assays reveal how BDQ specifically interacts with the rotor ring via numerous interactions and thereby completely covers the c-ring's ion-binding sites. This prevents the rotor ring from acting as an ion shuttle and stalls ATP synthase operation. The structures explain how diarylquinoline chemicals specifically inhibit the mycobacterial ATP synthase and thus enable structure-based drug design of next-generation ATP synthase inhibitors against Mycobacterium tuberculosis and other bacterial pathogens. PMID:26601184

  4. Identification of critical residues of the mycobacterial dephosphocoenzyme a kinase by site-directed mutagenesis.

    Directory of Open Access Journals (Sweden)

    Guneet Walia

    Full Text Available Dephosphocoenzyme A kinase performs the transfer of the γ-phosphate of ATP to dephosphocoenzyme A, catalyzing the last step of coenzyme A biosynthesis. This enzyme belongs to the P-loop-containing NTP hydrolase superfamily, all members of which posses a three domain topology consisting of a CoA domain that binds the acceptor substrate, the nucleotide binding domain and the lid domain. Differences in the enzymatic organization and regulation between the human and mycobacterial counterparts, have pointed out the tubercular CoaE as a high confidence drug target (HAMAP database. Unfortunately the absence of a three-dimensional crystal structure of the enzyme, either alone or complexed with either of its substrates/regulators, leaves both the reaction mechanism unidentified and the chief players involved in substrate binding, stabilization and catalysis unknown. Based on homology modeling and sequence analysis, we chose residues in the three functional domains of the enzyme to assess their contributions to ligand binding and catalysis using site-directed mutagenesis. Systematically mutating the residues from the P-loop and the nucleotide-binding site identified Lys14 and Arg140 in ATP binding and the stabilization of the phosphoryl intermediate during the phosphotransfer reaction. Mutagenesis of Asp32 and Arg140 showed catalytic efficiencies less than 5-10% of the wild type, indicating the pivotal roles played by these residues in catalysis. Non-conservative substitution of the Leu114 residue identifies this leucine as the critical residue from the hydrophobic cleft involved in leading substrate, DCoA binding. We show that the mycobacterial enzyme requires the Mg(2+ for its catalytic activity. The binding energetics of the interactions of the mutant enzymes with the substrates were characterized in terms of their enthalpic and entropic contributions by ITC, providing a complete picture of the effects of the mutations on activity. The properties of

  5. Attenuation of Mycobacterium tuberculosis by Disruption of a mas-Like Gene or a Chalcone Synthase-Like Gene, Which Causes Deficiency in Dimycocerosyl Phthiocerol Synthesis

    OpenAIRE

    Sirakova, Tatiana D.; Dubey, Vinod S.; Cynamon, Michael H.; Kolattukudy, Pappachan E.

    2003-01-01

    Tuberculosis is one of the leading preventable causes of death. Emergence of drug-resistant tuberculosis makes the discovery of new targets for antimycobacterial drugs critical. The unique mycobacterial cell wall lipids are known to play an important role in pathogenesis, and therefore the genes responsible for their biosynthesis offer potential new targets. To assess the possible role of some of the genes potentially involved in cell wall lipid synthesis, we disrupted a mas-like gene, msl7, ...

  6. Thioridazine in PLGA nanoparticles reduces toxicity and improves rifampicin therapy against mycobacterial infection in zebrafish.

    Science.gov (United States)

    Vibe, Carina Beatrice; Fenaroli, Federico; Pires, David; Wilson, Steven Ray; Bogoeva, Vanya; Kalluru, Raja; Speth, Martin; Anes, Elsa; Griffiths, Gareth; Hildahl, Jon

    2016-08-01

    Encapsulating antibiotics such as rifampicin in biodegradable nanoparticles provides several advantages compared to free drug administration, including reduced dosing due to localized targeting and sustained release. Consequently, these characteristics reduce systemic drug toxicity. However, new nanoformulations need to be tested in complex biological systems to fully characterize their potential for improved drug therapy. Tuberculosis, caused by infection with the bacterium Mycobacterium tuberculosis, requires lengthy and expensive treatment, and incomplete therapy contributes to an increasing incidence of drug resistance. Recent evidence suggests that standard therapy may be improved by combining antibiotics with bacterial efflux pump inhibitors, such as thioridazine. However, this drug is difficult to use clinically due to its toxicity. Here, we encapsulated thioridazine in poly(lactic-co-glycolic) acid nanoparticles and tested them alone and in combination with rifampicin nanoparticles, or free rifampicin in macrophages and in a zebrafish model of tuberculosis. Whereas free thioridazine was highly toxic in both cells and zebrafish embryos, after encapsulation in nanoparticles no toxicity was detected. When combined with rifampicin nanoparticles, the nanoparticles loaded with thioridazine gave a modest increase in killing of both Mycobacterium bovis BCG and M. tuberculosis in macrophages. In the zebrafish, the thioridazine nanoparticles showed a significant therapeutic effect in combination with rifampicin by enhancing embryo survival and reducing mycobacterial infection. Our results show that the zebrafish embryo is a highly sensitive indicator of drug toxicity and that thioridazine nanoparticle therapy can improve the antibacterial effect of rifampicin in vivo. PMID:26573343

  7. Nosocomial rapidly growing mycobacterial infections following laparoscopic surgery: CT imaging findings

    Energy Technology Data Exchange (ETDEWEB)

    Volpato, Richard [Cassiano Antonio de Moraes University Hospital, Department of Diagnostic Radiology, Vitoria, ES (Brazil); Campi de Castro, Claudio [University of Sao Paulo Medical School, Department of Radiology, Cerqueira Cesar, Sao Paulo (Brazil); Hadad, David Jamil [Cassiano Antonio de Moraes University Hospital, Nucleo de Doencas Infecciosas, Department of Internal Medicine, Vitoria, ES (Brazil); Silva Souza Ribeiro, Flavya da [Laboratorio de Patologia PAT, Department of Diagnostic Radiology, Unit 1473, Vitoria, ES (Brazil); Filho, Ezequiel Leal [UNIMED Diagnostico, Department of Diagnostic Radiology, Unit 1473, Vitoria, ES (Brazil); Marcal, Leonardo P. [The University of Texas M D Anderson Cancer Center, Department of Diagnostic Radiology, Unit 1473, Houston, TX (United States)

    2015-09-15

    To identify the distribution and frequency of computed tomography (CT) findings in patients with nosocomial rapidly growing mycobacterial (RGM) infection after laparoscopic surgery. A descriptive retrospective study in patients with RGM infection after laparoscopic surgery who underwent CT imaging prior to initiation of therapy. The images were analyzed by two radiologists in consensus, who evaluated the skin/subcutaneous tissues, the abdominal wall, and intraperitoneal region separately. The patterns of involvement were tabulated as: densification, collections, nodules (≥1.0 cm), small nodules (<1.0 cm), pseudocavitated nodules, and small pseudocavitated nodules. Twenty-six patients met the established criteria. The subcutaneous findings were: densification (88.5 %), small nodules (61.5 %), small pseudocavitated nodules (23.1 %), nodules (38.5 %), pseudocavitated nodules (15.4 %), and collections (26.9 %). The findings in the abdominal wall were: densification (61.5 %), pseudocavitated nodules (3.8 %), and collections (15.4 %). The intraperitoneal findings were: densification (46.1 %), small nodules (42.3 %), nodules (15.4 %), and collections (11.5 %). Subcutaneous CT findings in descending order of frequency were: densification, small nodules, nodules, small pseudocavitated nodules, pseudocavitated nodules, and collections. The musculo-fascial plane CT findings were: densification, collections, and pseudocavitated nodules. The intraperitoneal CT findings were: densification, small nodules, nodules, and collections. (orig.)

  8. Mycobacterial PE/PPE Proteins at the Host-Pathogen Interface

    Science.gov (United States)

    Sampson, Samantha L.

    2011-01-01

    The mycobacterial PE/PPE proteins have attracted much interest since their formal identification just over a decade ago. It has been widely speculated that these proteins may play a role in evasion of host immune responses, possibly via antigenic variation. Although a cohesive understanding of their function(s) has yet to be established, emerging data increasingly supports a role for the PE/PPE proteins at multiple levels of the infectious process. This paper will delineate salient features of the families revealed by comparative genomics, bioinformatic analyses and genome-wide screening approaches and will summarise existing knowledge of subcellular localization, secretion pathways, and protein structure. These characteristics will be considered in light of findings on innate and adaptive host responses to PE/PPE proteins, and we will review the increasing body of data on B and T cell recognition of these proteins. Finally, we will consider how current knowledge and future explorations may contribute to a more comprehensive understanding of these intriguing proteins and their involvement in host pathogen interactions. Ultimately this information could underpin future intervention strategies, for example, in the area of new and improved diagnostic tools and vaccine candidates. PMID:21318182

  9. Dynamics based pharmacophore models for screening potential inhibitors of mycobacterial cyclopropane synthase.

    Science.gov (United States)

    Choudhury, Chinmayee; Priyakumar, U Deva; Sastry, G Narahari

    2015-04-27

    The therapeutic challenges in the treatment of tuberculosis demand multidisciplinary approaches for the identification of potential drug targets as well as fast and accurate techniques to screen huge chemical libraries. Mycobacterial cyclopropane synthase (CmaA1) has been shown to be essential for the survival of the bacteria due to its critical role in the synthesis of mycolic acids. The present study proposes pharmacophore models based on the structure of CmaA1 taking into account its various states in the cyclopropanation process, and their dynamic nature as assessed using molecular dynamics (MD) simulations. The qualities of these pharmacophore models were validated by mapping 23 molecules that have been previously reported to exhibit inhibitory activities on CmaA1. Additionally, 1398 compounds that have been shown to be inactive for tuberculosis were collected from the ChEMBL database and were screened against the models for validation. The models were further validated by comparing the results from pharmacophore mapping with the results obtained from docking these molecules with the respective protein structures. The best models are suggested by validating all the models based on their screening abilities and by comparing with docking results. The models generated from the MD trajectories were found to perform better than the one generated based on the crystal structure demonstrating the importance of incorporating receptor flexibility in drug design.

  10. Efflux pump inhibitors: targeting mycobacterial efflux systems to enhance TB therapy.

    Science.gov (United States)

    Pule, Caroline M; Sampson, Samantha L; Warren, Robin M; Black, Philippa A; van Helden, Paul D; Victor, Tommie C; Louw, Gail E

    2016-01-01

    The emergence of drug resistance continues to plague TB control, with a global increase in the prevalence of MDR-TB. This acts as a gateway to XDR-TB and thus emphasizes the urgency for drug development and optimal treatment options. Bedaquiline is the first new anti-TB drug approved by the FDA in 40 years and has been shown to be an effective treatment option for MDR Mycobacterium tuberculosis infection. Bedaquiline has also recently been included in clinical trials for new regimens with the aim of improving and shortening treatment periods. Alarmingly, efflux-mediated bedaquiline resistance, as well as efflux-mediated cross-resistance to clofazimine, has been identified in treatment failures. This mechanism of resistance results in efflux of a variety of anti-TB drugs from the bacterial cell, thereby decreasing the intracellular drug concentration. In doing so, the bacillus is able to render the antibiotic treatment ineffective. Recent studies have explored strategies to reverse the resistance phenotype conferred by efflux pump activation. It was observed that the addition of efflux pump inhibitors partially restored drug susceptibility in vitro and in vivo. This has significant clinical implications, especially in MDR-TB management where treatment options are extremely limited. This review aims to highlight the current efflux pump inhibitors effective against M. tuberculosis, the effect of efflux pump inhibitors on mycobacterial growth and the clinical promise of treatment with efflux pump inhibitors and standard anti-TB therapy. PMID:26472768

  11. 分枝杆菌膜锚定表达载体的构建与亚细胞定位分析%The construction and sub-cellular localization analysis of novel mycobacterial membrane-anchored expression vector

    Institute of Scientific and Technical Information of China (English)

    王鑫; 范小勇; 马辉; 曲勍; 朱越雄

    2011-01-01

    Objective To construct mycobacterial membrane-anchored expression vector and to analyze expression level and sub-cellualr localization of exogenous target protein. Methods Based on the mycobacterial intracellular expression vector pMFA42 which contained a strong promoter of pfurAma mutant, the signal sequence of Mycobacterium tuberculosis(Mtb) 19×103 lipoprotein (19SS) was synthesized and was then cloned into the downstream of pfurAma mutant to generate the mycobacterial membrane-anchored expression vector pMFA42M. The coding gene of enhanced green fluorescent protein(EGFP) was amplified by PCR, and then sub-cloned into these two vectors described above to construct recombinant EGFP fused and membrane-anchored strains, respectively. The coding genes of Mtb immuno-dominant antigens Ag85A and its chimera Ag856A2 were then sub-cloned intothe membrane-anchored construct pMFA42MG to produce recombinant Mtb antigen EGFP fused-expression strains. After that, expression levels and sub-cellualr localization of exogenous target protein were further analyzed by Western blot and flow cytometry sorting(FCS), and the fluorescence intensities of recombinant EGFP- expressed strains were observed in vitro directly and after transfection of murine macrophage cell line RAW264.7. Results The novel mycobacterial membrane-anchored expression vector was constructed successfully by introduction of signal sequence of Mtb 19×103 lipoprotein. Using of EGFP as model antigen, exogenous target protein was demonstrated to be expressed with high level and could be anchored into cell membrane of recombinant mycobaterial strains. Conclusion A novel mycobacterial membrane-anchored expression vector was constructed successfully to research recombinant BCG and functions of mycobacterial membrane proteins, and the constructed EGFP-expressed recombinant strains could also be used to research cytophagy in cell model and mycobacterial colony and translocation in animal immunization as model indicator

  12. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  13. Detection of Mycobacterium bovis and Mycobacterium tuberculosis from Cattle: Possible Public Health Relevance

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Sharma, Mandeep; Katoch, Vipin C.;

    2012-01-01

    Mycobacterium bovis and Mycobacterium tuberculosis infect both animals and humans. The disease epidemiology by these agents differs in developed and developing countries due to the differences in the implementation of the prevention and control strategies. The present study describes the detection...... of M. bovis and M. tuberculosis from specimens of lungs and pulmonary lymph nodes of four cattle died in an organized herd of 183 cattle in the state of Himachal Pradesh, India, with inconclusive skin test results. Identification and distinction of these closely related mycobacterial species was done...... by PCR-RFLP targeting hsp65 gene followed by spacer oligonucleotide typing. Mixed infection of M. bovis and M. tuberculosis was detected in one cattle....

  14. CUTANEOUS MYCOBACTERIUM MARINUM INFECTION DIAGNOSED BY PCR-RFLP ANALYSIS

    Institute of Scientific and Technical Information of China (English)

    LI Xiao-jie; WANG Hong-sheng; TAO Shi-qin; WU Qin-xue; LIU Wei-da

    2009-01-01

    Objective To identify Mycobacterium marinum (M. marinum) inducing misdiagnosis and treatment failure.Methods The lesional specimen of patient with cutaneous M. marinum were cultivated on Lwenstein-Jensen medium. The isolate was identified by biochemical tests and polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) analysis of the hsp65 gene.Results Smooth and non-pigmented colonies were noted after incubation at 32 ℃ for 2 weeks. The isolate was acid-fast bacilli and confirmed as M. marinum by biochemical tests and PCR-RFLP.Conclusion For a correct diagnosis of cutaneous M. marinum infection, it is crucial for clinicians to have a high index of suspicion, obtain the history of exposure and trauma and understand growth characteristics of the organism. Compared with conventional biochemical techniques, PCR-RFLP analysis is a more rapid, accurate and reliable method for mycobacterial identification to species level.

  15. Expression and Immunogenicity of the Mycobacterial Ag85B/ESAT-6 Antigens Produced in Transgenic Plants by Elastin-Like Peptide Fusion Strategy

    Directory of Open Access Journals (Sweden)

    Doreen Manuela Floss

    2010-01-01

    Full Text Available This study explored a novel system combining plant-based production and the elastin-like peptide (ELP fusion strategy to produce vaccinal antigens against tuberculosis. Transgenic tobacco plants expressing the mycobacterial antigens Ag85B and ESAT-6 fused to ELP (TBAg-ELP were generated. Purified TBAg-ELP was obtained by the highly efficient, cost-effective, inverse transition cycling (ICT method and tested in mice. Furthermore, safety and immunogenicity of the crude tobacco leaf extracts were assessed in piglets. Antibodies recognizing mycobacterial antigens were produced in mice and piglets. A T-cell immune response able to recognize the native mycobacterial antigens was detected in mice. These findings showed that the native Ag85B and ESAT-6 mycobacterial B- and T-cell epitopes were conserved in the plant-expressed TBAg-ELP. This study presents the first results of an efficient plant-expression system, relying on the elastin-like peptide fusion strategy, to produce a safe and immunogenic mycobacterial Ag85B-ESAT-6 fusion protein as a potential vaccine candidate against tuberculosis.

  16. CT findings of mycobacterial infection other than tuberculosis : comparison with tuberculosis

    International Nuclear Information System (INIS)

    To compare the CT findings of mycobacterial infection other than tuberculosis (MOTT) with those of tuberculosis (TB). The chest CT scans of 30 immunocompetent patients with culture-proven pulmonary MOTT (M:F =3D 11:19); mean age, 51.2 yrs.) and of 24 patients with active tuberculosis (M:F 12:12; mean age, 42.5 yrs.) were analyzed by two radiologists; decisions were reached by consensus. Common findings for both MOTT and TB included brochogenically-spread bronchogenic spread nodular lesion (93.3% for MOTT, 100% for TB), bronchiectasis (90%, 83.3%), bronchial wall thickening (66.7%, 54.2%), granuloma (63.3%, 75%), parenchymal scarring (53.3%, 54.2%), and mediastinal lymphadenopathy (50%, 37.5%). Less commonly observed findings were emphysema (46.7%, 29.7%), atelectasis (36.7%, 29.2%), narrowing of a major airway (23.3%, 25%), consolidation (23.3%, 29.2%)and pleural disease (16.7%, 29.2%). Except for cavity (30%, 53.3%; P less than 0.05), the frequencies of each finding were not different between the two groups. A lobe-matched frequency comparison showed that only bronchiectasis in the right middle lobe (40%, 16.7%), right lower lobe (63.3%, 33.3%) and lingula division (53.3%, 25%) was significantly more common in MOTT than in TB (p less than 0.05). The number of lobes in which bronchiectasis and bronchial wall thickening were involved was greater in MOTT (3.20) than in TB (2.04) (p=3D 0.011). Although the CT findings of MOTT and TB overlap considerably, cavities are more common in TB, while in MOTT, bronchiectasis in the lower lung zone is more common and bronchiectasis tends to be more extensive. (author)

  17. Optimizing Mycobacterial Culture in Smear-Negative, Human Immunodeficiency Virus-Infected Tuberculosis Cases.

    Directory of Open Access Journals (Sweden)

    N A Ismail

    Full Text Available Tuberculosis (TB is a significant public health problem and the diagnosis in human immunodeficiency virus (HIV-infected individuals is challenging. The use of mycobacterial culture remains an important complementary tool and optimizing it has important benefits. We sought to determine the effect of an increase in the number of specimens evaluated, addition of nutritional supplementation to the culture medium, sputum appearance and volume on diagnostic yield and time to detection of pulmonary TB among smear-negative, HIV-infected adults.In this prospective study conducted at the Tshwane District Hospital and Academic TB Laboratory, Pretoria, South Africa we collected three sputum specimens an hour apart from presumptive TB cases at an antiretroviral treatment site. We analysed specimens from 236 patients. Specimen appearance and volume were recorded. All specimens were processed for culture using both standard and supplemented media.A single specimen identified 79% of PTB cases using standard media; the second and third specimens added 12.5% and 8.3% respectively. Media supplementation, sputum appearance and specimen volume had no effect on culture yield or contamination rates. The mean time to detection was reduced from 19.8 days in standard cultures to 11.8 days in nutrient supplemented cultures (p = 0.002. For every 1 ml increase in sputum volume, time to detection was decreased by a factor of 0.797 (p = 0.011.Use of an inexpensive culture supplement substantially reduced time to detection and could contribute to reducing treatment delay among HIV-infected cases.

  18. Bacillus calmette-guerin infection in NADPH oxidase deficiency: defective mycobacterial sequestration and granuloma formation.

    Directory of Open Access Journals (Sweden)

    Christine Deffert

    2014-09-01

    Full Text Available Patients with chronic granulomatous disease (CGD lack generation of reactive oxygen species (ROS through the phagocyte NADPH oxidase NOX2. CGD is an immune deficiency that leads to frequent infections with certain pathogens; this is well documented for S. aureus and A. fumigatus, but less clear for mycobacteria. We therefore performed an extensive literature search which yielded 297 cases of CGD patients with mycobacterial infections; M. bovis BCG was most commonly described (74%. The relationship between NOX2 deficiency and BCG infection however has never been studied in a mouse model. We therefore investigated BCG infection in three different mouse models of CGD: Ncf1 mutants in two different genetic backgrounds and Cybb knock-out mice. In addition, we investigated a macrophage-specific rescue (transgenic expression of Ncf1 under the control of the CD68 promoter. Wild-type mice did not develop severe disease upon BCG injection. In contrast, all three types of CGD mice were highly susceptible to BCG, as witnessed by a severe weight loss, development of hemorrhagic pneumonia, and a high mortality (∼ 50%. Rescue of NOX2 activity in macrophages restored BCG resistance, similar as seen in wild-type mice. Granulomas from mycobacteria-infected wild-type mice generated ROS, while granulomas from CGD mice did not. Bacterial load in CGD mice was only moderately increased, suggesting that it was not crucial for the observed phenotype. CGD mice responded with massively enhanced cytokine release (TNF-α, IFN-γ, IL-17 and IL-12 early after BCG infection, which might account for severity of the disease. Finally, in wild-type mice, macrophages formed clusters and restricted mycobacteria to granulomas, while macrophages and mycobacteria were diffusely distributed in lung tissue from CGD mice. Our results demonstrate that lack of the NADPH oxidase leads to a markedly increased severity of BCG infection through mechanisms including increased cytokine

  19. CT findings of mycobacterial infection other than tuberculosis : comparison with tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Chang Jin; Goo, Jin Mo; Seo, Joon Beom; Kim, Se Hyung; Im, Jung Gi [College of Medicine and the Institute of Radiation Medicine, Seoul National University, Seoul (Korea, Republic of)

    2000-03-01

    To compare the CT findings of mycobacterial infection other than tuberculosis (MOTT) with those of tuberculosis (TB). The chest CT scans of 30 immunocompetent patients with culture-proven pulmonary MOTT (M:F =3D 11:19; mean age, 51.2 yrs.) and of 24 patients with active tuberculosis (M:F 12:12; mean age, 42.5 yrs.) were analyzed by two radiologists; decisions were reached by consensus. Common findings for both MOTT and TB included brochogenically-spread bronchogenic spread nodular lesion (93.3% for MOTT, 100% for TB), bronchiectasis (90%, 83.3%), bronchial wall thickening (66.7%, 54.2%), granuloma (63.3%, 75%), parenchymal scarring (53.3%, 54.2%), and mediastinal lymphadenopathy (50%, 37.5%). Less commonly observed findings were emphysema (46.7%, 29.7%), atelectasis (36.7%, 29.2%), narrowing of a major airway (23.3%, 25%), consolidation (23.3%, 29.2%)and pleural disease (16.7%, 29.2%). Except for cavity (30%, 53.3%; P less than 0.05), the frequencies of each finding were not different between the two groups. A lobe-matched frequency comparison showed that only bronchiectasis in the right middle lobe (40%, 16.7%), right lower lobe (63.3%, 33.3%) and lingula division (53.3%, 25%) was significantly more common in MOTT than in TB (p less than 0.05). The number of lobes in which bronchiectasis and bronchial wall thickening were involved was greater in MOTT (3.20) than in TB (2.04) (p=3D 0.011). Although the CT findings of MOTT and TB overlap considerably, cavities are more common in TB, while in MOTT, bronchiectasis in the lower lung zone is more common and bronchiectasis tends to be more extensive. (author)

  20. T-Cell Recognition of Mycobacterial GroES Peptides in Thai Leprosy Patients and Contacts

    Science.gov (United States)

    Chua-Intra, Boosbun; Peerapakorn, Somchai; Davey, Nick; Jurcevic, Stipo; Busson, Marc; Vordermeier, H. Martin; Pirayavaraporn, Charoon; Ivanyi, Juraj

    1998-01-01

    We report here the mapping of T-cell-stimulatory determinants of the GroES 10-kDa heat shock protein homologues from Mycobacterium leprae and Mycobacterium tuberculosis, which are known as major immunogens in mycobacterial infections. Peripheral blood mononuclear cells (PBMC) from treated tuberculoid leprosy or lepromatous leprosy patients and from healthy household or hospital staff contacts of the patients were cultured with 20 16-mer peptides covering the entire sequences of both M. leprae and M. tuberculosis GroES. The total number of recognized peptides was found to be the largest in family contacts, while responder frequencies to the individual tested peptides varied (5 to 80%) with specificity between the patient and contact groups. Proliferative responses to some peptides showed positive or negative associations of low statistical significance with DR and DQ alleles, though responses to most GroES peptides were genetically permissive. Notably, the sequence of the 25–40 peptide of M. leprae, but not that of M. tuberculosis, was more frequently stimulatory in tuberculoid leprosy patients than in either group of sensitized healthy contacts. This peptide bound to a number of HLA-DR molecules, of which HLA-DRB5*0101 had the strongest affinity. The epitope core binding to this allele was localized to the 29-to-37 sequence, and its key residue was localized to the M. leprae-specific glutamic acid at position 32. This epitope may be of interest for the development of a blood test- or skin test-based diagnostic reagent for tuberculoid leprosy, subject to further clinical evaluation in untreated patients. PMID:9746595

  1. Dynamic ligand-based pharmacophore modeling and virtual screening to identify mycobacterial cyclopropane synthase inhibitors

    Indian Academy of Sciences (India)

    CHINMAYEE CHOUDHURY; U DEVA PRIYAKUMAR; G NARAHARI SASTRY

    2016-05-01

    Multidrug resistance in Mycobacterium tuberculosis (M. Tb) and its coexistence with HIV arethe biggest therapeutic challenges in anti-M. Tb drug discovery. The current study reports a Virtual Screening(VS) strategy to identify potential inhibitors of Mycobacterial cyclopropane synthase (CmaA1), an importantM. Tb target considering the above challenges. Five ligand-based pharmacophore models were generatedfrom 40 different conformations of the cofactors of CmaA1 taken from molecular dynamics (MD) simulationstrajectories of CmaA1. The screening abilities of these models were validated by screening 23 inhibitors and1398 non-inhibitors of CmaA1. A VS protocol was designed with four levels of screening i.e., ligand-basedpharmacophore screening, structure-based pharmacophore screening, docking and absorption, distribution,metabolism, excretion and the toxicity (ADMET) filters. In an attempt towards repurposing the existing drugsto inhibit CmaA1, 6,429 drugs reported in DrugBank were considered for screening. To find compounds thatinhibit multiple targets of M. Tb as well as HIV, we also chose 701 and 11,109 compounds showing activitybelow 1 μM range on M. Tb and HIV cell lines, respectively, collected from ChEMBL database. Thus, a totalof 18,239 compounds were screened against CmaA1, and 12 compounds were identified as potential hits forCmaA1 at the end of the fourth step. Detailed analysis of the structures revealed these compounds to interactwith key active site residues of CmaA1.

  2. Characterization of the Mycobacterial AdnAB DNA Motor Provides Insights into the Evolution of Bacterial Motor-Nuclease Machines*

    OpenAIRE

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2009-01-01

    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (kcat 415 s−1), and the affinity of the motor for the ssDNA cofa...

  3. Mechanism of the adjuvant activity of the synthetic mycobacterial cord factor analog Trehalose-6,6-dibehenate (TDB)

    OpenAIRE

    Althaus, Kerstin

    2010-01-01

    The mechanism behind the adjuvant activity of the mycobacterial cord factor TDM and its synthetic analog TDB as a component of the new adjuvant system CAF01 was investigated and compared to the TLR9 ligand CpG. In vitro, TDB and TDM potently activate antigen-presenting cells via a Myd88 and TLR independent, but FcRg-Syk-Card9 dependent signaling pathway. Microarray analysis indicated that in macrophages, TDB induced genome-wide transcriptional responses similar to the Dectin-1 ligand Curdlan ...

  4. Mincle is essential for recognition and adjuvanticity of the mycobacterial cord factor and its synthetic analogue trehalose-dibehenate1

    OpenAIRE

    Schoenen, Hanne; Bodendorfer, Barbara; Hitchens, Kelly; Manzanero, Silvia; Werninghaus, Kerstin; Nimmerjahn, Falk; Agger, Else Marie; Stenger, Steffen; Andersen, Peter; Ruland, Jürgen; Brown, Gordon D.; Wells, Christine; Lang, Roland

    2010-01-01

    The mycobacterial cord factor trehalose-6,6-dimycolate (TDM) and its synthetic analogue trehalose-6,6-dibehenate (TDB) are potent adjuvants for Th1/Th17 vaccination that activate Syk-Card9 signaling in antigen presenting cells. Here, we have further investigated the molecular mechanism of innate immune activation by TDM and TDB. The Syk-coupling adapter protein Fc receptor gamma chain (FcRγ) was essential for macrophage activation and Th17 adjuvanticity. The FcRγ-associated C-type lectin rece...

  5. Anti-mycobacterial screening of five Indian medicinal plants and partial purification of active extracts of Cassia sophera and Urtica dioica

    Institute of Scientific and Technical Information of China (English)

    Rambir Singh; Shariq Hussain; Rajesh Verma; Poonam Sharma

    2013-01-01

    Objective: To find out the anti-mycobacterial potential of Cassia sophera (C. sophera), Urticadioica (U. dioica), Momordica dioica, Tribulus terrestris and Coccinia indica plants against multi-drug resistant (MDR) strain of Mycobacterium tuberculosis (M. tuberculosis). Methods: Plant materials were extracted successively with solvents of increasing polarity. Solvent extracts were screened for anti-mycobacterial activity against fast growing, non-pathogenic mycobacterium strain, Mycobacterium semegmatis, by disk diffusion method. The active extracts were tested against MDR and clinical isolates of M. tuberculosis by absolute concentration and proportion methods. The active extracts were subjected to bio-autoassay on TLC followed by silica column chromatography for isolation of potential drug leads. Results: Hexane extract of U. dioica (HEUD) and methanol extract of C. sophera (MECS) produced inhibition zone of 20 mm in disc diffusion assay and MIC of 250 and 125 μg/mL respectively in broth dilution assay against Mycobacteriumsemegmatis. Semipurified fraction F2 from MECS produced 86% inhibition against clinical isolate and 60% inhibition against MDR strain of M. tuberculosis. F18 from HEUD produced 81% inhibition against clinical isolate and 60% inhibition against MDR strain of M. tuberculosis. Phytochemical analysis indicated that anti-mycobacterial activity of MECS may be due to presence of alkaloids or flavonoids and that of HEUD due to terpenoids. Conclusions: C. sophera and U. dioica plant extracts exhibited promising anti-mycobacterial activity against MDR strain of M. tuberculosis. This is the first report of anti-mycobacterial activity form C. sophera. This study showed possibility of purifying novel anti-mycobacterial compound(s) from C. sophera and U. dioica.

  6. Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)*

    OpenAIRE

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2010-01-01

    Mycobacterial AdnAB is a heterodimeric DNA helicase-nuclease and 3′ to 5′ DNA translocase implicated in the repair of double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal motor domain and a C-terminal nuclease domain. Inclusion of mycobacterial single strand DNA-binding protein (SSB) in reactions containing linear plasmid dsDNA allowed us to study the AdnAB helicase under conditions in which the unwound single strands are coated by SSB and thereby prevent...

  7. DNA-Launched Alphavirus Replicons Encoding a Fusion of Mycobacterial Antigens Acr and Ag85B Are Immunogenic and Protective in a Murine Model of TB Infection.

    Directory of Open Access Journals (Sweden)

    Neha Dalmia

    Full Text Available There is an urgent need for effective prophylactic measures against Mycobacterium tuberculosis (Mtb infection, particularly given the highly variable efficacy of Bacille Calmette-Guerin (BCG, the only licensed vaccine against tuberculosis (TB. Most studies indicate that cell-mediated immune responses involving both CD4+ and CD8+ T cells are necessary for effective immunity against Mtb. Genetic vaccination induces humoral and cellular immune responses, including CD4+ and CD8+ T-cell responses, against a variety of bacterial, viral, parasitic and tumor antigens, and this strategy may therefore hold promise for the development of more effective TB vaccines. Novel formulations and delivery strategies to improve the immunogenicity of DNA-based vaccines have recently been evaluated, and have shown varying degrees of success. In the present study, we evaluated DNA-launched Venezuelan equine encephalitis replicons (Vrep encoding a novel fusion of the mycobacterial antigens α-crystallin (Acr and antigen 85B (Ag85B, termed Vrep-Acr/Ag85B, for their immunogenicity and protective efficacy in a murine model of pulmonary TB. Vrep-Acr/Ag85B generated antigen-specific CD4+ and CD8+ T cell responses that persisted for at least 10 wk post-immunization. Interestingly, parenterally administered Vrep-Acr/Ag85B also induced T cell responses in the lung tissues, the primary site of infection, and inhibited bacterial growth in both the lungs and spleens following aerosol challenge with Mtb. DNA-launched Vrep may, therefore, represent an effective approach to the development of gene-based vaccines against TB, particularly as components of heterologous prime-boost strategies or as BCG boosters.

  8. Tratamiento antirretroviral en pacientes con sida y micobacteriosis Anti-retroviral treatment in patients with AIDS and mycobacterial diseases

    Directory of Open Access Journals (Sweden)

    Marcelo E. Corti

    2005-08-01

    Full Text Available La tuberculosis y otras micobacteriosis constituyen asociaciones o coinfecciones frecuentes en pacientes con sida y se asocian con una elevada mortalidad. En esta revisión se actualizan los tratamientos de las principales enfermedades micobacterianas asociadas al sida (tuberculosis y micobacteriosis por Mycobacterium avium, con especial énfasis en las interacciones farmacológicas entre antimicobacterianos, principalmente rifampicina y claritromicina, y fármacos antirretrovirales. Se analizan los esquemas de tratamiento, su duración, la quimioprofilaxis primaria y secundaria y el momento óptimo de iniciación del tratamiento antirretroviral. Finalmente se describe el síndrome inflamatorio de reconstitución inmune y su tratamiento.Tuberculosis and other mycobacterial diseases are frequent coinfections in AIDS patients with an increased related mortality. In this review we have updated the treatment of the main mycobacterial diseases (tuberculosis and Mycobacterium avium disease, under the scope of pharmacological interactions between antimycobacterial drugs, specially rifampicin and clarithromycin, and anti-retroviral drugs. Antimycobacterial treatment schemes, their duration, primary and secondary chemoprophylaxis and the optimal time to start the anti-retroviral therapy are analized. Finally, the immnune reconstitution inflammatory syndrome and its treatment are discussed.

  9. Mycobacterial secretion systems ESX-1 and ESX-5 play distinct roles in host cell death and inflammasome activation

    KAUST Repository

    Abdallah, Abdallah

    2011-09-28

    During infection of humans and animals, pathogenic mycobacteria manipulate the host cell causing severe diseases such as tuberculosis and leprosy. To understand the basis of mycobacterial pathogenicity, it is crucial to identify the molecular virulence mechanisms. In this study, we address the contribution of ESX-1 and ESX-5 - two homologous type VII secretion systems of mycobacteria that secrete distinct sets of immune modulators - during the macrophage infection cycle. Using wild-type, ESX-1- and ESX-5-deficient mycobacterial strains, we demonstrate that these secretion systems differentially affect subcellular localization and macrophage cell responses. We show that in contrast to ESX-1, the effector proteins secreted by ESX-5 are not required for the translocation of Mycobacterium tuberculosis or Mycobacterium marinum to the cytosol of host cells. However, the M. marinum ESX-5 mutant does not induce inflammasome activation and IL-1b activation. The ESX-5 system also induces a caspase-independent cell death after translocation has taken place. Importantly, by means of inhibitory agents and small interfering RNA experiments, we reveal that cathepsin B is involved in both the induction of cell death and inflammasome activation upon infection with wild-type mycobacteria. These results reveal distinct roles for two different type VII secretion systems during infection and shed light on how virulent mycobacteria manipulate the host cell in various ways to replicate and spread. Copyright © 2011 by The American Association of Immunologists, Inc.

  10. Fasciola hepatica infection reduces Mycobacterium bovis burden and mycobacterial uptake and suppresses the pro-inflammatory response.

    Science.gov (United States)

    Garza-Cuartero, L; O'Sullivan, J; Blanco, A; McNair, J; Welsh, M; Flynn, R J; Williams, D; Diggle, P; Cassidy, J; Mulcahy, G

    2016-07-01

    Bovine tuberculosis (BTB), caused by Mycobacterium bovis, has an annual incidence in cattle of 0.5% in the Republic of Ireland and 4.7% in the UK, despite long-standing eradication programmes being in place. Failure to achieve complete eradication is multifactorial, but the limitations of diagnostic tests are significant complicating factors. Previously, we have demonstrated that Fasciola hepatica infection, highly prevalent in these areas, induced reduced sensitivity of the standard diagnostic tests for BTB in animals co-infected with F. hepatica and M. bovis. This was accompanied by a reduced M. bovis-specific Th1 immune response. We hypothesized that these changes in co-infected animals would be accompanied by enhanced growth of M. bovis. However, we show here that mycobacterial burden in cattle is reduced in animals co-infected with F. hepatica. Furthermore, we demonstrate a lower mycobacterial recovery and uptake in blood monocyte-derived macrophages (MDM) from F. hepatica-infected cattle which is associated with suppression of pro-inflammatory cytokines and a switch to alternative activation of macrophages. However, the cell surface expression of TLR2 and CD14 in MDM from F. hepatica-infected cattle is increased. These findings reflecting the bystander effect of helminth-induced downregulation of pro-inflammatory responses provide insights to understand host-pathogen interactions in co-infection.

  11. Analytical performance of the Roche LightCycler® Mycobacterium Detection Kit for the diagnosis of clinically important mycobacterial species.

    Directory of Open Access Journals (Sweden)

    Shaheed V Omar

    Full Text Available BACKGROUND: The LightCycler® Mycobacterium Detection Kit based on real-time PCR technology for the detection of Mycobacterium tuberculosis, Mycobacterium avium and Mycobacterium kansasii was recently developed. This study evaluated its analytical sensitivity, specificity and reproducibility. METHODOLOGY/PRINCIPAL FINDINGS: Plasmid standards were prepared and used to determine the limit of detection. The assay was also performed against organisms other than mycobacteria, other mycobacterial strains and interfering substances to exclude cross-reactivity and interference. Reference standards were prepared and tested to assess the assay's reproducibility. All PCR assays were performed using the LightCycler® 2.0 Instrument. The detection limit for M. tuberculosis was 28 copies per microlitre. Neither cross-reactivity nor interference occurred with non-mycobacterial organisms and substances tested. Overall reproducibility for consecutive measurements, run-to-run, lot-to-lot, day-to-day and laboratory-to-laboratory achieved a coefficient of variance of less than two percent. SIGNIFICANCE: The LightCycler® Mycobacterium Detection kit has shown to be a robust and accurate assay with the potential to be used as a rapid TB diagnostic test.

  12. Mycobacterial infection in Northern snakehead (Channa argus) from the Potomac River catchment

    Science.gov (United States)

    Densmore, Christine L.; Iwanowicz, L.R.; Henderson, A.P.; Iwanowicz, D.D.; Odenkirk, J.S.

    2016-01-01

    The Northern snakehead, Channa argus (Cantor), is a non-native predatory fish that has become established regionally in some temperate freshwater habitats within the United States. Over the past decade, Northern snakehead populations have developed within aquatic ecosystems throughout the eastern USA, including the Potomac River system within Virginia, Maryland and Washington, D.C. Since this species was initially observed in this region in 2002, the population has expanded considerably (Odenkirk & Owens 2007). In the Chesapeake Bay watershed, populations of Northern snakehead exist in the lower Potomac River and Rappahannock Rivers on the Western shore of the Bay, and these fish have also been found in middle or upper reaches of river systems on the Eastern shore of the Bay, including the Nanticoke and Wicomico Rivers among others. Over the past several years, many aspects of Northern snakehead life history in the Potomac River have been described, including range and dispersal patterns, microhabitat selection and diet (Lapointe, Thorson & Angermeier 2010; Saylor, Lapointe & Angermeier 2012; Lapointe, Odenkirk & Angermeier 2013). However, comparatively little is known about their health status including susceptibility to parasitism and disease and their capacity to serve as reservoirs of disease for native wildlife. Although considered hardy by fisheries biologists, snakehead fish have demonstrated susceptibility to a number of described piscine diseases within their native range and habitat in Asia. Reported pathogens of significance in snakehead species in Asia include snakehead rhabdovirus (Lio-Po et al. 2000), aeromonad bacteria (Zheng, Cao & Yang 2012), Nocardia (Wang et al. 2007) andMycobacterium spp. (Chinabut, Limsuwan & Chantatchakool 1990; ). Mycobacterial isolates recovered from another snakehead species (Channa striata) in the previous studies have included M. marinum and M. fortuitum, as identified through molecular

  13. Comparative Ser/Thr/Tyr phosphoproteomics between two Mycobacterial species: The fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG.

    Directory of Open Access Journals (Sweden)

    Kehilwe Confidence Nakedi

    2015-04-01

    Full Text Available Ser/Thr/Tyr protein phosphorylation plays a critical role in regulating mycobacterial growth and development. Understanding the mechanistic link between protein phosphorylation signaling network and mycobacterial growth rate requires a global view of the phosphorylation events taking place at a given time under defined conditions. In the present study we employed a phosphopeptide enrichment and high throughput mass spectrometry-based strategy to investigate and qualitatively compare the phosphoproteome of two mycobacterial model organisms: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG. Cells were harvested during exponential phase and our analysis detected a total of 185 phospho-sites in M. smegmatis, of which 106 were confidently localized (localization probability (LP =0.75; PEP=0.01. By contrast, in M. bovis BCG the phosphoproteome comprised 442 phospho-sites, of which 289 were confidently localized. The percentage distribution of Ser/Thr/Tyr phosphorylation was 39.47, 57.02 and 3.51 % for M. smegmatis and 35, 61.6 and 3.1% for M. bovis BCG. Moreover, our study identified a number of conserved Ser/Thr phosphorylated sites and conserved Tyr phosphorylated sites across different mycobacterial species. Overall a qualitative comparison of the fast and slow growing mycobacteria suggests that the phosphoproteome of M. smegmatis is a simpler version of that of M. bovis BCG. In particular, M. bovis BCG exponential cells exhibited a much more complex and sophisticated protein phosphorylation network regulating important cellular cycle events such as cell wall biosynthesis, elongation, cell division including immediately response to stress. The differences in the two phosphoproteomes are discussed in light of different mycobacterial growth rates.

  14. Down-regulation of miR-20a-5p triggers cell apoptosis to facilitate mycobacterial clearance through targeting JNK2 in human macrophages.

    Science.gov (United States)

    Zhang, Guoliang; Liu, Xi; Wang, Wenfei; Cai, Yi; Li, Shaoyuan; Chen, Qi; Liao, Mingfeng; Zhang, Mingxia; Zeng, Gucheng; Zhou, Boping; Feng, Carl G; Chen, Xinchun

    2016-09-16

    Induction of cell apoptosis is one of the major host defense mechanisms through which macrophages control Mycobacterium tuberculosis (Mtb) infection. However, the mechanisms underlying macrophage apoptosis triggered by Mtb infection are still largely unknown. In this study, a microarray profiling survey revealed 14 miRNAs were down-regulated in CD14+ monocytes from active pulmonary tuberculosis patients, and only the reduction of miR-20a-5p could be reversed after successful anti-tuberculosis treatment. Validation of miR-20a-5p expression was confirmed using real time qPCR. Moreover, miR-20a-5p expression also decreased in differentiated THP-1 macrophages after mycobacterial infection in vitro. Functional assays through forced or inhibited expression of miR-20a-5p in THP-1 macrophages demonstrated that miR-20a-5p functioned as a negative regulator of mycobacterial-triggered apoptosis. Importantly, inhibition of miR-20a-5p expression resulted in more efficient mycobacterial clearance from infected THP-1 macrophages while miR-20a-5p overexpression promoted mycobacterial survival. Mechanistically, miR-20a-5p was demonstrated to regulate Bim expression in a JNK2-dependent manner, unlike Bcl2, and luciferase assay showed JNK2 was a novel direct target of miR-20a-5p. Together, our findings indicate that downregulation of miR-20a-5p triggers macrophage apoptosis as a novel mechanism for host defense against mycobacterial infection. PMID:27494776

  15. The external PASTA domain of the essential serine/threonine protein kinase PknB regulates mycobacterial growth.

    Science.gov (United States)

    Turapov, Obolbek; Loraine, Jessica; Jenkins, Christopher H; Barthe, Philippe; McFeely, Daniel; Forti, Francesca; Ghisotti, Daniela; Hesek, Dusan; Lee, Mijoon; Bottrill, Andrew R; Vollmer, Waldemar; Mobashery, Shahriar; Cohen-Gonsaud, Martin; Mukamolova, Galina V

    2015-07-01

    PknB is an essential serine/threonine protein kinase required for mycobacterial cell division and cell-wall biosynthesis. Here we demonstrate that overexpression of the external PknB_PASTA domain in mycobacteria results in delayed regrowth, accumulation of elongated bacteria and increased sensitivity to β-lactam antibiotics. These changes are accompanied by altered production of certain enzymes involved in cell-wall biosynthesis as revealed by proteomics studies. The growth inhibition caused by overexpression of the PknB_PASTA domain is completely abolished by enhanced concentration of magnesium ions, but not muropeptides. Finally, we show that the addition of recombinant PASTA domain could prevent regrowth of Mycobacterium tuberculosis, and therefore offers an alternative opportunity to control replication of this pathogen. These results suggest that the PknB_PASTA domain is involved in regulation of peptidoglycan biosynthesis and maintenance of cell-wall architecture.

  16. First Canadian Reports of Cervical Adenitis due to Mycobacterium malmoense and a 10-Year Review of Nontuberculous Mycobacterial Adenitis

    Directory of Open Access Journals (Sweden)

    Chris McCrossin

    2006-01-01

    Full Text Available The present report reviews a decade of experience with nontuberculous mycobacterial adenitis at a pediatric referral centre, noting that patients are often subjected to multiple ineffective antibiotic courses, and that delays in diagnosis and referral for appropriate therapy are common. Notable clinical features include a mean age of presentation of 3.4 years, a male-to-female ratio of 1:1.5 and a gradual onset of painless, unilateral cervical adenopathy. Fever was absent in most patients (77%, and the disease failed to respond to antistaphylococcal antibiotics. The mean time to correct diagnosis was longer than three months (15 weeks. The clinical features of the disease are highlighted and presented with a practical diagnostic approach to the child with subacute/chronic adenitis. New molecular diagnostic tools and emerging mycobacteria are discussed, including the first reports of Mycobacterium malmoense adenitis in Canada.

  17. A hybrid soft solar cell based on the mycobacterial porin MspA linked to a sensitizer-viologen Diad.

    Science.gov (United States)

    Perera, Ayomi S; Subbaiyan, Navaneetha K; Kalita, Mausam; Wendel, Sebastian O; Samarakoon, Thilani N; D'Souza, Francis; Bossmann, Stefan H

    2013-05-01

    A prototype of a nano solar cell containing the mycobacterial channel protein MspA has been successfully designed. MspA, an octameric transmembrane channel protein from Mycobacterium smegmatis, is one of the most stable proteins known to date. Eight Ruthenium(II) aminophenanthroline-viologen maleimide Diads (Ru-Diads) have been successfully bound to the MspA mutant MspAA96C via cysteine-maleimide bonds. MspA is known to form double layers in which it acts as nanoscopic surfactant. The nanostructured layer that is formed by (Ru-Diad)8MspA at the TiO2 electrode is photochemically active. The resulting "protein nano solar cell" features an incident photon conversion efficiency of 1% at 400 nm. This can be regarded as a proof-of-principle that stable proteins can be successfully integrated into the design of solar cells. PMID:23611424

  18. Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis

    OpenAIRE

    Huicong Liu; Min Yang; Zheng-Guo He

    2016-01-01

    Transport-related genes significantly affect bacterial antibiotic resistance. However, the effects of these genes and their regulation of bacterial drug resistance in several mycobacterial species, including the fast-growing Mycobacterium smegmatis, the pathogen M. tuberculosis and M. avium have not been clearly characterized. We identified Ms4022 (MSMEG_4022) as a novel TetR family regulator that activates the expression of seven transport-related genes and affects drug resistance in M. smeg...

  19. Efficient Calculation of Enzyme Reaction Free Energy Profiles Using a Hybrid Differential Relaxation Algorithm: Application to Mycobacterial Zinc Hydrolases.

    Science.gov (United States)

    Romero, Juan Manuel; Martin, Mariano; Ramirez, Claudia Lilián; Dumas, Victoria Gisel; Marti, Marcelo Adrián

    2015-01-01

    Determination of the free energy profile for an enzyme reaction mechanism is of primordial relevance, paving the way for our understanding of the enzyme's catalytic power at the molecular level. Although hybrid, mostly DFT-based, QM/MM methods have been extensively applied to this type of studies, achieving accurate and statistically converged results at a moderate computational cost is still an open challenge. Recently, we have shown that accurate results can be achieved in less computational time, combining Jarzynski's relationship with a hybrid differential relaxation algorithm (HyDRA), which allows partial relaxation of the solvent during the nonequilibrium steering of the reaction. In this work, we have applied this strategy to study two mycobacterial zinc hydrolases. Mycobacterium tuberculosis infections are still a worldwide problem and thus characterization and validation of new drug targets is an intense field of research. Among possible drug targets, recently two essential zinc hydrolases, MshB (Rv1170) and MA-amidase (Rv3717), have been proposed and structurally characterized. Although possible mechanisms have been proposed by analogy to the widely studied human Zn hydrolases, several key issues, particularly those related to Zn coordination sphere and its role in catalysis, remained unanswered. Our results show that mycobacterial Zn hydrolases share a basic two-step mechanism. First, the attacking water becomes deprotonated by the conserved base and establishes the new C-O bond leading to a tetrahedral intermediate. The intermediate requires moderate reorganization to allow for proton transfer to the amide N and C-N bond breaking to occur in the second step. Zn ion plays a key role in stabilizing the tetrahedral intermediate and balancing the negative charge of the substrate during hydroxide ion attack. Finally, comparative analysis of other Zn hydrolases points to a convergent mechanistic evolution. PMID:26415840

  20. The role of the mycobacterial DNA-binding protein 1 (MDP1 from Mycobacterium bovis BCG in host cell interaction

    Directory of Open Access Journals (Sweden)

    Kunisch Ralph

    2012-08-01

    Full Text Available Abstract Background Mycobacterium tuberculosis differs from most pathogens in its ability to multiply inside monocytes and to persist during long periods of time within granuloma in a status of latency. A class of proteins called mycobacterial histone-like proteins has been associated with regulation of replication and latency, but their precise role in the infection process has yet to be uncovered. Our study aimed at defining the impact of the histone-like protein MDP1 from M. bovis BCG (mycobacterial DNA-binding protein 1, corresponding to Rv2986c from M. tuberculosis on early steps of infection. Results Previously, a BCG (Bacillus Calmette Guérin strain had been generated by antisense-technique exhibiting reduced MDP1 expression. This strain was now used to analyse the impact of reduced amount of MDP1 on the interaction with human blood monocytes, macrophage lines and PBMC (peripheral blood mononuclear cells. MDP1 was revealed to be required for growth at acidic pH and for intracellular replication in human blood monocytes. Down-regulation of MDP1 resulted in reduced secretion of the cytokine IL-1β by infected human PBMC. In addition, a reduction of MDP1 expression had a major impact on the formation of fused multi-nucleated macrophages. In monocyte preparations from human blood as well as in human and mouse macrophage cell lines, both the percentage of multi-nucleated cells and the number of nuclei per cell were much enhanced when the monocytes were infected with BCG expressing less MDP1. Conclusion MDP1 from M. bovis BCG affects the growth at acidic pH and the intracellular replication in human monocytes. It furthermore affects cytokine secretion by host cells, and the formation of fused multi-nucleated macrophages. Our results suggest an important role of MDP1 in persistent infection.

  1. A novel inhibitor of gyrase B is a potent drug candidate for treatment of tuberculosis and nontuberculosis mycobacterial infections.

    Science.gov (United States)

    Locher, Christopher P; Jones, Steven M; Hanzelka, Brian L; Perola, Emanuele; Shoen, Carolyn M; Cynamon, Michael H; Ngwane, Andile H; Wiid, Ian J; van Helden, Paul D; Betoudji, Fabrice; Nuermberger, Eric L; Thomson, John A

    2015-03-01

    New drugs to treat drug-resistant tuberculosis are urgently needed. Extensively drug-resistant and probably the totally drug-resistant tuberculosis strains are resistant to fluoroquinolones like moxifloxacin, which target gyrase A, and most people infected with these strains die within a year. In this study, we found that a novel aminobenzimidazole, VXc-486, which targets gyrase B, potently inhibits multiple drug-sensitive isolates and drug-resistant isolates of Mycobacterium tuberculosis in vitro (MICs of 0.03 to 0.30 μg/ml and 0.08 to 5.48 μg/ml, respectively) and reduces mycobacterial burdens in lungs of infected mice in vivo. VXc-486 is active against drug-resistant isolates, has bactericidal activity, and kills intracellular and dormant M. tuberculosis bacteria in a low-oxygen environment. Furthermore, we found that VXc-486 inhibits the growth of multiple strains of Mycobacterium abscessus, Mycobacterium avium complex, and Mycobacterium kansasii (MICs of 0.1 to 2.0 μg/ml), as well as that of several strains of Nocardia spp. (MICs of 0.1 to 1.0 μg/ml). We made a direct comparison of the parent compound VXc-486 and a phosphate prodrug of VXc-486 and showed that the prodrug of VXc-486 had more potent killing of M. tuberculosis than did VXc-486 in vivo. In combination with other antimycobacterial drugs, the prodrug of VXc-486 sterilized M. tuberculosis infection when combined with rifapentine-pyrazinamide and bedaquiline-pyrazinamide in a relapse infection study in mice. Furthermore, the prodrug of VXc-486 appeared to perform at least as well as the gyrase A inhibitor moxifloxacin. These findings warrant further development of the prodrug of VXc-486 for the treatment of tuberculosis and nontuberculosis mycobacterial infections. PMID:25534737

  2. AADNMR: A Simple Method for Rapid Identification of Bacterial/Mycobacterial Infections in Antibiotic Treated Peritoneal Dialysis Effluent Samples for Diagnosis of Infectious Peritonitis

    CERN Document Server

    Guleria, Anupam; Rawat, Atul; Khetrapal, C L; Prasad, Narayan; Kumar, Dinesh

    2014-01-01

    An efficient method is reported for rapid identification of bacterial or mycobacterial infection in a suspected clinical/biological sample. The method is based on the fact that the ring methylene protons of cyclic fatty acids (constituting the cell membrane of several species of bacteria and mycobacteria) resonate specifically between -0.40 and 0.68 ppm region of the 1H NMR spectrum. These cyclic fatty acids are rarely found in the eukaryotic cell membranes. Therefore, the signals from cyclic ring moiety of these fatty acids can be used as markers (a) for the identification of bacterial and mycobacterial infections and (b) for differential diagnosis of bacterial and fungal infections. However, these microbial fatty acids when present inside the membrane are not easily detectable by NMR owing to their fast T2 relaxation. Nonetheless, the problem can easily be circumvented if these fatty acids become suspended in solution. This has been achieved by abolishing the membrane integrity using broad spectrum antibiot...

  3. High-pH anion-exchange chromatographic analysis of phosphorylated compounds: application to isolation and characterization of nonpeptide mycobacterial antigens.

    Science.gov (United States)

    Poquet, Y; Constant, P; Peyrat, M A; Poupot, R; Halary, F; Bonneville, M; Fournié, J J

    1996-12-01

    A rapid and sensitive high-pH anion-exchange chromatography (HPAEC) method for the separation and quantification of phosphorylated antigens in mycobacterial extracts has been developed. This method provides the separation of mono-, di-, or triphosphonucleotides and of various other phosphorylated molecules. Dual detection by conductimetry and UV absorption downstream of a chemical suppressor constitute nondegradative and highly sensitive tools for the physical detection and the quantification of phosphorylated compounds in biological samples. The lower limit of accurate quantification is around 1 nmol per sample. This method was used for the separation of several phosphorylated antigens activating human gamma delta T lymphocytes from semipurified mycobacterial fractions. Their quantification revealed that the minimal concentration activating a gamma delta T cell clone is between 1 and 5 nM. This approach can be used for more general preparative purposes with samples where minute amounts of biologically active phosphoanions are analyzed.

  4. A dual role for mycobacterial RecO in RecA-dependent homologous recombination and RecA-independent single-strand annealing.

    Science.gov (United States)

    Gupta, Richa; Ryzhikov, Mikhail; Koroleva, Olga; Unciuleac, Mihaela; Shuman, Stewart; Korolev, Sergey; Glickman, Michael S

    2013-02-01

    Mycobacteria have two genetically distinct pathways for the homology-directed repair of DNA double-strand breaks: homologous recombination (HR) and single-strand annealing (SSA). HR is abolished by deletion of RecA and reduced in the absence of the AdnAB helicase/nuclease. By contrast, SSA is RecA-independent and requires RecBCD. Here we examine the function of RecO in mycobacterial DNA recombination and repair. Loss of RecO elicits hypersensitivity to DNA damaging agents similar to that caused by deletion of RecA. We show that RecO participates in RecA-dependent HR in a pathway parallel to the AdnAB pathway. We also find that RecO plays a role in the RecA-independent SSA pathway. The mycobacterial RecO protein displays a zinc-dependent DNA binding activity in vitro and accelerates the annealing of SSB-coated single-stranded DNA. These findings establish a role for RecO in two pathways of mycobacterial DNA double-strand break repair and suggest an in vivo function for the DNA annealing activity of RecO proteins, thereby underscoring their similarity to eukaryal Rad52. PMID:23295671

  5. Control of Mycobacterial Infections in Mice Expressing Human Tumor Necrosis Factor (TNF) but Not Mouse TNF

    OpenAIRE

    Olleros, Maria L.; Chavez-Galan, Leslie; Segueni, Noria; Bourigault, Marie L.; Vesin, Dominique; Kruglov, Andrey A.; Drutskaya, Marina S.; Bisig, Ruth; Ehlers, Stefan; Aly, Sahar; Walter, Kerstin; Kuprash, Dmitry V.; Chouchkova, Miliana; Sergei V. Kozlov; Erard, François

    2015-01-01

    Tumor necrosis factor (TNF) is an important cytokine for host defense against pathogens but is also associated with the development of human immunopathologies. TNF blockade effectively ameliorates many chronic inflammatory conditions but compromises host immunity to tuberculosis. The search for novel, more specific human TNF blockers requires the development of a reliable animal model. We used a novel mouse model with complete replacement of the mouse TNF gene by its human ortholog (human TNF...

  6. The HyVac4 subunit vaccine efficiently boosts BCG-primed anti-mycobacterial protective immunity.

    Directory of Open Access Journals (Sweden)

    Rolf Billeskov

    Full Text Available BACKGROUND: The current vaccine against tuberculosis (TB, BCG, has failed to control TB worldwide and the protective efficacy is moreover limited to 10-15 years. A vaccine that could efficiently boost a BCG-induced immune response and thus prolong protective immunity would therefore have a significant impact on the global TB-burden. METHODS/FINDINGS: In the present study we show that the fusion protein HyVac4 (H4, consisting of the mycobacterial antigens Ag85B and TB10.4, given in the adjuvant IC31® or DDA/MPL effectively boosted and prolonged immunity induced by BCG, leading to improved protection against infection with virulent M. tuberculosis (M.tb. Increased protection correlated with an increased percentage of TB10.4 specific IFNγ/TNFα/IL-2 or TNFα/IL-2 producing CD4 T cells at the site of infection. Moreover, this vaccine strategy did not compromise the use of ESAT-6 as an accurate correlate of disease development/vaccine efficacy. Indeed both CD4 and CD8 ESAT-6 specific T cells showed significant correlation with bacterial levels. CONCLUSIONS/SIGNIFICANCE: H4-IC31® can efficiently boost BCG-primed immunity leading to an increased protective anti-M.tb immune response dominated by IFNγ/TNFα/IL-2 or TNFα/IL2 producing CD4 T cells. H4 in the CD4 T cell inducing adjuvant IC31® is presently in clinical trials.

  7. Transforming growth factor-beta response to mycobacterial infection in striped bass Morone saxatilis and hybrid tilapia Oreochromis spp.

    Science.gov (United States)

    Harms, Craig A; Howard, Kristina E; Wolf, Jeffrey C; Smith, Stephen A; Kennedy-Stoskopf, Suzanne

    2003-10-15

    Striped bass (Morone saxatilis) and hybrid tilapia (Oreochromis spp.) were experimentally infected with Mycobacterium marinum. Splenic mononuclear cell transforming growth factor-beta (TGF-beta) mRNA was measured by reverse transcription quantitative-competitive PCR (RT-qcPCR). In histologic sections of liver and anterior kidney, the area of each section that was occupied by granulomas and the total area of each section were measured by computer-assisted image analysis and compared as a proportion (the granuloma proportion). Infected striped bass splenic mononuclear cell TGF-beta mRNA expression was significantly lower than uninfected controls, while for tilapia there was no significant difference between infected and control fish. Mycobacterial granuloma proportion of liver and anterior kidney sections was significantly greater for infected striped bass than tilapia. Three (of 10) infected tilapia with the most pronounced inflammatory response displayed a decrease in TGF-beta mRNA expression, similar to the overall striped bass response to mycobacterium challenge. Downregulation of TGF-beta and failure to modulate the immune response may be related to excessive inflammatory damage to organs observed in mycobacteria-sensitive fish species. PMID:12963276

  8. Specific interaction between Mycobacterium tuberculosis lipoprotein-derived peptides and target cells inhibits mycobacterial entry in vitro

    Science.gov (United States)

    Ocampo, Marisol; Curtidor, Hernando; Vanegas, Magnolia; Patarroyo, Manuel Alfonso; Patarroyo, Manuel Elkin

    2014-01-01

    Summary Tuberculosis (TB) continues being one of the diseases having the greatest mortality rates around the world, 8.7 million cases having been reported in 2011. An efficient vaccine against TB having a great impact on public health is an urgent need. Usually, selecting antigens for vaccines has been based on proteins having immunogenic properties for patients suffering TB and having had promising results in mice and non-human primates. Our approach has been based on a functional approach involving the pathogen–host interaction in the search for antigens to be included in designing an efficient, minimal, subunit-based anti-tuberculosis vaccine. This means that Mycobacterium tuberculosis has mainly been involved in studies and that lipoproteins represent an important kind of protein on the cell envelope which can also contribute towards this pathogen's virulence. This study has assessed the expression of four lipoproteins from M. tuberculosis H37Rv, i.e. Rv1411c (LprG), Rv1911c (LppC), Rv2270 (LppN) and Rv3763 (LpqH), and the possible biological activity of peptides derived from these. Five peptides were found for these proteins which had high specific binding to both alveolar A549 epithelial cells and U937 monocyte-derived macrophages which were able to significantly inhibit mycobacterial entry to these cells in vitro. PMID:25041568

  9. Mycobacterial and nonbacterial pulmonary complications in hospitalized patients with human immunodeficiency virus infection: A prospective, cohort study

    Directory of Open Access Journals (Sweden)

    Afessa Bekele

    2001-09-01

    Full Text Available Abstract Background A prospective observational study was done to describe nonbacterial pulmonary complications in hospitalized patients with human immunodeficiency virus (HIV infection. Methods The study included 1,225 consecutive hospital admissions of 599 HIV-infected patients treated from April 1995 through March 1998. Data included demographics, risk factors for HIV infection, Acute Physiology and Chronic Health Evaluation (APACHE II score, pulmonary complications, CD4+ lymphocyte count, hospital stay and case-fatality rate. Results Patient age (mean ± SD was 38.2 ± 8.9 years, 62% were men, and 84% were African American. The median APACHE II score was 14, and median CD4+ lymphocyte count was 60/μL. Pulmonary complications were Pneumocystis carinii pneumonia (85 in 78 patients, Mycobacterium avium complex (51 in 38, Mycobacterium tuberculosis (40 in 35, Mycobacterium gordonae (11 in 11, Mycobacterium kansasii (10 in 9, Cytomegalovirus (10 in 10, Nocardia asteroides (3 in 3, fungus ball (2 in 2, respiratory syncytial virus (1, herpes simplex virus (1, Histoplasma capsulatum (1, lymphoma (3 in 3, bronchogenic carcinoma (2 in 2, and Kaposi sarcoma (1. The case-fatality rate of patients was 11% with Pneumocystis carinii pneumonia; 5%, Mycobacterium tuberculosis; 6%, Mycobacterium avium complex; and 7%, noninfectious pulmonary complications. Conclusion Most pulmonary complications in hospitalized patients with HIV are from Pneumocystis and mycobacterial infection.

  10. The chest radiographic appearances of non-tuberculous mycobacterial pulmonary infection in patients with acquired immunodeficiency syndrome

    International Nuclear Information System (INIS)

    Objective: To study the chest radiographic appearances of the non-tuberculous mycobacterial (NTM) pulmonary infection in patients with acquired immune deficiency syndrome (AIDS). Methods: Ten patients with AIDS and NTM underwent chest X-ray radiography and 7 patients performed high-resolution CT (HRCT) scan. Chest radiographic features of' NTM in patients with AIDS were retrospectively analyzed. Results: The chest radiograph showed bilateral pulmonary involvement in 6 cases and single lung involvement in 4 cases (3 cases in the right, 1 case in the left). Patchy air space consolidation (6 cases), large consolidation (5 cases), cavitation (5 cases), small nodules (3 cases), military nodules (2 cases), linear opacity (1 cases) were demonstrated on radiography. On HRCT, air space consolidation (7 cases), small nodules (6 cases), large consolidation (5 cases) with cavitation and cylindric bronchiectasis after the absorption of consolidation, enlarged hilar and mediastinal lymph nodes (4 cases), ground-glass opacities (3 cases), military nodules and 'tree-in-bud' sign (2 case), pleural effusion (1 case), pericardial effusion (1 case) and fibrotic band (1 case) were found. Conclusion: The most common radiographic appearances of NTM in patients with AIDS are bilateral small nodules, large consolidation with cavitation and cylindric bronchiectasis, enlarged hilar and mediastinal lymph nodes. (authors)

  11. The mycobacterial cord factor adjuvant analogue trehalose-6,6'-dibehenate (TDB) activates the Nlrp3 inflammasome.

    Science.gov (United States)

    Schweneker, Katrin; Gorka, Oliver; Schweneker, Marc; Poeck, Hendrik; Tschopp, Jürg; Peschel, Christian; Ruland, Jürgen; Gross, Olaf

    2013-04-01

    The success of a vaccine consists in the induction of an innate immune response and subsequent activation of the adaptive immune system. Because antigens are usually not immunogenic, the addition of adjuvants that activate innate immunity is required. The mycobacterial cord factor trehalose-6,6'-dimycolate (TDM) and its synthetic adjuvant analogue trehalose-6,6'-dibehenate (TDB) rely on the C-type lectin Mincle and the signaling molecules Syk and Card9 to trigger innate immunity. In this study, we show that stimulation of bone marrow-derived dendritic cells (BMDCs) with TDB induces Nlrp3 inflammasome-dependent IL-1β secretion. While Card9 is required for NF-κB activation by TDB, it is dispensable for TDB-induced activation of the Nlrp3 inflammasome. Additionally, efflux of intracellular potassium, lysosomal rupture, and oxygen radical (ROS) production are crucial for caspase-1 processing and IL-1β secretion by TDB. In an in vivo inflammation model, we demonstrate that the recruitment of neutrophils by TDB is significantly reduced in the Nlrp3-deficient mice compared to the wild-type mice, while the production of chemokines in vitro is not influenced by the absence of Nlrp3. These results identify the Nlrp3 inflammasome as an essential mediator for the induction of an innate immune response triggered by TDB. PMID:22921586

  12. Molecular characterisation of clinical and environmental isolates of Mycobacterium kansasii isolates from South African gold mines.

    Science.gov (United States)

    Kwenda, Geoffrey; Churchyard, Gavin J; Thorrold, Catherine; Heron, Ian; Stevenson, Karen; Duse, Adriano G; Marais, Elsé

    2015-03-01

    Mycobacterium kansasii (M. kansasii) is a major cause of non-tuberculous mycobacterial pulmonary disease in the South African gold-mining workforce, but the source of infection and molecular epidemiology are unknown. This study investigated the presence of M. kansasii in gold and coal mine and associated hostel water supplies and compared the genetic diversity of clinical and environmental isolates of M. kansasii. Five M. kansasii and ten other potentially pathogenic mycobacteria were cultured mainly from showerhead biofilms. Polymerase chain reaction-restriction analysis of the hsp65 gene on 196 clinical and environmental M. kansasii isolates revealed 160 subtype I, eight subtype II and six subtype IV strains. Twenty-two isolates did not show the typical M. kansasii restriction patterns, suggesting that these isolates may represent new subtypes of M. kansasii. In contrast to the clonal population structure found amongst the subtype I isolates from studies in other countries, DNA fingerprinting of 114 clinical and three environmental subtype I isolates demonstrated genetic diversity amongst the isolates. This study demonstrated that showerheads are possible sources of M. kansasii and other pathogenic non-tuberculous mycobacterial infection in a gold-mining region, that subtype I is the major clinical isolate of M. kansasii strain and that this subtype exhibits genetic diversity. PMID:25719478

  13. New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters

    Science.gov (United States)

    Kanno, Alex I.; Goulart, Cibelly; Rofatto, Henrique K.; Oliveira, Sergio C.; Leite, Luciana C. C.

    2016-01-01

    The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovis BCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. PMID:26850295

  14. The role of transcriptional regulation in maintaining the availability of mycobacterial adenylate cyclases

    Directory of Open Access Journals (Sweden)

    Sarah J. Casey

    2014-03-01

    Full Text Available Mycobacterium species have a complex cAMP regulatory network indicated by the high number of adenylate cyclases annotated in their genomes. However the need for a high level of redundancy in adenylate cyclase genes remains unknown. We have used semiquantitiative RT-PCR to examine the expression of eight Mycobacterium smegmatis cyclases with orthologs in the human pathogen Mycobacterium tuberculosis, where cAMP has recently been shown to be important for virulence. All eight cyclases were transcribed in all environments tested, and only four demonstrated environmental-mediated changes in transcription. M. smegmatis genes MSMEG_0545 and MSMEG_4279 were upregulated during starvation conditions while MSMEG_0545 and MSMEG_4924 were downregulated in H2O2 and MSMEG_3780 was downregulated in low pH and starvation. Promoter fusion constructs containing M. tuberculosis H37Rv promoters showed consistent regulation compared to their M. smegmatis orthologs. Overall our findings indicate that while low levels of transcriptional regulation occur, regulation at the mRNA level does not play a major role in controlling cellular cyclase availability in a given environment.

  15. Mycobacterial Interspersed Repetitive Unit Locus –A New Way to Predict the Drug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    feng Yu Wen

    2015-02-01

    Full Text Available The MIRU-VNTR (Mycobacterial Interspersed Repetitive Unit-Variable Number of Tandem Repeat typing has been a widely-used molecular method for Mycobacterium tuberculosis genotyping. It is unknown whether MIRU-VNTR is associated with drug resistance of Mycobacterium tuberculosis. The purpose of this study was to explore the ability of twenty-four MIRU loci to predict the drug resistance of Isoniazid (INH, Rifampicin (RFP, Streptomycin (SM, Ethambutol (EMB and Pyrazinamide (PZA. We collected the drug resistance and twenty-four MIRU loci information of 109 strains of Mycobacterium tuberculosis from an open database. The results of multivariate logistic regression showed that the variable number of tandem repeat polymorphism of MTUB04 was related to INH resistance (odds ratio (OR = 2.82, p=0.00, RFP resistance (OR =1.91, P=0.02, SM resistance (OR=1.98, P=0.01 and EMB resistance (OR = 1.95, P=0.03. MIRU40 was associated with INH resistance (OR = 2.22, P=0.00. MTUB21 was connected with INH resistance (OR=1.63, P=0.02 and SM resistance (OR=1.69, P=0.01. MIRU26 was correlated with SM resistance (OR=1.52, P=0.04. MIRU39 was associated with EMB resistance (OR=4.07, P=0.02. The areas under receiver operating characteristic curve of INH, RFP, SM, EMB and PZA resistance prediction models were 0.84, 0.70, 0.85 and 0.74 respectively. Our results showed that MIRU loci were related to anti-tuberculosis drug and could predict the drug resistance of tuberculosis.

  16. A Subset of Protective γ9δ2 T Cells Is Activated by Novel Mycobacterial Glycolipid Components.

    Science.gov (United States)

    Xia, Mei; Hesser, Danny C; De, Prithwiraj; Sakala, Isaac G; Spencer, Charles T; Kirkwood, Jay S; Abate, Getahun; Chatterjee, Delphi; Dobos, Karen M; Hoft, Daniel F

    2016-09-01

    γ9δ2 T cells provide a natural bridge between innate and adaptive immunity, rapidly and potently respond to pathogen infection in mucosal tissues, and are prominently induced by both tuberculosis (TB) infection and bacillus Calmette Guérin (BCG) vaccination. Mycobacterium-expanded γ9δ2 T cells represent only a subset of the phosphoantigen {isopentenyl pyrophosphate [IPP] and (E)-4-hydroxy-3-methyl-but-2-enylpyrophosphate [HMBPP]}-responsive γ9δ2 T cells, expressing an oligoclonal set of T cell receptor (TCR) sequences which more efficiently recognize and inhibit intracellular Mycobacterium tuberculosis infection. Based on this premise, we have been searching for M. tuberculosis antigens specifically capable of inducing a unique subset of mycobacterium-protective γ9δ2 T cells. Our screening strategy includes the identification of M. tuberculosis fractions that expand γ9δ2 T cells with biological functions capable of inhibiting intracellular mycobacterial replication. Chemical treatments of M. tuberculosis whole-cell lysates (MtbWL) ruled out protein, nucleic acid, and nonpolar lipids as the M. tuberculosis antigens inducing protective γ9δ2 T cells. Mild acid hydrolysis, which transforms complex carbohydrate to monomeric residues, abrogated the specific activity of M. tuberculosis whole-cell lysates, suggesting that a polysaccharide was required for biological activity. Extraction of MtbWL with chloroform-methanol-water (10:10:3) resulted in a polar lipid fraction with highly enriched specific activity; this activity was further enriched by silica gel chromatography. A combination of mass spectrometry and nuclear magnetic resonance analysis of bioactive fractions indicated that 6-O-methylglucose-containing lipopolysaccharides (mGLP) are predominant components present in this active fraction. These results have important implications for the development of new immunotherapeutic approaches for prevention and treatment of TB. PMID:27297390

  17. Systemic BCG immunization induces persistent lung mucosal multifunctional CD4 T(EM cells which expand following virulent mycobacterial challenge.

    Directory of Open Access Journals (Sweden)

    Daryan A Kaveh

    Full Text Available To more closely understand the mechanisms of how BCG vaccination confers immunity would help to rationally design improved tuberculosis vaccines that are urgently required. Given the established central role of CD4 T cells in BCG induced immunity, we sought to characterise the generation of memory CD4 T cell responses to BCG vaccination and M. bovis infection in a murine challenge model. We demonstrate that a single systemic BCG vaccination induces distinct systemic and mucosal populations of T effector memory (T(EM cells in vaccinated mice. These CD4+CD44(hiCD62L(loCD27⁻ T cells concomitantly produce IFN-γ and TNF-α, or IFN-γ, IL-2 and TNF-α and have a higher cytokine median fluorescence intensity MFI or 'quality of response' than single cytokine producing cells. These cells are maintained for long periods (>16 months in BCG protected mice, maintaining a vaccine-specific functionality. Following virulent mycobacterial challenge, these cells underwent significant expansion in the lungs and are, therefore, strongly associated with protection against M. bovis challenge. Our data demonstrate that a persistent mucosal population of T(EM cells can be induced by parenteral immunization, a feature only previously associated with mucosal immunization routes; and that these multifunctional T(EM cells are strongly associated with protection. We propose that these cells mediate protective immunity, and that vaccines designed to increase the number of relevant antigen-specific T(EM in the lung may represent a new generation of TB vaccines.

  18. Tomography high Resolution CT findings of nontuberculous mycobacterial pulmonary disease: Comparison between the first treatment and the re treatment group

    Energy Technology Data Exchange (ETDEWEB)

    Gwak, Soon Hyuk; Cho, Bum Sang; Jeon, Min Hee; Kim, Eun Young; Kang, Min Ho; Yi, Kyung Sik; Lee, Seung Young; Kim, Sung Jin; Lee, Ki Man [Chungbuk National Univ., Cheongju, (Korea, Republic of)

    2012-06-15

    To analyze and compare the thin section CT findings of first and re treatment nontuberculous mycobacterial (NTM) pulmonary disease. Between January 2005 and April 2010, 121 patients with positive sputum culture for NTM were recruited. We included only 32 patients underwent high resolution chest CT and were confirmed by American Thoracic Society criteria NTM pulmonary infection (first treatment 15, re treatment 17 patients). CT images of 32 patients were reviewed retrospectively. We evaluated the frequency and laterality of the followings; nodule, increased density, bronchial change, parenchymal change. The significantly frequent CT findings of the re treatment NTM group were well defined nodules (retreatment 82.4%, first treatment 33.3%, p = 0.00), consolidations (retreatment 88.2%, first treatment 53.3%, p = 0.03), bronchial changes (bronchiectasis; retreatment 100%, first treatment 66.6%, p = 0.01, bronchial narrowing; retreatment 23.5%, first treatment 0%, p = 0.04 and mucoid impaction; retreatment-58.8%, first treatment-20.0%, p = 0.03) and atelectasis with bronchiectasis (retreatment-88.2%, first treatment 26.7%, p = 0.00). However, most of the evaluated thin section CT findings, such as centrilobular and ill defined nodules, lobular, segmental and subpleural consolidations, ground glass attenuation, bronchial wall thickening, cavities, pleural lesions, fibrotic band, emphysema and laterality of lesions, have not shown significant differences between first treatment and the re treatment group. Thin section CT findings of well defined nodules, consolidations, bronchial changes (bronchiectasis, bronchial narrowing and mucoid impaction) and atelectasis with bronchiectasis are highly suggestive of re treatment NTM pulmonary disease.

  19. Tomography high Resolution CT findings of nontuberculous mycobacterial pulmonary disease: Comparison between the first treatment and the re treatment group

    International Nuclear Information System (INIS)

    To analyze and compare the thin section CT findings of first and re treatment nontuberculous mycobacterial (NTM) pulmonary disease. Between January 2005 and April 2010, 121 patients with positive sputum culture for NTM were recruited. We included only 32 patients underwent high resolution chest CT and were confirmed by American Thoracic Society criteria NTM pulmonary infection (first treatment 15, re treatment 17 patients). CT images of 32 patients were reviewed retrospectively. We evaluated the frequency and laterality of the followings; nodule, increased density, bronchial change, parenchymal change. The significantly frequent CT findings of the re treatment NTM group were well defined nodules (retreatment 82.4%, first treatment 33.3%, p = 0.00), consolidations (retreatment 88.2%, first treatment 53.3%, p = 0.03), bronchial changes (bronchiectasis; retreatment 100%, first treatment 66.6%, p = 0.01, bronchial narrowing; retreatment 23.5%, first treatment 0%, p = 0.04 and mucoid impaction; retreatment-58.8%, first treatment-20.0%, p = 0.03) and atelectasis with bronchiectasis (retreatment-88.2%, first treatment 26.7%, p = 0.00). However, most of the evaluated thin section CT findings, such as centrilobular and ill defined nodules, lobular, segmental and subpleural consolidations, ground glass attenuation, bronchial wall thickening, cavities, pleural lesions, fibrotic band, emphysema and laterality of lesions, have not shown significant differences between first treatment and the re treatment group. Thin section CT findings of well defined nodules, consolidations, bronchial changes (bronchiectasis, bronchial narrowing and mucoid impaction) and atelectasis with bronchiectasis are highly suggestive of re treatment NTM pulmonary disease

  20. Mycobacterium tuberculosis Zinc Metalloprotease-1 Elicits Tuberculosis-specific Humoral Immune Response Independent of Mycobacterial Load in Pulmonary and Extra-Pulmonary Tuberculosis Patients

    Directory of Open Access Journals (Sweden)

    Mani Harika eVemula

    2016-03-01

    Full Text Available Conventionally, facultative intracellular pathogen, Mycobacterium tuberculosis (M.tb, the tuberculosis (TB causing bacilli in human is cleared by cell-mediated immunity (CMI with CD4+ T cells playing instrumental role in protective immunity, while antibody-mediated immunity (AMI is considered non-protective. This longstanding convention has been challenged with recent evidences of increased susceptibility of hosts with compromised AMI and monoclonal antibodies conferring passive protection against TB and other intracellular pathogens. Therefore, novel approaches towards vaccine development include strategies aiming at induction of humoral response along with CMI. This necessitates the identification of mycobacterial proteins with properties of immunomodulation and strong immunogenicity. In this study, we determined the immunogenic potential of M.tb Zinc metalloprotease-1 (Zmp1, a secretory protein essential for intracellular survival and pathogenesis of M.tb. We observed that Zmp1 was secreted by in vitro grown M.tb under granuloma-like stress conditions (acidic, oxidative, iron deficiency and nutrient deprivation and generated Th2 cytokine microenvironment upon exogenous treatment of Peripheral Blood Mononulear Cells (PBMCs with recombinant Zmp1 (rZmp1. This was supported by recording specific and robust humoral response in TB patients in a cohort of 295. The anti-Zmp1 titers were significantly higher in TB patients (n=121 as against healthy control (n=62, household contacts (n=89 and non-specific infection controls (n=23. A significant observation of the study is the presence of equally high titers of anti-Zmp1 antibodies in a range of patients with high bacilli load (sputum bacilli load of 300+ per mL to paucibacillary smear-negative pulmonary tuberculosis (PTB cases. This clearly indicated the potential of Zmp1 to evoke an effective humoral response independent of mycobacterial load. Such mycobacterial proteins can be explored as antigen

  1. CarD stabilizes mycobacterial open complexes via a two-tiered kinetic mechanism

    Science.gov (United States)

    Rammohan, Jayan; Ruiz Manzano, Ana; Garner, Ashley L.; Stallings, Christina L.; Galburt, Eric A.

    2015-01-01

    CarD is an essential and global transcriptional regulator in mycobacteria. While its biological role is unclear, CarD functions by interacting directly with RNA polymerase (RNAP) holoenzyme promoter complexes. Here, using a fluorescent reporter of open complex, we quantitate RPo formation in real time and show that Mycobacterium tuberculosis CarD has a dramatic effect on the energetics of RNAP bound complexes on the M. tuberculosis rrnAP3 ribosomal RNA promoter. The data reveal that Mycobacterium bovis RNAP exhibits an unstable RPo that is stabilized by CarD and suggest that CarD uses a two-tiered, concentration-dependent mechanism by associating with open and closed complexes with different affinities. Specifically, the kinetics of open-complex formation can be explained by a model where, at saturating concentrations of CarD, the rate of bubble collapse is slowed and the rate of opening is accelerated. The kinetics and open-complex stabilities of CarD mutants further clarify the roles played by the key residues W85, K90 and R25 previously shown to affect CarD-dependent gene regulation in vivo. In contrast to M. bovis RNAP, Escherichia coli RNAP efficiently forms RPo on rrnAP3, suggesting an important difference between the polymerases themselves and highlighting how transcriptional machinery can vary across bacterial genera. PMID:25697505

  2. Síndromes micobacterianos felinos y su importancia en la salud pública - Feline mycobacterial syndromes and its importance to public health

    Directory of Open Access Journals (Sweden)

    Jorge, María Cristina

    2012-01-01

    Full Text Available ResumenEn felinos domésticos las especies del género Mycobacterium causan tres síndromes: tuberculosis ocasionada por el complejo M. tuberculosis, lepra felina por M. lepraemurium y micobacteriosis atípica causada por varias especies de micobacterias no tuberculosas y no lepromatosas.AbstractIn domestic felines three mycobacterial syndromes are described: tuberculoses caused by M. tuberculosis complex, feline leprosy caused by M. lepraemurium and atypical mycobacteriosis caused by non tuberculous and non lepromatous mycobacteria.

  3. Activation of human antigen-presenting cells by the mycobacterial cord factor and its glycolipid adjuvant analogue trehalose-6,6’-dibehenate

    OpenAIRE

    Ostrop, Jenny

    2015-01-01

    The mycobacterial cord factor trehalose-6,6’-dimycolate (TDM) is an abundant cell wall glycolipid of Mycobacterium tuberculosis and other mycobacteria. It causes inflammation and adjuvanticity, but it is also a major virulence factor of M. tuberculosis. Its synthetic analogue trehalose-6,6’-dibehenate (TDB) has robust adjuvant activity and induces a Th1/Th17 T cell response in animal models. The TDB-containing liposomal adjuvant formulation Caf01 has entered phase I clinical studies in humans...

  4. Multiphasic strain differentiation of atypical mycobacteria from elephant trunk wash

    OpenAIRE

    Chan, Kok-Gan; Loke, Mun Fai; Ong, Bee Lee; Wong, Yan Ling; Hong, Kar Wai; Tan, Kian Hin; Kaur, Sargit; Ng, Hien Fuh; Abdul Razak, MFA; Ngeow, Yun Fong

    2015-01-01

    Background. Two non-tuberculous mycobacterial strains, UM_3 and UM_11, were isolated from the trunk wash of captive elephants in Malaysia. As they appeared to be identical phenotypes, they were investigated further by conventional and whole genome sequence-based methods of strain differentiation. Methods. Multiphasic investigations on the isolates included species identification with hsp65 PCR-sequencing, conventional biochemical tests, rapid biochemical profiling using API strips and the Bio...

  5. Construction, Expression and Identification of a Recombinant BCG Vaccine Encoding Human Mycobacterium Tuberculosis Heat Shock Protein 65

    Institute of Scientific and Technical Information of China (English)

    戴五星; 梁靓; 高红; 黄海浪; 陈智浩; 程继忠; 皇甫永穆

    2004-01-01

    Heat shock protein 65 (HSP65) is one of the most important protective immunogens against the tuberculosis infection. The signal sequence of antigen 85B and the whole HSP65 DNA sequence of human Mycobacterium tuberculosis (M. tuberculosis) were amplified from BCG genome and plasmid pCMV-MTHSP65 respectively by polymerase chain reactions (PCR). These two sequences were cloned into the plasmid pBCG-2100 under the control of the promoter of heat shock protein 70 (HSP70) from human M. tuberculosis, yielding the prokaryotic shuttle expression plasmid pBCG-SP-HSP65. Results of restriction endonuclease analysis, PCR detection and DNA sequencing analysis showed that the two cloned DNA sequences were consistent with those previously reported, and the direction of their inserting into the recombinant was correct and the reading frame had been maintained. The recombinants were electroporated into BCG to construct the recombinant BCG vaccine and induced by heating. The induced expression detected by SDS-PAGE showed that the content of 65 kD protein expressed in recombinant BCG was 35.69 % in total bacterial protein and 74.09 % in the cell lysate supernatants, suggesting that the recombinant HSP65 gene could express in BCG with high efficiency and the expressed proteins were mainly soluble. Western-blot showed that the secretive recombinant proteins could specifically combine with antibody against M.tuberculosis HSP65, indicating that the recombinant proteins possess the biological activity of HSP65.

  6. A Subgroup of Latently Mycobacterium tuberculosis Infected Individuals Is Characterized by Consistently Elevated IgA Responses to Several Mycobacterial Antigens

    Directory of Open Access Journals (Sweden)

    Ralf Baumann

    2015-01-01

    Full Text Available Elevated antibody responses to Mycobacterium tuberculosis antigens in individuals with latent infection (LTBI have previously been linked to an increased risk for progression to active disease. Studies in the field focussed mainly on IgG antibodies. In the present study, IgA and/or IgG responses to the mycobacterial protein antigens AlaDH, NarL, 19 kDa, PstS3, and MPT83 were determined in a blinded fashion in sera from 53 LTBI controls, 14 healthy controls, and 42 active TB subjects. Among controls, we found that elevated IgA levels against all investigated antigens were not randomly distributed but concentrated on a subgroup of <30%—with particular high levels in a small subgroup of ~5% comprising one progressor to active TB. Based on a specificity of 100%, anti-NarL IgA antibodies achieved with 78.6% sensitivity the highest accuracy for the detection of active TB compared to healthy controls. In conclusion, the consistently elevated IgA levels in a subgroup of controls suggest higher mycobacterial load, a risk factor for progression to active TB, and together with high IgG levels may have prognostic potential and should be investigated in future large scale studies. The novel antigen NarL may also be promising for the antibody-based diagnosis of active TB cases.

  7. A High Throughput Screening Assay for Anti-Mycobacterial Small Molecules Based on Adenylate Kinase Release as a Reporter of Cell Lysis.

    Directory of Open Access Journals (Sweden)

    Lauren Forbes

    Full Text Available Mycobacterium tuberculosis (Mtb is well-established to be one of the most important bacterial pathogens for which new antimicrobial therapies are needed. Herein, we describe the development of a high throughput screening assay for the identification of molecules that are bactericidal against Mycobacteria. The assay utilizes the release of the intracellular enzyme adenylate kinase into the culture medium as a reporter of mycobacterial cell death. We demonstrate that the assay is selective for mycobactericidal molecules and detects anti-mycobacterial activity at concentrations below the minimum inhibitory concentration of many molecules. Thus, the AK assay is more sensitive than traditional growth assays. We have validated the AK assay in the HTS setting using the Mtb surrogate organism M. smegmatis and libraries of FDA approved drugs as well as a commercially available Diversity set. The screen of the FDA-approved library demonstrated that the AK assay is able to identify the vast majority of drugs with known mycobactericidal activity. Importantly, our screen of the Diversity set revealed that the increased sensitivity of the AK assay increases the ability of M. smegmatis-based screens to detect molecules with relatively poor activity against M. smegmatis but good to excellent activity against Mtb.

  8. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    International Nuclear Information System (INIS)

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  9. Genotypic characteristics of a Mycobacterium sp. isolated from yellowtail Seriola quinqueradiata and striped jack Pseudocaranx dentex in Japan.

    Science.gov (United States)

    Imajoh, Masayuki; Sugiura, Hidehiro; Hashida, Yumiko; Hatai, Kishio; Oshima, Syun-ichirou; Daibata, Masanori; Kawai, Kenji

    2013-01-01

    In Japan, a Mycobacterium marinum-like mycobacterium was isolated from the yellowtail, Seriola quinqueradiata. The species was identified as M. marinum by a commercial mycobacterial DNA-DNA hybridization kit. Nevertheless, PCR restriction analysis of the DNA of its RNA polymerase β-subunit gene definitively showed that this Mycobacterium sp. was M. ulcerans. PCR analysis revealed the genotypic characteristics of M. ulcerans in the Mycobacterium sp., only the mup053 gene sequence being absent, as has been found previously in other piscine mycobacteria such as M. marinum strains DL240490 and DL045 and M. pseudoshottsii. With one exception, this Mycobacterium sp. and M. pseudoshottsii had identical 16S rRNA gene sequences, which is also probably true of M. marinum strains DL240490 and DL045. Similarly, according to comparisons of the 16S rRNA gene, ITS region, and hsp65 gene sequences, this Mycobacterium sp. is more closely related to M. pseudoshottsii than to M. ulcerans or M. marinum. A PCR product of approximately 2000 bp was amplified from region of difference 9 in the Mycobacterium sp. The nucleotide sequence revealed insertion of IS2404, the sequence of which is 1366 bp long. The novel single nucleotide polymorphisms identified in this region distinguished this Mycobacterium sp. from M. marinum strain DL240490 and M. pseudoshottsii. The present findings raise the possibility that these species have a common ancestor. Further studies are required to improve our understanding of the relationship between their geographical origin and genetic diversity. PMID:23043488

  10. Characterization of the mycobacterial AdnAB DNA motor provides insights into the evolution of bacterial motor-nuclease machines.

    Science.gov (United States)

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2010-01-22

    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (k(cat) 415 s(-1)), and the affinity of the motor for the ssDNA cofactor increases 140-fold as DNA length is extended from 12 to 44 nucleotides. Using a streptavidin displacement assay, we demonstrate that AdnAB is a 3' --> 5' translocase on ssDNA. AdnAB binds stably to DSB ends. In the presence of ATP, the motor unwinds the DNA duplex without requiring an ssDNA loading strand. We integrate these findings into a model of DSB unwinding in which the "leading" AdnB and "lagging" AdnA motor domains track in tandem, 3' to 5', along the same DNA single strand. This contrasts with RecBCD, in which the RecB and RecD motors track in parallel along the two separated DNA single strands. The effects of 5' and 3' terminal obstacles on ssDNA cleavage by wild-type AdnAB suggest that the AdnA nuclease receives and processes the displaced 5' strand, while the AdnB nuclease cleaves the displaced 3' strand. We present evidence that the distinctive "molecular ruler" function of the ATP-dependent single strand DNase, whereby AdnAB measures the distance from the 5'-end to the sites of incision, reflects directional pumping of the ssDNA through the AdnAB motor into the AdnB nuclease. These and other findings suggest a scenario for the descent of the RecBCD- and AddAB-type DSB-processing machines from an ancestral AdnAB-like enzyme. PMID:19920138

  11. Factors associated with pastoral community knowledge and occurrence of mycobacterial infections in Human-Animal Interface areas of Nakasongola and Mubende districts, Uganda

    Directory of Open Access Journals (Sweden)

    Biffa Demelash

    2010-08-01

    Full Text Available Abstract Background Nontuberculous mycobacteria (NTM are emerging opportunistic pathogens whose role in human and animal disease is increasingly being recognized. Major concerns are their role as opportunistic pathogens in HIV/AIDS infections. The role of open natural water sources as source and livestock/wildlife as reservoirs of infections to man are well documented. This presents a health challenge to the pastoral systems in Africa that rely mostly on open natural water sources to meet livestock and human needs. Recent study in the pastoral areas of Uganda showed infections with same genotypes of NTM in pastoralists and their livestock. The aim of this study was to determine the environmental, animal husbandry and socio-demographic factors associated with occurrence and the pastoral community knowledge of mycobacterial infections at the human-environment-livestock/wildlife interface (HELI areas in pastoral ecosystems of Uganda. Methods Two hundred and fifty three (253 individuals were subjected to a questionnaire survey across the study districts of Nakasongola and Mubende. Data were analyzed using descriptive statistics and multivariable logistic regression analysis. Results Humans sharing of the water sources with wild animals from the forest compared to savannah ecosystem (OR = 3.3, the tribe of herding pastoral community (OR = 7.9, number of rooms present in household (3-5 vs. 1-2 rooms (OR = 3.3 were the socio-demographic factors that influenced the level of knowledge on mycobacterial infections among the pastoral communities. Tribe (OR = 6.4, use of spring vs. stream water for domestic use (OR = 4.5, presence of sediments in household water receptacle (OR = 2.32, non separation of water containers for drinking and domestic use (OR = 2.46, sharing of drinking water sources with wild animals (OR = 2.1, duration of involvement of >5 yrs in cattle keeping (OR = 3.7 and distance of household to animal night shelters (>20 meters (OR = 3

  12. Benzoic Acid-Inducible Gene Expression in Mycobacteria.

    Directory of Open Access Journals (Sweden)

    Marte S Dragset

    Full Text Available Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance.

  13. Rapid rebound of the Treg compartment in DEREG mice limits the impact of Treg depletion on mycobacterial burden, but prevents autoimmunity.

    Directory of Open Access Journals (Sweden)

    Luciana Berod

    Full Text Available The development of an effective vaccine against tuberculosis (Tb represents one of the major medical challenges of this century. Mycobacterium bovis Bacille Calmette-Guerin (BCG, the only vaccine available at present, is mostly effective at preventing disseminated Tb in children, but shows variable protection against pulmonary Tb, the most common form in adults. The reasons for this poor efficacy are not completely understood, but there is evidence that T regulatory cells (Tregs might be involved. Similarly, Tregs have been associated with the immunosuppression observed in patients infected with Tb and are therefore believed to play a role in pathogen persistence. Thus, Treg depletion has been postulated as a novel strategy to potentiate M. bovis BCG vaccination on one side, while on the other, employed as a therapeutic approach during chronic Tb infection. Yet since Tregs are critically involved in controlling autoimmune inflammation, elimination of Tregs may therefore also incur the danger of an excessive inflammatory immune response. Thus, understanding the dynamics and function of Tregs during mycobacterial infection is crucial to evaluate the potential of Treg depletion as a medical option. To address this, we depleted Tregs after infection with M. bovis BCG or Mycobacterium tuberculosis (Mtb using DEREG mice, which express the diphtheria toxin (DT receptor under the control of the FoxP3 locus, thereby allowing the selective depletion of FoxP3+ Tregs. Our results show that after depletion, the Treg niche is rapidly refilled by a population of DT-insensitive Tregs (diTregs and bacterial load remains unchanged. On the contrary, impaired rebound of Tregs in DEREG × FoxP3GFP mice improves pathogen burden, but is accompanied by detrimental autoimmune inflammation. Therefore, our study provides the proof-of-principle that, although a high degree of Treg depletion may contribute to the control of mycobacterial infection, it carries the risk of

  14. Rapid Detection of Mutation in RRDR of rpo B Gene for Rifampicin Resistance in MDR-Pulmonary Tuberculosis by DNA Sequencing

    OpenAIRE

    Patra, Surajeet Kumar; Jain, Anju; B L Sherwal; Khanna, Ashwani

    2010-01-01

    To detect the site of mutation in RRDR of rpo B gene for rifampicin resistance in MDR-TB by DNA sequencing. 50 MDR-TB patients were enrolled in our study after informed written consent. Mycobacterial DNA was extracted from sputum samples by Universal Sample Processing (USP) method and RRDR of rpo B gene was amplified by PCR using primers RP4T and RP8T and then sequenced by automated DNA sequencing. The nucleotide sequences of RRDR of rpo B gene were compared with the reference sequence. We ob...

  15. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  16. Diagnostic Yield of Bronchoalveolar Lavage Gene Xpert in Smear-Negative and Sputum-Scarce Pulmonary Tuberculosis

    International Nuclear Information System (INIS)

    Objective: To measure the diagnostic yield of Bronchoalveolar Lavage (BAL) gene Xpert (Xpert MTB/RIF assay), to detect Mycobacterium tuberculosis (MTB) and rifampicin resistance and compare it with that of mycobacterial cultures in a suspected case of pulmonary tuberculosis. Study Design: An analytical study. Place and Duration of Study: Department of Pulmonology, Fauji Foundation Hospital (FFH), Rawalpindi, from December 2012 to August 2013. Methodology: BAL specimens of 93 patients with suspected pulmonary tuberculosis with smear-negative or sputumscarce disease, who presented to the Department of Pulmonology, FFH, Rawalpindi were inducted. A smear-negative case was one in whom three consecutive early morning sputum samples did not reveal acid fast bacilli when examined by microscopy with Zeihl Nelson (ZN) stain. Patients who had sputum amount less than 1 ml were defined to have sputumscarce disease. The same was evaluated with ZN stain, gene Xpert and mycobacterial cultures. Sensitivity analysis was carried out using culture as the gold standard. Results: The frequency of positive mycobacterial cultures was 85 (91.4%). The sensitivity, specificity, positive predictive value and negative predictive values of BAL gene Xpert to detect Mycobacterium tuberculosis were 91.86%, 71.42%, 97.53% and 41.66% respectively. Xpert MTB/RIF assay had a sensitivity and specificity of 83.33% and 100% to detect rifampicin resistance. Conclusion: Bronchoalveolar lavage gene Xpert had a superior diagnostic yield in patients with either smear-negative or sputum-scarce pulmonary tuberculosis. Hence a positive Xpert MTB/RIF assay may be a useful adjunct to diagnosis and detection of MDR-TB in bronchoalveolar lavage specimens. (author)

  17. Decreased C3 Activation by the devR Gene-Disrupted Mycobacterium tuberculosis Strain in Comparison to the Wild-Type Strain

    Directory of Open Access Journals (Sweden)

    V. Narayan Rao

    2013-01-01

    Full Text Available Activation of the complement component C3 is an important step in the complement cascade, contributing to inflammatory mechanisms. Considerable research on gene-disrupted mycobacterial strains using animal models of tuberculosis infection has reported the roles of some of the mycobacterial genes during tuberculosis infection. The aim of the present study was to assess the pattern of complement activation by the devR gene-disrupted Mycobacterium tuberculosis H37Rv strain and compare with that by its wild-type strain. In vitro complement activation at the level of C3 by the gene-disrupted strain, its complemented strain, and wild-type strain was performed using solid-phase ELISA. It was observed that the ability of devR gene-disrupted M. tuberculosis H37Rv to activate C3 was significantly reduced in comparison to its wild-type strain (P<0.05. In addition, C3 activation by the complemented devR mutant strain was almost similar to that of the wild strain, which indicated that the reduced ability to activate C3 could potentially be due to the deletion of devR gene. These findings indicate that the gene devR probably aids in complement activation and contributes to the inflammatory processes during tuberculosis infection.

  18. Genetic Analysis of Mycobacterium avium Complex Strains Used for Producing Purified Protein Derivatives

    Science.gov (United States)

    Semret, Makeda; Bakker, Douwe; Smart, Nonie; Olsen, Ingrid; Haslov, Kaare; Behr, Marcel A.

    2006-01-01

    For over a century, purified protein derivatives (PPD) have been used to detect mycobacterial infections in humans and livestock. Among these, reagents to detect infections by Mycobacterium avium complex organisms have been produced, but the utility of these reagents has not been clearly established due in part to limited biologic and immunologic standardization. Because there is little information about the strains used to produce these reagents (avian PPD, intracellulare PPD, scrofulaceum PPD, and Johnin), we have performed genetic characterizations of strains used to produce these products. Sequence analysis of 16S rRNA and the hsp65 gene provided results concordant with species designations provided for M. avium, Mycobacterium intracellulare, and Mycobacterium scrofulaceum organisms. For M. avium strains, comparative genomic hybridization was performed on a whole-genome DNA microarray, revealing one novel 7.9-kilobase genomic deletion in certain Johnin-producing strains, in addition to genomic variability inherent to the particular M. avium subspecies. Our findings indicate that considerable genomic differences exist between organisms used for reagents and the infecting organism being studied. These results serve as a baseline for potency studies of different preparations and should aid in comparative studies of newly discovered antigens for the diagnosis of infection and disease by M. avium complex organisms. PMID:16960109

  19. Avian mycobacteriosis in psittacines: a retrospective study of 123 cases.

    Science.gov (United States)

    Palmieri, C; Roy, P; Dhillon, A S; Shivaprasad, H L

    2013-02-01

    One hundred and twenty-three cases of mycobacterioses were diagnosed in psittacine birds from a total of 9,241 submissions for necropsy examination or histopathology made to the California Animal Health and Food Safety Laboratory System between 1990 and 2007. The species affected most commonly were Amazon parrots (Amazona spp.)(n = 32; 26%) and grey-cheeked parakeets Brotogeris pyrrophterus (n = 23; 18.7%). The main gross findings on necropsy examination were enlarged and mottled pale livers and spleens and thickening of the small intestinal wall with numerous pale miliary nodules on the mucosa. Microscopical examination revealed infiltration of foamy macrophages and giant cells containing acid-fast bacteria in various organs. The gene encoding mycobacterial 65 kDa heat shock protein (hsp65) was amplified by nested polymerase chain reaction (PCR) from DNA extracted from 22 cases. The species of Mycobacterium involved was determined by analysis of restriction endonuclease patterns of the PCR products. Mycobacterium genavense was detected in 19 cases and Mycobacterium avium in two cases. One parrotlet (Touit spp.) had a mixed infection of both species of mycobacteria. It is concluded that M. genavense is the primary cause of mycobacteriosis in psittacine birds and the potential for zoonotic disease should be considered, especially for immunocompromised owners. PMID:22884283

  20. Comparison of Mycobacterial Growth Indicator Tube with Culture on RGM Selective Agar for Detection of Mycobacteria in Sputum Samples from Patients with Cystic Fibrosis.

    Science.gov (United States)

    Eltringham, Ian; Pickering, Julie; Gough, Helen; Preece, Clair L; Perry, John D

    2016-08-01

    Nontuberculous mycobacteria (NTM) are an important cause of pulmonary disease in patients with cystic fibrosis (CF). A new culture medium (RGM medium) for the isolation of rapidly growing mycobacteria from the sputum of cystic fibrosis patients has recently been reported. The aim of this study was to compare culture of sputum samples on RGM medium with culture using a standard automated liquid culture method. Sputum samples were obtained from 187 distinct patients with CF attending King's College Hospital, London, United Kingdom. Each sample was decontaminated with 3% oxalic acid and inoculated into a mycobacterial growth indicator tube (MGIT) that was monitored for 42 days using the Bactec MGIT 960 instrument. Each sample was also cultured, without decontamination, onto RGM medium, which was incubated for 10 days at 30°C. Mycobacteria were isolated from 28 patients (prevalence, 15%). Mycobacteria were detected in 24 samples (86%) using the MGIT and in 23 samples (82%) using RGM medium (P = 1.00). In this setting, RGM medium showed sensitivity equivalent to that of the MGIT for isolation of NTM from the sputum of patients with CF. RGM medium offers a simple, convenient tool that can be embedded into routine culture methods, allowing the culture of all sputum samples that are submitted from patients with CF. PMID:27225412

  1. The ubiquitin ligase TRIM27 functions as a host restriction factor antagonized by Mycobacterium tuberculosis PtpA during mycobacterial infection

    Science.gov (United States)

    Wang, Jing; Teng, Jade L. L.; Zhao, Dongdong; Ge, Pupu; Li, Bingxi; Woo, Patrick C. Y.; Liu, Cui Hua

    2016-01-01

    Macrophage-mediated innate immune responses play crucial roles in host defense against pathogens. Recent years have seen an explosion of host proteins that act as restriction factors blocking viral replication in infected cells. However, the essential factors restricting Mycobacterium tuberculosis (Mtb) and their regulatory roles during mycobacterial infection remain largely unknown. We previously reported that Mtb tyrosine phosphatase PtpA, a secreted effector protein required for intracellular survival of Mtb, inhibits innate immunity by co-opting the host ubiquitin system. Here, we identified a new PtpA-interacting host protein TRIM27, which is reported to possess a conserved RING domain and usually acts as an E3 ubiquitin ligase that interferes with various cellular processes. We further demonstrated that TRIM27 restricts survival of mycobacteria in macrophages by promoting innate immune responses and cell apoptosis. Interestingly, Mtb PtpA could antagonize TRIM27-promoted JNK/p38 MAPK pathway activation and cell apoptosis through competitively binding to the RING domain of TRIM27. TRIM27 probably works as a potential restriction factor for Mtb and its function is counteracted by Mtb effector proteins such as PtpA. Our study suggests a potential tuberculosis treatment via targeting of the TRIM27-PtpA interfaces. PMID:27698396

  2. Exposure to a Mycobacterial Antigen, ESAT-6, Exacerbates Granulomatous and Fibrotic Changes in a Multiwall Carbon Nanotube Model of Chronic Pulmonary Disease

    Science.gov (United States)

    Malur, Anagha; Barna, Barbara P; Patel, Janki; McPeek, Matthew; Wingard, Christopher J; Dobbs, Larry; Thomassen, Mary Jane

    2016-01-01

    Recent studies suggest additive effects of environmental pollutants and microbial antigens on respiratory disease. We established a granuloma model in which instilled multiwall carbon nanotubes (MWCNT) elicit granulomatous pathology. We hypothesized that mycobacterial antigen ESAT-6, a T cell activator associated with tuberculosis and sarcoidosis, might alter pathology. Wild-type C57Bl/6 mice received MWCNT with or without ESAT-6 peptide. Controls received vehicle (surfactant-PBS) or ESAT-6 alone. Mice were evaluated 60 days later for granulomas, fibrosis, and bronchoalveolar lavage (BAL) cell expression of inflammatory mediators (CCL2, MMP-12, and Osteopontin). Results indicated increased granulomas, fibrosis, and inflammatory mediators in mice receiving the combination of MWCNT+ESAT-6 compared to MWCNT or vehicle alone. ESAT-6 alone showed no significant effect on these pathological endpoints. However, CD3 (+) lymphocyte infiltration of lung tissue increased with MWCNT+ESAT-6 versus MWCNT alone. Findings suggest that concurrent exposure to microbial antigen and MWCNT exacerbates chronic pulmonary disease. PMID:27019768

  3. T Cell Reactivity against Mycolyl Transferase Antigen 85 of M. tuberculosis in HIV-TB Coinfected Subjects and in AIDS Patients Suffering from Tuberculosis and Nontuberculous Mycobacterial Infections

    Directory of Open Access Journals (Sweden)

    Pascal Launois

    2011-01-01

    Full Text Available The mycolyl transferase antigen 85 complex is a major secreted protein family from mycobacterial culture filtrate, demonstrating powerful T cell stimulatory properties in most HIV-negative, tuberculin-positive volunteers with latent M.tuberculosis infection and only weak responses in HIV-negative tuberculosis patients. Here, we have analyzed T cell reactivity against PPD and Ag85 in HIV-infected individuals, without or with clinical symptoms of tuberculosis, and in AIDS patients with disease caused by nontuberculous mycobacteria. Whereas responses to PPD were not significantly different in HIV-negative and HIV-positive tuberculin-positive volunteers, responses to Ag85 were significantly decreased in the HIV-positive (CDC-A and CDC-B group. Tuberculosis patients demonstrated low T cell reactivity against Ag85, irrespective of HIV infection, and finally AIDS patients suffering from NTM infections were completely nonreactive to Ag85. A one-year follow-up of twelve HIV-positive tuberculin-positive individuals indicated a decreased reactivity against Ag85 in patients developing clinical tuberculosis, highlighting the protective potential of this antigen.

  4. Serologic follow-up of IgG responses against recombinant mycobacterial proteins ML0405, ML2331 and LID-1 in a leprosy hyperendemic area in Venezuela

    Directory of Open Access Journals (Sweden)

    Elsa Rada

    2012-12-01

    Full Text Available Leprosy is a slowly evolving disease that occurs mainly in adults. In this study, the Mamaría Village, state of Portuguesa was selected because it had one of the highest prevalence rates (13.25% of leprosy cases in 1997. Between 1998-2004, 20.2% of the 89 cases registered in this village were less than 15 years old and 61.8% were males. Pau-cibacillary (PB lesions were the predominant clinical forms identified, although also multibacillary (MB forms were found. Additionally, 76% of the patients were bacteriologically negative. At the time of diagnosis, 75% of the patients presented with grade 0 disabilities, 23% with grade 1 and 2% with grade 2. Serum samples were collected from 18 PB and 15 MB patients, in addition to 14 family contacts, at the beginning and end of treatment. All the groups were re-evaluated during a three-year period (2008-2011. The proteins used for evaluation were ML0405, ML2331 and LID-1. These mycobacterial proteins were highly specific for Mycobacterium leprae and the IgG responses decreased in both MB and PB patients during multidrug treatment. Our results suggest that these antigens could be used as markers for successful treatment of non-reactional lepromatous patients.

  5. Phenolic-glycolipid-1 and lipoarabinomannan preferentially modulate TCR- and CD28-triggered proximal biochemical events, leading to T-cell unresponsiveness in mycobacterial diseases

    Directory of Open Access Journals (Sweden)

    Dagur Pradeep

    2012-09-01

    Full Text Available Background Advanced stages of leprosy show T cell unresponsiveness and lipids of mycobacterial origin are speculated to modulate immune responses in these patients. Present study elucidates the role of phenolicglycolipid (PGL-1 and Mannose-capped lipoarabinomannan (Man-LAM on TCR- and TCR/CD28- mediated signalling. Results We observed that lipid antigens significantly inhibit proximal early signalling events like Zap-70 phosphorylation and calcium mobilization. Interestingly, these antigens preferentially curtailed TCR-triggered early downstream signalling events like p38 phosphorylation whereas potentiated that of Erk1/2. Further, at later stages inhibition of NFAT binding, IL-2 message, CD25 expression and T-cell blastogenesis by PGL-1 and Man-LAM was noted. Conclusion Altogether, we report that Man-LAM and PGL-1 preferentially interfere with TCR/CD28-triggered upstream cell signalling events, leading to reduced IL-2 secretion and T-cell blastogenesis which potentially could lead to immunosupression and thus, disease exacerbation, as noted in disease spectrum.

  6. Cell wall lipids from Mycobacterium bovis BCG are inflammatory when inoculated within a gel matrix: characterization of a new model of the granulomatous response to mycobacterial components.

    Science.gov (United States)

    Rhoades, Elizabeth R; Geisel, Rachel E; Butcher, Barbara A; McDonough, Sean; Russell, David G

    2005-05-01

    The chronic inflammatory response to Mycobacterium generates complex granulomatous lesions that balance containment with destruction of infected tissues. To study the contributing factors from host and pathogen, we developed a model wherein defined mycobacterial components and leukocytes are delivered in a gel, eliciting a localized response that can be retrieved and analysed. We validated the model by comparing responses to the cell wall lipids from Mycobacterium bovis bacillus Calmette-Guerin (BCG) to reported activities in other models. BCG lipid-coated beads and bone marrow-derived macrophages (input macrophages) were injected intraperitoneally into BALB/c mice. Input macrophages and recruited peritoneal exudate cells took up fluorescently tagged BCG lipids, and matrix-associated macrophages and neutrophils produced tumor necrosis factor, interleukin-1alpha, and interleukin-6. Leukocyte numbers and cytokine levels were greater in BCG lipid-bearing matrices than matrices containing non-coated or phosphatidylglycerol-coated beads. Leukocytes arrived in successive waves of neutrophils, macrophages and eosinophils, followed by NK and T cells (CD4(+), CD8(+), or gammadelta) at 7 days and B cells within 12 days. BCG lipids also predisposed matrices for adherence and vascularization, enhancing cellular recruitment. We submit that the matrix model presents pertinent features of the murine granulomatous response that will prove to be an adaptable method for study of this complex response.

  7. Mutation in alkylhydroperoxidase D gene dramatically decreases persistence of Mycobacterium bovis bacillus calmette-guerin in infected macrophage

    Directory of Open Access Journals (Sweden)

    Farivar Taghi

    2008-07-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the leading cause of death from a single bacterial species in the world and is subjected to a highly oxidative environment in its host macrophage and consequently has evolved protective mechanisms against reactive oxygen and nitrogen intermediates. Alkyl hydroperoxidase D (AhpD is a molecule from these mycobacterial defense systems that has a dual function. It not only works with Alkyl hydroperoxidase C (AhpC in mycobacterial defense system against oxidative stress but also has a role in oxidation/reduction of succinyltransferase B (SucB, dihydrolipoamide dehydrogenase (LPD and AhpC. The present study was undertaken to find out the effects of inactivation of ahpD gene in the intra-macrophage persistence of resulted BCG mutant. Materials and Methods: We did allelic exchange mutagenesis in Mycobacterium bovis BCG and evaluate the effects of this mutagenesis in intracellular persistence of wild type BCG strains and ahpD mutant ones by comparing colony forming units (CFU in infected macrophage. Results: Our findings showed that after producing allelic exchange mutagenesis in ahpD gene of M.bovis BCG a sever decrease in the CFU′s of ahpD mutant BCG strains has been observed and intracellular persistence of ahpD mutant BCG strains decreased significantly. Conclusion: Mutagenesis in ahpD gene will cause significant decrease in intracellular survival of ahpD mutant strains than wild type M.bovis BCG strains and could leads to an inefficiency in pyruvate dehydrogenase pathway and could also impair impairs mycobacterial defense system against oxidative and nitrosative stress.

  8. Mycobacteria mobility shift assay: a method for the rapid identification of Mycobacterium tuberculosis and nontuberculous mycobacteria

    Directory of Open Access Journals (Sweden)

    Letícia Muraro Wildner

    2014-06-01

    Full Text Available The identification of mycobacteria is essential because tuberculosis (TB and mycobacteriosis are clinically indistinguishable and require different therapeutic regimens. The traditional phenotypic method is time consuming and may last up to 60 days. Indeed, rapid, affordable, specific and easy-to-perform identification methods are needed. We have previously described a polymerase chain reaction-based method called a mycobacteria mobility shift assay (MMSA that was designed for Mycobacterium tuberculosis complex (MTC and nontuberculous mycobacteria (NTM species identification. The aim of this study was to assess the MMSA for the identification of MTC and NTM clinical isolates and to compare its performance with that of the PRA-hsp65 method. A total of 204 clinical isolates (102 NTM and 102 MTC were identified by the MMSA and PRA-hsp65. For isolates for which these methods gave discordant results, definitive species identification was obtained by sequencing fragments of the 16S rRNA and hsp65 genes. Both methods correctly identified all MTC isolates. Among the NTM isolates, the MMSA alone assigned 94 (92.2% to a complex or species, whereas the PRA-hsp65 method assigned 100% to a species. A 91.5% agreement was observed for the 94 NTM isolates identified by both methods. The MMSA provided correct identification for 96.8% of the NTM isolates compared with 94.7% for PRA-hsp65. The MMSA is a suitable auxiliary method for routine use for the rapid identification of mycobacteria.

  9. The radiology of IRIS (immune reconstitution inflammatory syndrome) in patients with mycobacterial tuberculosis and HIV co-infection: appearances in 11 patients

    International Nuclear Information System (INIS)

    Aim: To determine the radiological manifestations of IRIS (immune reconstitution inflammatory syndrome) in patients with HIV and mycobacterium tuberculosis co-infection, in the context of their demographic and clinical data. Materials and methods: The radiological imaging, demographic and clinical data of 11 patients diagnosed with IRIS associated with HIV and mycobacterial tuberculosis co-infection were studied retrospectively. Where available, follow-up imaging studies were also reviewed. Results: The most common radiological feature of IRIS was lymph node enlargement (73%), with central low attenuation centres, in keeping with necrosis, present in most of these cases (88%). Most commonly affected were intra-abdominal nodes (70%), followed by axillary (40%) and mediastinal lymph nodes (36%). Within the lung parenchyma, diffuse, bilateral pulmonary nodules were seen in 55% of cases. Unilateral small volume pleural effusions were seen in two cases with associated parenchymal changes seen in only one. Small volume ascites was seen in two cases. Thirty-six percent of cases presented with new or worsening abscesses despite treatment. In this context, image-guided radiological drainage proved a useful adjunct to the conventional medical therapy for IRIS. The most common clinical signs of IRIS included fever (64%), abdominal pain (36%) and cough (27%). Conclusion: We have described the radiological features that are characteristic in IRIS and the importance of putting these into context with the clinical and pathological findings as part of a multidisciplinary approach in making the diagnosis. The role of the radiologist is central in diagnosis, monitoring of disease progression and management of complications in patients with IRIS

  10. Incidence of active mycobacterial infections in Brazilian patients with chronic inflammatory arthritis and negative evaluation for latent tuberculosis infection at baseline - A longitudinal analysis after using TNFα blockers

    Science.gov (United States)

    Gomes, Carina Mori Frade; Terreri, Maria Teresa; de Moraes-Pinto, Maria Isabel; Barbosa, Cássia; Machado, Natália Pereira; Melo, Maria Roberta; Pinheiro, Marcelo Medeiros

    2015-01-01

    Several studies point to the increased risk of reactivation of latent tuberculosis infection (LTBI) in patients with chronic inflammatory arthritis (CIAs) after using tumour necrosis factor (TNF)α blockers. To study the incidence of active mycobacterial infections (aMI) in patients starting TNF α blockers, 262 patients were included in this study: 109 with rheumatoid arthritis (RA), 93 with ankylosing spondylitis (AS), 44 with juvenile idiopathic arthritis (JIA) and 16 with psoriatic arthritis (PsA). All patients had indication for anti-TNF α therapy. Epidemiologic and clinical data were evaluated and a simple X-ray and tuberculin skin test (TST) were performed. The control group included 215 healthy individuals. The follow-up was 48 months to identify cases of aMI. TST positivity was higher in patients with AS (37.6%) than in RA (12.8%), PsA (18.8%) and JIA (6.8%) (p < 0.001). In the control group, TST positivity was 32.7%. Nine (3.43%) patients were diagnosed with aMI. The overall incidence rate of aMI was 86.93/100,000 person-years [95% confidence interval (CI) 23.6-217.9] for patients and 35.79/100,000 person-years (95% CI 12.4-69.6) for control group (p < 0.001). All patients who developed aMI had no evidence of LTBI at the baseline evaluation. Patients with CIA starting TNF α blockers and no evidence of LTBI at baseline, particularly with nonreactive TST, may have higher risk of aMI. PMID:26560983

  11. Contribution of MINCLE-SYK Signaling to Activation of Primary Human APCs by Mycobacterial Cord Factor and the Novel Adjuvant TDB.

    Science.gov (United States)

    Ostrop, Jenny; Jozefowski, Katrin; Zimmermann, Stephanie; Hofmann, Katharina; Strasser, Erwin; Lepenies, Bernd; Lang, Roland

    2015-09-01

    Trehalose-6,6-dimycolate (TDM), the mycobacterial cord factor, is an abundant cell wall glycolipid and major virulence factor of Mycobacterium tuberculosis. Its synthetic analog trehalose-6,6-dibehenate (TDB) is a new adjuvant currently in phase I clinical trials. In rodents, the C-type lectin receptors Mincle and Mcl bind TDB/TDM and activate macrophages and dendritic cells (DC) through the Syk-Card9 pathway. However, it is unknown whether these glycolipids activate human innate immune cells through the same mechanism. We performed in vitro analysis of TDB/TDM-stimulated primary human monocytes, macrophages, and DC; determined C-type lectin receptor expression; and tested the contribution of SYK, MINCLE, and MCL by small interfering RNA knockdown and genetic complementation. We observed a robust chemokine and cytokine release in response to TDB or TDM. MCSF-driven macrophages secreted higher levels of IL-8, IL-6, CCL3, CCL4, and CCL2 after stimulation with TDM, whereas DC responded more strongly to TDB and GM-CSF-driven macrophages were equally responsive to TDB and TDM. SYK kinase and the adaptor protein CARD9 were essential for glycolipid-induced IL-8 production. mRNA expression of MINCLE and MCL was high in monocytes and macrophages, with MINCLE and MCL proteins localized intracellularly under resting conditions. Small interfering RNA-mediated MINCLE or MCL knockdown caused on average reduced TDB- or TDM-induced IL-8 production. Conversely, retroviral expression in murine Mincle-deficient DC revealed that human MINCLE, but not MCL, was sufficient to confer responsiveness to TDB/TDM. Our study demonstrates that SYK-CARD9 signaling plays a key role in TDB/TDM-induced activation of innate immune cells in man as in mouse, likely by engagement of MINCLE. PMID:26202982

  12. Farmed deer: A veterinary model for chronic mycobacterial diseases that is accessible, appropriate and cost-effective

    Directory of Open Access Journals (Sweden)

    Frank Griffin

    2014-01-01

    Full Text Available Although most studies in immunology have used inbred mice as the experimental model to study fundamental immune mechanisms they have been proven to be limited in their ability to chart complex functional immune pathways, such as are seen in outbred populations of humans or animals. Translation of the findings from inbred mouse studies into practical solutions in therapeutics or the clinic has been remarkably unproductive compared with many other areas of clinical practice in human and veterinary medicine. Access to an unlimited array of mouse strains and an increasing number of genetically modified strains continues to sustain their paramount position in immunology research. Since the mouse studies have provided little more than the dictionary and glossary of immunology, another approach will be required to write the classic exposition of functional immunity. Domestic animals such as ruminants and swine present worthwhile alternatives as models for immunological research into infectious diseases, which may be more informative and cost effective. The original constraint on large animal research through a lack of reagents has been superseded by new molecular technologies and robotics that allow research to progress from gene discovery to systems biology, seamlessly. The current review attempts to highlight how exotic animals such as deer can leverage off the knowledge of ruminant genomics to provide cost-effective models for research into complex, chronic infections. The unique opportunity they provide relates to their diversity and polymorphic genotypes and the integrity of their phenotype for a range of infectious diseases.

  13. The Differential Gene Expression Pattern of Mycobacterium tuberculosis in Response to Capreomycin and PA-824 versus First-Line TB Drugs Reveals Stress- and PE/PPE-Related Drug Targets

    Directory of Open Access Journals (Sweden)

    Li M. Fu

    2009-01-01

    Full Text Available Tuberculosis is a leading infectious disease causing millions of deaths each year. How to eradicate mycobacterial persistence has become a central research focus for developing next-generation TB drugs. Yet, the knowledge in this area is fundamentally limited and only a few drugs, notably capreomycin and PA-824, have been shown to be active against non-replicating persistent TB bacilli. In this study, we performed a new bioinformatics analysis on microarray-based gene expression data obtained from the public domain to explore genes that were differentially induced by drugs between the group of capreomycin and PA-824 and the group of mainly the first-line TB drugs. Our study has identified 42 genes specifically induced by capreomycin and PA-824. Many of these genes are related to stress responses. In terms of the distribution of identified genes in a specific category relative to the whole genome, only the categories of PE/PPE and conserved hypotheticals have statistical significance. Six among the 42 genes identified in this study are on the list of the top 100 persistence targets selected by the TB Structural Genomics Consortium. Further biological elucidation of their roles in mycobacterial persistence is warranted.

  14. Identification of a novel gene product that promotes survival of Mycobacterium smegmatis in macrophages.

    Directory of Open Access Journals (Sweden)

    Assunta Pelosi

    Full Text Available BACKGROUND: Bacteria of the suborder Corynebacterineae include significant human pathogens such as Mycobacterium tuberculosis and M. leprae. Drug resistance in mycobacteria is increasingly common making identification of new antimicrobials a priority. Mycobacteria replicate intracellularly, most commonly within the phagosomes of macrophages, and bacterial proteins essential for intracellular survival and persistence are particularly attractive targets for intervention with new generations of anti-mycobacterial drugs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified a novel gene that, when inactivated, leads to accelerated death of M. smegmatis within a macrophage cell line in the first eight hours following infection. Complementation of the mutant with an intact copy of the gene restored survival to near wild type levels. Gene disruption did not affect growth compared to wild type M. smegmatis in axenic culture or in the presence of low pH or reactive oxygen intermediates, suggesting the growth defect is not related to increased susceptibility to these stresses. The disrupted gene, MSMEG_5817, is conserved in all mycobacteria for which genome sequence information is available, and designated Rv0807 in M. tuberculosis. Although homology searches suggest that MSMEG_5817 is similar to the serine:pyruvate aminotransferase of Brevibacterium linens suggesting a possible role in glyoxylate metabolism, enzymatic assays comparing activity in wild type and mutant strains demonstrated no differences in the capacity to metabolize glyoxylate. CONCLUSIONS/SIGNIFICANCE: MSMEG_5817 is a previously uncharacterized gene that facilitates intracellular survival of mycobacteria. Interference with the function of MSMEG_5817 may provide a novel therapeutic approach for control of mycobacterial pathogens by assisting the host immune system in clearance of persistent intracellular bacteria.

  15. A randomised controlled trial of the effects of albendazole in pregnancy on maternal responses to mycobacterial antigens and infant responses to bacille Calmette-Guérin (BCG immunisation [ISRCTN32849447

    Directory of Open Access Journals (Sweden)

    Nampijja Margaret

    2005-12-01

    Full Text Available Abstract Background Maternal schistosomiasis and filariasis have been shown to influence infant responses to neonatal bacille Calmette-Guérin (BCG immunisation but the effects of maternal hookworm, and of de-worming in pregnancy, are unknown. Methods In Entebbe, Uganda, we conducted a randomised, double-blind, placebo-controlled trial of a single dose of 400 mg of albendazole in the second trimester of pregnancy. Neonates received BCG. Interferon-gamma (IFN-γ and interleukin (IL-5 responses to a mycobacterial antigen (crude culture filtrate proteins (CFP of Mycobacterium tuberculosis were measured in a whole blood assay. We analysed results for binary variables using χ2 tests and logistic regression. We analysed continuous variables using Wilcoxon's tests. Results Maternal hookworm was associated with reduced maternal IFN-γ responses to CFP (adjusted odds ratio for IFN-γ > median response: 0.14 (95% confidence interval 0.02–0.83, p = 0.021. Conversely, maternal hookworm was associated with subsequent increased IFN-γ responses in their one-year-old infants (adjusted OR 17.65 (1.20–258.66; p = 0.013. Maternal albendazole tended to reduce these effects. Conclusion Untreated hookworm infection in pregnancy was associated with reduced maternal IFN-γ responses to mycobacterial antigens, but increased responses in their infants one year after BCG immunisation. The mechanisms of these effects, and their implications for protective immunity remain, to be determined.

  16. Mycobacterial and HIV infections up-regulated human zinc finger protein 134, a novel positive regulator of HIV-1 LTR activity and viral propagation.

    Directory of Open Access Journals (Sweden)

    Ronald Benjamin

    Full Text Available BACKGROUND: Concurrent occurrence of HIV and Tuberculosis (TB infections influence the cellular environment of the host for synergistic existence. An elementary approach to understand such coalition at the molecular level is to understand the interactions of the host and the viral factors that subsequently effect viral replication. Long terminal repeats (LTR of HIV genome serve as a template for binding trans-acting viral and cellular factors that regulate its transcriptional activity, thereby, deciding the fate of HIV pathogenesis, making it an ideal system to explore the interplay between HIV and the host. METHODOLOGY/PRINCIPAL FINDINGS: In this study, using biotinylated full length HIV-1 LTR sequence as bait followed by MALDI analyses, we identified and further characterized human-Zinc-finger-protein-134 (hZNF-134 as a novel positive regulator of HIV-1 that promoted LTR-driven transcription and viral production. Over-expression of hZNF-134 promoted LTR driven luciferase activity and viral transcripts, resulting in increased virus production while siRNA mediated knockdown reduced both the viral transcripts and the viral titers, establishing hZNF-134 as a positive effector of HIV-1. HIV, Mycobacteria and HIV-TB co-infections increased hZNF-134 expressions in PBMCs, the impact being highest by mycobacteria. Corroborating these observations, primary TB patients (n = 22 recorded extraordinarily high transcript levels of hZNF-134 as compared to healthy controls (n = 16. CONCLUSIONS/SIGNIFICANCE: With these observations, it was concluded that hZNF-134, which promoted HIV-1 LTR activity acted as a positive regulator of HIV propagation in human host. High titers of hZNF-134 transcripts in TB patients suggest that up-regulation of such positive effectors of HIV-1 upon mycobacterial infection can be yet another mechanism by which mycobacteria assists HIV-1 propagation during HIV-TB co-infections. hZNF-134, an uncharacterized host protein, thus

  17. Clinical applicability of PCR-RFLP in detection of mycobacterium infections of skin%PCR-RFLP法直接检测分枝杆菌皮肤感染的临床应用

    Institute of Scientific and Technical Information of China (English)

    张彩萍; 丁克云; 王洪生; 冯雨苗; 林麟; 崔盘根; 陈敏; 吴勤学

    2013-01-01

    目的:评价分枝杆菌热休克蛋白65(Hsp65)基因检测分枝杆菌皮肤感染标本的敏感性和特异性.方法:多聚酶链反应-限制性片段长度多态性(PCR-RFLP)的10%非变性聚丙烯酰胺凝胶法直接检测Hsp65基因,PCR-RFLP检测阳性的标本再经Hsp65基因和16S rRNA DNA基因测序验证.结果:与培养法相比,PCR-RFLP法检测临床分枝杆菌皮肤感染的敏感性为30% (3/10),特异性为100%(10/10).结论:分枝杆菌PCR-RFLP的10%非变性聚丙烯酰胺凝胶法可用于分枝杆菌皮肤感染的临床检测.%Objective: To assess the sensitivity and specificity of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)based on hsp65 by 10% non-denaturizing polyacrylamide gel in the detection of mycobacterium infections of skin. Methods: Twenty clinical skin specimens suspected of mycobacterium infections were detected and identified by culture and PCR - RFLP directly and confirmed by sequencing of hsp65 and 16S rRNA DNA genes. Results: Compared with culture method, the sensitivity and the specificity of PCR - RFLP were 30% (3/10) and 100% (10/10). Conclusion: PCR- RFLP based on hsp65 with 10% polyacrylamide gel can be clinically applied in the detection of mycobacterium infections of skin.

  18. Analysis on Epidemiological and Clinical Characteristics of 63 Cases of Nontuberculous mycobacterial(NTM)Lung Disease%63例非结核分枝杆菌肺病的流行病学及临床特点分析

    Institute of Scientific and Technical Information of China (English)

    梁冰; 黄瑞霞; 邓虹; 何庆秋

    2011-01-01

    目的 探讨非结核分枝杆菌肺病的临床特点及防治对策.方法 对2009-2011年7月广州市结核病防治所二分所经过实验室检查确诊的63例非结核分枝杆菌肺病患者进行分析.结果 非结核分枝杆菌肺病波及两肺叶为多(58%),双侧同时患病较多(51%),空洞仅占25%.涂阴培阳44%,涂阳培阳56%,菌型鉴定以龟分枝杆菌为多占44%.耐药以耐多药比例最大(占77%),耐药顺位为耐多药>耐二药>单药.仅有3例是对一二线抗结核药全敏感.其中47例为初治病例(75%),16例复治病例(25%).结论 由于生活环境的变迁可能导致了非结核分枝杆菌的习性发生了变化,以至于目前非结核分枝杆菌肺病的临床特点也发生了不同程度的改变.%Objective To investigate the nontuberculcxus mycobacterial(NTM) lung disease prevention and treatment of clinical features and treatment response. Methods Sixty - three cases of nontuberculous mycobacterial lung disease confirmed by the laboratory testing in the Second Clinic of Guangzhou Tuberculosis Dispensary from 2009 to July 2011 were analyzed. Results The case of both lung lobe were affected by nontuberculous mycobacterial accounted for 58%, while the case of both sides of lung were affected accounted for 51 %, and the cavityaccounted for only 25%. The bacteria - based . Identification of M. Chelonei accounted for more than 44% for the. Multiple drug resistance tuberculosis accounted for the largest proportion (77%) of drug - resistance. Conclusions As the environment changes may result in a nontuberculous mycobacteria habits change, so the current nontuberculous mycobacterial lung disease also occurred in the clinical features of varying degrees of change. In order to have a better control of multidrug- resistant tuberculosis, MDR-TB. And prevent the spread and infection of both multiple drug resistance tubercle bacillus and NTM with the property of MDR, therefore nontuberculous

  19. Immunoglobulin genes

    Energy Technology Data Exchange (ETDEWEB)

    Honjo, T. (Kyoto Univ. (Japan)); Alt, F.W. (Columbia Univ., Dobbs Ferry, NY (USA). Hudson Labs.); Rabbitts, T.H. (Medical Research Council, Cambridge (UK))

    1989-01-01

    This book reports on the structure, function, and expression of the genes encoding antibodies in normal and neoplastic cells. Topics covered are: B Cells; Organization and rearrangement of immunoglobin genes; Immunoglobin genes in disease; Immunoglobin gene expression; and Immunoglobin-related genes.

  20. Polyphasic taxonomic analysis establishes Mycobacterium indicus pranii as a distinct species.

    Directory of Open Access Journals (Sweden)

    Vikram Saini

    Full Text Available BACKGROUND: Mycobacterium indicus pranii (MIP, popularly known as Mw, is a cultivable, non-pathogenic organism, which, based on its growth and metabolic properties, is classified in Runyon Group IV along with M. fortuitum, M. smegmatis and M. vaccae. The novelty of this bacterium was accredited to its immunological ability to undergo antigen driven blast transformation of leukocytes and delayed hypersensitivity skin test in leprosy patients, a disease endemic in the Indian sub-continent. Consequently, MIP has been extensively evaluated for its biochemical and immunological properties leading to its usage as an immunomodulator in leprosy and tuberculosis patients. However, owing to advances in sequencing and culture techniques, the citing of new strains with almost 100% similarity in the sequences of marker genes like 16S rRNA, has compromised the identity of MIP as a novel species. Hence, to define its precise taxonomic position, we have carried out polyphasic taxonomic studies on MIP that integrate its phenotypic, chemotaxonomic and molecular phylogenetic attributes. METHODOLOGY/PRINCIPAL FINDINGS: The comparative analysis of 16S rRNA sequence of MIP by using BLAST algorithm at NCBI (nr database revealed a similarity of > or =99% with M. intracellulare, M. arosiense, M. chimaera, M. seoulense, M. avium subsp. hominissuis, M. avium subsp. paratuberculosis and M. bohemicum. Further analysis with other widely used markers like rpoB and hsp65 could resolve the phylogenetic relationship between MIP and other closely related mycobacteria apart from M. intracellulare and M. chimaera, which shares > or =99% similarity with corresponding MIP orthologues. Molecular phylogenetic analysis, based on the concatenation of candidate orthologues of 16S rRNA, hsp65 and rpoB, also substantiated its distinctiveness from all the related organisms used in the analysis excluding M. intracellulare and M. chimaera with which it exhibited a close proximity. This

  1. Gene expression

    International Nuclear Information System (INIS)

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn2+ or Cd2+. We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  2. Gene therapy

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    2005147 CNHK200-hA-a gene-viral therapeutic system and its antitumor effect on lung cancer. WANG Wei-guo(王伟国),et al. Viral & Gene Ther Center, Eastern Hepatobilli Surg Instit 2nd Milit Univ, Shanghai 200438. Chin J Oncol,2005:27(2):69-72. Objective: To develop a novel vector system, which combines the advantages of the gene therapy,

  3. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela; Goedegebuur, Frits; Van Solingen, Pieter; Ward, Michael

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  4. Gene therapy.

    OpenAIRE

    Mota Biosca, Anna

    1992-01-01

    Applications of gene therapy have been evaluated in virtually every oral tissue, and many of these have proved successful at least in animal models. While gene therapy will not be used routinely in the next decade, practitioners of oral medicine should be aware of the potential of this novel type of treatment that doubtless will benefit many patients with oral diseases.

  5. [Language gene].

    Science.gov (United States)

    Takahashi, Hiroshi

    2006-11-01

    The human capacity for acquiring speech and language must derive, at least in part, from the genome. Recent advance in the field of molecular genetics finally discovered 'Language Gene'. Disruption of FOXP2 gene, the firstly identified 'language gene' causes severe speech and language disorder. To elucidate the anatomical basis of language processing in the brain, we examined the expression pattern of FOXP2/Foxp2 genes in the monkey and rat brains through development. We found the preferential expression of FOXP2/Foxp2 in the striosomal compartment of the developing striatum. Thus, we suggest the striatum, particularly striosomal system may participate in neural information processing for language and speech. Our suggestion is consistent with the declarative/ procedural model of language proposed by Ullman (1997, 2001), which the procedural memory-dependent mental grammar is rooted in the basal ganglia and the frontal cortex, and the declarative memory-dependent mental lexicon is rooted in the temporal lobe. PMID:17432197

  6. Characterization of the first report of Mycobacterium timonense infecting an HIV patient in an Ecuadorian hospital.

    Science.gov (United States)

    Zurita, J; Ortega-Paredes, D; Mora, M; Espinel, N; Parra, H; Febres, L; Zurita-Salinas, C

    2014-12-01

    Mycobacterium timonense is a non-tuberculous mycobacteria (NTM) described in southern France in 2009, and to our knowledge, not reported again as a human pathogen in indexed literature. The aim of this work was to characterize the first clinical isolate of M. timonense in Ecuador. Time of growth, biochemical tests, thin layer growth test, PCR-RFLP analysis of the hsp65 gene and MALDI-TOF spectra analysis were not able to identify the species. The species identification was achieved through sequencing of rrs, hsp65 and rpoB genes. The results highlight the necessity to set up a sequencing method to identify emerging NTM in Ecuadorian clinical facilities. PMID:24813256

  7. Performance of an in-house real-time polymerase chain reaction for identification of Mycobacterium tuberculosis isolates in laboratory routine diagnosis from a high burden setting

    Science.gov (United States)

    Gallo, Juliana Failde; Pinhata, Juliana Maira Watanabe; Chimara, Erica; Gonçalves, Maria Gisele; Fukasawa, Lucila Okuyama; de Oliveira, Rosangela Siqueira

    2016-01-01

    Abstract Brazil is one of the high burden countries for tuberculosis, and a rapid diagnosis is essential for effective control of the disease. In the present study, an in-house real-time polymerase chain reaction (PCR) assay targeting the mpt64 gene for identification of Mycobacterium tuberculosis complex isolates was evaluated under routine diagnosis conditions in a reference laboratory. From May 2011 to July 2012, 1,520 isolates of mycobacteria were prospectively submitted for phenotypic and/or PRA-hsp65 identification and to real-time PCR. The mpt64 real-time PCR showed 99.7% sensitivity and 96% specificity and detected 79.4% of the cases missed by phenotypic and PRA-hsp65 identification. The in-house real-time PCR assay showed high sensitivity and specificity and was successfully implemented in the routine diagnosis of tuberculosis in a reference laboratory from a high burden setting. PMID:27598243

  8. An atypical mycobacterial infection of the shoulder

    Directory of Open Access Journals (Sweden)

    Christopher L Talbot

    2012-01-01

    Full Text Available Mycobacterium malmoense is an acid-fast non-tuberculous organism that most commonly causes pulmonary infection. Extrapulmonary infection has also been reported. With an increased emphasis being placed on the clinical importance of this organism, especially within Europe, we report the first case of septic arthritis of the shoulder caused by this organism. We also highlight the importance of considering atypical mycobacterium infection in the differential diagnosis of shoulder infection and issues surrounding the management of this entity.

  9. Mycobacterial factors relevant for transmission of tuberculosis

    NARCIS (Netherlands)

    Verhagen, L.M.; Hof, S. van den; Deutekom, H. van; Hermans, P.W.M.; Kremer, K.; Borgdorff, M.W.; Soolingen, D. van

    2011-01-01

    BACKGROUND: Tuberculosis (TB) transmission is associated with patient-related risk factors. However, DNA fingerprint analysis has provided anecdotal evidence suggesting a role for bacteriological factors. METHODS: To examine the importance of the bacteriological component in TB transmission, we inve

  10. Nontuberculous Mycobacterial Infections in Cystic Fibrosis.

    Science.gov (United States)

    Martiniano, Stacey L; Nick, Jerry A; Daley, Charles L

    2016-03-01

    Nontuberculous mycobacteria (NTM) are important emerging cystic fibrosis (CF) pathogens, with estimates of prevalence ranging from 6% to 13%. Diagnosis of NTM disease in patients with CF is challenging, as the infection may remain indolent in some, without evidence of clinical consequence, whereas other patients suffer significant morbidity and mortality. Treatment requires prolonged periods of multiple drugs and varies depending on NTM species, resistance pattern, and extent of disease. The development of a disease-specific approach to the diagnosis and treatment of NTM infection in CF patients is a research priority, as a lifelong strategy is needed for this high-risk population. PMID:26857770

  11. [Frontier of mycobacterium research--host vs. mycobacterium].

    Science.gov (United States)

    Okada, Masaji; Shirakawa, Taro

    2005-09-01

    During the past decade, we have observed advance in tuberculosis research including novel vaccines, innate immunity (TLR), SNIP analysis and molecular mechanism of drug resistance. Worldwide genome project enabled the whole genome sequence of host resistant against tuberculosis as well as the whole genome sequence of M. tuberculosis H37Rv. DNA technology has also provided a great impact on the development of novel vaccine against TB. In this symposium, we have invited leading researchers in the field of the frontier study of Mycobacterium research in order to provide general overview of the cutting edge of frontier research. Molecular mechanism of drug resistance of M. tuberculosis has been clarified. On the other hand, molecular mechanism of host-defence (insusceptibility of host) against M. tuberculosis has not yet elucidated. Dr. Taro Shirakawa (Kyoto University) reviewed the susceptibility genes of host in TB infection and presented candidate genes associated with multi-drug resistant tuberculosis. Dr. Naoto Keicho (International Medical Center of Japan) tried to identify host genetic factors involved in susceptibility to pulmonary Mycobacterium avium complex (MAC) infection by candidate gene approach and genome-wide approach. In Japan, Dr. Masaji Okada (National Hospital Organization Kinki-Chuo Chest Medical Center) has been engaged actively in the development of new tuberculosis vaccines (HVJ-liposome/Hsp65 DNA + IL-12 DNA vaccine and recombinant 72f BCG vaccine). He showed basic strategy for construction of new candidate vaccines and also showed significant efficacy on the protection of tuberculosis infection using cynomolgus monkeys, which are very similar to human tuberculosis. Dr. Hatsumi Taniguchi (University of Occupational and Environmental Health) presented that M. tuberculosis mIHF and the neighbor genes went into a dormacy-like state of M. smegmatis in J774 macrophage cells. This study might provide a weapon for elucidating the mechanism of dormacy

  12. A Founder Effect of c.257 + 2T > C Mutation in NCF2 Gene Underlies Severe Chronic Granulomatous Disease in Eleven Patients.

    Science.gov (United States)

    Ben-Farhat, Khaoula; Ben-Mustapha, Imen; Ben-Ali, Meriem; Rouault, Karen; Hamami, Saber; Mekki, Najla; Ben-Chehida, Amel; Larguèche, Beya; Fitouri, Zohra; Abdelmoula, Selim; Khemiri, Monia; Guediche, Mohamed-Neji; Boukthir, Samir; Barsaoui, Sihem; Chemli, Jalel; Barbouche, Mohamed-Ridha

    2016-08-01

    Chronic granulomatous disease (CGD) is the prototypic functional neutrophil disorder caused by genetic defects in one of the five genes encoding the superoxide-generating nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase subunits of phagocytes. Mutations causing the most prevalent form of CGD in western populations are located in the X-linked-CYBB gene. The four remaining autosomal recessive (AR) forms collectively account for one-third of CGD cases. We investigated the clinical and molecular features of eleven patients with CGD from 6 consanguineous families, originating from contiguous regions in the west of Tunisia. The patients' clinical phenotype is characterized by a high incidence of mycobacterial infections. Five out of the eleven patients died despite treatment arguing in favor of a severe clinical form of CGD. These findings correlated with the absence of functional p67phox protein as well as the absence of residual reactive oxygen intermediates (ROI) production. Genetic analysis showed the presence, in all patients, of a unique mutation (c.257 + 2T > C) in NCF2 gene predicted to affect RNA splicing. Segregating analysis using nine polymorphic markers overlapping the NCF2 gene revealed a common haplotype spanning 4.1 Mb. The founder event responsible for this mutation was estimated to have arisen approximately 175 years ago. These findings will facilitate the implementation of preventive approaches through genetic counseling in affected consanguineous families. PMID:27220316

  13. Genes and Psoriasis

    Science.gov (United States)

    ... Diet Tips" to find out more! Email * Zipcode Genes and Psoriasis Genes hold the key to understanding ... is responsible for causing psoriatic disease. How do genes work? Genes control everything from height to eye ...

  14. Genes and Hearing Loss

    Science.gov (United States)

    ... Meeting Calendar Find an ENT Doctor Near You Genes and Hearing Loss Genes and Hearing Loss Patient ... mutation may only have dystopia canthorum. How Do Genes Work? Genes are a road map for the ...

  15. Mycobacterium tuberculosis nuoG is a virulence gene that inhibits apoptosis of infected host cells.

    Directory of Open Access Journals (Sweden)

    Kamalakannan Velmurugan

    2007-07-01

    Full Text Available The survival and persistence of Mycobacterium tuberculosis depends on its capacity to manipulate multiple host defense pathways, including the ability to actively inhibit the death by apoptosis of infected host cells. The genetic basis for this anti-apoptotic activity and its implication for mycobacterial virulence have not been demonstrated or elucidated. Using a novel gain-of-function genetic screen, we demonstrated that inhibition of infection-induced apoptosis of macrophages is controlled by multiple genetic loci in M. tuberculosis. Characterization of one of these loci in detail revealed that the anti-apoptosis activity was attributable to the type I NADH-dehydrogenase of M. tuberculosis, and was mainly due to the subunit of this multicomponent complex encoded by the nuoG gene. Expression of M. tuberculosis nuoG in nonpathogenic mycobacteria endowed them with the ability to inhibit apoptosis of infected human or mouse macrophages, and increased their virulence in a SCID mouse model. Conversely, deletion of nuoG in M. tuberculosis ablated its ability to inhibit macrophage apoptosis and significantly reduced its virulence in mice. These results identify a key component of the genetic basis for an important virulence trait of M. tuberculosis and support a direct causal relationship between virulence of pathogenic mycobacteria and their ability to inhibit macrophage apoptosis.

  16. Transcription analysis of the dnaA gene and oriC region of the chromosome of Mycobacterium smegmatis and Mycobacterium bovis BCG, and its regulation by the DnaA protein.

    Science.gov (United States)

    Salazar, Leiria; Guerrero, Elba; Casart, Yveth; Turcios, Lilia; Bartoli, Fulvia

    2003-03-01

    The regions flanking the Mycobacterium dnaA gene have extensive sequence conservation, and comprise various DnaA boxes. Comparative analysis of the dnaA promoter and oriC region from several mycobacterial species revealed that the localization, spacing and orientation of the DnaA boxes are conserved. Detailed transcriptional analysis in M. smegmatis and M. bovis BCG shows that the dnaN gene of both species and the dnaA gene of M. bovis BCG are transcribed from two promoters, whereas the dnaA gene of M. smegmatis is transcribed from a single promoter. RT-PCR with total RNA showed that dnaA and dnaN were expressed in both species at all growth stages. Analysis of the promoter activity using dnaA-gfp fusion plasmids and DnaA expression plasmids indicates that the dnaA gene is autoregulated, although the degree of transcriptional autorepression was moderate. Transcription was also detected in the vicinity of oriC of M. bovis BCG, but not of M. smegmatis. These results suggest that a more complex transcriptional mechanism may be involved in the slow-growing mycobacteria, which regulates the expression of dnaA and initiation of chromosomal DNA replication.

  17. Gene gymnastics

    Science.gov (United States)

    Vijayachandran, Lakshmi S; Thimiri Govinda Raj, Deepak B; Edelweiss, Evelina; Gupta, Kapil; Maier, Josef; Gordeliy, Valentin; Fitzgerald, Daniel J; Berger, Imre

    2013-01-01

    Most essential activities in eukaryotic cells are catalyzed by large multiprotein assemblies containing up to ten or more interlocking subunits. The vast majority of these protein complexes are not easily accessible for high resolution studies aimed at unlocking their mechanisms, due to their low cellular abundance and high heterogeneity. Recombinant overproduction can resolve this bottleneck and baculovirus expression vector systems (BEVS) have emerged as particularly powerful tools for the provision of eukaryotic multiprotein complexes in high quality and quantity. Recently, synthetic biology approaches have begun to make their mark in improving existing BEVS reagents by de novo design of streamlined transfer plasmids and by engineering the baculovirus genome. Here we present OmniBac, comprising new custom designed reagents that further facilitate the integration of heterologous genes into the baculovirus genome for multiprotein expression. Based on comparative genome analysis and data mining, we herein present a blueprint to custom design and engineer the entire baculovirus genome for optimized production properties using a bottom-up synthetic biology approach. PMID:23328086

  18. Principles of gene therapy

    OpenAIRE

    Mammen Biju; Ramakrishnan T; Sudhakar Uma; Vijayalakshmi

    2007-01-01

    Genes are specific sequences of bases that encode instructions to make proteins. When genes are altered so that encoded proteins are unable to carry out their normal functions, genetic disorders can result. Gene therapy is designed to introduce genetic material into cells to compensate for abnormal genes or to make a beneficial protein. This article reviews the fundamentals in gene therapy and its various modes of administration with an insight into the role of gene therapy in Periodontics an...

  19. Organization of immunoglobulin genes.

    Science.gov (United States)

    Tonegawa, S; Brack, C; Hozumi, N; Pirrotta, V

    1978-01-01

    The nucleotide-sequence determination of a cloned, embryonic Vlambda gene directly demonstrated that V genes are separate from a corresponding C gene in embryonic cells. Analysis by restriction enzymes of total cellular DNA from various sources strongly suggested that the two separate immunoglobulin genes become continuous during differentiation of B lymphocytes. There seems to be a strict correlation between the joining event and activation of the joined genes. Cloning of more immunoglobulin genes from embryo and plasma cells will not only provide direct demonstration of such a gene-joining event but also help in the elucidation of a possible relationship of the event to gene activation mechanisms.

  20. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k+) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k+ gene expression where the H S V-1 t k+ gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([18 F]F H P G; [18 F]-A C V), and pyrimidine- ([123/131 I]I V R F U; [124/131I]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [123/131I]I V R F U imaging with the H S V-1 t k+ reporter gene will be presented

  1. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  2. Identifying Gene Interaction Enrichment for Gene Expression Data

    OpenAIRE

    Jigang Zhang; Jian Li; Hong-Wen Deng

    2009-01-01

    Gene set analysis allows the inclusion of knowledge from established gene sets, such as gene pathways, and potentially improves the power of detecting differentially expressed genes. However, conventional methods of gene set analysis focus on gene marginal effects in a gene set, and ignore gene interactions which may contribute to complex human diseases. In this study, we propose a method of gene interaction enrichment analysis, which incorporates knowledge of predefined gene sets (e.g. gene ...

  3. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Science.gov (United States)

    Rady, Hamada F; Dai, Guixiang; Huang, Weitao; Shellito, Judd E; Ramsay, Alistair J

    2016-01-01

    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route. PMID:26844553

  4. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  5. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Science.gov (United States)

    Rady, Hamada F; Dai, Guixiang; Huang, Weitao; Shellito, Judd E; Ramsay, Alistair J

    2016-01-01

    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  6. Comparative genomics analysis of Mycobacterium ulcerans for the identification of putative essential genes and therapeutic candidates.

    Directory of Open Access Journals (Sweden)

    Azeem Mehmood Butt

    Full Text Available Mycobacterium ulcerans, the causative agent of Buruli ulcer, is the third most common mycobacterial disease after tuberculosis and leprosy. The present treatment options are limited and emergence of treatment resistant isolates represents a serious concern and a need for better therapeutics. Conventional drug discovery methods are time consuming and labor-intensive. Unfortunately, the slow growing nature of M. ulcerans in experimental conditions is also a barrier for drug discovery and development. In contrast, recent advancements in complete genome sequencing, in combination with cheminformatics and computational biology, represent an attractive alternative approach for the identification of therapeutic candidates worthy of experimental research. A computational, comparative genomics workflow was defined for the identification of novel therapeutic candidates against M. ulcerans, with the aim that a selected target should be essential to the pathogen, and have no homology in the human host. Initially, a total of 424 genes were predicted as essential from the M. ulcerans genome, via homology searching of essential genome content from 20 different bacteria. Metabolic pathway analysis showed that the most essential genes are associated with carbohydrate and amino acid metabolism. Among these, 236 proteins were identified as non-host and essential, and could serve as potential drug and vaccine candidates. Several drug target prioritization parameters including druggability were also calculated. Enzymes from several pathways are discussed as potential drug targets, including those from cell wall synthesis, thiamine biosynthesis, protein biosynthesis, and histidine biosynthesis. It is expected that our data will facilitate selection of M. ulcerans proteins for successful entry into drug design pipelines.

  7. Autism and Genes

    Science.gov (United States)

    National Institutes of Health, 2005

    2005-01-01

    This document defines and discusses autism and how genes play a role in the condition. Answers to the following questions are covered: (1) What are genes? (2) What is autism? (3) What causes autism? (4) Why study genes to learn about autism? (5) How do researchers look for the genes involved in autism? (screen the whole genome; conduct cytogenetic…

  8. Essential Bacillus subtilis genes

    DEFF Research Database (Denmark)

    Kobayashi, K.; Ehrlich, S.D.; Albertini, A.;

    2003-01-01

    To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes we...

  9. Principles of gene therapy

    Directory of Open Access Journals (Sweden)

    Mammen Biju

    2007-01-01

    Full Text Available Genes are specific sequences of bases that encode instructions to make proteins. When genes are altered so that encoded proteins are unable to carry out their normal functions, genetic disorders can result. Gene therapy is designed to introduce genetic material into cells to compensate for abnormal genes or to make a beneficial protein. This article reviews the fundamentals in gene therapy and its various modes of administration with an insight into the role of gene therapy in Periodontics and future percepts and the technical and ethical issues of using gene therapy.

  10. Gene doping in sports.

    Science.gov (United States)

    Unal, Mehmet; Ozer Unal, Durisehvar

    2004-01-01

    Gene or cell doping is defined by the World Anti-Doping Agency (WADA) as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". New research in genetics and genomics will be used not only to diagnose and treat disease, but also to attempt to enhance human performance. In recent years, gene therapy has shown progress and positive results that have highlighted the potential misuse of this technology and the debate of 'gene doping'. Gene therapies developed for the treatment of diseases such as anaemia (the gene for erythropoietin), muscular dystrophy (the gene for insulin-like growth factor-1) and peripheral vascular diseases (the gene for vascular endothelial growth factor) are potential doping methods. With progress in gene technology, many other genes with this potential will be discovered. For this reason, it is important to develop timely legal regulations and to research the field of gene doping in order to develop methods of detection. To protect the health of athletes and to ensure equal competitive conditions, the International Olympic Committee, WADA and International Sports Federations have accepted performance-enhancing substances and methods as being doping, and have forbidden them. Nevertheless, the desire to win causes athletes to misuse these drugs and methods. This paper reviews the current status of gene doping and candidate performance enhancement genes, and also the use of gene therapy in sports medicine and ethics of genetic enhancement.

  11. Gene therapy in periodontics

    OpenAIRE

    Anirban Chatterjee; Nidhi Singh; Mini Saluja

    2013-01-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person′s genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is ′the use of genes as medicine′. It...

  12. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  13. CHROMATIN LOOPS, GENE POSITIONING AND GENE EXPRESSION

    Directory of Open Access Journals (Sweden)

    Sjoerd eHolwerda

    2012-10-01

    Full Text Available Technological developments and intense research over the last years have led to a better understanding of the three-dimensional structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the α- and β-globin gene loci, the antigen receptor loci, the imprinted H19-Igf2 locus and the Hox gene clusters. Collectively, these studies show that regulatory DNA sequences physically contact genes to control their transcription. Proteins set up the three-dimensional configuration of the genome and we will discuss the roles of the key structural organizers CTCF and cohesin, the nuclear lamina and the transcription machinery. Finally, genes adopt non-random positions in the nuclear interior. We will review studies on gene positioning and propose that cell-specific genome conformations can juxtapose a regulatory sequence on one chromosome to a responsive gene on another chromosome to cause altered gene expression in subpopulations of cells.

  14. Cochlear Gene Therapy

    OpenAIRE

    Lustig, Lawrence R.; Akil, Omar

    2012-01-01

    The purpose of this review is to highlight recent advances in cochlear gene therapy over the past several years. Cochlear gene therapy has undergone tremendous advances over the past decade. Beginning with some groundbreaking work in 2005 documenting hair cell regeneration using virallymediated delivery of the mouse atonal 1 gene, gene therapy is now being explored as a possible treatment for a variety of causes of hearing loss.

  15. Discovering genes underlying QTL

    Energy Technology Data Exchange (ETDEWEB)

    Vanavichit, Apichart [Kasetsart University, Kamphaengsaen, Nakorn Pathom (Thailand)

    2002-02-01

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  16. Discovering genes underlying QTL

    International Nuclear Information System (INIS)

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  17. Reading and Generalist Genes

    Science.gov (United States)

    Haworth, Claire M. A.; Meaburn, Emma L.; Harlaar, Nicole; Plomin, Robert

    2007-01-01

    Twin-study research suggests that many (but not all) of the same genes contribute to genetic influence on diverse learning abilities and disabilities, a hypothesis called "generalist genes". This generalist genes hypothesis was tested using a set of 10 DNA markers (single nucleotide polymorphisms [SNPs]) found to be associated with early reading…

  18. A Pilot Study of Gene/Gene and Gene/Environment Interactions in Alzheimer Disease

    OpenAIRE

    Ghebranious, Nader; Mukesh, Bickol; Giampietro, Philip F.; Glurich, Ingrid; Mickel, Susan F.; Waring, Stephen C.; Catherine A McCarty

    2011-01-01

    Background: Although some genes associated with increased risk of Alzheimer Disease (AD) have been identified, few data exist related to gene/gene and gene/environment risk of AD. The purpose of this pilot study was to explore gene/gene and gene/environment associations in AD and to obtain data for sample size estimates for larger, more definitive studies of AD.

  19. Gene therapy: An overview

    Directory of Open Access Journals (Sweden)

    Sudip Indu

    2013-01-01

    Full Text Available Gene therapy "the use of genes as medicine" involves the transfer of a therapeutic or working copy of a gene into specific cells of an individual in order to repair a faulty gene copy. The technique may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. The objective of gene therapy is to introduce new genetic material into target cells while causing no damage to the surrounding healthy cells and tissues, hence the treatment related morbidity is decreased. The delivery system includes a vector that delivers a therapeutic gene into the patient′s target cell. Functional proteins are created from the therapeutic gene causing the cell to return to a normal stage. The vectors used in gene therapy can be viral and non-viral. Gene therapy, an emerging field of biomedicine, is still at infancy and much research remains to be done before this approach to the treatment of condition will realize its full potential.

  20. Modelling prokaryote gene content

    Directory of Open Access Journals (Sweden)

    Edward Susko

    2006-01-01

    Full Text Available The patchy distribution of genes across the prokaryotes may be caused by multiple gene losses or lateral transfer. Probabilistic models of gene gain and loss are needed to distinguish between these possibilities. Existing models allow only single genes to be gained and lost, despite the empirical evidence for multi-gene events. We compare birth-death models (currently the only widely-used models, in which only one gene can be gained or lost at a time to blocks models (allowing gain and loss of multiple genes within a family. We analyze two pairs of genomes: two E. coli strains, and the distantly-related Archaeoglobus fulgidus (archaea and Bacillus subtilis (gram positive bacteria. Blocks models describe the data much better than birth-death models. Our models suggest that lateral transfers of multiple genes from the same family are rare (although transfers of single genes are probably common. For both pairs, the estimated median time that a gene will remain in the genome is not much greater than the time separating the common ancestors of the archaea and bacteria. Deep phylogenetic reconstruction from sequence data will therefore depend on choosing genes likely to remain in the genome for a long time. Phylogenies based on the blocks model are more biologically plausible than phylogenies based on the birth-death model.

  1. Gene conversion in human rearranged immunoglobulin genes.

    Science.gov (United States)

    Darlow, John M; Stott, David I

    2006-07-01

    Over the past 20 years, many DNA sequences have been published suggesting that all or part of the V(H) segment of a rearranged immunoglobulin gene may be replaced in vivo. Two different mechanisms appear to be operating. One of these is very similar to primary V(D)J recombination, involving the RAG proteins acting upon recombination signal sequences, and this has recently been proven to occur. Other sequences, many of which show partial V(H) replacements with no addition of untemplated nucleotides at the V(H)-V(H) joint, have been proposed to occur by an unusual RAG-mediated recombination with the formation of hybrid (coding-to-signal) joints. These appear to occur in cells already undergoing somatic hypermutation in which, some authors are convinced, RAG genes are silenced. We recently proposed that the latter type of V(H) replacement might occur by homologous recombination initiated by the activity of AID (activation-induced cytidine deaminase), which is essential for somatic hypermutation and gene conversion. The latter has been observed in other species, but not in human Ig genes, so far. In this paper, we present a new analysis of sequences published as examples of the second type of rearrangement. This not only shows that AID recognition motifs occur in recombination regions but also that some sequences show replacement of central sections by a sequence from another gene, similar to gene conversion in the immunoglobulin genes of other species. These observations support the proposal that this type of rearrangement is likely to be AID-mediated rather than RAG-mediated and is consistent with gene conversion.

  2. Evaluating gene × gene and gene × smoking interaction in rheumatoid arthritis using candidate genes in GAW15

    OpenAIRE

    Mei Ling; Li Xiaohui; Yang Kai; Cui Jinrui; Fang Belle; Guo Xiuqing; Rotter Jerome I

    2007-01-01

    Abstract We examined the potential gene × gene interactions and gene × smoking interactions in rheumatoid arthritis (RA) using the candidate gene data sets provided by Genetic Analysis Workshop 15 Problem 2. The multifactor dimensionality reduction (MDR) method was used to test gene × gene interactions among candidate genes. The case-only sample was used to test gene × smoking interactions. The best predictive model was the single-locus model with single-nucleotide polymorphism (SNP) rs247660...

  3. É possível uma vacina gênica auxiliar no controle da tuberculose? Could a DNA vaccine be useful in the control of tuberculosis?

    Directory of Open Access Journals (Sweden)

    José Maciel Rodrigues Júnior

    2004-08-01

    vaccines currently under pre-clinical and clinical development may prove to be important tools in combating infectious diseases, such as tuberculosis, for which no safe and effective form of prevention has yet been developed. In recent years, several studies have aimed to develop a DNA vaccine encoding mycobacterial proteins such as antigen 85 (Ag85 and the 65-kDa mycobacterial heat shock protein (hsp65. The latter is protective against virulent infection with Mycobacterium tuberculosis (including multidrug-resistant strains. The hsp65 DNA vaccine, currently under clinical evaluation in Brazil for cancer therapy, is able to induce the secretion of Th1 cytokines, such as gamma-interferon, associated with disease control. Furthermore, this vaccine stimulates cytotoxic CD8 and CD4 T-cell clones that can be characterized as memory cells, which are responsible for effective and long-lasting immunity against tuberculosis. When used as a therapeutic agent in inoculated mice, the hsp65 DNA vaccine promotes changes in the immunity profile, triggering the secretion of Th1 cytokines and establishing a favorable environment for the elimination of bacilli. The results also demonstrate that the route of administration, as well as the formulation in which the vaccine is administered, fundamentally influence the pattern and duration of the immune response induced. Taking all currently available data into account, we can conclude that a DNA vaccine against tuberculosis could contribute significantly to the control of the disease.

  4. Mycobacterium tuberculosis Rv3402c enhances mycobacterial survival within macrophages and modulates the host pro-inflammatory cytokines production via NF-kappa B/ERK/p38 signaling.

    Directory of Open Access Journals (Sweden)

    Wu Li

    Full Text Available Intracellular survival plays a central role in the pathogenesis of Mycobacterium tuberculosis, a process which depends on an array of virulence factors to colonize and replicate within the host. The M. tuberculosis iron regulated open reading frame (ORF rv3402c, encoding a conserved hypothetical protein, was shown to be up-regulated upon infection in both human and mice macrophages. To explore the function of this ORF, we heterologously expressed the rv3402c gene in the non-pathogenic fast-growing Mycobacterium smegmatis strain, and demonstrated that Rv3402c, a cell envelope-associated protein, was able to enhance the intracellular survival of recombinant M. smegmatis. Enhanced growth was not found to be the result of an increased resistance to intracellular stresses, as growth of the Rv3402c expressing strain was unaffected by iron depletion, H2O2 exposure, or acidic conditions. Colonization of macrophages by M. smegmatis expressing Rv3402c was associated with substantial cell death and significantly greater amount of TNF-α and IL-1β compared with controls. Rv3402c-induced TNF-α and IL-1β production was found to be mediated by NF-κB, ERK and p38 pathway in macrophages. In summary, our study suggests that Rv3402c delivered in a live M. smegmatis vehicle can modify the cytokines profile of macrophage, promote host cell death and enhance the persistence of mycobacterium within host cells.

  5. Novel functions of (p)ppGpp and Cyclic di-GMP in mycobacterial physiology revealed by phenotype microarray analysis of wild-type and isogenic strains of Mycobacterium smegmatis.

    Science.gov (United States)

    Gupta, Kuldeepkumar Ramnaresh; Kasetty, Sanjay; Chatterji, Dipankar

    2015-04-01

    The bacterial second messengers (p)ppGpp and bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) regulate important functions, such as transcription, virulence, biofilm formation, and quorum sensing. In mycobacteria, they regulate long-term survival during starvation, pathogenicity, and dormancy. Recently, a Pseudomonas aeruginosa strain lacking (p)ppGpp was shown to be sensitive to multiple classes of antibiotics and defective in biofilm formation. We were interested to find out whether Mycobacterium smegmatis strains lacking the gene for either (p)ppGpp synthesis (ΔrelMsm) or c-di-GMP synthesis (ΔdcpA) would display similar phenotypes. We used phenotype microarray technology to compare the growth of the wild-type and the knockout strains in the presence of several antibiotics. Surprisingly, the ΔrelMsm and ΔdcpA strains showed enhanced survival in the presence of many antibiotics, but they were defective in biofilm formation. These strains also displayed altered surface properties, like impaired sliding motility, rough colony morphology, and increased aggregation in liquid cultures. Biofilm formation and surface properties are associated with the presence of glycopeptidolipids (GPLs) in the cell walls of M. smegmatis. Thin-layer chromatography analysis of various cell wall fractions revealed that the levels of GPLs and polar lipids were reduced in the knockout strains. As a result, the cell walls of the knockout strains were significantly more hydrophobic than those of the wild type and the complemented strains. We hypothesize that reduced levels of GPLs and polar lipids may contribute to the antibiotic resistance shown by the knockout strains. Altogether, our data suggest that (p)ppGpp and c-di-GMP may be involved in the metabolism of glycopeptidolipids and polar lipids in M. smegmatis.

  6. Delivery Systems in Gene Therapy

    Institute of Scientific and Technical Information of China (English)

    Liu Hu; Anas El-Aneed; Cui Guohui

    2005-01-01

    1 Gene therapy Gene therapy includes the treatment of both genetically based and infectious diseases by introducing genetic materials which have therapeutic effects[1~3]. In its simplest terms, a wild type gene (which is non-functional in the cell leading to disease development) is introduced into the somatic cell lacking this gene to restore the normal gene function in this cell. Many gene therapy strategies, however, utilize genes to destroy specific cells.

  7. Genome-wide transcriptional profiling of peripheral blood leukocytes from cattle infected with Mycobacterium bovis reveals suppression of host immune genes

    Directory of Open Access Journals (Sweden)

    Killick Kate E

    2011-12-01

    Full Text Available Abstract Background Mycobacterium bovis is the causative agent of bovine tuberculosis (BTB, a pathological infection with significant economic impact. Recent studies have highlighted the role of functional genomics to better understand the molecular mechanisms governing the host immune response to M. bovis infection. Furthermore, these studies may enable the identification of novel transcriptional markers of BTB that can augment current diagnostic tests and surveillance programmes. In the present study, we have analysed the transcriptome of peripheral blood leukocytes (PBL from eight M. bovis-infected and eight control non-infected age-matched and sex-matched Holstein-Friesian cattle using the Affymetrix® GeneChip® Bovine Genome Array with 24,072 gene probe sets representing more than 23,000 gene transcripts. Results Control and infected animals had similar mean white blood cell counts. However, the mean number of lymphocytes was significantly increased in the infected group relative to the control group (P = 0.001, while the mean number of monocytes was significantly decreased in the BTB group (P = 0.002. Hierarchical clustering analysis using gene expression data from all 5,388 detectable mRNA transcripts unambiguously partitioned the animals according to their disease status. In total, 2,960 gene transcripts were differentially expressed (DE between the infected and control animal groups (adjusted P-value threshold ≤ 0.05; with the number of gene transcripts showing decreased relative expression (1,563 exceeding those displaying increased relative expression (1,397. Systems analysis using the Ingenuity® Systems Pathway Analysis (IPA Knowledge Base revealed an over-representation of DE genes involved in the immune response functional category. More specifically, 64.5% of genes in the affects immune response subcategory displayed decreased relative expression levels in the infected animals compared to the control group. Conclusions This

  8. Gene Conversion and Evolution of Gene Families: An Overview

    OpenAIRE

    Tomoko Ohta

    2010-01-01

    The importance of gene conversion for the evolution of gene families is reviewed. Four problems concerning gene conversion, i.e., concerted evolution, generation of useful variation, deleterious effects, and relation to neofunctionalization, are discussed by surveying reported examples of evolving gene families. Emphasis is given toward understanding interactive effects of gene conversion and natural selection.

  9. Gene promoters dictate histone occupancy within genes.

    Science.gov (United States)

    Perales, Roberto; Erickson, Benjamin; Zhang, Lian; Kim, Hyunmin; Valiquett, Elan; Bentley, David

    2013-10-01

    Spt6 is a transcriptional elongation factor and histone chaperone that reassembles transcribed chromatin. Genome-wide H3 mapping showed that Spt6 preferentially maintains nucleosomes within the first 500 bases of genes and helps define nucleosome-depleted regions in 5' and 3' flanking sequences. In Spt6-depleted cells, H3 loss at 5' ends correlates with reduced pol II density suggesting enhanced transcription elongation. Consistent with its 'Suppressor of Ty' (Spt) phenotype, Spt6 inactivation caused localized H3 eviction over 1-2 nucleosomes at 5' ends of Ty elements. H3 displacement differed between genes driven by promoters with 'open'/DPN and 'closed'/OPN chromatin conformations with similar pol II densities. More eviction occurred on genes with 'closed' promoters, associated with 'noisy' transcription. Moreover, swapping of 'open' and 'closed' promoters showed that they can specify distinct downstream patterns of histone eviction/deposition. These observations suggest a novel function for promoters in dictating histone dynamics within genes possibly through effects on transcriptional bursting or elongation rate.

  10. Lamins and their genes

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The nuclear lamina is an important nuclear structure. The studies on its peptides lamins and genes have made substantial progress in recent years. In this paper, the new achievements in studies of new lamin members and their functions, lamin genes and their origin and differentiation, are reviewed and discussed. Some research areas that deserve to be investigated further are put forward.

  11. Your Genes, Your Choices

    Science.gov (United States)

    Table of Contents Your Genes, Your Choices describes the Human Genome Project, the science behind it, and the ethical, legal, and social issues that are ... Nothing could be further from the truth. Your Genes, Your Choices points out how the progress of ...

  12. Novel Species Including Mycobacterium fukienense sp. Is Found from Tuberc-ulosis Patients in Fujian Province, China, Using Phylogenetic Analysis of Mycobacterium chelonae/abscessus Complex

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yuan Yuan; LI Yan Bing; HUANG Ming Xiang; ZHAO Xiu Qin; ZHANG Li Shui; LIU Wen En; WAN Kang Lin

    2013-01-01

    Objective To identify the novel species ‘Mycobacterium fukienense’ sp. nov of Mycobacterium chelonae/abscessus complex from tuberculosis patients in Fujian Province, China. Methods Five of 27 clinical Mycobacterium isolates (Cls) were previously identified as M. chelonae/abscessus complex by sequencing the hsp65, rpoB, 16S-23S rRNA internal transcribed spacer region (its), recA and sodA house-keeping genes commonly used to describe the molecular characteristics of Mycobacterium. Clinical Mycobacterium isolates were classified according to the gene sequence using a clustering analysis program. Sequence similarity within clusters and diversity between clusters were analyzed. Results The 5 isolates were identified with distinct sequences exhibiting 99.8% homology in the hsp65 gene. However, a complete lack of homology was observed among the sequences of the rpoB, 16S-23S rRNA internal transcribed spacer region (its), sodA, and recA genes as compared with the M. abscessus. Furthermore, no match for rpoB, sodA, and recA genes was identified among the published sequences. Conclusion The novel species, Mycobacterium fukienense, is identified from tuberculosis patients in Fujian Province, China, which does not belong to any existing subspecies of M. chelonea/abscessus complex.

  13. Mycobacterium pseudoshottsii sp. nov., a slowly growing chromogenic species isolated from Chesapeake Bay striped bass (Morone saxatilis)

    Science.gov (United States)

    Rhodes, M.W.; Kator, H.; McNabb, A.; Deshayes, C.; Reyrat, J.-M.; Brown-Elliott, B. A.; Wallace, R.; Trott, K.A.; Parker, J.M.; Lifland, B.; Osterhout, G.; Kaattari, I.; Reece, K.; Vogelbein, W.; Ottinger, C.A.

    2005-01-01

    A group of slowly growing photochromogenic mycobacteria was isolated from Chesapeake Bay striped bass (Morone saxatilis) during an epizootic of mycobacteriosis. Growth characteristics, acid-fastness and 16S rRNA gene sequencing results were consistent with those of the genus Mycobacterium. Biochemical reactions, growth characteristics and mycolic acid profiles (HPLC) resembled those of Mycobacterium shottsii, a non-pigmented mycobacterium also isolated during the same epizootic. Sequencing of the 16S rRNA genes, the gene encoding the exported repeated protein (erp) and the gene encoding the 65 kDa heat-shock protein (hsp65) and restriction enzyme analysis of the hsp65 gene demonstrated that this group of isolates is unique. Insertion sequences associated with Mycobacterium ulcerans, IS2404 and IS2606, were detected by PCR. These isolates could be differentiated from other slowly growing pigmented mycobacteria by their inability to grow at 37 ??C, production of niacin and urease, absence of nitrate reductase, negative Tween 80 hydrolysis and resistance to isoniazid (1 ??g ml-1), p-nitrobenzoic acid, thiacetazone and thiophene-2-carboxylic hydrazide. On the basis of this polyphasic study, it is proposed that these isolates represent a novel species, Mycobacterium pseudoshottsii sp. nov. The type strain, L15T, has been deposited in the American Type Culture Collection as ATCC BAA-883T and the National Collection of Type Cultures (UK) as NCTC 13318T. ?? 2005 IUMS.

  14. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function

    OpenAIRE

    Warde-Farley, David; Sylva L. Donaldson; Comes, Ovi; Zuberi, Khalid; Badrawi, Rashad; Chao, Pauline; Franz, Max; Grouios, Chris; Kazi, Farzana; Lopes, Christian Tannus; Maitland, Anson; Mostafavi, Sara; Montojo, Jason; Shao, Quentin; Wright, George

    2010-01-01

    GeneMANIA (http://www.genemania.org) is a flexible, user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. Six organisms are currently supported (Arabidopsis t...

  15. Novel targeting of PEGylated liposomes for codelivery of TGF-β1 siRNA and four antitubercular drugs to human macrophages for the treatment of mycobacterial infection: a quantitative proteomic study

    Directory of Open Access Journals (Sweden)

    Niu NK

    2015-08-01

    Full Text Available Ning-Kui Niu,1–3 Juan-Juan Yin,3 Yin-Xue Yang,4 Zi-Li Wang,1 Zhi-Wei Zhou,3 Zhi-Xu He,5 Xiao-Wu Chen,6 Xueji Zhang,7 Wei Duan,8 Tianxin Yang,9 Shu-Feng Zhou3 1Department of Orthopedics, General Hospital of Tianjin Medical University, Tianjin, 2Department of Spinal Surgery, General Hospital of Ningxia Medical University, Yinchuan, Ningxia, People’s Republic of China; 3Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA; 4Department of Colorectal Surgery, General Hospital of Ningxia Medical University, Yinchuan, Ningxia, 5Guizhou Provincial Key Laboratory for Regenerative Medicine, Stem Cell and Tissue Engineering Research Center and Sino-US Joint Laboratory for Medical Sciences, Guizhou Medical University, Guiyang, Guizhou, 6Department of General Surgery, The First People’s Hospital of Shunde Affiliated to Southern Medical University, Shunde, Foshan, Guangdong, 7Research Center for Bioengineering and Sensing Technology, University of Science and Technology Beijing, Beijing, People’s Republic of China; 8School of Medicine, Deakin University, Waurn Ponds, VIC, Australia; 9Department of Internal Medicine, University of Utah and Salt Lake Veterans Affairs Medical Center, Salt Lake City, UT, USA Abstract: Tuberculosis (TB is still a major public health issue in developing countries, and its chemotherapy is compromised by poor drug compliance and severe side effects. This study aimed to synthesize and characterize new multimodal PEGylated liposomes encapsulated with clinically commonly used anti-TB drugs with linkage to small interfering RNA (siRNA against transforming growth factor-β1 (TGF-β1. The novel NP-siRNA liposomes could target THP-1-derived human macrophages that were the host cells of mycobacterium infection. The biological effects of the NP-siRNA liposomes were evaluated on cell cycle distribution, apoptosis, autophagy, and the gene silencing efficiency of TGF-β1 siRNA in human

  16. Adenovirus Vectors for Gene Therapy, Vaccination and Cancer Gene Therapy

    OpenAIRE

    Wold, William S.M.; Toth, Karoly

    2013-01-01

    Adenovirus vectors are the most commonly employed vector for cancer gene therapy. They are also used for gene therapy and as vaccines to express foreign antigens. Adenovirus vectors can be replication-defective; certain essential viral genes are deleted and replaced by a cassette that expresses a foreign therapeutic gene. Such vectors are used for gene therapy, as vaccines, and for cancer therapy. Replication-competent (oncolytic) vectors are employed for cancer gene therapy. Oncolytic vector...

  17. [Is gene technology immoral?].

    Science.gov (United States)

    Halter, H

    1994-10-01

    Since it came into being in the USA in the early 1970s, gene technology has always been fundamentally controversial, especially in the German-speaking countries. The optimistic--or critical--supporters of gene technology are convinced that, in view of gene technology's not otherwise attainable advantages for human and animal health, for food production and other important aims, it would be ethically unacceptable to restrict to the minimum or even ban it. On the other hand, the radical critics are convinced that gene technology, in view of its anthropologically false starting-point, the questionable interests behind it, and above all its unforeseeable, serious negative implications for mankind and environment, is unacceptable on ethical grounds. Critical reflexion on these polarized arguments must start from the question why precisely gene technology is so controversial, and what are the criteria for ethical assessment. These reflexions presuppose that the prior judgement of gene technology as a technology in the ideological field is rooted in life attitudes, history and nature in general, and this is true not only of gene technology's opponents but also its supporters. It is thus a question of one ideology vs. another. Chief importance here attaches to the mankind-nature relationship and the need to take seriously the fundamental ambivalence of all (!) human action with unforeseeable consequences. The conclusion is that neither to demonize nor to glorify gene technology, as a matter of principle, does justice to its wide and varied positive or negative potential. The ethical assessment of gene technology must be differentiated according to the aims and possible implications.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7939540

  18. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...... to mammalian cells, the technology of RNAi expanded from being a valuable experimental tool to being an applicable method for gene-specific therapeutic regulation, and much effort has been put into further refinement of the technique. This review will focus on how RNAi has developed over the years and how...

  19. Gene Therapy of Cancerous Diseases

    OpenAIRE

    Valenčáková, A.; Dziaková, A.; Hatalová, E.

    2015-01-01

    Gene therapy of cancerous diseases provides new means of curing patients with oncologic illnesses. There are several approaches in treating cancer by gene therapy. Most commonly used methods are: cancer immunogene therapy, suicide gene therapy, application of tumor-suppressor genes, antiangiogenic therapy, mesenchymal stem cells used as vectors, gene directed enzyme/prodrug therapy and bacteria used as anti-cancer agents. Cancer gene immunotherapy uses several immunologic agents for the purp...

  20. What Is a Gene?

    Science.gov (United States)

    ... Quizzes Kids' Dictionary of Medical Words En Español What Other Kids Are Reading Back-to-School Butterflies? ... Got Homework? Here's Help White House Lunch Recipes What Is a Gene? KidsHealth > For Kids > What Is ...

  1. Gene Expression Omnibus (GEO)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  2. Polymorphism in the First Intron of Interferon-Gamma Gene (+874T/A in Patients with BCG Adenitis

    Directory of Open Access Journals (Sweden)

    N Parvaneh

    2009-09-01

    Full Text Available "nBackground: Cytokines and specially interferon-gamma (IFN-g are largely responsible for the regulation of the protective im­mune response against mycobacterial infections. Several studies have clarified the importance of common variants of IFN-g gene regarding the susceptibility to tuberculosis. Bacille Calmette-Guérin (BCG vaccine that is used to prevent se­vere forms of tuberculosis could produce local and systemic side effects. In this study we hypothesized that the IFN-g (+874T/A polymorphism was associated with development of BCG adenitis."nMethods: Thirty patients with BCG adenitis (18 males and 12 females and 30 age and sex-matched healthy children, vacci­nated with BCG during the first two days of life were chosen. All the patients and controls were of Iranian Fars origin and the study was conducted from 2005 to 2007. DNA samples were obtained from 30 patients with BCG adenitis and 30 age and sex matched healthy vaccinees. Polymorphism at +874 was identified using allele specific polymerase chain reac­tion. Allele and genotype frequencies in cases and controls were compared using the χ2 test and odds ratios (OR and their 95% confidence intervals (CI were calculated."nResults: The minor allele (T frequency was significantly lower in patients with BCG adenitis compared to controls (35% vs. 55%, P= 0.02, OR= 0.441, 95% CI= 0.211-0.919. The Armitage trend test revealed a gradually increasing protection from the AA genotype through AT to TT (common odds ratio= 0.49; P= 0.037."nConclusion: Our data suggest that in an Iranian population, the IFN-g (+874T/A polymorphism is associated with develop­ment of BCG adenitis in the vaccinees.

  3. Evidence for homosexuality gene

    Energy Technology Data Exchange (ETDEWEB)

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  4. Gene-gene, gene-environment, gene-nutrient interactionsand single nucleotide polymorphisms of inflammatorycytokines

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    Inflammation plays a significant role in the etiologyof type 2 diabetes mellitus (T2DM). The rise in thepro-inflammatory cytokines is the essential step inglucotoxicity and lipotoxicity induced mitochondrialinjury, oxidative stress and beta cell apoptosis inT2DM. Among the recognized markers are interleukin(IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha(TNF-α), C-reactive protein, resistin, adiponectin, tissueplasminogen activator, fibrinogen and heptoglobins.Diabetes mellitus has firm genetic and very strongenvironmental influence; exhibiting a polygenic modeof inheritance. Many single nucleotide polymorphisms(SNPs) in various genes including those of pro and antiinflammatorycytokines have been reported as a riskfor T2DM. Not all the SNPs have been confirmed byunifying results in different studies and wide variationshave been reported in various ethnic groups. Theinter-ethnic variations can be explained by the factthat gene expression may be regulated by gene-gene,gene-environment and gene-nutrient interactions. Thisreview highlights the impact of these interactions ondetermining the role of single nucleotide polymorphismof IL-6, TNF-α, resistin and adiponectin in pathogenesisof T2DM.

  5. The Mycoplasma hominis vaa gene displays a mosaic gene structure

    DEFF Research Database (Denmark)

    Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.;

    1998-01-01

    Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular...

  6. Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release.

    Science.gov (United States)

    Formica, S; Roach, T I; Blackwell, J M

    1994-05-01

    The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic

  7. Hox genes and study of Hox genes in crustacean

    Institute of Scientific and Technical Information of China (English)

    HOU Lin; CHEN Zhijuan; XU Mingyu; LIN Shengguo; WANG Lu

    2004-01-01

    Homeobox genes have been discovered in many species. These genes are known to play a major role in specifying regional identity along the anterior-posterior axis of animals from a wide range of phyla.The products of the homeotic genes are a set of evolutionarily conserved transcription factors that control elaborate developmental processes and specify cell fates in metazoans. Crustacean, presenting a variety of body plans not encountered in any other class or phylum of the Metazoa, has been shown to possess a single set of homologous Hox genes like insect. The ancestral crustacean Hox gene complex comprised ten genes: eight homologous to the hometic Hox genes and two related to nonhomeotic genes presented within the insect Hox complexes. The crustacean in particular exhibits an abundant diversity segment specialization and tagmosis. This morphological diversity relates to the Hox genes. In crustacean body plan, different Hox genes control different segments and tagmosis.

  8. GeneCards Version 3: the human gene integrator.

    Science.gov (United States)

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-01-01

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database

  9. GeneCards Version 3: the human gene integrator.

    Science.gov (United States)

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-01-01

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database

  10. Gene therapy for brain tumors.

    Science.gov (United States)

    Bansal, K; Engelhard, H H

    2000-09-01

    "Gene therapy" can be defined as the transfer of genetic material into a patient's cells for therapeutic purposes. To date, a diverse and creative assortment of treatment strategies utilizing gene therapy have been devised, including gene transfer for modulating the immune system, enzyme prodrug ("suicide gene") therapy, oncolytic therapy, replacement/therapeutic gene transfer, and antisense therapy. For malignant glioma, gene-directed prodrug therapy using the herpes simplex virus thymidine kinase gene was the first gene therapy attempted clinically. A variety of different strategies have now been pursued experimentally and in clinical trials. Although, to date, gene therapy for brain tumors has been found to be reasonably safe, concerns still exist regarding issues related to viral delivery, transduction efficiency, potential pathologic response of the brain, and treatment efficacy. Improved viral vectors are being sought, and potential use of gene therapy in combination with other treatments is being investigated.

  11. Introns in higher plant genes

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The intron is an important component of eukaryotic gene. Extensive studies have been conducted to get a better understanding of its structure and function. This paper presents a brief review of the structure and function of introns in higher plant genes. It is shown that higher plant introns possess structural properties shared by all eukaryotic introns, however, they also exhibit a striking degree of diversity. The process of intron splicing in higher plant genes involves interaction between multiple cis-acting elements and trans-acting factors, such as 5′ splicing site, 3′ splicing site and many protein factors. The process of intron splicing is an important level at which gene expression is regulated. Especially alternative splicing of intron can regulate time and space of gene expression. In addition, some introns in higher plant genes also regulate gene expression by affecting the pattern of gene expression, enhancing the level of gene expression and driving the gene expression.

  12. Radionuclide reporter gene imaging for cardiac gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Inubushi, Masayuki [Hokkaido University Graduate School of Medicine, Department of Molecular Imaging, Sapporo (Japan); Tamaki, Nagara [Hokkaido University Graduate School of Medicine, Department of Nuclear Medicine, Sapporo (Japan)

    2007-06-15

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  13. A review on microcephaly genes

    Directory of Open Access Journals (Sweden)

    Irshad S.

    2012-06-01

    Full Text Available This review aims to summarize the recent findings regarding microcephaly genes. We have discussed the molecular genetics studies of microcephaly genes including a comprehensive appraisal of the seven mapped loci (MCPH1–MCPH7, their corresponding genes and protein products of the genes, their likely role in normal brain development and the details of the mutations reported in these genes.

  14. Gene therapy: progress and predictions

    OpenAIRE

    Collins, Mary; Thrasher, Adrian

    2015-01-01

    The first clinical gene delivery, which involved insertion of a marker gene into lymphocytes from cancer patients, was published 25 years ago. In this review, we describe progress since then in gene therapy. Patients with some inherited single-gene defects can now be treated with their own bone marrow stem cells that have been engineered with a viral vector carrying the missing gene. Patients with inherited retinopathies and haemophilia B can also be treated by local or systemic injection of ...

  15. Gene decay in archaea

    Directory of Open Access Journals (Sweden)

    M. W. J. van Passel

    2007-01-01

    Full Text Available The gene-dense chromosomes of archaea and bacteria were long thought to be devoid of pseudogenes, but with the massive increase in available genome sequences, whole genome comparisons between closely related species have identified mutations that have rendered numerous genes inactive. Comparative analyses of sequenced archaeal genomes revealed numerous pseudogenes, which can constitute up to 8.6% of the annotated coding sequences in some genomes. The largest proportion of pseudogenes is created by gene truncations, followed by frameshift mutations. Within archaeal genomes, large numbers of pseudogenes contain more than one inactivating mutation, suggesting that pseudogenes are deleted from the genome more slowly in archaea than in bacteria. Although archaea seem to retain pseudogenes longer than do bacteria, most archaeal genomes have unique repertoires of pseudogenes.

  16. Correlating Expression Data with Gene Function Using Gene Ontology

    Institute of Scientific and Technical Information of China (English)

    LIU,Qi; DENG,Yong; WANG,Chuan; SHI,Tie-Liu; LI,Yi-Xue

    2006-01-01

    Clustering is perhaps one of the most widely used tools for microarray data analysis. Proposed roles for genes of unknown function are inferred from clusters of genes similarity expressed across many biological conditions.However, whether function annotation by similarity metrics is reliable or not and to what extent the similarity in gene expression patterns is useful for annotation of gene functions, has not been evaluated. This paper made a comprehensive research on the correlation between the similarity of expression data and of gene functions using Gene Ontology. It has been found that although the similarity in expression patterns and the similarity in gene functions are significantly dependent on each other, this association is rather weak. In addition, among the three categories of Gene Ontology, the similarity of expression data is more useful for cellular component annotation than for biological process and molecular function. The results presented are interesting for the gene functions prediction research area.

  17. The gene tree delusion.

    Science.gov (United States)

    Springer, Mark S; Gatesy, John

    2016-01-01

    Higher-level relationships among placental mammals are mostly resolved, but several polytomies remain contentious. Song et al. (2012) claimed to have resolved three of these using shortcut coalescence methods (MP-EST, STAR) and further concluded that these methods, which assume no within-locus recombination, are required to unravel deep-level phylogenetic problems that have stymied concatenation. Here, we reanalyze Song et al.'s (2012) data and leverage these re-analyses to explore key issues in systematics including the recombination ratchet, gene tree stoichiometry, the proportion of gene tree incongruence that results from deep coalescence versus other factors, and simulations that compare the performance of coalescence and concatenation methods in species tree estimation. Song et al. (2012) reported an average locus length of 3.1 kb for the 447 protein-coding genes in their phylogenomic dataset, but the true mean length of these loci (start codon to stop codon) is 139.6 kb. Empirical estimates of recombination breakpoints in primates, coupled with consideration of the recombination ratchet, suggest that individual coalescence genes (c-genes) approach ∼12 bp or less for Song et al.'s (2012) dataset, three to four orders of magnitude shorter than the c-genes reported by these authors. This result has general implications for the application of coalescence methods in species tree estimation. We contend that it is illogical to apply coalescence methods to complete protein-coding sequences. Such analyses amalgamate c-genes with different evolutionary histories (i.e., exons separated by >100,000 bp), distort true gene tree stoichiometry that is required for accurate species tree inference, and contradict the central rationale for applying coalescence methods to difficult phylogenetic problems. In addition, Song et al.'s (2012) dataset of 447 genes includes 21 loci with switched taxonomic names, eight duplicated loci, 26 loci with non-homologous sequences that are

  18. The gene tree delusion.

    Science.gov (United States)

    Springer, Mark S; Gatesy, John

    2016-01-01

    Higher-level relationships among placental mammals are mostly resolved, but several polytomies remain contentious. Song et al. (2012) claimed to have resolved three of these using shortcut coalescence methods (MP-EST, STAR) and further concluded that these methods, which assume no within-locus recombination, are required to unravel deep-level phylogenetic problems that have stymied concatenation. Here, we reanalyze Song et al.'s (2012) data and leverage these re-analyses to explore key issues in systematics including the recombination ratchet, gene tree stoichiometry, the proportion of gene tree incongruence that results from deep coalescence versus other factors, and simulations that compare the performance of coalescence and concatenation methods in species tree estimation. Song et al. (2012) reported an average locus length of 3.1 kb for the 447 protein-coding genes in their phylogenomic dataset, but the true mean length of these loci (start codon to stop codon) is 139.6 kb. Empirical estimates of recombination breakpoints in primates, coupled with consideration of the recombination ratchet, suggest that individual coalescence genes (c-genes) approach ∼12 bp or less for Song et al.'s (2012) dataset, three to four orders of magnitude shorter than the c-genes reported by these authors. This result has general implications for the application of coalescence methods in species tree estimation. We contend that it is illogical to apply coalescence methods to complete protein-coding sequences. Such analyses amalgamate c-genes with different evolutionary histories (i.e., exons separated by >100,000 bp), distort true gene tree stoichiometry that is required for accurate species tree inference, and contradict the central rationale for applying coalescence methods to difficult phylogenetic problems. In addition, Song et al.'s (2012) dataset of 447 genes includes 21 loci with switched taxonomic names, eight duplicated loci, 26 loci with non-homologous sequences that are

  19. Vertebrate gene predictions and the problem of large genes

    DEFF Research Database (Denmark)

    Wang, Jun; Li, ShengTing; Zhang, Yong;

    2003-01-01

    To find unknown protein-coding genes, annotation pipelines use a combination of ab initio gene prediction and similarity to experimentally confirmed genes or proteins. Here, we show that although the ab initio predictions have an intrinsically high false-positive rate, they also have a consistently...... low false-negative rate. The incorporation of similarity information is meant to reduce the false-positive rate, but in doing so it increases the false-negative rate. The crucial variable is gene size (including introns)--genes of the most extreme sizes, especially very large genes, are most likely to...

  20. Macrophage Activation by Ursolic and Oleanolic Acids during Mycobacterial Infection

    Directory of Open Access Journals (Sweden)

    Sonia López-García

    2015-08-01

    Full Text Available Oleanolic (OA and ursolic acids (UA are triterpenes that are abundant in vegetables, fruits and medicinal plants. They have been described as active moieties in medicinal plants used for the treatment of tuberculosis. In this study, we analyzed the effects of these triterpenes on macrophages infected in vitro with Mycobacterium tuberculosis (MTB. We evaluated production of nitric oxide (NO, reactive oxygen species (ROS, and cytokines (TNF-α and TGF-β as well as expression of cell membrane receptors (TGR5 and CD36 in MTB-infected macrophages following treatment with OA and UA. Triterpenes caused reduced MTB growth in macrophages, stimulated production of NO and ROS in the early phase, stimulated TNF-α, suppressed TGF-β and caused over-expression of CD36and TGR5 receptors. Thus, our data suggest immunomodulatory properties of OA and UA on MTB infected macrophages. In conclusion, antimycobacterial effects induced by these triterpenes may be attributable to the conversion of macrophages from stage M2 (alternatively activated to M1 (classically activated.

  1. Mycobacterial species as case-study of comparative genome analysis

    DEFF Research Database (Denmark)

    Zakham, F.; Belayachi, L.; Ussery, David;

    2011-01-01

    . Pasteur 1173P2, M. leprae Br4923, M. marinum M, M. sp. KMS, M. sp. MCS, M. tuberculosis CDC1551, M. tuberculosis F11, M. tuberculosis H37Ra, M. tuberculosis H37Rv, M. tuberculosis KZN 1435 , M. ulcerans Agy99,and M. vanbaalenii PYR—1, For this purpose a comparison has been done based on their length...

  2. MICOBACTERIUM PARATUBERCULOSIS AND NONTUBERCULOUS MYCOBACTERIAL IN POTABLE WATER

    Science.gov (United States)

    Nontuberculous mycobacteria (NTM) include Mycobacterium species that are not members of the Mycobacterium tuberculosis Complex. Members of the NTM group are important causes of disease in birds and mammals. Mycobacterium avium, Mycobacterium intracellulare and Mycobacterium parat...

  3. An experimental model of mycobacterial infection under corneal flaps

    Directory of Open Access Journals (Sweden)

    C.B.D. Adan

    2004-07-01

    Full Text Available In order to develop a new experimental animal model of infection with Mycobacterium chelonae in keratomileusis, we conducted a double-blind prospective study on 24 adult male New Zealand rabbits. One eye of each rabbit was submitted to automatic lamellar keratotomy with the automatic corneal shaper under general anesthesia. Eyes were immunosuppressed by a single local injection of methyl prednisolone. Twelve animals were inoculated into the keratomileusis interface with 1 µl of 10(6 heat-inactivated bacteria (heat-inactivated inoculum controls and 12 with 1 µl of 10(6 live bacteria. Trimethoprim drops (0.1%, w/v were used as prophylaxis for the surgical procedure every 4 h (50 µl, qid. Animals were examined by 2 observers under a slit lamp on the 1st, 3rd, 5th, 7th, 11th, 16th, and 23rd postoperative days. Slit lamp photographs were taken to document clinical signs. Animals were sacrificed when corneal disease was detected and corneal samples were taken for microbiological analysis. Eleven of 12 experimental rabbits developed corneal disease, and M. chelonae could be isolated from nine rabbits. Eleven of the 12 controls receiving a heat-inactivated inoculum did not develop corneal disease. M. chelonae was not isolated from any of the control rabbits receiving a heat-inactivated inoculum, or from the healthy cornea of control rabbits. Corneal infection by M. chelonae was successfully induced in rabbits submitted to keratomileusis. To our knowledge, this is the first animal model of M. chelonae infection following corneal flaps for refractive surgery to be described in the literature and can be used for the analysis of therapeutic responses.

  4. Thoracoscopic management for bronchiectasis with non-tuberculous mycobacterial infection

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Background Non-tuberculous mycobacteria (NTM) have emerged as important opportunistic pathogens of the human being in recent years. Patients with pre-existing bronchiectasis are susceptible to NTM. However, information about its occurrence among bronchiectatic patients in Shenzhen, China is lacking and its impact on the course of bronchiectasis following surgical intervention is unknown. This preliminary study aimed to investigate the prevalence of NTM in bronchiectasis that required surgery in our center, evaluate the role of intraoperative routine screening for NTM, and summarize our initial experience in thoracoscopic management for bronchiectatic patients with NTM. Methods A retrospective analysis of clinical, microbiological data of our bronchiectatic patients with NTM over 5 years was made and 40 patients with bronchiectasis were studied to determine the role of intraoperative routine screening for NTM. Results The prevalence of NTM in this population of patients with bronchiectasis in our center was 6.7% (7/105). The diagnostic yield of the 40 intraoperative specimens was 7.5% (3/40). Of the 7 patients with bronchiectasis and NTM, 3 patients developed postoperative wound infections. All were cured with chemotherapy for 8-12 months along with vigorous surgical debridement. Another patient had a slow growth of mycobacteria involving double lungs and the right thoracic cavity and recovered after chemotherapy for nearly 14 months and tube drainage. The affected tissue was completely resected in the remaining 3 patients with no operative mortality and postoperative morbidity, and routine intraoperative screening for NTM was initiated in these patients. Conclusions NTM is not uncommon in bronchiectatic patients which deserves surgeons' utmost attention. Routine intraoperative screening for NTM identified otherwise unsuspected patients has shown favorable outcomes. Thoracoscopic management for bronchiectasis with NTM is technically feasible although its role remains to be defined.

  5. Respiratory Review of 2014: Tuberculosis and Nontuberculous Mycobacterial Pulmonary Disease

    OpenAIRE

    Park, Cheol Kyu; Kwon, Yong Soo

    2014-01-01

    Since tuberculosis (TB) remains a major global health concern and the incidence of multi-drug resistant (MDR)-TB is increasing globally, new modalities for the detection of TB and drug resistant TB are needed to improve TB control. The Xpert MTB/RIF test can be a valuable new tool for early detection of TB and rifampicin resistance, with a high sensitivity and specificity. Late-generation fluoroquinolones, levofloxacin, and moxifloxacin, which are the principal drugs for the treatment of MDR-...

  6. Mycobacterial Pulmonary Infections in Patients with Idiopathic Pulmonary Fibrosis

    OpenAIRE

    Park, Sung-Woo; Song, Jin Woo; Shim, Tae Sun; Park, Moo-Suk; Lee, Hong-Lyeol; Uh, Soo-taek; Park, Choon-Sik; Kim, Dong Soon

    2012-01-01

    Patients with idiopathic pulmonary fibrosis (IPF) have an increased risk for developing tuberculosis (TB). However, no studies have been reported regarding the development of nontuberculous mycobacterium (NTM) lung disease (NTMLD). We reviewed 795 patients with IPF from five university hospitals who were diagnosed by histological or radio-clinical criteria. In the 795 patients with IPF, pulmonary infections with mycobacterium tuberculosis (MTB) and NTM were found in 35 (4.4%) and 16 patients ...

  7. Host response to nontuberculous mycobacterial infections of current clinical importance.

    Science.gov (United States)

    Orme, Ian M; Ordway, Diane J

    2014-09-01

    The nontuberculous mycobacteria are a large group of acid-fast bacteria that are very widely distributed in the environment. While Mycobacterium avium was once regarded as innocuous, its high frequency as a cause of disseminated disease in HIV-positive individuals illustrated its potential as a pathogen. Much more recently, there is growing evidence that the incidence of M. avium and related nontuberculous species is increasing in immunocompetent individuals. The same has been observed for M. abscessus infections, which are very difficult to treat; accordingly, this review focuses primarily on these two important pathogens. Like the host response to M. tuberculosis infections, the host response to these infections is of the TH1 type but there are some subtle and as-yet-unexplained differences.

  8. Mycobacterial heat shock protein 65 and experimental autoimmune uveitis

    Institute of Scientific and Technical Information of China (English)

    杨俊杰

    2010-01-01

    @@ Uveitis, common cause of human visual disability and blindness, is an inflammatory eye disease of unknown etiology. Human autoimmune uveiti, which characterizes inflammation of different tissues of the eyes, is diverse and complex. Approximately 50% of patients with uveitis were found to occur in families in which clustering of other underlying systemic autoimmune diseases has been observed (multiplex families) such as diabetes, sarcoidosis, rheumatoid arthritis (RA), Behcet disease, multiple sclerosis (MS), and others [1-3]. Animal models of experimental autoimmune uveitis (EAU), which represent different forms of clinical uveitis, have been widely used for studying the immunopathological mechanisms of uveitis to develop preventive or therapeutic strategies because of the difficulties in obtaining tissues from a patient's inflamed eye for experiments [4].

  9. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  10. [Construction of fusion gene vaccine of WT1 multi-epitope fused with stimulating epitope of mycobacterium tuberculosis heat shock protein 70 and its expression and immunogenicity].

    Science.gov (United States)

    Tian, Wei-Wei; Qiao, Zhen-Hua; Yang, Lin-Hua; Wang, Hong-Wei; Tang, Yan-Hong; Bian, Si-Cheng

    2011-04-01

    This study was purposed to construct a fusion DNA vaccine containing WT1 multi-epitope and stimulating epitope of mycobacterium tuberculosis heat shock protein 70 and to detect its expression and immunogenicity. On the basis of published data, a multi-epitope gene (Multi-WT1) containing three HLA *0201-restricted CTL epitopes: one HLA*2402-restricted CTL epitope, two Th epitopes and one universal Th Pan-DR epitope (PADRE) was constructed. DNA-coding sequence was modified by Computer-Aided Design (CAD) to optimize proteasome-mediated epitope processing through the introduction of different amino acid spacer sequences. The synthetic nucleotide sequence was then inserted into an eukaryotic vector to construct the plasmid pcDNA3.1-WT1.For enhancing CTL activity, HSP70 fragment including stimulatory domain P407-426 was amplified by PCR from mycobacterial HSP70 gene and cloned into pcDNA3.1(+). Then Multi-WT1 was fused to the N-terminal of pcDNA3.1-mHSP70(407-426) to make the multi-epitope fusion gene vaccine pcDNA3.1-WT1-mHSP70(407-426). HEK-293T cells were transfected with this vaccine and the expressed product was identified by RT-PCR. Enzyme-linked immunospot assay (ELISPOT) was used to evaluate the immunological responses elicited by vaccine. The results showed that the most of WT1 epitopes could be correctly cleaved which was confirmed by software Net Chop 3.1 and PAPROCIanalysis. RT-PCR showed correct expression of target gene in HEK293T cells and ELISPOT showed specific T-cell responses. It is concluded that the eukaryotic expression vector PcDNA3.1-WT1-mHSP70(407-426) fusion gene has been successfully constructed and the immunity response is also elicited, which is a good candidate for further research of DNA vaccine.

  11. GENES BEHIND SMOKE ACTION

    Directory of Open Access Journals (Sweden)

    Vilmos Soós

    2008-09-01

    Full Text Available Smoke can break dormancy and promote seed germination of many plant species. We investigated changes in the gene expression changes after imbibition of light-sensitive Lactuca sativa L. cv. Grand Rapids achenes with dilute smoke water compared to water control samples kept in dark or continuous light. Although no difference was detected in the smoke water vs. water control samples germinated in light, smoke water treatment resulted in the differential display of several expressed sequence tags (ESTs when compared to water control samples kept in dark. The most pronounced fragments isolated correspond to known genes with functions related to cell wall expansion, abscisic acid regulation, regulation of translation, the cell division cycle, carbohydrate metabolism and desiccation tolerance. These data clearly indicate that the smoke water, which stimulates germination of light-sensitive Grand Rapids lettuce seeds in the dark, rapidly affects genes that are essential for cell division, cell wall expansion and mobilization and utilization of nutrients for the resumption of embryo growth. Although the master genes remained unknown, our hope is that the using of maize microarray will reveal the whole molecular background of smoke action.

  12. Ultrasound mediated gene transfection

    Science.gov (United States)

    Williamson, Rene G.; Apfel, Robert E.; Brandsma, Janet L.

    2002-05-01

    Gene therapy is a promising modality for the treatment of a variety of human diseases both inherited and acquired, such as cystic fibrosis and cancer. The lack of an effective, safe method for the delivery of foreign genes into the cells, a process known as transfection, limits this effort. Ultrasound mediated gene transfection is an attractive method for gene delivery since it is a noninvasive technique, does not introduce any viral particles into the host and can offer very good temporal and spatial control. Previous investigators have shown that sonication increases transfection efficiency with and without ultrasound contrast agents. The mechanism is believed to be via a cavitation process where collapsing bubble nuclei permeabilize the cell membrane leading to increased DNA transfer. The research is focused on the use of pulsed wave high frequency focused ultrasound to transfect DNA into mammalian cells in vitro and in vivo. A better understanding of the mechanism behind the transfection process is also sought. A summary of some in vitro results to date will be presented, which includes the design of a sonication chamber that allows us to model the in vivo case more accurately.

  13. Old genes experience stronger translational selection than young genes.

    Science.gov (United States)

    Yin, Hongyan; Ma, Lina; Wang, Guangyu; Li, Mengwei; Zhang, Zhang

    2016-09-15

    Selection on synonymous codon usage for translation efficiency and/or accuracy has been identified as a widespread mechanism in many living organisms. However, it remains unknown whether translational selection associates closely with gene age and acts differentially on genes with different evolutionary ages. To address this issue, here we investigate the strength of translational selection acting on different aged genes in human. Our results show that old genes present stronger translational selection than young genes, demonstrating that translational selection correlates positively with gene age. We further explore the difference of translational selection in duplicates vs. singletons and in housekeeping vs. tissue-specific genes. We find that translational selection acts comparably in old singletons and old duplicates and stronger translational selection in old genes is contributed primarily by housekeeping genes. For young genes, contrastingly, singletons experience stronger translational selection than duplicates, presumably due to redundant function of duplicated genes during their early evolutionary stage. Taken together, our results indicate that translational selection acting on a gene would not be constant during all stages of evolution, associating closely with gene age. PMID:27259662

  14. Genes2FANs: connecting genes through functional association networks

    Directory of Open Access Journals (Sweden)

    Dannenfelser Ruth

    2012-07-01

    Full Text Available Abstract Background Protein-protein, cell signaling, metabolic, and transcriptional interaction networks are useful for identifying connections between lists of experimentally identified genes/proteins. However, besides physical or co-expression interactions there are many ways in which pairs of genes, or their protein products, can be associated. By systematically incorporating knowledge on shared properties of genes from diverse sources to build functional association networks (FANs, researchers may be able to identify additional functional interactions between groups of genes that are not readily apparent. Results Genes2FANs is a web based tool and a database that utilizes 14 carefully constructed FANs and a large-scale protein-protein interaction (PPI network to build subnetworks that connect lists of human and mouse genes. The FANs are created from mammalian gene set libraries where mouse genes are converted to their human orthologs. The tool takes as input a list of human or mouse Entrez gene symbols to produce a subnetwork and a ranked list of intermediate genes that are used to connect the query input list. In addition, users can enter any PubMed search term and then the system automatically converts the returned results to gene lists using GeneRIF. This gene list is then used as input to generate a subnetwork from the user’s PubMed query. As a case study, we applied Genes2FANs to connect disease genes from 90 well-studied disorders. We find an inverse correlation between the counts of links connecting disease genes through PPI and links connecting diseases genes through FANs, separating diseases into two categories. Conclusions Genes2FANs is a useful tool for interpreting the relationships between gene/protein lists in the context of their various functions and networks. Combining functional association interactions with physical PPIs can be useful for revealing new biology and help form hypotheses for further experimentation. Our

  15. Nocardia altamirensis sp. nov., isolated from Altamira cave, Cantabria, Spain.

    Science.gov (United States)

    Jurado, Valme; Boiron, Patrick; Kroppenstedt, Reiner M; Laurent, Frédéric; Couble, Andrée; Laiz, Leonila; Klenk, Hans-Peter; González, Juan M; Saiz-Jimenez, Cesareo; Mouniée, Delphine; Bergeron, Emanuelle; Rodríguez-Nava, Verónica

    2008-09-01

    A novel actinomycete strain, OFN S17(T), was isolated from a sample collected from Altamira Cave, Cantabria, Spain. This strain was identified by using a polyphasic taxonomic approach. The 16S rRNA, hsp65 and sod gene sequences of the strain were determined and compared with those of representative Nocardia species. The results showed that strain OFN S17(T) should be assigned to the genus Nocardia. Phylogenetic analysis indicated that strain OFN S17(T) was most closely related to the type strain of Nocardia tenerifensis (98.6, 96.2 and 96% similarity, respectively, for the 16S rRNA, hsp65 and sod gene sequences). The DNA G+C content was 64.4 mol%. DNA-DNA hybridization analyses revealed 29% relative reassociation between the DNA of strain OFN S17(T) and N. tenerifensis DSM 44704(T). The phenotypic and genotypic data show that strain OFN S17(T) merits recognition as a representative of a novel species of the genus Nocardia, for which the name Nocardia altamirensis sp. nov. is proposed. The type strain is OFN S17(T) (=CIP 109606(T) =DSM 44997(T)). PMID:18768631

  16. Nontuberculous mycobacteria in respiratory samples from patients with pulmonary tuberculosis in the state of Rondonia, Brazil

    Directory of Open Access Journals (Sweden)

    Cleoni Alves Mendes de Lima

    2013-06-01

    Full Text Available The main cause of pulmonary tuberculosis (TB is infection with Mycobacterium tuberculosis (MTB. We aimed to evaluate the contribution of nontuberculous mycobacteria (NTM to pulmonary disease in patients from the state of Rondônia using respiratory samples and epidemiological data from TB cases. Mycobacterium isolates were identified using a combination of conventional tests, polymerase chain reaction-based restriction enzyme analysis of hsp65 gene and hsp65 gene sequencing. Among the 1,812 cases suspected of having pulmonary TB, 444 yielded bacterial cultures, including 369 cases positive for MTB and 75 cases positive for NTM. Within the latter group, 14 species were identified as Mycobacterium abscessus, Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium intracellulare, Mycobacterium gilvum, Mycobacterium gordonae, Mycobacterium asiaticum, Mycobacterium tusciae, Mycobacterium porcinum, Mycobacterium novocastrense, Mycobacterium simiae, Mycobacterium szulgai, Mycobacterium phlei and Mycobacterium holsaticum and 13 isolates could not be identified at the species level. The majority of NTM cases were observed in Porto Velho and the relative frequency of NTM compared with MTB was highest in Ji-Paraná. In approximately half of the TB subjects with NTM, a second sample containing NTM was obtained, confirming this as the disease-causing agent. The most frequently observed NTM species were M. abscessus and M. avium and because the former species is resistant to many antibiotics and displays unsatisfactory cure rates, the implementation of rapid identification of mycobacterium species is of considerable importance.

  17. Industrial scale gene synthesis.

    Science.gov (United States)

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery.

  18. Genes contributing to prion pathogenesis

    DEFF Research Database (Denmark)

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V;

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...

  19. Entrez Gene: gene-centered information at NCBI.

    Science.gov (United States)

    Maglott, Donna; Ostell, Jim; Pruitt, Kim D; Tatusova, Tatiana

    2007-01-01

    Entrez Gene (www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) is NCBI's database for gene-specific information. Entrez Gene includes records from genomes that have been completely sequenced, that have an active research community to contribute gene-specific information or that are scheduled for intense sequence analysis. The content of Entrez Gene represents the result of both curation and automated integration of data from NCBI's Reference Sequence project (RefSeq), from collaborating model organism databases and from other databases within NCBI. Records in Entrez Gene are assigned unique, stable and tracked integers as identifiers. The content (nomenclature, map location, gene products and their attributes, markers, phenotypes and links to citations, sequences, variation details, maps, expression, homologs, protein domains and external databases) is provided via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programing utilities (E-Utilities), and for bulk transfer by ftp. PMID:17148475

  20. Tumor-specific gene expression patterns with gene expression profiles

    Institute of Scientific and Technical Information of China (English)

    RUAN Xiaogang; LI Yingxin; LI Jiangeng; GONG Daoxiong; WANG Jinlian

    2006-01-01

    Gene expression profiles of 14 common tumors and their counterpart normal tissues were analyzed with machine learning methods to address the problem of selection of tumor-specific genes and analysis of their differential expressions in tumor tissues. First, a variation of the Relief algorithm, "RFE_Relief algorithm" was proposed to learn the relations between genes and tissue types. Then, a support vector machine was employed to find the gene subset with the best classification performance for distinguishing cancerous tissues and their counterparts. After tissue-specific genes were removed, cross validation experiments were employed to demonstrate the common deregulated expressions of the selected gene in tumor tissues. The results indicate the existence of a specific expression fingerprint of these genes that is shared in different tumor tissues, and the hallmarks of the expression patterns of these genes in cancerous tissues are summarized at the end of this paper.

  1. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  2. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  3. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

    Directory of Open Access Journals (Sweden)

    Odelta dos Santos

    Full Text Available Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR, one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

  4. Dominance from the perspective of gene-gene and gene-chemical interactions.

    Science.gov (United States)

    Gladki, Arkadiusz; Zielenkiewicz, Piotr; Kaczanowski, Szymon

    2016-02-01

    In this study, we used genetic interaction (GI) and gene-chemical interaction (GCI) data to compare mutations with different dominance phenotypes. Our analysis focused primarily on Saccharomyces cerevisiae, where haploinsufficient genes (HI; genes with dominant loss-of-function mutations) were found to be participating in gene expression processes, namely, the translation and regulation of gene transcription. Non-ribosomal HI genes (mainly regulators of gene transcription) were found to have more GIs and GCIs than haplosufficient (HS) genes. Several properties seem to lead to the enrichment of interactions, most notably, the following: importance, pleiotropy, gene expression level and gene expression variation. Importantly, after these properties were appropriately considered in the analysis, the correlation between dominance and GI/GCI degrees was still observed. Strikingly, for the GCIs of heterozygous strains, haploinsufficiency was the only property significantly correlated with the number of GCIs. We found ribosomal HI genes to be depleted in GIs/GCIs. This finding can be explained by their high variation in gene expression under different genetic backgrounds and environmental conditions. We observed the same distributions of GIs among non-ribosomal HI, ribosomal HI and HS genes in three other species: Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens. One potentially interesting exception was the lack of significant differences in the degree of GIs between non-ribosomal HI and HS genes in Schizosaccharomyces pombe. PMID:26613610

  5. Dominance from the perspective of gene-gene and gene-chemical interactions.

    Science.gov (United States)

    Gladki, Arkadiusz; Zielenkiewicz, Piotr; Kaczanowski, Szymon

    2016-02-01

    In this study, we used genetic interaction (GI) and gene-chemical interaction (GCI) data to compare mutations with different dominance phenotypes. Our analysis focused primarily on Saccharomyces cerevisiae, where haploinsufficient genes (HI; genes with dominant loss-of-function mutations) were found to be participating in gene expression processes, namely, the translation and regulation of gene transcription. Non-ribosomal HI genes (mainly regulators of gene transcription) were found to have more GIs and GCIs than haplosufficient (HS) genes. Several properties seem to lead to the enrichment of interactions, most notably, the following: importance, pleiotropy, gene expression level and gene expression variation. Importantly, after these properties were appropriately considered in the analysis, the correlation between dominance and GI/GCI degrees was still observed. Strikingly, for the GCIs of heterozygous strains, haploinsufficiency was the only property significantly correlated with the number of GCIs. We found ribosomal HI genes to be depleted in GIs/GCIs. This finding can be explained by their high variation in gene expression under different genetic backgrounds and environmental conditions. We observed the same distributions of GIs among non-ribosomal HI, ribosomal HI and HS genes in three other species: Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens. One potentially interesting exception was the lack of significant differences in the degree of GIs between non-ribosomal HI and HS genes in Schizosaccharomyces pombe.

  6. Gene doping in modern sport.

    Directory of Open Access Journals (Sweden)

    MAREK SAWCZUK

    2009-01-01

    Full Text Available Background: The subject of this paper is gene doping, which should be understood as "he non-therapeutic use of cells, genes, genetic elements, or of the modulation of gene expression, having the capacity to improve athletic performance". The authors of this work, based on the review of literature and previous research, make an attempt at wider characterization of gene doping and the discussion of related potential threats.Methods: This is a comprehensive survey of literature on the latest applications of molecular biology in medicine. The analysis involves a dozen scientific databases examined in order to find genes used in gene therapy and potentially useful in gene doping. Results: The obtained results enable better recognition of gene doping and indicate genes used in medicine that could be used in gene doping. This paper describes potential effects of their use and associated risk, and predicts the possible developments of gene doping in the future. Conclusion: Gene doping is undoubtedly a part of modern sport. Although WADA included gene doping on the list of banned methods as early as 2004, as previously stated above, it has not managed to develop efficient methods of detection.

  7. On atavisms and atavistic genes.

    Science.gov (United States)

    Cantú, J M; Ruiz, C

    1985-01-01

    The authors propose the term atavistic to designate a gene producing an ancestral phenotype (atavism). Several examples are presented, and the possible origin of atavistic genes, as well as their pathological implications discussed. PMID:3879145

  8. Genes That Influence Blood Pressure

    Science.gov (United States)

    ... Research Matters NIH Research Matters September 26, 2011 Genes that Influence Blood Pressure In one of the ... 16 previously unknown variations. Six were found in genes already suspected of regulating blood pressure. The remaining ...

  9. Genes and human brain evolution

    OpenAIRE

    Geschwind, Daniel H.; Konopka, Genevieve

    2012-01-01

    Several genes were duplicated during human evolution. It seems that one such duplication gave rise to a gene that may have helped to make human brains bigger and more adaptable than those of our ancestors.

  10. Gene Testing for Hereditary Ataxia

    Science.gov (United States)

    FAQ NATIONAL ATAXIA FOUNDATION FREQUENTLY ASKED QUESTIONS ABOUT... Gene Testing for Hereditary Ataxia This fact sheet provides an overview of gene testing for ataxia. It also addresses commonly asked ...

  11. Gene therapy in gastric cancer

    Institute of Scientific and Technical Information of China (English)

    Xu Chang-tai; Guo Xue-gang; Pan Bo-rong

    2003-01-01

    @@ 1 Introduction We have reviewed the gene therapy in gastrointestinal diseases[1]. Gastric cancer is common in China[2~20] ,and its early diagnosis andtreatment are still difficult up to now[13~36]. The expression of anexogenous gene introduced by gene therapy into patients with gliomascan be monitored non- invasively by positron- emission tomography[4]. In recent years, gene study in cancer is a hotspot, and great progress hasbeen achieved[33~41].

  12. Human housekeeping genes are compact

    OpenAIRE

    Eisenberg, Eli; Erez Y. Levanon

    2003-01-01

    We identify a set of 575 human genes that are expressed in all conditions tested in a publicly available database of microarray results. Based on this common occurrence, the set is expected to be rich in "housekeeping" genes, showing constitutive expression in all tissues. We compare selected aspects of their genomic structure with a set of background genes. We find that the introns, untranslated regions and coding sequences of the housekeeping genes are shorter, indicating a selection for co...

  13. Gene therapy of liver cancer

    OpenAIRE

    Hernandez-Alcoceba, R. (Rubén); B. Sangro; Prieto, J.

    2006-01-01

    The application of gene transfer technologies to the treatment of cancer has led to the development of new experimental approaches like gene directed enzyme/pro-drug therapy (GDEPT), inhibition of oncogenes and restoration of tumor-suppressor genes. In addition, gene therapy has a big impact on other fields like cancer immunotherapy, anti-angiogenic therapy and virotherapy. These strategies are being evaluated for the treatment of primary and metastatic liver cancer and some of them have reac...

  14. Genes y especies

    Directory of Open Access Journals (Sweden)

    A. G. Sáez

    2009-01-01

    Full Text Available La posibilidad de secuenciar y manipular los genes sigue abriendo fronteras en el estudio de las especies y la especiación. En tiempos recientes particularmente en dos direcciones. Por un lado, la secuenciación del gen COI (y otros en miles de muestras de forma sistemática y masiva, el llamado "DNA barcoding", está revelando una gran cantidad de biodiversidad, en buena medida previamente no sospechada y correspondiente a especies crípticas (morfológicamente irreconocibles. En segundo lugar, el estudio de los genes responsables de los cambios morfológicos nos está haciendo volver a dar una creciente importancia a la selección como motor de la especiación y de la evolución, incluso en presencia de dosis importantes de flujo génico.

  15. Gene-gene and gene-environmental interactions of childhood asthma: a multifactor dimension reduction approach.

    Directory of Open Access Journals (Sweden)

    Ming-Wei Su

    Full Text Available BACKGROUND: The importance of gene-gene and gene-environment interactions on asthma is well documented in literature, but a systematic analysis on the interaction between various genetic and environmental factors is still lacking. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a population-based, case-control study comprised of seventh-grade children from 14 Taiwanese communities. A total of 235 asthmatic cases and 1,310 non-asthmatic controls were selected for DNA collection and genotyping. We examined the gene-gene and gene-environment interactions between 17 single-nucleotide polymorphisms in antioxidative, inflammatory and obesity-related genes, and childhood asthma. Environmental exposures and disease status were obtained from parental questionnaires. The model-free and non-parametrical multifactor dimensionality reduction (MDR method was used for the analysis. A three-way gene-gene interaction was elucidated between the gene coding glutathione S-transferase P (GSTP1, the gene coding interleukin-4 receptor alpha chain (IL4Ra and the gene coding insulin induced gene 2 (INSIG2 on the risk of lifetime asthma. The testing-balanced accuracy on asthma was 57.83% with a cross-validation consistency of 10 out of 10. The interaction of preterm birth and indoor dampness had the highest training-balanced accuracy at 59.09%. Indoor dampness also interacted with many genes, including IL13, beta-2 adrenergic receptor (ADRB2, signal transducer and activator of transcription 6 (STAT6. We also used likelihood ratio tests for interaction and chi-square tests to validate our results and all tests showed statistical significance. CONCLUSIONS/SIGNIFICANCE: The results of this study suggest that GSTP1, INSIG2 and IL4Ra may influence the lifetime asthma susceptibility through gene-gene interactions in schoolchildren. Home dampness combined with each one of the genes STAT6, IL13 and ADRB2 could raise the asthma risk.

  16. Gene therapy for mucopolysaccharidosis

    OpenAIRE

    Ponder, Katherine P.; Haskins, Mark E.

    2007-01-01

    Mucopolysaccharidoses (MPS) are due to deficiencies in activities of lysosomal enzymes that degrade glycosaminoglycans. Some attempts at gene therapy for MPS in animal models have involved intravenous injection of vectors derived from an adeno-associated virus (AAV), adenovirus, retrovirus or a plasmid, which primarily results in expression in liver and secretion of the relevant enzyme into blood. Most vectors can correct disease in liver and spleen, although correction in other organs includ...

  17. Engineering prokaryotic gene circuits

    OpenAIRE

    Michalodimitrakis, Konstantinos; Isalan, Mark

    2009-01-01

    Engineering of synthetic gene circuits is a rapidly growing discipline, currently dominated by prokaryotic transcription networks, which can be easily rearranged or rewired to give different output behaviours. In this review, we examine both a rational and a combinatorial design of such networks and discuss progress on using in vitro evolution techniques to obtain functional systems. Moving beyond pure transcription networks, more and more networks are being implemented at the level of RNA, t...

  18. Gene Porter Bridwell

    Science.gov (United States)

    1994-01-01

    Gene Porter Bridwell served as the director of the Marshall Space Flight Center from January 6, 1994 until February 3, 1996, when he retired from NASA after thirty-four years service. Bridwell, a Marshall employee since 1962, had been Marshall's Space Shuttle Projects Office Director and Space Station Redesign Team deputy manager. Under Bridwell, Marshall worked to develop its role as a Center of Excellence for propulsion and for providing access to space.

  19. Gene therapy of cancer and development of therapeutic target gene

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene.

  20. Gene therapy of cancer and development of therapeutic target gene

    International Nuclear Information System (INIS)

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene

  1. Ascidian gene-expression profiles

    OpenAIRE

    William R Jeffery

    2002-01-01

    With the advent of gene-expression profiling, a large number of genes can now be investigated simultaneously during critical stages of development. This approach will be particularly informative in studies of ascidians, basal chordates whose genomes and embryology are uniquely suited for mapping developmental gene networks.

  2. Compositional gradients in Gramineae genes

    DEFF Research Database (Denmark)

    Wong, Gane Ka-Shu; Wang, Jun; Tao, Lin;

    2002-01-01

    In this study, we describe a property of Gramineae genes, and perhaps all monocot genes, that is not observed in eudicot genes. Along the direction of transcription, beginning at the junction of the 5'-UTR and the coding region, there are gradients in GC content, codon usage, and amino-acid usage...

  3. Decationized polyplexes for gene delivery

    NARCIS (Netherlands)

    Novo, L.; Mastrobattista, E.; Nostrum, van C.F.; Lammers, T.G.G.M.; Hennink, W.E.

    2015-01-01

    Gene therapy has received much attention in the field of drug delivery. Synthetic, nonviral gene delivery systems have gained increasing attention as vectors for gene therapy mainly due to a favorable immunogenicity profile and ease of manufacturing as compared to viral vectors. The great majority o

  4. Independent Gene Discovery and Testing

    Science.gov (United States)

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry

    2010-01-01

    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  5. Gene therapy for thyroid cancer

    International Nuclear Information System (INIS)

    Gene therapy for thyroid cancer include immunotherapy, suicide gene therapy, tumor suppressor replacement, 131I therapy by sodium/iodide symporter and antisense therapy and so on. Gene therapy has wide perspectives, but there are many problems need to be solved for clinical application

  6. nanosheets for gene therapy

    Science.gov (United States)

    Kou, Zhongyang; Wang, Xin; Yuan, Renshun; Chen, Huabin; Zhi, Qiaoming; Gao, Ling; Wang, Bin; Guo, Zhaoji; Xue, Xiaofeng; Cao, Wei; Guo, Liang

    2014-10-01

    A new class of two-dimensional (2D) nanomaterial, transition metal dichalcogenides (TMDCs) such as MoS2, MoSe2, WS2, and WSe2 which have fantastic physical and chemical properties, has drawn tremendous attention in different fields recently. Herein, we for the first time take advantage of the great potential of MoS2 with well-engineered surface as a novel type of 2D nanocarriers for gene delivery and therapy of cancer. In our system, positively charged MoS2-PEG-PEI is synthesized with lipoic acid-modified polyethylene glycol (LA-PEG) and branched polyethylenimine (PEI). The amino end of positively charged nanomaterials can bind to the negatively charged small interfering RNA (siRNA). After detection of physical and chemical characteristics of the nanomaterial, cell toxicity was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Polo-like kinase 1 (PLK1) was investigated as a well-known oncogene, which was a critical regulator of cell cycle transmission at multiple levels. Through knockdown of PLK1 with siRNA carried by novel nanovector, qPCR and Western blot were used to measure the interfering efficiency; apoptosis assay was used to detect the transfection effect of PLK1. All results showed that the novel nanocarrier revealed good biocompatibility, reduced cytotoxicity, as well as high gene-carrying ability without serum interference, thus would have great potential for gene delivery and therapy.

  7. Extracting gene-gene interactions through curve fitting.

    Science.gov (United States)

    Das, Ranajit; Mitra, Sushmita; Murthy, C A

    2012-12-01

    This paper presents a simple and novel curve fitting approach for generating simple gene regulatory subnetworks from time series gene expression data. Microarray experiments simultaneously generate massive data sets and help immensely in the large-scale study of gene expression patterns. Initial biclustering reduces the search space in the high-dimensional microarray data. The least-squares error between fitting of gene pairs is minimized to extract a set of gene-gene interactions, involving transcriptional regulation of genes. The higher error values are eliminated to retain only the strong interacting gene pairs in the resultant gene regulatory subnetwork. Next the algorithm is extended to a generalized framework to enhance its capability. The methodology takes care of the higher-order dependencies involving multiple genes co-regulating a single gene, while eliminating the need for user-defined parameters. It has been applied to the time-series Yeast data, and the experimental results biologically validated using standard databases and literature. PMID:22997274

  8. Identification of Significant Association and Gene-Gene Interaction of GABA Receptor Subunit Genes in Autism

    OpenAIRE

    Ma, D Q; Whitehead, P. L.; Menold, M M; Martin, E. R.; Ashley-Koch, A. E.; Mei, H; Ritchie, M. D.; Delong, G R; Abramson, R.K.; Wright, H. H.; Cuccaro, M. L.; Hussman, J. P.; Gilbert, J.R.; Pericak-Vance, M A

    2005-01-01

    Autism is a common neurodevelopmental disorder with a significant genetic component. Existing research suggests that multiple genes contribute to autism and that epigenetic effects or gene-gene interactions are likely contributors to autism risk. However, these effects have not yet been identified. Gamma-aminobutyric acid (GABA), the primary inhibitory neurotransmitter in the adult brain, has been implicated in autism etiology. Fourteen known autosomal GABA receptor subunit genes were studied...

  9. Gene Network Biological Validity Based on Gene-Gene Interaction Relevance

    OpenAIRE

    Francisco Gómez-Vela; Norberto Díaz-Díaz

    2014-01-01

    In recent years, gene networks have become one of the most useful tools for modeling biological processes. Many inference gene network algorithms have been developed as techniques for extracting knowledge from gene expression data. Ensuring the reliability of the inferred gene relationships is a crucial task in any study in order to prove that the algorithms used are precise. Usually, this validation process can be carried out using prior biological knowledge. The metabolic pathways stored in...

  10. Systematic use of universal 16S rRNA gene polymerase chain reaction (PCR) and sequencing for processing pleural effusions improves conventional culture techniques.

    Science.gov (United States)

    Insa, Rosario; Marín, Mercedes; Martín, Adoración; Martín-Rabadán, Pablo; Alcalá, Luís; Cercenado, Emilia; Calatayud, Laura; Liñares, Josefina; Bouza, Emilio

    2012-03-01

    Conventional culture of pleural fluid samples frequently provides false-negative results. Universal polymerase chain reaction (PCR) of the 16S ribosomal ribonucleic acid (rRNA) gene (16S PCR) has proven useful in the diagnosis of various bacterial infections. We conducted a prospective study to assess the value of 16S PCR in the etiologic diagnosis of pleural effusion. All pleural fluid samples received for culture were also studied using 16S PCR. Positive samples were sequenced for identification. Clinical records and conventional culture results were analyzed to classify pleural fluid samples as infected or not infected. We studied 723 samples. We excluded 188 samples because they were obtained from a long-term chest tube, there was a diagnosis of mycobacterial infection, or there were insufficient data to classify the episode. Finally, 535 pleural fluid samples were analyzed. According to our criteria, 82 (15.3%) were infected and 453 (84.7%) were not infected. In the infected samples, 16S PCR was positive in 67 samples (81.7%) while conventional culture was positive in 45 (54.9%). There were 4 false positives with 16S PCR (0.9%) and 12 with culture (2.6%). The values for the etiologic diagnosis of bacterial pleural effusion of conventional culture compared with 16S PCR were as follows: sensitivity, 54.9%/81.7%; specificity, 97.4%/99.1%; positive predictive value, 76.3%/94.4%; negative predictive value, 92.6%/96.8%; and accuracy, 90.8%/96.5%.When compared with conventional culture, 16S PCR plus sequencing substantially improves the etiologic diagnosis of infectious pleural effusion. In our opinion, this technique should be added to the routine diagnostic armamentarium of clinical microbiology laboratories.

  11. Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

    Science.gov (United States)

    Uhía, Iria; Galán, Beatriz; Medrano, Francisco Javier; García, José Luis

    2011-09-01

    The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P₅₂₂₈ promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P₅₂₂₈ promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P₅₂₂₈-β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P₅₂₂₈ promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism. PMID:21565928

  12. Gene therapy of liver cancer

    Institute of Scientific and Technical Information of China (English)

    Ruben Hernandez-Alcoceba; Bruno Sangro; Jesus Prieto

    2006-01-01

    The application of gene transfer technologies to the treatment of cancer has led to the development of new experimental approaches like gene directed enzyme/prodrug therapy (GDEPT), inhibition of oncogenes and restoration of tumor-suppressor genes. In addition,gene therapy has a big impact on other fields like cancer immunotherapy, anti-angiogenic therapy and virotherapy.These strategies are being evaluated for the treatment of primary and metastatic liver cancer and some of them have reached clinical phases. We present a review on the basis and the actual status of gene therapy approaches applied to liver cancer.

  13. Gene finding in novel genomes

    Directory of Open Access Journals (Sweden)

    Korf Ian

    2004-05-01

    Full Text Available Abstract Background Computational gene prediction continues to be an important problem, especially for genomes with little experimental data. Results I introduce the SNAP gene finder which has been designed to be easily adaptable to a variety of genomes. In novel genomes without an appropriate gene finder, I demonstrate that employing a foreign gene finder can produce highly inaccurate results, and that the most compatible parameters may not come from the nearest phylogenetic neighbor. I find that foreign gene finders are more usefully employed to bootstrap parameter estimation and that the resulting parameters can be highly accurate. Conclusion Since gene prediction is sensitive to species-specific parameters, every genome needs a dedicated gene finder.

  14. An appraisal of PCR-based technology in the detection of Mycobacterium tuberculosis.

    Science.gov (United States)

    Sankar, Sathish; Ramamurthy, Mageshbabu; Nandagopal, Balaji; Sridharan, Gopalan

    2011-02-01

    Tuberculosis is an under-recognized yet catastrophic health problem, particularly in developing countries. The HIV pandemic has served to increase the number of susceptible individuals, and multidrug-resistance and poor socioeconomic conditions also augment the prevalence and the consequences of the disease. To control the disease and its spread, it is vital that tuberculosis diagnostics are accurate and rapid. Whereas microscopy and culture have several limitations (low sensitivity is a problem for the former, while the latter has a delayed turnaround time), PCR-based techniques targeting regions of the Mycobacterium tuberculosis genome such as IS6110 have proved to be useful. The purpose of this review is to assess the use of PCR-RFLP, nested PCR and real-time PCR protocols and the choice of target regions for the detection of M. tuberculosis. Real-time PCR for the detection of M. tuberculosis target genes in clinical specimens has contributed to improving diagnosis and epidemiologic surveillance in the past decade. However, targeting one genome sequence such as IS6110 may not by itself be sufficiently sensitive to reach 100% diagnosis, especially in the case of pulmonary tuberculosis. Additional testing for target genome sequences such as hsp65 seems encouraging. An interesting approach would be a multiplex real-time PCR targeting both IS6110 and hsp65 to achieve comprehensive and specific molecular diagnosis. This technology needs development and adequate field testing before it becomes the acceptable gold standard for diagnosis.

  15. Validation of qPCR Methods for the Detection of Mycobacterium in New World Animal Reservoirs.

    Science.gov (United States)

    Housman, Genevieve; Malukiewicz, Joanna; Boere, Vanner; Grativol, Adriana D; Pereira, Luiz Cezar M; Silva, Ita de Oliveira; Ruiz-Miranda, Carlos R; Truman, Richard; Stone, Anne C

    2015-11-01

    Zoonotic pathogens that cause leprosy (Mycobacterium leprae) and tuberculosis (Mycobacterium tuberculosis complex, MTBC) continue to impact modern human populations. Therefore, methods able to survey mycobacterial infection in potential animal hosts are necessary for proper evaluation of human exposure threats. Here we tested for mycobacterial-specific single- and multi-copy loci using qPCR. In a trial study in which armadillos were artificially infected with M. leprae, these techniques were specific and sensitive to pathogen detection, while more traditional ELISAs were only specific. These assays were then employed in a case study to detect M. leprae as well as MTBC in wild marmosets. All marmosets were negative for M. leprae DNA, but 14 were positive for the mycobacterial rpoB gene assay. Targeted capture and sequencing of rpoB and other MTBC genes validated the presence of mycobacterial DNA in these samples and revealed that qPCR is useful for identifying mycobacterial-infected animal hosts. PMID:26571269

  16. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  17. Genes and Disease: Prader-Willi Syndrome

    Science.gov (United States)

    ... MD): National Center for Biotechnology Information (US); 1998-. Genes and Disease [Internet]. Show details National Center for ... Willi syndrome. PDF version of this page (220K) Gene sequence Genome view see gene locations Entrez Gene ...

  18. Gene Therapy and Children (For Parents)

    Science.gov (United States)

    ... Story" 5 Things to Know About Zika & Pregnancy Gene Therapy and Children KidsHealth > For Parents > Gene Therapy ... that don't respond to conventional therapies. About Genes Our genes help make us unique. Inherited from ...

  19. Genes and species

    OpenAIRE

    Sáez, Alberto G.

    2009-01-01

    La posibilidad de secuenciar y manipular los genes sigue abriendo fronteras en el estudio de las especies y la especiación. En tiempos recientes particularmente en dos direcciones. Por un lado, la secuenciación del gen COI (y otros) en miles de muestras de forma sistemática y masiva, el llamado "DNA barcoding", está revelando una gran cantidad de biodiversidad, en buena medida previamente no sospechada y correspondiente a especies crípticas (morfológicamente irreconocibles). En segundo lug...

  20. Computation in gene networks

    Science.gov (United States)

    Ben-Hur, Asa; Siegelmann, Hava T.

    2004-03-01

    Genetic regulatory networks have the complex task of controlling all aspects of life. Using a model of gene expression by piecewise linear differential equations we show that this process can be considered as a process of computation. This is demonstrated by showing that this model can simulate memory bounded Turing machines. The simulation is robust with respect to perturbations of the system, an important property for both analog computers and biological systems. Robustness is achieved using a condition that ensures that the model equations, that are generally chaotic, follow a predictable dynamics.

  1. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  2. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.

    Science.gov (United States)

    Warde-Farley, David; Donaldson, Sylva L; Comes, Ovi; Zuberi, Khalid; Badrawi, Rashad; Chao, Pauline; Franz, Max; Grouios, Chris; Kazi, Farzana; Lopes, Christian Tannus; Maitland, Anson; Mostafavi, Sara; Montojo, Jason; Shao, Quentin; Wright, George; Bader, Gary D; Morris, Quaid

    2010-07-01

    GeneMANIA (http://www.genemania.org) is a flexible, user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. Six organisms are currently supported (Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, Mus musculus, Homo sapiens and Saccharomyces cerevisiae) and hundreds of data sets have been collected from GEO, BioGRID, Pathway Commons and I2D, as well as organism-specific functional genomics data sets. Users can select arbitrary subsets of the data sets associated with an organism to perform their analyses and can upload their own data sets to analyze. The GeneMANIA algorithm performs as well or better than other gene function prediction methods on yeast and mouse benchmarks. The high accuracy of the GeneMANIA prediction algorithm, an intuitive user interface and large database make GeneMANIA a useful tool for any biologist. PMID:20576703

  3. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata;

    2015-01-01

    Many cancer-associated somatic copy number alterations (SCNAs) are known. Currently, one of the challenges is to identify the molecular downstream effects of these variants. Although several SCNAs are known to change gene expression levels, it is not clear whether each individual SCNA affects gene...... expression. We reanalyzed 77,840 expression profiles and observed a limited set of 'transcriptional components' that describe well-known biology, explain the vast majority of variation in gene expression and enable us to predict the biological function of genes. On correcting expression profiles...... for these components, we observed that the residual expression levels (in 'functional genomic mRNA' profiling) correlated strongly with copy number. DNA copy number correlated positively with expression levels for 99% of all abundantly expressed human genes, indicating global gene dosage sensitivity. By applying...

  4. PROAPOPTOTIC FUNCTION OF FHIT GENE

    Institute of Scientific and Technical Information of China (English)

    QIU Zhe-fu; HAN De-min; ZHANG Luo; ZHANG Wei

    2006-01-01

    Tumor suppressor gene plays an important role in maintaining the homeostasis between cell loss and growth. Fragile in maintaining the homeostasis between cell loss and growth. Fragile histidine triad (FHIT) gene found recently was studied in a deep going way; it becomes the focus as a result of its roleof ep going way; it becomes the focus as a result of its roleof anti-tumor in human various type of tissue. Due to the high efficiency of FHIT gene benefiting the anti-tumor, it is proposed gh efficiency of FHIT gene benefiting the anti-tumor, it is proposed as a candidate of tumor suppressor gene though there are several opposite opinions.several opposite opinions. We stress the summary of some properties of FHIT gene on proapoptosis according to the published data which showed gene on proapoptosis according to the published data which showed the stronger proapoptotic function of FHIT gene; the apoptosis induced by FHIT depends on the expression level and status of ene; the apoptosis induced by FHIT depends on the expression level and status of FHIT; and FHIT gene can alternate the cell cycling properties and reduce the tumorigenic potential; the apoptotic process e can alternate the cell cycling properties and reduce the tumorigenic potential; the apoptotic process induced by FHIT has no relation to p53 gene. In a ward, in consideration of its multiple functions against malignancies, FHIT in consideration of its multiple functions against malignancies, FHIT gene deserves attention and exploration as a selective target for searching the mechanism of tumorigenesis and clinical et for searching the mechanism of tumorigenesis and clinical therapeutic applications in further.le histidine triad (FHIT) gene; Apoptosis; Tumorigenesis; Tumor suppressor gene deserves attention and exploration as a selective target for searching the mechanism of tumorigenesis and clinical therapeutic applications in further.

  5. Identifying Driver Genes in Cancer by Triangulating Gene Expression, Gene Location, and Survival Data

    Science.gov (United States)

    Rouam, Sigrid; Miller, Lance D; Karuturi, R Krishna Murthy

    2014-01-01

    Driver genes are directly responsible for oncogenesis and identifying them is essential in order to fully understand the mechanisms of cancer. However, it is difficult to delineate them from the larger pool of genes that are deregulated in cancer (ie, passenger genes). In order to address this problem, we developed an approach called TRIAngulating Gene Expression (TRIAGE through clinico-genomic intersects). Here, we present a refinement of this approach incorporating a new scoring methodology to identify putative driver genes that are deregulated in cancer. TRIAGE triangulates – or integrates – three levels of information: gene expression, gene location, and patient survival. First, TRIAGE identifies regions of deregulated expression (ie, expression footprints) by deriving a newly established measure called the Local Singular Value Decomposition (LSVD) score for each locus. Driver genes are then distinguished from passenger genes using dual survival analyses. Incorporating measurements of gene expression and weighting them according to the LSVD weight of each tumor, these analyses are performed using the genes located in significant expression footprints. Here, we first use simulated data to characterize the newly established LSVD score. We then present the results of our application of this refined version of TRIAGE to gene expression data from five cancer types. This refined version of TRIAGE not only allowed us to identify known prominent driver genes, such as MMP1, IL8, and COL1A2, but it also led us to identify several novel ones. These results illustrate that TRIAGE complements existing tools, allows for the identification of genes that drive cancer and could perhaps elucidate potential future targets of novel anticancer therapeutics. PMID:25949096

  6. Genes of aging.

    Science.gov (United States)

    Hamet, Pavel; Tremblay, Johanne

    2003-10-01

    According to developmental genetics theories, aging is a genetically programmed and controlled continuum of development and maturation. Being dynamic and malleable processes, development and aging are controlled not only by genes but also by environmental and epigenetic influences that predominate in the second half of life. Genetic mutations affect many phenotypes in flies, worms, rodents, and humans which share several diseases or their equivalents, including cancer, neurodegeneration, and infectious disorders as well as their susceptibility to them. Life span and stress resistance are closely linked. Oxidative stress actually constitutes a defined hypothesis of aging in that macromolecule oxidative damage accumulates with age and tends to be associated with life expectancy. DNA methylation, a force in the regulation of gene expression, is also one of the biomarkers of genetic damage. The mitotic clock of aging is marked, if not guided, by telomeres, essential genetic elements stabilizing natural chromosomic ends. The dream of humans to live longer, healthy lives is being tested by attempts to modify longevity in animal models, frequently by dietary manipulation. The quest continues to understand the mechanisms of healthy aging, one of the most compelling areas of research in the 21st century. PMID:14577056

  7. Tetraspanin genes in plants.

    Science.gov (United States)

    Wang, Feng; Vandepoele, Klaas; Van Lijsebettens, Mieke

    2012-07-01

    Tetraspanins represent a four-transmembrane protein superfamily with a conserved structure and amino acid residues that are present in mammals, insects, fungi and plants. Tetraspanins interact with each other or with other membrane proteins to form tetraspanin-enriched microdomains that play important roles in development, pathogenesis and immune responses via facilitating cell-cell adhesion and fusion, ligand binding and intracellular trafficking. Here, we emphasize evolutionary aspects within the plant kingdom based on genomic sequence information. A phylogenetic tree based on 155 tetraspanin genes of 11 plant species revealed ancient and fast evolving clades. Tetraspanins were only present in multicellular plants, were often duplicated in the plant genomes and predicted by the electronic Fluorescent Pictograph for gene expression analysis to be either functionally redundant or divergent. Tetraspanins contain a large extracellular loop with conserved cysteines that provide the binding sites for the interactions. The Arabidopsis thaliana TETRASPANIN1/TORNADO2/EKEKO has a function in leaf and root patterning and TETRASPANIN3 was identified in the plasmodesmatal proteome, suggesting a role in cell-cell communication during plant development.

  8. Immunity-related genes and gene families in Anopheles gambiae.

    Science.gov (United States)

    Christophides, George K; Zdobnov, Evgeny; Barillas-Mury, Carolina; Birney, Ewan; Blandin, Stephanie; Blass, Claudia; Brey, Paul T; Collins, Frank H; Danielli, Alberto; Dimopoulos, George; Hetru, Charles; Hoa, Ngo T; Hoffmann, Jules A; Kanzok, Stefan M; Letunic, Ivica; Levashina, Elena A; Loukeris, Thanasis G; Lycett, Gareth; Meister, Stephan; Michel, Kristin; Moita, Luis F; Müller, Hans-Michael; Osta, Mike A; Paskewitz, Susan M; Reichhart, Jean-Marc; Rzhetsky, Andrey; Troxler, Laurent; Vernick, Kenneth D; Vlachou, Dina; Volz, Jennifer; von Mering, Christian; Xu, Jiannong; Zheng, Liangbiao; Bork, Peer; Kafatos, Fotis C

    2002-10-01

    We have identified 242 Anopheles gambiae genes from 18 gene families implicated in innate immunity and have detected marked diversification relative to Drosophila melanogaster. Immune-related gene families involved in recognition, signal modulation, and effector systems show a marked deficit of orthologs and excessive gene expansions, possibly reflecting selection pressures from different pathogens encountered in these insects' very different life-styles. In contrast, the multifunctional Toll signal transduction pathway is substantially conserved, presumably because of counterselection for developmental stability. Representative expression profiles confirm that sequence diversification is accompanied by specific responses to different immune challenges. Alternative RNA splicing may also contribute to expansion of the immune repertoire. PMID:12364793

  9. Gene-targeting pharmaceuticals for single-gene disorders.

    Science.gov (United States)

    Beaudet, Arthur L; Meng, Linyan

    2016-04-15

    The concept of orphan drugs for treatment of orphan genetic diseases is perceived enthusiastically at present, and this is leading to research investment on the part of governments, disease-specific foundations and industry. This review attempts to survey the potential to use traditional pharmaceuticals as opposed to biopharmaceuticals to treat single-gene disorders. The available strategies include the use of antisense oligonucleotides (ASOs) to alter splicing or knock-down expression of a transcript, siRNAs to knock-down gene expression and drugs for nonsense mutation read-through. There is an approved drug for biallelic knock-down of the APOB gene as treatment for familial hypercholesterolemia. Both ASOs and siRNAs are being explored to knock-down the transthyretin gene to prevent the related form of amyloidosis. The use of ASOs to alter gene-splicing to treat spinal muscular atrophy is in phase 3 clinical trials. Work is progressing on the use of ASOs to activate the normally silent paternal copy of the imprinted UBE3A gene in neurons as a treatment for Angelman syndrome. A gene-activation or gene-specific ramp-up strategy would be generally helpful if such could be developed. There is exciting theoretical potential for converting biopharmaceutical strategies such gene correction and CRISPR-Cas9 editing to a synthetic pharmaceutical approach. PMID:26628634

  10. 散发性皮肤非结核分枝杆菌感染37例回顾研究%Sporadic cutaneous infections due to nontuberculous mycobacteria: a retrospective study of 37 cases

    Institute of Scientific and Technical Information of China (English)

    金江; 贾军; 丁晓岚; 陈雪; 孙青苗; 徐健楠; 薛晨红; 杜娟; 蔡林

    2015-01-01

    Objective:To study the clinical and pathological characteristics of sporadic cutaneous in-fections due to nontuberculous mycobacteria ( NTM) , and investigate the diagnostic criteria and therapeu-tic principal. Methods:Totally 37 cases of sporadic cutaneous infections due to NTM were confirmed in the Department of Dermatology, Peking University People's Hospital from January 2000 to March 2014. The microbiologic and clinical data were reviewed, and their skin biopsy specimens were reassessed. Re-sults:Of all the 37 patients, 30 cases were Mycobacterium marinum infection, 6 were Mycobacterium ab-scessus infection, and one was Mycobacterium chelonea and Mycobacterium fortuitum infection. Identifica-tion of mycobacterial species by analysis of hsp65 gene in tissue DNA was more sensitive than traditional bacterial culture. The most common risk factors were traumatic injuries ( 21 of 37 ) and aquarium or fish-related job (21 of 37). One case of Mycobacterium abscessus infection occurred after autologous fat filling. Nodule and plaque were most common lesions in Mycobacterium marinum infection. Twenty-four of the 30 cases of Mycobacterium marinum infection presented with multiple lesions or sporotrichoid spread lesions. Ulceration, papules, abscess, and purulent discharge were observed in cases of Mycobac-terium abscessus infection. Infective granuloma was most common histopathological appearance. For the treatment of Mycobacterium marinum infection, rifampin, ethambutol, and clarithromycin were commonly used (combination of two antibiotics, or three antibiotics), with the cure rate 90. 00%. Four of the six Mycobacterium abscessus infections cases were cured, and one patient died. Conclusion:The most com-mon species of sporadic cutaneous infections due to NTM is Mycobacterium marinum. Traumatic injuries, aquarium or fish-related job, and cosmetic surgeries are common risk factors. Mycobacterium marinum in-fection often presents with nodules, plaques, and sometimes

  11. Sporadic cutaneous infections due to nontuberculous mycobacteria: a retrospective study of 37 cases%散发性皮肤非结核分枝杆菌感染37例回顾研究

    Institute of Scientific and Technical Information of China (English)

    金江; 贾军; 丁晓岚; 陈雪; 孙青苗; 徐健楠; 薛晨红; 杜娟; 蔡林

    2015-01-01

    Objective:To study the clinical and pathological characteristics of sporadic cutaneous in-fections due to nontuberculous mycobacteria ( NTM) , and investigate the diagnostic criteria and therapeu-tic principal. Methods:Totally 37 cases of sporadic cutaneous infections due to NTM were confirmed in the Department of Dermatology, Peking University People's Hospital from January 2000 to March 2014. The microbiologic and clinical data were reviewed, and their skin biopsy specimens were reassessed. Re-sults:Of all the 37 patients, 30 cases were Mycobacterium marinum infection, 6 were Mycobacterium ab-scessus infection, and one was Mycobacterium chelonea and Mycobacterium fortuitum infection. Identifica-tion of mycobacterial species by analysis of hsp65 gene in tissue DNA was more sensitive than traditional bacterial culture. The most common risk factors were traumatic injuries ( 21 of 37 ) and aquarium or fish-related job (21 of 37). One case of Mycobacterium abscessus infection occurred after autologous fat filling. Nodule and plaque were most common lesions in Mycobacterium marinum infection. Twenty-four of the 30 cases of Mycobacterium marinum infection presented with multiple lesions or sporotrichoid spread lesions. Ulceration, papules, abscess, and purulent discharge were observed in cases of Mycobac-terium abscessus infection. Infective granuloma was most common histopathological appearance. For the treatment of Mycobacterium marinum infection, rifampin, ethambutol, and clarithromycin were commonly used (combination of two antibiotics, or three antibiotics), with the cure rate 90. 00%. Four of the six Mycobacterium abscessus infections cases were cured, and one patient died. Conclusion:The most com-mon species of sporadic cutaneous infections due to NTM is Mycobacterium marinum. Traumatic injuries, aquarium or fish-related job, and cosmetic surgeries are common risk factors. Mycobacterium marinum in-fection often presents with nodules, plaques, and sometimes

  12. Gene polymorphisms in chronic periodontitis

    OpenAIRE

    Laine, Marja L; Loos, Bruno G.; Crielaard, W.

    2010-01-01

    We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or polymorphism. Candidate gene polymorphism studies with a case-control design and reported genotype frequencies in CP patients were searched and reviewed. There is growing evidence that polymorphisms in ...

  13. Hormones, genes, and behavior

    OpenAIRE

    Pfaff, Donald W.

    1997-01-01

    With assays of hormone-sensitive behaviors, it is possible to demonstrate both direct and indirect actions of genes on mammalian social behaviors. Direct effects of estrogen receptor gene expression and progesterone receptor gene expression figure prominently in well analyzed neuroendocrine mechanisms for sex behavior, operating through a neural circuit that has been delineated. Indirect effects, notably the consequences of sexual differentiation, display complex d...

  14. Gene set analysis for GWAS

    DEFF Research Database (Denmark)

    Debrabant, Birgit; Soerensen, Mette

    2014-01-01

    Abstract We discuss the use of modified Kolmogorov-Smirnov (KS) statistics in the context of gene set analysis and review corresponding null and alternative hypotheses. Especially, we show that, when enhancing the impact of highly significant genes in the calculation of the test statistic...... parameter and the genesis and distribution of the gene-level statistics, and illustrate the effects of differential weighting in a real-life example....

  15. Gene therapy in pancreatic cancer

    OpenAIRE

    Liu, Si-Xue; Xia, Zhong-Sheng; Zhong, Ying-Qiang

    2014-01-01

    Pancreatic cancer (PC) is a highly lethal disease and notoriously difficult to treat. Only a small proportion of PC patients are eligible for surgical resection, whilst conventional chemoradiotherapy only has a modest effect with substantial toxicity. Gene therapy has become a new widely investigated therapeutic approach for PC. This article reviews the basic rationale, gene delivery methods, therapeutic targets and developments of laboratory research and clinical trials in gene therapy of PC...

  16. Testing for gene-gene interaction with AMMI models.

    Science.gov (United States)

    Barhdadi, Amina; Dubé, Marie-Pierre

    2010-01-01

    Studies have shown that many common diseases are influenced by multiple genes and their interactions. There is currently a strong interest in testing for association between combinations of these genes and disease, in particular because genes that affect the risk of disease only in the presence of another genetic variant may not be detected in marginal analysis. In this paper we propose the use of additive main effect and multiplicative interaction (AMMI) models to detect and to quantify gene-gene interaction effects for a quantitative trait. The objective of the present research is to demonstrate the practical advantages of these models to describe complex interaction between two unlinked loci. Although gene-gene interactions have often been defined as a deviance from additive genetic effects, the residual term has generally not been appropriately treated. The AMMI models allow for the analysis of a two way factorial data structure and combine the analysis of variance of the two main genotype effects with a principal component analysis of the residual multiplicative interaction. The AMMI models for gene-gene interaction presented here allow for the testing of non additivity between the two loci, and also describe how their interaction structure fits the existing non-additivity. Moreover, these models can be used to identify the specific two genotypes combinations that contribute to the significant gene-gene interaction. We describe the use of the biplot to display the structure of the interaction and evaluate the performance of the AMMI and the special cases of the AMMI previously described by Tukey and Mandel with simulated data sets. Our simulated study showed that the AMMI model is as powerful as general linear models when the interaction is not modeled in the presence of marginal effects. However, in the presence of pure epitasis, i.e. in the absence of marginal effects, the AMMI method was not found to be superior to other tested regression methods.

  17. A genetic ensemble approach for gene-gene interaction identification

    Directory of Open Access Journals (Sweden)

    Ho Joshua WK

    2010-10-01

    Full Text Available Abstract Background It has now become clear that gene-gene interactions and gene-environment interactions are ubiquitous and fundamental mechanisms for the development of complex diseases. Though a considerable effort has been put into developing statistical models and algorithmic strategies for identifying such interactions, the accurate identification of those genetic interactions has been proven to be very challenging. Methods In this paper, we propose a new approach for identifying such gene-gene and gene-environment interactions underlying complex diseases. This is a hybrid algorithm and it combines genetic algorithm (GA and an ensemble of classifiers (called genetic ensemble. Using this approach, the original problem of SNP interaction identification is converted into a data mining problem of combinatorial feature selection. By collecting various single nucleotide polymorphisms (SNP subsets as well as environmental factors generated in multiple GA runs, patterns of gene-gene and gene-environment interactions can be extracted using a simple combinatorial ranking method. Also considered in this study is the idea of combining identification results obtained from multiple algorithms. A novel formula based on pairwise double fault is designed to quantify the degree of complementarity. Conclusions Our simulation study demonstrates that the proposed genetic ensemble algorithm has comparable identification power to Multifactor Dimensionality Reduction (MDR and is slightly better than Polymorphism Interaction Analysis (PIA, which are the two most popular methods for gene-gene interaction identification. More importantly, the identification results generated by using our genetic ensemble algorithm are highly complementary to those obtained by PIA and MDR. Experimental results from our simulation studies and real world data application also confirm the effectiveness of the proposed genetic ensemble algorithm, as well as the potential benefits of

  18. ERGDB: Estrogen Responsive Genes Database.

    Science.gov (United States)

    Tang, Suisheng; Han, Hao; Bajic, Vladimir B

    2004-01-01

    ERGDB is an integrated knowledge database dedicated to genes responsive to estrogen. Genes included in ERGDB are those whose expression levels are experimentally proven to be either up-regulated or down-regulated by estrogen. Genes included are identified based on publications from the PubMed database and each record has been manually examined, evaluated and selected for inclusion by biologists. ERGDB aims to be a unified gateway to store, search, retrieve and update information about estrogen responsive genes. Each record contains links to relevant databases, such as GenBank, LocusLink, Refseq, PubMed and ATCC. The unique feature of ERGDB is that it contains information on the dependence of gene reactions on experimental conditions. In addition to basic information about the genes, information for each record includes gene functional description, experimental methods used, tissue or cell type, gene reaction, estrogen exposure time and the summary of putative estrogen response elements if the gene's promoter sequence was available. Through a web interface at http://sdmc.i2r.a-star.edu.sg/ergdb/ cgi-bin/explore.pl users can either browse or query ERGDB. Access is free for academic and non-profit users. PMID:14681475

  19. Gene-environment interaction.

    Science.gov (United States)

    Manuck, Stephen B; McCaffery, Jeanne M

    2014-01-01

    With the advent of increasingly accessible technologies for typing genetic variation, studies of gene-environment (G×E) interactions have proliferated in psychological research. Among the aims of such studies are testing developmental hypotheses and models of the etiology of behavioral disorders, defining boundaries of genetic and environmental influences, and identifying individuals most susceptible to risk exposures or most amenable to preventive and therapeutic interventions. This research also coincides with the emergence of unanticipated difficulties in detecting genetic variants of direct association with behavioral traits and disorders, which may be obscured if genetic effects are expressed only in predisposing environments. In this essay we consider these and other rationales for positing G×E interactions, review conceptual models meant to inform G×E interpretations from a psychological perspective, discuss points of common critique to which G×E research is vulnerable, and address the role of the environment in G×E interactions.

  20. Angiogenin gene polymorphism

    Institute of Scientific and Technical Information of China (English)

    Hongli Wang; Dongsheng Fan; Yingshuang Zhang

    2013-01-01

    Angiogenin is associated with the pathogenesis of diabetic peripheral neuropathy. Here, we se-quenced the coding region of the angiogenin gene in genomic DNA from 207 patients with type 2 diabetes mel itus (129 diabetic peripheral neuropathy patients and 78 diabetic non-neuropathy pa-tients) and 268 healthy controls. Al subjects were from the Han population of northern China. No mutations were found. We then compared the genotype and allele frequencies of the angiogenin synonymous single nucleotide polymorphism rs11701 between the diabetic peripheral neuropathy patients and controls, and between the diabetic neuropathy and non-neuropathy patients, using a case-control design. We detected no statistical y significant genetic associations. Angiogenin may not be associated with genetic susceptibility to diabetic peripheral neuropathy in the Han population of northern China.

  1. Mycobacterium avium subsp. paratuberculosis as a trigger of type-1 diabetes: destination Sardinia, or beyond?

    Directory of Open Access Journals (Sweden)

    Rani Pittu

    2010-03-01

    Full Text Available Abstract Type 1 diabetes mellitus (T1DM is a multifactorial autoimmune disease in which the insulin producing β cell population is destroyed by the infiltrated T lymphocytes. Even though the exact cause of T1DM is yet to be ascertained, varying degree of genetic susceptibility and environmental factors have been linked to the disease progress and outcome. Mycobacterium avium subsp. paratuberculosis (MAP is an obligate zoonotic pathogen that causes chronic infection of intestines in ruminants, the Johne's disease. MAP that can even survive pasteurization and chlorination has also been implicated to cause similar type of enteritis in humans called Crohn's disease. With the increasing recognition of the link between MAP and Crohn's disease, it has been postulated that MAP is an occult antigen which besides Crohn's could as well be thought to trigger T1DM. Epitope homologies between mycobacterial proteins (Hsp 65 and pancreatic glutamic acid decarboxylase (GAD 65 and infant nutrition studies implicate MAP as one of the triggers for T1DM. PCR and ELISA analyses in diabetic patients from Sardinia suggest that MAP acts as a possible trigger for T1DM. Systematic mechanistic insights are needed to prove this link. Unfortunately, no easy animal model(s or in-vitro systems are available to decipher the complex immunological network that is triggered in MAP infection leading to T1DM.

  2. Multiphasic strain differentiation of atypical mycobacteria from elephant trunk wash.

    Science.gov (United States)

    Chan, Kok-Gan; Loke, Mun Fai; Ong, Bee Lee; Wong, Yan Ling; Hong, Kar Wai; Tan, Kian Hin; Kaur, Sargit; Ng, Hien Fuh; Abdul Razak, Mfa; Ngeow, Yun Fong

    2015-01-01

    Background. Two non-tuberculous mycobacterial strains, UM_3 and UM_11, were isolated from the trunk wash of captive elephants in Malaysia. As they appeared to be identical phenotypes, they were investigated further by conventional and whole genome sequence-based methods of strain differentiation. Methods. Multiphasic investigations on the isolates included species identification with hsp65 PCR-sequencing, conventional biochemical tests, rapid biochemical profiling using API strips and the Biolog Phenotype Microarray analysis, protein profiling with liquid chromatography-mass spectrometry, repetitive sequence-based PCR typing and whole genome sequencing followed by phylogenomic analyses. Results. The isolates were shown to be possibly novel slow-growing schotochromogens with highly similar biological and genotypic characteristics. Both strains have a genome size of 5.2 Mbp, G+C content of 68.8%, one rRNA operon and 52 tRNAs each. They qualified for classification into the same species with their average nucleotide identity of 99.98% and tetranucleotide correlation coefficient of 0.99999. At the subspecies level, both strains showed 98.8% band similarity in the Diversilab automated repetitive sequence-based PCR typing system, 96.2% similarity in protein profiles obtained by liquid chromatography mass spectrometry, and a genomic distance that is close to zero in the phylogenomic tree constructed with conserved orthologs. Detailed epidemiological tracking revealed that the elephants shared a common habitat eight years apart, thus, strengthening the possibility of a clonal relationship between the two strains. PMID:26587340

  3. Heat shock protein 60 activates B cells via the TLR4-MyD88 pathway.

    Science.gov (United States)

    Cohen-Sfady, Michal; Nussbaum, Gabriel; Pevsner-Fischer, Meirav; Mor, Felix; Carmi, Pnina; Zanin-Zhorov, Alexandra; Lider, Ofer; Cohen, Irun R

    2005-09-15

    We recently reported that soluble 60-kDa heat shock protein (HSP60) can directly activate T cells via TLR2 signaling to enhance their Th2 response. In this study we investigated whether HSP60 might also activate B cells by an innate signaling pathway. We found that human HSP60 (but not the Escherichia coli GroEL or the Mycobacterial HSP65 molecules) induced naive mouse B cells to proliferate and to secrete IL-10 and IL-6. In addition, the HSP60-treated B cells up-regulated their expression of MHC class II and accessory molecules CD69, CD40, and B7-2. We tested the functional ability of HSP60-treated B cells to activate an allogeneic T cell response and found enhanced secretion of both IL-10 and IFN-gamma by the responding T cells. The effects of HSP60 were found to be largely dependent on TLR4 and MyD88 signaling; B cells from TLR4-mutant mice or from MyD88 knockout mice showed decreased responses to HSP60. Care was taken to rule out contamination of the HSP60 with LPS as a causative factor. These findings add B cells to the complex web of interactions by which HSP60 can regulate immune responses. PMID:16148103

  4. Are TMEM genes potential candidate genes for panic disorder?

    DEFF Research Database (Denmark)

    NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne;

    2014-01-01

    We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...

  5. STATE-OF-THE-ART HUMAN GENE THERAPY: PART I. GENE DELIVERY TECHNOLOGIES

    OpenAIRE

    Wang, Dan; Gao, Guangping

    2014-01-01

    Safe and effective gene delivery is a prerequisite for successful gene therapy. In the early age of human gene therapy, setbacks due to problematic gene delivery vehicles plagued the exciting therapeutic outcome. However, gene delivery technologies rapidly evolved ever since. With the advancement of gene delivery techniques, gene therapy clinical trials surged during the past decade. As the first gene therapy product has obtained regulatory approval and reached clinic, human gene therapy fina...

  6. Classifying genes to the correct Gene Ontology Slim term in Saccharomyces cerevisiae using neighbouring genes with classification learning

    Directory of Open Access Journals (Sweden)

    Tsatsoulis Costas

    2010-05-01

    Full Text Available Abstract Background There is increasing evidence that gene location and surrounding genes influence the functionality of genes in the eukaryotic genome. Knowing the Gene Ontology Slim terms associated with a gene gives us insight into a gene's functionality by informing us how its gene product behaves in a cellular context using three different ontologies: molecular function, biological process, and cellular component. In this study, we analyzed if we could classify a gene in Saccharomyces cerevisiae to its correct Gene Ontology Slim term using information about its location in the genome and information from its nearest-neighbouring genes using classification learning. Results We performed experiments to establish that the MultiBoostAB algorithm using the J48 classifier could correctly classify Gene Ontology Slim terms of a gene given information regarding the gene's location and information from its nearest-neighbouring genes for training. Different neighbourhood sizes were examined to determine how many nearest neighbours should be included around each gene to provide better classification rules. Our results show that by just incorporating neighbour information from each gene's two-nearest neighbours, the percentage of correctly classified genes to their correct Gene Ontology Slim term for each ontology reaches over 80% with high accuracy (reflected in F-measures over 0.80 of the classification rules produced. Conclusions We confirmed that in classifying genes to their correct Gene Ontology Slim term, the inclusion of neighbour information from those genes is beneficial. Knowing the location of a gene and the Gene Ontology Slim information from neighbouring genes gives us insight into that gene's functionality. This benefit is seen by just including information from a gene's two-nearest neighbouring genes.

  7. Erg gene: a human gene related to the ets oncogene

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, E.S.P.; Rao, V.N.; Papas, T.S.

    1987-09-01

    The authors have isolated a cDNA clone representing the complete coding sequence of a human gene named erg, related to the ets oncogene. Nucleotide sequence analysis of this cDNA (4.6 kilobases long) revealed that this gene encodes a 363-residue protein whose predicted amino acid sequence showed a homology of approx. = 40% and 70% to two domains corresponding to the 5' and 3' regions of v-ets oncogene, respectively. A 3.2- to 3.6-kilobase and approx. = 5-kilobase transcript of the erg gene, which differ in size from those of the previously described Hu-ets 1 and Hu-ets 2 genes, were observed in different cells. These results suggest that the erg gene is a member of the ets oncogen family.

  8. Gene-Gene and Gene-Environment Interactions in Ulcerative Colitis

    OpenAIRE

    Wang, Ming-Hsi; FIOCCHI, CLAUDIO; Zhu, Xiaofeng; Ripke, Stephan; Kamboh, M. Ilyas; Rebert, Nancy; Duerr, Richard H.; Achkar, Jean-Paul

    2013-01-01

    Genome-wide association studies (GWAS) have identified at least 133 ulcerative colitis (UC) associated loci. The role of genetic factors in clinical practice is not clearly defined. The relevance of genetic variants to disease pathogenesis is still uncertain because of not characterized gene-gene and gene-environment interactions. We examined the predictive value of combining the 133 UC risk loci with genetic interactions in an ongoing inflammatory bowel disease (IBD) GWAS. The Wellcome Trust...

  9. Evidence Based Selection of Housekeeping Genes

    OpenAIRE

    de Jonge, Hendrik J.M.; Fehrmann, Rudolf S. N.; Eveline S. J. M. de Bont; Hofstra, Robert M. W.; Gerbens, Frans; Kamps, Willem A.; Vries, Elisabeth G. E.; van der Zee, Ate G.J.; te Meerman, Gerard J.; ter Elst, Arja

    2007-01-01

    For accurate and reliable gene expression analysis, normalization of gene expression data against housekeeping genes (reference or internal control genes) is required. It is known that commonly used housekeeping genes (e.g. ACTB, GAPDH, HPRT1, and B2M) vary considerably under different experimental conditions and therefore their use for normalization is limited. We performed a meta-analysis of 13,629 human gene array samples in order to identify the most stable expressed genes. Here we show n...

  10. Advancement and prospects of tumor gene therapy

    OpenAIRE

    Zhang, Chao; Wang, Qing-Tao; Liu, He; Zhang, Zhen-Zhu; Huang, Wen-Lin

    2011-01-01

    Gene therapy is one of the most attractive fields in tumor therapy. In past decades, significant progress has been achieved. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. Several therapeutic strategies have evolved, including gene-based (tumor suppressor genes, suicide genes, antiangiogenic genes, cytokine and oxidative stress-based genes) and RNA-based (antisense oligonucleotides and RNA inter...

  11. Candidate gene prioritization with Endeavour.

    Science.gov (United States)

    Tranchevent, Léon-Charles; Ardeshirdavani, Amin; ElShal, Sarah; Alcaide, Daniel; Aerts, Jan; Auboeuf, Didier; Moreau, Yves

    2016-07-01

    Genomic studies and high-throughput experiments often produce large lists of candidate genes among which only a small fraction are truly relevant to the disease, phenotype or biological process of interest. Gene prioritization tackles this problem by ranking candidate genes by profiling candidates across multiple genomic data sources and integrating this heterogeneous information into a global ranking. We describe an extended version of our gene prioritization method, Endeavour, now available for six species and integrating 75 data sources. The performance (Area Under the Curve) of Endeavour on cross-validation benchmarks using 'gold standard' gene sets varies from 88% (for human phenotypes) to 95% (for worm gene function). In addition, we have also validated our approach using a time-stamped benchmark derived from the Human Phenotype Ontology, which provides a setting close to prospective validation. With this benchmark, using 3854 novel gene-phenotype associations, we observe a performance of 82%. Altogether, our results indicate that this extended version of Endeavour efficiently prioritizes candidate genes. The Endeavour web server is freely available at https://endeavour.esat.kuleuven.be/. PMID:27131783

  12. Candidate genes for behavioural ecology

    NARCIS (Netherlands)

    Fitzpatrick, M.J.; Ben-Sahar, Y.; Smid, H.M.; Vet, L.E.M.; Robinson, G.E.; Sokolowski, M.B.

    2005-01-01

    In spite of millions of years of evolutionary divergence, the conservation of gene function is common across distant lineages. As such, genes that are known to influence behaviour in one organism are likely to influence similar behaviours in other organisms. Recent studies of the evolution of behavi

  13. Gene polymorphisms in chronic periodontitis

    NARCIS (Netherlands)

    M.L. Laine; B.G. Loos; W. Crielaard

    2010-01-01

    We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or polym

  14. FunGeneClusterS

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla; Brandl, Julian; Andersen, Mikael Rørdam

    2016-01-01

    Secondary metabolites of fungi are receiving an increasing amount of interest due to their prolific bioactivities and the fact that fungal biosynthesis of secondary metabolites often occurs from co-regulated and co-located gene clusters. This makes the gene clusters attractive for synthetic biology...

  15. Determining Semantically Related Significant Genes.

    Science.gov (United States)

    Taha, Kamal

    2014-01-01

    GO relation embodies some aspects of existence dependency. If GO term xis existence-dependent on GO term y, the presence of y implies the presence of x. Therefore, the genes annotated with the function of the GO term y are usually functionally and semantically related to the genes annotated with the function of the GO term x. A large number of gene set enrichment analysis methods have been developed in recent years for analyzing gene sets enrichment. However, most of these methods overlook the structural dependencies between GO terms in GO graph by not considering the concept of existence dependency. We propose in this paper a biological search engine called RSGSearch that identifies enriched sets of genes annotated with different functions using the concept of existence dependency. We observe that GO term xcannot be existence-dependent on GO term y, if x- and y- have the same specificity (biological characteristics). After encoding into a numeric format the contributions of GO terms annotating target genes to the semantics of their lowest common ancestors (LCAs), RSGSearch uses microarray experiment to identify the most significant LCA that annotates the result genes. We evaluated RSGSearch experimentally and compared it with five gene set enrichment systems. Results showed marked improvement.

  16. Multifunctional nanorods for gene delivery

    Science.gov (United States)

    Salem, Aliasger K.; Searson, Peter C.; Leong, Kam W.

    2003-10-01

    The goal of gene therapy is to introduce foreign genes into somatic cells to supplement defective genes or provide additional biological functions, and can be achieved using either viral or synthetic non-viral delivery systems. Compared with viral vectors, synthetic gene-delivery systems, such as liposomes and polymers, offer several advantages including ease of production and reduced risk of cytotoxicity and immunogenicity, but their use has been limited by the relatively low transfection efficiency. This problem mainly stems from the difficulty in controlling their properties at the nanoscale. Synthetic inorganic gene carriers have received limited attention in the gene-therapy community, the only notable example being gold nanoparticles with surface-immobilized DNA applied to intradermal genetic immunization by particle bombardment. Here we present a non-viral gene-delivery system based on multisegment bimetallic nanorods that can simultaneously bind compacted DNA plasmids and targeting ligands in a spatially defined manner. This approach allows precise control of composition, size and multifunctionality of the gene-delivery system. Transfection experiments performed in vitro and in vivo provide promising results that suggest potential in genetic vaccination applications.

  17. Gene electrotransfer in clinical trials

    DEFF Research Database (Denmark)

    Gehl, Julie

    2014-01-01

    Electroporation is increasingly being used for delivery of chemotherapy to tumors. Likewise, gene delivery by electroporation is rapidly gaining momentum for both vaccination purposes and for delivery of genes coding for other therapeutic molecules, such as chronic diseases or cancer. This chapte...

  18. Phytochrome-regulated Gene Expression

    Institute of Scientific and Technical Information of China (English)

    Peter H. Quail

    2007-01-01

    Identification of all genes involved in the phytochrome (phy)-mediated responses of plants to their light environment is an important goal in providing an overall understanding of light-regulated growth and development. This article highlights and integrates the central findings of two recent comprehensive studies in Arabidopsis that have identified the genome-wide set of phy-regulated genes that respond rapidly to red-light signals upon first exposure of dark-grown seedlings, and have tested the functional relevance to normal seedling photomorphogenesis of an initial subset of these genes. The data: (a) reveal considerable complexity in the channeling of the light signals through the different phy-family members (phyA to phyE) to responsive genes; (b) identify a diversity of transcription-factor-encoding genes as major early, if not primary, targets of phy signaling, and, therefore, as potentially important regulators in the transcriptional-network hierarchy; and (c) identify auxin-related genes as the dominant class among rapidly-regulated, hormone-related genes. However, reverse-genetic functional profiling of a selected subset of these genes reveals that only a limited fraction are necessary for optimal phy-induced seedling deetiolation.

  19. Nonviral Vectors for Gene Delivery

    Science.gov (United States)

    Baoum, Abdulgader Ahmed

    2011-12-01

    The development of nonviral vectors for safe and efficient gene delivery has been gaining considerable attention recently. An ideal nonviral vector must protect the gene against degradation by nuclease in the extracellular matrix, internalize the plasma membrane, escape from the endosomal compartment, unpackage the gene at some point and have no detrimental effects. In comparison to viruses, nonviral vectors are relatively easy to synthesize, less immunogenic, low in cost, and have no limitation in the size of a gene that can be delivered. Significant progress has been made in the basic science and applications of various nonviral gene delivery vectors; however, the majority of nonviral approaches are still inefficient and often toxic. To this end, two nonviral gene delivery systems using either biodegradable poly(D,L-lactide- co-glycolide) (PLG) nanoparticles or cell penetrating peptide (CPP) complexes have been designed and studied using A549 human lung epithelial cells. PLG nanoparticles were optimized for gene delivery by varying particle surface chemistry using different coating materials that adsorb to the particle surface during formation. A variety of cationic coating materials were studied and compared to more conventional surfactants used for PLG nanoparticle fabrication. Nanoparticles (˜200 nm) efficiently encapsulated plasmids encoding for luciferase (80-90%) and slowly released the same for two weeks. After a delay, moderate levels of gene expression appeared at day 5 for certain positively charged PLG particles and gene expression was maintained for at least two weeks. In contrast, gene expression mediated by polyethyleneimine (PEI) ended at day 5. PLG particles were also significantly less cytotoxic than PEI suggesting the use of these vehicles for localized, sustained gene delivery to the pulmonary epithelium. On the other hand, a more simple method to synthesize 50-200 nm complexes capable of high transfection efficiency or high gene knockdown was

  20. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder;

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...... known genes and 157 ESTs were found to be highly relevant for CRC. The alteration of known genes was confirmed in >70% of the cases by array analysis of 25 single samples. Two-way hierarchical average linkage cluster analysis clustered normal tissue together with Dukes' A, clustered Dukes' B with Dukes...

  1. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas

    2011-01-01

    The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa....... Not is a homeobox containing gene that regulates the formation of the notochord in chordates, while Cdx (caudal) is a ParaHox gene involved in the formation of posterior tissues of various animal phyla. The T. transversa homolog, TtrNot, is expressed in the ectoderm from the beginning of gastrulation until...... formation. TtrNot expression is absent in unfertilized eggs, in embryos prior to gastrulation, and in settled individuals during and after metamorphosis. Comparison with the expression patterns of Not genes in other metazoan phyla suggests an ancestral role for this gene in gastrulation and germ layer...

  2. Delivery systems for gene therapy

    Directory of Open Access Journals (Sweden)

    Shrikant Mali

    2013-01-01

    Full Text Available The structure of DNA was unraveled by Watson and Crick in 1953, and two decades later Arber, Nathans and Smith discovered DNA restriction enzymes, which led to the rapid growth in the field of recombinant DNA technology. From expressing cloned genes in bacteria to expressing foreign DNA in transgenic animals, DNA is now slated to be used as a therapeutic agent to replace defective genes in patients suffering from genetic disorders or to kill tumor cells in cancer patients. Gene therapy provides modern medicine with new perspectives that were unthinkable two decades ago. Progress in molecular biology and especially, molecular medicine is now changing the basics of clinical medicine. A variety of viral and non-viral possibilities are available for basic and clinical research. This review summarizes the delivery routes and methods for gene transfer used in gene therapy.

  3. Function analysis of unknown genes

    DEFF Research Database (Denmark)

    Rogowska-Wrzesinska, A.

    2002-01-01

      This thesis entitled "Function analysis of unknown genes" presents the use of proteome analysis for the characterisation of yeast (Saccharomyces cerevisiae) genes and their products (proteins especially those of unknown function). This study illustrates that proteome analysis can be used...... to describe different aspects of molecular biology of the cell, to study changes that occur in the cell due to overexpression or deletion of a gene and to identify various protein modifications. The biological questions and the results of the described studies show the diversity of the information that can...... genes and proteins. It reports the first global proteome database collecting 36 yeast single gene deletion mutants and selecting over 650 differences between analysed mutants and the wild type strain. The obtained results show that two-dimensional gel electrophoresis and mass spectrometry based proteome...

  4. GeneMANIA Prediction Server 2013 Update

    OpenAIRE

    Zuberi, Khalid; Franz, Max; Rodriguez, Harold; Montojo, Jason; Lopes, Christian Tannus; Bader, Gary D.; Morris, Quaid

    2013-01-01

    GeneMANIA (http://www.genemania.org) is a flexible user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query gene list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. GeneMANIA can also be used in a function predict...

  5. Gene expression profiling: can we identify the right target genes?

    Directory of Open Access Journals (Sweden)

    J. E. Loyd

    2008-12-01

    Full Text Available Gene expression profiling allows the simultaneous monitoring of the transcriptional behaviour of thousands of genes, which may potentially be involved in disease development. Several studies have been performed in idiopathic pulmonary fibrosis (IPF, which aim to define genetic links to the disease in an attempt to improve the current understanding of the underlying pathogenesis of the disease and target pathways for intervention. Expression profiling has shown a clear difference in gene expression between IPF and normal lung tissue, and has identified a wide range of candidate genes, including those known to encode for proteins involved in extracellular matrix formation and degradation, growth factors and chemokines. Recently, familial pulmonary fibrosis cohorts have been examined in an attempt to detect specific genetic mutations associated with IPF. To date, these studies have identified families in which IPF is associated with mutations in the gene encoding surfactant protein C, or with mutations in genes encoding components of telomerase. Although rare and clearly not responsible for the disease in all individuals, the nature of these mutations highlight the importance of the alveolar epithelium in disease pathogenesis and demonstrate the potential for gene expression profiling in helping to advance the current understanding of idiopathic pulmonary fibrosis.

  6. Genes and gene networks implicated in aggression related behaviour.

    Science.gov (United States)

    Malki, Karim; Pain, Oliver; Du Rietz, Ebba; Tosto, Maria Grazia; Paya-Cano, Jose; Sandnabba, Kenneth N; de Boer, Sietse; Schalkwyk, Leonard C; Sluyter, Frans

    2014-10-01

    Aggressive behaviour is a major cause of mortality and morbidity. Despite of moderate heritability estimates, progress in identifying the genetic factors underlying aggressive behaviour has been limited. There are currently three genetic mouse models of high and low aggression created using selective breeding. This is the first study to offer a global transcriptomic characterization of the prefrontal cortex across all three genetic mouse models of aggression. A systems biology approach has been applied to transcriptomic data across the three pairs of selected inbred mouse strains (Turku Aggressive (TA) and Turku Non-Aggressive (TNA), Short Attack Latency (SAL) and Long Attack Latency (LAL) mice and North Carolina Aggressive (NC900) and North Carolina Non-Aggressive (NC100)), providing novel insight into the neurobiological mechanisms and genetics underlying aggression. First, weighted gene co-expression network analysis (WGCNA) was performed to identify modules of highly correlated genes associated with aggression. Probe sets belonging to gene modules uncovered by WGCNA were carried forward for network analysis using ingenuity pathway analysis (IPA). The RankProd non-parametric algorithm was then used to statistically evaluate expression differences across the genes belonging to modules significantly associated with aggression. IPA uncovered two pathways, involving NF-kB and MAPKs. The secondary RankProd analysis yielded 14 differentially expressed genes, some of which have previously been implicated in pathways associated with aggressive behaviour, such as Adrbk2. The results highlighted plausible candidate genes and gene networks implicated in aggression-related behaviour. PMID:25142712

  7. Progress of gene targeting in mouse

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Gene targeting is a powerful approach of study- ing the genefunction in vivo. Specific genetic modifications, including simple gene disruption, point mutations, large chromosomal deletions and rearrangements, targeted incor- poration of foreign genes, could be introduced into the mouse genome by gene targeting. Recent studies make it possible to do the gene targeting with temporal and spatial control.

  8. Genes, Economics, and Happiness.

    Science.gov (United States)

    De Neve, Jan-Emmanuel; Christakis, Nicholas A; Fowler, James H; Frey, Bruno S

    2012-11-01

    We explore the influence of genetic variation on subjective well-being by employing a twin design and genetic association study. In a nationally-representative twin sample, we first show that about 33% of the variation in life satisfaction is explained by genetic variation. Although previous studies have shown that baseline happiness is significantly heritable, little research has considered molecular genetic associations with subjective well-being. We study the relationship between a functional polymorphism on the serotonin transporter gene (5-HTTLPR) and life satisfaction. We initially find that individuals with the longer, transcriptionally more efficient variant of this genotype report greater life satisfaction (n=2,545, p=0.012). However, our replication attempts on independent samples produce mixed results indicating that more work needs to be done to better understand the relationship between this genotype and subjective well-being. This work has implications for how economists think about the determinants of utility, and the extent to which exogenous shocks might affect individual well-being.

  9. Genes and equality.

    Science.gov (United States)

    Farrelly, C

    2004-12-01

    The way people think about equality as a value will influence how they think genetic interventions should be regulated. In this paper the author uses the taxonomy of equality put forth by Derek Parfit and applies this to the issue of genetic interventions. It is argued that telic egalitarianism is untenable and that deontic egalitarianism collapses into prioritarianism. The priority view maintains that it is morally more important to benefit the people who are worse off. Once this precision has been given to the concerns egalitarians have, a number of diverse issues must be considered before determining what the just regulation of genetic interventions would be. Consideration must be given to the current situation of the least advantaged, the fiscal realities behind genetic interventions, the budget constraints on other social programmes egalitarians believe should receive scarce public funds, and the interconnected nature of genetic information. These considerations might lead egalitarians to abandon what they take to be the obvious policy recommendations for them to endorse regarding the regulation of gene therapies and enhancements. PMID:15574450

  10. Genes, Economics, and Happiness.

    Science.gov (United States)

    De Neve, Jan-Emmanuel; Christakis, Nicholas A; Fowler, James H; Frey, Bruno S

    2012-11-01

    We explore the influence of genetic variation on subjective well-being by employing a twin design and genetic association study. In a nationally-representative twin sample, we first show that about 33% of the variation in life satisfaction is explained by genetic variation. Although previous studies have shown that baseline happiness is significantly heritable, little research has considered molecular genetic associations with subjective well-being. We study the relationship between a functional polymorphism on the serotonin transporter gene (5-HTTLPR) and life satisfaction. We initially find that individuals with the longer, transcriptionally more efficient variant of this genotype report greater life satisfaction (n=2,545, p=0.012). However, our replication attempts on independent samples produce mixed results indicating that more work needs to be done to better understand the relationship between this genotype and subjective well-being. This work has implications for how economists think about the determinants of utility, and the extent to which exogenous shocks might affect individual well-being. PMID:24349601

  11. Gene Electrotransfer: A Mechanistic Perspective.

    Science.gov (United States)

    Rosazza, Christelle; Meglic, Sasa Haberl; Zumbusch, Andreas; Rols, Marie-Pierre; Miklavcic, Damijan

    2016-01-01

    Gene electrotransfer is a powerful method of DNA delivery offering several medical applications, among the most promising of which are DNA vaccination and gene therapy for cancer treatment. Electroporation entails the application of electric fields to cells which then experience a local and transient change of membrane permeability. Although gene electrotransfer has been extensively studied in in vitro and in vivo environments, the mechanisms by which DNA enters and navigates through cells are not fully understood. Here we present a comprehensive review of the body of knowledge concerning gene electrotransfer that has been accumulated over the last three decades. For that purpose, after briefly reviewing the medical applications that gene electrotransfer can provide, we outline membrane electropermeabilization, a key process for the delivery of DNA and smaller molecules. Since gene electrotransfer is a multipart process, we proceed our review in describing step by step our current understanding, with particular emphasis on DNA internalization and intracellular trafficking. Finally, we turn our attention to in vivo testing and methodology for gene electrotransfer. PMID:27029943

  12. Genes: an Open Access Journal

    Directory of Open Access Journals (Sweden)

    J. Peter W. Young

    2009-11-01

    Full Text Available Genes have been in the scientific vocabulary for a hundred years. The term "gene" was proposed by the Danish plant scientist Wilhelm Johannsen in the first decade of the 20th century. For Johannsen, the gene remained an abstract concept, "free of any hypothesis" [1], but others were already pointing to chromosomes as the likely location of genes. The science of genetics was born at that time, and genes were rapidly connected with mutations, with patterns of inheritance, with development, with quantitative traits, with evolution and with biochemical pathways. All this was achieved without knowledge of the physical nature of genes, but this changed in mid-century with the discoveries of molecular biology. DNA was revealed as the genetic material, and the mechanisms were elucidated by which the information was encoded, and propagated, and linked to the phenotype. However, the concept of a "gene" did not become clearer. Quite the reverse, as the units of mutation, of recombination, of inheritance, of expression, of regulation, etc. did not necessarily coincide. [...

  13. Linking Genes to Cardiovascular Diseases: Gene Action and Gene-Environment Interactions.

    Science.gov (United States)

    Pasipoularides, Ares

    2015-12-01

    A unique myocardial characteristic is its ability to grow/remodel in order to adapt; this is determined partly by genes and partly by the environment and the milieu intérieur. In the "post-genomic" era, a need is emerging to elucidate the physiologic functions of myocardial genes, as well as potential adaptive and maladaptive modulations induced by environmental/epigenetic factors. Genome sequencing and analysis advances have become exponential lately, with escalation of our knowledge concerning sometimes controversial genetic underpinnings of cardiovascular diseases. Current technologies can identify candidate genes variously involved in diverse normal/abnormal morphomechanical phenotypes, and offer insights into multiple genetic factors implicated in complex cardiovascular syndromes. The expression profiles of thousands of genes are regularly ascertained under diverse conditions. Global analyses of gene expression levels are useful for cataloging genes and correlated phenotypes, and for elucidating the role of genes in maladies. Comparative expression of gene networks coupled to complex disorders can contribute insights as to how "modifier genes" influence the expressed phenotypes. Increasingly, a more comprehensive and detailed systematic understanding of genetic abnormalities underlying, for example, various genetic cardiomyopathies is emerging. Implementing genomic findings in cardiology practice may well lead directly to better diagnosing and therapeutics. There is currently evolving a strong appreciation for the value of studying gene anomalies, and doing so in a non-disjointed, cohesive manner. However, it is challenging for many-practitioners and investigators-to comprehend, interpret, and utilize the clinically increasingly accessible and affordable cardiovascular genomics studies. This survey addresses the need for fundamental understanding in this vital area.

  14. GeneNet: a database on structure and functional organisation of gene networks

    OpenAIRE

    Ananko, E A; Podkolodny, N. L.; Stepanenko, I. L.; Ignatieva, E. V.; Podkolodnaya, O. A.; Kolchanov, N. A.

    2002-01-01

    The GeneNet database is designed for accumulation of information on gene networks. Original technology applied in GeneNet enables description of not only a gene network structure and functional relationships between components, but also metabolic and signal transduction pathways. Specialised software, GeneNet Viewer, automatically displays the graphical diagram of gene networks described in the database. Current release 3.0 of GeneNet database contains descriptions of 25 gene networks, 945 pr...

  15. Genes Might Explain Hispanics' Added Longevity

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_160528.html Genes Might Explain Hispanics' Added Longevity Differences in 'genetic ... Services, or federal policy. More Health News on: Genes and Gene Therapy Hispanic American Health Recent Health ...

  16. Personalized Medicine: Matching Treatments to Your Genes

    Science.gov (United States)

    ... disclaimer . Subscribe Personalized Medicine Matching Treatments to Your Genes You’re one of a kind. It’s not ... personalized medicine begins with the unique set of genes you inherited from your parents. Genes are stretches ...

  17. Basics on Genes and Genetic Disorders

    Science.gov (United States)

    ... Help a Friend Who Cuts? The Basics on Genes and Genetic Disorders KidsHealth > For Teens > The Basics ... such as treating health problems. What Is a Gene? To understand how genes work, let's review some ...

  18. Gene Therapy for Diseases and Genetic Disorders

    Science.gov (United States)

    ... Mentor Submit Your Press Release Donate Home ASGCT Gene Therapy for Diseases Gene Therapy has made important ... Among the most notable advancements are the following: Gene Therapy for Genetic Disorders Severe Combined Immune Deficiency ( ...

  19. The Ensembl gene annotation system.

    Science.gov (United States)

    Aken, Bronwen L; Ayling, Sarah; Barrell, Daniel; Clarke, Laura; Curwen, Valery; Fairley, Susan; Fernandez Banet, Julio; Billis, Konstantinos; García Girón, Carlos; Hourlier, Thibaut; Howe, Kevin; Kähäri, Andreas; Kokocinski, Felix; Martin, Fergal J; Murphy, Daniel N; Nag, Rishi; Ruffier, Magali; Schuster, Michael; Tang, Y Amy; Vogel, Jan-Hinnerk; White, Simon; Zadissa, Amonida; Flicek, Paul; Searle, Stephen M J

    2016-01-01

    The Ensembl gene annotation system has been used to annotate over 70 different vertebrate species across a wide range of genome projects. Furthermore, it generates the automatic alignment-based annotation for the human and mouse GENCODE gene sets. The system is based on the alignment of biological sequences, including cDNAs, proteins and RNA-seq reads, to the target genome in order to construct candidate transcript models. Careful assessment and filtering of these candidate transcripts ultimately leads to the final gene set, which is made available on the Ensembl website. Here, we describe the annotation process in detail.Database URL: http://www.ensembl.org/index.html. PMID:27337980

  20. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin;

    2014-01-01

    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...

  1. Panspermia and horizontal gene transfer

    Science.gov (United States)

    Klyce, Brig

    2009-08-01

    Evidence that extremophiles are hardy and ubiquitous is helping to make panspermia a respectable theory. But even if life on Earth originally came from space, biologists assume that the subsequent evolution of life is still governed by the darwinian paradigm. In this review we show how panspermia could amend darwinism and point to a cosmic source for, not only extremophiles but, all of life. This version of panspermia can be called "strong panspermia." To support this theory we will discuss recent evidence pertaining to horizontal gene transfer, viruses, genes apparently older than the Earthly evolution of the features they encode, and primate-specific genes without identifiable precursors.

  2. [Pathogenicity and pneumococcal capsular genes].

    Science.gov (United States)

    García, E; García, P; López, R

    1994-01-01

    Pneumococci remain to be one of the most prominent human pathogens. Increasing efforts are being dedicated to the development of improved vaccines with wider specificity. Since a clear understanding of the genetics of capsular types in Streptococcus pneumoniae is missing, our efforts are oriented to characterize, at the molecular level, the genes involved in capsular polysaccharide biosynthesis. We have cloned and sequenced a chromosomal DNA fragment of a clinical isolate of type 3 pneumococcus and showed that it contains a type 3 specific gene as well as genes common to other serotypes.

  3. Parsimonious selection of useful genes in microarray gene expression data

    OpenAIRE

    González Navarro, Félix Fernando; Belanche Muñoz, Luis Antonio

    2011-01-01

    Machine Learning methods have of late made significant efforts to solving multidisciplinary problems in the field of cancer classification in microarray gene expression data. These tasks are characterized by a large number of features and a few observations, making the modeling a non-trivial undertaking. In this work we apply entropic filter methods for gene selection, in combination with several off-the-shelf classifiers. The introduction of bootstrap resampling techniques permits the achiev...

  4. Integrating Gene Ontology and Blast to predict gene functions

    Institute of Scientific and Technical Information of China (English)

    WANG Cheng-gang; MO Zhi-hong

    2007-01-01

    A GoBlast system was built to predict gene function by integrating Blast search and Gene Ontology (GO) annotations together. The operation system was based on Debian Linux 3.1, with Apache as the web server and Mysql database as the data storage system. FASTA files with GO annotations were taken as the sequence source for blast alignment, which were formatted by wu-formatdb program. The GoBlast system includes three Bioperl modules in Perl: a data input module, a data process module and a data output module. A GoBlast query starts with an amino acid or nucleotide sequence. It ends with an output in an html page, presenting high scoring gene products which are of a high homology to the queried sequence and listing associated GO terms beside respective gene poducts. A simple click on a GO term leads to the detailed explanation of the specific gene function. This avails gene function prediction by Blast. GoBlast can be a very useful tool for functional genome research and is available for free at http://bioq.org/goblast.

  5. Viral vectors for vascular gene therapy

    OpenAIRE

    Fischer, Lukas; Preis, Meir; Weisz, Anat; Koren, Belly; Lewis, Basil S; Flugelman, Moshe Y

    2002-01-01

    Vascular gene therapy is the focus of multiple experimental and clinical research efforts. While several genes with therapeutic potential have been identified, the best method of gene delivery is unknown. Viral vectors have the capacity to transfer genes at high efficiency rates. Several viral-based vectors have been used in experimental vascular gene therapy for in vivo and ex vivo gene transfer. Adenoviral-based vectors are being used for the induction of angiogenesis in phase 1 and 2 clini...

  6. Evolution of the nuclear receptor gene superfamily.

    OpenAIRE

    Laudet, V; Hänni, C; Coll, J.; F. Catzeflis; Stéhelin, D

    1992-01-01

    Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplica...

  7. Evolution of alternative splicing after gene duplication

    OpenAIRE

    Su, Zhixi; Wang, Jianmin; Yu, Jun; Huang, Xiaoqiu; Gu, Xun

    2006-01-01

    Alternative splicing and gene duplication are two major sources of proteomic function diversity. Here, we study the evolutionary trend of alternative splicing after gene duplication by analyzing the alternative splicing differences between duplicate genes. We observed that duplicate genes have fewer alternative splice (AS) forms than single-copy genes, and that a negative correlation exists between the mean number of AS forms and the gene family size. Interestingly, we found that the loss of ...

  8. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin;

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  9. The evolution of resistance gene in plants

    Institute of Scientific and Technical Information of China (English)

    BEN Haiyan; LIU Xuemin; LI Lijun; LIU Li

    2007-01-01

    Resistance genes enable plants to fight against plant pathogens. Plant resistance genes (R gene) are organized complexly in genome. Some resistance gene sequence data enable an insight into R gene structure and gene evolution. Some sites like Leucine-Rich Repeat (LRR) are of specific interest since homologous recombination can happen. Crossing over, transposon insertion and excision and mutation can produce new specificity. Three models explaining R gene evolution were discussed. More information needed for dissection of R gene evolution though some step can be inferred from genetic and sequence analysis.

  10. Gene Therapy for Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Rachel Denyer

    2012-01-01

    Full Text Available Current pharmacological and surgical treatments for Parkinson's disease offer symptomatic improvements to those suffering from this incurable degenerative neurological disorder, but none of these has convincingly shown effects on disease progression. Novel approaches based on gene therapy have several potential advantages over conventional treatment modalities. These could be used to provide more consistent dopamine supplementation, potentially providing superior symptomatic relief with fewer side effects. More radically, gene therapy could be used to correct the imbalances in basal ganglia circuitry associated with the symptoms of Parkinson's disease, or to preserve or restore dopaminergic neurons lost during the disease process itself. The latter neuroprotective approach is the most exciting, as it could theoretically be disease modifying rather than simply symptom alleviating. Gene therapy agents using these approaches are currently making the transition from the laboratory to the bedside. This paper summarises the theoretical approaches to gene therapy for Parkinson's disease and the findings of clinical trials in this rapidly changing field.

  11. Gene discovery in Triatoma infestans

    Directory of Open Access Journals (Sweden)

    de Burgos Nelia

    2011-03-01

    Full Text Available Abstract Background Triatoma infestans is the most relevant vector of Chagas disease in the southern cone of South America. Since its genome has not yet been studied, sequencing of Expressed Sequence Tags (ESTs is one of the most powerful tools for efficiently identifying large numbers of expressed genes in this insect vector. Results In this work, we generated 826 ESTs, resulting in an increase of 47% in the number of ESTs available for T. infestans. These ESTs were assembled in 471 unique sequences, 151 of which represent 136 new genes for the Reduviidae family. Conclusions Among the putative new genes for the Reduviidae family, we identified and described an interesting subset of genes involved in development and reproduction, which constitute potential targets for insecticide development.

  12. Gene therapy in lung transplantation.

    Science.gov (United States)

    Sato, Masaaki; Keshavjee, Shaf

    2006-08-01

    Lung transplantation is effective life-saving therapy for the treatment of a variety of end-stage lung diseases. However, the application of lung transplantation is hindered by multiple factors such as the shortage of organ donors, early graft failure and chronic graft dysfunction. These problems are related to various lung injuries before and after transplantation including donor brain-death-related lung injury, ischemia, reperfusion and immune-mediated injuries. Gene transfection presents a potential molecular therapeutic solution to modify the transplanted organ such that it is better able to deal with these obstacles. In fact, in many ways lung transplantation is an ideal situation for gene therapy in that: 1) the targeted injuries are predictable (e.g. IR injury), 2) only transient gene expression is needed in many instances, 3) the immunosuppressive regimen necessary to prevent rejection of the transplanted organ attenuates vector-induced inflammation and the immune response to the vectors or the transgene products, and thus effectively augments and prolongs gene expression; 4) the anatomical structure of the lung enables trans-airway access and local gene delivery - as well as re-transfection. A number of issues need to be considered to develop a strategy of gene delivery in lung transplantation: administration route (intra-airway, trans-vascular, intravenous, intramuscular), timing (donor in-vivo, ex-vivo organ transfection or recipient), vector selection and gene selection. Based on our work and the work of others, over the last decade, we present the state of art of in gene therapy in lung transplantation and exciting future directions in the field. PMID:16918334

  13. Shuffling Yeast Gene Expression Data

    OpenAIRE

    Bilke, Sven

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent ...

  14. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  15. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  16. Gemini surfactants as gene carriers

    Directory of Open Access Journals (Sweden)

    Teresa Piskorska

    2010-03-01

    Full Text Available Gemini surfactants are a new class of amphiphilic compounds built from two classic surfactant moieties bound together by a special spacer group. These compounds appear to be excellent for creating complexes with DNA and are effective in mediating transfection. Thanks to their construction, DNA carrier molecules built from gemini surfactants are able to deliver genes to cells of almost any DNA molecule size, unattainable when using viral gene delivery systems. Moreover, they are much safer for living organisms.

  17. Gene therapy in clinical medicine

    OpenAIRE

    Selkirk, S

    2004-01-01

    Although the field of gene therapy has experienced significant setbacks and limited success, it is one of the most promising and active research fields in medicine. Interest in this therapeutic modality is based on the potential for treatment and cure of some of the most malignant and devastating diseases affecting humans. Over the next decade, the relevance of gene therapy to medical practices will increase and it will become important for physicians to understand the basic principles and st...

  18. Vascular gene expression: a hypothesis

    OpenAIRE

    Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto

    2013-01-01

    The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular ti...

  19. Rice's Salt Tolerance Gene Cloned

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ In cooperation with US colleagues, CAS researchers have made significant progress in their studies into functional genes for key agronomic traits by cloning SKC1, a salt-tolerant functional gene of rice and making clear its biological functions and mechanisms. This pioneering work,which was reported in the Oct. issue of Nature Genetics (37:1141-1146), is believed to hold promise to increase the output of the crop plant in this country.

  20. Gene Polymorphisms in Chronic Periodontitis

    Directory of Open Access Journals (Sweden)

    Marja L. Laine

    2010-01-01

    Full Text Available We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or polymorphism. Candidate gene polymorphism studies with a case-control design and reported genotype frequencies in CP patients were searched and reviewed. There is growing evidence that polymorphisms in the IL1, IL6, IL10, vitamin D receptor, and CD14 genes may be associated with CP in certain populations. However, carriage rates of the rare (-allele of any polymorphism varied considerably among studies and most of the studies appeared under-powered and did not correct for other risk factors. Larger cohorts, well-defined phenotypes, control for other risk factors, and analysis of multiple genes and polymorphisms within the same pathway are needed to get a more comprehensive insight into the contribution of gene polymorphisms in CP.

  1. Cationic Bolaamphiphiles for Gene Delivery

    Science.gov (United States)

    Tan, Amelia Li Min; Lim, Alisa Xue Ling; Zhu, Yiting; Yang, Yi Yan; Khan, Majad

    2014-05-01

    Advances in medical research have shed light on the genetic cause of many human diseases. Gene therapy is a promising approach which can be used to deliver therapeutic genes to treat genetic diseases at its most fundamental level. In general, nonviral vectors are preferred due to reduced risk of immune response, but they are also commonly associated with low transfection efficiency and high cytotoxicity. In contrast to viral vectors, nonviral vectors do not have a natural mechanism to overcome extra- and intracellular barriers when delivering the therapeutic gene into cell. Hence, its design has been increasingly complex to meet challenges faced in targeting of, penetration of and expression in a specific host cell in achieving more satisfactory transfection efficiency. Flexibility in design of the vector is desirable, to enable a careful and controlled manipulation of its properties and functions. This can be met by the use of bolaamphiphile, a special class of lipid. Unlike conventional lipids, bolaamphiphiles can form asymmetric complexes with the therapeutic gene. The advantage of having an asymmetric complex lies in the different purposes served by the interior and exterior of the complex. More effective gene encapsulation within the interior of the complex can be achieved without triggering greater aggregation of serum proteins with the exterior, potentially overcoming one of the great hurdles faced by conventional single-head cationic lipids. In this review, we will look into the physiochemical considerations as well as the biological aspects of a bolaamphiphile-based gene delivery system.

  2. Immunoglobulin genes of the turtles.

    Science.gov (United States)

    Magadán-Mompó, Susana; Sánchez-Espinel, Christian; Gambón-Deza, Francisco

    2013-03-01

    The availability of reptile genomes for the use of the scientific community is an exceptional opportunity to study the evolution of immunoglobulin genes. The genome of Chrysemys picta bellii and Pelodiscus sinensis is the first one that has been reported for turtles. The scanning for immunoglobulin genes resulted in the presence of a complex locus for the immunoglobulin heavy chain (IGH). This IGH locus in both turtles contains genes for 13 isotypes in C. picta bellii and 17 in P. sinensis. These correspond with one immunoglobulin M, one immunoglobulin D, several immunoglobulins Y (six in C. picta bellii and eight in P. sinensis), and several immunoglobulins that are similar to immunoglobulin D2 (five in C. picta belli and seven in P. sinensis) that was previously described in Eublepharis macularius. It is worthy to note that IGHD2 are placed in an inverted transcriptional orientation and present sequences for two immunoglobulin domains that are similar to bird IgA domains. Furthermore, its phylogenetic analysis allows us to consider about the presence of IGHA gene in a primitive reptile, so we would be dealing with the memory of the gene that originated from the bird IGHA. In summary, we provide a clear picture of the immunoglobulins present in a turtle, whose analysis supports the idea that turtles emerged from the evolutionary line from the differentiation of birds and the presence of the IGHA gene present in a common ancestor.

  3. Origin and evolution of new genes

    Institute of Scientific and Technical Information of China (English)

    LI Xin; YANG Shuang; PENG Lixin; CHEN Hong; WANG Wen

    2004-01-01

    Organisms have variable genome sizes andcontain different numbers of genes. This difference demonstrates that new gene origination is a fundamental process in evolutionary biology. Though the study of the origination of new genes dated back more than half a century ago, it is not until the 1990s when the first young genejingwei was found that empirical investigation of the molecular mechanisms of origination of new genes became possible. In the recent years,several young genes were identified and the studies on these genes have greatly enriched the knowledge of this field. Yet more details in a general picture of new genes origination are to be clarified. We have developed a systematic approach to searching for young genes at the genomic level, in the hope to summarize a general pattern of the origination and evolution of new genes, such as the rate of new gene appearance, impact of new genes on their host genomes, etc.

  4. Noninvasive tracking of gene transcript and neuroprotection after gene therapy.

    Science.gov (United States)

    Ren, J; Chen, Y I; Liu, C H; Chen, P-C; Prentice, H; Wu, J-Y; Liu, P K

    2016-01-01

    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) complimentary DNA (cDNA) encoded in self-complementary adeno-associated virus-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer's dementia, Parkinson's disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine. PMID:26207935

  5. Sequencing and Gene Expression Analysis of Leishmania tropica LACK Gene.

    Directory of Open Access Journals (Sweden)

    Nour Hammoudeh

    2014-12-01

    Full Text Available Leishmania Homologue of receptors for Activated C Kinase (LACK antigen is a 36-kDa protein, which provokes a very early immune response against Leishmania infection. There are several reports on the expression of LACK through different life-cycle stages of genus Leishmania, but only a few of them have focused on L.tropica.The present study provides details of the cloning, DNA sequencing and gene expression of LACK in this parasite species. First, several local isolates of Leishmania parasites were typed in our laboratory using PCR technique to verify of Leishmania parasite species. After that, LACK gene was amplified and cloned into a vector for sequencing. Finally, the expression of this molecule in logarithmic and stationary growth phase promastigotes, as well as in amastigotes, was evaluated by Reverse Transcription-PCR (RT-PCR technique.The typing result confirmed that all our local isolates belong to L.tropica. LACK gene sequence was determined and high similarity was observed with the sequences of other Leishmania species. Furthermore, the expression of LACK gene in both promastigotes and amastigotes forms was confirmed.Overall, the data set the stage for future studies of the properties and immune role of LACK gene products.

  6. Newer Gene Editing Technologies toward HIV Gene Therapy

    Directory of Open Access Journals (Sweden)

    Premlata Shankar

    2013-11-01

    Full Text Available Despite the great success of highly active antiretroviral therapy (HAART in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  7. Characterizing gene-gene interactions in a statistical epistasis network of twelve candidate genes for obesity

    OpenAIRE

    Rishika; Hu, Ting; Moore, Jason H.; Gilbert-Diamond, Diane

    2015-01-01

    Background Recent findings have reemphasized the importance of epistasis, or gene-gene interactions, as a contributing factor to the unexplained heritability of obesity. Network-based methods such as statistical epistasis networks (SEN), present an intuitive framework to address the computational challenge of studying pairwise interactions between thousands of genetic variants. In this study, we aimed to analyze pairwise interactions that are associated with Body Mass Index (BMI) between SNPs...

  8. A gene sets approach for identifying prognostic gene signatures for outcome prediction

    OpenAIRE

    Kim Yong Sung; Kim Seon-Young

    2008-01-01

    Abstract Background Gene expression profiling is a promising approach to better estimate patient prognosis; however, there are still unresolved problems, including little overlap among similarly developed gene sets and poor performance of a developed gene set in other datasets. Results We applied a gene sets approach to develop a prognostic gene set from multiple gene expression datasets. By analyzing 12 independent breast cancer gene expression datasets comprising 1,756 tissues with 2,411 pr...

  9. How Gene Patents May Inhibit Scientific Research

    Directory of Open Access Journals (Sweden)

    Campo-Engelstein, Lisa

    2015-02-01

    Full Text Available In this paper, we point out three possible ways gene patents could impede scientific research. First, gene patent laws might exacerbate the culture of secrecy ubiquitous in science. Second, gene patents may limit researchers’ ability to study poly or multigenic diseases without access to all genetic etiologies. Third, gene patents could result in a “patent thicket”.

  10. Analysis of Duplicate Genes in Soybean

    Institute of Scientific and Technical Information of China (English)

    C.M. Cai; K.J. Van; M.Y. Kim; S.H. Lee

    2007-01-01

    @@ Gene duplication is a major determinant of the size and gene complement of eukaryotic genomes (Lockton and Gaut, 2005). There are a number of different ways in which duplicate genes can arise (Sankoff, 2001), but the most spectacular method of gene duplication may be whole genome duplication via polyploidization.

  11. Deregulated genes in sporadic vestibular schwannomas

    DEFF Research Database (Denmark)

    Cayé-Thomasen, Per; Helweg-Larsen, Rehannah Holga Andrea; Stangerup, Sven-Eric;

    2010-01-01

    In search of genes associated with vestibular schwannoma tumorigenesis, this study examines the gene expression in human vestibular nerve versus vestibular schwannoma tissue samples using microarray technology.......In search of genes associated with vestibular schwannoma tumorigenesis, this study examines the gene expression in human vestibular nerve versus vestibular schwannoma tissue samples using microarray technology....

  12. The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study

    DEFF Research Database (Denmark)

    Hedley, Paula L; Haundrup, Ole; Andersen, Paal S;

    2011-01-01

    The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a...

  13. Gene expression profiles in skeletal muscle after gene electrotransfer

    DEFF Research Database (Denmark)

    Hojman, Pernille; Zibert, John R; Gissel, Hanne;

    2007-01-01

    BACKGROUND: Gene transfer by electroporation (DNA electrotransfer) to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have...... investigated by microarray analysis, and descriptive statistics were performed to evaluate the effects of 1) electroporation, 2) DNA injection, and 3) time after treatment. The biological significance of the results was assessed by gene annotation and supervised cluster analysis.Generally, electroporation...

  14. Gene therapy and radiotherapy in malignant tumor

    International Nuclear Information System (INIS)

    Tumor treatment is one of the most important fields in medical research. Nowadays, a novel method which is combined gene therapy with radiotherapy plays an important role in the field of cancer research, and mainly includes immune gene therapy combined with radiotherapy, suicide gene therapy or tumor suppressor gene therapy combined with radiotherapy, antiangiogenesis gene therapy combined with radiotherapy and protective gene therapy combined with radiotherapy based on the technical features. This review summarized the current status of combined therapies of gene therapy and radiotherapy and possible mechanism. (authors)

  15. FINDING GENERIFS VIA GENE ONTOLOGY ANNOTATIONS

    OpenAIRE

    Lu, Zhiyong; Cohen, K Bretonnel; Hunter, Lawrence

    2006-01-01

    A Gene Reference Into Function (GeneRIF) is a concise phrase describing a function of a gene in the Entrez Gene database. Applying techniques from the area of natural language processing known as automatic summarization, it is possible to link the Entrez Gene database, the Gene Ontology, and the biomedical literature. A system was implemented that automatically suggests a sentence from a PubMed/MEDLINE abstract as a candidate GeneRIF by exploiting a gene’s GO annotations along with location f...

  16. Molecular Studies on Preproinsulin Gene

    Directory of Open Access Journals (Sweden)

    Sabir Sarah

    2016-01-01

    Full Text Available Insulin plays an important role in maintaining the blood glucose level of the body. The β-cells of pancreas produce insulin in the form of precursor that is preproinsulin. The gene of preproinsulin provides an interesting system for addressing question related to molecular evolution. Recombinant DNA technology has made it possible to isolate and sequence the chromosomal genes coding for unique protein products. Although preproinsulin of various organism has been isolated and cloned, but there is no report from buffalo (Bubalus bubalis that is our major livestock. The genomic DNA of buffalo was isolated using Laura-Lee-Boodram method. The part of preproinsulin gene (596bp and 520bp using BPPI-UPS and bpiful_F as forward and BC1-C as reverse primer was amplified. Cloning of amplified fragments of gene were performed in pCR 2.1 vector. Positive clones were screened on the basis of blue white selection. The band obtained on 596bp and 520bp after colony PCR confirmed the successful cloning of preproinsulin gene in pCR 2.1 vector.

  17. Melatonin Receptor Genes in Vertebrates

    Directory of Open Access Journals (Sweden)

    Hua Dong Yin

    2013-05-01

    Full Text Available Melatonin receptors are members of the G protein-coupled receptor (GPCR family. Three genes for melatonin receptors have been cloned. The MT1 (or Mel1a or MTNR1A and MT2 (or Mel1b or MTNR1B receptor subtypes are present in humans and other mammals, while an additional melatonin receptor subtype, Mel1c (or MTNR1C, has been identified in fish, amphibians and birds. Another melatonin related orphan receptor, GPR50, which does not bind melatonin, is found exclusively in mammals. The hormone melatonin is secreted primarily by the pineal gland, with highest levels occurring during the dark period of a circadian cycle. This hormone acts systemically in numerous organs. In the brain, it is involved in the regulation of various neural and endocrine processes, and it readjusts the circadian pacemaker, the suprachiasmatic nucleus. This article reviews recent studies of gene organization, expression, evolution and mutations of melatonin receptor genes of vertebrates. Gene polymorphisms reveal that numerous mutations are associated with diseases and disorders. The phylogenetic analysis of receptor genes indicates that GPR50 is an outgroup to all other melatonin receptor sequences. GPR50 may have separated from a melatonin receptor ancestor before the split between MTNR1C and the MTNR1A/B ancestor.

  18. Clock Genes in Glia Cells

    Science.gov (United States)

    Chi-Castañeda, Donají

    2016-01-01

    Circadian rhythms are periodic patterns in biological processes that allow the organisms to anticipate changes in the environment. These rhythms are driven by the suprachiasmatic nucleus (SCN), the master circadian clock in vertebrates. At a molecular level, circadian rhythms are regulated by the so-called clock genes, which oscillate in a periodic manner. The protein products of clock genes are transcription factors that control their own and other genes’ transcription, collectively known as “clock-controlled genes.” Several brain regions other than the SCN express circadian rhythms of clock genes, including the amygdala, the olfactory bulb, the retina, and the cerebellum. Glia cells in these structures are expected to participate in rhythmicity. However, only certain types of glia cells may be called “glial clocks,” since they express PER-based circadian oscillators, which depend of the SCN for their synchronization. This contribution summarizes the current information about clock genes in glia cells, their plausible role as oscillators and their medical implications. PMID:27666286

  19. Advancement and prospects of tumor gene therapy

    Institute of Scientific and Technical Information of China (English)

    Chao Zhang; Qing-Tao Wang; He Liu; Zhen-Zhu Zhang; Wen-Lin Huang

    2011-01-01

    Gene therapy is one of the most attractive fields in tumor therapy. In past decades, significant progress has been achieved. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. Several therapeutic strategies have evolved, including gene-based (tumor suppressor genes, suicide genes, antiangiogenic genes, cytokine and oxidative stress-based genes) and RNA-based (antisense oligonucieotides and RNA interference) approaches. In addition, immune response-based strategies (dendritic cell- and T cell-based therapy) are also under investigation in tumor gene therapy. This review highlights the progress and recent developments in gene delivery systems, therapeutic strategies, and possible clinical directions for gene therapy.

  20. Genes Contributing to the Development of Alcoholism

    OpenAIRE

    Edenberg, Howard J

    2012-01-01

    Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case–control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that...

  1. Switching on the Lights for Gene Therapy

    OpenAIRE

    Alexandra Winkeler; Miguel Sena-Esteves; Paulis, Leonie E.M.; Hongfeng Li; Yannic Waerzeggers; Benedikt Rückriem; Uwe Himmelreich; Markus Klein; Parisa Monfared; Rueger, Maria A.; Michael Heneka; Stefan Vollmar; Mathias Hoehn; Cornel Fraefel; Rudolf Graf

    2007-01-01

    Strategies for non-invasive and quantitative imaging of gene expression in vivo have been developed over the past decade. Non-invasive assessment of the dynamics of gene regulation is of interest for the detection of endogenous disease-specific biological alterations (e.g., signal transduction) and for monitoring the induction and regulation of therapeutic genes (e.g., gene therapy). To demonstrate that non-invasive imaging of regulated expression of any type of gene after in vivo transductio...

  2. Activities of Human Gene Nomenclature Committee

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-16

    The objective of this project, shared between NIH and DOE, has been and remains to enable the medical genetics communities to use common names for genes that are discovered by different gene hunting groups, in different species. This effort provides consistent gene nomenclature and approved gene symbols to the community at large. This contributes to a uniform and consistent understanding of genomes, particularly the human as well as functional genomics based on comparisons between homologous genes in related species (human and mice).

  3. Repetitive sequence environment distinguishes housekeeping genes

    OpenAIRE

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan,; Horvath, Steve; Marahrens, York

    2006-01-01

    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear E...

  4. Concerted evolution of human amylase genes.

    OpenAIRE

    Gumucio, D L; Wiebauer, K; Caldwell, R M; Samuelson, L C; Meisler, M H

    1988-01-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, we have identified two pancreatic amylase genes and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, du...

  5. Progress in Gene Therapy for Prostate Cancer

    OpenAIRE

    KamranAliAhmed; BrianJamesDavis; TorrenceMWilson; GregoryAWiseman; MarkJFederspiel; JohnCMorris

    2012-01-01

    Gene therapy has held promise to correct various disease processes. Prostate cancer represents the second leading cause of cancer death in American men. A number of clinical trials involving gene therapy for the treatment of prostate cancer have been reported. The ability to efficiently transduce tumors with effective levels of therapeutic genes has been identified as a fundamental barrier to effective cancer gene therapy. The approach utilizing gene therapy in prostate cancer patients at our...

  6. Gene Therapy in Human Breast Cancer

    OpenAIRE

    Abaan, Ogan D.

    2002-01-01

    Gene therapy, being a novel treatment for many diseases, is readily applicable for the treatment of cancer patients. Breast cancer is the most common cancer among women. There are many clinical protocols for the treatment of breast cancer, and gene therapy is now being considered within current protocols. This review will focus on the basic concepts of cancer gene therapy strategies (suicide gene, tumor suppressor gene, anti-angiogenesis, immunotherapy, oncolytic viruses and ribozyme/antisens...

  7. Gene functional similarity search tool (GFSST)

    OpenAIRE

    Russo James J; Sheng Huitao; Zhang Jinghui; Zhang Peisen; Osborne Brian; Buetow Kenneth

    2006-01-01

    Abstract Background With the completion of the genome sequences of human, mouse, and other species and the advent of high throughput functional genomic research technologies such as biomicroarray chips, more and more genes and their products have been discovered and their functions have begun to be understood. Increasing amounts of data about genes, gene products and their functions have been stored in databases. To facilitate selection of candidate genes for gene-disease research, genetic as...

  8. Novel algorithms for in vitro gene synthesis

    OpenAIRE

    Thachuk, Chris

    2007-01-01

    Methods for reliable synthesis of long genes offer great promise for novel protein synthesis via expression of synthetic genes. Current technologies use computational methods for design of short oligos, which can then be reliably synthesized and assembled into the desired target gene. A precursor to this process is optimization of the gene sequence for improved protein expression. In this thesis, we provide the first results on the computational complexity of oligo design for gene synthesis. ...

  9. Gene networks and haloperidol-induced catalepsy

    OpenAIRE

    Iancu, O. D.; Darakjian, P.; Malmanger, B.; Walter, N. A. R.; McWeeney, S.; Hitzemann, R

    2011-01-01

    The current study examined the changes in striatal gene network structure induced by short-term selective breeding from a heterogeneous stock for haloperidol response. Brain (striatum) gene expression data were obtained using the Illumina WG 8.2 array, and the datasets from responding and non-responding selected lines were independently interrogated using a weighted gene coexpression network analysis (WGCNA). We detected several gene modules (groups of coexpressed genes) in each dataset; the ...

  10. Modelling Nonstationary Gene Regulatory Processes

    Directory of Open Access Journals (Sweden)

    Marco Grzegorcyzk

    2010-01-01

    Full Text Available An important objective in systems biology is to infer gene regulatory networks from postgenomic data, and dynamic Bayesian networks have been widely applied as a popular tool to this end. The standard approach for nondiscretised data is restricted to a linear model and a homogeneous Markov chain. Recently, various generalisations based on changepoint processes and free allocation mixture models have been proposed. The former aim to relax the homogeneity assumption, whereas the latter are more flexible and, in principle, more adequate for modelling nonlinear processes. In our paper, we compare both paradigms and discuss theoretical shortcomings of the latter approach. We show that a model based on the changepoint process yields systematically better results than the free allocation model when inferring nonstationary gene regulatory processes from simulated gene expression time series. We further cross-compare the performance of both models on three biological systems: macrophages challenged with viral infection, circadian regulation in Arabidopsis thaliana, and morphogenesis in Drosophila melanogaster.

  11. The plant ADH gene family.

    Science.gov (United States)

    Strommer, Judith

    2011-04-01

    The structures, evolution and functions of alcohol dehydrogenase gene families and their products have been scrutinized for half a century. Our understanding of the enzyme structure and catalytic activity of plant alcohol dehydrogenase (ADH-P) is based on the vast amount of information available for its animal counterpart. The probable origins of the enzyme from a simple β-coil and eventual emergence from a glutathione-dependent formaldehyde dehydrogenase have been well described. There is compelling evidence that the small ADH gene families found in plants today are the survivors of multiple rounds of gene expansion and contraction. To the probable original function of their products in the terminal reaction of anaerobic fermentation have been added roles in yeast-like aerobic fermentation and the production of characteristic scents that act to attract animals that serve as pollinators or agents of seed dispersal and to protect against herbivores.

  12. Gene Technology in Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Xiao-Dan Sun

    2006-01-01

    Full Text Available Scaffold, cells and signaling factors are regarded as the three essential components in tissue engineering. With the development of molecular and cell biology, gene technology is beginning to show a promising position in tissue engineering as it can influence these essential components at DNA-level. By introducing plasmid DNA or genes encoding certain signaling factors (growth factors/cytokines into the cells, required growth factors/cytokines can be expressed and secreted spatially and temporally by the transfected cells, which will promote the differentiation, proliferation and organization of the cells on the scaffold. Protein-based scaffolds which have specific structures can also be prepared genetically to induce attachment and spreading of the cells. This paper reviews research work of gene technology developed in tissue engineering.

  13. Detecting Sequence Homology at the Gene Cluster Level with MultiGeneBlast

    NARCIS (Netherlands)

    Medema, Marnix H.; Takano, Eriko; Breitling, Rainer; Nowick, Katja

    2013-01-01

    The genes encoding many biomolecular systems and pathways are genomically organized in operons or gene clusters. With MultiGeneBlast, we provide a user-friendly and effective tool to perform homology searches with operons or gene clusters as basic units, instead of single genes. The contextualizatio

  14. EasyGene – a prokaryotic gene finder that ranks ORFs by statistical significance

    DEFF Research Database (Denmark)

    Larsen, Thomas Schou; Krogh, Anders Stærmose

    2003-01-01

    annotated as genes.Results: In this paper, we present a new automated gene-finding method, EasyGene, which estimates the statistical significance of a predicted gene. The gene finder is based on a hidden Markov model (HMM) that is automatically estimated for a new genome. Using extensions of similarities...

  15. Gene Therapy for Coagulation Disorders.

    Science.gov (United States)

    Swystun, Laura L; Lillicrap, David

    2016-04-29

    Molecular genetic details of the human coagulation system were among the first successes of the genetic revolution in the 1980s. This information led to new molecular diagnostic strategies for inherited disorders of hemostasis and the development of recombinant clotting factors for the treatment of the common inherited bleeding disorders. A longer term goal of this knowledge has been the establishment of gene transfer to provide continuing access to missing or defective hemostatic proteins. Because of the relative infrequency of inherited coagulation factor disorders and the availability of safe and effective alternative means of management, the application of gene therapy for these conditions has been slow to realize clinical application. Nevertheless, the tools for effective and safe gene transfer are now much improved, and we have started to see examples of clinical gene therapy successes. Leading the way has been the use of adeno-associated virus-based strategies for factor IX gene transfer in hemophilia B. Several small phase 1/2 clinical studies using this approach have shown prolonged expression of therapeutically beneficial levels of factor IX. Nevertheless, before the application of gene therapy for coagulation disorders becomes widespread, several obstacles need to be overcome. Immunologic responses to the vector and transgenic protein need to be mitigated, and production strategies for clinical grade vectors require enhancements. There is little doubt that with the development of more efficient and facile strategies for genome editing and the application of other nucleic acid-based approaches to influence the coagulation system, the future of genetic therapies for hemostasis is bright. PMID:27126652

  16. Electroporation-mediated gene delivery.

    Science.gov (United States)

    Young, Jennifer L; Dean, David A

    2015-01-01

    Electroporation has been used extensively to transfer DNA to bacteria, yeast, and mammalian cells in culture for the past 30 years. Over this time, numerous advances have been made, from using fields to facilitate cell fusion, delivery of chemotherapeutic drugs to cells and tissues, and most importantly, gene and drug delivery in living tissues from rodents to man. Electroporation uses electrical fields to transiently destabilize the membrane allowing the entry of normally impermeable macromolecules into the cytoplasm. Surprisingly, at the appropriate field strengths, the application of these fields to tissues results in little, if any, damage or trauma. Indeed, electroporation has even been used successfully in human trials for gene delivery for the treatment of tumors and for vaccine development. Electroporation can lead to between 100 and 1000-fold increases in gene delivery and expression and can also increase both the distribution of cells taking up and expressing the DNA as well as the absolute amount of gene product per cell (likely due to increased delivery of plasmids into each cell). Effective electroporation depends on electric field parameters, electrode design, the tissues and cells being targeted, and the plasmids that are being transferred themselves. Most importantly, there is no single combination of these variables that leads to greatest efficacy in every situation; optimization is required in every new setting. Electroporation-mediated in vivo gene delivery has proven highly effective in vaccine production, transgene expression, enzyme replacement, and control of a variety of cancers. Almost any tissue can be targeted with electroporation, including muscle, skin, heart, liver, lung, and vasculature. This chapter will provide an overview of the theory of electroporation for the delivery of DNA both in individual cells and in tissues and its application for in vivo gene delivery in a number of animal models.

  17. Genomics of local adaptation with gene flow.

    Science.gov (United States)

    Tigano, Anna; Friesen, Vicki L

    2016-05-01

    Gene flow is a fundamental evolutionary force in adaptation that is especially important to understand as humans are rapidly changing both the natural environment and natural levels of gene flow. Theory proposes a multifaceted role for gene flow in adaptation, but it focuses mainly on the disruptive effect that gene flow has on adaptation when selection is not strong enough to prevent the loss of locally adapted alleles. The role of gene flow in adaptation is now better understood due to the recent development of both genomic models of adaptive evolution and genomic techniques, which both point to the importance of genetic architecture in the origin and maintenance of adaptation with gene flow. In this review, we discuss three main topics on the genomics of adaptation with gene flow. First, we investigate selection on migration and gene flow. Second, we discuss the three potential sources of adaptive variation in relation to the role of gene flow in the origin of adaptation. Third, we explain how local adaptation is maintained despite gene flow: we provide a synthesis of recent genomic models of adaptation, discuss the genomic mechanisms and review empirical studies on the genomics of adaptation with gene flow. Despite predictions on the disruptive effect of gene flow in adaptation, an increasing number of studies show that gene flow can promote adaptation, that local adaptations can be maintained despite high gene flow, and that genetic architecture plays a fundamental role in the origin and maintenance of local adaptation with gene flow.

  18. GeneMANIA prediction server 2013 update.

    Science.gov (United States)

    Zuberi, Khalid; Franz, Max; Rodriguez, Harold; Montojo, Jason; Lopes, Christian Tannus; Bader, Gary D; Morris, Quaid

    2013-07-01

    GeneMANIA (http://www.genemania.org) is a flexible user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query gene list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. GeneMANIA can also be used in a function prediction setting: given a query gene, GeneMANIA finds a small set of genes that are most likely to share function with that gene based on their interactions with it. Enriched Gene Ontology categories among this set can sometimes point to the function of the gene. Seven organisms are currently supported (Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, Mus musculus, Homo sapiens, Rattus norvegicus and Saccharomyces cerevisiae), and hundreds of data sets have been collected from GEO, BioGRID, IRefIndex and I2D, as well as organism-specific functional genomics data sets. Users can customize their search by selecting specific data sets to query and by uploading their own data sets to analyze. PMID:23794635

  19. A gene-based information gain method for detecting gene-gene interactions in case-control studies.

    Science.gov (United States)

    Li, Jin; Huang, Dongli; Guo, Maozu; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Zhang, Ruijie; Jiang, Yongshuai; Lv, Hongchao; Wang, Limei

    2015-11-01

    Currently, most methods for detecting gene-gene interactions (GGIs) in genome-wide association studies are divided into SNP-based methods and gene-based methods. Generally, the gene-based methods can be more powerful than SNP-based methods. Some gene-based entropy methods can only capture the linear relationship between genes. We therefore proposed a nonparametric gene-based information gain method (GBIGM) that can capture both linear relationship and nonlinear correlation between genes. Through simulation with different odds ratio, sample size and prevalence rate, GBIGM was shown to be valid and more powerful than classic KCCU method and SNP-based entropy method. In the analysis of data from 17 genes on rheumatoid arthritis, GBIGM was more effective than the other two methods as it obtains fewer significant results, which was important for biological verification. Therefore, GBIGM is a suitable and powerful tool for detecting GGIs in case-control studies.

  20. From gene to disease; hypophosphataemic rickets and the PHEX gene

    NARCIS (Netherlands)

    Jansen, M; van Dael, C.M.L.; Verrijn Stuart, A.A.; van der Hout, A.H.; Rump, P.

    2006-01-01

    X-linked hypophosphataemic rickets is associated with mutations in the PHEX gene on the short arm of the X chromosome, encoding a membrane-bound endoprotease which is predominantly expressed in osteoblasts. Defective PHEX function leaves phosphaturic peptides such as FGF23 uncleaved, enabling these