WorldWideScience

Sample records for mutations affecting kinase

  1. Phenotypic Variability in a Family with Acrodysostosis Type 2 Caused by a Novel PDE4D Mutation Affecting the Serine Target of Protein Kinase-A Phosphorylation

    Hoppmann, Julia; Gesing, Julia; Silve, Caroline; Leroy, Chrystel; Bertsche, Astrid; Hirsch, Franz Wolfgang; Kiess, Wieland; Pfäffle, Roland; Schuster, Volker

    2017-01-01

    Acrodysostosis is a very rare congenital multisystem condition characterized by skeletal dysplasia with severe brachydactyly, midfacial hypoplasia, and short stature, varying degrees of intellectual disability, and possible resistance to multiple G protein-coupled receptor signalling hormones. Two distinct subtypes are differentiated: acrodysostosis type 1 resulting from defects in protein kinase type 1-α regulatory subunit and acrodysostosis type 2 caused by mutations in phosphodiesterase 4D (PDE4D). Most cases are sporadic. We report on a rare multigenerational familial case of acrodysostosis type 2 due to a novel autosomal dominantly inherited PDE4D mutation. A 3.5-year-old boy presented with short stature, midfacial hypoplasia, severe brachydactyly, developmental delay, and behavioural problems. Laboratory investigations revealed mild thyrotropin resistance. His mother shared some characteristic features, such as midfacial hypoplasia and severe brachydactyly, but did not show short stature, intellectual disability or hormonal resistance. Genetic analysis identified the identical, novel heterozygous missense mutation of the PDE4D gene c.569C>T (p.Ser190Phe) in both patients. This case illustrates the significant phenotypic variability of acrodysostosis even within one family with identical mutations. Hence, a specific clinical diagnosis of acrodysostosis remains challenging because of great interindividual variability and a substantial overlap of the two subtypes as well as with other related Gsα-cAMP-signalling-linked disorders. PMID:28515031

  2. Novel mutations associated with pyruvate kinase deficiency in Brazil

    Maria Carolina Costa Melo Svidnicki

    2018-01-01

    Full Text Available Background: Pyruvate kinase deficiency is a hereditary disease that affects the glycolytic pathway of the red blood cell, causing nonspherocytic hemolytic anemia. The disease is transmitted as an autosomal recessive trait and shows a marked variability in clinical expression. This study reports on the molecular characterization of ten Brazilian pyruvate kinase-deficient patients and the genotype–phenotype correlations. Method: Sanger sequencing and in silico analysis were carried out to identify and characterize the genetic mutations. A non-affected group of Brazilian individuals were also screened for the most commonly reported variants (c.1456C>T and c.1529G>A. Results: Ten different variants were identified in the PKLR gene, of which three are reported here for the first time: p.Leu61Gln, p.Ala137Val and p.Ala428Thr. All the three missense variants involve conserved amino acids, providing a rationale for the observed enzyme deficiency. The allelic frequency of c.1456C>T was 0.1% and the 1529G>A variant was not found. Conclusion: This is the first comprehensive report on molecular characterization of pyruvate kinase deficiency from South America. The results allowed us to correlate the severity of the clinical phenotype with the identified variants. Keywords: Red cell disorder, Pyruvate kinase, Mutation, Hemolytic anemia, PKLR gene

  3. Characterization of pathogenic germline mutations in human Protein Kinases

    Orengo Christine A

    2011-07-01

    Full Text Available Abstract Background Protein Kinases are a superfamily of proteins involved in crucial cellular processes such as cell cycle regulation and signal transduction. Accordingly, they play an important role in cancer biology. To contribute to the study of the relation between kinases and disease we compared pathogenic mutations to neutral mutations as an extension to our previous analysis of cancer somatic mutations. First, we analyzed native and mutant proteins in terms of amino acid composition. Secondly, mutations were characterized according to their potential structural effects and finally, we assessed the location of the different classes of polymorphisms with respect to kinase-relevant positions in terms of subfamily specificity, conservation, accessibility and functional sites. Results Pathogenic Protein Kinase mutations perturb essential aspects of protein function, including disruption of substrate binding and/or effector recognition at family-specific positions. Interestingly these mutations in Protein Kinases display a tendency to avoid structurally relevant positions, what represents a significant difference with respect to the average distribution of pathogenic mutations in other protein families. Conclusions Disease-associated mutations display sound differences with respect to neutral mutations: several amino acids are specific of each mutation type, different structural properties characterize each class and the distribution of pathogenic mutations within the consensus structure of the Protein Kinase domain is substantially different to that for non-pathogenic mutations. This preferential distribution confirms previous observations about the functional and structural distribution of the controversial cancer driver and passenger somatic mutations and their use as a proxy for the study of the involvement of somatic mutations in cancer development.

  4. Mutation Study of Two Thymidine Kinases 

    Skovgaard, Tine; Munch-Petersen, Birgitte; Eklund, Hans

    that phosphorylates all the natural deoxyribonucleosides and like insects, C. elegans only contains a single deoxyribonucleoside kinase-like gene. In contrast to the insects, however, the protein encoded by the elegans gene is 46 % identical to human TK1 (HuTK1) and have no homology to the insect kinase. Like HuTK1...... the C. elegans kinase (CeTK1) has thymidine as the preferred substrate, but it also displays activity with deoxyguanosine, though with high Km. A number of point mutations have been introduced in the active site of both the human and elegans TK's in order to change the substrate specificity away from...... not phosphorylate the anticancer analog 1-β-D-arabinofuranosylcytosine (AraC), however. The HuTK1 mutant has been crystallized, and azidothymidine monophosphate has been modelled into the active site....

  5. The wavy Mutation Maps to the Inositol 1,4,5-Trisphosphate 3-Kinase 2 (IP3K2) Gene of Drosophila and Interacts with IP3R to Affect Wing Development.

    Dean, Derek M; Maroja, Luana S; Cottrill, Sarah; Bomkamp, Brent E; Westervelt, Kathleen A; Deitcher, David L

    2015-11-27

    Inositol 1,4,5-trisphosphate (IP3) regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs) bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy), a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2), a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80(ts) indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling. Copyright © 2016 Dean et al.

  6. The wavy Mutation Maps to the Inositol 1,4,5-Trisphosphate 3-Kinase 2 (IP3K2 Gene of Drosophila and Interacts with IP3R to Affect Wing Development

    Derek M. Dean

    2016-02-01

    Full Text Available Inositol 1,4,5-trisphosphate (IP3 regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy, a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2, a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80ts indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling.

  7. Impact of kinase activating and inactivating patient mutations on binary PKA interactions.

    Röck, Ruth; Mayrhofer, Johanna E; Bachmann, Verena; Stefan, Eduard

    2015-01-01

    The second messenger molecule cAMP links extracellular signals to intracellular responses. The main cellular cAMP effector is the compartmentalized protein kinase A (PKA). Upon receptor initiated cAMP-mobilization, PKA regulatory subunits (R) bind cAMP thereby triggering dissociation and activation of bound PKA catalytic subunits (PKAc). Mutations in PKAc or RIa subunits manipulate PKA dynamics and activities which contribute to specific disease patterns. Mutations activating cAMP/PKA signaling contribute to carcinogenesis or hormone excess, while inactivating mutations cause hormone deficiency or resistance. Here we extended the application spectrum of a Protein-fragment Complementation Assay based on the Renilla Luciferase to determine binary protein:protein interactions (PPIs) of the PKA network. We compared time- and dose-dependent influences of cAMP-elevation on mutually exclusive PPIs of PKAc with the phosphotransferase inhibiting RIIb and RIa subunits and the protein kinase inhibitor peptide (PKI). We analyzed PKA dynamics following integration of patient mutations into PKAc and RIa. We observed that oncogenic modifications of PKAc(L206R) and RIa(Δ184-236) as well as rare disease mutations in RIa(R368X) affect complex formation of PKA and its responsiveness to cAMP elevation. With the cell-based PKA PPI reporter platform we precisely quantified the mechanistic details how inhibitory PKA interactions and defined patient mutations contribute to PKA functions.

  8. A novel mutation in the tyrosine kinase domain of ERBB2 in hepatocellular carcinoma

    Bekaii-Saab, Tanios; Williams, Nita; Plass, Christoph; Calero, Miguel Villalona; Eng, Charis

    2006-01-01

    Several studies showed that gain-of-function somatic mutations affecting the catalytic domain of EGFR in non-small cell lung carcinomas were associated with response to gefitinib and erlotinib, both EGFR-tyrosine kinase inhibitors. In addition, 4% of non-small cell lung carcinomas were shown to have ERBB2 mutations in the kinase domain. In our study, we sought to determine if similar respective gain-of-function EGFR and ERBB2 mutations were present in hepatoma and/or biliary cancers. We extracted genomic DNA from 40 hepatoma (18) and biliary cancers (22) samples, and 44 adenocarcinomas of the lung, this latter as a positive control for mutation detection. We subjected those samples to PCR-based semi-automated double stranded nucleotide sequencing targeting exons 18–21 of EGFR and ERBB2. All samples were tested against matched normal DNA. We found 11% of hepatoma, but no biliary cancers, harbored a novel ERBB2 H878Y mutation in the activating domain. These newly described mutations may play a role in predicting response to EGFR-targeted therapy in hepatoma and their role should be explored in prospective studies

  9. Identifying pathways affected by cancer mutations.

    Iengar, Prathima

    2017-12-16

    Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Mutations and phenotype in isolated glycerol kinase deficiency

    Walker, A.P.; Muscatelli, F.; Stafford, A.N.; Monaco, A.P. [Inst. of Molecular Medicine, Oxford (United Kingdom)] [and others

    1996-06-01

    We demonstrate that isolated glycerol kinase (GK) deficiency in three families results from mutation of the Xp21 GK gene. GK mutations were detected in four patients with widely differing phenotypes. Patient 1 had a splice-site mutation causing premature termination. His general health was good despite absent GK activity, indicating that isolated GK deficiency can be silent. Patient 2 had GK deficiency and a severe phenotype involving psychomotor retardation and growth delay, bone dysplasia, and seizures, similar to the severe phenotype of one of the first described cases of GK deficiency. His younger brother, patient 3, also had GK deficiency, but so far his development has been normal. GK exon 17 was deleted in both brothers, implicating additional factors in causation of the severe phenotype of patient 2. Patient 4 had both GK deficiency with mental retardation and a GK missense mutation (D440V). Possible explanations for the phenotypic variation of these four patients include ascertainment bias; metabolic or environmental stress as a precipitating factor in revealing GK-related changes, as has previously been described in juvenile GK deficiency; and interactions with functional polymorphisms in other genes that alter the effect of GK deficiency on normal development. 36 refs., 4 figs., 1 tab.

  11. Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.

    Harry F Heijnen

    Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.

  12. Recurrent recessive mutation in deoxyguanosine kinase causes idiopathic noncirrhotic portal hypertension.

    Vilarinho, Sílvia; Sari, Sinan; Yilmaz, Güldal; Stiegler, Amy L; Boggon, Titus J; Jain, Dhanpat; Akyol, Gulen; Dalgic, Buket; Günel, Murat; Lifton, Richard P

    2016-06-01

    Despite advances in the diagnosis and management of idiopathic noncirrhotic portal hypertension, its pathogenesis remains elusive. Insight may be gained from study of early-onset familial idiopathic noncirrhotic portal hypertension, in which Mendelian mutations may account for disease. We performed exome sequencing of eight subjects from six kindreds with onset of portal hypertension of indeterminate etiology during infancy or childhood. Three subjects from two consanguineous families shared the identical rare homozygous p.N46S mutation in DGUOK, a deoxyguanosine kinase required for mitochondrial DNA replication; haplotype sharing demonstrated that the mutation in the two families was inherited from a remote common ancestor. All three affected subjects had stable portal hypertension with noncirrhotic liver disease for 6-16 years of follow-up. This mutation impairs adenosine triphosphate binding and reduces catalytic activity. Loss-of-function mutations in DGUOK have previously been implicated in cirrhosis and liver failure but not in isolated portal hypertension. Interestingly, treatment of patients with human immunodeficiency viral infection with the nucleoside analogue didanosine is known to cause portal hypertension in a subset of patients and lowers deoxyguanosine kinase levels in vitro; the current findings implicate these effects on deoxyguanosine kinase in the causal mechanism. Our findings provide new insight into the mechanisms mediating inherited and acquired noncirrhotic portal hypertension, expand the phenotypic spectrum of DGUOK deficiency, and provide a new genetic test for a specific cause of idiopathic noncirrhotic portal hypertension. (Hepatology 2016;63:1977-1986). © 2016 by the American Association for the Study of Liver Diseases.

  13. Comparative active-site mutation study of human and Caenorhabditis elegans thymidine kinase 1

    Skovgaard, Tine; Uhlin, Ulla; Munch-Petersen, Birgitte

    2012-01-01

    surrounding the substrate base. In CeTK1, some of these mutations led to increased activity with deoxycytidine and deoxyguanosine, two unusual substrates for TK1-like kinases. In HuTK1, mutation of T163 to S resulted in a kinase with a 140-fold lower K(m) for the antiviral nucleoside analogue 3'-azido-3...

  14. Novel mutations in cyclin-dependent kinase-like 5 (CDKL5) gene in Indian cases of Rett syndrome.

    Das, Dhanjit Kumar; Mehta, Bhakti; Menon, Shyla R; Raha, Sarbani; Udani, Vrajesh

    2013-03-01

    Rett syndrome is a severe neurodevelopmental disorder, almost exclusively affecting females and characterized by a wide spectrum of clinical manifestations. Both the classic and atypical forms of Rett syndrome are primarily due to mutations in the methyl-CpG-binding protein 2 (MECP2) gene. Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with atypical Rett syndrome, X-linked infantile spasms sharing common features of generally early-onset seizures and mental retardation. CDKL5 is known as serine/threonine protein kinase 9 (STK9) and is mapped to the Xp22 region. It has a conserved serine/threonine kinase domain within its amino terminus and a large C-terminal region. Disease-causing mutations are distributed in both the amino terminal domain and in the large C-terminal domain. We have screened the CDKL5 gene in 44 patients with atypical Rett syndrome who had tested negative for MECP2 gene mutations and have identified 6 sequence variants, out of which three were novel and three known mutations. Two of these novel mutations p.V966I and p.A1011V were missense and p.H589H a silent mutation. Other known mutations identified were p.V999M, p.Q791P and p.T734A. Sequence homology for all the mutations revealed that the two mutations (p.Q791P and p.T734A) were conserved across species. This indicated the importance of these residues in structure and function of the protein. The damaging effects of these mutations were analysed in silico using PolyPhen-2 online software. The PolyPhen-2 scores of p.Q791P and p.T734A were 0.998 and 0.48, revealing that these mutations could be deleterious and might have potential functional effect. All other mutations had a low score suggesting that they might not alter the activity of CDKL5. We have also analysed the position of the mutations in the CDKL5 protein and found that all the mutations were present in the C-terminal domain of the protein. The C-terminal domain is required for

  15. Unchanged thymidine triphosphate pools and thymidine metabolism in two lines of thymidine kinase 2-mutated fibroblasts.

    Frangini, Miriam; Rampazzo, Chiara; Franzolin, Elisa; Lara, Mari-Carmen; Vilà, Maya R; Martí, Ramon; Bianchi, Vera

    2009-02-01

    Mitochondrial thymidine kinase (TK2) catalyzes the phosphorylation of thymidine in mitochondria. Its function becomes essential for dTTP synthesis in noncycling cells, where cytosolic dTTP synthesis via R1/R2 ribonucleotide reductase and thymidine kinase 1 is turned down. Mutations in the nuclear gene for TK2 cause a fatal mtDNA depletion syndrome. Only selected cell types are affected, suggesting that the other cells compensate for the TK2 deficiency by adapting the enzyme network that regulates dTTP synthesis outside S-phase. Here we looked for such metabolic adaptation in quiescent cultures of fibroblasts from two TK2-deficient patients with a slow-progressing syndrome. In cell extracts, we measured the activities of TK2, deoxycytidine kinase, thymidine phosphorylase, deoxynucleotidases and the amounts of the three ribonucleotide reductase subunits. Patient cells contained 40% or 5% TK2 activity and unchanged activities of the other enzymes. However, their mitochondrial and cytosolic dTTP pools were unchanged, and also the overall composition of the dNTP pools was normal. TK2-dependent phosphorylation of [(3)H]thymidine in intact cells and the turnover of the dTTP pool showed that even the fibroblasts with 5% residual TK2 activity synthesized dTTP at an almost normal rate. Normal fibroblasts apparently contain more TK2 than needed to maintain dTTP during quiescence, which would explain why TK2-mutated fibroblasts do not manifest mtDNA depletion despite their reduced TK2 activity.

  16. Mutation of serine 1333 in the ATR HEAT repeats creates a hyperactive kinase.

    Jessica W Luzwick

    Full Text Available Subcellular localization, protein interactions, and post-translational modifications regulate the DNA damage response kinases ATR, ATM, and DNA-PK. During an analysis of putative ATR phosphorylation sites, we found that a single mutation at S1333 creates a hyperactive kinase. In vitro and in cells, mutation of S1333 to alanine (S1333A-ATR causes elevated levels of kinase activity with and without the addition of the protein activator TOPBP1. S1333 mutations to glycine, arginine, or lysine also create a hyperactive kinase, while mutation to aspartic acid decreases ATR activity. S1333A-ATR maintains the G2 checkpoint and promotes completion of DNA replication after transient exposure to replication stress but the less active kinase, S1333D-ATR, has modest defects in both of these functions. While we find no evidence that S1333 is phosphorylated in cultured cells, our data indicate that small changes in the HEAT repeats can have large effects on kinase activity. These mutants may serve as useful tools for future studies of the ATR pathway.

  17. New mutations affecting induced mutagenesis in yeast.

    Lawrence, C W; Krauss, B R; Christensen, R B

    1985-01-01

    Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.

  18. Complement Mutations in Diacylglycerol Kinase-ε–Associated Atypical Hemolytic Uremic Syndrome

    Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago

    2014-01-01

    Background and objectives Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Design, setting, participants, & measurements Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Results Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol

  19. Complement mutations in diacylglycerol kinase-ε-associated atypical hemolytic uremic syndrome.

    Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago

    2014-09-05

    Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol kinase-ε and C3 mutations. Data suggest that complement dysregulation influences

  20. Characteristics and mutation analysis of Ph-positive leukemia patients with T315I mutation receiving tyrosine kinase inhibitors

    Xu PP

    2017-09-01

    Full Text Available Peipei Xu,1 Dan Guo,2 Xiaoyan Shao,1 Miaoxin Peng,1 Bing Chen2 1Department of Hematology, Drum Tower Hospital, School of Medicine, Nanjing University, 2Department of Hematology, Nanjing Drum Tower Hospital Clinical College of Nanjing Medical University, Nanjing, People’s Republic of China Background: TKIs are the first-line treatment for patients with Ph-positive (Ph+ leukemia. However, drug resistance is frequently observed, mainly due to mutations within the breakpoint cluster region-Abelson leukemia virus (BCR-ABL kinase domain. The T315I substitution confers complete resistance to TKIs. The aim of this study was to analyze the clinical characteristics of 17 patients with T315I mutation after TKI treatment and provide a basis for prognosis.Patients and methods: The clinical data of 17 TKI-resistant Ph+ leukemia patients who were found to have a ABL kinase domain mutation from September 2008 to January 2017 were collected. Karyotypes and BCR-ABL fusion gene were analyzed by R-banding and fluorescence in situ hybridization, respectively. Total RNA was extracted by TRIzol reagent, and the ABL kinase domain mutation was detected by direct sequencing.Results: A total of 17 patients reached effective remission including major molecular response and complete cytogenetic response. However, all the patients subsequently developed a T315I mutation after treatment with TKIs. The rate of the BCR-ABL fusion gene in most of the patients who developed the T315I mutation was significantly higher than that before the mutation. At initial diagnosis, patients average platelet count was 149.7×109/L, whereas the average platelet count was only 53.88×109/L after the T315I mutation (P<0.01. The results also showed that the survival time of patients with a high proportion of blast cells or a high number of white blood cells was obviously shortened.Conclusion: Patients platelet count decreased when detected with the T315I mutation compared with the initial

  1. Kin-Driver: a database of driver mutations in protein kinases.

    Simonetti, Franco L; Tornador, Cristian; Nabau-Moretó, Nuria; Molina-Vila, Miguel A; Marino-Buslje, Cristina

    2014-01-01

    Somatic mutations in protein kinases (PKs) are frequent driver events in many human tumors, while germ-line mutations are associated with hereditary diseases. Here we present Kin-driver, the first database that compiles driver mutations in PKs with experimental evidence demonstrating their functional role. Kin-driver is a manual expert-curated database that pays special attention to activating mutations (AMs) and can serve as a validation set to develop new generation tools focused on the prediction of gain-of-function driver mutations. It also offers an easy and intuitive environment to facilitate the visualization and analysis of mutations in PKs. Because all mutations are mapped onto a multiple sequence alignment, analogue positions between kinases can be identified and tentative new mutations can be proposed for studying by transferring annotation. Finally, our database can also be of use to clinical and translational laboratories, helping them to identify uncommon AMs that can correlate with response to new antitumor drugs. The website was developed using PHP and JavaScript, which are supported by all major browsers; the database was built using MySQL server. Kin-driver is available at: http://kin-driver.leloir.org.ar/ © The Author(s) 2014. Published by Oxford University Press.

  2. Targeting oncoprotein stability overcomes drug resistance caused by FLT3 kinase domain mutations.

    Chuanjiang Yu

    Full Text Available FLT3 is the most frequently mutated kinase in acute myeloid leukemia (AML. Internal tandem duplications (ITDs in the juxta-membrane region constitute the majority of activating FLT3 mutations. Several FLT3 kinase inhibitors were developed and tested in the clinic with significant success. However, recent studies have reported the development of secondary drug resistance in patients treated with FLT3 inhibitors. Since FLT3-ITD is an HSP90 client kinase, we here explored if targeting the stability of drug-resistant FLT3 mutant protein could be a potential therapeutic option. We observed that HSP90 inhibitor treatment resulted in the degradation of inhibitor-resistant FLT3-ITD mutants and selectively induced toxicity in cells expressing FLT3-ITD mutants. Thus, HSP90 inhibitors provide a potential therapeutic choice to overcome secondary drug resistance following TKI treatment in FLT3-ITD positive AML.

  3. A nonsense mutation in cGMP-dependent type II protein kinase (PRKG2) causes dwarfism in American Angus cattle.

    Koltes, James E; Mishra, Bishnu P; Kumar, Dinesh; Kataria, Ranjit S; Totir, Liviu R; Fernando, Rohan L; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M

    2009-11-17

    Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle.

  4. Molecular insight into mitochondrial DNA depletion syndrome in two patients with novel mutations in the deoxyguanosine kinase and thymidine kinase 2 genes.

    Wang, Liya; Limongelli, Anna; Vila, Maya R; Carrara, Franco; Zeviani, Massimo; Eriksson, Staffan

    2005-01-01

    Thymidine kinase 2 (TK2) and deoxyguanosine kinase (dGK) are the two key enzymes in mitochondrial DNA (mtDNA) precursor synthesis. Deficiencies in TK2 or dGK activity, due to genetic alteration, have been shown to cause tissue-specific depletion of mtDNA. In the case of TK2 deficiency, affected individuals suffer severe myopathy and, in the case of dGK deficiency, devastating liver or multi-systemic disease. Here, we report clinical and biochemical findings from two patients with mtDNA depletion syndrome. Patient A was a compound heterozygote carrying the previously reported T77M mutation and a novel mutation (R161K) in the TK2 gene. Patient B carried a novel mutation (L250S) in the dGK gene. The clinical symptoms of patient A included muscular weakness and exercise intolerance due to a severe mitochondrial myopathy associated with a 92% reduction in mtDNA. There was minimal involvement of other organs. Patient B suffered from rapidly progressive, early onset fatal liver failure associated with profoundly decreased mtDNA levels in liver and, to a lesser extent, in skeletal muscle. Site-directed mutagenesis was used to introduce the mutations detected in patients A and B into the TK2 and dGK cDNAs, respectively. We then characterized each of these recombinant enzymes. Catalytic activities of the three mutant enzymes were reduced to about 2-4% for TK2 and 0.5% for dGK as compared to the wild-type enzymes. Altered competition between dCyd and dThd was observed for the T77M mutant. The residual activities of the two mitochondrial enzymes correlated directly with disease development.

  5. Somatic mutations affect key pathways in lung adenocarcinoma

    Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

    2009-01-01

    Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

  6. Hierarchical modeling of activation mechanisms in the ABL and EGFR kinase domains: thermodynamic and mechanistic catalysts of kinase activation by cancer mutations.

    Anshuman Dixit

    2009-08-01

    Full Text Available Structural and functional studies of the ABL and EGFR kinase domains have recently suggested a common mechanism of activation by cancer-causing mutations. However, dynamics and mechanistic aspects of kinase activation by cancer mutations that stimulate conformational transitions and thermodynamic stabilization of the constitutively active kinase form remain elusive. We present a large-scale computational investigation of activation mechanisms in the ABL and EGFR kinase domains by a panel of clinically important cancer mutants ABL-T315I, ABL-L387M, EGFR-T790M, and EGFR-L858R. We have also simulated the activating effect of the gatekeeper mutation on conformational dynamics and allosteric interactions in functional states of the ABL-SH2-SH3 regulatory complexes. A comprehensive analysis was conducted using a hierarchy of computational approaches that included homology modeling, molecular dynamics simulations, protein stability analysis, targeted molecular dynamics, and molecular docking. Collectively, the results of this study have revealed thermodynamic and mechanistic catalysts of kinase activation by major cancer-causing mutations in the ABL and EGFR kinase domains. By using multiple crystallographic states of ABL and EGFR, computer simulations have allowed one to map dynamics of conformational fluctuations and transitions in the normal (wild-type and oncogenic kinase forms. A proposed multi-stage mechanistic model of activation involves a series of cooperative transitions between different conformational states, including assembly of the hydrophobic spine, the formation of the Src-like intermediate structure, and a cooperative breakage and formation of characteristic salt bridges, which signify transition to the active kinase form. We suggest that molecular mechanisms of activation by cancer mutations could mimic the activation process of the normal kinase, yet exploiting conserved structural catalysts to accelerate a conformational transition

  7. The Development of Ataxia Telangiectasia Mutated Kinase Inhibitors

    Andrs, M.; Kobarecny, J.; Nepovimova, E.; Jun, D.; Hodný, Zdeněk; Moravcová, Simona; Hanzlíková, Hana; Kuca, K.

    2014-01-01

    Roč. 14, č. 10 (2014), s. 805-811 ISSN 1389-5575 R&D Projects: GA MŠk(CZ) CZ.1.07/2.3.00/30.0044 Grant - others:MH CZ - DRO (University Hospital Hradec Kralove(CZ) 00179906 Institutional support: RVO:68378050 Keywords : Ataxia telangiectasia mutated * cancer * chemosensitization * DNA damage response Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.903, year: 2014

  8. Mutation pattern in the Bruton's tyrosine kinase gene in 26 unrelated patients with X-linked agammaglobulinemia

    Vorechovský, I; Luo, L; Hertz, Jens Michael

    1997-01-01

    Mutation pattern was characterized in the Bruton's tyrosine kinase gene (BTK) in 26 patients with X-linked agammaglobulinemia, the first described immunoglobulin deficiency, and was related to BTK expression. A total of 24 different mutations were identified. Most BTK mutations were found to result...

  9. Computational Analysis of Epidermal Growth Factor Receptor Mutations Predicts Differential Drug Sensitivity Profiles toward Kinase Inhibitors.

    Akula, Sravani; Kamasani, Swapna; Sivan, Sree Kanth; Manga, Vijjulatha; Vudem, Dashavantha Reddy; Kancha, Rama Krishna

    2018-05-01

    A significant proportion of patients with lung cancer carry mutations in the EGFR kinase domain. The presence of a deletion mutation in exon 19 or L858R point mutation in the EGFR kinase domain has been shown to cause enhanced efficacy of inhibitor treatment in patients with NSCLC. Several less frequent (uncommon) mutations in the EGFR kinase domain with potential implications in treatment response have also been reported. The role of a limited number of uncommon mutations in drug sensitivity was experimentally verified. However, a huge number of these mutations remain uncharacterized for inhibitor sensitivity or resistance. A large-scale computational analysis of clinically reported 298 point mutants of EGFR kinase domain has been performed, and drug sensitivity profiles for each mutant toward seven kinase inhibitors has been determined by molecular docking. In addition, the relative inhibitor binding affinity toward each drug as compared with that of adenosine triphosphate was calculated for each mutant. The inhibitor sensitivity profiles predicted in this study for a set of previously characterized mutants correlated well with the published clinical, experimental, and computational data. Both the single and compound mutations displayed differential inhibitor sensitivity toward first- and next-generation kinase inhibitors. The present study provides predicted drug sensitivity profiles for a large panel of uncommon EGFR mutations toward multiple inhibitors, which may help clinicians in deciding mutant-specific treatment strategies. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  10. X-linked agammaglobulinemia - first case with Bruton tyrosine kinase mutation from Pakistan.

    Zaidi, Samreen Kulsom; Qureshi, Sonia; Qamar, Farah Naz

    2017-03-01

    X-linked agammaglobulinemia (XLA) is a primary immunodeficiency with more than 600 mutations in Bruton tyrosine kinase (Bkt) gene which are responsible for early-onset agammaglobulinemia and repeated infections. Herein we present a case of a 3-year-old boy with history of repeated diarrhoea and an episode of meningoencephalitis with hemiplegia. The workup showed extremely low levels of immunoglobulin with low CD+19 cells. Genetic analysis showed Btk mutation 18 c.1883delCp.T628fs. To the best of our knowledge this is the first report of a case of XLA confirmed by molecular technique from Pakistan.

  11. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  12. An Activin Receptor IA/Activin-Like Kinase-2 (R206H Mutation in Fibrodysplasia Ossificans Progressiva

    Rafael Herrera-Esparza

    2013-01-01

    Full Text Available Fibrodysplasia ossificans progressiva (FOP is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2. A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP signalling that causes FOP.

  13. Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

    McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

    2015-01-01

    Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

  14. Pantothenate kinase 2 mutation with classic pantothenate-kinase-associated neurodegeneration without 'eye-of-the-tiger' sign on MRI in a pair of siblings

    Zolkipli, Zarazuela; Surtees, Robert; Dahmoush, Hisham; Saunders, Dawn E.; Kling Chong, W.K.

    2006-01-01

    It has been postulated that all patients with pantothenate kinase 2 (PANK2) mutations causing pantothenate-kinase-associated neurodegeneration (PKAN) are associated with the 'eye-of-the-tiger' sign on MRI. We report a pair of siblings who presented with dystonia and who have been found to be homozygous for 104C>A, S35X mutation, confirming the diagnosis of PKAN. They do not have the typical iron deposition in the globi pallida or substantia nigra on MR imaging. (orig.)

  15. Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

    Klein, H H; Müller, R; Vestergaard, H

    1999-01-01

    We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

  16. Tyrosine kinase domain mutations of EGFR gene in head and neck squamous cell carcinoma

    Vatte C

    2017-03-01

    Full Text Available Chittibabu Vatte,1 Ali M Al Amri,2 Cyril Cyrus,1 Shahanas Chathoth,1 Sadananda Acharya,3 Tariq Mohammad Hashim,4 Zhara Al Ali,2 Saleh Tawfeeq Alshreadah,2 Ahmed Alsayyah,4 Amein K Al-Ali5 1Department of Genetic Research, Institute for Research and Medical Consultation, University of Dammam, Dammam, 2Department of Internal Medicine, King Fahd Hospital of the University, University of Dammam, Al-Khobar, 3Department of Stemcell Research, Institute for Research and Medical Consultation, 4Department of Pathology, King Fahd Hospital of the University, University of Dammam, Al-Khobar, 5Department of Biochemistry, College of Medicine, University of Dammam, Dammam, Kingdom of Saudi Arabia Background: Epidermal growth factor receptor (EGFR is a commonly altered gene that is identified in various cancers, including head and neck squamous cell carcinoma (HNSCC. Therefore, EGFR is a promising molecular marker targeted by monoclonal antibodies and small molecule inhibitors targeting the tyrosine kinase (TK domain. Objective: The objective of this study was to investigate the spectrum of mutations in exons 18, 19, 20, and 21 of the EGFR gene in HNSCC patients. Materials and methods: This retrospective study included 47 confirmed HNSCC cases. Mutations in the TK domain, exons 18, 19, 20, and 21 of the EGFR gene, were detected by Scorpion® chemistry and ARMS® technologies on Rotor-Gene Q real-time polymerase chain reaction.Results: The tumors exhibited EGFR-TK domain mutations in 57% of cases. Four cases of T790M mutations were reported for the first time among HNSCC patients. Out of the total mutations, L861Q (exon 21, exon 20 insertions and deletions of exon 19 accounted for the majority of mutations (21%, 19%, and 17%, respectively. EGFR mutation status was correlated with the higher grade (P=0.026 and advanced stage (P=0.034 of HNSCC tumors.Conclusion: Higher frequency of EGFR-TK domain mutations together with the presence of the T790M mutation suggests

  17. Male Hypogonadism and Germ Cell Loss Caused by a Mutation in Polo-Like Kinase 4

    Harris, Rebecca M.; Weiss, Jeffrey

    2011-01-01

    The genetic etiologies of male infertility remain largely unknown. To identify genes potentially involved in spermatogenesis and male infertility, we performed genome-wide mutagenesis in mice with N-ethyl-N-nitrosourea and identified a line with dominant hypogonadism and patchy germ cell loss. Genomic mapping and DNA sequence analysis identified a novel heterozygous missense mutation in the kinase domain of Polo-like kinase 4 (Plk4), altering an isoleucine to asparagine at residue 242 (I242N). Genetic complementation studies using a gene trap line with disruption in the Plk4 locus confirmed that the putative Plk4 missense mutation was causative. Plk4 is known to be involved in centriole formation and cell cycle progression. However, a specific role in mammalian spermatogenesis has not been examined. PLK4 was highly expressed in the testes both pre- and postnatally. In the adult, PLK4 expression was first detected in stage VIII pachytene spermatocytes and was present through step 16 elongated spermatids. Because the homozygous Plk4I242N/I242N mutation was embryonic lethal, all analyses were performed using the heterozygous Plk4+/I242N mice. Testis size was reduced by 17%, and histology revealed discrete regions of germ cell loss, leaving only Sertoli cells in these defective tubules. Testis cord formation (embryonic day 13.5) was normal. Testis histology was also normal at postnatal day (P)1, but germ cell loss was detected at P10 and subsequent ages. We conclude that the I242N heterozygous mutation in PLK4 is causative for patchy germ cell loss beginning at P10, suggesting a role for PLK4 during the initiation of spermatogenesis. PMID:21791561

  18. HER family kinase domain mutations promote tumor progression and can predict response to treatment in human breast cancer

    Boulbes, Delphine R.

    2014-11-11

    Resistance to HER2-targeted therapies remains a major obstacle in the treatment of HER2-overexpressing breast cancer. Understanding the molecular pathways that contribute to the development of drug resistance is needed to improve the clinical utility of novel agents, and to predict the success of targeted personalized therapy based on tumor-specific mutations. Little is known about the clinical significance of HER family mutations in breast cancer. Because mutations within HER1/EGFR are predictive of response to tyrosine kinase inhibitors (TKI) in lung cancer, we investigated whether mutations in HER family kinase domains are predictive of response to targeted therapy in HER2-overexpressing breast cancer. We sequenced the HER family kinase domains from 76 HER2-overexpressing invasive carcinomas and identified 12 missense variants. Patients whose tumors carried any of these mutations did not respond to HER2 directed therapy in the metastatic setting. We developed mutant cell lines and used structural analyses to determine whether changes in protein conformation could explain the lack of response to therapy. We also functionally studied all HER2 mutants and showed that they conferred an aggressive phenotype and altered effects of the TKI lapatinib. Our data demonstrate that mutations in the finely tuned HER kinase domains play a critical function in breast cancer progression and may serve as prognostic and predictive markers.

  19. HER family kinase domain mutations promote tumor progression and can predict response to treatment in human breast cancer

    Boulbes, Delphine R.; Arold, Stefan T.; Chauhan, Gaurav B.; Blachno, Korina V.; Deng, Nanfu; Chang, Wei-Chao; Jin, Quanri; Huang, Tzu-Hsuan; Hsu, Jung-Mao; Brady, Samuel W.; Bartholomeusz, Chandra; Ladbury, John E.; Stone, Steve; Yu, Dihua; Hung, Mien-Chie; Esteva, Francisco J.

    2014-01-01

    Resistance to HER2-targeted therapies remains a major obstacle in the treatment of HER2-overexpressing breast cancer. Understanding the molecular pathways that contribute to the development of drug resistance is needed to improve the clinical utility of novel agents, and to predict the success of targeted personalized therapy based on tumor-specific mutations. Little is known about the clinical significance of HER family mutations in breast cancer. Because mutations within HER1/EGFR are predictive of response to tyrosine kinase inhibitors (TKI) in lung cancer, we investigated whether mutations in HER family kinase domains are predictive of response to targeted therapy in HER2-overexpressing breast cancer. We sequenced the HER family kinase domains from 76 HER2-overexpressing invasive carcinomas and identified 12 missense variants. Patients whose tumors carried any of these mutations did not respond to HER2 directed therapy in the metastatic setting. We developed mutant cell lines and used structural analyses to determine whether changes in protein conformation could explain the lack of response to therapy. We also functionally studied all HER2 mutants and showed that they conferred an aggressive phenotype and altered effects of the TKI lapatinib. Our data demonstrate that mutations in the finely tuned HER kinase domains play a critical function in breast cancer progression and may serve as prognostic and predictive markers.

  20. Sensitive detection of pre-existing BCR-ABL kinase domain mutations in CD34+ cells of newly diagnosed chronic-phase chronic myeloid leukemia patients is associated with imatinib resistance: implications in the post-imatinib era.

    Zafar Iqbal

    Full Text Available BACKGROUND: BCR-ABL kinase domain mutations are infrequently detected in newly diagnosed chronic-phase chronic myeloid leukemia (CML patients. Recent studies indicate the presence of pre-existing BCR-ABL mutations in a higher percentage of CML patients when CD34+ stem/progenitor cells are investigated using sensitive techniques, and these mutations are associated with imatinib resistance and disease progression. However, such studies were limited to smaller number of patients. METHODS: We investigated BCR-ABL kinase domain mutations in CD34+ cells from 100 chronic-phase CML patients by multiplex allele-specific PCR and sequencing at diagnosis. Mutations were re-investigated upon manifestation of imatinib resistance using allele-specific PCR and direct sequencing of BCR-ABL kinase domain. RESULTS: Pre-existing BCR-ABL mutations were detected in 32/100 patients and included F311L, M351T, and T315I. After a median follow-up of 30 months (range 8-48, all patients with pre-existing BCR-ABL mutations exhibited imatinib resistance. Of the 68 patients without pre-existing BCR-ABL mutations, 24 developed imatinib resistance; allele-specific PCR and BCR-ABL kinase domain sequencing detected mutations in 22 of these patients. All 32 patients with pre-existing BCR-ABL mutations had the same mutations after manifestation of imatinib-resistance. In imatinib-resistant patients without pre-existing BCR-ABL mutations, we detected F311L, M351T, Y253F, and T315I mutations. All imatinib-resistant patients except T315I and Y253F mutations responded to imatinib dose escalation. CONCLUSION: Pre-existing BCR-ABL mutations can be detected in a substantial number of chronic-phase CML patients by sensitive allele-specific PCR technique using CD34+ cells. These mutations are associated with imatinib resistance if affecting drug binding directly or indirectly. After the recent approval of nilotinib, dasatinib, bosutinib and ponatinib for treatment of chronic myeloid

  1. Identification of a Non-Gatekeeper Hot Spot for Drug-Resistant Mutations in mTOR Kinase.

    Wu, Tzung-Ju; Wang, Xiaowen; Zhang, Yanjie; Meng, Linghua; Kerrigan, John E; Burley, Stephen K; Zheng, X F Steven

    2015-04-21

    Protein kinases are therapeutic targets for human cancer. However, "gatekeeper" mutations in tyrosine kinases cause acquired clinical resistance, limiting long-term treatment benefits. mTOR is a key cancer driver and drug target. Numerous small-molecule mTOR kinase inhibitors have been developed, with some already in human clinical trials. Given our clinical experience with targeted therapeutics, acquired drug resistance in mTOR is thought likely, but not yet documented. Herein, we describe identification of a hot spot (L2185) for drug-resistant mutations, which is distinct from the gatekeeper site, and a chemical scaffold refractory to drug-resistant mutations. We also provide new insights into mTOR kinase structure and function. The hot spot mutations are potentially useful as surrogate biomarkers for acquired drug resistance in ongoing clinical trials and future treatments and for the design of the next generation of mTOR-targeted drugs. Our study provides a foundation for further research into mTOR kinase function and targeting. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. The tyrosine kinase receptor Tyro3 enhances lifespan and neuropeptide Y (Npy neuron survival in the mouse anorexia (anx mutation

    Dennis Y. Kim

    2017-05-01

    Full Text Available Severe appetite and weight loss define the eating disorder anorexia nervosa, and can also accompany the progression of some neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS. Although acute loss of hypothalamic neurons that produce appetite-stimulating neuropeptide Y (Npy and agouti-related peptide (Agrp in adult mice or in mice homozygous for the anorexia (anx mutation causes aphagia, our understanding of the factors that help maintain appetite regulatory circuitry is limited. Here we identify a mutation (C19T that converts an arginine to a tryptophan (R7W in the TYRO3 protein tyrosine kinase 3 (Tyro3 gene, which resides within the anx critical interval, as contributing to the severity of anx phenotypes. Our observation that, like Tyro3−/− mice, anx/anx mice exhibit abnormal secondary platelet aggregation suggested that the C19T Tyro3 variant might have functional consequences. Tyro3 is expressed in the hypothalamus and other brain regions affected by the anx mutation, and its mRNA localization appeared abnormal in anx/anx brains by postnatal day 19 (P19. The presence of wild-type Tyro3 transgenes, but not an R7W-Tyro3 transgene, doubled the weight and lifespans of anx/anx mice and near-normal numbers of hypothalamic Npy-expressing neurons were present in Tyro3-transgenic anx/anx mice at P19. Although no differences in R7W-Tyro3 signal sequence function or protein localization were discernible in vitro, distribution of R7W-Tyro3 protein differed from that of Tyro3 protein in the cerebellum of transgenic wild-type mice. Thus, R7W-Tyro3 protein localization deficits are only detectable in vivo. Further analyses revealed that the C19T Tyro3 mutation is present in a few other mouse strains, and hence is not the causative anx mutation, but rather an anx modifier. Our work shows that Tyro3 has prosurvival roles in the appetite regulatory circuitry and could also provide useful insights towards the development of interventions

  3. Mini Screening of Kinase Inhibitors Affecting Period-length of Mammalian Cellular Circadian Clock

    Yagita, Kazuhiro; Yamanaka, Iori; Koinuma, Satoshi; Shigeyoshi, Yasufumi; Uchiyama, Yasuo

    2009-01-01

    In mammalian circadian rhythms, the transcriptional-translational feedback loop (TTFL) consisting of a set of clock genes is believed to elicit the circadian clock oscillation. The TTFL model explains that the accumulation and degradation of mPER and mCRY proteins control the period-length (tau) of the circadian clock. Although recent studies revealed that the Casein Kinase Iεδ (CKIεδ) regurates the phosphorylation of mPER proteins and the circadian period-length, other kinases are also likely to contribute the phosphorylation of mPER. Here, we performed small scale screening using 84 chemical compounds known as kinase inhibitors to identify candidates possibly affecting the circadian period-length in mammalian cells. Screening by this high-throughput real-time bioluminescence monitoring system revealed that the several chemical compounds apparently lengthened the cellular circadian clock oscillation. These compounds are known as inhibitors against kinases such as Casein Kinase II (CKII), PI3-kinase (PI3K) and c-Jun N-terminal Kinase (JNK) in addition to CKIεδ. Although these kinase inhibitors may have some non-specific effects on other factors, our mini screening identified new candidates contributing to period-length control in mammalian cells

  4. Autosomal mutations affecting Y chromosome loops in Drosophila melanogaster

    Petrucci Romano

    2008-04-01

    Full Text Available Abstract Background The Y chromosome of Drosophila melanogaster harbors several genes required for male fertility. The genes for these fertility factors are very large in size and contain conspicuous amounts of repetitive DNA and transposons. Three of these loci (ks-1, kl-3 and kl-5 have the ability to develop giant lampbrush-like loops in primary spermatocytes, a cytological manifestation of their active state in these cells. Y-loops bind a number of non-Y encoded proteins, but the mechanisms regulating their development and their specific functions are still to be elucidated. Results Here we report the results of a screen of 726 male sterile lines to identify novel autosomal genes controlling Y-loop function. We analyzed mutant testis preparations both in vivo and by immunofluorescence using antibodies directed against Y-loop-associated proteins. This screen enabled us to isolate 17 mutations at 15 loci whose wild-type function is required for proper Y-loop morphogenesis. Six of these loci are likely to specifically control loop development, while the others display pleiotropic effects on both loops and meiotic processes such as spermiogenesis, sperm development and maturation. We also determined the map position of the mutations affecting exclusively Y-loop morphology. Conclusion Our cytological screening permitted us to identify novel genetic functions required for male spermatogenesis, some of which show pleiotropic effects. Analysis of these mutations also shows that loop development can be uncoupled from meiosis progression. These data represent a useful framework for the characterization of Y-loop development at a molecular level and for the study of the genetic control of heterochromatin.

  5. Adrenal incidentaloma and the Janus Kinase 2 V617F mutation: A case-based review of the literature

    Mustafa Unubol

    2013-01-01

    Full Text Available Adrenal incidentaloma was detected in an 81-year-old male patient and a 37-year-old female patient who had been diagnosed with essential thrombocytosis. Each patient′s Janus Kinase 2 (JAK2 V617F mutation was positive, and they were evaluated as having non-functional adrenal incidentaloma. The JAK2 activates the signal transducers and activators of transcription (STAT proteins which then activate the phosphoinositol-3 kinases, Ras, mitogen-activated protein (MAP kinases, and transcription. Constitutive activation causes cell proliferation and dysregulation of apoptosis. It is thought that STAT3 activation-mediated JAK family kinases have a central role in the solid tumor cell series. Permanent activation of STAT3 and STAT5 causes tumor cell proliferation, survival, metastasis, and an increase in tumor-mediated inflammation in solid and hematologic tumors. According to our literature screening, irregular JAK signaling, seen at the pathogenesis of many solid and hematologic tumors, has not been previously evaluated with regard to adrenal tumors. As a result, our cases are the first coexistence of JAK V617F mutation with adrenal incidentaloma in the literature. Because of this, we think that JAK2 mutation must be evaluated to clarify the etiology of adrenal incidentalomas.

  6. Molecular and clinical characterization of the myopathic form of mitochondrial DNA depletion syndrome caused by mutations in the thymidine kinase (TK2) gene.

    Chanprasert, Sirisak; Wang, Jing; Weng, Shao-Wen; Enns, Gregory M; Boué, Daniel R; Wong, Brenda L; Mendell, Jerry R; Perry, Deborah A; Sahenk, Zarife; Craigen, William J; Alcala, Francisco J Climent; Pascual, Juan M; Melancon, Serge; Zhang, Victor Wei; Scaglia, Fernando; Wong, Lee-Jun C

    2013-01-01

    Mitochondrial DNA (mtDNA) depletion syndromes (MDSs) are a clinically and molecularly heterogeneous group of mitochondrial cytopathies characterized by severe mtDNA copy number reduction in affected tissues. Clinically, MDSs are mainly categorized as myopathic, encephalomyopathic, hepatocerebral, or multi-systemic forms. To date, the myopathic form of MDS is mainly caused by mutations in the TK2 gene, which encodes thymidine kinase 2, the first and rate limiting step enzyme in the phosphorylation of pyrimidine nucleosides. We analyzed 9 unrelated families with 11 affected subjects exhibiting the myopathic form of MDS, by sequencing the TK2 gene. Twelve mutations including 4 novel mutations were detected in 9 families. Skeletal muscle specimens were available from 7 out of 11 subjects. Respiratory chain enzymatic activities in skeletal muscle were measured in 6 subjects, and enzymatic activities were reduced in 3 subjects. Quantitative analysis of mtDNA content in skeletal muscle was performed in 5 subjects, and marked mtDNA content reduction was observed in each. In addition, we outline the molecular and clinical characteristics of this syndrome in a total of 52 patients including those previously reported, and a total of 36 TK2 mutations are summarized. Clinically, hypotonia and proximal muscle weakness are the major phenotypes present in all subjects. In summary, our study expands the molecular and clinical spectrum associated with TK2 deficiency. © 2013.

  7. CBL is frequently altered in lung cancers: its relationship to mutations in MET and EGFR tyrosine kinases.

    Yi-Hung Carol Tan

    2010-01-01

    Full Text Available Non-small cell lung cancer (NSCLC is a heterogeneous group of disorders with a number of genetic and proteomic alterations. c-CBL is an E3 ubiquitin ligase and adaptor molecule important in normal homeostasis and cancer. We determined the genetic variations of c-CBL, relationship to receptor tyrosine kinases (EGFR and MET, and functionality in NSCLC.Using archival formalin-fixed paraffin embedded (FFPE extracted genomic DNA, we show that c-CBL mutations occur in somatic fashion for lung cancers. c-CBL mutations were not mutually exclusive of MET or EGFR mutations; however they were independent of p53 and KRAS mutations. In normal/tumor pairwise analysis, there was significant loss of heterozygosity (LOH for the c-CBL locus (22%, n = 8/37 and none of these samples revealed any mutation in the remaining copy of c-CBL. The c-CBL LOH also positively correlated with EGFR and MET mutations observed in the same samples. Using select c-CBL somatic mutations such as S80N/H94Y, Q249E and W802* (obtained from Caucasian, Taiwanese and African-American samples, respectively transfected in NSCLC cell lines, there was increased cell viability and cell motility.Taking the overall mutation rate of c-CBL to be a combination as somatic missense mutation and LOH, it is clear that c-CBL is highly mutated in lung cancers and may play an essential role in lung tumorigenesis and metastasis.

  8. Phosphorylation of the Yeast Choline Kinase by Protein Kinase C

    Choi, Mal-Gi; Kurnov, Vladlen; Kersting, Michael C.; Sreenivas, Avula; Carman, George M.

    2005-01-01

    The Saccharomyces cerevisiae CKI1-encoded choline kinase catalyzes the committed step in phosphatidylcholine synthesis via the Kennedy pathway. The enzyme is phosphorylated on multiple serine residues, and some of this phosphorylation is mediated by protein kinase A. In this work, we examined the hypothesis that choline kinase is also phosphorylated by protein kinase C. Using choline kinase as a substrate, protein kinase C activity was dose- and time-dependent, and dependent on the concentrations of choline kinase (Km = 27 μg/ml) and ATP (Km = 15 μM). This phosphorylation, which occurred on a serine residue, was accompanied by a 1.6-fold stimulation of choline kinase activity. The synthetic peptide SRSSS25QRRHS (Vmax/Km = 17.5 mM-1 μmol min-1 mg-1) that contains the protein kinase C motif for Ser25 was a substrate for protein kinase C. A Ser25 to Ala (S25A) mutation in choline kinase resulted in a 60% decrease in protein kinase C phosphorylation of the enzyme. Phosphopeptide mapping analysis of the S25A mutant enzyme confirmed that Ser25 was a protein kinase C target site. In vivo, the S25A mutation correlated with a decrease (55%) in phosphatidylcholine synthesis via the Kennedy pathway whereas an S25D phosphorylation site mimic correlated with an increase (44%) in phosphatidylcholine synthesis. Whereas the S25A (protein kinase C site) mutation did not affect the phosphorylation of choline kinase by protein kinase A, the S30A (protein kinase A site) mutation caused a 46% reduction in enzyme phosphorylation by protein kinase C. A choline kinase synthetic peptide (SQRRHS30LTRQ) containing Ser30 was a substrate (Vmax/Km = 3.0 mM−1 μmol min−1 mg−1) for protein kinase C. Comparison of phosphopeptide maps of the wild type and S30A mutant choline kinase enzymes phosphorylated by protein kinase C confirmed that Ser30 was also a target site for protein kinase C. PMID:15919656

  9. Two novel mutations in thymidine kinase-2 cause early onset fatal encephalomyopathy and severe mtDNA depletion.

    Lesko, Nicole; Naess, Karin; Wibom, Rolf; Solaroli, Nicola; Nennesmo, Inger; von Döbeln, Ulrika; Karlsson, Anna; Larsson, Nils-Göran

    2010-03-01

    Deficiency of thymidine kinase-2 (TK2) has been described in children with early onset fatal skeletal myopathy. TK2 is a mitochondrial deoxyribonucleoside kinase required for the phosphorylation of deoxycytidine and deoxythymidine and hence is vital for the maintenance of a balanced mitochondrial dNTP pool in post-mitotic tissues. We describe a patient with two novel TK2 mutations, which caused disease onset shortly after birth and death at the age of three months. One mutation (219insCG) generated an early stop codon, thus preventing the synthesis of a functional protein. The second mutation (R130W) resulted in an amino acid substitution, which caused a severe reduction (TK2 enzyme activity. These two novel TK2 mutations cause an extremely severe phenotype with overwhelming central nervous system symptoms not commonly seen in patients with TK2-deficiency. We conclude that the severe clinical presentation in this patient was due to a virtual lack of mitochondrial TK2 activity. Copyright 2009 Elsevier B.V. All rights reserved.

  10. The frequencies and clinical implications of mutations in 33 kinase-related genes in locally advanced rectal cancer: a pilot study.

    Abdul-Jalil, Khairun I

    2014-08-01

    Locally advanced rectal cancer (LARC: T3\\/4 and\\/or node-positive) is treated with preoperative\\/neoadjuvant chemoradiotherapy (CRT), but responses are not uniform. The phosphatidylinositol 3-kinase (PI3K), MAP kinase (MAPK), and related pathways are implicated in rectal cancer tumorigenesis. Here, we investigated the association between genetic mutations in these pathways and LARC clinical outcomes.

  11. Parkinson-Related LRRK2 Mutation R1628P Enables Cdk5 Phosphorylation of LRRK2 and Upregulates Its Kinase Activity.

    Yang Shu

    Full Text Available Recent studies have linked certain single nucleotide polymorphisms in the leucine-rich repeat kinase 2 (LRRK2 gene with Parkinson's disease (PD. Among the mutations, LRRK2 c.4883G>C (R1628P variant was identified to have a significant association with the risk of PD in ethnic Han-Chinese populations. But the molecular pathological mechanisms of R1628P mutation in PD is still unknown.Unlike other LRRK2 mutants in the Roc-COR-Kinase domain, the R1628P mutation didn't alter the LRRK2 kinase activity and promote neuronal death directly. LRRK2 R1628P mutation increased the binding affinity of LRRK2 with Cyclin-dependent kinase 5 (Cdk5. Interestingly, R1628P mutation turned its adjacent amino acid residue S1627 on LRRK2 protein to a novel phosphorylation site of Cdk5, which could be defined as a typical type II (+ phosphorylation-related single nucleotide polymorphism. Importantly, we showed that the phosphorylation of S1627 by Cdk5 could activate the LRRK2 kinase, and neurons ectopically expressing R1628P displayed a higher sensitivity to 1-methyl-4-phenylpyridinium, a bioactive metabolite of environmental toxin MPTP, in a Cdk5-dependent manner.Our data indicate that Parkinson-related LRRK2 mutation R1628P leads to Cdk5 phosphorylation of LRRK2 at S1627, which would upregulate the kinase activity of LRRK2 and consequently cause neuronal death.

  12. Mutations induced by ultraviolet radiation affecting virulence in Puccinia striiformis

    Shang Hongsheng; Jing Jinxue; Li Zhenqi

    1994-01-01

    Uredospores of parent culture, cy 29-1, were treated by ultraviolet radiation and mutations to virulent were tested on resistant wheat cultivars inoculated with treated spores. 7 mutant cultures virulent to the test cultivars were developed with estimated mutation rate 10~6~10~4. The virulence of mutant cultures was different from the all known races of stripe rust. Resistance segregation to mutant cultures was detected in two test cultivars. The results suggested that mutation was important mechanism of virulence variation operative in asexual population of rust fungi

  13. ADCK3, an ancestral kinase, is mutated in a form of recessive ataxia associated with coenzyme Q10 deficiency.

    Lagier-Tourenne, Clotilde; Tazir, Meriem; López, Luis Carlos; Quinzii, Catarina M; Assoum, Mirna; Drouot, Nathalie; Busso, Cleverson; Makri, Samira; Ali-Pacha, Lamia; Benhassine, Traki; Anheim, Mathieu; Lynch, David R; Thibault, Christelle; Plewniak, Frédéric; Bianchetti, Laurent; Tranchant, Christine; Poch, Olivier; DiMauro, Salvatore; Mandel, Jean-Louis; Barros, Mario H; Hirano, Michio; Koenig, Michel

    2008-03-01

    Muscle coenzyme Q(10) (CoQ(10) or ubiquinone) deficiency has been identified in more than 20 patients with presumed autosomal-recessive ataxia. However, mutations in genes required for CoQ(10) biosynthetic pathway have been identified only in patients with infantile-onset multisystemic diseases or isolated nephropathy. Our SNP-based genome-wide scan in a large consanguineous family revealed a locus for autosomal-recessive ataxia at chromosome 1q41. The causative mutation is a homozygous splice-site mutation in the aarF-domain-containing kinase 3 gene (ADCK3). Five additional mutations in ADCK3 were found in three patients with sporadic ataxia, including one known to have CoQ(10) deficiency in muscle. All of the patients have childhood-onset cerebellar ataxia with slow progression, and three of six have mildly elevated lactate levels. ADCK3 is a mitochondrial protein homologous to the yeast COQ8 and the bacterial UbiB proteins, which are required for CoQ biosynthesis. Three out of four patients tested showed a low endogenous pool of CoQ(10) in their fibroblasts or lymphoblasts, and two out of three patients showed impaired ubiquinone synthesis, strongly suggesting that ADCK3 is also involved in CoQ(10) biosynthesis. The deleterious nature of the three identified missense changes was confirmed by the introduction of them at the corresponding positions of the yeast COQ8 gene. Finally, a phylogenetic analysis shows that ADCK3 belongs to the family of atypical kinases, which includes phosphoinositide and choline kinases, suggesting that ADCK3 plays an indirect regulatory role in ubiquinone biosynthesis possibly as part of a feedback loop that regulates ATP production.

  14. Patients harboring EGFR mutation after primary resistance to crizotinib and response to EGFR-tyrosine kinase inhibitor

    Wang WX

    2016-01-01

    Full Text Available Wenxian Wang,1 Xiaowen Jiang,1 Zhengbo Song,1,2 Yiping Zhang1,2 1Department of Chemotherapy, Zhejiang Cancer Hospital, 2Key Laboratory Diagnosis and Treatment Technology on Thoracic Oncology, Hangzhou, Zhejiang, People’s Republic of China Abstract: Anaplastic lymphoma kinase (ALK rearrangement lung cancer responds to ALK tyrosine kinase inhibitors. It is known that many cases ultimately acquired resistance to crizotinib. However, a case of primary resistance is rare. We present a case of harboring exon 19 deletion in epidermal growth factor receptor in ALK rearranged lung adenocarcinoma, who experienced a partial tumor response to icotinib after failure with crizotinib therapy and chemotherapy. Considering the partial response, we conclude that it is important to find the cause of resistance to crizotinib. We detected gene mutations with plasma by the next-generation sequencing; the next-generation sequencing demonstrates an attractive system to identify mutations improving the outcome of patients with a deadly disease. Keywords: non-small cell lung cancer, anaplastic lymphoma kinase, crizotinib, epidermal growth factor receptor

  15. Frequency of janus associated kinase 2 (jak2) mutation in patients of bcr-abl negative myeloproliferative neoplasms

    Sadiq, M.A.; Ahmed, S.; Ali, N.

    2013-01-01

    To determine the frequency of Janus associated kinase 2 mutation in the patients of BCR-ABL negative classical myeloproliferative neoplasms. Study Design: Cross-sectional descriptive study Place and Duration of Study: Molecular Department of Haematology, Armed Forces Institute of Pathology (AFIP), Rawalpindi from Jul 2011 to Jul 2012. Patients and Methods: Ninety three consecutive patients of Polycythaemia vera (PV), Essential thrombocythaemia (ET) and Idiopathic myelofibrosis (IMF) diagnosed by the conventional haematological criteria were included in the study. All patients were screened for G-T point mutation (V617F) in the JAK2 gene on chromosome 9 by an allele specific PCR. Results: Out of the 93 myeloproliferative neoplasm (MPN) patients, 33(35%) had polycythaemia vera, 36(39%) had essential thrombocythaemia and 24(26%) had idiopathic myelofibrosis. JAK2 mutation was seen in 64/93 (69%) patients including 33/33(100%) in PV, 19/36(52.6%) in ET and 12/24(50%) in IMF. Conclusion: Classical myeloproliferative neoplasms are an important group of heamatological disorder in our country. JAK2 gene mutation is seen in significant proportion of these disorders (69%). JAK2 mutation analysis can be used to differentiate between polycythemia vera and secondary polycythemia in most cases with near certainty, where it was found in 100% of the cases. (author)

  16. Factors affecting the spontaneous mutational spectra in somatic mammalian cells

    О.А. Ковальова

    2006-04-01

    Full Text Available  In our survey of references we are discussed the influence of factors biological origin on the spontaneous mutation specters in mammalian. Seasonal and age components influence on the frequence of cytogenetic anomalies. The immune and endocrinous systems are take part in control of the alteration of the spontaneous mutation specters. Genetical difference of sensibility in animal and human at the alteration of factors enviroment as and  genetical differences of repair systems activity are may influence on individual variation of spontaneous destabilization characters of chromosomal apparatus.

  17. Mutation analysis of 272 Spanish families affected by autosomal recessive retinitis pigmentosa using a genotyping microarray.

    Ávila-Fernández, Almudena; Cantalapiedra, Diego; Aller, Elena; Vallespín, Elena; Aguirre-Lambán, Jana; Blanco-Kelly, Fiona; Corton, M; Riveiro-Álvarez, Rosa; Allikmets, Rando; Trujillo-Tiebas, María José; Millán, José M; Cremers, Frans P M; Ayuso, Carmen

    2010-12-03

    Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by progressive loss of vision. The aim of this study was to identify the causative mutations in 272 Spanish families using a genotyping microarray. 272 unrelated Spanish families, 107 with autosomal recessive RP (arRP) and 165 with sporadic RP (sRP), were studied using the APEX genotyping microarray. The families were also classified by clinical criteria: 86 juveniles and 186 typical RP families. Haplotype and sequence analysis were performed to identify the second mutated allele. At least one-gene variant was found in 14% and 16% of the juvenile and typical RP groups respectively. Further study identified four new mutations, providing both causative changes in 11% of the families. Retinol Dehydrogenase 12 (RDH12) was the most frequently mutated gene in the juvenile RP group, and Usher Syndrome 2A (USH2A) and Ceramide Kinase-Like (CERKL) were the most frequently mutated genes in the typical RP group. The only variant found in CERKL was p.Arg257Stop, the most frequent mutation. The genotyping microarray combined with segregation and sequence analysis allowed us to identify the causative mutations in 11% of the families. Due to the low number of characterized families, this approach should be used in tandem with other techniques.

  18. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  19. Identification of a nuclear localization signal in the retinitis pigmentosa-mutated RP26 protein, ceramide kinase-like protein

    Inagaki, Yuichi; Mitsutake, Susumu; Igarashi, Yasuyuki

    2006-01-01

    Retinitis pigmentosa (RP) is a genetically heterogeneous disease characterized by degeneration of the retina. A mutation in a new ceramide kinase (CERK) homologous gene, named CERK-like protein (CERKL), was found to cause autosomal recessive retinitis pigmentosa (RP26). Here, we show a point mutation of one of two putative nuclear localization signal (NLS) sequences inhibited the nuclear localization of the protein. Furthermore, the tetra-GFP-tagged NLS, which cannot passively enter the nucleus, was observed not only in the nucleus but also in the nucleolus. Our results provide First evidence of the active nuclear import of CERKL and suggest that the identified NLS might be responsible for nucleolar retention of the protein. As recent studies have shown other RP-related proteins are localized in the nucleus or the nucleolus, our identification of NLS in CERKL suggests that CERKL likely plays important roles for retinal functions in the nucleus and the nucleolus

  20. Deep mutational scanning identifies sites in influenza nucleoprotein that affect viral inhibition by MxA.

    Orr Ashenberg

    2017-03-01

    Full Text Available The innate-immune restriction factor MxA inhibits influenza replication by targeting the viral nucleoprotein (NP. Human influenza virus is more resistant than avian influenza virus to inhibition by human MxA, and prior work has compared human and avian viral strains to identify amino-acid differences in NP that affect sensitivity to MxA. However, this strategy is limited to identifying sites in NP where mutations that affect MxA sensitivity have fixed during the small number of documented zoonotic transmissions of influenza to humans. Here we use an unbiased deep mutational scanning approach to quantify how all single amino-acid mutations to NP affect MxA sensitivity in the context of replication-competent virus. We both identify new sites in NP where mutations affect MxA resistance and re-identify mutations known to have increased MxA resistance during historical adaptations of influenza to humans. Most of the sites where mutations have the greatest effect are almost completely conserved across all influenza A viruses, and the amino acids at these sites confer relatively high resistance to MxA. These sites cluster in regions of NP that appear to be important for its recognition by MxA. Overall, our work systematically identifies the sites in influenza nucleoprotein where mutations affect sensitivity to MxA. We also demonstrate a powerful new strategy for identifying regions of viral proteins that affect inhibition by host factors.

  1. Lamin A/C mutation affecting primarily the right side of the heart

    Laura Ollila

    2013-04-01

    Full Text Available LMNA mutations are amongst the most important causes of familial dilated cardiomyopathy. The most important cause of arrhythmogenic right ventricular cardiomyopathy (ARVC is desmosomal pathology. The aim of the study was to elucidate the role of LMNA mutations among Finnish cardiomyopathy patients. We screened 135 unrelated cardiomyopathy patients for LMNA mutations. Because of unusual phenotype, two patients were screened for the known Finnish ARVC-related mutations of desmosomal genes, and their Plakophilin-2b gene was sequenced. Myocardial samples from two patients were examined by immunohistochemical plakoglobin staining and in one case by electron microscopy. We found a new LMNA mutation Phe237Ser in a family of five affected members with a cardiomyopathy affecting primarily the right side of the heart. The phenotype resembles ARVC but does not fulfill the Task Force Criteria. The main clinical manifestations of the mutation were severe tricuspid insufficiency, right ventricular enlargement and failure. Three of the affected patients died of the heart disease, and the two living patients received heart transplants at ages 44 and 47. Electron microscopy showed nuclear blebbing compatible with laminopathy. Immunohisto - chemical analysis did not suggest desmosomal pathology. No desmosomal mutations were found. The Phe237Ser LMNA mutation causes a phenotype different from traditional cardiolaminopathy. Our findings suggest that cardiomyopathy affecting primarily the right side of the heart is not always caused by desmosomal pathology. Our observations highlight the challenges in classifying cardiomyopathies, as there often is significant overlap between the traditional categories.

  2. Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.

    Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques

    2013-09-01

    Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.

  3. Mitogen-activated protein kinase kinase 1/2 inhibition and angiotensin II converting inhibition in mice with cardiomyopathy caused by lamin A/C gene mutation

    Muchir, Antoine; Wu, Wei; Sera, Fusako; Homma, Shunichi; Worman, Howard J.

    2014-01-01

    Highlights: • Both ACE and MEK1/2 inhibition are beneficial on cardiac function in Lmna cardiomyopathy. • MEK1/2 inhibitor has beneficial effects beyond ACE inhibition for Lmna cardiomyopathy. • These results provide further preclinical rationale for a clinical trial of a MEK1/2 inhibitor. - Abstract: Background: Mutations in the LMNA gene encoding A-type nuclear lamins can cause dilated cardiomyopathy with or without skeletal muscular dystrophy. Previous studies have shown abnormally increased extracellular signal-regulated kinase 1/2 activity in hearts of Lmna H222P/H222P mice, a small animal model. Inhibition of this abnormal signaling activity with a mitogen-activated protein kinase kinase 1/2 (MEK1/2) inhibitor has beneficial effects on heart function and survival in these mice. However, such treatment has not been examined relative to any standard of care intervention for dilated cardiomyopathy or heart failure. We therefore examined the effects of an angiotensin II converting enzyme (ACE) inhibitor on left ventricular function in Lmna H222P/H222P mice and assessed if adding a MEK1/2 inhibitor would provide added benefit. Methods: Male Lmna H222P/H222P mice were treated with the ACE inhibitor benazepril, the MEK1/2 inhibitor selumetinib or both. Transthoracic echocardiography was used to measure left ventricular diameters and fractional shortening was calculated. Results: Treatment of Lmna H222P/H222P mice with either benazepril or selumetinib started at 8 weeks of age, before the onset of detectable left ventricular dysfunction, lead to statistically significantly increased fractional shortening compared to placebo at 16 weeks of age. There was a trend towards a great value for fractional shortening in the selumetinib-treated mice. When treatment was started at 16 weeks of age, after the onset of left ventricular dysfunction, the addition of selumetinib treatment to benazepril lead to a statistically significant increase in left ventricular fractional

  4. Mitogen-activated protein kinase kinase 1/2 inhibition and angiotensin II converting inhibition in mice with cardiomyopathy caused by lamin A/C gene mutation

    Muchir, Antoine, E-mail: a.muchir@institut-myologie.org [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Wu, Wei [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Sera, Fusako; Homma, Shunichi [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Worman, Howard J., E-mail: hjw14@columbia.edu [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY (United States)

    2014-10-03

    Highlights: • Both ACE and MEK1/2 inhibition are beneficial on cardiac function in Lmna cardiomyopathy. • MEK1/2 inhibitor has beneficial effects beyond ACE inhibition for Lmna cardiomyopathy. • These results provide further preclinical rationale for a clinical trial of a MEK1/2 inhibitor. - Abstract: Background: Mutations in the LMNA gene encoding A-type nuclear lamins can cause dilated cardiomyopathy with or without skeletal muscular dystrophy. Previous studies have shown abnormally increased extracellular signal-regulated kinase 1/2 activity in hearts of Lmna{sup H222P/H222P} mice, a small animal model. Inhibition of this abnormal signaling activity with a mitogen-activated protein kinase kinase 1/2 (MEK1/2) inhibitor has beneficial effects on heart function and survival in these mice. However, such treatment has not been examined relative to any standard of care intervention for dilated cardiomyopathy or heart failure. We therefore examined the effects of an angiotensin II converting enzyme (ACE) inhibitor on left ventricular function in Lmna{sup H222P/H222P} mice and assessed if adding a MEK1/2 inhibitor would provide added benefit. Methods: Male Lmna{sup H222P/H222P} mice were treated with the ACE inhibitor benazepril, the MEK1/2 inhibitor selumetinib or both. Transthoracic echocardiography was used to measure left ventricular diameters and fractional shortening was calculated. Results: Treatment of Lmna{sup H222P/H222P} mice with either benazepril or selumetinib started at 8 weeks of age, before the onset of detectable left ventricular dysfunction, lead to statistically significantly increased fractional shortening compared to placebo at 16 weeks of age. There was a trend towards a great value for fractional shortening in the selumetinib-treated mice. When treatment was started at 16 weeks of age, after the onset of left ventricular dysfunction, the addition of selumetinib treatment to benazepril lead to a statistically significant increase in left

  5. Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

    Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

    2015-11-01

    Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. The novel RAF1 mutation p.(Gly361Ala) located outside the kinase domain of the CR3 region in two patients with Noonan syndrome, including one with a rare brain tumor.

    Harms, Frederike L; Alawi, Malik; Amor, David J; Tan, Tiong Y; Cuturilo, Goran; Lissewski, Christina; Brinkmann, Julia; Schanze, Denny; Kutsche, Kerstin; Zenker, Martin

    2018-02-01

    Noonan syndrome is characterized by typical craniofacial dysmorphism, postnatal growth retardation, congenital heart defect, and learning difficulties and belongs to the RASopathies, a group of neurodevelopmental disorders caused by germline mutations in genes encoding components of the RAS-MAPK pathway. Mutations in the RAF1 gene are associated with Noonan syndrome, with a high prevalence of hypertrophic cardiomyopathy (HCM). RAF1 mutations cluster in exons encoding the conserved region 2 (CR2), the kinase activation segment of the CR3 domain, and the C-terminus. We present two boys with Noonan syndrome and the identical de novo RAF1 missense variant c.1082G>C/p.(Gly361Ala) affecting the CR3, but located outside the kinase activation segment. The p.(Gly361Ala) mutation has been identified as a RAF1 allele conferring resistance to RAF inhibitors. This amino acid change favors a RAF1 conformation that allows for enhanced RAF dimerization and increased intrinsic kinase activity. Both patients with Noonan syndrome showed typical craniofacial dysmorphism, macrocephaly, and short stature. One individual developed HCM and was diagnosed with a disseminated oligodendroglial-like leptomeningeal tumor (DOLT) of childhood at the age of 9 years. While there is a well-established association of NS with malignant tumors, especially childhood hemato-oncological diseases, brain tumors have rarely been reported in Noonan syndrome. Our data demonstrate that mutation scanning of the entire coding region of genes associated with Noonan syndrome is mandatory not to miss rare variants located outside the known mutational hotspots. © 2017 Wiley Periodicals, Inc.

  7. Increased Ac excision (iae): Arabidopsis thaliana mutations affecting Ac transposition

    Jarvis, P.; Belzile, F.; Page, T.; Dean, C.

    1997-01-01

    The maize transposable element Ac is highly active in the heterologous hosts tobacco and tomato, but shows very much reduced levels of activity in Arabidopsis. A mutagenesis experiment was undertaken with the aim of identifying Arabidopsis host factors responsible for the observed low levels of Ac activity. Seed from a line carrying a single copy of the Ac element inserted into the streptomycin phosphotransferase (SPT) reporter fusion, and which displayed typically low levels of Ac activity, were mutagenized using gamma rays. Nineteen mutants displaying high levels of somatic Ac activity, as judged by their highly variegated phenotypes, were isolated after screening the M2 generation on streptomycin-containing medium. The mutations fall into two complementation groups, iae1 and iae2, are unlinked to the SPT::Ac locus and segregate in a Mendelian fashion. The iae1 mutation is recessive and the iae2 mutation is semi-dominant. The iae1 and iae2 mutants show 550- and 70-fold increases, respectively, in the average number of Ac excision sectors per cotyledon. The IAE1 locus maps to chromosome 2, whereas the SPT::Ac reporter maps to chromosome 3. A molecular study of Ac activity in the iae1 mutant confirmed the very high levels of Ac excision predicted using the phenotypic assay, but revealed only low levels of Ac re-insertion. Analyses of germinal transposition in the iae1 mutant demonstrated an average germinal excision frequency of 3% and a frequency of independent Ac re-insertions following germinal excision of 22%. The iae mutants represents a possible means of improving the efficiency of Ac/Ds transposon tagging systems in Arabidopsis, and will enable the dissection of host involvement in Ac transposition and the mechanisms employed for controlling transposable element activity

  8. An Immunohistochemical Study of Anaplastic Lymphoma Kinase and Epidermal Growth Factor Receptor Mutation in Non-Small Cell Lung Carcinoma.

    Verma, Sonal; Kumar, Madhu; Kumari, Malti; Mehrotra, Raj; Kushwaha, R A S; Goel, Madhumati; Kumar, Ashutosh; Kant, Surya

    2017-07-01

    Lung cancer is one of the leading causes of cancer related death. Targeted treatment for specific markers may help in reducing the cancer related morbidity and mortality. To study expression of Anaplastic Lymphoma Kinase (ALK)and Epidermal Growth Factor Receptor (EGFR) mutations in patients of Non-Small Cell Lung Cancer NSCLC, that are the targets for specific ALK inhibitors and EGFR tyrosine kinase inhibitors. Total 69 cases of histologically diagnosed NSCLC were examined retrospectively for immunohistochemical expression of EGFR and ALK, along with positive control of normal placental tissue and anaplastic large cell lymphoma respectively. Of the NSCLC, Squamous Cell Carcinoma (SCC) accounted for 71.0% and adenocarcinoma was 26.1%. ALK expression was seen in single case of 60-year-old female, non-smoker with adenocarcinoma histology. EGFR expression was seen in both SCC (59.18%) and adenocarcinoma in (77.78%) accounting for 63.77% of all cases. Both ALK and EGFR mutation were mutually exclusive. EGFR expression was seen in 63.77% of cases, highlighting the importance of its use in routine analysis, for targeted therapy and better treatment results. Although, ALK expression was seen in 1.45% of all cases, it is an important biomarker in targeted cancer therapy. Also, the mutually exclusive expression of these two markers need further studies to develop a diagnostic algorithm for NSCLC patients.

  9. A kinase-dependent feedforward loop affects CREBB stability and long term memory formation.

    Lee, Pei-Tseng; Lin, Guang; Lin, Wen-Wen; Diao, Fengqiu; White, Benjamin H; Bellen, Hugo J

    2018-02-23

    In Drosophila , long-term memory (LTM) requires the cAMP-dependent transcription factor CREBB, expressed in the mushroom bodies (MB) and phosphorylated by PKA. To identify other kinases required for memory formation, we integrated Trojan exons encoding T2A-GAL4 into genes encoding putative kinases and selected for genes expressed in MB. These lines were screened for learning/memory deficits using UAS-RNAi knockdown based on an olfactory aversive conditioning assay. We identified a novel, conserved kinase, Meng-Po ( MP , CG11221 , SBK1 in human), the loss of which severely affects 3 hr memory and 24 hr LTM, but not learning. Remarkably, memory is lost upon removal of the MP protein in adult MB but restored upon its reintroduction. Overexpression of MP in MB significantly increases LTM in wild-type flies showing that MP is a limiting factor for LTM. We show that PKA phosphorylates MP and that both proteins synergize in a feedforward loop to control CREBB levels and LTM. key words: Drosophila, Mushroom bodies, SBK1, deGradFP, T2A-GAL4, MiMIC.

  10. Mutation of cis-proline 207 in mitochondrial creatine kinase to alanine leads to increased acid stability.

    Forstner, M; Müller, A; Rognan, D; Kriechbaum, M; Wallimann, T

    1998-07-01

    We show that the mutation of an uncharged residue far from the active site to another uncharged residue can have effects on the active site without disturbing the overall structure of the protein. Cis-proline 207 of mitochondrial creatine kinase was mutated to alanine. The mutant showed a decrease in the pH-optimum for ATP synthesis by 1.5 units while the maximum relative activity was lowered to 53% of the wild-type enzyme. In the direction of ATP consumption, the pH optimum was lowered by 1.3 units and the maximum relative activity was 49% of the wild-type enzyme. The enzyme kinetic parameters Km and Kd for the substrates did not change dramatically, indicating a largely unperturbed active site. Small-angle X-ray scattering was used to investigate the structural change concomitant with the mutation, yielding a scattering profile only slightly different from that of the wild-type enzyme. Neither the radius of gyration nor the molecular mass showed any significant differences, leading to the conclusion that quarternary organization and fold of the mutant and the wild-type enzymes were similar. Theoretical analysis suggests the most probable primary source of structural change to be a transition of residue 207 peptide bond torsional angle co from the cis to the trans configuration.

  11. Reconstitution of normal and hyperactivated forms of casein kinase-2 by variably mutated beta-subunits

    Boldyreff, B; Meggio, F; Pinna, L A

    1993-01-01

    Twenty-one mutants of the noncatalytic beta-subunit of human casein kinase-2 have been created, expressed in Escherichia coli, and purified to homogeneity. They are either modified at the autophosphorylation site (mutants beta delta 1-4 and beta A 5,6) or bear variable deletions in their C...

  12. The callipyge mutation and other genes that affect muscle hypertrophy in sheep

    Cockett Noelle E

    2005-12-01

    Full Text Available Abstract Genetic strategies to improve the profitability of sheep operations have generally focused on traits for reproduction. However, natural mutations exist in sheep that affect muscle growth and development, and the exploitation of these mutations in breeding strategies has the potential to significantly improve lamb-meat quality. The best-documented mutation for muscle development in sheep is callipyge (CLPG, which causes a postnatal muscle hypertrophy that is localized to the pelvic limbs and loin. Enhanced skeletal muscle growth is also observed in animals with the Carwell (or rib-eye muscling mutation, and a double-muscling phenotype has been documented for animals of the Texel sheep breed. However, the actual mutations responsible for these muscular hypertrophy phenotypes in sheep have yet to be identified, and further characterization of the genetic basis for these phenotypes will provide insight into the biological control of muscle growth and body composition.

  13. Diaphanous gene mutation affects spiral cleavage and chirality in snails

    Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

    2016-01-01

    L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

  14. Prevalence of Janus kinase 2 mutations in patients with unusual site venous thrombosis

    Ana Lisa Basquiera

    2011-08-01

    Full Text Available We aimed to study patients with splanchnic vein thrombosis (SVT and cerebral vein thrombosis (CVT searching for JAK2 mutations. We evaluated 14 patients (median age: 41.5 years with portal vein thrombosis (PVT = 7; mesenteric vein thrombosis (MVT = 3; and CVT = 4. JAK2 V617F was assessed by allele specific PCR of peripheral blood DNA. In addition, DNA was sequenced for other JAK2 mutations. Other inherited and acquired thrombophilia risk factors were evaluated. JAK2 V617F was positive in four out of seven patients with PVT and in one CVT patient. These five patients had a diagnosis of myeloproliferative disorder (MPD at the moment of the occurrence of thrombosis (n = 2 or later (n = 2. Patients with MVT and CVT were negative for JAK2 V617F, except one patient with CVT and a diagnosis of essential thrombocythemia. No other JAK2 mutations were found in this cohort. Besides MPD, other thrombophilia risk factors were identified in five patients. One patient had MPD as well as thrombophilia risk factor. In this group, 4 out of 7 of the patients with PVT carried the JAK2 V617F mutation with or without overt MPD. However, the investigation of other JAK2 mutations may not be necessary in patients with thrombosis at unusual sites.

  15. HER2 mutated breast cancer responds to treatment with single agent neratinib, a second generation HER2/EGFR tyrosine kinase inhibitor

    Ben–Baruch, Noa Efrat; Bose, Ron; Kavuri, Shyam M.; Ma, Cynthia X.; Ellis, Matthew J.

    2015-01-01

    Activating mutations in the HER2 tyrosine kinase have been identified in human breast cancers that lack HER2 gene amplification. These patients are not candidates for HER2 targeted drugs under current standards of care, but preclinical data strongly suggest that these patients will benefit from anti-HER2 drugs. In this case report, we describe a young woman with metastatic breast cancer whose tumor was found to carry a HER2 L755S mutation, which is in the kinase domain of HER2. Treatment with the second generation HER2/EGFR tyrosine kinase inhibitor, neratinib, resulted in partial response and dramatic improvement in the patient’s function status. This partial response lasted 11 months and when the patient’s cancer progressed, she was treated with neratinib plus capecitabine and her cancer again responded. This second response parallels the benefit seen with continuing trastuzumab in HER2 amplified breast cancer after disease progression. This case is the first report, to our knowledge, of successful single agent treatment of HER2 mutated breast cancer. Two clinical trials of neratinib for HER2 mutated, metastatic breast cancer are currently enrolling patients. Further, data from The Cancer Genome Atlas project have identified HER2 mutations in a wide range of solid tumors, including bladder, colorectal, and non-small cell lung cancer, suggesting that clinical trials of neratinib or neratinib-based combinations for HER2 mutated solid tumors is warranted. PMID:26358790

  16. HER2-Mutated Breast Cancer Responds to Treatment With Single-Agent Neratinib, a Second-Generation HER2/EGFR Tyrosine Kinase Inhibitor.

    Ben-Baruch, Noa Efrat; Bose, Ron; Kavuri, Shyam M; Ma, Cynthia X; Ellis, Matthew J

    2015-09-01

    Activating mutations in the HER2 tyrosine kinase have been identified in human breast cancers that lack HER2 gene amplification. These patients are not candidates for HER2-targeted drugs under current standards of care, but preclinical data strongly suggest that these patients will benefit from anti-HER2 drugs. This case report describes a young woman with metastatic breast cancer whose tumor was found to carry a HER2 L755S mutation, which is in the kinase domain of HER2. Treatment with the second-generation HER2/EGFR tyrosine kinase inhibitor neratinib resulted in partial response and dramatic improvement in the patient's functional status. This partial response lasted 11 months, and when the patient's cancer progressed, she was treated with neratinib plus capecitabine and her cancer again responded. This second response parallels the benefit seen with continuing trastuzumab in HER2-amplified breast cancer after disease progression. This case represents the first report, to our knowledge, of successful single-agent treatment of HER2-mutated breast cancer. Two clinical trials of neratinib for HER2-mutated metastatic breast cancer are currently enrolling patients. Further, data from The Cancer Genome Atlas project have identified HER2 mutations in a wide range of solid tumors, including bladder, colorectal, and non-small cell lung cancers, suggesting that clinical trials of neratinib or neratinib-based combinations for HER2-mutated solid tumors is warranted. Copyright © 2015 by the National Comprehensive Cancer Network.

  17. p110α Hot Spot Mutations E545K and H1047R Exert Metabolic Reprogramming Independently of p110α Kinase Activity.

    Chaudhari, Aditi; Krumlinde, Daniel; Lundqvist, Annika; Akyürek, Levent M; Bandaru, Sashidhar; Skålén, Kristina; Ståhlman, Marcus; Borén, Jan; Wettergren, Yvonne; Ejeskär, Katarina; Rotter Sopasakis, Victoria

    2015-10-01

    The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) catalytic subunit p110α is the most frequently mutated kinase in human cancer, and the hot spot mutations E542K, E545K, and H1047R are the most common mutations in p110α. Very little is known about the metabolic consequences of the hot spot mutations of p110α in vivo. In this study, we used adenoviral gene transfer in mice to investigate the effects of the E545K and H1047R mutations on hepatic and whole-body glucose metabolism. We show that hepatic expression of these hot spot mutations results in rapid hepatic steatosis, paradoxically accompanied by increased glucose tolerance, and marked glycogen accumulation. In contrast, wild-type p110α expression does not lead to hepatic accumulation of lipids or glycogen despite similar degrees of upregulated glycolysis and expression of lipogenic genes. The reprogrammed metabolism of the E545K and H1047R p110α mutants was surprisingly not dependent on altered p110α lipid kinase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Evolution of BCR/ABL gene mutation in CML is time dependent and dependent on the pressure exerted by tyrosine kinase inhibitor.

    Shantashri Vaidya

    Full Text Available BACKGROUND: Mutations in the ABL kinase domain and SH3-SH2 domain of the BCR/ABL gene and amplification of the Philadelphia chromosome are the two important BCR/ABL dependent mechanisms of imatinib resistance. Here, we intended to study the role played by TKI, imatinib, in selection of gene mutations and development of chromosomal abnormalities in Indian CML patients. METHODS: Direct sequencing methodology was employed to detect mutations and conventional cytogenetics was done to identify Philadelphia duplication. RESULTS: Among the different mechanisms of imatinib resistance, kinase domain mutations (39% of the BCR/ABL gene were seen to be more prevalent, followed by mutations in the SH3-SH2 domain (4% and then BCR/ABL amplification with the least frequency (1%. The median duration of occurrence of mutation was significantly shorter for patients with front line imatinib than those pre-treated with hydroxyurea. Patients with high Sokal score (p = 0.003 showed significantly higher incidence of mutations, as compared to patients with low/intermediate score. Impact of mutations on the clinical outcome in AP and BC was observed to be insignificant. Of the 94 imatinib resistant patients, only 1 patient exhibited duplication of Philadelphia chromosome, suggesting a less frequent occurrence of this abnormality in Indian CML patients. CONCLUSION: Close monitoring at regular intervals and proper analysis of the disease resistance would facilitate early detection of resistance and thus aid in the selection of the most appropriate therapy.

  19. Crizotinib-Resistant ROS1 Mutations Reveal a Predictive Kinase Inhibitor Sensitivity Model for ROS1- and ALK-Rearranged Lung Cancers.

    Facchinetti, Francesco; Loriot, Yohann; Kuo, Mei-Shiue; Mahjoubi, Linda; Lacroix, Ludovic; Planchard, David; Besse, Benjamin; Farace, Françoise; Auger, Nathalie; Remon, Jordi; Scoazec, Jean-Yves; André, Fabrice; Soria, Jean-Charles; Friboulet, Luc

    2016-12-15

    The identification of molecular mechanisms conferring resistance to tyrosine kinase inhibitor (TKI) is a key step to improve therapeutic results for patients with oncogene addiction. Several alterations leading to EGFR and anaplastic lymphoma kinase (ALK) resistance to TKI therapy have been described in non-small cell lung cancer (NSCLC). Only two mutations in the ROS1 kinase domain responsible for crizotinib resistance have been described in patients thus far. A patient suffering from a metastatic NSCLC harboring an ezrin (EZR)-ROS1 fusion gene developed acquired resistance to the ALK/ROS1 inhibitor crizotinib. Molecular analysis (whole-exome sequencing, CGH) and functional studies were undertaken to elucidate the mechanism of resistance. Based on this case, we took advantage of the structural homology of ROS1 and ALK to build a predictive model for drug sensitivity regarding future ROS1 mutations. Sequencing revealed a dual mutation, S1986Y and S1986F, in the ROS1 kinase domain. Functional in vitro studies demonstrated that ROS1 harboring either the S1986Y or the S1986F mutation, while conferring resistance to crizotinib and ceritinib, was inhibited by lorlatinib (PF-06463922). The patient's clinical response confirmed the potency of lorlatinib against S1986Y/F mutations. The ROS1 S1986Y/F and ALK C1156Y mutations are homologous and displayed similar sensitivity patterns to ALK/ROS1 TKIs. We extended this analogy to build a model predicting TKI efficacy against potential ROS1 mutations. Clinical evidence, in vitro validation, and homology-based prediction provide guidance for treatment decision making for patients with ROS1-rearranged NSCLC who progressed on crizotinib. Clin Cancer Res; 22(24); 5983-91. ©2016 AACR. ©2016 American Association for Cancer Research.

  20. Homozygous mutation of focal adhesion kinase in embryonic stem cell derived neurons: normal electrophysiological and morphological properties in vitro

    Komiyama NH

    2006-06-01

    Full Text Available Abstract Background Genetically manipulated embryonic stem (ES cell derived neurons (ESNs provide a powerful system with which to study the consequences of gene manipulation in mature, synaptically connected neurons in vitro. Here we report a study of focal adhesion kinase (FAK, which has been implicated in synapse formation and regulation of ion channels, using the ESN system to circumvent the embryonic lethality of homozygous FAK mutant mice. Results Mouse ES cells carrying homozygous null mutations (FAK-/- were generated and differentiated in vitro into neurons. FAK-/- ESNs extended axons and dendrites and formed morphologically and electrophysiologically intact synapses. A detailed study of NMDA receptor gated currents and voltage sensitive calcium currents revealed no difference in their magnitude, or modulation by tyrosine kinases. Conclusion FAK does not have an obligatory role in neuronal differentiation, synapse formation or the expression of NMDA receptor or voltage-gated calcium currents under the conditions used in this study. The use of genetically modified ESNs has great potential for rapidly and effectively examining the consequences of neuronal gene manipulation and is complementary to mouse studies.

  1. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Prevalence of the B Type Raf Kinase V600E Mutation in Cytologically Indeterminate Thyroid Nodules: Correlation with Ultrasonographic and Pathologic Features

    Kim, Chae Hyun; Choi, Yoon Jung; Choi, Seon Hyeong; Rho, Myong Ho Kook Shin Ho; Chung, Eun Chul [Dept. of Radiology, Kangbuk Samsung Hospital, Sungkyunkwan University College of Medicine, Seoul (Korea, Republic of); Chae, Seoung Wan; Kim, Dong Hoon; Sohn, Jin Hee [Dept. of Radiology, Kangbuk Samsung Hospital, Sungkyunkwan University College of Medicine, Seoul (Korea, Republic of); Yun, Ji Sup [Dept. of Radiology, Kangbuk Samsung Hospital, Sungkyunkwan University College of Medicine, Seoul (Korea, Republic of)

    2012-01-15

    To study the prevalence of B type Raf kinase (BRAF) mutations, and to evaluate the ultrasonographic and clinicopathological features associated with thyroid cytology of indeterminate nodules. We assessed the presence or absence of BRAF mutation in 44 specimens from patients with cytologically indeterminate thyroid nodules according to two consecutive preoperative fine needle aspiration cytology procedures. In 9 specimens, the test for BRAF mutation was not possible due to scant cellularity. DNA was extracted from the atypical cells and then analyzed for the BRAF V600E mutation by pyrosequencing. The ultrasonographic and clinicopathological features of the patients were characterized according to their mutation status. The BRAF V600E mutation was present in 17 (48.6%) of 35 patients with indeterminate cytology results and in 17 (54.8%) of the 31 patients with papillary thyroid cancer (PTC). Twenty two of 35 cytologically indeterminate nodules had calcifications, and among them 14 cases were proven to be positive for BRAF V600E mutations. Extrathyroid extension was significantly more frequent in the presence of the BRAF V600E mutation (p = 0.027), while tumor size, lympho-vascular invasion, or lymph node metastasis were not associated with the mutation. Screening for BRAF V600E mutations in conjunction with cytology may increase the diagnostic accuracy for PTC with indeterminate cytology results.

  3. Prevalence of the B Type Raf Kinase V600E Mutation in Cytologically Indeterminate Thyroid Nodules: Correlation with Ultrasonographic and Pathologic Features

    Kim, Chae Hyun; Choi, Yoon Jung; Choi, Seon Hyeong; Rho, Myong Ho Kook Shin Ho; Chung, Eun Chul; Chae, Seoung Wan; Kim, Dong Hoon; Sohn, Jin Hee; Yun, Ji Sup

    2012-01-01

    To study the prevalence of B type Raf kinase (BRAF) mutations, and to evaluate the ultrasonographic and clinicopathological features associated with thyroid cytology of indeterminate nodules. We assessed the presence or absence of BRAF mutation in 44 specimens from patients with cytologically indeterminate thyroid nodules according to two consecutive preoperative fine needle aspiration cytology procedures. In 9 specimens, the test for BRAF mutation was not possible due to scant cellularity. DNA was extracted from the atypical cells and then analyzed for the BRAF V600E mutation by pyrosequencing. The ultrasonographic and clinicopathological features of the patients were characterized according to their mutation status. The BRAF V600E mutation was present in 17 (48.6%) of 35 patients with indeterminate cytology results and in 17 (54.8%) of the 31 patients with papillary thyroid cancer (PTC). Twenty two of 35 cytologically indeterminate nodules had calcifications, and among them 14 cases were proven to be positive for BRAF V600E mutations. Extrathyroid extension was significantly more frequent in the presence of the BRAF V600E mutation (p = 0.027), while tumor size, lympho-vascular invasion, or lymph node metastasis were not associated with the mutation. Screening for BRAF V600E mutations in conjunction with cytology may increase the diagnostic accuracy for PTC with indeterminate cytology results.

  4. The BCR-ABLT315I mutation compromises survival in chronic phase chronic myelogenous leukemia patients resistant to tyrosine kinase inhibitors, in a matched pair analysis

    Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona

    2013-01-01

    The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...

  5. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  6. Grain legume cultivars derived from induced mutations, and mutations affecting nodulation

    Bhatia, C.R.; Maluszynski, M.; Nichterlein, K.; Zanten, L. van

    2001-01-01

    Two hundred and sixty-five grain legume cultivars developed using induced mutations have been released in 32 countries. A maximum number of cultivars have been released in soybean (58), followed by common bean (50), groundnut (44), pea (32) and mungbean (14). Gamma or x-ray exposures of seeds led to the direct development of 111 cultivars, while neutron and chemical mutagen treatments resulted in 8 and 36 cultivars respectively. One hundred and three cultivars have been developed using mutants in cross breeding. Attempts have been made to estimate the successful dose range for gamma and x-rays, defined as the dose range, which led to the development, registration and release of a maximum number of mutant cultivars. Exposures to seeds ranging between 100-200 Gy in all grain legumes, except faba bean, resulted in 49 out of 111 cultivars being developed as direct mutants. Successful doses reported for faba bean are lower than 100 Gy. Modified crop plant characters are listed. Besides the development of new cultivars, a large number of induced mutants that show altered nodulation pattern have been isolated in grain legumes. Such mutants have made a significant contribution in basic studies on host-symbiont interactions and towards cloning of plant genes related to symbiosis and nitrogen fixation. Their exploitation in breeding programs for enhancing nitrogen fixation is just beginning. Available information on nodulation mutants in grain legume crops is summarised. Mainly, four types of nodulation mutants have been isolated. They show either: no nodulation (nod -), few nodules (nod +/-), ineffective nodulation (Fix-), hypernodulation (nod ++) or hypernodulation even in the presence of otherwise inhibitory nitrate levels (nts). Hypernodulating and nts mutants are of great interest. A soybean cultivar incorporating nts trait has been released in Australia. (author)

  7. Hydroxyurea enhances the activity of acyclovir and cidofovir against herpes simplex virus type 1 resistant strains harboring mutations in the thymidine kinase and/or the DNA polymerase genes.

    Sergerie, Yan; Boivin, Guy

    2008-01-01

    Drug-resistant herpes simplex virus type 1 (HSV-1) recombinant strains harboring mutations in the thymidine kinase and/or the DNA polymerase genes were evaluated for their susceptibility to various antivirals in the presence of 25 microg/ml of hydroxyurea (HyU). The latter compound decreased the 50% inhibitory concentrations of acyclovir by 1.5-3.8-fold and that of cidofovir by 2.7-14.4-fold. However, HyU did not affect the susceptibilities of the various recombinant mutants to foscarnet. Hydroxyurea, a ribonucleotide reductase inhibitor, can increase the activity of nucleoside/nucleotide analogues against drug-resistant viruses.

  8. MVP-Associated Filamin A Mutations Affect FlnA-PTPN12 (PTP-PEST) Interactions.

    Duval, Damien; Labbé, Pauline; Bureau, Léa; Le Tourneau, Thierry; Norris, Russell A; Markwald, Roger R; Levine, Robert; Schott, Jean-Jacques; Mérot, Jean

    2015-09-08

    Although the genetic basis of mitral valve prolapse (MVP) has now been clearly established, the molecular and cellular mechanisms involved in the pathological processes associated to a specific mutation often remain to be determined. The FLNA gene (encoding Filamin A; FlnA) was the first gene associated to non-syndromic X-linked myxomatous valvular dystrophy, but the impacts of the mutations on its function remain un-elucidated. Here, using the first repeats (1-8) of FlnA as a bait in a yeast two-hybrid screen, we identified the tyrosine phosphatase PTPN12 (PTP-PEST) as a specific binding partner of this region of FlnA protein. In addition, using yeast two-hybrid trap assay pull down and co-immunoprecipitation experiments, we showed that the MVP-associated FlnA mutations (G288R, P637Q, H743P) abolished FlnA/PTPN12 interactions. PTPN12 is a key regulator of signaling pathways involved in cell-extracellular matrix (ECM) crosstalk, cellular responses to mechanical stress that involve integrins, focal adhesion transduction pathways, and actin cytoskeleton dynamics. Interestingly, we showed that the FlnA mutations impair the activation status of two PTPN12 substrates, the focal adhesion associated kinase Src, and the RhoA specific activating protein p190RhoGAP. Together, these data point to PTPN12/FlnA interaction and its weakening by FlnA mutations as a mechanism potentially involved in the physiopathology of FlnA-associated MVP.

  9. MVP-Associated Filamin A Mutations Affect FlnA-PTPN12 (PTP-PEST Interactions

    Damien Duval

    2015-09-01

    Full Text Available Although the genetic basis of mitral valve prolapse (MVP has now been clearly established, the molecular and cellular mechanisms involved in the pathological processes associated to a specific mutation often remain to be determined. The FLNA gene (encoding Filamin A; FlnA was the first gene associated to non-syndromic X-linked myxomatous valvular dystrophy, but the impacts of the mutations on its function remain un-elucidated. Here, using the first repeats (1–8 of FlnA as a bait in a yeast two-hybrid screen, we identified the tyrosine phosphatase PTPN12 (PTP-PEST as a specific binding partner of this region of FlnA protein. In addition, using yeast two-hybrid trap assay pull down and co-immunoprecipitation experiments, we showed that the MVP-associated FlnA mutations (G288R, P637Q, H743P abolished FlnA/PTPN12 interactions. PTPN12 is a key regulator of signaling pathways involved in cell-extracellular matrix (ECM crosstalk, cellular responses to mechanical stress that involve integrins, focal adhesion transduction pathways, and actin cytoskeleton dynamics. Interestingly, we showed that the FlnA mutations impair the activation status of two PTPN12 substrates, the focal adhesion associated kinase Src, and the RhoA specific activating protein p190RhoGAP. Together, these data point to PTPN12/FlnA interaction and its weakening by FlnA mutations as a mechanism potentially involved in the physiopathology of FlnA-associated MVP.

  10. Mutational profiling of non-small-cell lung cancer patients resistant to first-generation EGFR tyrosine kinase inhibitors using next generation sequencing

    Jin, Ying; Shao, Yang; Shi, Xun; Lou, Guangyuan; Zhang, Yiping; Wu, Xue; Tong, Xiaoling; Yu, Xinmin

    2016-01-01

    Patients with advanced non-small-cell lung cancer (NSCLC) harboring sensitive epithelial growth factor receptor (EGFR) mutations invariably develop acquired resistance to EGFR tyrosine kinase inhibitors (TKIs). Identification of actionable genetic alterations conferring drug-resistance can be helpful for guiding the subsequent treatment decision. One of the major resistant mechanisms is secondary EGFR-T790M mutation. Other mechanisms, such as HER2 and MET amplifications, and PIK3CA mutations, were also reported. However, the mechanisms in the remaining patients are still unknown. In this study, we performed mutational profiling in a cohort of 83 NSCLC patients with TKI-sensitizing EGFR mutations at diagnosis and acquired resistance to three different first-generation EGFR TKIs using targeted next generation sequencing (NGS) of 416 cancer-related genes. In total, we identified 322 genetic alterations with a median of 3 mutations per patient. 61% of patients still exhibit TKI-sensitizing EGFR mutations, and 36% of patients acquired EGFR-T790M. Besides other known resistance mechanisms, we identified TET2 mutations in 12% of patients. Interestingly, we also observed SOX2 amplification in EGFR-T790M negative patients, which are restricted to Icotinib treatment resistance, a drug widely used in Chinese NSCLC patients. Our study uncovered mutational profiles of NSCLC patients with first-generation EGFR TKIs resistance with potential therapeutic implications. PMID:27528220

  11. Analysis of factors affecting the development of food crop varieties bred by mutation method in China

    Wang Zhidong; Hu Ruifa

    2002-01-01

    The research developed a production function on crop varieties developed by mutation method in order to explore factors affecting the development of new varieties. It is found that the research investment, human capital and radiation facilities were the most important factors that affected the development and cultivation area of new varieties through the mutation method. It is concluded that not all institutions involved in the breeding activities using mutation method must have radiation facilities and the national government only needed to invest in those key research institutes, which had strong research capacities. The saved research budgets can be used in the entrusting the institutes that have stronger research capacities with irradiating more breeding materials developed by the institutes that have weak research capacities, by which more opportunities to breed better varieties can be created

  12. ERK mutations confer resistance to mitogen-activated protein kinase pathway inhibitors.

    Goetz, Eva M; Ghandi, Mahmoud; Treacy, Daniel J; Wagle, Nikhil; Garraway, Levi A

    2014-12-01

    The use of targeted therapeutics directed against BRAF(V600)-mutant metastatic melanoma improves progression-free survival in many patients; however, acquired drug resistance remains a major medical challenge. By far, the most common clinical resistance mechanism involves reactivation of the MAPK (RAF/MEK/ERK) pathway by a variety of mechanisms. Thus, targeting ERK itself has emerged as an attractive therapeutic concept, and several ERK inhibitors have entered clinical trials. We sought to preemptively determine mutations in ERK1/2 that confer resistance to either ERK inhibitors or combined RAF/MEK inhibition in BRAF(V600)-mutant melanoma. Using a random mutagenesis screen, we identified multiple point mutations in ERK1 (MAPK3) and ERK2 (MAPK1) that could confer resistance to ERK or RAF/MEK inhibitors. ERK inhibitor-resistant alleles were sensitive to RAF/MEK inhibitors and vice versa, suggesting that the future development of alternating RAF/MEK and ERK inhibitor regimens might help circumvent resistance to these agents. ©2014 American Association for Cancer Research.

  13. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  14. Frequency of ABL gene mutations in chronic myeloid leukemia patients resistant to imatinib and results of treatment switch to second-generation tyrosine kinase inhibitors.

    Marcé, Silvia; Zamora, Lurdes; Cabezón, Marta; Xicoy, Blanca; Boqué, Concha; Fernández, Cristalina; Grau, Javier; Navarro, José-Tomás; Fernández de Sevilla, Alberto; Ribera, Josep-Maria; Feliu, Evarist; Millá, Fuensanta

    2013-08-04

    Tyrosine kinase inhibitors (TKI) have improved the management of patients with chronic myeloid leukemia (CML). However, a significant proportion of patients do not achieve the optimal response or are resistant to TKI. ABL kinase domain mutations have been extensively implicated in the pathogenesis of TKI resistance. Treatment with second-generation TKI has produced high rates of hematologic and cytogenetic responses in mutated ABL patients. The aim of this study was to determine the type and frequency of ABL mutations in patients who were resistant to imatinib or had lost the response, and to analyze the effect of second-generation TKI on their outcome. The presence of ABL mutations in 45 CML patients resistant to imatinib was evaluated by direct sequencing and was correlated with the results of the cytogenetic study (performed in 39 cases). The outcome of these patients after therapy with nilotinib or dasatinib was analyzed. ABL mutations were detected in 14 out of 45 resistant patients. Patients with clonal cytogenetic evolution tended to develop mutations more frequently than those without clonal evolution. Nine out of the 15 patients with ABL mutation responded to a treatment switch to nilotinib (n=4), dasatinib (n=2), interferon (n=1) or hematopoietic stem cell transplantation (n=2). The frequency of ABL mutations in CML patients resistant to imatinib is high and is more frequent among those with clonal cytogenetic evolution. The change to second-generation TKI can overcome imatinib resistance in most of the mutated patients. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  15. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

    Dhanasekar, P; Reddy, K S

    2015-02-01

    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  16. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  17. P-loop conformation governed crizotinib resistance in G2032R-mutated ROS1 tyrosine kinase: clues from free energy landscape.

    Huiyong Sun

    2014-07-01

    Full Text Available Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance.

  18. Accurate calculation of mutational effects on the thermodynamics of inhibitor binding to p38α MAP kinase: a combined computational and experimental study.

    Zhu, Shun; Travis, Sue M; Elcock, Adrian H

    2013-07-09

    A major current challenge for drug design efforts focused on protein kinases is the development of drug resistance caused by spontaneous mutations in the kinase catalytic domain. The ubiquity of this problem means that it would be advantageous to develop fast, effective computational methods that could be used to determine the effects of potential resistance-causing mutations before they arise in a clinical setting. With this long-term goal in mind, we have conducted a combined experimental and computational study of the thermodynamic effects of active-site mutations on a well-characterized and high-affinity interaction between a protein kinase and a small-molecule inhibitor. Specifically, we developed a fluorescence-based assay to measure the binding free energy of the small-molecule inhibitor, SB203580, to the p38α MAP kinase and used it measure the inhibitor's affinity for five different kinase mutants involving two residues (Val38 and Ala51) that contact the inhibitor in the crystal structure of the inhibitor-kinase complex. We then conducted long, explicit-solvent thermodynamic integration (TI) simulations in an attempt to reproduce the experimental relative binding affinities of the inhibitor for the five mutants; in total, a combined simulation time of 18.5 μs was obtained. Two widely used force fields - OPLS-AA/L and Amber ff99SB-ILDN - were tested in the TI simulations. Both force fields produced excellent agreement with experiment for three of the five mutants; simulations performed with the OPLS-AA/L force field, however, produced qualitatively incorrect results for the constructs that contained an A51V mutation. Interestingly, the discrepancies with the OPLS-AA/L force field could be rectified by the imposition of position restraints on the atoms of the protein backbone and the inhibitor without destroying the agreement for other mutations; the ability to reproduce experiment depended, however, upon the strength of the restraints' force constant

  19. Wee1 Kinase Inhibitor AZD1775 Radiosensitizes Hepatocellular Carcinoma Regardless of TP53 Mutational Status Through Induction of Replication Stress

    Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.; Parcels, Leslie A.; Parcels, Joshua; Karnak, David; Ryan, Caila; Liu, Na; Maybaum, Jonathan; Lawrence, Theodore S.

    2016-06-01

    Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3 antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.

  20. AMP kinase-related kinase NUAK2 affects tumor growth, migration, and clinical outcome of human melanoma.

    Namiki, Takeshi; Tanemura, Atsushi; Valencia, Julio C; Coelho, Sergio G; Passeron, Thierry; Kawaguchi, Masakazu; Vieira, Wilfred D; Ishikawa, Masashi; Nishijima, Wataru; Izumo, Toshiyuki; Kaneko, Yasuhiko; Katayama, Ichiro; Yamaguchi, Yuji; Yin, Lanlan; Polley, Eric C; Liu, Hongfang; Kawakami, Yutaka; Eishi, Yoshinobu; Takahashi, Eishi; Yokozeki, Hiroo; Hearing, Vincent J

    2011-04-19

    The identification of genes that participate in melanomagenesis should suggest strategies for developing therapeutic modalities. We used a public array comparative genomic hybridization (CGH) database and real-time quantitative PCR (qPCR) analyses to identify the AMP kinase (AMPK)-related kinase NUAK2 as a candidate gene for melanomagenesis, and we analyzed its functions in melanoma cells. Our analyses had identified a locus at 1q32 where genomic gain is strongly associated with tumor thickness, and we used real-time qPCR analyses and regression analyses to identify NUAK2 as a candidate gene at that locus. Associations of relapse-free survival and overall survival of 92 primary melanoma patients with NUAK2 expression measured using immunohistochemistry were investigated using Kaplan-Meier curves, log rank tests, and Cox regression models. Knockdown of NUAK2 induces senescence and reduces S-phase, decreases migration, and down-regulates expression of mammalian target of rapamycin (mTOR). In vivo analysis demonstrated that knockdown of NUAK2 suppresses melanoma tumor growth in mice. Survival analysis showed that the risk of relapse is greater in acral melanoma patients with high levels of NUAK2 expression than in acral melanoma patients with low levels of NUAK2 expression (hazard ratio = 3.88; 95% confidence interval = 1.44-10.50; P = 0.0075). These data demonstrate that NUAK2 expression is significantly associated with the oncogenic features of melanoma cells and with the survival of acral melanoma patients. NUAK2 may provide a drug target to suppress melanoma progression. This study further supports the importance of NUAK2 in cancer development and tumor progression, while AMPK has antioncogenic properties.

  1. Mutations affecting components of the SWI/SNF complex cause Coffin-Siris syndrome.

    Tsurusaki, Yoshinori; Okamoto, Nobuhiko; Ohashi, Hirofumi; Kosho, Tomoki; Imai, Yoko; Hibi-Ko, Yumiko; Kaname, Tadashi; Naritomi, Kenji; Kawame, Hiroshi; Wakui, Keiko; Fukushima, Yoshimitsu; Homma, Tomomi; Kato, Mitsuhiro; Hiraki, Yoko; Yamagata, Takanori; Yano, Shoji; Mizuno, Seiji; Sakazume, Satoru; Ishii, Takuma; Nagai, Toshiro; Shiina, Masaaki; Ogata, Kazuhiro; Ohta, Tohru; Niikawa, Norio; Miyatake, Satoko; Okada, Ippei; Mizuguchi, Takeshi; Doi, Hiroshi; Saitsu, Hirotomo; Miyake, Noriko; Matsumoto, Naomichi

    2012-03-18

    By exome sequencing, we found de novo SMARCB1 mutations in two of five individuals with typical Coffin-Siris syndrome (CSS), a rare autosomal dominant anomaly syndrome. As SMARCB1 encodes a subunit of the SWItch/Sucrose NonFermenting (SWI/SNF) complex, we screened 15 other genes encoding subunits of this complex in 23 individuals with CSS. Twenty affected individuals (87%) each had a germline mutation in one of six SWI/SNF subunit genes, including SMARCB1, SMARCA4, SMARCA2, SMARCE1, ARID1A and ARID1B.

  2. Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.

    Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang

    2013-12-01

    The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.

  3. MeCP2 Rett mutations affect large scale chromatin organization

    Gupta, Noopur Agarwal; Becker, Annette; Jost, K Laurence

    2011-01-01

    Rett syndrome is a neurological, X chromosomal-linked disorder associated with mutations in the MECP2 gene. MeCP2 protein has been proposed to play a role in transcriptional regulation as well as in chromatin architecture. Since MeCP2 mutant cells exhibit surprisingly mild changes in gene...... expression, we have now explored the possibility that Rett mutations may affect the ability of MeCP2 to bind and organize chromatin. We found that all but one of the 21 missense MeCP2 mutants analyzed accumulated at heterochromatin and about half of them were significantly affected. Furthermore, two......-thirds of all mutants showed a significantly decreased ability to cluster heterochromatin. Three mutants containing different proline substitutions (P101H, P101R and P152R) were severely affected only in heterochromatin clustering and located far away from the DNA interface in the MeCP2 methyl-binding domain...

  4. Isolation of mutations affecting the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh.

    Warren, G; McKown, R; Marin, A L; Teutonico, R

    1996-08-01

    We screened for mutations deleterious to the freezing tolerance of Arabidopsis thaliana (L.) Heynh. ecotype Columbia. Tolerance was assayed by the vigor and regrowth of intact plants after cold acclimation and freezing. From a chemically mutagenized population, we obtained 13 lines of mutants with highly penetrant phenotypes. In 5 of these, freezing sensitivity was attributable to chilling injury sustained during cold acclimation, but in the remaining 8 lines, the absence of injury prior to freezing suggested that they were affected specifically in the development of freezing tolerance. In backcrosses, freezing sensitivity from each line segregated as a single nuclear mutation. Complementation tests indicated that the 8 lines contained mutations in 7 different genes. The mutants' freezing sensitivity was also detectable in the leakage of electrolytes from frozen leaves. However, 1 mutant line that displayed a strong phenotype at the whole-plant level showed a relatively weak phenotype by the electrolyte leakage assay.

  5. Mutational analysis to identify the residues essential for the inhibition of N-acetyl glutamate kinase of Corynebacterium glutamicum.

    Huang, Yuanyuan; Zhang, Hao; Tian, Hongming; Li, Cheng; Han, Shuangyan; Lin, Ying; Zheng, Suiping

    2015-09-01

    N-acetyl glutamate kinase (NAGK) is a key enzyme in the synthesis of L-arginine that is inhibited by its end product L-arginine in Corynebacterium glutamicum (C. glutamicum). In this study, the potential binding sites of arginine and the residues essential for its inhibition were identified by homology modeling, inhibitor docking, and site-directed mutagenesis. The allosteric inhibition of NAGK was successfully alleviated by a mutation, as determined through analysis of mutant enzymes, which were overexpressed in vivo in C. glutamicum ATCC14067. Analysis of the mutant enzymes and docking analysis demonstrated that residue W23 positions an arginine molecule, and the interaction between arginine and residues L282, L283, and T284 may play an important role in the remote inhibitory process. Based on the results of the docking analysis of the effective mutants, we propose a linkage mechanism for the remote allosteric regulation of NAGK activity, in which residue R209 may play an essential role. In this study, the structure of the arginine-binding site of C. glutamicum NAGK (CgNAGK) was successfully predicted and the roles of the relevant residues were identified, providing new insight into the allosteric regulation of CgNAGK activity and a solid platform for the future construction of an optimized L-arginine producing strain.

  6. Calreticulin mutation analysis in non-mutated Janus kinase 2 essential thrombocythemia patients in Chiang Mai University: analysis of three methods and clinical correlations.

    Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree

    2018-03-09

    The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.

  7. PROGRANULIN MUTATIONS AFFECTS BRAIN OSCILLATORY ACTIVITY IN FRONTO-TEMPORAL DEMENTIA

    Davide Vito Moretti

    2016-02-01

    Full Text Available Background: mild cognitive impairment (MCI is a clinical stage indicating a prodromal phase of dementia. This practical concept could be used also for fronto-temporal dementia (FTD. Progranulin (PGRN has been recently recognized as a useful diagnostic biomarker for fronto-temporal lobe degeneration (FTLD due to GRN null mutations. Electroencephalography (EEG is a reliable tool in detecting brain networks changes. The working hypothesis of the present study is that EEG oscillations could detect different modifications among FTLD stages (FTD-MCI versus overt FTD as well as differences between GRN mutation carriers versus non carriers in patients with overt FTD. Methods: EEG in all patients and PGRN dosage in patients with a clear FTD were detected. The cognitive state has been investigated through mini mental state examination (MMSE. Results: MCI-FTD showed a significant lower spectral power in both alpha and theta oscillations as compared to overt FTD. GRN mutations carriers affected by FTLD show an increase in high alpha and decrease in theta oscillations as compared to non-carriers.Conclusion: EEG frequency rhythms are sensible to different stage of FTD and could detect changes in brain oscillatory activity affected by GRN mutations

  8. Effects of icotinib, a novel epidermal growth factor receptor tyrosine kinase inhibitor, in EGFR-mutated non-small cell lung cancer.

    Yang, Guangdie; Yao, Yinan; Zhou, Jianya; Zhao, Qiong

    2012-06-01

    Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small cell lung cancer (NSCLC). Our study demonstrated the antitumor effects of icotinib hydrochloride, a highly selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI), in two EGFR-mutated lung cancer cell lines compared to A549, a cell line without EGFR mutations. We incubated PC-9 and HCC827 human lung cancer cell lines both with (E746-A750) mutations with various concentrations of icotinib and gefitinib for 48 h. Cell proliferation and migration were determined using a real-time cell invasion and migration assay and cytotoxicity assay. Apoptosis was assessed by measuring Annexin V staining using flow cytometry. The antitumor effects of icotinib compared to gefitinib were similar and were most effective in reducing the proliferation of EGFR-mutated cells compared to non-mutated controls. Our results suggest the possibility of icotinib as a new therapeutic agent of EGFR-mutated cancer cells, which has the potential to be used in the first-line treatment of EGFR-mutated NSCLC.

  9. Adenylate kinase I does not affect cellular growth characteristics under normal and metabolic stress conditions.

    de Bruin, Wieke; Oerlemans, Frank; Wieringa, Bé

    2004-07-01

    Adenylate kinase (AK)-catalyzed phosphotransfer is essential in the maintenance of cellular energetic economy in cells of fully differentiated tissues with highly variable energy demand, such as muscle and brain. To investigate if AK isoenzymes have a comparable function in the energy-demand management of proliferating cells, AK1 and AK1beta were expressed in mouse neuroblastoma N2a cells and in human colon carcinoma SW480 cells. Glucose deprivation, galactose feeding, and metabolic inhibitor tests revealed a differential energy dependency for these two cell lines. N2a cells showed a faster proliferation rate and strongest coupling to mitochondrial activity, SW480 proliferation was more dependent on glycolysis. Despite these differences, ectopic expression of AK1 or AK1beta did not affect their growth characteristics under normal conditions. Also, no differential effects were seen under metabolic stress upon treatment with mitochondrial and glycolytic inhibitors in in vitro culture or in solid tumors grown in vivo. Although many intimate connections have been revealed between cell death and metabolism, our results suggest that AK1- or AK1beta-mediated high-energy phosphoryl transfer is not a modulating factor in the survival of tumor cells during episodes of metabolic crisis.

  10. [Identification of a novel GPR143 mutation in a Chinese family affected with X-linked ocular albinism].

    Zhao, Qi; Guan, Menglong; Wang, Ling; Liao, Yong; Li-Ling, Jesse; Wan, Huajing

    2017-04-10

    To detect mutation of GPR143 gene in a Chinese patient affected with ocular albinism. Peripheral blood samples were collected from the proband and his parents. The coding regions of the GPR143 gene were subjected to PCR amplification and Sanger sequencing. A previously unreported mutation (c.758T>A) was found in exon 6 of the GPR143 gene in the proband and his mother. The same mutation was not found in his father. As predicted, the mutation has resulted in a stop codon, causing premature termination of protein translation. A novel mutation of the GPR143 gene related to X-linked ocular albinism has been identified.

  11. Sequential treatment of tyrosine kinase inhibitors and chemotherapy for EGFR-mutated non-small cell lung cancer: a meta-analysis of Phase III trials

    Zhang Y

    2013-11-01

    Full Text Available Yiliang Zhang,1,* Yihua Sun,1,* Lei Wang,1 Ting Ye,1 Yunjian Pan,1 Haichuan Hu,1 Yongfu Yu,2 Naiqing Zhao,2 Yanyan Song,3 David Garfield,4 Haiquan Chen1 1Department of Thoracic Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, 2Department of Biostatistics, School of Public Health, Fudan University, 3Department of Pharmacology and Biostatistics, Institute of Medical Science, Shanghai Jiaotong University School of Medicine, 4ProMed Cancer Centers, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: This aim of this study was to compare the efficacy of first-line tyrosine kinase inhibitor therapy followed, upon progression, by chemotherapy with the reverse sequence in patients with EGFR-mutated non-small cell lung cancer (NSCLC in terms of overall survival. Methods: We performed a meta-analysis of studies that met the following criteria: Phase III clinical trial comparing the sequencing of epidermal growth factor receptor (EGFR tyrosine kinase inhibitors with chemotherapy in the treatment of advanced EGFR-mutated NSCLC; activating mutations reported; and availability of hazard ratio estimates with 95% confidence intervals (CIs for overall survival. Results: Six clinical trials were included in this study. The pooled hazard ratio for overall survival of the EGFR-mutated population that completed sequential treatment was 1.03 (95% CI 0.86–1.22, P=0.776. There was no statistically significant heterogeneity between the studies (tau2 =0; I2=0, 95% CI 0–0.37, P=0.548. Evidence of marked publication bias for the two treatment sequences was insufficient (P=0.145. Conclusion: In patients with advanced NSCLC and activating EGFR mutations, first-line chemotherapy followed upon progression by a tyrosine kinase inhibitor was not inferior in terms of overall survival compared with the inverse sequence. This may serve as an indication that

  12. Heterozygous Null Bone Morphogenetic Protein Receptor Type 2 Mutations Promote SRC Kinase-dependent Caveolar Trafficking Defects and Endothelial Dysfunction in Pulmonary Arterial Hypertension*

    Prewitt, Allison R.; Ghose, Sampa; Frump, Andrea L.; Datta, Arumima; Austin, Eric D.; Kenworthy, Anne K.; de Caestecker, Mark P.

    2015-01-01

    Hereditary pulmonary arterial hypertension (HPAH) is a rare, fatal disease of the pulmonary vasculature. The majority of HPAH patients inherit mutations in the bone morphogenetic protein type 2 receptor gene (BMPR2), but how these promote pulmonary vascular disease is unclear. HPAH patients have features of pulmonary endothelial cell (PEC) dysfunction including increased vascular permeability and perivascular inflammation associated with decreased PEC barrier function. Recently, frameshift mutations in the caveolar structural protein gene Caveolin-1 (CAV-1) were identified in two patients with non-BMPR2-associated HPAH. Because caveolae regulate endothelial function and vascular permeability, we hypothesized that defects in caveolar function might be a common mechanism by which BMPR2 mutations promote pulmonary vascular disease. To explore this, we isolated PECs from mice carrying heterozygous null Bmpr2 mutations (Bmpr2+/−) similar to those found in the majority of HPAH patients. We show that Bmpr2+/− PECs have increased numbers and intracellular localization of caveolae and caveolar structural proteins CAV-1 and Cavin-1 and that these defects are reversed after blocking endocytosis with dynasore. SRC kinase is also constitutively activated in Bmpr2+/− PECs, and localization of CAV-1 to the plasma membrane is restored after treating Bmpr2+/− PECs with the SRC kinase inhibitor 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (PP2). Late outgrowth endothelial progenitor cells isolated from HPAH patients show similar increased activation of SRC kinase. Moreover, Bmpr2+/− PECs have impaired endothelial barrier function, and barrier function is restored after treatment with PP2. These data suggest that heterozygous null BMPR2 mutations promote SRC-dependent caveolar trafficking defects in PECs and that this may contribute to pulmonary endothelial barrier dysfunction in HPAH patients. PMID:25411245

  13. Bcr-aBL1 kinase domain mutation analysis in chronic myeloid leukaemia patients with suboptimal response to tyrosine kinase inhibitors

    Tadej Pajič

    2012-12-01

    Conclusions: It seems that the BCR-ABl1 mutations are rare in patients who do not achieve a MMR by 18 months or more or who have lost MMR. The T315I mutation detected in one patient in our cohort of CML patients indicates that the BCR-ABL1 mutation analysis could be recommended in these cases. The silent mutation detected did not lead to amino acid change, however, it is listed in major single nucleotide polymorphisms databases (SNP, rs2227985. The role of the SNP in the resistance to TKIs is not clear.

  14. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  15. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Gustafsson, Ann-Sofie; Abramenkovs, Andris; Stenerlöw, Bo

    2014-01-01

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  16. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes.

    Metts, J; West, J; Doares, S H; Matthysse, A G

    1991-01-01

    Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was d...

  17. Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing

    Akeson, A.L.; Wiginton, D.A.; States, C.J.; Perme, C.M.; Dusing, M.R.; Hutton, J.J.

    1987-01-01

    Adenosine deaminase deficiency is one cause of the genetic disease severe combined immunodeficiency. To identify mutations responsible for ADA deficiency, the authors synthesized cDNAs to ADA mRNAs from two cell lines, GM2756 and GM2825A, derived from ADA-deficient immunodeficient patients. Sequence analysis of GM2756 cDNA clones revealed a different point mutation in each allele that causes amino acid changes of alanine to valine and arginine to histidine. One allele of GM2825A also has a point mutation that causes an alanine to valine substitution. The other allele of GM2825A was found to produce an mRNA in which exon 4 had been spliced out but had no other detrimental mutations. S1 nuclease mapping of GM2825A mRNA showed equal abundance of the full-length ADA mRNA and the ADA mRNA that was missing exon 4. Several of the ADA cDNA clones extended 5' of the major initiation start site, indicating multiple start sites for ADA transcription. The point mutations in GM2756 and GM2825A and the absence of exon 4 in GM2825A appear to be directly responsible for the ADA deficiency. Comparison of a number of normal and mutant ADA cDNA sequences showed a number of changes in the third base of codons. These change do not affect the amino acid sequence. Analyses of ADA cDNAs from different cell lines detected aberrant RNA species that either included intron 7 or excluded exon 7. Their presence is a result of aberrant splicing of pre-mRNAs and is not related to mutations that cause ADA deficiency

  18. Conserved retinoblastoma protein-binding motif in human cytomegalovirus UL97 kinase minimally impacts viral replication but affects susceptibility to maribavir

    Chou Sunwen

    2009-01-01

    Full Text Available Abstract The UL97 kinase has been shown to phosphorylate and inactivate the retinoblastoma protein (Rb and has three consensus Rb-binding motifs that might contribute to this activity. Recombinant viruses containing mutations in the Rb-binding motifs generally replicated well in human foreskin fibroblasts with only a slight delay in replication kinetics. Their susceptibility to the specific UL97 kinase inhibitor, maribavir, was also examined. Mutation of the amino terminal motif, which is involved in the inactivation of Rb, also renders the virus hypersensitive to the drug and suggests that the motif may play a role in its mechanism of action.

  19. The rad2 mutation affects the molecular nature of UV and acridine-mustard-induced mutations in the ADE2 gene of Saccharomyces cerevisiae

    Ivanov, E.L.; Kovaltzova, S.V.; Kassinova, G.V.; Gracheva, L.M.; Korolev, V.G.; Zakharov, I.A.

    1986-01-01

    The authors have studied the molecular nature of ade2 mutations induced by UV light and bifunctional acridine-mustard (BAM) in wild-type (RAD) and in excision-deficient (rad2) strains of the yeast, Saccharomyces cerevisiae. In the RAD strain, UV causes 45% GC → AT transitions among all mutations; in the rad2 strain this value is 77%. BAM was shown to be highly specific for frameshift mutagenesis: 60% frameshifts in the RAD strain, and as many as 84% frameshifts in the rad2 strain were induced. Therefore, the rad2 mutation affects the specificity of UV- and BAM-induced mutagenesis in yeast. Experimental data agree with the view that the majority of mutations in the RAD strain are induced by a prereplicative mechanism, whereas mutations in the rad2 strain are predominantly postreplicative events. (Auth.)

  20. Acquired resistance L747S mutation in an epidermal growth factor receptor-tyrosine kinase inhibitor-naïve patient: A report of three cases.

    Yamaguchi, Fumihiro; Fukuchi, Kunihiko; Yamazaki, Yohei; Takayasu, Hiromi; Tazawa, Sakiko; Tateno, Hidetsugu; Kato, Eisuke; Wakabayashi, Aya; Fujimori, Mami; Iwasaki, Takuya; Hayashi, Makoto; Tsuchiya, Yutaka; Yamashita, Jun; Takeda, Norikazu; Kokubu, Fumio

    2014-02-01

    The purpose of the present study was to report cases of epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI)-naïve patients carrying a mutation associated with acquired resistance to the drug. Gene alterations in 77 lung carcinoma patients were analyzed by collecting and studying curette lavage fluid at the time of diagnosis. PCRs were performed to amplify mutation hotspot regions in EGFR genes. The PCR products were direct-sequenced and the mutations confirmed by resequencing using different primers. Case 1 was a 78-year-old Japanese male diagnosed with stage IB lung adenocarcinoma who was found to have two EGFR mutations, G719S and L747S. Case 2 was a 73-year-old Japanese male diagnosed with stage IV squamous cell lung carcinoma and bone metastasis who had the EGFR mutation, L747S. Case 3 was an 82-year-old Japanese male diagnosed with hyponatremia due to inappropriate secretion of antidiuretic hormone and stage IIIB small cell lung carcinoma (SCLC) who had the EGFR mutation, L747S. Thus, the EGFR mutation L747S associated with acquired EGFR-TKI resistance was detected in two non-small cell lung carcinoma (NSCLC) patients and one SCLC patient, none of whom had ever received EGFR-TKI. The patients were current smokers with stages at diagnosis ranging from IB to IV, and their initial tumors contained resistant clones carrying L747S. L747S may be associated with primary resistance. To the best of our knowledge, this study is the first report of an EGFR mutation associated with resistance to EGFR-TKI in SCLC patients. The early detection of EGFR-TKI resistance mutations may be beneficial in making treatment decisions for lung carcinoma patients, including those with SCLC.

  1. A genetic screen for mutations affecting embryonic development in medaka fish (Oryzias latipes).

    Loosli, F; Köster, R W; Carl, M; Kühnlein, R; Henrich, T; Mücke, M; Krone, A; Wittbrodt, J

    2000-10-01

    In a pilot screen, we assayed the efficiency of ethylnitrosourea (ENU) as a chemical mutagen to induce mutations that lead to early embryonic and larval lethal phenotypes in the Japanese medaka fish, Oryzias latipes. ENU acts as a very efficient mutagen inducing mutations at high rates in germ cells. Three repeated treatments of male fish in 3 mM ENU for 1 h results in locus specific mutation rates of 1.1-1.95 x10(-3). Mutagenized males were outcrossed to wild type females and the F1 offspring was used to establish F2 families. F2 siblings were intercrossed and the F3 progeny was scored 24, 48 and 72 h after fertilization for morphological alterations affecting eye development. The presented mutant phenotypes were identified using morphological criteria and occur during early developmental stages of medaka. They are stably inherited in a Mendelian fashion. The high efficiency of ENU to induce mutations in this pilot screen indicates that chemical mutagenesis and screening for morphologically visible phenotypes in medaka fish allows the genetic analysis of specific aspects of vertebrate development complementing the screens performed in other vertebrate model systems.

  2. Radiotherapy of non-small-cell lung cancer in the era of EGFR gene mutations and EGF receptor tyrosine kinase inhibitors.

    Moschini, Ilaria; Dell'Anna, Cristina; Losardo, Pier Luigi; Bordi, Paola; D'Abbiero, Nunziata; Tiseo, Marcello

    2015-01-01

    Non-small-cell lung cancer (NSCLC) occurs, approximately, in 80-85% of all cases of lung cancer. The majority of patients present locally advanced or metastatic disease when diagnosed, with poor prognosis. The discovery of activating mutations in the EGFR gene has started a new era of personalized treatment for NSCLC patients. To improve the treatment outcome in patients with unresectable NSCLC and, in particular, EGFR mutated, a combined strategy of radiotherapy and medical treatment can be undertaken. In this review we will discuss preclinical data regarding EGF receptor (EGFR) tyrosine kinase inhibitors (TKIs) and radiotherapy, available clinical trials investigating efficacy and toxicity of combined treatment (thoracic or whole brain radiotherapy and EGFR-TKIs) and, also, the role of local radiation in mutated EGFR patients who developed EGFR-TKI resistance.

  3. Mendelian and non-mendelian mutations affecting surface antigen expression in Paramecium tetraurelia

    Epstein, L.M.; Forney, J.D.

    1984-01-01

    A screening procedure was devised for the isolation of X-ray-induced mutations affecting the expression of the A immobilization antigen (i-antigen) in Paramecium tetraurelia. Two of the mutations isolated by this procedure proved to be in modifier genes. The two genes are unlinked to each other and unlinked to the structural A i-antigen gene. These are the first modifier genes identified in a Paramecium sp. that affect surface antigen expression. Another mutation was found to be a deletion of sequences just downstream from the A i-antigen gene. In cells carrying this mutation, the A i-antigen gene lies in close proximity to the end of a macronuclear chromosome. The expression of the A i-antigen is not affected in these cells, demonstrating that downstream sequences are not important for the regulation and expression of the A i-antigen gene. A stable cell line was also recovered which shows non-Mendelian inheritance of a macronuclear deletion of the A i-antigen gene. This mutant does not contain the gene in its macronucleus, but contains a complete copy of the gene in its micronucleus. In the cytoplasm of wild-type animals, the micronuclear gene is included in the developing macronucleus; in the cytoplasm of the mutant, the incorporation of the A i-antigen gene into the macronucleus is inhibited. This is the first evidence that a mechanism is available in ciliates to control the expression of a gene by regulating its incorporation into developing macronuclei

  4. Identification of a novel FAM83H mutation and microhardness of an affected molar in autosomal dominant hypocalcified amelogenesis imperfecta.

    Hyun, H-K; Lee, S-K; Lee, K-E; Kang, H-Y; Kim, E-J; Choung, P-H; Kim, J-W

    2009-11-01

    To determine the underlying molecular genetic aetiology of a family with the hypocalcified form of amelogenesis imperfecta and to investigate the hardness of the enamel and dentine of a known FAM83H mutation. Mutational screening of the FAM83H on the basis of candidate gene approach was performed. All exons and exon-intron boundaries was amplified and sequenced. A microhardness test was performed to measure the Vickers microhardness value. A novel nonsense mutation (c.1354C>T, p.Q452X) was identified in the last exon of FAM83H, which resulted in soft, uncalcified enamel. The affected enamel was extremely soft (about 17% of the normal control), but the underlying dentine was as hard as the normal control. Mutational analysis revealed a novel mutation in FAM83H gene. Hardness of dentine was not affected by the mutation, whilst the enamel was extremely soft.

  5. Reactive oxygen species-generating mitochondrial DNA mutation up-regulates hypoxia-inducible factor-1alpha gene transcription via phosphatidylinositol 3-kinase-Akt/protein kinase C/histone deacetylase pathway.

    Koshikawa, Nobuko; Hayashi, Jun-Ichi; Nakagawara, Akira; Takenaga, Keizo

    2009-11-27

    Lewis lung carcinoma-derived high metastatic A11 cells constitutively overexpress hypoxia-inducible factor (HIF)-1alpha mRNA compared with low metastatic P29 cells. Because A11 cells exclusively possess a G13997A mutation in the mitochondrial NADH dehydrogenase subunit 6 (ND6) gene, we addressed here a causal relationship between the ND6 mutation and the activation of HIF-1alpha transcription, and we investigated the potential mechanism. Using trans-mitochondrial cybrids between A11 and P29 cells, we found that the ND6 mutation was directly involved in HIF-1alpha mRNA overexpression. Stimulation of HIF-1alpha transcription by the ND6 mutation was mediated by overproduction of reactive oxygen species (ROS) and subsequent activation of phosphatidylinositol 3-kinase (PI3K)-Akt and protein kinase C (PKC) signaling pathways. The up-regulation of HIF-1alpha transcription was abolished by mithramycin A, an Sp1 inhibitor, but luciferase reporter and chromatin immunoprecipitation assays indicated that Sp1 was necessary but not sufficient for HIF-1alpha mRNA overexpression in A11 cells. On the other hand, trichostatin A, a histone deacetylase (HDAC) inhibitor, markedly suppressed HIF-1alpha transcription in A11 cells. In accordance with this, HDAC activity was high in A11 cells but low in P29 cells and in A11 cells treated with the ROS scavenger ebselene, the PI3K inhibitor LY294002, and the PKC inhibitor Ro31-8220. These results suggest that the ROS-generating ND6 mutation increases HIF-1alpha transcription via the PI3K-Akt/PKC/HDAC pathway, leading to HIF-1alpha protein accumulation in hypoxic tumor cells.

  6. miR-122 targets pyruvate kinase M2 and affects metabolism of hepatocellular carcinoma.

    Angela M Liu

    Full Text Available In contrast to normal differentiated cells that depend on mitochondrial oxidative phosphorylation for energy production, cancer cells have evolved to utilize aerobic glycolysis (Warburg's effect, with benefit of providing intermediates for biomass production. MicroRNA-122 (miR-122 is highly expressed in normal liver tissue regulating a wide variety of biological processes including cellular metabolism, but is reduced in hepatocellular carcinoma (HCC. Overexpression of miR-122 was shown to inhibit cancer cell proliferation, metastasis, and increase chemosensitivity, but its functions in cancer metabolism remains unknown. The present study aims to identify the miR-122 targeted genes and to investigate the associated regulatory mechanisms in HCC metabolism. We found the ectopic overexpression of miR-122 affected metabolic activities of HCC cells, evidenced by the reduced lactate production and increased oxygen consumption. Integrated gene expression analysis in a cohort of 94 HCC tissues revealed miR-122 level tightly associated with a battery of glycolytic genes, in which pyruvate kinase (PK gene showed the strongest anti-correlation coefficient (Pearson r = -0.6938, p = <0.0001. In addition, reduced PK level was significantly associated with poor clinical outcomes of HCC patients. We found isoform M2 (PKM2 is the dominant form highly expressed in HCC and is a direct target of miR-122, as overexpression of miR-122 reduced both the mRNA and protein levels of PKM2, whereas PKM2 re-expression abrogated the miR-122-mediated glycolytic activities. The present study demonstrated the regulatory role of miR-122 on PKM2 in HCC, having an implication of therapeutic intervention targeting cancer metabolic pathways.

  7. Mutation types and aging differently affect revertant fiber expansion in dystrophic mdx and mdx52 mice.

    Yusuke Echigoya

    Full Text Available Duchenne muscular dystrophy (DMD, one of the most common and lethal genetic disorders, and the mdx mouse myopathies are caused by a lack of dystrophin protein. These dystrophic muscles contain sporadic clusters of dystrophin-expressing revertant fibers (RFs, as detected by immunohistochemistry. RFs are known to arise from muscle precursor cells with spontaneous exon skipping (alternative splicing and clonally expand in size with increasing age through the process of muscle degeneration/regeneration. The expansion of revertant clusters is thought to represent the cumulative history of muscle regeneration and proliferation of such precursor cells. However, the precise mechanisms by which RFs arise and expand are poorly understood. Here, to test the effects of mutation types and aging on RF expansion and muscle regeneration, we examined the number of RFs in mdx mice (containing a nonsense mutation in exon 23 and mdx52 mice (containing deletion mutation of exon 52 with the same C57BL/6 background at 2, 6, 12, and 18months of age. Mdx mice displayed a significantly higher number of RFs compared to mdx52 mice in all age groups, suggesting that revertant fiber expansion largely depends on the type of mutation and/or location in the gene. A significant increase in the expression and clustering levels of RFs was found beginning at 6months of age in mdx mice compared with mdx52 mice. In contrast to the significant expansion of RFs with increasing age, the number of centrally nucleated fibers and embryonic myosin heavy chain-positive fibers (indicative of cumulative and current muscle regeneration, respectively decreased with age in both mouse strains. These results suggest that mutation types and aging differently affect revertant fiber expansion in mdx and mdx52 mice.

  8. FLT3 mutations in early T-cell precursor ALL characterize a stem cell like leukemia and imply the clinical use of tyrosine kinase inhibitors.

    Martin Neumann

    Full Text Available Early T-cell precursor acute lymphoblastic leukemia (ETP-ALL has been identified as high-risk subgroup of acute T-lymphoblastic leukemia (T-ALL with a high rate of FLT3-mutations in adults. To unravel the underlying pathomechanisms and the clinical course we assessed molecular alterations and clinical characteristics in a large cohort of ETP-ALL (n = 68 in comparison to non-ETP T-ALL adult patients. Interestingly, we found a high rate of FLT3-mutations in ETP-ALL samples (n = 24, 35%. Furthermore, FLT3 mutated ETP-ALL was characterized by a specific immunophenotype (CD2+/CD5-/CD13+/CD33-, a distinct gene expression pattern (aberrant expression of IGFBP7, WT1, GATA3 and mutational status (absence of NOTCH1 mutations and a low frequency, 21%, of clonal TCR rearrangements. The observed low GATA3 expression and high WT1 expression in combination with lack of NOTCH1 mutations and a low rate of TCR rearrangements point to a leukemic transformation at the pluripotent prothymocyte stage in FLT3 mutated ETP-ALL. The clinical outcome in ETP-ALL patients was poor, but encouraging in those patients with allogeneic stem cell transplantation (3-year OS: 74%. To further explore the efficacy of targeted therapies, we demonstrate that T-ALL cell lines transfected with FLT3 expression constructs were particularly sensitive to tyrosine kinase inhibitors. In conclusion, FLT3 mutated ETP-ALL defines a molecular distinct stem cell like leukemic subtype. These data warrant clinical studies with the implementation of FLT3 inhibitors in addition to early allogeneic stem cell transplantation for this high risk subgroup.

  9. Novel somatic mutations in the catalytic subunit of the protein kinase A as a cause of adrenal Cushing's syndrome: a European multicentric study.

    Di Dalmazi, Guido; Kisker, Caroline; Calebiro, Davide; Mannelli, Massimo; Canu, Letizia; Arnaldi, Giorgio; Quinkler, Marcus; Rayes, Nada; Tabarin, Antoine; Laure Jullié, Marie; Mantero, Franco; Rubin, Beatrice; Waldmann, Jens; Bartsch, Detlef K; Pasquali, Renato; Lohse, Martin; Allolio, Bruno; Fassnacht, Martin; Beuschlein, Felix; Reincke, Martin

    2014-10-01

    Somatic mutations in PRKACA gene, encoding the catalytic subunit of protein kinase A (PKA), have been recently found in a high proportion of sporadic adenomas associated with Cushing's syndrome. The aim was to analyze the PRKACA mutation in a large cohort of patients with adrenocortical masses. Samples from nine European centers were included (Germany, n = 4; Italy, n = 4; France, n = 1). Samples were drawn from 149 patients with nonsecreting adenomas (n = 32 + 2 peritumoral), subclinical hypercortisolism (n = 36), Cushing's syndrome (n = 64 + 2 peritumoral), androgen-producing tumors (n = 4), adrenocortical carcinomas (n = 5 + 2 peritumoral), and primary bilateral macronodular adrenal hyperplasias (n = 8). Blood samples were available from patients with nonsecreting adenomas (n = 15), subclinical hypercortisolism (n = 10), and Cushing's syndrome (n = 35). Clinical and hormonal data were collected. DNA amplification by PCR of exons 6 and 7 of the PRKACA gene and direct sequencing were performed. PRKACA heterozygous mutations were found in 22/64 samples of Cushing's syndrome patients (34%). No mutations were found in peritumoral tissue and blood samples or in other tumors examined. The c.617A>C (p.Leu206Arg) occurred in 18/22 patients. Furthermore, two novel mutations were identified: c.600_601insGTG/p.Cys200_Gly201insVal in three patients and c.639C>G+c.638_640insATTATCCTGAGG/p.Ser213Arg+p.Leu212_Lys214insIle-Ile-Leu-Arg) in one. All the mutations involved a region implicated in interaction between PKA regulatory and catalytic subunits. Patients with somatic PRKACA mutations showed higher levels of cortisol after dexamethasone test and a smaller adenoma size, compared with nonmutated subjects. These data confirm and extend previous observations that somatic PRKACA mutations are specific for adrenocortical adenomas causing Cushing's syndrome.

  10. A mild phenotype of dihydropyrimidine dehydrogenase deficiency and developmental retardation associated with a missense mutation affecting cofactor binding

    Weidensee, Sabine; Goettig, Peter; Bertone, Marko; Haas, Dorothea; Magdolen, Viktor; Kiechle, Marion; Meindl, Alfons; van Kuilenburg, André B. P.; Gross, Eva

    2011-01-01

    Evaluation of a non-synonymous mutation associated with dihydropyrimidine dehydrogenase (DPD) deficiency. DPD enzyme analysis, mutation analysis and molecular dynamics simulations based on the 3D-model of DPD. The substitution Lys63Glu is likely to affect the FAD binding pocket within the DPD

  11. ramR Mutations Affecting Fluoroquinolone Susceptibility in Epidemic Multidrug-Resistant Salmonella enterica Serovar Kentucky ST198

    Axel eCloeckaert

    2013-07-01

    Full Text Available A screening for non-target mutations affecting fluoroquinolone susceptibility was conducted in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198. Among a panel of representative isolates (n=30, covering the epidemic, only three showed distinct mutations in ramR resulting in enhanced expression of genes encoding the AcrAB-TolC efflux system and low increase in ciprofloxacin MIC. No mutations were detected in other regulatory regions of this efflux system. Ciprofloxacin resistance in serovar Kentucky ST198 is thus currently mainly due to multiple target gene mutations.

  12. A kinase-dead knock-in mutation in mTOR leads to early embryonic lethality and is dispensable for the immune system in heterozygous mice

    Cavender Druie

    2009-05-01

    Full Text Available Abstract Background The mammalian target of rapamycin protein (mTOR is an evolutionarily conserved kinase that regulates protein synthesis, cell cycle progression and proliferation in response to various environmental cues. As a critical downstream mediator of PI3K signaling, mTOR is important for lymphocyte development and function of mature T and B-cells. Most studies of mTOR in immune responses have relied on the use of pharmacological inhibitors, such as rapamycin. Rapamycin-FKBP12 complex exerts its immunosuppressive and anti-proliferative effect by binding outside the kinase domain of mTOR, and subsequently inhibiting downstream mTOR signaling. Results To determine the requirement for mTOR kinase activity in the immune system function, we generated knock-in mice carrying a mutation (D2338 in the catalytic domain of mTOR. While homozygous mTOR kd/kd embryos died before embryonic day 6.5, heterozygous mTOR+/kd mice appeared entirely normal and are fertile. mTOR +/kd mice exhibited normal T and B cell development and unaltered proliferative responses of splenocytes to IL-2 and TCR/CD28. In addition, heterozygousity for the mTOR kinase-dead allele did not sensitize T cells to rapamycin in a CD3-mediated proliferation assay. Unexpectedly, mTOR kinase activity towards its substrate 4E-BP1 was not decreased in hearts and livers from heterozygous animals. Conclusion Altogether, our findings indicate that mTOR kinase activity is indispensable for the early development of mouse embryos. Moreover, a single wild type mTOR allele is sufficient to maintain normal postnatal growth and lymphocyte development and proliferation.

  13. Two novel mutations in the BCKDK (branched-chain keto-acid dehydrogenase kinase) gene are responsible for a neurobehavioral deficit in two pediatric unrelated patients.

    García-Cazorla, Angels; Oyarzabal, Alfonso; Fort, Joana; Robles, Concepción; Castejón, Esperanza; Ruiz-Sala, Pedro; Bodoy, Susanna; Merinero, Begoña; Lopez-Sala, Anna; Dopazo, Joaquín; Nunes, Virginia; Ugarte, Magdalena; Artuch, Rafael; Palacín, Manuel; Rodríguez-Pombo, Pilar; Alcaide, Patricia; Navarrete, Rosa; Sanz, Paloma; Font-Llitjós, Mariona; Vilaseca, Ma Antonia; Ormaizabal, Aida; Pristoupilova, Anna; Agulló, Sergi Beltran

    2014-04-01

    Inactivating mutations in the BCKDK gene, which codes for the kinase responsible for the negative regulation of the branched-chain α-keto acid dehydrogenase complex (BCKD), have recently been associated with a form of autism in three families. In this work, two novel exonic BCKDK mutations, c.520C>G/p.R174G and c.1166T>C/p.L389P, were identified at the homozygous state in two unrelated children with persistently reduced body fluid levels of branched-chain amino acids (BCAAs), developmental delay, microcephaly, and neurobehavioral abnormalities. Functional analysis of the mutations confirmed the missense character of the c.1166T>C change and showed a splicing defect r.[520c>g;521_543del]/p.R174Gfs1*, for c.520C>G due to the presence of a new donor splice site. Mutation p.L389P showed total loss of kinase activity. Moreover, patient-derived fibroblasts showed undetectable (p.R174Gfs1*) or barely detectable (p.L389P) levels of BCKDK protein and its phosphorylated substrate (phospho-E1α), resulting in increased BCKD activity and the very rapid BCAA catabolism manifested by the patients' clinical phenotype. Based on these results, a protein-rich diet plus oral BCAA supplementation was implemented in the patient homozygous for p.R174Gfs1*. This treatment normalized plasma BCAA levels and improved growth, developmental and behavioral variables. Our results demonstrate that BCKDK mutations can result in neurobehavioral deficits in humans and support the rationale for dietary intervention. © 2014 WILEY PERIODICALS, INC.

  14. TG101209, a small molecule JAK2-selective kinase inhibitor potently inhibits myeloproliferative disorder-associated JAK2V617F and MPLW515L/K mutations.

    Pardanani, A; Hood, J; Lasho, T; Levine, R L; Martin, M B; Noronha, G; Finke, C; Mak, C C; Mesa, R; Zhu, H; Soll, R; Gilliland, D G; Tefferi, A

    2007-08-01

    JAK2V617F and MPLW515L/K represent recently identified mutations in myeloproliferative disorders (MPD) that cause dysregulated JAK-STAT signaling, which is implicated in MPD pathogenesis. We developed TG101209, an orally bioavailable small molecule that potently inhibits JAK2 (IC(50)=6 nM), FLT3 (IC(50)=25 nM) and RET (IC(50)=17 nM) kinases, with significantly less activity against other tyrosine kinases including JAK3 (IC(50)=169 nM). TG101209 inhibited growth of Ba/F3 cells expressing JAK2V617F or MPLW515L mutations with an IC(50) of approximately 200 nM. In a human JAK2V617F-expressing acute myeloid leukemia cell line, TG101209-induced cell cycle arrest and apoptosis, and inhibited phosphorylation of JAK2V617F, STAT5 and STAT3. Therapeutic efficacy of TG101209 was demonstrated in a nude mouse model. Furthermore, TG101209 suppressed growth of hematopoietic colonies from primary progenitor cells harboring JAK2V617F or MPL515 mutations.

  15. Activity of EGFR-tyrosine kinase and ALK inhibitors for EML4–ALK-rearranged non–small–cell lung cancer harbored coexisting EGFR mutation

    Miyanaga, Akihiko; Kawamoto, Masashi; Tsuchiya, Shinichi; Hagiwara, Koichi; Soda, Manabu; Takeuchi, Kengo; Yamamoto, Nobuyuki; Mano, Hiroyuki; Ishikawa, Yuichi; Gemma, Akihiko; Shimizu, Kumi; Noro, Rintaro; Seike, Masahiro; Kitamura, Kazuhiro; Kosaihira, Seiji; Minegishi, Yuji; Shukuya, Takehito; Yoshimura, Akinobu

    2013-01-01

    The EML4–ALK (echinoderm microtubule-associated protein-like 4 gene and the anaplastic lymphoma kinase gene) fusion oncogene represents a novel molecular target in a small subset of non–small–cell lung cancers (NSCLCs). The EML4–ALK fusion gene occurs generally in NSCLC without mutations in epidermal growth factor receptor (EGFR) and KRAS. We report that a case of EML4–ALK-positive NSCLC with EGFR mutation had a response of stable disease to both an EGFR tyrosine kinase inhibitor (EGFR-TKI) and ALK inhibitor. We described the first clinical report of a patient with EML4–ALK-positive NSCLC with EGFR mutation that had a response of stable disease to both single-agent EGFR-TKI and ALK inhibitor. EML4–ALK translocation may be associated with resistance to EGFR-TKI, and EGFR signaling may contribute to resistance to ALK inhibitor in EML4–ALK-positive NSCLC

  16. Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation testing in adults with locally advanced or metastatic non-small cell lung cancer: A systematic review and cost-effectiveness analysis

    Westwood, Marie; Joore, Manuela; Whiting, Penny; Asselt, Thea; Ramaekers, Bram; Armstrong, Nigel; Misso, Kate; Severens, Hans; Kleijnen, Jos

    2014-01-01

    markdownabstract__Abstract__ Background: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment with standard chemotherapy. Patients with NSCLC are therefore tested for EGFR-TK tumour gene mutations to inform treatment decisions. There are a variety of tests available to detect these mutations. T...

  17. MED and PSACH COMP mutations affect chondrogenesis in chicken limb bud micromass cultures.

    Roman-Blas, J; Dion, A S; Seghatoleslami, M R; Giunta, K; Oca, P; Jimenez, S A; Williams, C J

    2010-09-01

    Mutations in cartilage oligomeric matrix protein (COMP) cause pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). We studied the effects of over-expression of wild type and mutant COMP on early stages of chondrogenesis in chicken limb bud micromass cultures. Cells were transduced with RCAS virus harboring wild type or mutant (C328R, PSACH; T585R, MED) COMP cDNAs and cultured for 3, 4, and 5 days. The effect of COMP constructs on chondrogenesis was assessed by analyzing mRNA and protein expression of several COMP binding partners. Cell viability was assayed, and evaluation of apoptosis was performed by monitoring caspase 3 processing. Over-expression of COMP, and especially expression of COMP mutants, had a profound affect on the expression of syndecan 3 and tenascin C, early markers of chondrogenesis. Over-expression of COMP did not affect levels of type II collagen or matrilin-3; however, there were increases in type IX collagen expression and sulfated proteoglycan synthesis, particularly at day 5 of harvest. In contrast to cells over-expressing COMP, cells with mutant COMP showed reduction in type IX collagen expression and increased matrilin 3 expression. Finally, reduction in cell viability, and increased activity of caspase 3, at days 4 and 5, were observed in cultures expressing either wild type or mutant COMP. MED, and PSACH mutations, despite displaying phenotypic differences, demonstrated only subtle differences in their cellular viability and mRNA and protein expression of components of the extracellular matrix, including those that interact with COMP. These results suggest that COMP mutations, by disrupting normal interactions between COMP and its binding partners, significantly affect chondrogenesis. (c) 2010 Wiley-Liss, Inc.

  18. A New Generalizable Test for Detection of Mutations Affecting Tn10 Transposition

    Huisman, Olivier; Kleckner, Nancy

    1987-01-01

    We describe here a new rapid screen that allows easy detection of transposon or host mutations that affect Tn10 transposition in Escherichia coli. This test involves a new Tn10 derivative called the "mini-lacZ-kanR fusion hopper" or mini-Tn10-LK for short. This element does not direct expression of β-galactosidase when present at its original starting location on a suitably engineered plasmid or phage genome because it lacks appropriate transcription and translation start signals. However, t...

  19. Adenylate kinase I does not affect cellular growth characteristics under normal and metabolic stress conditions.

    Bruin, W.C.C. de; Oerlemans, F.T.J.J.; Wieringa, B.

    2004-01-01

    Adenylate kinase (AK)-catalyzed phosphotransfer is essential in the maintenance of cellular energetic economy in cells of fully differentiated tissues with highly variable energy demand, such as muscle and brain. To investigate if AK isoenzymes have a comparable function in the energy-demand

  20. Prevalence of GJB2 Mutations in Affected Individuals from United Arab Emirates with Autosomal Recessive Nonsyndromic Hearing Loss.

    Tlili, Abdelaziz; Al Mutery, Abdullah; Kamal Eddine Ahmad Mohamed, Walaa; Mahfood, Mona; Hadj Kacem, Hassen

    2017-11-01

    Mutations in the gap junction protein beta 2 (GJB2) gene are responsible for more cases of nonsyndromic recessive hearing loss than any other gene. The purpose of our study was to evaluate the prevalence of GJB2 mutations among affected individuals from United Arab Emirates (UAE). There were 50 individuals diagnosed with hereditary hearing loss and 120 healthy individuals enrolled in the study. The Sanger sequencing method was used to screen the GJB2 coding region in all affected individuals. The c.-1G>A variant was determined by the polymerase chain reaction-restriction fragment length polymorphism method in normal individuals. Nine cases with bi-allelic mutations and three cases with mono-allelic mutations were detected in 12 out of 50 patients (24%). The homozygous mutation c.35delG was identified as the cause of hearing loss in six participants (12%). The mutation c.506G>A was identified in three affected individuals (6%). The allelic frequency (14%) and low percentage of individuals that were homozygous (2%) for the c.35delG mutation suggest that there are other genes responsible for nonsyndromic deafness in the UAE population. The results reported here are a preliminary step in collecting epidemiological data regarding autosomal recessive nonsyndromic hearing loss related to GJB2 gene mutations among the UAE population. The c.35delG mutation of the GJB2 gene is the most frequently seen causative mutation in the UAE and is followed by the p.Cys169Tyr mutation.

  1. Localization of active, dually phosphorylated extracellular signal-regulated kinase 1 and 2 in colorectal cancer with or without activating BRAF and KRAS mutations

    Holck, Susanne; Bonde, Jesper; Pedersen, Helle

    2016-01-01

    Colorectal cancers (CRC) often show activating mutations of the KRAS or BRAF genes, which stimulate the extracellular signal-regulated kinase (ERK) pathway, thus increasing cell proliferation and inhibiting apoptosis. However, immunohistochemical results on ERK activation in such tumors differ...... detectable increases in phosphorylation of ERK (pERK), we stained biopsies from 36 CRC patients with activating mutations in the BRAF gene (BRAFV600E: BRAF(m)), the KRAS gene (KRAS(m)) or in neither (BRAF/KRAS(n)) with this optimized method. Staining was scored in blind-coded specimens by two observers....... Staining of stromal cells was used as a positive control. BRAF(m) or KRAS(m) tumors did not show higher staining scores than BRAF/KRAS(n) tumors. Although BRAFV600E staining occurred in over 90% of cancer cells in all 9 BRAF(m) tumors, 3 only showed staining for pERK in less than 10% of cancer cell nuclei...

  2. Loss of mutL homolog-1 (MLH1) expression promotes acquisition of oncogenic and inhibitor-resistant point mutations in tyrosine kinases.

    Springuel, Lorraine; Losdyck, Elisabeth; Saussoy, Pascale; Turcq, Béatrice; Mahon, François-Xavier; Knoops, Laurent; Renauld, Jean-Christophe

    2016-12-01

    Genomic instability drives cancer progression by promoting genetic abnormalities that allow for the multi-step clonal selection of cells with growth advantages. We previously reported that the IL-9-dependent TS1 cell line sequentially acquired activating substitutions in JAK1 and JAK3 upon successive selections for growth factor independent and JAK inhibitor-resistant cells, suggestive of a defect in mutation avoidance mechanisms. In the first part of this paper, we discovered that the gene encoding mutL homolog-1 (MLH1), a key component of the DNA mismatch repair system, is silenced by promoter methylation in TS1 cells. By means of stable ectopic expression and RNA interference methods, we showed that the high frequencies of growth factor-independent and inhibitor-resistant cells with activating JAK mutations can be attributed to the absence of MLH1 expression. In the second part of this paper, we confirm the clinical relevance of our findings by showing that chronic myeloid leukemia relapses upon ABL-targeted therapy correlated with a lower expression of MLH1 messenger RNA. Interestingly, the mutational profile observed in our TS1 model, characterized by a strong predominance of T:A>C:G transitions, was identical to the one described in the literature for primitive cells derived from chronic myeloid leukemia patients. Taken together, our observations demonstrate for the first time a causal relationship between MLH1-deficiency and incidence of oncogenic point mutations in tyrosine kinases driving cell transformation and acquired resistance to kinase-targeted cancer therapies.

  3. A Novel KCNJ2 Mutation Identified in an Autistic Proband Affects the Single Channel Properties of Kir2.1

    Anna Binda

    2018-03-01

    Full Text Available Inwardly rectifying potassium channels (Kir have been historically associated to several cardiovascular disorders. In particular, loss-of-function mutations in the Kir2.1 channel have been reported in cases affected by Andersen-Tawil syndrome while gain-of-function mutations in the same channel cause the short QT3 syndrome. Recently, a missense mutation in Kir2.1, as well as mutations in the Kir4.1, were reported to be involved in autism spectrum disorders (ASDs suggesting a role of potassium channels in these diseases and introducing the idea of the existence of K+ channel ASDs. Here, we report the identification in an Italian affected family of a novel missense mutation (p.Phe58Ser in the KCNJ2 gene detected in heterozygosity in a proband affected by autism and borderline for short QT syndrome type 3. The mutation is located in the N-terminal region of the gene coding for the Kir2.1 channel and in particular in a very conserved domain. In vitro assays demonstrated that this mutation results in an increase of the channel conductance and in its open probability. This gain-of-function of the protein is consistent with the autistic phenotype, which is normally associated to an altered neuronal excitability.

  4. Four-channel asymmetric Real-Time PCR hybridization probe assay: a rapid pre-screening method for critical BCR-ABL kinase domain mutations.

    Martinez-Serra, Jordi; Gutiérrez, Antonio; Marcús, Toni F; Soverini, Simona; Amat, Juan Carlos; Navarro-Palou, María; Ros, Teresa; Bex, Teresa; Ballester, Carmen; Bauça, Josep Miquel; SanFelix, Sara; Novo, Andrés; Vidal, Carmen; Santos, Carmen; Besalduch, Joan

    2012-03-01

    Within the laboratory protocols, used for the study of BCR-ABL resistance mutations in chronic myeloid leukemia patients treated with Imatinib, direct sequencing remains the reference method. Since the incidence of patients with a mutation-related loss of response is not very high, it is very useful in the routine laboratory to perform a fast pre-screening method. With this in mind, we have designed a new technique, based on a single Real-Time FRET-based PCR, followed by a study of melting peaks. This new tool, developed in a LightCycler 2.0, combines four different fluorescence channels for the simultaneous detection, in a single close tube, of critical mutations within the ABL kinase domain. Assay evaluation performed on 33 samples, previously genotyped by sequentiation, resulted in full concordance of results. This new methodology detects in a few steps the presence of critical mutations associated to Imatinib resistance. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Acquired resistance mechanisms to tyrosine kinase inhibitors in lung cancer with activating epidermal growth factor receptor mutation--diversity, ductility, and destiny.

    Suda, Kenichi; Mizuuchi, Hiroshi; Maehara, Yoshihiko; Mitsudomi, Tetsuya

    2012-12-01

    Lung cancers that harbor somatic activating mutations in the gene for the epidermal growth factor receptor (EGFR) depend on mutant EGFR for their proliferation and survival; therefore, lung cancer patients with EGFR mutations often dramatically respond to orally available EGFR tyrosine kinase inhibitors (TKIs). However, emergence of acquired resistance is virtually inevitable, thus limiting improvement in patient outcomes. To elucidate and overcome this acquired resistance, multidisciplinary basic and clinical investigational approaches have been applied, using in vitro cell line models or samples obtained from lung cancer patients treated with EGFR-TKIs. These efforts have revealed several acquired resistance mechanisms and candidates, including EGFR secondary mutations (T790M and other rare mutations), MET amplification, PTEN downregulation, CRKL amplification, high-level HGF expression, FAS-NFκB pathway activation, epithelial-mesenchymal transition, and conversion to small cell lung cancer. Interestingly, cancer cells harbor potential destiny and ductility together in acquiring resistance to EGFR-TKIs, as shown in in vitro acquired resistance models. Molecular mechanisms of "reversible EGFR-TKI tolerance" that occur in early phase EGFR-TKI exposure have been identified in cell line models. Furthermore, others have reported molecular markers that can predict response to EGFR-TKIs in clinical settings. Deeper understanding of acquired resistance mechanisms to EGFR-TKIs, followed by the development of molecular target drugs that can overcome the resistance, might turn this fatal disease into a chronic disorder.

  6. Affect of Presenilin Mutations on APP Cleavage; Insights into the Pathogenesis of FAD

    Nuomin eLi

    2016-03-01

    Full Text Available Alzheimer disease (AD is characterized by progressive memory loss, reduction in cognitive functions, and damage to the brain. The β-amyloid precursor protein can be sequentially cleaved by β- secretase and γ-secretase. Mutations in the presenilin1(PS1) are the most common cause of Familial Alzheimer’s disease ( FAD. PS1 mutations can alter the activity of γ-secretase on the cleavage of the β-amyloid precursor protein, causing increased Aβ production. Previous studies show that the βAPP-C-terminal fragment is first cleaved by β-scretase, primarily generating long fragments of Aβ48 and Aβ49, followed by the stepwise cleavage of every three amino acid residues at the C terminus, resulting in Aβ48-, 45-, 42 line and Aβ49-, 46-, 43-, 40 line. Here, we used LC-MS/MS to analyze unique peptides IAT, VVIA, ITL,TVI,IVI through sequential cleavage, combined with ELISA to test the level of Aβ42 and Aβ40 for validation. The results show that most FAD mutant PS1 can alter the level of Aβ42 and Aβ40 monitored by the Aβ42/Aβ40 ratio. Among them, 6 mutants (I143T, H163P, S170F, Q223R, M233V and G384A affect the Aβ42/40 ratio through both Aβ49-40 and Aβ48-38 lines; L166P through decreasing the Aβ49-40 line, 6 mutants (I143V, M146V, G217A, E280A, L381V and L392V through increasing the Aβ48-42 line. More importantly, we found some mutations can affect the γ-secretase cleavage preference of α-CTF and β-CTF. In conclusion, we found that the FAD PS1 mutations mainly increase the generation of Aβ42 by decreasing the cleavage of Aβ42-Aβ38 and Aβ43-Aβ40.

  7. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  8. Identification of a novel mutation in WFS1 in a family affected by low-frequency hearing impairment

    Kunz, Juergen; Marquez-Klaka, Ben; Uebe, Steffen; Volz-Peters, Anja; Berger, Roswitha; Rausch, Peter

    2003-04-09

    Previously we confirmed linkage of autosomal dominantly inherited low-frequency sensorineural hearing impairment (LFSNHI) in a German family to the genetic locus DFNA6/DFNA14 on chromosome 4p16.3 close to the markers D4S432 and D4S431. Analysis of data from the Human Genome Project, showed that WFS1 is located in this region. Mutations in WFS1 are known to be responsible for Wolfram syndrome (DIDMOAD, MIM no. 606201), which follows an autosomal recessive trait. Studies in low-frequency hearing loss families showed that mutations in WFS1 were responsible for the phenotype. In all affected family members analysed, we detected a missense mutation in WFS1 (K705N) and therefore confirm the finding that the majority of mutations responsible for LFSNHI are missense mutations which localise to the C-terminal domain of the protein.

  9. Identification of a novel mutation in WFS1 in a family affected by low-frequency hearing impairment

    Kunz, Juergen; Marquez-Klaka, Ben; Uebe, Steffen; Volz-Peters, Anja; Berger, Roswitha; Rausch, Peter

    2003-01-01

    Previously we confirmed linkage of autosomal dominantly inherited low-frequency sensorineural hearing impairment (LFSNHI) in a German family to the genetic locus DFNA6/DFNA14 on chromosome 4p16.3 close to the markers D4S432 and D4S431. Analysis of data from the Human Genome Project, showed that WFS1 is located in this region. Mutations in WFS1 are known to be responsible for Wolfram syndrome (DIDMOAD, MIM no. 606201), which follows an autosomal recessive trait. Studies in low-frequency hearing loss families showed that mutations in WFS1 were responsible for the phenotype. In all affected family members analysed, we detected a missense mutation in WFS1 (K705N) and therefore confirm the finding that the majority of mutations responsible for LFSNHI are missense mutations which localise to the C-terminal domain of the protein

  10. wKinMut: An integrated tool for the analysis and interpretation of mutations in human protein kinases

    Gonzalez-Izarzugaza, Jose Maria; Vazquez, Miguel; del Pozo, Angela

    2013-01-01

    mutation remains a considerable challenge. Results The wKinMut web-server offers direct prediction of the potential pathogenicity of the mutations from a number of methods, including our recently developed prediction method based on the combination of information from a range of diverse sources, including...

  11. High-throughput genotyping in metastatic esophageal squamous cell carcinoma identifies phosphoinositide-3-kinase and BRAF mutations.

    Chi Hoon Maeng

    Full Text Available Given the high incidence of metastatic esophageal squamous cell carcinoma, especially in Asia, we screened for the presence of somatic mutations using OncoMap platform with the aim of defining subsets of patients who may be potential candidate for targeted therapy.We analyzed 87 tissue specimens obtained from 80 patients who were pathologically confirmed with esophageal squamous cell carcinoma and received 5-fluoropyrimidine/platinum-based chemotherapy. OncoMap 4.0, a mass-spectrometry based assay, was used to interrogate 471 oncogenic mutations in 41 commonly mutated genes. Tumor specimens were prepared from primary cancer sites in 70 patients and from metastatic sites in 17 patients. In order to test the concordance between primary and metastatic sites from the patient for mutations, we analyzed 7 paired (primary-metastatic specimens. All specimens were formalin-fixed paraffin embedded tissues and tumor content was >70%.In total, we have detected 20 hotspot mutations out of 80 patients screened. The most frequent mutation was PIK3CA mutation (four E545K, five H1047R and one H1047L (N = 10, 11.5% followed by MLH1 V384D (N = 7, 8.0%, TP53 (R306, R175H and R273C (N = 3, 3.5%, BRAF V600E (N = 1, 1.2%, CTNNB1 D32N (N = 1, 1.2%, and EGFR P733L (N = 1, 1.2%. Distributions of somatic mutations were not different according to anatomic sites of esophageal cancer (cervical/upper, mid, lower. In addition, there was no difference in frequency of mutations between primary-metastasis paired samples.Our study led to the detection of potentially druggable mutations in esophageal SCC which may guide novel therapies in small subsets of esophageal cancer patients.

  12. Phosphorylation of Staphylococcus aureus Protein-Tyrosine Kinase Affects the Function of Glucokinase and Biofilm Formation.

    Vasu, Dudipeta; Kumar, Pasupuleti Santhosh; Prasad, Uppu Venkateswara; Swarupa, Vimjam; Yeswanth, Sthanikam; Srikanth, Lokanathan; Sunitha, Manne Mudhu; Choudhary, Abhijith; Sarma, Potukuchi Venkata Gurunadha Krishna

    2017-03-01

    When Staphylococcus aureus is grown in the presence of high concentration of external glucose, this sugar is phosphorylated by glucokinase (glkA) to form glucose-6-phosphate. This product subsequently enters into anabolic phase, which favors biofilm formation. The presence of ROK (repressor protein, open reading frame, sugar kinase) motif, phosphate-1 and -2 sites, and tyrosine kinase sites in glkA of S. aureus indicates that phosphorylation must regulate the glkA activity. The aim of the present study was to identify the effect of phosphorylation on the function of S. aureus glkA and biofilm formation. Pure glkA and protein-tyrosine kinase (BYK) of S. aureus ATCC 12600 were obtained by fractionating the cytosolic fractions of glkA1 and BYK-1 expressing recombinant clones through nickel metal chelate column. The pure glkA was used as a substrate for BYK and the phosphorylation of glkA was confirmed by treating with reagent A and resolving in SDS-PAGE, as well as staining with reagent A. The kinetic parameters of glkA and phosphorylated glkA were determined spectrophotometrically, and in silico tools were used for validation. S. aureus was grown in brain heart infusion broth, which was supplemented with glucose, and then biofilm units were calculated. Fourfold elevated glkA activity was observed upon the phosphorylation by BYK. Protein-protein docking analysis revealed that glkA structure docked close to the adenosine triphosphate-binding site of BYK structure corroborating the kinetic results. Further, S. aureus grown in the presence of elevated glucose concentration exhibited an increase in the rate of biofilm formation. The elevated function of glkA is an essential requirement for increased biofilm units in S. aureus, a key pathogenic factor that helps its survival and spread the infection.

  13. The slaty mutation affects the morphology and maturation of melanosomes in the mouse melanocytes.

    Hirobe, Tomohisa; Abe, Hiroyuki

    2006-10-01

    The slaty (Dct(slt)) mutation is known to reduce the activity of dopachrome tautomerase in melanocytes and to reduce the melanin content in skin, hairs and eyes. Although the melanosomes in slaty melanocytes are reported to be eumelanosome-like, detailed melanosome biogenesis is not well studied. To address this point, melanosomes in neonatal epidermal melanocytes from wild-type (Dct+/Dct+) mice at the slaty locus as well as its congenic mouse mutant (Dct(slt)/Dct(slt)) in serum-free primary culture were observed under the electron microscope. Wild-type melanocytes possessed exclusively elliptical melanosomes with internal longitudinal structures, whereas in mutant melanocytes, numerous spherical melanosomes with globular depositions of pigment and elliptical melanosomes as well as mixed type of the two melanosomes were observed. Mature stage IV melanosomes were greatly decreased in mutant melanocytes, whereas immature stage III melanosomes were more numerous than in wild-type melanocytes. These results suggest that the slaty mutation affects the morphology and maturation of melanosomes in mouse melanocytes.

  14. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  15. Mutations in the RNA-binding domains of tombusvirus replicase proteins affect RNA recombination in vivo

    Panaviene, Zivile; Nagy, Peter D.

    2003-01-01

    RNA recombination, which is thought to occur due to replicase errors during viral replication, is one of the major driving forces of virus evolution. In this article, we show evidence that the replicase proteins of Cucumber necrosis virus, a tombusvirus, are directly involved in RNA recombination in vivo. Mutations within the RNA-binding domains of the replicase proteins affected the frequency of recombination observed with a prototypical defective-interfering (DI) RNA, a model template for recombination studies. Five of the 17 replicase mutants tested showed delay in the formation of recombinants when compared to the wild-type helper virus. Interestingly, two replicase mutants accelerated recombinant formation and, in addition, these mutants also increased the level of subgenomic RNA synthesis (Virology 308 (2003), 191-205). A trans-complementation system was used to demonstrate that mutation in the p33 replicase protein resulted in altered recombination rate. Isolated recombinants were mostly imprecise (nonhomologous), with the recombination sites clustered around a replication enhancer region and a putative cis-acting element, respectively. These RNA elements might facilitate the proposed template switching events by the tombusvirus replicase. Together with data in the article cited above, results presented here firmly establish that the conserved RNA-binding motif of the replicase proteins is involved in RNA replication, subgenomic RNA synthesis, and RNA recombination

  16. CK1δ in lymphoma: gene expression and mutation analyses and validation of CK1δ kinase activity for therapeutic application

    Brigitte Sophia Winkler

    2015-02-01

    Full Text Available The prognosis of lymphoid neoplasms has improved considerably during the last decades. However, treatment response for some lymphoid neoplasms is still poor, indicating the need for new therapeutic approaches. One promising new strategy is the inhibition of kinases regulating key signal transduction pathways, which are of central importance in tumorigenesis. Kinases of the CK1 family may represent an attractive drug target since CK1 expression and/or activity are associated with the pathogenesis of malignant diseases. Over the last years efforts were taken to develop highly potent and selective CK1-specific inhibitor compounds and their therapeutic potential has now to be proved in pre-clinical trials. Therefore, we analyzed expression and mutational status of CK1δ in several cell lines representing established lymphoma entities, and also measured the mRNA expression level in primary lymphoma tissue as well as non-neoplastic blood cells. For a selection of lymphoma cell lines we furthermore determined CK1δ kinase activity and demonstrated therapeutic potential of CK1-specific inhibitors as a putative therapeutic option in the treatment of lymphoid neoplasms.

  17. Affected female carriers of MTM1 mutations display a wide spectrum of clinical and pathological involvement: delineating diagnostic clues

    Biancalana, V.; Scheidecker, S.; Miguet, M.; Laquerriere, A.; Romero, N.B.; Stojkovic, T.; Neto, O. Abath; Mercier, S.; Voermans, N.C.; Tanner, L.; Rogers, C.; Ollagnon-Roman, E.; Roper, H.; Boutte, C.; Ben-Shachar, S.; Lornage, X.; Vasli, N.; Schaefer, E.; Laforet, P.; Pouget, J.; Moerman, A.; Pasquier, L.; Marcorelle, P.; Magot, A.; Kusters, B.; Streichenberger, N.; Tranchant, C.; Dondaine, N.; Schneider, R.; Gasnier, C.; Calmels, N.; Kremer, V.; Nguyen, K. Van; Perrier, J.; Kamsteeg, E.J.; Carlier, P.; Carlier, R.Y.; Thompson, J.; Boland, A.; Deleuze, J.F.; Fardeau, M.; Zanoteli, E.; Eymard, B.; Laporte, J.

    2017-01-01

    X-linked myotubular myopathy (XLMTM), a severe congenital myopathy, is caused by mutations in the MTM1 gene located on the X chromosome. A majority of affected males die in the early postnatal period, whereas female carriers are believed to be usually asymptomatic. Nevertheless, several affected

  18. Novel somatic mutations in large granular lymphocytic leukemia affecting the STAT-pathway and T-cell activation

    Andersson, E I; Rajala, H L M; Eldfors, S; Ellonen, P; Olson, T; Jerez, A; Clemente, M J; Kallioniemi, O; Porkka, K; Heckman, C; Loughran, T P Jr; Maciejewski, J P; Mustjoki, S

    2013-01-01

    T-cell large granular lymphocytic (T-LGL) leukemia is a clonal disease characterized by the expansion of mature CD3+CD8+ cytotoxic T cells. It is often associated with autoimmune disorders and immune-mediated cytopenias. Our recent findings suggest that up to 40% of T-LGL patients harbor mutations in the STAT3 gene, whereas STAT5 mutations are present in 2% of patients. In order to identify putative disease-causing genetic alterations in the remaining T-LGL patients, we performed exome sequencing from three STAT mutation-negative patients and validated the findings in 113 large granular lymphocytic (LGL) leukemia patients. On average, 11 CD8+ LGL leukemia cell-specific high-confidence nonsynonymous somatic mutations were discovered in each patient. Interestingly, all patients had at least one mutation that affects either directly the STAT3-pathway (such as PTPRT) or T-cell activation (BCL11B, SLIT2 and NRP1). In all three patients, the STAT3 pathway was activated when studied by RNA expression or pSTAT3 analysis. Screening of the remaining 113 LGL leukemia patients did not reveal additional patients with same mutations. These novel mutations are potentially biologically relevant and represent rare genetic triggers for T-LGL leukemia, and are associated with similar disease phenotype as observed in patients with mutations in the STAT3 gene

  19. AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages.

    Marina Kemmerer

    Full Text Available AMP-activated protein kinase (AMPK maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO. The transcription factor peroxisome proliferator-activated receptor δ (PPARδ also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload.

  20. Inhibition of protein kinase C affects on mode of synaptic vesicle exocytosis due to cholesterol depletion

    Petrov, Alexey M., E-mail: fysio@rambler.ru; Zakyrjanova, Guzalija F., E-mail: guzik121192@mail.ru; Yakovleva, Anastasia A., E-mail: nastya1234qwer@mail.ru; Zefirov, Andrei L., E-mail: zefiroval@rambler.ru

    2015-01-02

    Highlights: • We examine the involvement of PKC in MCD induced synaptic vesicle exocytosis. • PKC inhibitor does not decrease the effect MCD on MEPP frequency. • PKC inhibitor prevents MCD induced FM1-43 unloading. • PKC activation may switch MCD induced exocytosis from kiss-and-run to a full mode. • Inhibition of phospholipase C does not lead to similar change in exocytosis. - Abstract: Previous studies demonstrated that depletion of membrane cholesterol by 10 mM methyl-beta-cyclodextrin (MCD) results in increased spontaneous exocytosis at both peripheral and central synapses. Here, we investigated the role of protein kinase C in the enhancement of spontaneous exocytosis at frog motor nerve terminals after cholesterol depletion using electrophysiological and optical methods. Inhibition of the protein kinase C by myristoylated peptide and chelerythrine chloride prevented MCD-induced increases in FM1-43 unloading, whereas the frequency of spontaneous postsynaptic events remained enhanced. The increase in FM1-43 unloading still could be observed if sulforhodamine 101 (the water soluble FM1-43 quencher that can pass through the fusion pore) was added to the extracellular solution. This suggests a possibility that exocytosis of synaptic vesicles under these conditions could occur through the kiss-and-run mechanism with the formation of a transient fusion pore. Inhibition of phospholipase C did not lead to similar change in MCD-induced exocytosis.

  1. An ethanolamine kinase Eki1 affects radial growth and cell wall integrity in Trichoderma reesei.

    He, Ronglin; Guo, Wei; Zhang, Dongyuan

    2015-09-01

    Ethanolamine kinase (ATP:ethanolamine O-phosphotransferase, EC 2.7.1.82) catalyzes the committed step of phosphatidylethanolamine synthesis via the CDP-ethanolamine pathway. The functions of eki genes that encode ethanolamine kinase have been intensively studied in mammalian cells, fruit flies and yeast. However, the role of the eki gene has not yet been characterized in filamentous fungi. In this study, Treki1, an ortholog of Saccharomyces cerevisiae EKI1, was identified and functionally characterized using a target gene deletion strategy in Trichoderma reesei. A Treki deletion mutant was less sensitive to cell wall stressors calcofluor white and Congo red and released fewer protoplasts during cell wall digestion than the parent strain QM9414. Further transcription analysis showed that the expression levels of five genes that encode chitin synthases were drastically increased in the ΔTreki1 mutant. The chitin content was also increased in the null mutant of Treki1 comparing to the parent strain. In addition, the ΔTreki1 mutant exhibited defects in radial growth, conidiation and the accumulation of ethanolamine. The results indicate that Treki1 plays a key role in growth and development and in the maintenance of cell wall integrity in T. reesei. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Phosphatidyl inositol-3 kinase (PIK3CA) E545K mutation confers cisplatin resistance and a migratory phenotype in cervical cancer cells

    Arjumand, Wani; Merry, Cole D.; Wang, Chen; Saba, Elias; McIntyre, John B.; Fang, Shujuan; Kornaga, Elizabeth; Ghatage, Prafull; Doll, Corinne M.; Lees, Susan P.

    2016-01-01

    The phosphatidylinositol-3 kinase (PI3K)/Akt/mTOR signaling pathway is activated in many human cancers. Previously, we reported that patients with early stage cervical cancer whose tumours harbour PIK3CA exon 9 or 20 mutations have worse overall survival in response to treatment with radiation and cisplatin than patients with wild-type PIK3CA. The purpose of this study was to determine whether PIK3CA-E545K mutation renders cervical cancer cells more resistant to cisplatin and/or radiation, and whether PI3K inhibition reverses the phenotype. We found that CaSki cells that are heterozygous for the PIK3CA-E545K mutation are more resistant to cisplatin or cisplatin plus radiation than either HeLa or SiHa cells that express only wild-type PIK3CA. Similarly, HeLa cells engineered to stably express PIK3CA-E545K were more resistant to cisplatin or cisplatin plus radiation than cells expressing only wild-type PIK3CA or with PIK3CA depleted. Cells expressing the PIK3CA-E545K mutation also had constitutive PI3K pathway activation and increased cellular migration and each of these phenotypes was reversed by treatment with the PI3K inhibitor GDC-0941/Pictilisib. Our results suggests that cervical cancer patients whose tumours are positive for the PIK3CA-E545K mutation may benefit from PI3K inhibitor therapy in concert with standard cisplatin and radiation therapy. PMID:27489350

  3. Induced plasmon mutations affecting the growth habit of peanuts, A. hypogaea L

    Levy, A.; Ashri, A.

    1978-01-01

    The effectiveness of the acridines ethidium bromide (EB) and acriflavine in inducing plasmon mutations was compared with the alkylating agents ethyl methanesulphonate (EMS) and diethyl sulphate and to γ-rays. The growth habit (trailing versus bunch) of peanuts (A. hypogaea), controlled by genic-cytoplasmic interactions, was utilized. Breeding tests distinguishing nuclear from plasmon mutations were developed and are described in detail. Plasmon mutations were induced, but there were differences in mutation yields between the cultivars and the mutagens. (Auth.)

  4. Missense mutation in GRN gene affecting RNA splicing and plasma progranulin level in a family affected by frontotemporal lobar degeneration.

    Luzzi, Simona; Colleoni, Lara; Corbetta, Paola; Baldinelli, Sara; Fiori, Chiara; Girelli, Francesca; Silvestrini, Mauro; Caroppo, Paola; Giaccone, Giorgio; Tagliavini, Fabrizio; Rossi, Giacomina

    2017-06-01

    Gene coding for progranulin, GRN, is a major gene linked to frontotemporal lobar degeneration. While most of pathogenic GRN mutations are null mutations leading to haploinsufficiency, GRN missense mutations do not have an obvious pathogenicity, and only a few have been revealed to act through different pathogenetic mechanisms, such as cytoplasmic missorting, protein degradation, and abnormal cleavage by elastase. The aim of this study was to disclose the pathogenetic mechanisms of the GRN A199V missense mutation, which was previously reported not to alter physiological progranulin features but was associated with a reduced plasma progranulin level. After investigating the family pedigree, we performed genetic and biochemical analysis on its members and performed RNA expression studies. We found that the mutation segregates with the disease and discovered that its pathogenic feature is the alteration of GRN mRNA splicing, actually leading to haploinsufficiency. Thus, when facing with a missense GRN mutation, its pathogenetic effects should be investigated, especially if associated with low plasma progranulin levels, to determine its nature of either benign polymorphism or pathogenic mutation. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  6. EGFR mutation is a better predictor of response to tyrosine kinase inhibitors in non-small cell lung carcinoma than FISH, CISH, and immunohistochemistry.

    Sholl, Lynette M; Xiao, Yun; Joshi, Victoria; Yeap, Beow Y; Cioffredi, Leigh-Anne; Jackman, David M; Lee, Charles; Jänne, Pasi A; Lindeman, Neal I

    2010-06-01

    About 10% of patients with non-small cell lung carcinoma (NSCLC) respond to epidermal growth factor receptor (EGFR)-targeted tyrosine kinase inhibitors (TKIs). More than 75% of "responders" have activating mutations in EGFR. However, mutation analysis is not widely available, and proposed alternatives (in situ hybridization and immunohistochemical analysis) have shown inconsistent associations with outcome. Fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), immunohistochemical analysis, and DNA sequencing were compared in this study of 40 NSCLC samples from TKI-treated patients. Response rates were 12 of 19 in EGFR-mutant vs 1 of 20 EGFR wild-type tumors (P = .0001), 7 of 19 FISH+ vs 4 of 17 FISH- tumors (not significant [NS]), 5 of 16 CISH+ vs 6 of 21 CISH- tumors (NS), and 3 of 9 immunohistochemically positive vs 7 of 22 immunohistochemically negative tumors (NS). EGFR mutation was associated with improved progression-free survival (P = .0004). Increased copy number (FISH or CISH) and protein expression (immunohistochemical) did not independently predict outcome. Thus, EGFR sequence analysis was the only method useful for predicting response and progression-free survival following TKI therapy in NSCLC.

  7. A novel mutation in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene associated with a severe Rett phenotype.

    Sprovieri, T; Conforti, F L; Fiumara, A; Mazzei, R; Ungaro, C; Citrigno, L; Muglia, M; Arena, A; Quattrone, A

    2009-02-15

    Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have recently been reported in patients with severe neurodevelopmental disorder characterized by early-onset seizures, infantile spasms, severe psychomotor impairment and very recently, in patients with Rett syndrome (RTT)-like phenotype. Although the involvement of CDKL5 in specific biological pathways and its neurodevelopmental role have not been completely elucidated, the CDKL5 appears to be physiologically related to the MECP2 gene. Here we report on the clinical and CDKL5 molecular investigation in a very unusual RTT case, with severe, early-neurological involvement in which we have shown in a previous report, a novel P388S MECP2 mutation [Conforti et al. (2003); Am J Med Genet A 117A: 184-187]. The patient has had severe psychomotor delay since the first month of life and infantile spasms since age 5 months. Moreover, at age 5 years the patient suddenly presented with renal failure. The severe pattern of symptoms in our patient, similar to a CDKL5 phenotype, prompted us to perform an analysis of the CDKL5, which revealed a novel missense mutation never previously described. The X-inactivation assay was non-informative. In conclusion, this report reinforces the observation that the CDKL5 phenotype overlaps with RTT and that CDKL5 analysis is recommended in patients with a seizure disorder commencing during the first months of life.

  8. De Novo Mutations in Protein Kinase Genes CAMK2A and CAMK2B Cause Intellectual Disability

    Küry, Sébastien; van Woerden, Geeske M; Besnard, Thomas; Proietti Onori, Martina; Latypova, Xénia; Towne, Meghan C; Cho, Megan T.; Prescott, Trine E; Ploeg, Melissa A; Sanders, Jan-Stephan; Stessman, Holly A F; Pujol, Aurora; Distel, Ben; Robak, Laurie A; Bernstein, Jonathan A; Denommé-Pichon, Anne-Sophie; Lesca, Gaëtan; Sellars, Elizabeth A; Berg, Jonathan; Carré, Wilfrid; Busk, Øyvind Løvold; van Bon, Bregje W M; Waugh, Jeff L; Deardorff, Matthew; Hoganson, George E; Bosanko, Katherine B; Johnson, Diana S; Dabir, Tabib; Holla, Øystein Lunde; Sarkar, Ajoy; Tveten, Kristian; de Bellescize, Julitta; Braathen, Geir J; Terhal, Paulien A; Grange, Dorothy K; van Haeringen, Arie; Lam, Christina; Mirzaa, Ghayda; Burton, Jennifer; Bhoj, Elizabeth J.; Douglas, Jessica; Santani, Avni B; Nesbitt, Addie I; Helbig, Katherine L; Andrews, Marisa V; Begtrup, Amber; Tang, Sha; van Gassen, Koen L I; Juusola, Jane; Foss, Kimberly; Enns, Gregory M; Moog, Ute; Hinderhofer, Katrin; Paramasivam, Nagarajan; Lincoln, Sharyn; Kusako, Brandon H; Lindenbaum, Pierre; Charpentier, Eric; Nowak, Catherine B; Cherot, Elouan; Simonet, Thomas; Ruivenkamp, Claudia A L; Hahn, Sihoun; Brownstein, Catherine A; Xia, Fan; Schmitt, Sébastien; Deb, Wallid; Bonneau, Dominique; Nizon, Mathilde; Quinquis, Delphine; Chelly, Jamel; Rudolf, Gabrielle; Sanlaville, Damien; Parent, Philippe; Gilbert-Dussardier, Brigitte; Toutain, Annick; Sutton, Vernon R; Thies, Jenny; Peart-Vissers, Lisenka E L M; Boisseau, Pierre; Vincent, Marie; Grabrucker, Andreas M; Dubourg, Christèle; Tan, Wen-Hann; Verbeek, Nienke E; Granzow, Martin; Santen, Gijs W E; Shendure, Jay; Isidor, Bertrand; Pasquier, Laurent; Redon, Richard; Yang, Yaping; State, Matthew W; Kleefstra, Tjitske; Cogné, Benjamin; Petrovski, Slavé; Retterer, Kyle; Eichler, Evan E.; Rosenfeld, Jill A; Agrawal, Pankaj B; Bézieau, Stéphane; Odent, Sylvie; Elgersma, Ype; Mercier, Sandra

    2017-01-01

    Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study based on a

  9. A randomized assessment of adding the kinase inhibitor lestaurtinib to first-line chemotherapy for FLT3-mutated AML

    Knapper, Steven; Russell, Nigel; Gilkes, Amanda

    2017-01-01

    The clinical benefit of adding FMS-like tyrosine kinase-3 (FLT3)-directed small molecule therapy to standard first-line treatment of acute myeloid leukemia (AML) has not yet been established. As part of the UK AML15 and AML17 trials, patients with previously untreated AML and confirmed FLT3-activ...

  10. Mutations that cause threonine sensitivity identify catalytic and regulatory regions of the aspartate kinase of Saccharomyces cerevisiae

    Arévalo-Rodríguez, M; Calderón, I L; Holmberg, S

    1999-01-01

    The HOM3 gene of Saccharomyces cerevisiae encodes aspartate kinase, which catalyses the first step in the branched pathway leading to the synthesis of threonine and methionine from aspartate. Regulation of the carbon flow into this pathway takes place mainly by feedback inhibition of this enzyme ...

  11. Mutations affecting the SAND domain of DEAF1 cause intellectual disability with severe speech impairment and behavioral problems.

    Vulto-van Silfhout, Anneke T; Rajamanickam, Shivakumar; Jensik, Philip J; Vergult, Sarah; de Rocker, Nina; Newhall, Kathryn J; Raghavan, Ramya; Reardon, Sara N; Jarrett, Kelsey; McIntyre, Tara; Bulinski, Joseph; Ownby, Stacy L; Huggenvik, Jodi I; McKnight, G Stanley; Rose, Gregory M; Cai, Xiang; Willaert, Andy; Zweier, Christiane; Endele, Sabine; de Ligt, Joep; van Bon, Bregje W M; Lugtenberg, Dorien; de Vries, Petra F; Veltman, Joris A; van Bokhoven, Hans; Brunner, Han G; Rauch, Anita; de Brouwer, Arjan P M; Carvill, Gemma L; Hoischen, Alexander; Mefford, Heather C; Eichler, Evan E; Vissers, Lisenka E L M; Menten, Björn; Collard, Michael W; de Vries, Bert B A

    2014-05-01

    Recently, we identified in two individuals with intellectual disability (ID) different de novo mutations in DEAF1, which encodes a transcription factor with an important role in embryonic development. To ascertain whether these mutations in DEAF1 are causative for the ID phenotype, we performed targeted resequencing of DEAF1 in an additional cohort of over 2,300 individuals with unexplained ID and identified two additional individuals with de novo mutations in this gene. All four individuals had severe ID with severely affected speech development, and three showed severe behavioral problems. DEAF1 is highly expressed in the CNS, especially during early embryonic development. All four mutations were missense mutations affecting the SAND domain of DEAF1. Altered DEAF1 harboring any of the four amino acid changes showed impaired transcriptional regulation of the DEAF1 promoter. Moreover, behavioral studies in mice with a conditional knockout of Deaf1 in the brain showed memory deficits and increased anxiety-like behavior. Our results demonstrate that mutations in DEAF1 cause ID and behavioral problems, most likely as a result of impaired transcriptional regulation by DEAF1. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  12. Point mutation in FGF receptor eliminates phosphatidylinositol hydrolysis without affecting mitogenesis.

    Mohammadi, M; Dionne, C A; Li, W; Li, N; Spivak, T; Honegger, A M; Jaye, M; Schlessinger, J

    1992-08-20

    Stimulation of growth factor receptors with tyrosine kinase activity is followed by rapid receptor dimerization, tyrosine autophosphorylation and phosphorylation of signalling molecules such as phospholipase C gamma (PLC gamma) and the ras GTPase-activating protein. PLC gamma and GTPase-activating protein bind to specific tyrosine-phosphorylated regions in growth factor receptors through their src-homologous SH2 domains. Growth factor-induced tyrosine phosphorylation of PLC gamma is essential for stimulation of phosphatidylinositol hydrolysis in vitro and in vivo. We have shown that a short phosphorylated peptide containing tyrosine at position 766 from a conserved region of the fibroblast growth factor (FGF) receptor is a binding site for the SH2 domain of PLC gamma (ref. 8). Here we show that an FGF receptor point mutant in which Tyr 766 is replaced by a phenylalanine residue (Y766F) is unable to associate with and tyrosine-phosphorylate PLC gamma or to stimulate hydrolysis of phosphatidylinositol. Nevertheless, the Y766F FGF receptor mutant can be autophosphorylated, and can phosphorylate several cellular proteins and stimulate DNA synthesis. Our data show that phosphorylation of the conserved Tyr 766 of the FGF receptor is essential for phosphorylation of PLC gamma and for hydrolysis of phosphatidylinositol, but that elimination of this hydrolysis does not affect FGF-induced mitogenesis.

  13. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes.

    Metts, J; West, J; Doares, S H; Matthysse, A G

    1991-02-01

    Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.

  14. Psychological Distress, Anxiety, and Depression of Cancer-Affected BRCA1/2 Mutation Carriers: a Systematic Review.

    Ringwald, Johanna; Wochnowski, Christina; Bosse, Kristin; Giel, Katrin Elisabeth; Schäffeler, Norbert; Zipfel, Stephan; Teufel, Martin

    2016-10-01

    Understanding the intermediate- and long-term psychological consequences of genetic testing for cancer patients has led to encouraging research, but a clear consensus of the psychosocial impact and clinical routine for cancer-affected BRCA1 and BRCA2 mutation carriers is still missing. We performed a systematic review of intermediate- and long-term studies investigating the psychological impact like psychological distress, anxiety, and depression in cancer-affected BRCA mutation carriers compared to unaffected mutation carriers. This review included the screening of 1243 studies. Eight intermediate- and long-term studies focusing on distress, anxiety, and depression symptoms among cancer-affected mutation carriers at least six months after the disclosure of genetic testing results were included. Studies reported a great variety of designs, methods, and patient outcomes. We found evidence indicating that cancer-affected mutation carriers experienced a negative effect in relation to psychological well-being in terms of an increase in symptoms of distress, anxiety, and depression in the first months after test disclosure. In the intermediate- and long-term, no significant clinical relevant symptoms occurred. However, none of the included studies used specific measurements, which can clearly identify psychological burdens of cancer-affected mutation carriers. We concluded that current well-implemented distress screening instruments are not sufficient for precisely identifying the psychological burden of genetic testing. Therefore, future studies should implement coping strategies, specific personality structures, the impact of genetic testing, supportive care needs and disease management behaviour to clearly screen for the possible intermediate- and long-term psychological impact of a positive test disclosure.

  15. Differential radiosensitivity phenotypes of DNA-PKcs mutations affecting NHEJ and HRR systems following irradiation with gamma-rays or very low fluences of alpha particles.

    Lin, Yu-Fen; Nagasawa, Hatsumi; Little, John B; Kato, Takamitsu A; Shih, Hung-Ying; Xie, Xian-Jin; Wilson, Paul F; Brogan, John R; Kurimasa, Akihiro; Chen, David J; Bedford, Joel S; Chen, Benjamin P C

    2014-01-01

    We have examined cell-cycle dependence of chromosomal aberration induction and cell killing after high or low dose-rate γ irradiation in cells bearing DNA-PKcs mutations in the S2056 cluster, the T2609 cluster, or the kinase domain. We also compared sister chromatid exchanges (SCE) production by very low fluences of α-particles in DNA-PKcs mutant cells, and in homologous recombination repair (HRR) mutant cells including Rad51C, Rad51D, and Fancg/xrcc9. Generally, chromosomal aberrations and cell killing by γ-rays were similarly affected by mutations in DNA-PKcs, and these mutant cells were more sensitive in G1 than in S/G2 phase. In G1-irradiated DNA-PKcs mutant cells, both chromosome- and chromatid-type breaks and exchanges were in excess than wild-type cells. For cells irradiated in late S/G2 phase, mutant cells showed very high yields of chromatid breaks compared to wild-type cells. Few exchanges were seen in DNA-PKcs-null, Ku80-null, or DNA-PKcs kinase dead mutants, but exchanges in excess were detected in the S2506 or T2609 cluster mutants. SCE induction by very low doses of α-particles is resulted from bystander effects in cells not traversed by α-particles. SCE seen in wild-type cells was completely abolished in Rad51C- or Rad51D-deficient cells, but near normal in Fancg/xrcc9 cells. In marked contrast, very high levels of SCEs were observed in DNA-PKcs-null, DNA-PKcs kinase-dead and Ku80-null mutants. SCE induction was also abolished in T2609 cluster mutant cells, but was only slightly reduced in the S2056 cluster mutant cells. Since both non-homologous end-joining (NHEJ) and HRR systems utilize initial DNA lesions as a substrate, these results suggest the possibility of a competitive interference phenomenon operating between NHEJ and at least the Rad51C/D components of HRR; the level of interaction between damaged DNA and a particular DNA-PK component may determine the level of interaction of such DNA with a relevant HRR component.

  16. Insight into resistance mechanism of anaplastic lymphoma kinase to alectinib and JH-VIII-157-02 caused by G1202R solvent front mutation

    Wang H

    2018-05-01

    Full Text Available Han Wang,1–3 Yao Wang,1–3 Wentao Guo,4 Bin Du,1–3 Xiaobing Huang,1–3 Riping Wu,1–3 Baoyu Yang,1–3 Xiaoyan Lin,1–3,5 Yilan Wu6 1Department of Medical Oncology, Fujian Medical University Union Hospital, Fuzhou, People’s Republic of China; 2Stem Cell Research Institute, Fujian Medical University, Fuzhou, People’s Republic of China; 3Fujian Key Laboratory of Translational Cancer Medicine, Fuzhou, People’s Republic of China; 4School of Pharmacy, Wenzhou Medical University, Wenzhou, People’s Republic of China; 5Graduate School of Education, Fujian Medical University, Fuzhou, People’s Republic of China; 6School of Nursing, Fujian University of Traditional Chinese Medicine, Fuzhou, People’s Republic of China Background: Mutated anaplastic lymphoma kinase (ALK drives the development of advanced non-small cell lung cancer (NSCLC. Most reported small-molecule inhibitors targeting the ALK domain do not display good inhibition of the G1202R solvent front mutation. The solvent front mutation was assumed to hinder drug binding. However, a different fact could be uncovered by the simulations reported in this study through a structural analog of alectinib (JH-VIII-157-02, which demonstrated potent effects against the G1202R mutation. Methods: Molecular docking, conventional molecular dynamics (MD simulations, free energy calculations, and umbrella sampling (US simulations were carried out to make clear the principles of the binding preferences of alectinib and JH-VIII-157-02 toward ALKWT and the ALK G1202R (ALKG1202R mutation. Results: JH-VIII-157-02 has similar binding affinities to both ALKWT and ALKG1202R whereas it has has a much lower binding affinity for alectinib to ALKG1202R. Analysis of individual energy terms indicate the major variation involves the van der Waals and entropy terms. Structural analysis reveals that the conformational change of the ATP-binding glycine-rich loop was primarily responsible for the alectinib

  17. Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth

    Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, J?rn

    2017-01-01

    Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell...

  18. Rapid Evolution to Blast Crisis Associated with a Q252H ABL1 Kinase Domain Mutation in e19a2 BCR-ABL1 Chronic Myeloid Leukaemia

    Sarah L. McCarron

    2013-01-01

    Full Text Available A minority of chronic myeloid leukaemia (CML patients express variant transcripts of which the e19a2 BCR-ABL1 fusion is the most common. Instances of tyrosine kinase inhibitor (TKI resistance in e19a2 BCR-ABL1 CML patients have rarely been reported. A case of e19a2 BCR-ABL1 CML is described in whom imatinib resistance, associated with a Q252H ABL1 kinase domain mutation, became apparent soon after initiation of TKI therapy. The patient rapidly transformed to myeloid blast crisis (BC with considerable bone marrow fibrosis and no significant molecular response to a second generation TKI. The clinical course was complicated by comorbidities with the patient rapidly succumbing to advanced disease. This scenario of Q252H-associated TKI resistance with rapid BC transformation has not been previously documented in e19a2 BCR-ABL1 CML. This case highlights the considerable challenges remaining in the management of TKI-resistant BC CML, particularly in the elderly patient.

  19. Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation testing in adults with locally advanced or metastatic non-small cell lung cancer : a systematic review and cost-effectiveness analysis

    Westwood, Marie; Joore, Manuela; Whiting, Penny; van Asselt, Thea; Ramaekers, Bram; Armstrong, Nigel; Misso, Kate; Severens, Johan; Kleijnen, Jos

    BACKGROUND: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment with standard chemotherapy.

  20. Epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutation testing in adults with locally advanced or metastatic non-small cell lung cancer: A systematic review and cost-effectiveness analysis

    M. Westwood (Marie); M.A. Joore (Manuela); P. Whiting (Penny); T. van Asselt (Thea); B.L.T. Ramaekers (Bram); N. Armstrong (Nigel); K. Misso (Kate); J.L. Severens (Hans); J. Kleijnen (Jos)

    2014-01-01

    markdownabstract__Abstract__ Background: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment

  1. High prevalence of mutations affecting the splicing process in a Spanish cohort with autosomal dominant retinitis pigmentosa

    Ezquerra-Inchausti, Maitane; Barandika, Olatz; Anasagasti, Ander; Irigoyen, Cristina; López de Munain, Adolfo; Ruiz-Ederra, Javier

    2017-01-01

    Retinitis pigmentosa is the most frequent group of inherited retinal dystrophies. It is highly heterogeneous, with more than 80 disease-causing genes 27 of which are known to cause autosomal dominant RP (adRP), having been identified. In this study a total of 29 index cases were ascertained based on a family tree compatible with adRP. A custom panel of 31 adRP genes was analysed by targeted next-generation sequencing using the Ion PGM platform in combination with Sanger sequencing. This allowed us to detect putative disease-causing mutations in 14 out of the 29 (48.28%) families analysed. Remarkably, around 38% of all adRP cases analysed showed mutations affecting the splicing process, mainly due to mutations in genes coding for spliceosome factors (SNRNP200 and PRPF8) but also due to splice-site mutations in RHO. Twelve of the 14 mutations found had been reported previously and two were novel mutations found in PRPF8 in two unrelated patients. In conclusion, our results will lead to more accurate genetic counselling and will contribute to a better characterisation of the disease. In addition, they may have a therapeutic impact in the future given the large number of studies currently underway based on targeted RNA splicing for therapeutic purposes. PMID:28045043

  2. Mutations in TSPEAR, Encoding a Regulator of Notch Signaling, Affect Tooth and Hair Follicle Morphogenesis.

    Alon Peled

    2016-10-01

    Full Text Available Despite recent advances in our understanding of the pathogenesis of ectodermal dysplasias (EDs, the molecular basis of many of these disorders remains unknown. In the present study, we aimed at elucidating the genetic basis of a new form of ED featuring facial dysmorphism, scalp hypotrichosis and hypodontia. Using whole exome sequencing, we identified 2 frameshift and 2 missense mutations in TSPEAR segregating with the disease phenotype in 3 families. TSPEAR encodes the thrombospondin-type laminin G domain and EAR repeats (TSPEAR protein, whose function is poorly understood. TSPEAR knock-down resulted in altered expression of genes known to be regulated by NOTCH and to be involved in murine hair and tooth development. Pathway analysis confirmed that down-regulation of TSPEAR in keratinocytes is likely to affect Notch signaling. Accordingly, using a luciferase-based reporter assay, we showed that TSPEAR knock-down is associated with decreased Notch signaling. In addition, NOTCH1 protein expression was reduced in patient scalp skin. Moreover, TSPEAR silencing in mouse hair follicle organ cultures was found to induce apoptosis in follicular epithelial cells, resulting in decreased hair bulb diameter. Collectively, these observations indicate that TSPEAR plays a critical, previously unrecognized role in human tooth and hair follicle morphogenesis through regulation of the Notch signaling pathway.

  3. Joint analysis of quantitative trait loci and majoreffect causative mutations affecting meat quality and carcass composition traits in pigs

    Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Herault, Frédéric; Damon, Marie; Le Roy, Pascale

    2011-01-01

    Abstract Background Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effect...

  4. Tumor-specific mutations in low-frequency genes affect their functional properties

    L. Erdem-Eraslan (Lale); D. Heijsman (Daphne); M. De Wit (Maurice); A.E. Kremer (Andreas); A. Sacchetti (Andrea); P.J. van der Spek (Peter); P.A.E. Sillevis Smitt (Peter); P.J. French (Pim)

    2015-01-01

    textabstractCausal genetic changes in oligodendrogliomas (OD) with 1p/19q co-deletion include mutations in IDH1, IDH2, CIC, FUBP1, TERT promoter and NOTCH1. However, it is generally assumed that more somatic mutations are required for tumorigenesis. This study aimed to establish whether genes

  5. Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

    Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

    2013-01-01

    BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

  6. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Mehul Mistri

    Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  7. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh

    2012-01-01

    Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  8. TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.

    Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf

    2017-06-01

    Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  9. Identification of a mutation in the CHAT gene of Old Danish Pointing Dogs affected with congenital myasthenic syndrome

    Proschowsky, Helle Friis; Flagstad, Annette; Cirera, Susanna

    2007-01-01

    The presence of a recessive inherited muscle disease in Old Danish Pointing Dogs has been well known for years. Comparisons of this disease with myasthenic diseases of other dog breeds and humans have pointed toward a defect in the synthesis of the neurotransmitter acetylcholine possibly due...... to decreased activity of the enzyme choline acetyltransferase. We sequenced exons 5-18 of the gene encoding choline acetyltransferase (CHAT) in 2 affected and 2 unaffected dogs and identified a G to A missense mutation in exon 6. The mutation causes a valine to methionine substitution and segregates...... in agreement with the inheritance of the disease. The mutation was not detected in 50 dogs representing 25 other dog breeds. A DNA test has been developed and is now available to the breeders of Old Danish Pointing Dogs....

  10. A dynamically coupled allosteric network underlies binding cooperativity in Src kinase.

    Foda, Zachariah H; Shan, Yibing; Kim, Eric T; Shaw, David E; Seeliger, Markus A

    2015-01-20

    Protein tyrosine kinases are attractive drug targets because many human diseases are associated with the deregulation of kinase activity. However, how the catalytic kinase domain integrates different signals and switches from an active to an inactive conformation remains incompletely understood. Here we identify an allosteric network of dynamically coupled amino acids in Src kinase that connects regulatory sites to the ATP- and substrate-binding sites. Surprisingly, reactants (ATP and peptide substrates) bind with negative cooperativity to Src kinase while products (ADP and phosphopeptide) bind with positive cooperativity. We confirm the molecular details of the signal relay through the allosteric network by biochemical studies. Experiments on two additional protein tyrosine kinases indicate that the allosteric network may be largely conserved among these enzymes. Our work provides new insights into the regulation of protein tyrosine kinases and establishes a potential conduit by which resistance mutations to ATP-competitive kinase inhibitors can affect their activity.

  11. Sporadic infantile epileptic encephalopathy caused by mutations in PCDH19 resembles Dravet syndrome but mainly affects females.

    Christel Depienne

    2009-02-01

    Full Text Available Dravet syndrome (DS is a genetically determined epileptic encephalopathy mainly caused by de novo mutations in the SCN1A gene. Since 2003, we have performed molecular analyses in a large series of patients with DS, 27% of whom were negative for mutations or rearrangements in SCN1A. In order to identify new genes responsible for the disorder in the SCN1A-negative patients, 41 probands were screened for micro-rearrangements with Illumina high-density SNP microarrays. A hemizygous deletion on chromosome Xq22.1, encompassing the PCDH19 gene, was found in one male patient. To confirm that PCDH19 is responsible for a Dravet-like syndrome, we sequenced its coding region in 73 additional SCN1A-negative patients. Nine different point mutations (four missense and five truncating mutations were identified in 11 unrelated female patients. In addition, we demonstrated that the fibroblasts of our male patient were mosaic for the PCDH19 deletion. Patients with PCDH19 and SCN1A mutations had very similar clinical features including the association of early febrile and afebrile seizures, seizures occurring in clusters, developmental and language delays, behavioural disturbances, and cognitive regression. There were, however, slight but constant differences in the evolution of the patients, including fewer polymorphic seizures (in particular rare myoclonic jerks and atypical absences in those with PCDH19 mutations. These results suggest that PCDH19 plays a major role in epileptic encephalopathies, with a clinical spectrum overlapping that of DS. This disorder mainly affects females. The identification of an affected mosaic male strongly supports the hypothesis that cellular interference is the pathogenic mechanism.

  12. Tyrosine kinase inhibitors: Multi-targeted or single-targeted?

    Broekman, Fleur; Giovannetti, Elisa; Peters, Godefridus J

    2011-02-10

    Since in most tumors multiple signaling pathways are involved, many of the inhibitors in clinical development are designed to affect a wide range of targeted kinases. The most important tyrosine kinase families in the development of tyrosine kinase inhibitors are the ABL, SCR, platelet derived growth factor, vascular endothelial growth factor receptor and epidermal growth factor receptor families. Both multi-kinase inhibitors and single-kinase inhibitors have advantages and disadvantages, which are related to potential resistance mechanisms, pharmacokinetics, selectivity and tumor environment. In different malignancies various tyrosine kinases are mutated or overexpressed and several resistance mechanisms exist. Pharmacokinetics is influenced by interindividual differences and differs for two single targeted inhibitors or between patients treated by the same tyrosine kinase inhibitor. Different tyrosine kinase inhibitors have various mechanisms to achieve selectivity, while differences in gene expression exist between tumor and stromal cells. Considering these aspects, one type of inhibitor can generally not be preferred above the other, but will depend on the specific genetic constitution of the patient and the tumor, allowing personalized therapy. The most effective way of cancer treatment by using tyrosine kinase inhibitors is to consider each patient/tumor individually and to determine the strategy that specifically targets the consequences of altered (epi)genetics of the tumor. This strategy might result in treatment by a single multi kinase inhibitor for one patient, but in treatment by a couple of single kinase inhibitors for other patients.

  13. Comparison of serum creatine kinase estimation with short tandem repeats based linkage analysis in carriers and affected children of duchenne muscular dystrophy

    Hashim, R.; Ahmad, S.; Sattar, A.; Khan, F.A.

    2011-01-01

    Background: Duchenne Muscular Dystrophy (DMD) is an X-linked recessive lethal, genetic disorder characterised by progressive weakness of skeletal muscles which is untreatable and transmitted to males by carrier females. Advances in laboratory techniques now focus direct mutational analysis as the most reliable and indirect analysis based on Short Tandem Repeats (STR) based linkage analysis as feasible, inexpensive, and efficient method for carrier detection and prenatal diagnosis. The objective of this study was to compare the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and diagnostic efficiency of Serum Creatine Kinase (SCK) with Short Tandem Repeats (STR based linkage analysis in carriers and affected children of Duchenne Muscular Dystrophy. Methods: The study was carried out from Dec 2006 to Dec 2007 in families having index clinical cases of DMD who were referred from different hospitals for evaluation/workup of DMD. SCK was done as a preliminary investigation in all index cases. The PCR assay with STR based linkage analysis with Intron 44, 45, 49 and 50 of DMD gene were performed in all families. Six families were informative with Intron 44 of DMD gene and one family was non-informative with all four intronic markers of DMD. SCK analyses were done in all the family members and compared with PCR analysis in informative families. SCK was not performed on Chorionic villous sample (CVS) done for prenatal diagnosis of DMD, and CVS and non-informative family members were excluded from the study. Results: In carriers of DMD, the sensitivity and negative predictive value of SCK were 33.3%, and specificity and positive predictive were 100% with diagnostic efficiency of 50%. In affected cases of DMD the sensitivity and negative predictive value of SCK were 100%, and specificity and positive predictive were 91% and 88.8% respectively and diagnostic efficiency of 94.1%. Conclusion: The SCK is an excellent screening test for

  14. HERC 1 ubiquitin ligase mutation affects neocortical, CA3 hippocampal and spinal cord projection neurons. An ultrastructural study

    Rocío eRuiz

    2016-04-01

    Full Text Available The spontaneous mutation tambaleante is caused by the Gly483Glu substitution in the highly conserved N terminal RCC1-like domain of the HERC1 protein, which leads to the increase of mutated protein levels responsible for cerebellar Purkinje cell death by autophagy. Until now, Purkinje cells have been the only central nervous neurons reported as being targeted by the mutation, and their degeneration elicits an ataxic syndrome in adult mutant mice. However, the ultrastructural analysis performed here demonstrates that signs of autophagy, such as autophagosomes, lysosomes, and altered mitochondria, are present in neocortical pyramidal, CA3 hippocampal pyramidal, and spinal cord motor neurons. The main difference is that the reduction in the number of neurons affected in the tambaleante mutation in the neocortex, the hippocampus, and the spinal cord is not so evident as the dramatic loss of cerebellar Purkinje cells. Interestingly, signs of autophagy are absent in both interneurons and neuroglia cells. Affected neurons have in common that they are projection neurons which receive strong and varied synaptic inputs, and possess the highest degree of neuronal activity. Therefore, because the integrity of the ubiquitin-proteasome system is essential for protein degradation and, hence, for normal protein turnover, it could be hypothesized that the deleterious effects of the misrouting of these pathways would depend directly on the neuronal activity.

  15. A short in-frame deletion in NTRK1 tyrosine kinase domain caused by a novel splice site mutation in a patient with congenital insensitivity to pain with anhidrosis

    Arístegui Javier

    2011-06-01

    Full Text Available Abstract Background Congenital insensitivity to pain with anhidrosis (CIPA is a rare autosomal recessive genetic disease characterized by the lack of reaction to noxious stimuli and anhidrosis. It is caused by mutations in the NTRK1 gene, which encodes the high affinity tyrosine kinase receptor I for Neurotrophic Growth Factor (NGF. Case Presentation We present the case of a female patient diagnosed with CIPA at the age of 8 months. The patient is currently 6 years old and her psychomotor development conforms to her age (RMN, SPECT and psychological study are in the range of normality. PCR amplification of DNA, followed by direct sequencing, was used to investigate the presence of NTRK1 gene mutations. Reverse transcriptase (RT-PCR amplification of RNA, followed by cloning and sequencing of isolated RT-PCR products was used to characterize the effect of the mutations on NTRK1 mRNA splicing. The clinical diagnosis of CIPA was confirmed by the detection of two splice-site mutations in NTRK1, revealing that the patient was a compound heterozygote at this gene. One of these alterations, c.574+1G>A, is located at the splice donor site of intron 5. We also found a second mutation, c.2206-2 A>G, not previously reported in the literature, which is located at the splice acceptor site of intron 16. Each parent was confirmed to be a carrier for one of the mutations by DNA sequencing analysis. It has been proposed that the c.574+1G>A mutation would cause exon 5 skipping during NTRK1 mRNA splicing. We could confirm this prediction and, more importantly, we provide evidence that the novel c.2206-2A>G mutation also disrupts normal NTRK1 splicing, leading to the use of an alternative splice acceptor site within exon 17. As a consequence, this mutation would result in the production of a mutant NTRK1 protein with a seven aminoacid in-frame deletion in its tyrosine kinase domain. Conclusions We present the first description of a CIPA-associated NTRK1 mutation

  16. Death and population dynamics affect mutation rate estimates and evolvability under stress in bacteria.

    Frenoy, Antoine; Bonhoeffer, Sebastian

    2018-05-01

    The stress-induced mutagenesis hypothesis postulates that in response to stress, bacteria increase their genome-wide mutation rate, in turn increasing the chances that a descendant is able to better withstand the stress. This has implications for antibiotic treatment: exposure to subinhibitory doses of antibiotics has been reported to increase bacterial mutation rates and thus probably the rate at which resistance mutations appear and lead to treatment failure. More generally, the hypothesis posits that stress increases evolvability (the ability of a population to generate adaptive genetic diversity) and thus accelerates evolution. Measuring mutation rates under stress, however, is problematic, because existing methods assume there is no death. Yet subinhibitory stress levels may induce a substantial death rate. Death events need to be compensated by extra replication to reach a given population size, thus providing more opportunities to acquire mutations. We show that ignoring death leads to a systematic overestimation of mutation rates under stress. We developed a system based on plasmid segregation that allows us to measure death and division rates simultaneously in bacterial populations. Using this system, we found that a substantial death rate occurs at the tested subinhibitory concentrations previously reported to increase mutation rate. Taking this death rate into account lowers and sometimes removes the signal for stress-induced mutagenesis. Moreover, even when antibiotics increase mutation rate, we show that subinhibitory treatments do not increase genetic diversity and evolvability, again because of effects of the antibiotics on population dynamics. We conclude that antibiotic-induced mutagenesis is overestimated because of death and that understanding evolvability under stress requires accounting for the effects of stress on population dynamics as much as on mutation rate. Our goal here is dual: we show that population dynamics and, in particular, the

  17. Search for gene mutations affecting protein structure in children of A-bomb survivors, 2

    Satoh, Chiyoko; Fujita, Mikio; Goriki, Kazuaki; Asakawa, Jun-ichi; Takahashi, Norio; Hamilton, H.B.; Hazama, Ryuji; Neel, J.V.

    1984-01-01

    Children who were born between May 1, 1946 and April 1, 1971 to survivor(s) exposed to A-bombing within 2,000 m from the hypocenter in Hiroshima and Nagasaki were selected as exposed group; their sex- and age-matched children born to survivor(s) who were exposed at 2,500 m or farther were selected as control group. When these children were in junior high school, mutation of protein structure was examined by using electrophoresis and by determining red cell enzymes with decreased activity and heat-unstable red cell enzymes. Electrophoretic study revealed a ''rare type of protein mutation'' in 635 of 12,242 individuals in the exposed group and in 448 of 10,154 individuals in the control group. The number of locuses in all proteins examined was calculated. The number of locuses per protein was corrected using the rate of parents' mutation type, and relative number of locuses were obtained. As a result, there was no difference in the mutation frequency per locus and generation between the exposed and control groups. Among children having red cell enzymes with decreased activity, mutant in triose phosphate isomerase was detected in one child in the exposed group, in whom electrophoretic pattern was normal and red cell enzymes were stable to heat. Heat-unstable red cell enzymes were seen in 9 children and their parents. However, family survey revealed genetic mutation in all instances irrespective of A-bombing. (Namekawa, K.)

  18. Screening of mutations affecting protein stability and dynamics of FGFR1—A simulation analysis

    C. George Priya Doss

    2012-12-01

    Full Text Available Single amino acid substitutions in Fibroblast Growth Factor Receptor 1 (FGFR1 destabilize protein and have been implicated in several genetic disorders like various forms of cancer, Kallamann syndrome, Pfeiffer syndrome, Jackson Weiss syndrome, etc. In order to gain functional insight into mutation caused by amino acid substitution to protein function and expression, special emphasis was laid on molecular dynamics simulation techniques in combination with in silico tools such as SIFT, PolyPhen 2.0, I-Mutant 3.0 and SNAP. It has been estimated that 68% nsSNPs were predicted to be deleterious by I-Mutant, slightly higher than SIFT (37%, PolyPhen 2.0 (61% and SNAP (58%. From the observed results, P722S mutation was found to be most deleterious by comparing results of all in silico tools. By molecular dynamics approach, we have shown that P722S mutation leads to increase in flexibility, and deviated more from the native structure which was supported by the decrease in the number of hydrogen bonds. In addition, biophysical analysis revealed a clear insight of stability loss due to P722S mutation in FGFR1 protein. Majority of mutations predicted by these in silico tools were in good concordance with the experimental results.

  19. Gain-of-function mutations in protein kinase Cα (PKCα) may promote synaptic defects in Alzheimer’s disease

    Alfonso, Stephanie I.; Callender, Julia A.; Hooli, Basavaraj; Antal, Corina E.; Mullin, Kristina; Sherman, Mathew A.; Lesné, Sylvain E.; Leitges, Michael; Newton, Alexandra C.; Tanzi, Rudolph E.; Malinow, Roberto

    2016-01-01

    Alzheimer’s disease (AD) is a progressive dementia disorder characterized by synaptic degeneration and amyloid-β (Aβ) accumulation in the brain. Through whole-genome sequencing of 1345 individuals from 410 families with late-onset AD (LOAD), we identified three highly penetrant variants in PRKCA, the gene that encodes protein kinase Cα (PKCα), in five of the families. All three variants linked with LOAD displayed increased catalytic activity relative to wild-type PKCα as assessed in live-cell imaging experiments using a genetically encoded PKC activity reporter. Deleting PRKCA in mice or adding PKC antagonists to mouse hippocampal slices infected with a virus expressing the Aβ precursor CT100 revealed that PKCα was required for the reduced synaptic activity caused by Aβ. In PRKCA−/− neurons expressing CT100, introduction of PKCα, but not PKCα lacking a PDZ interaction moiety, rescued synaptic depression, suggesting that a scaffolding interaction bringing PKCα to the synapse is required for its mediation of the effects of Aβ. Thus, enhanced PKCα activity may contribute to AD, possibly by mediating the actions of Aβ on synapses. In contrast, reduced PKCα activity is implicated in cancer. Hence, these findings reinforce the importance of maintaining a careful balance in the activity of this enzyme. PMID:27165780

  20. Characterisation of mutations of the phosphoinositide-3-kinase regulatory subunit, PIK3R2, in perisylvian polymicrogyria: a next-generation sequencing study.

    Mirzaa, Ghayda M; Conti, Valerio; Timms, Andrew E; Smyser, Christopher D; Ahmed, Sarah; Carter, Melissa; Barnett, Sarah; Hufnagel, Robert B; Goldstein, Amy; Narumi-Kishimoto, Yoko; Olds, Carissa; Collins, Sarah; Johnston, Kathreen; Deleuze, Jean-François; Nitschké, Patrick; Friend, Kathryn; Harris, Catharine; Goetsch, Allison; Martin, Beth; Boyle, Evan August; Parrini, Elena; Mei, Davide; Tattini, Lorenzo; Slavotinek, Anne; Blair, Ed; Barnett, Christopher; Shendure, Jay; Chelly, Jamel; Dobyns, William B; Guerrini, Renzo

    2015-12-01

    Bilateral perisylvian polymicrogyria (BPP), the most common form of regional polymicrogyria, causes the congenital bilateral perisylvian syndrome, featuring oromotor dysfunction, cognitive impairment, and epilepsy. The causes of BPP are heterogeneous, but only a few genetic causes have been reported. The aim of this study was to identify additional genetic causes of BPP and characterise their frequency in this population. Children (aged ≤18 years) with polymicrogyria were enrolled into our research programme from July, 1980, to October, 2015, at two centres (Florence, Italy, and Seattle, WA, USA). We obtained samples (blood and saliva) throughout this period at both centres and did whole-exome sequencing on DNA from eight trios (two parents and one affected child) with BPP in 2014. After the identification of mosaic PIK3R2 mutations in two of these eight children, we performed targeted screening of PIK3R2 by two methods in a cohort of 118 children with BPP. First, we performed targeted sequencing of the entire PIK3R2 gene by single molecule molecular inversion probes (smMIPs) on 38 patients with BPP with normal to large head size. Second, we did amplicon sequencing of the recurrent PIK3R2 mutation (Gly373Arg) in 80 children with various types of polymicrogyria including BPP. One additional patient had clinical whole-exome sequencing done independently, and was included in this study because of the phenotypic similarity to our cohort. We identified a mosaic mutation (Gly373Arg) in a regulatory subunit of the PI3K-AKT-mTOR pathway, PIK3R2, in two children with BPP. Of the 38 patients with BPP and normal to large head size who underwent targeted next-generation sequencing by smMIPs, we identified constitutional and mosaic PIK3R2 mutations in 17 additional children. In parallel, one patient had the recurrent PIK3R2 mutation identified by clinical whole-exome sequencing. Seven of these 20 patients had BPP alone, and 13 had BPP in association with features of the

  1. Rich Medium Composition Affects Escherichia coli Survival, Glycation, and Mutation Frequency during Long-Term Batch Culture.

    Kram, Karin E; Finkel, Steven E

    2015-07-01

    Bacteria such as Escherichia coli are frequently grown to high density to produce biomolecules for study in the laboratory. To achieve this, cells can be incubated in extremely rich media that increase overall cell yield. In these various media, bacteria may have different metabolic profiles, leading to changes in the amounts of toxic metabolites produced. We have previously shown that stresses experienced during short-term growth can affect the survival of cells during the long-term stationary phase (LTSP). Here, we incubated cells in LB, 2× yeast extract-tryptone (YT), Terrific Broth, or Super Broth medium and monitored survival during the LTSP, as well as other reporters of genetic and physiological change. We observe differential cell yield and survival in all media studied. We propose that differences in long-term survival are the result of changes in the metabolism of components of the media that may lead to increased levels of protein and/or DNA damage. We also show that culture pH and levels of protein glycation, a covalent modification that causes protein damage, affect long-term survival. Further, we measured mutation frequency after overnight incubation and observed a correlation between high mutation frequencies at the end of the log phase and loss of viability after 4 days of LTSP incubation, indicating that mutation frequency is potentially predictive of long-term survival. Since glycation and mutation can be caused by oxidative stress, we measured expression of the oxyR oxidative stress regulator during log-phase growth and found that higher levels of oxyR expression during the log phase are consistent with high mutation frequency and lower cell density during the LTSP. Since these complex rich media are often used when producing large quantities of biomolecules in the laboratory, the observed increase in damage resulting in glycation or mutation may lead to production of a heterogeneous population of plasmids or proteins, which could affect the

  2. Characterization of novel Brown midrib 6 mutations affecting lignin biosynthesis in sorghum

    The presence of lignin reduces the quality of lignocellulosic biomass for forage materials and feedstock for biofuels. In C4 grasses, the brown midrib phenotype has been linked to mutations to genes in the monolignol biosynthesis pathway. For example, the Bmr6 gene in sorghum (Sorghum bicolor) has b...

  3. Rooting, growth, and color mutation of poinsettias affected by gamma radiation

    Lee, Eun Kyung; Kim, Won Hee; Kim, Seung Tae; Kang, Si Yong

    2010-01-01

    This experiment was carried out to investigate the effects of gamma-radiation on the rooting, growth, and color mutation in poinsettia. Using 10 poinsettia varieties ('Lollipop', 'Little Peace', 'Happy Day', 'Early Bird', 'Pixy Red', 'Happy Time', 'Heidi', 'Red Bell', 'Clara', and 'Scarlet') bred by National Institute of Horticultural and Herbal Science, 100 Gy of gamma ray was irradiated at the stage of callused cuttings. Four weeks after sticking cuttings in the rooting media, 8 cultivars showed 100% of root formation, but 'Early Bird' rooted 24.4% and even died off during the cutting propagation. After planting rooted cuttings, survival rate until flowering time varied among irradiated cultivars. While 'Pixy Red' and 'Heidi' survived about 98%, 'Clara', 'Happy Day', and 'Early Bird' survived lesser than 30%. All irradiated plants showed remarkably shorter plant height, lesser branch numbers than non-irradiated control plants. Thirty color mutants were obtained among 281 plants survived until flowering time. Nine were complete color mutated branches, whereas 21 mutants were partially color mutated bracts and transitional leaves. Color patterns mutated by 100 Gy of gamma ray were divided into pink, hot pink, light red and spotted (pink spots with red main color). Pink mutants were commonly obtained. Complete color mutants were discovered from 4 plants of 'Pixy Red', 2 plants of 'Red Bell' and 3 plants of Lollipop

  4. Mutations in NRXN1 in a family multiply affected with brain disorders

    Duong, Linh; Klitten, Laura L; Møller, Rikke S

    2012-01-01

    to be deleterious to NRXN1. The deletion was passed on from the patient's mother who was clinically characterized by sub-diagnostic autistic traits in addition to type 1 diabetes mellitus. The point mutation was subsequently found in the patient's brother, suffering from a psychotic disorder, which implies...

  5. Vps33b pathogenic mutations preferentially affect VIPAS39/SPE-39-positive endosomes.

    Tornieri, Karine; Zlatic, Stephanie A; Mullin, Ariana P; Werner, Erica; Harrison, Robert; L'hernault, Steven W; Faundez, Victor

    2013-12-20

    Mutations in Vps33 isoforms cause pigment dilution in mice (Vps33a, buff) and Drosophila (car) and the neurogenic arthrogryposis, renal dysfunction and cholestasis syndrome in humans (ARC1, VPS33B). The later disease is also caused by mutations in VIPAS39, (Vps33b interacting protein, apical-basolateral polarity regulator, SPE-39 homolog; ARC2), a protein that interacts with the HOmotypic fusion and Protein Sorting (HOPS) complex, a tether necessary for endosome-lysosome traffic. These syndromes offer insight into fundamental endosome traffic processes unique to metazoans. However, the molecular and cellular mechanisms underlying these mutant phenotypes remain poorly understood. Here we investigate interactions of wild-type and disease-causing mutations in VIPAS39/SPE-39 and Vps33b by yeast two hybrid, immunoprecipitation and quantitative fluorescent microscopy. We find that although few mutations prevent interaction between VIPAS39/SPE-39 and Vps33b, some mutants fragment VIPAS39/SPE-39-positive endosomes, but all mutants alter the subcellular localization of Vps33b to VIPAS39/SPE-39-positive endosomes. Our data suggest that the ARC syndrome may result through impaired VIPAS39/SPE-39 and Vps33b-dependent endosomal maturation or fusion.

  6. Mutation analysis of 272 Spanish families affected by autosomal recessive retinitis pigmentosa using a genotyping microarray.

    Avila-Fernandez, A.; Cantalapiedra, D.; Aller, E.; Vallespin, E.; Aguirre-Lamban, J.; Blanco-Kelly, F.; Corton, M.; Riveiro-Alvarez, R.; Allikmets, R.; Trujillo-Tiebas, M.J.; Millan, J.M.; Cremers, F.P.M.; Ayuso, C.

    2010-01-01

    PURPOSE: Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by progressive loss of vision. The aim of this study was to identify the causative mutations in 272 Spanish families using a genotyping microarray. METHODS: 272 unrelated Spanish families, 107 with autosomal

  7. Flipped script for gefitinib: A reapproved tyrosine kinase inhibitor for first-line treatment of epidermal growth factor receptor mutation positive metastatic nonsmall cell lung cancer.

    Bogdanowicz, Brian S; Hoch, Matthew A; Hartranft, Megan E

    2017-04-01

    Purpose The approval history, pharmacology, pharmacokinetics, clinical trials, efficacy, dosing recommendations, drug interactions, safety, place in therapy, and economic considerations of gefitinib are reviewed. Summary Lung cancer is one of the most commonly diagnosed cancers and is the leading cause of cancer death. Platinum-based chemotherapy and tyrosine kinase inhibitors, such as erlotinib and afatinib, are recommended therapies for nonsmall cell lung cancer. The European Medicines Association based their approval of gefitinib on the randomized, multicenter Iressa Pan-Asia Study (IPASS, NCT00322452) and a single-arm study showing effectiveness in Caucasians (IFUM, NCT01203917). Both studies were recently referenced by the United States Food & Drug Administration to reapprove gefitinib for the first-line treatment of advanced nonsmall cell lung cancer with epidermal growth factor receptor exon 19 deletions or exon 21 substitution. Diarrhea, acneiform rash, and interstitial lung disease are known side effects of gefitinib. Conclusion Use of gefitinib for the first-line therapy of metastatic nonsmall cell lung cancer with epidermal growth factor receptor exon 19 deletions (residues 747-750) or exon 21 substitution mutation (L858R) is well-documented and supported.

  8. DNMT1 mutations found in HSANIE patients affect interaction with UHRF1 and neuronal differentiation.

    Smets, Martha; Link, Stephanie; Wolf, Patricia; Schneider, Katrin; Solis, Veronica; Ryan, Joel; Meilinger, Daniela; Qin, Weihua; Leonhardt, Heinrich

    2017-04-15

    DNMT1 is recruited to substrate sites by PCNA and UHRF1 to maintain DNA methylation after replication. The cell cycle dependent recruitment of DNMT1 is mediated by the PCNA-binding domain (PBD) and the targeting sequence (TS) within the N-terminal regulatory domain. The TS domain was found to be mutated in patients suffering from hereditary sensory and autonomic neuropathies with dementia and hearing loss (HSANIE) and autosomal dominant cerebellar ataxia deafness and narcolepsy (ADCA-DN) and is associated with global hypomethylation and site specific hypermethylation. With functional complementation assays in mouse embryonic stem cells, we showed that DNMT1 mutations P496Y and Y500C identified in HSANIE patients not only impair DNMT1 heterochromatin association, but also UHRF1 interaction resulting in hypomethylation. Similar DNA methylation defects were observed when DNMT1 interacting domains in UHRF1, the UBL and the SRA domain, were deleted. With cell-based assays, we could show that HSANIE associated mutations perturb DNMT1 heterochromatin association and catalytic complex formation at methylation sites and decrease protein stability in late S and G2 phase. To investigate the neuronal phenotype of HSANIE mutations, we performed DNMT1 rescue assays and could show that cells expressing mutated DNMT1 were prone to apoptosis and failed to differentiate into neuronal lineage. Our results provide insights into the molecular basis of DNMT1 dysfunction in HSANIE patients and emphasize the importance of the TS domain in the regulation of DNA methylation in pluripotent and differentiating cells. © The Author 2017. Published by Oxford University Press.

  9. A mutation in the aroE gene affects pigment production, virulence, and chemotaxis in Xanthomonas oryzae pv. oryzae.

    Kim, Hong-Il; Noh, Tae-Hwan; Lee, Chang-Soo; Park, Young-Jin

    2015-01-01

    Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight (BB) in rice. To study its function, a random insertion mutation library of Xoo was constructed using the Tn5 transposon. A mutant strain with decreased virulence against the susceptible rice cultivar IR24 was isolated from the library (aroE mutant), which also had extremely low pigment production. Thermal asymmetric interlaced-polymerase chain reaction (TAIL-PCR) and sequence analysis of the mutant revealed that the transposon was inserted into the aroE gene (encoding shikimate dehydrogenase). To investigate gene expression changes in the pigment- and virulence-deficient mutant, DNA microarray analysis was performed, which showed downregulation of 20 genes involved in the chemotaxis of Xoo. Our findings reveal that mutation of the aroE gene affects virulence and pigment production, as well as expression of genes involved in Xoo chemotaxis. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. Phosphorylation of the Transient Receptor Potential Ankyrin 1 by Cyclin-dependent Kinase 5 affects Chemo-nociception

    Hall, Bradford E.; Prochazkova, Michaela; Sapio, Matthew R.; Minetos, Paul; Kurochkina, Natalya; Binukumar, B. K.; Amin, Niranjana D.; Terse, Anita; Joseph, John; Raithel, Stephen J.; Mannes, Andrew J.; Pant, Harish C.; Chung, Man-Kyo; Iadarola, Michael J.; Kulkarni, Ashok B.

    2018-01-01

    Cyclin-dependent kinase 5 (Cdk5) is a key neuronal kinase that is upregulated during inflammation, and can subsequently modulate sensitivity to nociceptive stimuli. We conducted an in silico screen for Cdk5 phosphorylation sites within proteins whose expression was enriched in nociceptors and identified the chemo-responsive ion channel Transient Receptor Potential Ankyrin 1 (TRPA1) as a possible Cdk5 substrate. Immunoprecipitated full length TRPA1 was shown to be phosphorylated by Cdk5 and th...

  11. cld and lec23 are disparate mutations that affect maturation of lipoprotein lipase in the endoplasmic reticulum.

    Briquet-Laugier, V; Ben-Zeev, O; White, A; Doolittle, M H

    1999-11-01

    The mutations cld (combined lipase deficiency) and lec23 disrupt in a similar manner the expression of lipoprotein lipase (LPL). Whereas cld affects an unknown gene, lec23 abolishes the activity of alpha-glucosidase I, an enzyme essential for proper folding and assembly of nascent glycoproteins. The hypothesis that cld, like lec23, affects the folding/assembly of nascent LPL was confirmed by showing that in cell lines homozygous for these mutations (Cld and Lec23, respectively), the majority of LPL was inactive, displayed heterogeneous aggregation, and had a decreased affinity for heparin. While inactive LPL was retained in the ER, a small amount of LPL that had attained a native conformation was transported through the Golgi and secreted. Thus, Cld and Lec23 cells recognized and retained the majority of LPL as misfolded, maintaining the standard of quality control. Examination of candidate factors affecting protein maturation, such as glucose addition and trimming, proteins involved in lectin chaperone cycling, and other abundant ER chaperones, revealed that calnexin levels were dramatically reduced in livers from cld/cld mice; this finding was also confirmed in Cld cells. We conclude that cld may affect components in the ER, such as calnexin, that play a role in protein maturation. Whether the reduced calnexin levels per se contribute to the LPL deficiency awaits confirmation.

  12. Compound heterozygous mutations in two different domains of ALDH18A1 do not affect the amino acid levels in a patient with hereditary spastic paraplegia

    Steenhof, Maria; Kibæk, Maria; Larsen, Martin J.

    2018-01-01

    with mutations affecting the GR5P domain. We present a 19-year old male patient with autosomal recessive spastic paraplegia and compound heterozygosity for two ALDH18A1 mutations, one in each of the P5CS domains. This young man has spastic paraplegia with onset in childhood and temporal lobe epilepsy, but normal...

  13. Proteomic Changes in Cerebrospinal Fluid of Presymptomatic and Affected Persons Carrying Familial Alzheimer Disease Mutations

    Ringman, John M.; Schulman, Howard; Becker, Chris; Jones, Ted; Bai, Yuchen; Immermann, Fred; Cole, Gregory; Sokolow, Sophie; Gylys, Karen; Geschwind, Daniel H.; Cummings, Jeffrey L.; Wan, Hong I.

    2013-01-01

    Objective To identify cerebrospinal fluid (CSF) protein changes in persons who will develop familial Alzheimer disease (FAD) due to PSEN1 and APP mutations, using unbiased proteomics. Design We compared proteomic profiles of CSF from individuals with FAD who were mutation carriers (MCs) and related noncarriers (NCs). Abundant proteins were depleted and samples were analyzed using liquid chromatography– electrospray ionization–mass spectrometry on a high-resolution time-of-flight instrument. Tryptic peptides were identified by tandem mass spectrometry. Proteins differing in concentration between the MCs and NCs were identified. Setting A tertiary dementia referral center and a proteomic biomarker discovery laboratory. Participants Fourteen FAD MCs (mean age, 34.2 years; 10 are asymptomatic, 12 have presenilin-1 [PSEN1] gene mutations, and 2 have amyloid precursor protein [APP] gene mutations) and 5 related NCs (mean age, 37.6 years). Results Fifty-six proteins were identified, represented by multiple tryptic peptides showing significant differences between MCs and NCs (46 upregulated and 10 downregulated); 40 of these proteins differed when the analysis was restricted to asymptomatic individuals. Fourteen proteins have been reported in prior proteomic studies in late-onset AD, including amyloid precursor protein, transferrin, α1β-glycoprotein, complement components, afamin precursor, spondin 1, plasminogen, hemopexin, and neuronal pentraxin receptor. Many other proteins were unique to our study, including calsyntenin 3, AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) 4 glutamate receptor, CD99 antigen, di-N-acetyl-chitobiase, and secreted phosphoprotein 1. Conclusions We found much overlap in CSF protein changes between individuals with presymptomatic and symptomatic FAD and those with late-onset AD. Our results are consistent with inflammation and synaptic loss early in FAD and suggest new presymptomatic biomarkers of potential usefulness in drug

  14. Rooting, growth, and color mutation of poinsettias affected by gamma radiation

    Lee, Eun Kyung; Kim, Won Hee; Kim, Seung Tae [National Institute of Horticultural and Herbal Science, RDA, Suwon (Korea, Republic of); Kang, Si Yong [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2010-09-15

    This experiment was carried out to investigate the effects of gamma-radiation on the rooting, growth, and color mutation in poinsettia. Using 10 poinsettia varieties ('Lollipop', 'Little Peace', 'Happy Day', 'Early Bird', 'Pixy Red', 'Happy Time', 'Heidi', 'Red Bell', 'Clara', and 'Scarlet') bred by National Institute of Horticultural and Herbal Science, 100 Gy of gamma ray was irradiated at the stage of callused cuttings. Four weeks after sticking cuttings in the rooting media, 8 cultivars showed 100% of root formation, but 'Early Bird' rooted 24.4% and even died off during the cutting propagation. After planting rooted cuttings, survival rate until flowering time varied among irradiated cultivars. While 'Pixy Red' and 'Heidi' survived about 98%, 'Clara', 'Happy Day', and 'Early Bird' survived lesser than 30%. All irradiated plants showed remarkably shorter plant height, lesser branch numbers than non-irradiated control plants. Thirty color mutants were obtained among 281 plants survived until flowering time. Nine were complete color mutated branches, whereas 21 mutants were partially color mutated bracts and transitional leaves. Color patterns mutated by 100 Gy of gamma ray were divided into pink, hot pink, light red and spotted (pink spots with red main color). Pink mutants were commonly obtained. Complete color mutants were discovered from 4 plants of 'Pixy Red', 2 plants of 'Red Bell' and 3 plants of Lollipop.

  15. Nicotine reward and affective nicotine withdrawal signs are attenuated in calcium/calmodulin-dependent protein kinase IV knockout mice.

    Kia J Jackson

    Full Text Available The influx of Ca(2+ through calcium-permeable nicotinic acetylcholine receptors (nAChRs leads to activation of various downstream processes that may be relevant to nicotine-mediated behaviors. The calcium activated protein, calcium/calmodulin-dependent protein kinase IV (CaMKIV phosphorylates the downstream transcription factor cyclic AMP response element binding protein (CREB, which mediates nicotine responses; however the role of CaMKIV in nicotine dependence is unknown. Given the proposed role of CaMKIV in CREB activation, we hypothesized that CaMKIV might be a crucial molecular component in the development of nicotine dependence. Using male CaMKIV genetically modified mice, we found that nicotine reward is attenuated in CaMKIV knockout (-/- mice, but cocaine reward is enhanced in these mice. CaMKIV protein levels were also increased in the nucleus accumbens of C57Bl/6 mice after nicotine reward. In a nicotine withdrawal assessment, anxiety-related behavior, but not somatic signs or the hyperalgesia response are attenuated in CaMKIV -/- mice. To complement our animal studies, we also conducted a human genetic association analysis and found that variants in the CaMKIV gene are associated with a protective effect against nicotine dependence. Taken together, our results support an important role for CaMKIV in nicotine reward, and suggest that CaMKIV has opposing roles in nicotine and cocaine reward. Further, CaMKIV mediates affective, but not physical nicotine withdrawal signs, and has a protective effect against nicotine dependence in human genetic association studies. These findings further indicate the importance of calcium-dependent mechanisms in mediating behaviors associated with drugs of abuse.

  16. A new Gsdma3 mutation affecting anagen phase of first hair cycle

    Tanaka, Shigekazu; Tamura, Masaru; Aoki, Aya; Fujii, Tomoaki; Komiyama, Hiromitsu; Sagai, Tomoko; Shiroishi, Toshihiko

    2007-01-01

    Recombination-induced mutation 3 (Rim3) is a spontaneous mouse mutation that exhibits dominant phenotype of hyperkeratosis and hair loss. Fine linkage analysis of Rim3 and sequencing revealed a novel single point mutation, G1124A leading to Ala348Thr, in Gsdma3 in chromosome 11. Transgenesis with BAC DNA harboring the Rim3-type Gsdma3 recaptured the Rim3 phenotype, providing direct evidence that Gsdma3 is the causative gene of Rim3. We examined the spatial expression of Gsdma3 and characterized the Rim3 phenotype in detail. Gsdma3 is expressed in differentiated epidermal cells in the skin, but not in the proliferating epidermal cells. Histological analysis of Rim3 mutant showed hyperplasia of the epidermal cells in the upper hair follicles and abnormal anagen phase at the first hair cycle. Furthermore, immunohistochemical analysis revealed hyperproliferation and misdifferentiation of the upper follicular epidermis in Rim3 mutant. These results suggest that Gsdma3 is involved in the proliferation and differentiation of epidermal stem cells

  17. Myotonia congenita-associated mutations in chloride channel-1 affect zebrafish body wave swimming kinematics.

    Cheng, Wei; Tian, Jing; Burgunder, Jean-Marc; Hunziker, Walter; Eng, How-Lung

    2014-01-01

    Myotonia congenita is a human muscle disorder caused by mutations in CLCN1, which encodes human chloride channel 1 (CLCN1). Zebrafish is becoming an increasingly useful model for human diseases, including muscle disorders. In this study, we generated transgenic zebrafish expressing, under the control of a muscle specific promoter, human CLCN1 carrying mutations that have been identified in human patients suffering from myotonia congenita. We developed video analytic tools that are able to provide precise quantitative measurements of movement abnormalities in order to analyse the effect of these CLCN1 mutations on adult transgenic zebrafish swimming. Two new parameters for body-wave kinematics of swimming reveal changes in body curvature and tail offset in transgenic zebrafish expressing the disease-associated CLCN1 mutants, presumably due to their effect on muscle function. The capability of the developed video analytic tool to distinguish wild-type from transgenic zebrafish could provide a useful asset to screen for compounds that reverse the disease phenotype, and may be applicable to other movement disorders besides myotonia congenita.

  18. Myotonia congenita-associated mutations in chloride channel-1 affect zebrafish body wave swimming kinematics.

    Wei Cheng

    Full Text Available Myotonia congenita is a human muscle disorder caused by mutations in CLCN1, which encodes human chloride channel 1 (CLCN1. Zebrafish is becoming an increasingly useful model for human diseases, including muscle disorders. In this study, we generated transgenic zebrafish expressing, under the control of a muscle specific promoter, human CLCN1 carrying mutations that have been identified in human patients suffering from myotonia congenita. We developed video analytic tools that are able to provide precise quantitative measurements of movement abnormalities in order to analyse the effect of these CLCN1 mutations on adult transgenic zebrafish swimming. Two new parameters for body-wave kinematics of swimming reveal changes in body curvature and tail offset in transgenic zebrafish expressing the disease-associated CLCN1 mutants, presumably due to their effect on muscle function. The capability of the developed video analytic tool to distinguish wild-type from transgenic zebrafish could provide a useful asset to screen for compounds that reverse the disease phenotype, and may be applicable to other movement disorders besides myotonia congenita.

  19. Functional single nucleotide polymorphisms within the cyclin-dependent kinase inhibitor 2A/2B region affect pancreatic cancer risk

    Campa, Daniele; Pastore, Manuela; Gentiluomo, Manuel; Talar-Wojnarowska, Renata; Kupcinskas, Juozas; Malecka-Panas, Ewa; Neoptolemos, John P.; Niesen, Willem; Vodicka, Pavel; Delle Fave, Gianfranco; Bueno-de-Mesquita, H. Bas; Gazouli, Maria; Pacetti, Paola; Di Leo, Milena; Ito, Hidemi; Klüter, Harald; Soucek, Pavel; Corbo, Vincenzo; Yamao, Kenji; Hosono, Satoyo; Kaaks, Rudolf; Vashist, Yogesh; Gioffreda, Domenica; Strobel, Oliver; Shimizu, Yasuhiro; Dijk, Frederike; Andriulli, Angelo; Ivanauskas, Audrius; Bugert, Peter; Tavano, Francesca; Vodickova, Ludmila; Zambon, Carlo Federico; Lovecek, Martin; Landi, Stefano; Key, Timothy J.; Boggi, Ugo; Pezzilli, Raffaele; Jamroziak, Krzysztof; Mohelnikova-Duchonova, Beatrice; Mambrini, Andrea; Bambi, Franco; Busch, Olivier; Pazienza, Valerio; Valente, Roberto; Theodoropoulos, George E.; Hackert, Thilo; Capurso, Gabriele; Cavestro, Giulia Martina; Pasquali, Claudio; Basso, Daniela; Sperti, Cosimo; Matsuo, Keitaro; Büchler, Markus; Khaw, Kay-Tee; Izbicki, Jakob; Costello, Eithne; Katzke, Verena; Michalski, Christoph; Stepien, Anna; Rizzato, Cosmeri; Canzian, Federico

    2016-01-01

    The CDKN2A (p16) gene plays a key role in pancreatic cancer etiology. It is one of the most commonly somatically mutated genes in pancreatic cancer, rare germline mutations have been found to be associated with increased risk of developing familiar pancreatic cancer and CDKN2A promoter

  20. The prevalence of ABCB1:c.227_230delATAG mutation in affected dog breeds from European countries.

    Firdova, Zuzana; Turnova, Evelina; Bielikova, Marcela; Turna, Jan; Dudas, Andrej

    2016-06-01

    Deletion of 4-base pairs in the canine ABCB1 (MDR1) gene, responsible for encoding P-glycoprotein, leads to nonsense frame-shift mutation, which causes hypersensitivity to macrocyclic lactones drugs (e.g. ivermectin). To date, at least 12 purebred dog breeds have been found to be affected by this mutation. The aim of this study was to update information about the prevalence of ABCB1 mutation (c.227_230delATAG) in predisposed breeds in multiple European countries. This large scale survey also includes countries which were not involved in previous studies. The samples were collected in the period from 2012 to 2014. The overview is based on genotyping data of 4729 individuals. The observed mutant allele frequencies were 58.5% (Smooth Collie), 48.3% (Rough Collie), 35% (Australian Shepherd), 30.3% (Shetland Sheepdog), 28.1% (Silken Windhound), 26.1% (Miniature Australian Shepherd), 24.3% (Longhaired Whippet), 16.2% (White Swiss Shepherd) and 0% (Border Collie). The possible presence of an ABCB1 mutant allele in Akita-Inu breed has been investigated with negative results. This information could be helpful for breeders in optimization of their breeding strategy and for veterinarians when prescribing drug therapy for dogs of predisposed breeds. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Cell surface fucosylation does not affect development of colon tumors in mice with germline Smad3 mutation

    Domino, Steven E.; Karnak, David M.; Hurd, Elizabeth A.

    2006-01-01

    Background/Aims: Neoplasia-related alterations in cell surface α(1,2)fucosylated glycans have been reported in multiple tumors including colon, pancreas, endometrium, cervix, bladder, lung, and choriocarcinoma. Spontaneous colorectal tumors from mice with a germline null mutation of transforming growth factor-β signaling gene Smad3 (Madh3) were tested for α(1,2)fucosylated glycan expression. Methods: Ulex Europaeus Agglutinin-I lectin staining, fucosyltransferase gene northern blot analysis, and a cross of mutant mice with Fut2 and Smad3 germline mutations were performed. Results: Spontaneous colorectal tumors from Smad3 (-/-) homozygous null mice were found to express α(1,2)fucosylated glycans in an abnormal pattern compared to adjacent nonneoplastic colon. Northern blot analysis of α(1,2)fucosyltransferase genes Fut1 and Fut2 revealed that Fut2, but not Fut1, steady-state mRNA levels were significantly increased in tumors relative to adjacent normal colonic mucosa. Mutant mice with a Fut2-inactivating germline mutation were crossed with Smad3 targeted mice. In Smad3 (-/-)/Fut2 (-/-) double knock-out mice, UEA-I lectin staining was eliminated from colon and colon tumors, however, the number and size of tumors present by 24 weeks of age did not vary regardless of the Fut2 genotype. Conclusions: In this model of colorectal cancer, cell surface α(1,2)fucosylation does not affect development of colon tumors. PMID:17264540

  2. Mutations altering the gammaretrovirus endoproteolytic motif affect glycosylation of the envelope glycoprotein and early events of the virus life cycle

    Argaw, Takele; Wilson, Carolyn A., E-mail: carolyn.wilson@fda.hhs.gov

    2015-01-15

    Previously, we found that mutation of glutamine to proline in the endoproteolytic cleavage signal of the PERV-C envelope (RQKK to RPKK) resulted in non-infectious vectors. Here, we show that RPKK results in a non-infectious vector when placed in not only a PERV envelope, but also the envelope of a related gammaretrovirus, FeLV-B. The amino acid substitutions do not prevent envelope precursor cleavage, viral core and genome assembly, or receptor binding. Rather, the mutations result in the formation of hyperglycosylated glycoprotein and a reduction in the reverse transcribed minus strand synthesis and undetectable 2-LTR circular DNA in cells exposed to vectors with these mutated envelopes. Our findings suggest novel functions associated with the cleavage signal sequence that may affect trafficking through the glycosylation machinery of the cell. Further, the glycosylation status of the envelope appears to impact post-binding events of the viral life cycle, either membrane fusion, internalization, or reverse transcription. - Highlights: • Env cleavage signal impacts infectivity of gammaretroviruses. • Non-infectious mutants have hyper-glycosylated envelope that bind target cells. • Non-infectious mutants have defects in the formation of the double-stranded DNA. • Env cleavage motif has functions beyond cleavage of the env precursor.

  3. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus

    Zhitao Niu

    2017-11-01

    Full Text Available The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1 consistent GC content evolution trends and mutational biases in single-copy (SC and inverted repeats (IRs regions; and (2 that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus.

  4. Mutational Biases and GC-Biased Gene Conversion Affect GC Content in the Plastomes of Dendrobium Genus

    Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu

    2017-01-01

    The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062

  5. A novel COL11A1 mutation affecting splicing in a patient with Stickler syndrome.

    Kohmoto, Tomohiro; Naruto, Takuya; Kobayashi, Haruka; Watanabe, Miki; Okamoto, Nana; Masuda, Kiyoshi; Imoto, Issei; Okamoto, Nobuhiko

    2015-01-01

    Stickler syndrome is a clinically and genetically heterogeneous collagenopathy characterized by ocular, auditory, skeletal and orofacial abnormalities, commonly occurring as an autosomal dominant trait. We conducted target resequencing to analyze candidate genes associated with known clinical phenotypes from a 4-year-old girl with Stickler syndrome. We detected a novel heterozygous intronic mutation (NM_001854.3:c.3168+5G>A) in COL11A1 that may impair splicing, which was suggested by in silico prediction and a minigene assay.

  6. Mutation of the protein kinase C site in borna disease virus phosphoprotein abrogates viral interference with neuronal signaling and restores normal synaptic activity.

    Christine M A Prat

    2009-05-01

    Full Text Available Understanding the pathogenesis of infection by neurotropic viruses represents a major challenge and may improve our knowledge of many human neurological diseases for which viruses are thought to play a role. Borna disease virus (BDV represents an attractive model system to analyze the molecular mechanisms whereby a virus can persist in the central nervous system (CNS and lead to altered brain function, in the absence of overt cytolysis or inflammation. Recently, we showed that BDV selectively impairs neuronal plasticity through interfering with protein kinase C (PKC-dependent signaling in neurons. Here, we tested the hypothesis that BDV phosphoprotein (P may serve as a PKC decoy substrate when expressed in neurons, resulting in an interference with PKC-dependent signaling and impaired neuronal activity. By using a recombinant BDV with mutated PKC phosphorylation site on P, we demonstrate the central role of this protein in BDV pathogenesis. We first showed that the kinetics of dissemination of this recombinant virus was strongly delayed, suggesting that phosphorylation of P by PKC is required for optimal viral spread in neurons. Moreover, neurons infected with this mutant virus exhibited a normal pattern of phosphorylation of the PKC endogenous substrates MARCKS and SNAP-25. Finally, activity-dependent modulation of synaptic activity was restored, as assessed by measuring calcium dynamics in response to depolarization and the electrical properties of neuronal networks grown on microelectrode arrays. Therefore, preventing P phosphorylation by PKC abolishes viral interference with neuronal activity in response to stimulation. Our findings illustrate a novel example of viral interference with a differentiated neuronal function, mainly through competition with the PKC signaling pathway. In addition, we provide the first evidence that a viral protein can specifically interfere with stimulus-induced synaptic plasticity in neurons.

  7. A UV-induced mutation in neurospora that affects translational regulation in response to arginine

    Freitag, M.; Dighde, N.; Sachs, M.S.

    1996-01-01

    The Neurospora crassa arg-2 gene encodes the small subunit of arginine-specific carbamoyl phosphate synthetase. The levels of arg-2 mRNA and mRNA translation are negatively regulated by arginine. An upstream open reading frame (uORF) in the transcript's 5' region has been implicated in arginine-specific control. An arg-2-hph fusion gene encoding hygromycin phosphotransferase conferred arginine-regulated resistance to hygromycin when introduced into N. crassa. We used an arg-2-hph strain to select for UV-induced mutants that grew in the presence of hygromycin and arginine, and we isolated 46 mutants that had either of two phenotypes. One phenotype indicated altered expression of both arg-2-hph and arg-2 genes; the other, altered expression of arg-2-hph but not arg-2. One of the latter mutations, which was genetically closely linked to arg-2-hph, was recovered from the 5' region of the arg-2-hph gene using PCR Sequence analyses and transformation experiments revealed a mutation at uORF codon 12 (Asp to Asn) that abrogated negative regulation. Examination of the distribution of ribosomes on arg-2-hph transcripts showed that loss of regulation had a translational component, indicating the uORF sequence was important for Arg-specific translational control. Comparisons with other uORFs suggest common elements in translational control mechanisms

  8. SAD-B kinase regulates pre-synaptic vesicular dynamics at hippocampal Schaffer collateral synapses and affects contextual fear memory.

    Watabe, Ayako M; Nagase, Masashi; Hagiwara, Akari; Hida, Yamato; Tsuji, Megumi; Ochiai, Toshitaka; Kato, Fusao; Ohtsuka, Toshihisa

    2016-01-01

    Synapses of amphids defective (SAD)-A/B kinases control various steps in neuronal development and differentiation, such as axon specifications and maturation in central and peripheral nervous systems. At mature pre-synaptic terminals, SAD-B is associated with synaptic vesicles and the active zone cytomatrix; however, how SAD-B regulates neurotransmission and synaptic plasticity in vivo remains unclear. Thus, we used SAD-B knockout (KO) mice to study the function of this pre-synaptic kinase in the brain. We found that the paired-pulse ratio was significantly enhanced at Shaffer collateral synapses in the hippocampal CA1 region in SAD-B KO mice compared with wild-type littermates. We also found that the frequency of the miniature excitatory post-synaptic current was decreased in SAD-B KO mice. Moreover, synaptic depression following prolonged low-frequency synaptic stimulation was significantly enhanced in SAD-B KO mice. These results suggest that SAD-B kinase regulates vesicular release probability at pre-synaptic terminals and is involved in vesicular trafficking and/or regulation of the readily releasable pool size. Finally, we found that hippocampus-dependent contextual fear learning was significantly impaired in SAD-B KO mice. These observations suggest that SAD-B kinase plays pivotal roles in controlling vesicular release properties and regulating hippocampal function in the mature brain. Synapses of amphids defective (SAD)-A/B kinases control various steps in neuronal development and differentiation, but their roles in mature brains were only partially known. Here, we demonstrated, at mature pre-synaptic terminals, that SAD-B regulates vesicular release probability and synaptic plasticity. Moreover, hippocampus-dependent contextual fear learning was significantly impaired in SAD-B KO mice, suggesting that SAD-B kinase plays pivotal roles in controlling vesicular release properties and regulating hippocampal function in the mature brain. © 2015 International

  9. Emodin negatively affects the phosphoinositide 3-kinase/AKT signalling pathway: a study on its mechanism of action

    Olsen, Birgitte B; Bjørling-Poulsen, Marina; Guerra, Barbara

    2007-01-01

    with inhibitors of protein kinase CK2, such as emodin, induces apoptosis and that the anti-apoptotic effect of CK2 is partially mediated by target phosphorylation and up-regulation of AKT by CK2. In the present study, a screening with selected CK2 inhibitors induced a variable response with respect to AKT down...

  10. Differentiation of C2C12 myoblasts expressing lamin A mutated at a site responsible for Emery-Dreifuss muscular dystrophy is improved by inhibition of the MEK-ERK pathway and stimulation of the PI3-kinase pathway

    Favreau, Catherine; Delbarre, Erwan; Courvalin, Jean-Claude; Buendia, Brigitte

    2008-01-01

    Mutation R453W in A-type lamins, that are major nuclear envelope proteins, generates Emery-Dreifuss muscular dystrophy. We previously showed that mouse myoblasts expressing R453W-lamin A incompletely exit the cell cycle and differentiate into myocytes with a low level of multinucleation. Here we attempted to improve differentiation by treating these cells with a mixture of PD98059, an extracellular-regulated kinase (ERK) kinase (also known as mitogen-activated kinase, MEK) inhibitor, and insulin-like growth factor-II, an activator of phosphoinositide 3-kinase. We show that mouse myoblasts expressing R453W-lamin A were sensitive to the drug treatment as shown by (i) an increase in multinucleation, (ii) downregulation of proliferation markers (cyclin D1, hyperphosphorylated Rb), (iii) upregulation of myogenin, and (iv) sustained activation of p21 and cyclin D3. However, nuclear matrix anchorage of p21 and cyclin D3 in a complex with hypophosphorylated Rb that is critical to trigger cell cycle arrest and myogenin induction was deficient and incompletely restored by drug treatment. As the turn-over of R453W-lamin A at the nuclear envelope was greatly enhanced, we propose that R453W-lamin A impairs the capacity of the nuclear lamina to serve as scaffold for substrates of the MEK-ERK pathway and for MyoD-induced proteins that play a role in the differentiation process

  11. Mutations in the C-terminal region affect subcellular localization of crucian carp herpesvirus (CaHV) GPCR.

    Wang, Jun; Gui, Lang; Chen, Zong-Yan; Zhang, Qi-Ya

    2016-08-01

    G protein-coupled receptors (GPCRs) are known as seven transmembrane domain receptors and consequently can mediate diverse biological functions via regulation of their subcellular localization. Crucian carp herpesvirus (CaHV) was recently isolated from infected fish with acute gill hemorrhage. CaHV GPCR of 349 amino acids (aa) was identified based on amino acid identity. A series of variants with truncation/deletion/substitution mutation in the C-terminal (aa 315-349) were constructed and expressed in fathead minnow (FHM) cells. The roles of three key C-terminal regions in subcellular localization of CaHV GPCR were determined. Lysine-315 (K-315) directed the aggregation of the protein preferentially at the nuclear side. Predicted N-myristoylation site (GGGWTR, aa 335-340) was responsible for punctate distribution in periplasm or throughout the cytoplasm. Predicted phosphorylation site (SSR, aa 327-329) and GGGWTR together determined the punctate distribution in cytoplasm. Detection of organelles localization by specific markers showed that the protein retaining K-315 colocalized with the Golgi apparatus. These experiments provided first evidence that different mutations of CaHV GPCR C-terminals have different affects on the subcellular localization of fish herpesvirus-encoded GPCRs. The study provided valuable information and new insights into the precise interactions between herpesvirus and fish cells, and could also provide useful targets for antiviral agents in aquaculture.

  12. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  13. Cell culture-adaptive mutations of NS5A affect replication of hepatitis C virus differentially depending on the viral genotypes.

    Chung, Aeri; Jin, Bora; Han, Kwang-Hyub; Ahn, Sang Hoon; Kim, Seungtaek

    2017-01-01

    Most of HCV RNAs require cell culture-adaptive mutations for efficient replication in cell culture and a number of such mutations have been described including a well-known S2204I substitution mutation in NS5A protein. In contrast, the replication of genotype 2a JFH1 RNA in cell culture does not require any cell culture-adaptive mutation. Rather, the presence of S2204I mutation impaired the JFH1 RNA replication. In this study, we examined the effect of reversions and substitutions of NS5A cell culture-adaptive mutations on virus replication in different genotypic backgrounds after either placing genotype 1a NS5A in the genotype 2a JFH1 or vice versa. The results from this investigation suggest that the S2204I mutation affects HCV RNA replication differentially depending on the viral genotypes but that the effect was not simply explained by the genotypic background. Perhaps, the effect of the S2204I mutation on HCV replication reflects both intra- and intergenic interactions of NS5A protein. J. Med. Virol. 89:146-152, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Molecular analysis of HEXA gene in Argentinean patients affected with Tay-Sachs disease: possible common origin of the prevalent c.459+5A>G mutation.

    Zampieri, Stefania; Montalvo, Annalisa; Blanco, Mariana; Zanin, Irene; Amartino, Hernan; Vlahovicek, Kristian; Szlago, Marina; Schenone, Andrea; Pittis, Gabriela; Bembi, Bruno; Dardis, Andrea

    2012-05-15

    Tay-Sachs disease (TSD) is a recessively inherited disorder caused by the deficient activity of hexosaminidase A due to mutations in the HEXA gene. Up to date there is no information regarding the molecular genetics of TSD in Argentinean patients. In the present study we have studied 17 Argentinean families affected by TSD, including 20 patients with the acute infantile form and 3 with the sub-acute form. Overall, we identified 14 different mutations accounting for 100% of the studied alleles. Eight mutations were novel: 5 were single base changes leading to drastic residue changes or truncated proteins, 2 were small deletions and one was an intronic mutation that may cause a splicing defect. Although the spectrum of mutations was highly heterogeneous, a high frequency of the c.459+5G>A mutation, previously described in different populations was found among the studied cohort. Haplotype analysis suggested that in these families the c.459+5G>A mutation might have arisen by a single mutational event. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Interleukin-6 Deficiency Does Not Affect Motor Neuron Disease Caused by Superoxide Dismutase 1 Mutation.

    Han, Yongmei; Ripley, Barry; Serada, Satoshi; Naka, Tetsuji; Fujimoto, Minoru

    2016-01-01

    Amyotrophic Lateral Sclerosis (ALS) is an adult-onset, progressive, motor neuron degenerative disease. Recent evidence indicates that inflammation is associated with many neurodegenerative diseases including ALS. Previously, abnormal levels of inflammatory cytokines including IL-1β, IL-6 and TNF-α were described in ALS patients and/or in mouse ALS models. In addition, one study showed that blocking IL-1β could slow down progression of ALS-like symptoms in mice. In this study, we examined a role for IL-6 in ALS, using an animal model for familial ALS. Mice with mutant SOD1 (G93A) transgene, a model for familial ALS, were used in this study. The expression of the major inflammatory cytokines, IL-6, IL-1β and TNF-α, in spinal cords of these SOD1 transgenic (TG) mice were assessed by real time PCR. Mice were then crossed with IL-6(-/-) mice to generate SOD1TG/IL-6(-/-) mice. SOD1 TG/IL-6(-/-) mice (n = 17) were compared with SOD1 TG/IL-6(+/-) mice (n = 18), SOD1 TG/IL-6(+/+) mice (n = 11), WT mice (n = 15), IL-6(+/-) mice (n = 5) and IL-6(-/-) mice (n = 8), with respect to neurological disease severity score, body weight and the survival. We also histologically compared the motor neuron loss in lumber spinal cords and the atrophy of hamstring muscles between these mouse groups. Levels of IL-6, IL-1β and TNF-α in spinal cords of SOD1 TG mice was increased compared to WT mice. However, SOD1 TG/IL-6(-/-) mice exhibited weight loss, deterioration in motor function and shortened lifespan (167.55 ± 11.52 days), similarly to SOD1 TG /IL-6(+/+) mice (164.31±12.16 days). Motor neuron numbers and IL-1β and TNF-α levels in spinal cords were not significantly different in SOD1 TG /IL-6(-/-) mice and SOD1 TG /IL-6 (+/+) mice. These results provide compelling preclinical evidence indicating that IL-6 does not directly contribute to motor neuron disease caused by SOD1 mutations.

  16. Interleukin-6 Deficiency Does Not Affect Motor Neuron Disease Caused by Superoxide Dismutase 1 Mutation.

    Yongmei Han

    Full Text Available Amyotrophic Lateral Sclerosis (ALS is an adult-onset, progressive, motor neuron degenerative disease. Recent evidence indicates that inflammation is associated with many neurodegenerative diseases including ALS. Previously, abnormal levels of inflammatory cytokines including IL-1β, IL-6 and TNF-α were described in ALS patients and/or in mouse ALS models. In addition, one study showed that blocking IL-1β could slow down progression of ALS-like symptoms in mice. In this study, we examined a role for IL-6 in ALS, using an animal model for familial ALS.Mice with mutant SOD1 (G93A transgene, a model for familial ALS, were used in this study. The expression of the major inflammatory cytokines, IL-6, IL-1β and TNF-α, in spinal cords of these SOD1 transgenic (TG mice were assessed by real time PCR. Mice were then crossed with IL-6(-/- mice to generate SOD1TG/IL-6(-/- mice. SOD1 TG/IL-6(-/- mice (n = 17 were compared with SOD1 TG/IL-6(+/- mice (n = 18, SOD1 TG/IL-6(+/+ mice (n = 11, WT mice (n = 15, IL-6(+/- mice (n = 5 and IL-6(-/- mice (n = 8, with respect to neurological disease severity score, body weight and the survival. We also histologically compared the motor neuron loss in lumber spinal cords and the atrophy of hamstring muscles between these mouse groups.Levels of IL-6, IL-1β and TNF-α in spinal cords of SOD1 TG mice was increased compared to WT mice. However, SOD1 TG/IL-6(-/- mice exhibited weight loss, deterioration in motor function and shortened lifespan (167.55 ± 11.52 days, similarly to SOD1 TG /IL-6(+/+ mice (164.31±12.16 days. Motor neuron numbers and IL-1β and TNF-α levels in spinal cords were not significantly different in SOD1 TG /IL-6(-/- mice and SOD1 TG /IL-6 (+/+ mice.These results provide compelling preclinical evidence indicating that IL-6 does not directly contribute to motor neuron disease caused by SOD1 mutations.

  17. Alpha-cardiac myosin heavy chain (MYH6) mutations affecting myofibril formation are associated with congenital heart defects.

    Granados-Riveron, Javier T; Ghosh, Tushar K; Pope, Mark; Bu'Lock, Frances; Thornborough, Christopher; Eason, Jacqueline; Kirk, Edwin P; Fatkin, Diane; Feneley, Michael P; Harvey, Richard P; Armour, John A L; David Brook, J

    2010-10-15

    Congenital heart defects (CHD) are collectively the most common form of congenital malformation. Studies of human cases and animal models have revealed that mutations in several genes are responsible for both familial and sporadic forms of CHD. We have previously shown that a mutation in MYH6 can cause an autosomal dominant form of atrial septal defect (ASD), whereas others have identified mutations of the same gene in patients with hypertrophic and dilated cardiomyopathy. In the present study, we report a mutation analysis of MYH6 in patients with a wide spectrum of sporadic CHD. The mutation analysis of MYH6 was performed in DNA samples from 470 cases of isolated CHD using denaturing high-performance liquid chromatography and sequence analysis to detect point mutations and small deletions or insertions, and multiplex amplifiable probe hybridization to detect partial or complete copy number variations. One non-sense mutation, one splicing site mutation and seven non-synonymous coding mutations were identified. Transfection of plasmids encoding mutant and non-mutant green fluorescent protein-MYH6 fusion proteins in mouse myoblasts revealed that the mutations A230P and A1366D significantly disrupt myofibril formation, whereas the H252Q mutation significantly enhances myofibril assembly in comparison with the non-mutant protein. Our data indicate that functional variants of MYH6 are associated with cardiac malformations in addition to ASD and provide a novel potential mechanism. Such phenotypic heterogeneity has been observed in other genes mutated in CHD.

  18. Epilepsy caused by CDKL5 mutations.

    Castrén, Maija; Gaily, Eija; Tengström, Carola; Lähdetie, Jaana; Archer, Hayley; Ala-Mello, Sirpa

    2011-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been identified in female patients with early onset epileptic encephalopathy and severe mental retardation with a Rett-like phenotype. Subsequently CDKL5 mutations were shown to be associated with more diverse phenotypes including mild epilepsy and autism without epilepsy. Furthermore, CDKL5 mutations were found in patients with Angelman-like phenotype. The severity of epilepsy associated with CDKL5 mutations was recently shown to correlate with the type of CDKL5 mutations and epilepsy was identified to involve three distinct sequential stages. Here, we describe the phenotype of a severe form of neurodevelopmental disease in a female patient with a de novo nonsense mutation of the CDKL5 gene c.175C > T (p.R59X) affecting the catalytic domain of CDKL5 protein. Mutations in the CDKL5 gene are less common in males and can be associated with a genomic deletion as found in our male patient with a deletion of 0.3 Mb at Xp22.13 including the CDKL5 gene. We review phenotypes associated with CDKL5 mutations and examine putative relationships between the clinical epilepsy phenotype and the type of the mutation in the CDKL5 gene. © 2010 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  19. Loss of thymidine kinase 2 alters neuronal bioenergetics and leads to neurodegeneration

    Bartesaghi, Stefano; Betts-Henderson, Joanne; Cain, Kelvin; Dinsdale, David; Zhou, Xiaoshan; Karlsson, Anna; Salomoni, Paolo; Nicotera, Pierluigi

    2010-01-01

    Mutations of thymidine kinase 2 (TK2), an essential component of the mitochondrial nucleotide salvage pathway, can give rise to mitochondrial DNA (mtDNA) depletion syndromes (MDS). These clinically heterogeneous disorders are characterized by severe reduction in mtDNA copy number in affected tissues and are associated with progressive myopathy, hepatopathy and/or encephalopathy, depending in part on the underlying nuclear genetic defect. Mutations of TK2 have previously been associated with a...

  20. Whole-Genome Sequencing and iPLEX MassARRAY Genotyping Map an EMS-Induced Mutation Affecting Cell Competition in Drosophila melanogaster.

    Lee, Chang-Hyun; Rimesso, Gerard; Reynolds, David M; Cai, Jinlu; Baker, Nicholas E

    2016-10-13

    Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the Atm and Xrp1 genes identified in this screen. Copyright © 2016 Lee et al.

  1. Whole-Genome Sequencing and iPLEX MassARRAY Genotyping Map an EMS-Induced Mutation Affecting Cell Competition in Drosophila melanogaster

    Chang-Hyun Lee

    2016-10-01

    Full Text Available Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the Atm and Xrp1 genes identified in this screen.

  2. Joint analysis of quantitative trait loci and major-effect causative mutations affecting meat quality and carcass composition traits in pigs.

    Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Hérault, Frédéric; Damon, Marie; Le Roy, Pascale

    2011-08-29

    Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08), with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the influence of major-effect mutations on the least affected

  3. Joint analysis of quantitative trait loci and major-effect causative mutations affecting meat quality and carcass composition traits in pigs

    Iannuccelli Nathalie

    2011-08-01

    Full Text Available Abstract Background Detection of quantitative trait loci (QTLs affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08, with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Results Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Conclusions Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the

  4. Clinical phenotype of 5 females with a CDKL5 mutation.

    Stalpers, Xenia L; Spruijt, Liesbeth; Yntema, Helger G; Verrips, Aad

    2012-01-01

    Mutations in the X-linked cyclin dependent kinase like 5 (CDKL5) gene have been reported in approximately 80 patients since the first description in 2003. The clinical presentation partly corresponds with Rett syndrome, considering clinical features as intellectual disability, hypotonia, and poor visual, language, and motor development. However, these patients do not meet the consensus criteria for Rett syndrome since they lack the clear period of regression. Furthermore, in contrast to Rett syndrome, patients with CDKL5 mutations, have seizures or infantile spasms starting in the first weeks of life. We present clinical phenotype of 5 girls having a mutation in the CDKL5 gene. All mutations are novel and are pathogenic since they either lead to a frameshift in the reading frame or affect a consensus splice site. Four of the mutations are detected de novo in the affected girl.

  5. [INHIBITORS OF MAP-KINASE PATHWAY U0126 AND PD98059 DIFFERENTLY AFFECT ORGANIZATION OF TUBULIN CYTOSKELETON AFTER STIMULATION OF EGF RECEPTOR ENDOCYTOSIS].

    Zlobina, M V; Steblyanko, Yu Yu; Shklyaeva, M A; Kharchenko, V V; Salova, A V; Kornilova, E S

    2015-01-01

    To confirm the hypothesis about the involvement of EGF-stimulated MAP-kinase ERK1/2 in the regulation of microtubule (MT) system, the influence of two widely used ERK1/2 inhibitors, U0126 and PD98059, on the organization of tubulin cytoskeleton in interphase HeLa cells during EGF receptor endocytosis has been investigated. We have found that addition of U0126 or PD98059 to not-stimulated with EGF ells for 30 min has no effect on radially organized MT system. However, in the case of U0126 addition before EGF endocytosis stimulation, the number of MT per cell decreased within 15 min after such stimulation and was followed by complete MT depolymerization by 60-90 min. Stimulation of EGF endocytosis in the presence of PD98059 resulted only in insignificant depolymerization of MT and it could be detected mainly from their minus-ends. At the same time, MT regions close to plasma membrane became stabilized, which was proved by increase in tubulin acetylation level. This situation was characteristic for all period of the experiment. It has been also found that the inhibitors affect endocytosis dynamics of EGF-receptor complexes. Quantitative analysis demonstrated that the stimulation of endocytosis in the presence of U0126 generated a greater number of endosomes compared to control cells, and their number did not change significantly during the experiment. All these endosomes were localized peripherally. Effect of PD98059 resulted in the formation of lower number of endosomes that in control, but they demonstrated very slow clusterization despite the presence of some intact MT. Both inhibitors decreased EGFR colocolization with early endosomal marker EEA1, which indicated a delay in endosome fusions and maturation. The inhibitors were also shown to affect differently phospho-ERK 1 and 2 forms: U0126 completely inhibited phospho-ERK1 and 2, white, in the presence of PD98059, the two ERK forms demonstrated sharp transient activation in 15 min after stimulation, but only

  6. Hsp90 inhibition differentially destabilises MAP kinase and TGF-beta signalling components in cancer cells revealed by kinase-targeted chemoproteomics

    Haupt, Armin; Dahl, Andreas; Lappe, Michael; Lehrach, Hans; Gonzalez, Cayetano; Drewes, Gerard; Lange, Bodo MH; Joberty, Gerard; Bantscheff, Marcus; Fröhlich, Holger; Stehr, Henning; Schweiger, Michal R; Fischer, Axel; Kerick, Martin; Boerno, Stefan T

    2012-01-01

    The heat shock protein 90 (Hsp90) is required for the stability of many signalling kinases. As a target for cancer therapy it allows the simultaneous inhibition of several signalling pathways. However, its inhibition in healthy cells could also lead to severe side effects. This is the first comprehensive analysis of the response to Hsp90 inhibition at the kinome level. We quantitatively profiled the effects of Hsp90 inhibition by geldanamycin on the kinome of one primary (Hs68) and three tumour cell lines (SW480, U2OS, A549) by affinity proteomics based on immobilized broad spectrum kinase inhibitors ('kinobeads'). To identify affected pathways we used the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway classification. We combined Hsp90 and proteasome inhibition to identify Hsp90 substrates in Hs68 and SW480 cells. The mutational status of kinases from the used cell lines was determined using next-generation sequencing. A mutation of Hsp90 candidate client RIPK2 was mapped onto its structure. We measured relative abundances of > 140 protein kinases from the four cell lines in response to geldanamycin treatment and identified many new potential Hsp90 substrates. These kinases represent diverse families and cellular functions, with a strong representation of pathways involved in tumour progression like the BMP, MAPK and TGF-beta signalling cascades. Co-treatment with the proteasome inhibitor MG132 enabled us to classify 64 kinases as true Hsp90 clients. Finally, mutations in 7 kinases correlate with an altered response to Hsp90 inhibition. Structural modelling of the candidate client RIPK2 suggests an impact of the mutation on a proposed Hsp90 binding domain. We propose a high confidence list of Hsp90 kinase clients, which provides new opportunities for targeted and combinatorial cancer treatment and diagnostic applications

  7. Sapanisertib and Osimertinib in Treating Patients With Stage IV EGFR Mutation Positive Non-small Cell Lung Cancer After Progression on a Previous EGFR Tyrosine Kinase Inhibitor

    2018-04-25

    EGFR Activating Mutation; EGFR Exon 19 Deletion Mutation; EGFR NP_005219.2:p.G719X; EGFR NP_005219.2:p.L858R; EGFR NP_005219.2:p.L861Q; EGFR T790M Mutation Negative; Recurrent Non-Small Cell Lung Carcinoma; Stage III Non-Small Cell Lung Cancer AJCC v7; Stage IIIA Non-Small Cell Lung Cancer AJCC v7; Stage IIIB Non-Small Cell Lung Cancer AJCC v7; Stage IV Non-Small Cell Lung Cancer AJCC v7

  8. The LRRK2 G2385R variant is a partial loss-of-function mutation that affects synaptic vesicle trafficking through altered protein interactions.

    Carrion, Maria Dolores Perez; Marsicano, Silvia; Daniele, Federica; Marte, Antonella; Pischedda, Francesca; Di Cairano, Eliana; Piovesana, Ester; von Zweydorf, Felix; Kremmer, Elisabeth; Gloeckner, Christian Johannes; Onofri, Franco; Perego, Carla; Piccoli, Giovanni

    2017-07-14

    Mutations in the Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial Parkinson's disease (PD). LRRK2 protein contains several functional domains, including protein-protein interaction domains at its N- and C-termini. In this study, we analyzed the functional features attributed to LRRK2 by its N- and C-terminal domains. We combined TIRF microscopy and synaptopHluorin assay to visualize synaptic vesicle trafficking. We found that N- and C-terminal domains have opposite impact on synaptic vesicle dynamics. Biochemical analysis demonstrated that different proteins are bound at the two extremities, namely β3-Cav2.1 at N-terminus part and β-Actin and Synapsin I at C-terminus domain. A sequence variant (G2385R) harboured within the C-terminal WD40 domain increases the risk for PD. Complementary biochemical and imaging approaches revealed that the G2385R variant alters strength and quality of LRRK2 interactions and increases fusion of synaptic vesicles. Our data suggest that the G2385R variant behaves like a loss-of-function mutation that mimics activity-driven events. Impaired scaffolding capabilities of mutant LRRK2 resulting in perturbed vesicular trafficking may arise as a common pathophysiological denominator through which different LRRK2 pathological mutations cause disease.

  9. Predictive efficacy of low burden EGFR mutation detected by next-generation sequencing on response to EGFR tyrosine kinase inhibitors in non-small-cell lung carcinoma.

    Hye Sook Kim

    Full Text Available Direct sequencing remains the most widely used method for the detection of epidermal growth factor receptor (EGFR mutations in lung cancer; however, its relatively low sensitivity limits its clinical use. The objective of this study was to investigate the sensitivity of detecting an epidermal growth factor receptor (EGFR mutation from peptide nucleic acid-locked nucleic acid polymerase chain reaction (PNA-LNA PCR clamp and Ion Torrent Personal Genome Machine (PGM techniques compared to that by direct sequencing. Furthermore, the predictive efficacy of EGFR mutations detected by PNA-LNA PCR clamp was evaluated. EGFR mutational status was assessed by direct sequencing, PNA-LNA PCR clamp, and Ion Torrent PGM in 57 patients with non-small cell lung cancer (NSCLC. We evaluated the predictive efficacy of PNA-LNA PCR clamp on the EGFR-TKI treatment in 36 patients with advanced NSCLC retrospectively. Compared to direct sequencing (16/57, 28.1%, PNA-LNA PCR clamp (27/57, 47.4% and Ion Torrent PGM (26/57, 45.6% detected more EGFR mutations. EGFR mutant patients had significantly longer progressive free survival (14.31 vs. 21.61 months, P = 0.003 than that of EGFR wild patients when tested with PNA-LNA PCR clamp. However, no difference in response rate to EGFR TKIs (75.0% vs. 82.4%, P = 0.195 or overall survival (34.39 vs. 44.10 months, P = 0.422 was observed between the EGFR mutations by direct sequencing or PNA-LNA PCR clamp. Our results demonstrate firstly that patients with EGFR mutations were detected more frequently by PNA-LNA PCR clamp and Ion Torrent PGM than those by direct sequencing. EGFR mutations detected by PNA-LNA PCR clamp may be as a predicative factor for EGFR TKI response in patients with NSCLC.

  10. Fanconi anemia with biallelic FANCD1/BRCA2 mutations - Case report of a family with three affected children.

    Svojgr, Karel; Sumerauer, David; Puchmajerova, Alena; Vicha, Ales; Hrusak, Ondrej; Michalova, Kyra; Malis, Josef; Smisek, Petr; Kyncl, Martin; Novotna, Drahuse; Machackova, Eva; Jencik, Jan; Pycha, Karel; Vaculik, Miroslav; Kodet, Roman; Stary, Jan

    2016-03-01

    Fanconi anemia, complementation group D1 with bi-allelic FANCD1 (BRCA2) mutations, is a very rare genetic disorder characterized by early onset of childhood malignancies, including acute leukemia, brain cancer and nephroblastoma. Here, we present a case report of a family with 3 affected children in terms of treatment outcome, toxicity and characterization of the malignancies using comprehensive cytogenetic analysis. The first child was diagnosed with T-cell acute lymphoblastic leukemia when he was 11 months old. During chemotherapy, he suffered from repeated pancytopenia, sepsis and severe vincristine polyneuropathy, and 18 months after primary diagnosis, he succumbed to secondary acute monocytic leukemia. The second child was diagnosed with stage 2 triphasic nephroblastoma (Wilms tumor), when he was 3 years and 11 months old. During chemotherapy, he suffered from vincristine polyneuropathy. Currently, he is in complete remission, 29 months following the initial diagnosis. The third child was diagnosed with medulloblastoma with classical histology, when she was 4 years and 5 months old. After the first cycle of chemotherapy, she suffered from prolonged pancytopenia, sepsis and severe skin and mucosal toxicity. Six weeks after primary diagnosis, a first relapse in the posterior fossa was diagnosed, and at 7 and half months after primary diagnosis, a second relapse was diagnosed that led to the patient's death. Our case report underscores tumor heterogeneity, treatment toxicity and poor outcome in Fanconi anemia patients of complementation group D1. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  11. A loss-of-function mutation in the PAS kinase Rim15p is related to defective quiescence entry and high fermentation rates of Saccharomyces cerevisiae sake yeast strains.

    Watanabe, Daisuke; Araki, Yuya; Zhou, Yan; Maeya, Naoki; Akao, Takeshi; Shimoi, Hitoshi

    2012-06-01

    Sake yeast cells have defective entry into the quiescent state, allowing them to sustain high fermentation rates. To reveal the underlying mechanism, we investigated the PAS kinase Rim15p, which orchestrates initiation of the quiescence program in Saccharomyces cerevisiae. We found that Rim15p is truncated at the carboxyl terminus in modern sake yeast strains as a result of a frameshift mutation. Introduction of this mutation or deletion of the full-length RIM15 gene in a laboratory strain led to a defective stress response, decreased synthesis of the storage carbohydrates trehalose and glycogen, and impaired G(1) arrest, which together closely resemble the characteristic phenotypes of sake yeast. Notably, expression of a functional RIM15 gene in a modern sake strain suppressed all of these phenotypes, demonstrating that dysfunction of Rim15p prevents sake yeast cells from entering quiescence. Moreover, loss of Rim15p or its downstream targets Igo1p and Igo2p remarkably improved the fermentation rate in a laboratory strain. This finding verified that Rim15p-mediated entry into quiescence plays pivotal roles in the inhibition of ethanol fermentation. Taken together, our results suggest that the loss-of-function mutation in the RIM15 gene may be the key genetic determinant of the increased ethanol production rates in modern sake yeast strains.

  12. Mutations affecting the SAND domain of DEAF1 cause intellectual disability with severe speech impairment and behavioral problems

    Silfhout, A.T. van; Rajamanickam, S.; Jensik, P.J.; Vergult, S.; Rocker, N. de; Newhall, K.J.; Raghavan, R.; Reardon, S.N.; Jarrett, K.; McIntyre, T.; Bulinski, J.; Ownby, S.L.; Huggenvik, J.I.; McKnight, G.S.; Rose, G.M.; Cai, X; Willaert, A.; Zweier, C.; Endele, S.; Ligt, J. de; Bon, B.W.M. van; Lugtenberg, D.; Vries, P.F. de; Veltman, J.A.; Bokhoven, H. van; Brunner, H.G.; Rauch, A.; Brouwer, A.P.M. de; Carvill, G.L.; Hoischen, A.; Mefford, H.C.; Eichler, E.E.; Vissers, L.E.L.M.; Menten, B.; Collard, M.W.; Vries, L.B.A. de

    2014-01-01

    Recently, we identified in two individuals with intellectual disability (ID) different de novo mutations in DEAF1, which encodes a transcription factor with an important role in embryonic development. To ascertain whether these mutations in DEAF1 are causative for the ID phenotype, we performed

  13. X-linked retinoschisis: RS1 mutation severity and age affect the ERG phenotype in a cohort of 68 affected male subjects.

    Bowles, Kristen; Cukras, Catherine; Turriff, Amy; Sergeev, Yuri; Vitale, Susan; Bush, Ronald A; Sieving, Paul A

    2011-11-29

    To assess the effect of age and RS1 mutation on the phenotype of X-linked retinoschisis (XLRS) subjects using the clinical electroretinogram (ERG) in a cross-sectional analysis. Sixty-eight XLRS males 4.5 to 55 years of age underwent genotyping, and the retinoschisis (RS1) mutations were classified as less severe (27 subjects) or more severe (41 subjects) based on the putative impact on the protein. ERG parameters of retinal function were analyzed by putative mutation severity with age as a continuous variable. The a-wave amplitude remained greater than the lower limit of normal (mean, -2 SD) for 72% of XLRS males and correlated with neither age nor mutation class. However, b-wave and b/a-ratio amplitudes were significantly lower in the more severe than in the less severe mutation groups and in older than in younger subjects. Subjects up to 10 years of age with more severe RS1 mutations had significantly greater b-wave amplitudes and faster a-wave trough implicit times than older subjects in this group. RS1 mutation putative severity and age both had significant effects on retinal function in XLRS only in the severe mutation group, as judged by ERG analysis of the b-wave amplitude and the b/a-ratio, whereas the a-wave amplitude remained normal in most. A new observation was that increasing age (limited to those aged 55 and younger) caused a significant delay in XLRS b-wave onset (i.e., a-wave implicit time), even for those who retained considerable b-wave amplitudes. The delayed b-wave onset suggested that dysfunction of the photoreceptor synapse or of bipolar cells increases with age of XLRS subjects.

  14. Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy

    Nardone Anna

    2004-04-01

    Full Text Available Abstract Background Cystic fibrosis (CF is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000 and functionally important polymorphisms (>200. Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. Methods We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy characterised by an extensive allelic heterogeneity. Results We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R and one microdeletion (4167delCTAAGCC. Conclusion Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%.

  15. Interplay between intergrin-linked kinase and ribonuclease inhibitor affects growth and metastasis of bladder cancer through signaling ILK pathways.

    Zhuang, Xiang; Lv, Mengxin; Zhong, Zhenyu; Zhang, Luyu; Jiang, Rong; Chen, Junxia

    2016-08-30

    Integrin-linked kinase (ILK) is a multifunctional adaptor protein which is involved with protein signalling within cells to modulate malignant (cancer) cell movement, cell cycle, metastasis and epithelial-mesenchymal transition (EMT). Our previous experiment demonstrated that ILK siRNA inhibited the growth and induced apoptosis of bladder cancer cells as well as increased the expression of Ribonuclease inhibitor (RI), an important cytoplasmic protein with many functions. We also reported that RI overexpression inhibited ILK and phosphorylation of AKT and GSK3β. ILK and RI gene both locate on chromosome 11p15 and the two genes are always at the adjacent position of same chromosome during evolution, which suggest that ILK and RI could have some relationship. However, underlying interacting mechanisms remain unclear between them. Here, we postulate that RI might regulate ILK signaling pathway via interacting with ILK. Co-immunoprecipitation, GST pull-down and co-localization under laser confocal microscope assay were used to determine the interaction between ILK and RI exogenously and endogenously. Furthermore, we further verified that there is a direct binding between the two proteins by fluorescence resonance energy transfer (FRET) in cells. Next, The effects of interplay between ILK and RI on the key target protein expressions of PI3K/AKT/mTOR signaling pathway were determined by western blot, immunohistochemistry and immunofluorescence assay in vivo and in vitro. Finally, the interaction was assessed using nude mice xenograft model. We first found that ILK could combine with RI both in vivo and in vitro by GST pull-down, co-immunoprecipitation (Co-IP) and FRET. The protein levels of ILK and RI revealed a significant inverse correlation in vivo and in vitro. Subsequently, The results showed that up-regulating ILK could increase cell proliferation, change cell morphology and regulate cell cycle. We also demonstrated that the overexpression of ILK remarkably

  16. Loss of function mutations in PTPN6 promote STAT3 deregulation via JAK3 kinase in diffuse large B-cell lymphoma

    Demosthenous, Christos; Han, Jing Jing; Hu, Guangzhen; Stenson, Mary; Gupta, Mamta

    2015-01-01

    PTPN6 (SHP1) is a tyrosine phosphatase that negatively controls the activity of multiple signaling pathways including STAT signaling, however role of mutated PTPN6 is not much known. Here we investigated whether PTPN6 might also be a potential target for diffuse large B cell lymphoma (DLBCL) and performed Sanger sequencing of the PTPN6 gene. We have identified missense mutations within PTPN6 (N225K and A550V) in 5% (2/38) of DLBCL tumors. Site directed mutagenesis was performed to mutate wild type (WT) PTPN6 and stable cell lines were generated by lentiviral transduction of PTPN6WT, PTPN6N225K and PTPN6A550V constructs, and effects of WT or mutated PTPN6 on STAT3 signaling were analyzed. WT PTPN6 dephosphorylated STAT3, but had no effect on STAT1, STAT5 or STAT6 phosphorylation. Both PTPN6 mutants were unable to inhibit constitutive, as well as cytokines induced STAT3 activation. Both PTPN6 mutants also demonstrated reduced tyrosine phosphatase activity and exhibited enhanced STAT3 transactivation activity. Intriguingly, a lack of direct binding between STAT3 and WT or mutated PTPN6 was observed. However, compared to WT PTPN6, cells expressing PTPN6 mutants exhibited increased binding between JAK3 and PTPN6 suggesting a more dynamic interaction of PTPN6 with upstream regulators of STAT3. Consistent with this notion, both the mutants demonstrated increased resistance to JAK3 inhibitor, WHIP-154 relative to WT PTPN6. Overall, this is the first study, which demonstrates that N225K and A550V PTPN6 mutations cause loss-of-function leading to JAK3 mediated deregulation of STAT3 pathway and uncovers a mechanism that tumor cells can use to control PTPN6 substrate specificity. PMID:26565811

  17. A splice acceptor mutation in C. elegans daf-19/Rfx disrupts functional specialization of male-specific ciliated neurons but does not affect ciliogenesis.

    Wells, Kristen L; Rowneki, Mazhgan; Killian, Darrell J

    2015-04-01

    RFX transcription factors are master regulators of ciliogenesis in diverse animal species. The sole Caenorhabditis elegans RFX homolog, DAF-19, plays at least two roles in the formation of functional cilia. The DAF-19(C) isoform is required for ciliogenesis and the DAF-19(M) isoform is required for the functional specialization of a subset of male-specific ciliated neurons called PKD neurons. Here we report the identification of a novel mutation, daf-19(sm129), which disrupts the functional specification of PKD neurons and thus suggests that daf-19m activity is compromised. However, ciliogenesis is not disrupted in daf-19(sm129) mutants suggesting that daf-19c activity is retained. The sm129 mutation disrupts a splice acceptor site adjacent to an exon common to the daf-19c and daf-19m isoforms resulting in aberrant splicing in a proportion of transcripts. While aberrant splicing of daf-19c to upstream cryptic sites results in in-frame and functional products, a large proportion of daf-19m mRNAs include the entire upstream intron, which introduces a frameshift and stop codons. At least 15% of disease-causing mutations affect splicing of the gene bearing the mutation, thus it is important to understand the consequences of splice site mutations on gene function. However, predicting the effects of a splice site mutation remains difficult and experimental determination is still required. Using daf-19(sm129) as a model, our results suggest that this problem is exacerbated when a splice acceptor mutation is used by multiple isoforms of the same gene because the effects on each isoform can be dramatically different. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. A novel point mutation within the EDA gene causes an exon dropping in mature RNA in Holstein Friesian cattle breed affected by X-linked anhidrotic ectodermal dysplasia

    Pariset Lorraine

    2011-07-01

    Full Text Available Abstract Background X-linked anhidrotic ectodermal dysplasia is a disorder characterized by abnormal development of tissues and organs of ectodermal origin caused by mutations in the EDA gene. The bovine EDA gene encodes the ectodysplasin A, a membrane protein expressed in keratinocytes, hair follicles and sweat glands, which is involved in the interactions between cell and cell and/or cell and matrix. Four mutations causing ectodermal dysplasia in cattle have been described so far. Results We identified a new single nucleotide polymorphism (SNP at the 9th base of exon 8 in the EDA gene in two calves of Holstein Friesian cattle breed affected by ectodermal dysplasia. This SNP is located in the exonic splicing enhancer (ESEs recognized by SRp40 protein. As a consequence, the spliceosome machinery is no longer able to recognize the sequence as exonic and causes exon skipping. The mutation determines the deletion of the entire exon (131 bp in the RNA processing, causing a severe alteration of the protein structure and thus the disease. Conclusion We identified a mutation, never described before, that changes the regulation of alternative splicing in the EDA gene and causes ectodermal dysplasia in cattle. The analysis of the SNP allows the identification of carriers that can transmit the disease to the offspring. This mutation can thus be exploited for a rational and efficient selection of unequivocally healthy cows for breeding.

  19. A novel mutation in the NOD2 gene associated with Blau syndrome: a Norwegian family with four affected members

    Milman, N; Ursin, K; Rødevand, E

    2009-01-01

    BACKGROUND: Blau syndrome is a chronic granulomatous disease with an autosomal dominant trait characterized by the triad granulomatous dermatitis, arthritis, and uveitis. It is caused by mutations in the NOD2 gene, also termed the CARD15 gene. OBJECTIVE: To report a novel mutation in the NOD2 gen...... with an autosomal dominant heritage. Most likely the mutation has arisen de novo in the proband. Genetic counselling and antenatal diagnostics should be available to the involved families....... associated with Blau syndrome. METHODS AND RESULTS: The proband was a 68-year-old ethnic Norwegian male who had uveitis and arthritis since 10 years of age followed by lifelong recurrent arthritis and chronic eye involvement. Genetic analysis showed a heterozygous c.1814 C>A, T605N mutation in NOD2 that has...

  20. Deoxyribonucleoside kinases in mitochondrial DNA depletion.

    Saada-Reisch, Ann

    2004-10-01

    Mitochondrial DNA (mtDNA) depletion syndromes (MDS) are a heterogeneous group of mitochondrial disorders, manifested by a decreased mtDNA copy number and respiratory chain dysfunction. Primary MDS are inherited autosomally and may affect a single organ or multiple tissues. Mutated mitochondrial deoxyribonucleoside kinases; deoxyguanosine kinase (dGK) and thymidine kinase 2 (TK2), were associated with the hepatocerebral and myopathic forms of MDS respectively. dGK and TK2 are key enzymes in the mitochondrial nucleotide salvage pathway, providing the mitochondria with deoxyribonucleotides (dNP) essential for mtDNA synthesis. Although the mitochondrial dNP pool is physically separated from the cytosolic one, dNP's may still be imported through specific transport. Non-replicating tissues, where cytosolic dNP supply is down regulated, are thus particularly vulnerable to dGK and TK2 deficiency. The overlapping substrate specificity of deoxycytidine kinase (dCK) may explain the relative sparing of muscle in dGK deficiency, while low basal TK2 activity render this tissue susceptible to TK2 deficiency. The precise pathophysiological mechanisms of mtDNA depletion due to dGK and TK2 deficiencies remain to be determined, though recent findings confirm that it is attributed to imbalanced dNTP pools.

  1. Thymidine kinase 2 (H126N) knockin mice show the essential role of balanced deoxynucleotide pools for mitochondrial DNA maintenance

    Akman, Hasan O.; Dorado, Beatriz; López, Luis C.; García-Cazorla, Ángeles; Vilà, Maya R.; Tanabe, Lauren M.; Dauer, William T.; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

    2008-01-01

    Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous...

  2. A search for mutations affecting protein structure in children of proximally and distally exposed atomic bomb survivors

    Neel, J.V.; Satoh, Chiyoko; Hamilton, H.B.; Otake, Masanori; Goriki, Kazuaki; Kageoka, Takeshi; Fujita, Mikio; Neriishi, Shotaro; Asakawa, Jun-ichi.

    1981-07-01

    A total of 289,868 locus tests based on 28 different protein phenotypes, employing one-dimensional electrophoresis to detect variant proteins, has yielded one probable mutation in the offspring of 'proximally exposed' parents, who received an estimated average gonadal exposure dose of between 31 and 39 rem from the atomic bombs in Hiroshima and Nagasaki. There were no mutations in 208,196 locus tests involving children of 'distally exposed' parents, who had essentially no radiation exposure. (author)

  3. A novel dominant D109A CRYAB mutation in a family with myofibrillar myopathy affects αB-crystallin structure

    Jakub P. Fichna

    2017-06-01

    Molecular modeling in accordance with muscle biopsy microscopic analyses predicted that D109A mutation influence both structure and function of CRYAB due to decreased stability of oligomers leading to aggregate formation. In consequence disrupted sarcomere cytoskeleton organization might lead to muscle pathology. We also suggest that mutated RQDE sequence of CRYAB could impair CRYAB chaperone-like activity and promote aggregation of lens crystallins.

  4. Antibodies to Mutated Citrullinated Vimentin in Rheumatoid Arthritis: Diagnostic Value, Association with Radiological Damage and Axial Skeleton Affection

    Howaida E. Mansour

    2010-05-01

    Full Text Available Abstract Background: Early definitive diagnosis and effective treatment are mandatory in rheumatoid arthritis (RA as it can halt the disease progression and subsequent joints destruction. Objective: To investigate the diagnostic and prognostic value of anti-mutated citrullinated vimentin (anti-MCV and its correlation with disease activity, peripheral and axial skeleton affection in RA patients. Patients and methods: A total of 123 patients with different rheumatic diseases were enrolled in a prospective-two year study at Ain Shams University hospital: 64 patients with RA and 59 patients with other rheumatic diseases as controls. RA patients were fulfilling the traditional and the new ACR/EULAR diagnostic criteria for RA. They have been followed up for two years. At baseline, all RA patients were subjected to: Clinical assessment of disease activity by taking full histories, general and local examination, measurement of 28 joint count of tender and swollen joints with calculation of disease activity score (DAS-28 for each patient. Complete blood count, erythrocytes sedimentation rate, C-reactive protein and rheumatoid factor titers were performed. Anti-MCV IgG immunoglobulins’ assay was performed at the study endpoint by ELISA. RA patients were then classified into; anti-MCV positive and anti-MCV negative groups for statistical comparison. Plain X-ray was performed on the peripheral joints and scored by the Simple Erosion Narrowing score (SEN-score. Magnetic Resonance Imaging (MRI scans were carried out to 22 RA patients on cervical and lumbosacral regions. Results: Anti-MCV antibodies were found to be of high sensitivity (79.6% and specificity (96.6% in diagnosing RA. The area under the curve was 0.893 at 95% confidence interval (CI, confers an odds ratio of 23.5. Anti-MCV positive RA patients had significantly higher DAS-28 and SEN-scores than anti-MCV negative patients; who were found to have more benign disease with lower incidence of

  5. Dual Inhibition of EGFR with Afatinib and Cetuximab in Kinase Inhibitor-Resistant EGFR-Mutant Lung Cancer with and without T790M Mutations

    Janjigian, Yelena Y.; Smit, Egbert F.; Groen, Harry J. M.; Horn, Leora; Gettinger, Scott; Camidge, D. Ross; Riely, Gregory J.; Wang, Bushi; Fu, Yali; Chand, Vikram K.; Miller, Vincent A.; Pao, William

    EGFR-mutant lung cancers responsive to reversible EGFR inhibitors (gefitinib/erlotinib) develop acquired resistance, mediated by second-site EGFR T790M mutation in >50% of cases. Preclinically, afatinib (irreversible ErbB family blocker) plus cetuximab (anti-EGFR monoclonal antibody) overcomes

  6. Epidermal Growth Factor Receptor Mutation (EGFR) Testing for Prediction of Response to EGFR-Targeting Tyrosine Kinase Inhibitor (TKI) Drugs in Patients with Advanced Non-Small-Cell Lung Cancer: An Evidence-Based Analysis.

    2010-01-01

    In February 2010, the Medical Advisory Secretariat (MAS) began work on evidence-based reviews of the literature surrounding three pharmacogenomic tests. This project came about when Cancer Care Ontario (CCO) asked MAS to provide evidence-based analyses on the effectiveness and cost-effectiveness of three oncology pharmacogenomic tests currently in use in Ontario.Evidence-based analyses have been prepared for each of these technologies. These have been completed in conjunction with internal and external stakeholders, including a Provincial Expert Panel on Pharmacogenetics (PEPP). Within the PEPP, subgroup committees were developed for each disease area. For each technology, an economic analysis was also completed by the Toronto Health Economics and Technology Assessment Collaborative (THETA) and is summarized within the reports.THE FOLLOWING REPORTS CAN BE PUBLICLY ACCESSED AT THE MAS WEBSITE AT: http://www.health.gov.on.ca/mas or at www.health.gov.on.ca/english/providers/program/mas/mas_about.htmlGENE EXPRESSION PROFILING FOR GUIDING ADJUVANT CHEMOTHERAPY DECISIONS IN WOMEN WITH EARLY BREAST CANCER: An Evidence-Based AnalysisEpidermal Growth Factor Receptor Mutation (EGFR) Testing for Prediction of Response to EGFR-Targeting Tyrosine Kinase Inhibitor (TKI) Drugs in Patients with Advanced Non-Small-Cell Lung Cancer: an Evidence-Based AnalysisK-RAS testing in Treatment Decisions for Advanced Colorectal Cancer: an Evidence-Based Analysis The Medical Advisory Secretariat undertook a systematic review of the evidence on the clinical effectiveness and cost-effectiveness of epidermal growth factor receptor (EGFR) mutation testing compared with no EGFR mutation testing to predict response to tyrosine kinase inhibitors (TKIs), gefitinib (Iressa(®)) or erlotinib (Tarceva(®)) in patients with advanced non-small cell lung cancer (NSCLC). TARGET POPULATION AND CONDITION With an estimated 7,800 new cases and 7,000 deaths last year, lung cancer is the leading cause of cancer

  7. Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

    Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

    2008-08-15

    The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

  8. Characterization of mutations of the phosphoinositide-3-kinase regulatory subunit, PIK3R2, in perisylvian polymicrogyria: a next generation sequencing study

    Mirzaa, Ghayda; Conti, Valerio; Timms, Andrew E.; Smyser, Christopher D.; Ahmed, Sarah; Carter, Melissa; Barnett, Sarah; Hufnagel, Robert B.; Goldstein, Amy; Narumi-Kishimoto, Yoko; Olds, Carissa; Collins, Sarah; Johnston, Kathreen; Deleuze, Jean-François; Nitschké, Patrick; Friend, Kathryn; Harris, Catharine; Goetsch, Allison; Martin, Beth; Boyle, Evan August; Parrini, Elena; Mei, Davide; Tattini, Lorenzo; Slavotinek, Anne; Blair, Ed; Barnett, Christopher; Shendure, Jay; Chelly, Jamel; Dobyns, William B.; Guerrini, Renzo

    2015-01-01

    SUMMARY Background Bilateral perisylvian polymicrogyria (BPP), the most common form of regional polymicrogyria, causes the congenital bilateral perisylvian syndrome, featuring oromotor dysfunction, cognitive impairment and epilepsy. BPP is etiologically heterogeneous, but only a few genetic causes have been reported. The aim of this study was to identify additional genetic etiologies of BPP and delineate their frequency in this patient population. Methods We performed child-parent (trio)-based whole exome sequencing (WES) on eight children with BPP. Following the identification of mosaic PIK3R2 mutations in two of these eight children, we performed targeted screening of PIK3R2 in a cohort of 118 children with BPP who were ascertained from 1980 until 2015 using two methods. First, we performed targeted sequencing of the entire PIK3R2 gene by single molecule molecular inversion probes (smMIPs) on 38 patients with BPP with normal-large head size. Second, we performed amplicon sequencing of the recurrent PIK3R2 mutation (p.Gly373Arg) on 80 children with various types of polymicrogyria including BPP. One additional patient underwent clinical WES independently, and was included in this study given the phenotypic similarity to our cohort. All patients included in this study were children (BPP. Of the 38 patients with BPP and normal-large head size who underwent targeted next generation sequencing by smMIPs, we identified constitutional and mosaic PIK3R2 mutations in 17 additional children. In parallel, one patient was found to have the recurrent PIK3R2 mutation by clinical WES. Seven patients had BPP alone, and 13 had BPP in association with features of the megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH). Nineteen patients had the same mutation (Gly373Arg), and one had a nearby missense mutation (p.Lys376Glu). Across the entire cohort, mutations were constitutional in 12 and mosaic in eight patients. Among mosaic patients, we observed substantial

  9. Chromosomal mapping and mutational analysis of the coding region of the glycogen synthase kinase-3alpha and beta isoforms in patients with NIDDM

    Hansen, L; Arden, K C; Rasmussen, S B

    1997-01-01

    isoforms of GSK-3alpha and GSK-3beta in 72 NIDDM patients and 12 control subjects. No structural changes were detected apart from a few silent mutations. Mapping of the GSK-3alpha to chromosome 19q13.1-13.2 and the GSK-3beta to chromosome 3q13.3-q21 outside known genetic loci linked to NIDDM further makes...

  10. Distinct mutations in yeast TAF(II)25 differentially affect the composition of TFIID and SAGA complexes as well as global gene expression patterns.

    Kirschner, Doris B; vom Baur, Elmar; Thibault, Christelle; Sanders, Steven L; Gangloff, Yann-Gaël; Davidson, Irwin; Weil, P Anthony; Tora, Làszlò

    2002-05-01

    The RNA polymerase II transcription factor TFIID, composed of the TATA-binding protein (TBP) and TBP-associated factors (TAF(II)s), nucleates preinitiation complex formation at protein-coding gene promoters. SAGA, a second TAF(II)-containing multiprotein complex, is involved in transcription regulation in Saccharomyces cerevisiae. One of the essential protein components common to SAGA and TFIID is yTAF(II)25. We define a minimal evolutionarily conserved 91-amino-acid region of TAF(II)25 containing a histone fold domain that is necessary and sufficient for growth in vivo. Different temperature-sensitive mutations of yTAF(II)25 or chimeras with the human homologue TAF(II)30 arrested cell growth at either the G(1) or G(2)/M cell cycle phase and displayed distinct phenotypic changes and gene expression patterns. Immunoprecipitation studies revealed that TAF(II)25 mutation-dependent gene expression and phenotypic changes correlated at least partially with the integrity of SAGA and TFIID. Genome-wide expression analysis revealed that the five TAF(II)25 temperature-sensitive mutant alleles individually affect the expression of between 18 and 33% of genes, whereas taken together they affect 64% of all class II genes. Thus, different yTAF(II)25 mutations induce distinct phenotypes and affect the regulation of different subsets of genes, demonstrating that no individual TAF(II) mutant allele reflects the full range of its normal functions.

  11. HIV-1 Nef mutations abrogating downregulation of CD4 affect other Nef functions and show reduced pathogenicity in transgenic mice

    Hanna, Zaher; Priceputu, Elena; Hu, Chunyan; Vincent, Patrick; Jolicoeur, Paul

    2006-01-01

    Nef Wt Tg mice. Our data suggest that the RD35/36AA and D174K mutations affect other Nef functions, namely those involved in the development of lung and kidney diseases, in addition to their known role in CD4 downregulation. Similarly, in HIV-1-infected individuals, loss of CD4 downregulation by Nef alleles may reflect their lower intrinsic pathogenicity, independently of their effects on virus replication

  12. Germline CYBB mutations that selectively affect macrophages in kindreds with X-linked predisposition to tuberculous mycobacterial disease

    Bustamante, Jacinta; Arias, Andres A; Vogt, Guillaume; Picard, Capucine; Galicia, Lizbeth Blancas; Prando, Carolina; Grant, Audrey V; Marchal, Christophe C; Hubeau, Marjorie; Chapgier, Ariane; de Beaucoudrey, Ludovic; Puel, Anne; Feinberg, Jacqueline; Valinetz, Ethan; Jannière, Lucile; Besse, Céline; Boland, Anne; Brisseau, Jean-Marie; Blanche, Stéphane; Lortholary, Olivier; Fieschi, Claire; Emile, Jean-François; Boisson-Dupuis, Stéphanie; Al-Muhsen, Saleh; Woda, Bruce; Newburger, Peter E; Condino-Neto, Antonio; Dinauer, Mary C; Abel, Laurent; Casanova, Jean-Laurent

    2011-01-01

    Germline mutations in CYBB, the human gene encoding the gp91phox subunit of the phagocyte NADPH oxidase, impair the respiratory burst of all types of phagocytes and result in X-linked chronic granulomatous disease (CGD). We report here two kindreds in which otherwise healthy male adults developed X-linked recessive Mendelian susceptibility to mycobacterial disease (MSMD) syndromes. These patients had previously unknown mutations in CYBB that resulted in an impaired respiratory burst in monocyte-derived macrophages but not in monocytes or granulocytes. The macrophage-specific functional consequences of the germline mutation resulted from cell-specific impairment in the assembly of the NADPH oxidase. This ‘experiment of nature’ indicates that CYBB is associated with MSMD and demonstrates that the respiratory burst in human macrophages is a crucial mechanism for protective immunity to tuberculous mycobacteria. PMID:21278736

  13. Neurodevelopmental disease-associated de novo mutations and rare sequence variants affect TRIO GDP/GTP exchange factor activity.

    Katrancha, Sara M; Wu, Yi; Zhu, Minsheng; Eipper, Betty A; Koleske, Anthony J; Mains, Richard E

    2017-12-01

    Bipolar disorder, schizophrenia, autism and intellectual disability are complex neurodevelopmental disorders, debilitating millions of people. Therapeutic progress is limited by poor understanding of underlying molecular pathways. Using a targeted search, we identified an enrichment of de novo mutations in the gene encoding the 330-kDa triple functional domain (TRIO) protein associated with neurodevelopmental disorders. By generating multiple TRIO antibodies, we show that the smaller TRIO9 isoform is the major brain protein product, and its levels decrease after birth. TRIO9 contains two guanine nucleotide exchange factor (GEF) domains with distinct specificities: GEF1 activates both Rac1 and RhoG; GEF2 activates RhoA. To understand the impact of disease-associated de novo mutations and other rare sequence variants on TRIO function, we utilized two FRET-based biosensors: a Rac1 biosensor to study mutations in TRIO (T)GEF1, and a RhoA biosensor to study mutations in TGEF2. We discovered that one autism-associated de novo mutation in TGEF1 (K1431M), at the TGEF1/Rac1 interface, markedly decreased its overall activity toward Rac1. A schizophrenia-associated rare sequence variant in TGEF1 (F1538Intron) was substantially less active, normalized to protein level and expressed poorly. Overall, mutations in TGEF1 decreased GEF1 activity toward Rac1. One bipolar disorder-associated rare variant (M2145T) in TGEF2 impaired inhibition by the TGEF2 pleckstrin-homology domain, resulting in dramatically increased TGEF2 activity. Overall, genetic damage to both TGEF domains altered TRIO catalytic activity, decreasing TGEF1 activity and increasing TGEF2 activity. Importantly, both GEF changes are expected to decrease neurite outgrowth, perhaps consistent with their association with neurodevelopmental disorders. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Reciprocal mouse and human limb phenotypes caused by gain- and loss-of-function mutations affecting Lmbr1.

    Clark, R M; Marker, P C; Roessler, E; Dutra, A; Schimenti, J C; Muenke, M; Kingsley, D M

    2001-01-01

    The major locus for dominant preaxial polydactyly in humans has been mapped to 7q36. In mice the dominant Hemimelic extra toes (Hx) and Hammertoe (Hm) mutations map to a homologous chromosomal region and cause similar limb defects. The Lmbr1 gene is entirely within the small critical intervals recently defined for both the mouse and human mutations and is misexpressed at the exact time that the mouse Hx phenotype becomes apparent during limb development. This result suggests that Lmbr1 may un...

  15. alpha-Adducin mutations increase Na/K pump activity in renal cells by affecting constitutive endocytosis: implications for tubular Na reabsorption.

    Torielli, Lucia; Tivodar, Simona; Montella, Rosa Chiara; Iacone, Roberto; Padoani, Gloria; Tarsini, Paolo; Russo, Ornella; Sarnataro, Daniela; Strazzullo, Pasquale; Ferrari, Patrizia; Bianchi, Giuseppe; Zurzolo, Chiara

    2008-08-01

    Genetic variation in alpha-adducin cytoskeletal protein is implicated in the polymerization and bundling of actin and alteration of the Na/K pump, resulting in abnormal renal sodium transport and hypertension in Milan hypertensive rats and humans. To investigate the molecular involvement of alpha-adducin in controlling Na/K pump activity, wild-type or mutated rat and human alpha-adducin forms were, respectively, transfected into several renal cell lines. Through multiple experimental approaches (microscopy, enzymatic assays, coimmunoprecipitation), we showed that rat and human mutated forms increased Na/K pump activity and the number of pump units; moreover, both variants coimmunoprecipitate with Na/K pump. The increased Na/K pump activity was not due to changes in its basolateral localization, but to an alteration of Na/K pump residential time on the plasma membrane. Indeed, both rat and human mutated variants reduced constitutive Na/K pump endocytosis and similarly affected transferrin receptor trafficking and fluid-phase endocytosis. In fact, alpha-adducin was detected in clathrin-coated vesicles and coimmunoprecipitated with clathrin. These results indicate that adducin, besides its modulatory effects on actin cytoskeleton dynamics, might play a direct role in clathrin-dependent endocytosis. The constitutive reduction of the Na/K pump endocytic rate induced by mutated adducin variants may be relevant in Na-dependent hypertension.

  16. COL1A2 gene analysis in a Czech osteogenesis imperfecta patient: a candidate novel mutation in a patient affected by osteogenesis imperfecta type 3

    Hrušková L

    2015-08-01

    Full Text Available Lucie Hrušková,1 Ivo Mařík,2,3 Stella Mazurová,1 Pavel Martásek,1 Ivan Mazura1 1Department of Pediatrics and Adolescent Medicine, First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic; 2Ambulant Centre for Defects of Locomotor Apparatus 1.1.c., Prague, Czech Republic; 3Faculty of Medical Studies, West Bohemia University, Pilsen, Czech RepublicAbstract: Osteogenesis imperfecta is a heritable bone fragility disease with a heterogenic genetic origin. Most cases result from mutations of either the COL1A1 gene or the COL1A2 gene. We identified a novel COL1A2 gene mutation in a Czech patient, born to unaffected parents, who was diagnosed according to clinical and anthropometric findings and radiographic features as having type 3 osteogenesis imperfecta, which is a severe form of this disease. The identified Gly814Trp mutation was predicted by a number of complementary bioinformatic programs to result in functional alteration of the protein. This case report provides both evidence of a novel COL1A2 mutation resulting in type 3 osteogenesis imperfecta and a genotype:phenotype correlation in this affected individual. Keywords: osteogenesis imperfecta type 3, collagen, alpha-2 (I chain, substitution, sequencing 

  17. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    Ratti Antonia

    2007-12-01

    Full Text Available Abstract Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs. The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders.

  18. Factors affecting mutational specificity in mammalian cells: Informal [technical] progress report, February 1, 1987-January 31, 1988

    Strauss, B.S.

    1986-01-01

    We analyzed the different c-H-ras mutations produced in cells after treatment with chemical carcinogens. The overall goal of this work is an understanding of the changes produced by environmental mutagens and carcinogens to learn how closely the results obtained with bacterial and cellular assay systems apply to the in vivo situation

  19. The hunt for a functional mutation affecting conformation and calving traits on chromosome 18 in Holstein cattle

    Sequence data from 11 US Holstein bulls were analyzed to identify putative causal mutations associated with calving and conformation traits. The SNP ARS-BFGL-NGS-109285 at 57,589,121 bp (UMD 3.1 assembly) on BTA18 has large effects on 4 measures of body shape and size, 2 measures of dystocia, longev...

  20. HIV-1 protease inhibitor mutations affect the development of HIV-1 resistance to the maturation inhibitor bevirimat

    Fun, A.; Maarseveen van, N. M.; Pokorná, Jana; Maas, R. E.; Schipper, P. J.; Konvalinka, Jan; Nijhuis, M.

    2011-01-01

    Roč. 8, č. 70 (2011), s. 1-12 ISSN 1742-4690 Grant - others:European Union(XE) LWSHP-CT-2007-037693 Institutional research plan: CEZ:AV0Z40550506 Keywords : immunodeficiency-virus type-1 * gag spacer peptide-1 * replication capacity * compensatory mutations * cleavage sites Subject RIV: CE - Biochemistry Impact factor: 6.470, year: 2011

  1. Familial isolated primary pigmented nodular adrenocortical disease associated with a novel low penetrance PRKAR1A gene splice site mutation

    Storr, Helen L; Metherell, Louise A; Dias, Renuka

    2010-01-01

    Primary pigmented nodular adrenocortical disease (PPNAD) is associated with inactivating germline protein kinase A regulatory subunit type 1-alpha (PRKAR1A) mutations and loss of heterozygosity at the 17q22-24 locus in approximately 50% patients. PRKAR1A mutations are observed in both isolated PP...... PPNAD (iPPNAD) and Carney complex (CNC). Most mutations result in a functionally null-allele and exhibit high penetrance. We genotyped members of an extended family for a novel PRKAR1A mutation and undertook detailed phenotyping for CNC in the affected individuals....

  2. Efficacy and Molecular Mechanisms of Differentiated Response to the Aurora and Angiogenic Kinase Inhibitor ENMD-2076 in Preclinical Models of p53-Mutated Triple-Negative Breast Cancer

    Anastasia A. Ionkina

    2017-05-01

    Full Text Available PurposeTriple-negative breast cancer (TNBC is a subtype associated with poor prognosis and for which there are limited therapeutic options. The purpose of this study was to evaluate the efficacy of ENMD-2076 in p53-mutated TNBC patient-derived xenograft (PDX models and describe patterns of terminal cell fate in models demonstrating sensitivity, intrinsic resistance, and acquired resistance to ENMD-2076.Experimental designp53-mutated, TNBC PDX models were treated with ENMD-2076 and evaluated for mechanisms of sensitivity or resistance to treatment. Correlative tissue testing was performed on tumor tissue to assess for markers of proliferation, apoptosis, senescence, and pathways of resistance after treatment and at the time of acquired resistance.ResultsSensitivity to ENMD-2076 200 mg/kg daily was associated with induction of apoptosis while models exhibiting intrinsic or acquired resistance to treatment presented with a senescent phenotype. Response to ENMD-2076 was accompanied by an increase in p53 and p73 levels, even within the background of mutant p53. Treatment with ENMD-2076 resulted in a decrease in pAurA and an increase in pHH3. We observed a TNBC subtype switch from the luminal androgen receptor to the basal-like subtype at acquired resistance.ConclusionENMD-2076 has antitumor activity in preclinical models of p53-mutated TNBC. Increased levels of p53 and p73 correlated with sensitivity whereas senescence was associated with resistance to ENMD-2076. The novel finding of a TNBC subtype switch at time of acquired resistance may provide mechanistic insights into the biologic effects of selective pressure of anticancer treatments on TNBC. ENMD-2076 is currently being evaluated in a Phase 2 clinical trial in patients with metastatic, previously treated TNBC where these biologic correlates can be further explored.

  3. What affects the predictability of evolutionary constraints using a G-matrix? The relative effects of modular pleiotropy and mutational correlation.

    Chebib, Jobran; Guillaume, Frédéric

    2017-10-01

    Phenotypic traits do not always respond to selection independently from each other and often show correlated responses to selection. The structure of a genotype-phenotype map (GP map) determines trait covariation, which involves variation in the degree and strength of the pleiotropic effects of the underlying genes. It is still unclear, and debated, how much of that structure can be deduced from variational properties of quantitative traits that are inferred from their genetic (co) variance matrix (G-matrix). Here we aim to clarify how the extent of pleiotropy and the correlation among the pleiotropic effects of mutations differentially affect the structure of a G-matrix and our ability to detect genetic constraints from its eigen decomposition. We show that the eigenvectors of a G-matrix can be predictive of evolutionary constraints when they map to underlying pleiotropic modules with correlated mutational effects. Without mutational correlation, evolutionary constraints caused by the fitness costs associated with increased pleiotropy are harder to infer from evolutionary metrics based on a G-matrix's geometric properties because uncorrelated pleiotropic effects do not affect traits' genetic correlations. Correlational selection induces much weaker modular partitioning of traits' genetic correlations in absence then in presence of underlying modular pleiotropy. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  4. Retention of a 24-hour time memory in Syrian hamsters carrying the 20-hour short circadian period mutation in casein kinase-1ε (ck1εtau/tau).

    Cain, Sean W; Yoon, Jeena; Shrestha, Tenjin C; Ralph, Martin R

    2014-10-01

    Circadian rhythmic expression of conditioned place avoidance (CPA) was produced in Syrian hamsters homozygous for the circadian short period mutation, tau. In constant dim red light neither the 20 h endogenous period, nor a 20 h place conditioning schedule eliminated the 24 h modulation of CPA behavior described previously for wild type (wt) hamsters and other species. Tau mutants exhibited a 20 h rhythm superimposed on the 24 h modulation. The 20 h component was removed selectively with lesions of the suprachiasmatic nucleus. Wt animals conditioned on a 20 h schedule did not produce a 20 h rhythm, but still expressed the 24 h modulation. The results show that the context entrainable oscillator (CEO) underlying memory for the timing of an unconditioned stimulus, retains a period of about 24 h regardless of clock gene background (tau mutation) and/or the conditioning schedule (24 vs 20 h). Therefore the CEO responsible for time memory is distinct from the biological clock controlling activity; the underlying circadian molecular mechanisms may differ from the ubiquitous transcription-translation feedback oscillator; and time memory itself is not classically conditioned. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen

    2008-01-01

    of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...... for resistance to the tuberactinomycin antibiotic capreomycin. Two base substitutions, A1913U and mU1915G, and a single base deletion, DeltamU1915, were identified in helix 69 of 23S rRNA, a structural element that forms part of an interribosomal subunit bridge with the decoding center of 16S rRNA, the site...... to capreomycin. Finally, none of the mutations in helix 69 interferes with methylation at C1920 or with pseudouridylation at positions 1911 and 1917. We conclude that the resistance phenotype is a consequence of structural changes introduced by the mutations....

  6. The ataxia related G1107D mutation of the plasma membrane Ca2+ ATPase isoform 3 affects its interplay with calmodulin and the autoinhibition process.

    Calì, Tito; Frizzarin, Martina; Luoni, Laura; Zonta, Francesco; Pantano, Sergio; Cruz, Carlos; Bonza, Maria Cristina; Bertipaglia, Ilenia; Ruzzene, Maria; De Michelis, Maria Ida; Damiano, Nunzio; Marin, Oriano; Zanni, Ginevra; Zanotti, Giuseppe; Brini, Marisa; Lopreiato, Raffaele; Carafoli, Ernesto

    2017-01-01

    The plasma membrane Ca 2+ ATPases (PMCA pumps) have a long, cytosolic C-terminal regulatory region where a calmodulin-binding domain (CaM-BD) is located. Under basal conditions (low Ca 2+ ), the C-terminal tail of the pump interacts with autoinhibitory sites proximal to the active center of the enzyme. In activating conditions (i.e., high Ca 2+ ), Ca 2+ -bound CaM displaces the C-terminal tail from the autoinhibitory sites, restoring activity. We have recently identified a G1107D replacement within the CaM-BD of isoform 3 of the PMCA pump in a family affected by X-linked congenital cerebellar ataxia. Here, we investigate the effects of the G1107D replacement on the interplay of the mutated CaM-BD with both CaM and the pump core, by combining computational, biochemical and functional approaches. We provide evidence that the affinity of the isolated mutated CaM-BD for CaM is significantly reduced with respect to the wild type (wt) counterpart, and that the ability of CaM to activate the pump in vitro is thus decreased. Multiscale simulations support the conclusions on the detrimental effect of the mutation, indicating reduced stability of the CaM binding. We further show that the G1107D replacement impairs the autoinhibition mechanism of the PMCA3 pump as well, as the introduction of a negative charge perturbs the contacts between the CaM-BD and the pump core. Thus, the mutation affects both the ability of the pump to optimally transport Ca 2+ in the activated state, and the autoinhibition mechanism in its resting state. Copyright © 2016. Published by Elsevier B.V.

  7. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Compound heterozygosity for two GHR missense mutations in a patient affected by Laron Syndrome: a case report.

    Moia, Stefania; Tessaris, Daniele; Einaudi, Silvia; de Sanctis, Luisa; Bona, Gianni; Bellone, Simonetta; Prodam, Flavia

    2017-10-12

    Mutations localized in the Growth Hormone Receptor (GHR) gene are often associated with the pathogenesis of Laron Syndrome, an autosomal recessive hereditary disorder characterized by severe growth retardation. Biochemically, patients present normal to high circulating GH levels, in presence of very low or undetectable IGF-I levels, which do not rise after rhGH treatment. We describe the case of a 3.8 years old girl with symmetrical short stature (-3.76 SDS), low IGF-1 and IGFBP-3, in presence of normal GH levels. Parents were not relatives and there was no family history of short stature. During the second day of birth, she developed severe hypoglycaemia that required glucose infusion. She presented frontal bossing and depressed nasal bridge. IGF-1 generation test showed no response, suggesting a GH resistance evidence. In the hypothesis of Laron Syndrome, we decided to perform a molecular analysis of Growth Hormone Receptor (GHR) gene. This analysis demonstrated that the patient was compound heterozygote for two missense mutations. GHR gene mutations are a well demonstrated cause of GH insensitivity. In heterozygous patients, probably the normal stature may be achieved by a compensatory mechanism of GH secretion or signalling. On the contrary, in homozygous or compound heterozygous patients these compensatory mechanisms are inadequate, and short stature may be the consequence.

  9. Characterisation of adiponectin multimers and the IGF axis in humans with a heterozygote mutation in the tyrosine kinase domain of the insulin receptor gene

    Højlund, Kurt; Beck-Nielsen, Henning; Flyvbjerg, Allan

    2012-01-01

    Objective: Low levels of adiponectin, IGF-binding protein (IGFBP)-1, and IGFBP-2, and high levels of leptin correlate with several indices of insulin resistance and risk of type 2 diabetes. However, in insulin receptoropathies plasma adiponectin is paradoxically increased despite severe insulin...... resistance, whereas the IGF-axis is sparsely described. Here, we aimed to characterize the multimeric distribution of adiponectin and the IGF-axis in humans with a heterozygous INSR mutation (Arg1174Gln).Methods: Blood samples obtained in six Arg1174Gln-carriers and 10 lean, healthy controls before and after...... an euglycemic-hyperinsulinemic clamp were examined for plasma adiponectin multimers, leptin, total IGF-I, IGF-II, free IGF-I, IGFBP-1 and IGFBP-2.Results: Despite 10-fold elevated fasting insulin and marked insulin resistance in Arg1174Gln-carriers, the levels of total adiponectin, leptin, IGFBP-1 and IGFBP-2...

  10. Affect

    Cetinic, M.; Diamanti, J.; Szeman, I.; Blacker, S.; Sully, J.

    2017-01-01

    This chapter historicizes four divergent but historically contemporaneous genres of affect theory – romantic, realist, speculative, and materialist. While critics credited with the turn to affect in the 1990s wrote largely in the wake of poststructuralism from the perspective of gender and queer

  11. Mutation in cyclophilin B that causes hyperelastosis cutis in American Quarter Horse does not affect peptidylprolyl cis-trans isomerase activity but shows altered cyclophilin B-protein interactions and affects collagen folding.

    Ishikawa, Yoshihiro; Vranka, Janice A; Boudko, Sergei P; Pokidysheva, Elena; Mizuno, Kazunori; Zientek, Keith; Keene, Douglas R; Rashmir-Raven, Ann M; Nagata, Kazuhiro; Winand, Nena J; Bächinger, Hans Peter

    2012-06-22

    The rate-limiting step of folding of the collagen triple helix is catalyzed by cyclophilin B (CypB). The G6R mutation in cyclophilin B found in the American Quarter Horse leads to autosomal recessive hyperelastosis cutis, also known as hereditary equine regional dermal asthenia. The mutant protein shows small structural changes in the region of the mutation at the side opposite the catalytic domain of CypB. The peptidylprolyl cis-trans isomerase activity of the mutant CypB is normal when analyzed in vitro. However, the biosynthesis of type I collagen in affected horse fibroblasts shows a delay in folding and secretion and a decrease in hydroxylysine and glucosyl-galactosyl hydroxylysine. This leads to changes in the structure of collagen fibrils in tendon, similar to those observed in P3H1 null mice. In contrast to cyclophilin B null mice, where little 3-hydroxylation was found in type I collagen, 3-hydroxylation of type I collagen in affected horses is normal. The mutation disrupts the interaction of cyclophilin B with the P-domain of calreticulin, with lysyl hydroxylase 1, and probably other proteins, such as the formation of the P3H1·CypB·cartilage-associated protein complex, resulting in less effective catalysis of the rate-limiting step in collagen folding in the rough endoplasmic reticulum.

  12. Mutation in Cyclophilin B That Causes Hyperelastosis Cutis in American Quarter Horse Does Not Affect Peptidylprolyl cis-trans Isomerase Activity but Shows Altered Cyclophilin B-Protein Interactions and Affects Collagen Folding*

    Ishikawa, Yoshihiro; Vranka, Janice A.; Boudko, Sergei P.; Pokidysheva, Elena; Mizuno, Kazunori; Zientek, Keith; Keene, Douglas R.; Rashmir-Raven, Ann M.; Nagata, Kazuhiro; Winand, Nena J.; Bächinger, Hans Peter

    2012-01-01

    The rate-limiting step of folding of the collagen triple helix is catalyzed by cyclophilin B (CypB). The G6R mutation in cyclophilin B found in the American Quarter Horse leads to autosomal recessive hyperelastosis cutis, also known as hereditary equine regional dermal asthenia. The mutant protein shows small structural changes in the region of the mutation at the side opposite the catalytic domain of CypB. The peptidylprolyl cis-trans isomerase activity of the mutant CypB is normal when analyzed in vitro. However, the biosynthesis of type I collagen in affected horse fibroblasts shows a delay in folding and secretion and a decrease in hydroxylysine and glucosyl-galactosyl hydroxylysine. This leads to changes in the structure of collagen fibrils in tendon, similar to those observed in P3H1 null mice. In contrast to cyclophilin B null mice, where little 3-hydroxylation was found in type I collagen, 3-hydroxylation of type I collagen in affected horses is normal. The mutation disrupts the interaction of cyclophilin B with the P-domain of calreticulin, with lysyl hydroxylase 1, and probably other proteins, such as the formation of the P3H1·CypB·cartilage-associated protein complex, resulting in less effective catalysis of the rate-limiting step in collagen folding in the rough endoplasmic reticulum. PMID:22556420

  13. The erratic mitochondrial clock: variations of mutation rate, not population size, affect mtDNA diversity across birds and mammals

    Galtier Nicolas

    2009-03-01

    Full Text Available Abstract Background During the last ten years, major advances have been made in characterizing and understanding the evolution of mitochondrial DNA, the most popular marker of molecular biodiversity. Several important results were recently reported using mammals as model organisms, including (i the absence of relationship between mitochondrial DNA diversity and life-history or ecological variables, (ii the absence of prominent adaptive selection, contrary to what was found in invertebrates, and (iii the unexpectedly large variation in neutral substitution rate among lineages, revealing a possible link with species maximal longevity. We propose to challenge these results thanks to the bird/mammal comparison. Direct estimates of population size are available in birds, and this group presents striking life-history trait differences with mammals (higher mass-specific metabolic rate and longevity. These properties make birds the ideal model to directly test for population size effects, and to discriminate between competing hypotheses about the causes of substitution rate variation. Results A phylogenetic analysis of cytochrome b third-codon position confirms that the mitochondrial DNA mutation rate is quite variable in birds, passerines being the fastest evolving order. On average, mitochondrial DNA evolves slower in birds than in mammals of similar body size. This result is in agreement with the longevity hypothesis, and contradicts the hypothesis of a metabolic rate-dependent mutation rate. Birds show no footprint of adaptive selection on cytochrome b evolutionary patterns, but no link between direct estimates of population size and cytochrome b diversity. The mutation rate is the best predictor we have of within-species mitochondrial diversity in birds. It partly explains the differences in mitochondrial DNA diversity patterns observed between mammals and birds, previously interpreted as reflecting Hill-Robertson interferences with the W

  14. JAK2 Exon 12 Mutations in Polycythemia Vera and Idiopathic Erythrocytosis

    Scott, Linda M.; Tong, Wei; Levine, Ross L.; Scott, Mike A.; Beer, Philip A.; Stratton, Michael R.; Futreal, P. Andrew; Erber, Wendy N.; McMullin, Mary Frances; Harrison, Claire N.; Warren, Alan J.; Gilliland, D. Gary; Lodish, Harvey F.; Green, Anthony R.

    2010-01-01

    BACKGROUND The V617F mutation, which causes the substitution of phenylalanine for valine at position 617 of the Janus kinase (JAK) 2 gene (JAK2), is often present in patients with polycythemia vera, essential thrombocythemia, and idiopathic myelofibrosis. However, the molecular basis of these myeloproliferative disorders in patients without the V617F mutation is unclear. METHODS We searched for new mutations in members of the JAK and signal transducer and activator of transcription (STAT) gene families in patients with V617F-negative polycythemia vera or idiopathic erythrocytosis. The mutations were characterized biochemically and in a murine model of bone marrow transplantation. RESULTS We identified four somatic gain-of-function mutations affecting JAK2 exon 12 in 10 V617F-negative patients. Those with a JAK2 exon 12 mutation presented with an isolated erythrocytosis and distinctive bone marrow morphology, and several also had reduced serum erythropoietin levels. Erythroid colonies could be grown from their blood samples in the absence of exogenous erythropoietin. All such erythroid colonies were heterozygous for the mutation, whereas colonies homozygous for the mutation occur in most patients with V617F-positive polycythemia vera. BaF3 cells expressing the murine erythropoietin receptor and also carrying exon 12 mutations could proliferate without added interleukin-3. They also exhibited increased phosphorylation of JAK2 and extracellular regulated kinase 1 and 2, as compared with cells transduced by wild-type JAK2 or V617F JAK2. Three of the exon 12 mutations included a substitution of leucine for lysine at position 539 of JAK2. This mutation resulted in a myeloproliferative phenotype, including erythrocytosis, in a murine model of retroviral bone marrow transplantation. CONCLUSIONS JAK2 exon 12 mutations define a distinctive myeloproliferative syndrome that affects patients who currently receive a diagnosis of polycythemia vera or idiopathic erythrocytosis

  15. Mutations that abrogate transactivational activity of the feline leukemia virus long terminal repeat do not affect virus replication

    Abujamra, Ana L.; Faller, Douglas V.; Ghosh, Sajal K.

    2003-01-01

    The U3 region of the LTR of oncogenic Moloney murine leukemia virus (Mo-MuLV) and feline leukemia viruses (FeLV) have been previously reported to activate expression of specific cellular genes in trans, such as MHC class I, collagenase IV, and MCP-1, in an integration-independent manner. It has been suggested that transactivation of these specific cellular genes by leukemia virus U3-LTR may contribute to the multistage process of leukemogenesis. The U3-LTR region, necessary for gene transactivational activity, also contains multiple transcription factor-binding sites that are essential for normal virus replication. To dissect the promoter activity and the gene transactivational activity of the U3-LTR, we conducted mutational analysis of the U3-LTR region of FeLV-A molecular clone 61E. We identified minimal nucleotide substitution mutants on the U3 LTR that did not disturb transcription factor-binding sites but abrogated its ability to transactivate the collagenase gene promoter. To determine if these mutations actually have altered any uncharacterized important transcription factor-binding site, we introduced these U3-LTR mutations into the full-length infectious molecular clone 61E. We demonstrate that the mutant virus was replication competent but could not transactivate cellular gene expression. These results thus suggest that the gene transactivational activity is a distinct property of the LTR and possibly not related to its promoter activity. The cellular gene transactivational activity-deficient mutant FeLV generated in this study may also serve as a valuable reagent for testing the biological significance of LTR-mediated cellular gene activation in the tumorigenesis caused by leukemia viruses

  16. Disease-causing missense mutations affect enzymatic activity, stability and oligomerization of glutaryl-CoA dehydrogenase (GCDH)

    Keyser, B.; Muhlhausen, C.; Dickmanns, A.

    2008-01-01

    Glutaric aciduria type 1 (GA1) is an autosomal recessive neurometabolic disorder caused by mutations in the glutaryl-CoA dehydrogenase gene (GCDH), leading to an accumulation and high excretion of glutaric acid and 3-hydroxyglutaric acid. Considerable variation in severity of the clinical phenotype......Da GCDH complexes. Molecular modeling of mutant GCDH suggests that Met263 at the surface of the GCDH protein might be part of the contact interface to interacting proteins. These results indicate that reduced intramitochondrial stability as well as the impaired formation of homo- and heteromeric GCDH...

  17. A rapid phenotypic assay for detection of acyclovir-resistant varicella-zoster virus with mutations in the thymidine kinase open reading frame.

    Sahli, R; Andrei, G; Estrade, C; Snoeck, R; Meylan, P R

    2000-04-01

    Susceptibility assays by cell culture methods are time-consuming and are particularly difficult to perform with varicella-zoster virus (VZV). To overcome this limitation, we have adapted a functional test of the viral thymidine kinase (TK) in TK-deficient (tdk mutant) bacteria to detect ACV-resistant VZV in clinical samples. After PCR amplification, the complete viral TK open reading frame (ORF) is purified from PCR primers, digested with two restriction enzymes, and ligated in an oriented fashion into a bacterial expression vector. The ligation products are then used to transform tdk mutant bacteria. After transformation, an aliquot of the bacteria is plated onto a plate with minimal medium containing (i) ampicillin to select for plasmids carrying the viral TK ORF and (ii) isopropyl beta-D-thiogalactopyranoside (IPTG) to induce its expression. An identical aliquot of bacteria is also plated onto a medium containing, in addition to the components described above, 5-fluorodeoxyuridine (FUdR). Compared to the number of transformants on FUdR-free medium, the number of colonies carrying TK derived from susceptible strains was reduced by 86%, on average, in the presence of FUdR. In contrast, the number of transformants carrying TK from resistant strains with a mutant TK were reduced by only 4%, on average, on FUdR-containing plates. We have assessed the validity of this assay with cell culture isolates and several clinical samples including two cerebrospinal fluid samples from which no virus could be isolated. This colony reduction assay allowed the correct identification of the TK phenotype of each VZV isolate tested and can be completed within 3 days of receipt of the sample.

  18. Sensitivity to epidermal growth factor receptor tyrosine kinase inhibitors in males, smokers, and non-adenocarcinoma lung cancer in patients with EGFR mutations.

    Zeng, Zhu; Chen, Hua-Jun; Yan, Hong-Hong; Yang, Jin-Ji; Zhang, Xu-Chao; Wu, Yi-Long

    2013-09-27

    The demographical/clinical characteristics of being Asian, having an adenocarcinoma, being female, and being a "never-smoker" are regarded as favorable predictors for epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) efficacy in non-small cell lung cancer (NSCLC) with unknown EGFR gene status. In this study, we examined the effects of the supposedly unfavorable clinical variables in EGFR-mutant patients. In total, 159 EGFR-mutant NSCLC patients' clinical features were correlated with progression-free survival (PFS), response rate (RR), and overall survival (OS). Multivariate analysis of clinical characteristics was performed using the Cox and logistic regression methods. There were 90 females (56.6%), 112 never-smokers (70.4%), and 153 patients with adenocarcinomas (96.2%). All patients were treated with EGFR-TKI, and 52.8% received TKI in a first-line setting. The median PFS of patients receiving first-line TKI was similar, regardless of gender (males vs females: 9.1 vs 9.7 months, p=0.793), smoking status (never-smokers vs smokers: 9.9 vs 9.1 months, p=0.570), or histology (adenocarcinoma vs non-adenocarcinoma: 9.7 vs 9.2 months, p=0.644). OS curves of first-line TKI-treated patients were also not associated with gender (p=0.722), smoking status (p=0.579), or histology (p=0.480). Similar results of PFS and OS were obtained for patients who received TKI beyond first-line. Multivariate analysis indicated that none of these clinical factors was an independent predictor of survival. The supposedly 'favorable' clinical factors of female gender, non-smoking status, and adenocarcinoma were not independent predictive factors for PFS or OS in this population of EGFR-mutant NSCLC patients.

  19. Towards Prognostic Profiling of Non-Small Cell Lung Cancer: New Perspectives on the Relevance of Polo-Like Kinase 1 Expression, the TP53 Mutation Status and Hypoxia

    Van den Bossche, Jolien; Deben, Christophe; Op de Beeck, Ken; Deschoolmeester, Vanessa; Hermans, Christophe; De Pauw, Ines; Jacobs, Julie; Van Schil, Paul; Vermorken, Jan Baptist; Pauwels, Patrick; Peeters, Marc; Lardon, Filip; Wouters, An

    2017-01-01

    Background: Currently, prognosis of non-small cell lung cancer (NSCLC) patients is based on clinicopathological factors, including TNM stage. However, there are considerable differences in patient outcome within a similar staging group, even when patients received identical treatments. In order to improve prognostic predictions and to guide treatment options, additional parameters influencing outcome are required. Polo-like kinase 1 (Plk1), a master regulator of mitotic cell division and the DNA damage response, is considered as a new potential biomarker in this research area. While several studies reported Plk1 overexpression in a broad range of human malignancies, inconsistent results were published regarding the clinical significance hereof. A prognostic panel, consisting of Plk1 and additional biomarkers that are related to the Plk1 pathway, might further improve prediction of patient prognosis. Methods: In this study, we evaluated for the first time the prognostic value of Plk1 mRNA and protein expression in combination with the TP53 mutation status (next generation sequencing), induction of apoptotic cell death (immunohistochemistry for cleaved caspase 3) and hypoxia (immunohistochemistry for carbonic anhydrase IX (CA IX)) in 98 NSCLC adenocarcinoma patients. Results: Both Plk1 mRNA and protein expression and CA IX protein levels were upregulated in the majority of tumor samples. Plk1 mRNA and protein expression levels were higher in TP53 mutant samples, suggesting that Plk1 overexpression is, at least partially, the result of loss of functional p53 (<0.05). Interestingly, the outcome of patients with both Plk1 mRNA and CA IX protein overexpression, who also harbored a TP53 mutation, was much worse than that of patients with aberrant expression of only one of the three markers (p=0.001). Conclusion: The combined evaluation of Plk1 mRNA expression, CA IX protein expression and TP53 mutations shows promise as a prognostic panel in NSCLC patients. Moreover

  20. Presence of pleural effusion is associated with a poor prognosis in patients with epidermal growth factor receptor-mutated lung cancer receiving tyrosine kinase inhibitors as first-line treatment.

    Wang, Tso-Fu; Chu, Sung-Chao; Lee, Jen-Jyh; Yang, Gee-Gwo; Huang, Wei-Han; Chang, En-Ting; Low, Tissot; Wu, Yi-Feng; Kao, Ruey-Ho; Lin, Chih-Bin

    2017-08-01

    This study was conducted to evaluate the effect of clinical factors on the treatment outcomes of lung cancer patients with active epidermal growth factor receptor (EGFR) mutations treated by first-line tyrosine kinase inhibitors (TKIs). Patients of stage IIIb or IV lung adenocarcinoma harboring mutated EGFR were enrolled between March 2010 and June 2014 and followed up until December 2015. The effects of various clinical features, such as age, sex, smoking history, EGFR mutation types, TKIs used, presence of pleural effusion, metastatic sites on progression-free survival (PFS) and overall survival (OS), were analyzed retrospectively. A total of 104 patients were included in this study. Patients with pleural effusion at initial diagnosis had significantly shorter PFS and OS than those without pleural effusion (median PFS: 8.2 months vs 15.3 months, P = 0.0004; median OS: 16.3 months vs 28.2 months, P = 0.0003). Univariate analysis revealed that being male or a smoker was associated with short PFS, whereas smoking history, bony metastasis and malignant pleural effusion were associated with poor OS. Stepwise multivariate Cox regression analysis showed that the presence of pleural effusion and different TKI use were independent prognostic factors for PFS [hazard ratio [HR] = 2.50 (95% confidence interval [CI], 1.53-4.10), P = 0.0003 and HR = 0.55 (95% CI, 0.31-0.97), P = 0.0396, respectively], whereas the presence of pleural effusion and liver metastasis were associated with poor OS [HR = 2.79 (95% CI: 1.46-5.30), P = 0.0018 and HR = 2.12 (95% CI, 1.02-4.40), P = 0.0440, respectively]. The presence of pleural effusion predicts poor PFS and OS in lung adenocarcinoma patients receiving TKIs as the first-line treatment. Additional studies are warranted to elucidate the underlying mechanisms and determine novel strategies for improving the outcome of these patients. © 2017 John Wiley & Sons Australia, Ltd.

  1. c-Jun controls the efficiency of MAP kinase signaling by transcriptional repression of MAP kinase phosphatases

    Sprowles, Amy; Robinson, Dan; Wu Yimi; Kung, H.-J.; Wisdom, Ron

    2005-01-01

    The mammalian JNK signaling pathway regulates the transcriptional response of cells to environmental stress, including UV irradiation. This signaling pathway is composed of a classical MAP kinase cascade; activation results in phosphorylation of the transcription factor substrates c-Jun and ATF2, and leads to changes in gene expression. The defining components of this pathway are conserved in the fission yeast S. pombe, where the genetic studies have shown that the ability of the JNK homolog Spc1 to be activated in response to UV irradiation is dependent on the presence of the transcription factor substrate Atf1. We have used genetic analysis to define the role of c-Jun in activation of the mammalian JNK signaling pathway. Our results show that optimal activation of JNK requires the presence of its transcription factor substrate c-Jun. Mutational analysis shows that the ability of c-Jun to support efficient activation of JNK requires the ability of Jun to bind DNA, suggesting a transcriptional mechanism. Consistent with this, we show that c-Jun represses the expression of several MAP kinase phosphatases. In the absence of c-Jun, the increased expression of MAP kinase phosphatases leads to impaired activation of the ERK, JNK, and p38 MAP kinases after pathway activation. The results show that one function of c-Jun is to regulate the efficiency of signaling by the ERK, p38, and JNK MAP kinases, a function that is likely to affect cellular responses to many different stimuli

  2. Mutations in Arabidopsis thaliana genes involved in the tryptophan biosynthesis pathway affect root waving on tilted agar surfaces

    Rutherford, R.; Gallois, P.; Masson, P. H.

    1998-01-01

    Arabidopsis thaliana roots grow in a wavy pattern upon a slanted surface. A novel mutation in the anthranilate synthase alpha 1 (ASA1) gene, named trp5-2wvc1, and mutations in the tryptophan synthase alpha and beta 1 genes (trp3-1 and trp2-1, respectively) confer a compressed root wave phenotype on tilted agar surfaces. When trp5-2wvc1 seedlings are grown on media supplemented with anthranilate metabolites, their roots wave like wild type. Genetic and pharmacological experiments argue that the compressed root wave phenotypes of trp5-2wvc1, trp2-1 and trp3-1 seedlings are not due to reduced IAA biosynthetic potential, but rather to a deficiency in L-tryptophan (L-Trp), or in a L-Trp derivative. Although the roots of 7-day-old seedlings possess higher concentrations of free L-Trp than the shoot as a whole, trp5-2wvc1 mutants show no detectable alteration in L-Trp levels in either tissue type, suggesting that a very localized shortage of L-Trp, or of a L-Trp-derived compound, is responsible for the observed phenotype.

  3. A mutation in human VAP-B--MSP domain, present in ALS patients, affects the interaction with other cellular proteins.

    Mitne-Neto, M; Ramos, C R R; Pimenta, D C; Luz, J S; Nishimura, A L; Gonzales, F A; Oliveira, C C; Zatz, M

    2007-09-01

    Amyotrophic Lateral Sclerosis (ALS) is the most common adult-onset Motor Neuron Disease (MND), characterized by motor neurons death in the cortex, brainstem and spinal cord. Ten loci linked to Familial ALS have been mapped. ALS8 is caused by a substitution of a proline by a serine in the Vesicle-Associated Membrane Protein-Associated protein-B/C (VAP-B/C). VAP-B belongs to a highly conserved family of proteins implicated in Endoplasmic Reticulum-Golgi and intra-Golgi transport and microtubules stabilization. Previous studies demonstrated that the P56S mutation disrupts the subcellular localization of VAP-B and that this position would be essential for Unfolded Protein Response (UPR) induced by VAP-B. In the present work we expressed and purified recombinant wild-type and P56S mutant VAP-B-MSP domain for the analysis of its interactions with other cellular proteins. Our findings suggest that the P56S mutation may lead to a less stable interaction of this endoplasmic reticulum protein with at least two other proteins: tubulin and GAPDH. These two proteins have been previously related to other forms of neurodegenerative diseases and are potential key points to understand ALS8 pathogenesis and other forms of MND. Understanding the role of these protein interactions may help the treatment of this devastating disease in the future.

  4. Factors affecting mutational specificity in mammalian cells: [Informal technical progress report], February 1, 1986-January 31, 1987

    Strauss, B.S.

    1987-01-01

    We analyzed the different c-H-ras mutations produced in cells after treatment with chemical carcinogens. The overall goal of this work is an understanding of the changes produced by environmental mutagens and carcinogens to learn how closely the results obtained with bacterial and cellular assay systems apply to the in vivo situation. Our work continues to utilize the technique for the study of DNA synthesis termination in vitro developed in this laboraory and utilized for the past several years. This technology can be characterized as a Sanger dideoxy sequencing technique with mutation induced lesions in the template strand serving as chain terminators instead of the dideoxynucleotides used in the Sanger technique to terminate the growing strand. We have added to this technique a modification for the study of termination on double stranded templates as possibly modeling more closely the natural situation. For this modification, double stranded M13 DNA is split once with a restriction enzyme which makes a unique cut and the linearized DNA is hybridized with single stranded circular DNA to make a uniquely nicked double stranded circle with a single 3'OH to serve as a primer for DNA synthesis which can occur by either strand displacement or nick translation

  5. The scid mutation does not affect slowly repairing potentially lethal damage that is sensitive to 0.23 M NaCl

    Kimura, Hiroshi; Ikebuchi, Makoto; Fushiki, Masato; Komatsu, Kenshi.

    1996-01-01

    The repair of slowly repairing potentially lethal damage (PLD) in radiosensitive cells from the severe combined immunodeficient (scid) mouse was compared with that in Balb/c 3T3 cells with ''wild-type'' radiosensitivity and that in RD13B2 cells derived from scid cells whose sensitivity is normal because of the presence of fragments of human chromosome 8. Treatment with 0.23 M NaCl was used for fixation of slowly repairing PLD. The scid cells repaired PLD sensitive to 0.23 M NaCl to a great extent whin 3-4 h, similarly to Balb/c 3T3 and RD13B2 cells. This indicates that the scid mutation hardly affects the repair of PLD sensitive to 0.23 M NaCl. On the other hand, as reported previously, the rapidly repairing PLD that is sensitive to 0.5 M NaCl was repaired only slowly (3-4 h) in scid cells, in contrast to the rapid repair (within 1 h) seen with Balb/c 3T3 and RD13B2. This suggests that scid mutation is responsible for this repair at reduced rate. To confirm the independence of repair of 0.23 M NaCl-sensitive PLD from that of 0.5 M NaCl-sensitive PLD, both treatments with 0.23 M NaCl and 0.5 M NaCl were combined in each line. It is found that the repair of either PLD was not affected by the other treatment. The scid mutation impaired only the repair of 0.5 M NaCl-sensitive PLD. (author)

  6. Recurrent De Novo Mutations Affecting Residue Arg138 of Pyrroline-5-Carboxylate Synthase Cause a Progeroid Form of Autosomal-Dominant Cutis Laxa.

    Fischer-Zirnsak, Björn; Escande-Beillard, Nathalie; Ganesh, Jaya; Tan, Yu Xuan; Al Bughaili, Mohammed; Lin, Angela E; Sahai, Inderneel; Bahena, Paulina; Reichert, Sara L; Loh, Abigail; Wright, Graham D; Liu, Jaron; Rahikkala, Elisa; Pivnick, Eniko K; Choudhri, Asim F; Krüger, Ulrike; Zemojtel, Tomasz; van Ravenswaaij-Arts, Conny; Mostafavi, Roya; Stolte-Dijkstra, Irene; Symoens, Sofie; Pajunen, Leila; Al-Gazali, Lihadh; Meierhofer, David; Robinson, Peter N; Mundlos, Stefan; Villarroel, Camilo E; Byers, Peter; Masri, Amira; Robertson, Stephen P; Schwarze, Ulrike; Callewaert, Bert; Reversade, Bruno; Kornak, Uwe

    2015-09-03

    Progeroid disorders overlapping with De Barsy syndrome (DBS) are collectively denoted as autosomal-recessive cutis laxa type 3 (ARCL3). They are caused by biallelic mutations in PYCR1 or ALDH18A1, encoding pyrroline-5-carboxylate reductase 1 and pyrroline-5-carboxylate synthase (P5CS), respectively, which both operate in the mitochondrial proline cycle. We report here on eight unrelated individuals born to non-consanguineous families clinically diagnosed with DBS or wrinkly skin syndrome. We found three heterozygous mutations in ALDH18A1 leading to amino acid substitutions of the same highly conserved residue, Arg138 in P5CS. A de novo origin was confirmed in all six probands for whom parental DNA was available. Using fibroblasts from affected individuals and heterologous overexpression, we found that the P5CS-p.Arg138Trp protein was stable and able to interact with wild-type P5CS but showed an altered sub-mitochondrial distribution. A reduced size upon native gel electrophoresis indicated an alteration of the structure or composition of P5CS mutant complex. Furthermore, we found that the mutant cells had a reduced P5CS enzymatic activity leading to a delayed proline accumulation. In summary, recurrent de novo mutations, affecting the highly conserved residue Arg138 of P5CS, cause an autosomal-dominant form of cutis laxa with progeroid features. Our data provide insights into the etiology of cutis laxa diseases and will have immediate impact on diagnostics and genetic counseling. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Mutations in the DNA-binding domain of NR2E3 affect in vivo dimerization and interaction with CRX.

    Raphael Roduit

    Full Text Available BACKGROUND: NR2E3 (PNR is an orphan nuclear receptor essential for proper photoreceptor determination and differentiation. In humans, mutations in NR2E3 have been associated with the recessively inherited enhanced short wavelength sensitive (S- cone syndrome (ESCS and, more recently, with autosomal dominant retinitis pigmentosa (adRP. NR2E3 acts as a suppressor of the cone generation program in late mitotic retinal progenitor cells. In adult rod photoreceptors, NR2E3 represses cone-specific gene expression and acts in concert with the transcription factors CRX and NRL to activate rod-specific genes. NR2E3 and CRX have been shown to physically interact in vitro through their respective DNA-binding domains (DBD. The DBD also contributes to homo- and heterodimerization of nuclear receptors. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed NR2E3 homodimerization and NR2E3/CRX complex formation in an in vivo situation by Bioluminescence Resonance Energy Transfer (BRET(2. NR2E3 wild-type protein formed homodimers in transiently transfected HEK293T cells. NR2E3 homodimerization was impaired in presence of disease-causing mutations in the DBD, except for the p.R76Q and p.R104W mutant proteins. Strikingly, the adRP-linked p.G56R mutant protein interacted with CRX with a similar efficiency to that of NR2E3 wild-type and p.R311Q proteins. In contrast, all other NR2E3 DBD-mutant proteins did not interact with CRX. The p.G56R mutant protein was also more effective in abolishing the potentiation of rhodospin gene transactivation by the NR2E3 wild-type protein. In addition, the p.G56R mutant enhanced the transrepression of the M- and S-opsin promoter, while all other NR2E3 DBD-mutants did not. CONCLUSIONS/SIGNIFICANCE: These results suggest different disease mechanisms in adRP- and ESCS-patients carrying NR2E3 mutations. Titration of CRX by the p.G56R mutant protein acting as a repressor in trans may account for the severe clinical phenotype in adRP patients.

  8. In Azospirillum brasilense, mutations in flmA or flmB genes affect polar flagellum assembly, surface polysaccharides, and attachment to maize roots.

    Rossi, Fernando Ariel; Medeot, Daniela Beatriz; Liaudat, Juan Pablo; Pistorio, Mariano; Jofré, Edgardo

    2016-09-01

    Azospirillum brasilense is a soil bacterium capable of promoting plant growth. Several surface components were previously reported to be involved in the attachment of A. brasilense to root plants. Among these components are the exopolysaccharide (EPS), lipopolysaccharide (LPS) and the polar flagellum. Flagellin from polar flagellum is glycosylated and it was suggested that genes involved in such a posttranslational modification are the same ones involved in the biosynthesis of sugars present in the O-antigen of the LPS. In this work, we report on the characterization of two homologs present in A. brasilense Cd, to the well characterized flagellin modification genes, flmA and flmB, from Aeromonas caviae. We show that mutations in either flmA or flmB genes of A. brasilense resulted in non-motile cells due to alterations in the polar flagellum assembly. Moreover, these mutations also affected the capability of A. brasilense cells to adsorb to maize roots and to produce LPS and EPS. By generating a mutant containing the polar flagellum affected in their rotation, we show the importance of the bacterial motility for the early colonization of maize roots. Copyright © 2016 Elsevier GmbH. All rights reserved.

  9. Genetic and epigenetic mutations affect the DNA binding capability of human ZFP57 in transient neonatal diabetes type 1.

    Baglivo, Ilaria; Esposito, Sabrina; De Cesare, Lucia; Sparago, Angela; Anvar, Zahra; Riso, Vincenzo; Cammisa, Marco; Fattorusso, Roberto; Grimaldi, Giovanna; Riccio, Andrea; Pedone, Paolo V

    2013-05-21

    In the mouse, ZFP57 contains three classical Cys2His2 zinc finger domains (ZF) and recognizes the methylated TGC(met)CGC target sequence using the first and the second ZFs. In this study, we demonstrate that the human ZFP57 (hZFP57) containing six Cys2His2 ZFs, binds the same methylated sequence through the third and the fourth ZFs, and identify the aminoacids critical for DNA interaction. In addition, we present evidences indicating that hZFP57 mutations and hypomethylation of the TNDM1 ICR both associated with Transient Neonatal Diabetes Mellitus type 1 result in loss of hZFP57 binding to the TNDM1 locus, likely causing PLAGL1 activation. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  10. Sweat chloride and immunoreactive trypsinogen in infants carrying two CFTR mutations and not affected by cystic fibrosis.

    Castellani, Carlo; Tridello, Gloria; Tamanini, Anna; Assael, Baroukh M

    2017-07-01

    Newborns with raised immunotrypsinogen levels who have non-pathological sweat chloride values and carry two cystic fibrosis transmembrane regulator ( CFTR ) mutations of which at least one is not acknowledged to be cystic fibrosis (CF)-causing are at risk of developing clinical manifestations consistent with CFTR-related disorders or even CF. It is not known whether newborns with similar genotypes and normal immunoreactive trypsinogen (IRT) may share the same risk. This study found that newborns with these characteristics and normal IRT have lower sweat chloride values than those with raised IRT (p=0.007). Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  11. MILDEW LOCUS O Mutation Does Not Affect Resistance to Grain Infections with Fusarium spp. and Ramularia collo-cygni.

    Hofer, Katharina; Linkmeyer, Andrea; Textor, Katharina; Hückelhoven, Ralph; Hess, Michael

    2015-09-01

    MILDEW LOCUS O defines a major susceptibility gene for powdery mildew, and recessive mlo resistance alleles are widely used in breeding for powdery mildew resistance in spring barley. Barley powdery mildew resistance, which is conferred by mlo genes, is considered to be costly in terms of spontaneous defense reactions and enhanced susceptibility to cell-death-inducing pathogens. We assessed fungal infestation of barley (Hordeum vulgare) grain by measuring fungal DNA after natural infection with Fusarium spp. and Ramularia collo-cygni or after inoculation with Fusarium spp. in the field. Powdery-mildew-resistant mlo5 genotypes did not show enhanced Fusarium spp. or R. collo-cygni DNA content of grain over four consecutive years. Data add to our understanding of pleiotropic effects of mlo-mediated powdery mildew resistance and contributes to the discussion of whether or not application of barley mlo mutations may support pathogenesis of cell-death-inducing fungal pathogens under field conditions.

  12. Using answer set programming to integrate RNA expression with signalling pathway information to infer how mutations affect ageing.

    Papatheodorou, Irene; Ziehm, Matthias; Wieser, Daniela; Alic, Nazif; Partridge, Linda; Thornton, Janet M

    2012-01-01

    A challenge of systems biology is to integrate incomplete knowledge on pathways with existing experimental data sets and relate these to measured phenotypes. Research on ageing often generates such incomplete data, creating difficulties in integrating RNA expression with information about biological processes and the phenotypes of ageing, including longevity. Here, we develop a logic-based method that employs Answer Set Programming, and use it to infer signalling effects of genetic perturbations, based on a model of the insulin signalling pathway. We apply our method to RNA expression data from Drosophila mutants in the insulin pathway that alter lifespan, in a foxo dependent fashion. We use this information to deduce how the pathway influences lifespan in the mutant animals. We also develop a method for inferring the largest common sub-paths within each of our signalling predictions. Our comparisons reveal consistent homeostatic mechanisms across both long- and short-lived mutants. The transcriptional changes observed in each mutation usually provide negative feedback to signalling predicted for that mutation. We also identify an S6K-mediated feedback in two long-lived mutants that suggests a crosstalk between these pathways in mutants of the insulin pathway, in vivo. By formulating the problem as a logic-based theory in a qualitative fashion, we are able to use the efficient search facilities of Answer Set Programming, allowing us to explore larger pathways, combine molecular changes with pathways and phenotype and infer effects on signalling in in vivo, whole-organism, mutants, where direct signalling stimulation assays are difficult to perform. Our methods are available in the web-service NetEffects: http://www.ebi.ac.uk/thornton-srv/software/NetEffects.

  13. A Point Mutation in p190A RhoGAP Affects Ciliogenesis and Leads to Glomerulocystic Kidney Defects.

    Katherine Stewart

    2016-02-01

    Full Text Available Rho family GTPases act as molecular switches regulating actin cytoskeleton dynamics. Attenuation of their signaling capacity is provided by GTPase-activating proteins (GAPs, including p190A, that promote the intrinsic GTPase activity of Rho proteins. In the current study we have performed a small-scale ENU mutagenesis screen and identified a novel loss of function allele of the p190A gene Arhgap35, which introduces a Leu1396 to Gln substitution in the GAP domain. This results in decreased GAP activity for the prototypical Rho-family members, RhoA and Rac1, likely due to disrupted ordering of the Rho binding surface. Consequently, Arhgap35-deficient animals exhibit hypoplastic and glomerulocystic kidneys. Investigation into the cystic phenotype shows that p190A is required for appropriate primary cilium formation in renal nephrons. P190A specifically localizes to the base of the cilia to permit axoneme elongation, which requires a functional GAP domain. Pharmacological manipulations further reveal that inhibition of either Rho kinase (ROCK or F-actin polymerization is able to rescue the ciliogenesis defects observed upon loss of p190A activity. We propose a model in which p190A acts as a modulator of Rho GTPases in a localized area around the cilia to permit the dynamic actin rearrangement required for cilia elongation. Together, our results establish an unexpected link between Rho GTPase regulation, ciliogenesis and glomerulocystic kidney disease.

  14. Hyper-immunoglobulin D syndrome with novel mutations in an afebrile infant.

    Cadmus, Simi D; Green, Reid; Carrasco, Ruy; Levy, Moise L; Diaz, Lucia Z

    2018-03-30

    Hyper-immunoglobulin D syndrome is a rare autosomal-recessive autoinflammatory syndrome in which a mevalonate kinase deficiency results due to mutations of the mevalonate kinase gene. We report a case of an Asian male infant who was found to have hyper-immunoglobulin D syndrome in the absence of fever. His skin manifestations included cephalic pustulosis as well recurrent transient and fixed pink plaques and nodules on the face and extremities. Subsequent examination revealed hyper-immunoglobulin D syndrome with two novel allelic mutations in the mevalonate kinase gene: c.895G > A (p.D299N) and c.1168C > T (p.Q390). It is important for dermatologists to recognize the varied cutaneous presentations of hyper-immunoglobulin D syndrome because rapid diagnosis and treatment can significantly affect outcomes. © 2018 Wiley Periodicals, Inc.

  15. Benazepril affects integrin-linked kinase and smooth muscle α-actin expression in diabetic rat glomerulus and cultured mesangial cells.

    Niu, Honglin; Nie, Lei; Liu, Maodong; Chi, Yanqing; Zhang, Tao; Li, Ying

    2014-08-20

    Diabetic nephropathy (DN) is the leading cause of chronic kidney disease and is associated with excessive cardiovascular morbidity and mortality. The angiotensin converting enzyme inhibitor (ACEI) benazepril has been shown to slow the progression of chronic renal disease and have beneficial effects in patients with a combination of chronic renal disease and cardiovascular disease. Transforming growth factor-β(1) (TGF-β(1)) plays a central role in the pathogenesis and progression of DN. Integrin-linked kinase (ILK) can modulate TGF-β(1)-induced glomerular mesangial cell (GMC) injury, which is a prominent characteristic of renal pathology in kidney diseases. As an integrin cytoplasmic-binding protein, ILK regulates fibronectin (FN) matrix deposition and the actin cytoskeleton. Smooth muscle α-actin (α-SMA) is involved in progressive renal dysfunction in both human and experimental renal disease. To explore the mechanisms of benazepril's reno-protective effects, we examined the expression of TGF-β(1), ILK, and α-SMA in GMC exposed to high glucose (HG) and in the kidneys of streptozotocin (STZ)-induced diabetic rats using real-time quantitative RT-PCR and western blot analysis. To elucidate the mechanism(s) of the effect of benazepril on GMC cellular processes, we assessed the effect of benazepril on Angiotensin II (Ang II) signalling pathways using western blot analysis. The expression of TGF-β(1), ILK, and α-SMA increased significantly in the diabetic group compared with the control group. Benazepril treatment inhibited the expression of these genes in DN but failed to rescue the same levels in the control group. Similar results were found in GMC treated with HG or benazepril. Ang II increased ERK and Akt phosphorylation in the HG group, and benazepril could not completely block these responses, suggesting that other molecules might be involved in the progression of DN. Our findings suggest that benazepril decreases ILK and α-SMA expression, at least in

  16. Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency

    Garone, Caterina; Garc??a-D??az, Beatriz; Emmanuele, Valentina; L??pez Garc??a, Luis Carlos; Tadesse, Saba; Akman, Hasan O.; Tanji, Kurenai; Quinzii, Catarina M.; Hirano, Michio

    2014-01-01

    Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2 −/− ) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-...

  17. Convergent Evolution of Head Crests in Two Domesticated Columbids Is Associated with Different Missense Mutations in EphB2

    Vickrey, Anna I.; Domyan, Eric T.; Horvath, Martin P.; Shapiro, Michael D.

    2015-01-01

    Head crests are important display structures in wild bird species and are also common in domesticated lineages. Many breeds of domestic rock pigeon (Columba livia) have crests of reversed occipital feathers, and this recessive trait is associated with a nonsynonymous coding mutation in the intracellular kinase domain of EphB2 (Ephrin receptor B2). The domestic ringneck dove (Streptopelia risoria) also has a recessive crested morph with reversed occipital feathers, and interspecific crosses between crested doves and pigeons produce crested offspring, suggesting a similar genetic basis for this trait in both species. We therefore investigated EphB2 as a candidate for the head crest phenotype of ringneck doves and identified a nonsynonymous coding mutation in the intracellular kinase domain that is significantly associated with the crested morph. This mutation is over 100 amino acid positions away from the crest mutation found in rock pigeons, yet both mutations are predicted to negatively affect the function of ATP-binding pocket. Furthermore, bacterial toxicity assays suggest that “crest” mutations in both species severely impact kinase activity. We conclude that head crests are associated with different mutations in the same functional domain of the same gene in two different columbid species, thereby representing striking evolutionary convergence in morphology and molecules. PMID:26104009

  18. Point mutations in EBV gH that abrogate or differentially affect B cell and epithelial cell fusion

    Wu Liguo; Hutt-Fletcher, Lindsey M.

    2007-01-01

    Cell fusion mediated by Epstein-Barr virus requires three conserved glycoproteins, gB and gHgL, but activation is cell type specific. B cell fusion requires interaction between MHC class II and a fourth virus glycoprotein, gp42, which complexes non-covalently with gHgL. Epithelial cell fusion requires interaction between gHgL and a novel epithelial cell coreceptor and is blocked by excess gp42. We show here that gp42 interacts directly with gH and that point mutations in the region of gH recognized by an antibody that differentially inhibits epithelial and B cell fusion significantly impact both the core fusion machinery and cell-specific events. Substitution of alanine for glycine at residue 594 completely abrogates fusion with either B cells or epithelial cells. Substitution of alanine for glutamic acid at residue 595 reduces fusion with epithelial cells, greatly enhances fusion with B cells and allows low levels of B cell fusion even in the absence of gL

  19. Mutations that promote furin-independent growth of Semliki Forest virus affect p62-E1 interactions and membrane fusion

    Zhang Xinyong; Kielian, Margaret

    2004-01-01

    The enveloped alphavirus Semliki Forest virus (SFV) infects cells via a low pH-triggered membrane fusion reaction mediated by the E1 protein. E1's fusion activity is regulated by its heterodimeric interaction with a companion membrane protein E2. Mature E2 protein is generated by furin processing of the precursor p62. Processing destabilizes the heterodimer, allowing dissociation at acidic pH, E1 conformational changes, and membrane fusion. We used a furin-deficient cell line, FD11, to select for SFV mutants that show increased growth in the absence of p62 processing. We isolated and characterized 7 such pci mutants (p62 cleavage independent), which retained the parental furin cleavage site but showed significant increases in their ability to carry out membrane fusion in the p62 form. Sequence analysis of the pci mutants identified mutations primarily on the E2 protein, and suggested sites important in the interaction of p62 with E1 and the regulation of fusion

  20. Mutagenic DNA repair in Escherichia coli. Pt. 2. Factors affecting loss of photoreversibility of UV induced mutations

    Doubleday, O P; Bridges, B A; Green, M H.L. [Medical Research Council, Brighton (UK). Cell Mutation Unit

    1975-01-01

    The photoreversibility of UV-induced mutations to Trp/sup +/ in strain Escherichia coli WP2 uvr A trp (unable to excise pyrimidine dimers) was lost at different rates during incubation in different media. In Casamino acids medium after a short initial lag, photoreversibility was lost over about one generation time; in minimal medium with tryptophan, photoreversibility persisted for more than two generations; in Casamino acids medium with pantoyl lactone photoreversibility was lost extremely slowly. The rate of loss of photoreversibility was unaffected by UV dose in either Casamino acids medium or in minimal medium. The same eventual number of induced mutants was obtained when cells were incubated for two generations in any of the three media before being transferred to selective plates supplemented with Casamino acids. Thus in each the proportion of cells capable of giving rise to a mutant was the same and only the rate at which these cells did so during post-irradiation growth varied, suggesting that there might be a specific fraction of pyrimidine dimers at a given site capable of initiating a mutagenic repair event, and that the size of this fraction is dose dependent. Segregation experiments have shown that error-prone repair appears to occur once only and is not repeated in subsequent replication cycles, in contrast to (presumed error-free) recombination repair. The results are discussed in the light of current models of UV mutagenesis.

  1. Autoregulation of kinase dephosphorylation by ATP binding in AGC protein kinases.

    Chan, Tung O; Pascal, John M; Armen, Roger S; Rodeck, Ulrich

    2012-02-01

    AGC kinases, including the three Akt (protein kinase B) isoforms, protein kinase A (PKA) and all protein kinase C (PKC) isoforms, require activation loop phosphorylation (threonine 308 in Akt1) as well as phosphorylation of a C-terminal residue (serine 473 in Akt1) for catalytic activity and phosphorylation of downstream targets. Conversely, phosphatases reverse these phosphorylations. Virtually all cellular processes are affected by AGC kinases, a circumstance that has led to intense scrutiny of the molecular mechanisms that regulate phosphorylation of these kinases. Here, we review a new layer of control of phosphorylation in Akt, PKA and PKC pointing to ATP binding pocket occupancy as a means to decelerate dephosphorylation of these and, potentially, other kinases. This additional level of kinase regulation opens the door to search for new functional motifs for the rational design of non- ATP-competitive kinase inhibitors that discriminate within and between protein kinase families.

  2. Autoregulation of kinase dephosphorylation by ATP binding to AGC protein kinases

    Pascal, John M; Armen, Roger S

    2012-01-01

    AGC kinases, including the three Akt (protein kinase B) isoforms, protein kinase A (PKA) and all protein kinase C (PKC) isoforms, require activation loop phosphorylation (threonine 308 in Akt1) as well as phosphorylation of a C-terminal residue (serine 473 in Akt1) for catalytic activity and phosphorylation of downstream targets. Conversely, phosphatases reverse these phosphorylations. Virtually all cellular processes are affected by AGC kinases, a circumstance that has led to intense scrutiny of the molecular mechanisms that regulate phosphorylation of these kinases. Here, we review a new layer of control of phosphorylation in Akt, PKA and PKC pointing to ATP binding pocket occupancy as a means to decelerate dephosphorylation of these and, potentially, other kinases. This additional level of kinase regulation opens the door to search for new functional motifs for the rational design of non-ATP-competitive kinase inhibitors that discriminate within and between protein kinase families. PMID:22262182

  3. Calcium is the switch in the moonlighting dual function of the ligand-activated receptor kinase phytosulfokine receptor 1

    Muleya, Victor

    2014-09-23

    Background: A number of receptor kinases contain guanylate cyclase (GC) catalytic centres encapsulated in the cytosolic kinase domain. A prototypical example is the phytosulfokine receptor 1 (PSKR1) that is involved in regulating growth responses in plants. PSKR1 contains both kinase and GC activities however the underlying mechanisms regulating the dual functions have remained elusive. Findings: Here, we confirm the dual activity of the cytoplasmic domain of the PSKR1 receptor. We show that mutations within the guanylate cyclase centre modulate the GC activity while not affecting the kinase catalytic activity. Using physiologically relevant Ca2+ levels, we demonstrate that its GC activity is enhanced over two-fold by Ca2+ in a concentration-dependent manner. Conversely, increasing Ca2+ levels inhibits kinase activity up to 500-fold at 100 nM Ca2+. Conclusions: Changes in calcium at physiological levels can regulate the kinase and GC activities of PSKR1. We therefore propose a functional model of how calcium acts as a bimodal switch between kinase and GC activity in PSKR1 that could be relevant to other members of this novel class of ligand-activated receptor kinases.

  4. Insight on Mutation-Induced Resistance from Molecular Dynamics Simulations of the Native and Mutated CSF-1R and KIT.

    Priscila Da Silva Figueiredo Celestino Gomes

    Full Text Available The receptors tyrosine kinases (RTKs for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V and CSF-1R (mutation D802V by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii the electrostatic interactions are a decisive factor affecting the binding energy; (iii the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R and D816V (KIT mutations; (iv the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.

  5. Signaling network of the Btk family kinases.

    Qiu, Y; Kung, H J

    2000-11-20

    The Btk family kinases represent new members of non-receptor tyrosine kinases, which include Btk/Atk, Itk/Emt/Tsk, Bmx/Etk, and Tec. They are characterized by having four structural modules: PH (pleckstrin homology) domain, SH3 (Src homology 3) domain, SH2 (Src homology 2) domain and kinase (Src homology 1) domain. Increasing evidence suggests that, like Src-family kinases, Btk family kinases play central but diverse modulatory roles in various cellular processes. They participate in signal transduction in response to virtually all types of extracellular stimuli which are transmitted by growth factor receptors, cytokine receptors, G-protein coupled receptors, antigen-receptors and integrins. They are regulated by many non-receptor tyrosine kinases such as Src, Jak, Syk and FAK family kinases. In turn, they regulate many of major signaling pathways including those of PI3K, PLCgamma and PKC. Both genetic and biochemical approaches have been used to dissect the signaling pathways and elucidate their roles in growth, differentiation and apoptosis. An emerging new role of this family of kinases is cytoskeletal reorganization and cell motility. The physiological importance of these kinases was amply demonstrated by their link to the development of immunodeficiency diseases, due to germ-line mutations. The present article attempts to review the structure and functions of Btk family kinases by summarizing our current knowledge on the interacting partners associated with the different modules of the kinases and the diverse signaling pathways in which they are involved.

  6. The association of JAK2V617F mutation and leukocytosis with thrombotic events in essential thrombocythemia.

    Hsiao, Hui-Hua; Yang, Ming-Yu; Liu, Yi-Chang; Lee, Ching-Ping; Yang, Wen-Chi; Liu, Ta-Chih; Chang, Chao-Sung; Lin, Sheng-Fung

    2007-11-01

    The Janus kinase 2 mutation, JAK2 (V617F), and megakaryocytic mutations, MPL (W515L/K), have been identified and correlated with a subtype of essential thrombocythemia (ET) patients. We investigated the frequency of mutations in ET patients and analyzed the relationship with their clinical features. Fifty-three ET patients were enrolled in the study. The amplification refractory mutation system was applied for the mutation survey of the JAK2V617F, while the polymerase chain reaction with sequencing was used for the mutation survey of MPLW515L/K. Thirty-five (66%) patients harboring the JAK2 (V617F) mutation, including 3 homozygous and 32 heterozygous changes, but no MPLW515L/K mutation, were found. During follow-up, 17 (32.1%) patients suffered from documented thrombotic events, with 15 having JAK2V617F mutations. Statistical analysis showed that patients with the JAK2 mutation had significantly higher leukocytes, hemoglobin level, and thrombotic event (p = 0.043, p = 0.001, and p = 0.029, respectively). Thrombotic events were also significantly correlated with leukocytosis and older age. The JAK2V617F mutation was noted in a certain population of ET patients and correlated with leukocytosis, high hemoglobin level, and thrombosis. Therefore, detection of the JAK2V617F mutation can affect not only the diagnosis, but also the management of ET patients.

  7. Clinical and molecular features of an infant patient affected by Leigh Disease associated to m.14459G > A mitochondrial DNA mutation: a case report

    Moggio Maurizio

    2011-07-01

    Full Text Available Abstract Background Leigh Syndrome (LS is a severe neurodegenerative disorder characterized by bilateral symmetrical necrotic lesions in the basal ganglia and brainstem. Onset is in early infancy and prognosis is poor. Causative mutations have been disclosed in mitochondrial DNA and nuclear genes affecting respiratory chain subunits and assembly factors. Case presentation Here we report the clinical and molecular features of a 15-month-old female LS patient. Direct sequencing of her muscle-derived mtDNA revealed the presence of two apparently homoplasmic variants: the novel m.14792C > G and the already known m.14459G > A resulting in p.His16Asp change in cytochrome b (MT-CYB and p.Ala72Val substitution in ND6 subunit, respectively. The m.14459G > A was heteroplasmic in the mother's blood-derived DNA. Conclusions The m.14459G > A might lead to LS, complicated LS or Leber Optic Hereditary Neuropathy. A comprehensive re-evaluation of previously described 14459G > A-mutated patients does not explain this large clinical heterogeneity.

  8. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  9. Novel ETHE1 mutation in a carrier couple having prior offspring affected with ethylmalonic encephalopathy: Genetic analysis, clinical management and reproductive outcome.

    Walsh, David J

    2010-03-01

    Ethylmalonic encephalopathy (EE) is an autosomally recessive inherited disorder with a relentlessly progressive decline in neurological function, usually fatal by the age of ten. It is characterised by generalised hypotonia, psychomotor regression, spastic tetraparesis, dystonia, seizures and, eventually, global neurological failure. Approximately 50 reports have been published worldwide describing this devastating disease, most involving patients of Mediterranean or Arab origin. The fundamental defect in EE likely involves the impairment of a mitochondrial sulphur dioxygenase coded by the ETHE1 gene responsible for the catabolism of sulphide, which subsequently accumulates to toxic levels. A diagnosis of EE should initiate careful genetic evaluation and counselling, particularly if the parents intend to have additional offspring. The present report describes the diagnosis of EE in a reproductive endocrinology context, where both members of a non-consanguineous couple were confirmed to be carriers of an identical A↷G mutation. This previously unknown mutation at nucleotide position c.494 resulted in an amino acid substitution, p.Asp165Gly. Although consideration was given to in vitro fertilisation, embryo biopsy and single gene pre-implantation genetic diagnosis, the couple decided to first utilise a less aggressive therapeutic approach with donor sperm insemination. Pregnancy with a low risk of EE was indeed achieved; however, the infant was affected with a different anomaly (hypoplastic left heart). As this case demonstrates, prior to the initiation of fertility therapy, genetic analysis may be used to provide a confirmatory diagnosis when EE is suspected.

  10. Mutational analysis of the Wolfram syndrome gene in two families with chromosome 4p-linked bipolar affective disorder.

    Evans, K L; Lawson, D; Meitinger, T; Blackwood, D H; Porteous, D J

    2000-04-03

    Bipolar affective disorder (BPAD) is a complex disease with a significant genetic component. Heterozygous carriers of Wolfram syndrome (WFS) are at increased risk of psychiatric illness. A gene for WFS (WFS1) has recently been cloned and mapped to chromosome 4p, in the general region we previously reported as showing linkage to BPAD. Here we present sequence analysis of the WFS1 coding sequence in five affected individuals from two chromosome 4p-linked families. This resulted in the identification of six polymorphisms, two of which are predicted to change the amino acid sequence of the WFS1 protein, however none of the changes segregated with disease status. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:158-160, 2000. Copyright 2000 Wiley-Liss, Inc.

  11. Mutations in the voltage-sensing domain affect the alternative ion permeation pathway in the TRPM3 channel.

    Held, Katharina; Gruss, Fabian; Aloi, Vincenzo Davide; Janssens, Annelies; Ulens, Chris; Voets, Thomas; Vriens, Joris

    2018-03-31

    mutations in S4 can create an analogous 'omega' pore, we performed site-directed mutagenesis studies and patch clamp experiments to identify amino acid residues involved in the formation of the non-canonical pore in TRPM3. Based on our results, we pinpoint four residues in S4 (W982, R985, D988 and G991) as crucial determinants of the properties of the alternative ion permeation pathway. © 2018 KU Leuven The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  12. Pyrosequencing-Based Assays for Rapid Detection of HER2 and HER3 Mutations in Clinical Samples Uncover an E332E Mutation Affecting HER3 in Retroperitoneal Leiomyosarcoma

    Paula González-Alonso

    2015-08-01

    Full Text Available Mutations in Human Epidermal Growth Factor Receptors (HER are associated with poor prognosis of several types of solid tumors. Although HER-mutation detection methods are currently available, such as Next-Generation Sequencing (NGS, alternative pyrosequencing allow the rapid characterization of specific mutations. We developed specific PCR-based pyrosequencing assays for identification of most prevalent HER2 and HER3 mutations, including S310F/Y, R678Q, L755M/P/S/W, V777A/L/M, 774-776 insertion, and V842I mutations in HER2, as well as M91I, V104M/L, D297N/V/Y, and E332E/K mutations in HER3. We tested 85 Formalin Fixed and Paraffin Embbeded (FFPE samples and we detected three HER2-V842I mutations in colorectal carcinoma (CRC, ovarian carcinoma, and pancreatic carcinoma patients, respectively, and a HER2-L755M mutation in a CRC specimen. We also determined the presence of a HER3-E332K mutation in an urothelial carcinoma sample, and two HER3-D297Y mutations, in both gastric adenocarcinoma and CRC specimens. The D297Y mutation was previously detected in breast and gastric tumors, but not in CRC. Moreover, we found a not-previously-described HER3-E332E synonymous mutation in a retroperitoneal leiomyosarcoma patient. The pyrosequencing assays presented here allow the detection and characterization of specific HER2 and HER3 mutations. These pyrosequencing assays might be implemented in routine diagnosis for molecular characterization of HER2/HER3 receptors as an alternative to complex NGS approaches.

  13. Mutations in DSTYK and dominant urinary tract malformations.

    Sanna-Cherchi, Simone; Sampogna, Rosemary V; Papeta, Natalia; Burgess, Katelyn E; Nees, Shannon N; Perry, Brittany J; Choi, Murim; Bodria, Monica; Liu, Yan; Weng, Patricia L; Lozanovski, Vladimir J; Verbitsky, Miguel; Lugani, Francesca; Sterken, Roel; Paragas, Neal; Caridi, Gianluca; Carrea, Alba; Dagnino, Monica; Materna-Kiryluk, Anna; Santamaria, Giuseppe; Murtas, Corrado; Ristoska-Bojkovska, Nadica; Izzi, Claudia; Kacak, Nilgun; Bianco, Beatrice; Giberti, Stefania; Gigante, Maddalena; Piaggio, Giorgio; Gesualdo, Loreto; Vukic, Durdica Kosuljandic; Vukojevic, Katarina; Saraga-Babic, Mirna; Saraga, Marijan; Gucev, Zoran; Allegri, Landino; Latos-Bielenska, Anna; Casu, Domenica; State, Matthew; Scolari, Francesco; Ravazzolo, Roberto; Kiryluk, Krzysztof; Al-Awqati, Qais; D'Agati, Vivette D; Drummond, Iain A; Tasic, Velibor; Lifton, Richard P; Ghiggeri, Gian Marco; Gharavi, Ali G

    2013-08-15

    Congenital abnormalities of the kidney and the urinary tract are the most common cause of pediatric kidney failure. These disorders are highly heterogeneous, and the etiologic factors are poorly understood. We performed genomewide linkage analysis and whole-exome sequencing in a family with an autosomal dominant form of congenital abnormalities of the kidney or urinary tract (seven affected family members). We also performed a sequence analysis in 311 unrelated patients, as well as histologic and functional studies. Linkage analysis identified five regions of the genome that were shared among all affected family members. Exome sequencing identified a single, rare, deleterious variant within these linkage intervals, a heterozygous splice-site mutation in the dual serine-threonine and tyrosine protein kinase gene (DSTYK). This variant, which resulted in aberrant splicing of messenger RNA, was present in all affected family members. Additional, independent DSTYK mutations, including nonsense and splice-site mutations, were detected in 7 of 311 unrelated patients. DSTYK is highly expressed in the maturing epithelia of all major organs, localizing to cell membranes. Knockdown in zebrafish resulted in developmental defects in multiple organs, which suggested loss of fibroblast growth factor (FGF) signaling. Consistent with this finding is the observation that DSTYK colocalizes with FGF receptors in the ureteric bud and metanephric mesenchyme. DSTYK knockdown in human embryonic kidney cells inhibited FGF-stimulated phosphorylation of extracellular-signal-regulated kinase (ERK), the principal signal downstream of receptor tyrosine kinases. We detected independent DSTYK mutations in 2.3% of patients with congenital abnormalities of the kidney or urinary tract, a finding that suggests that DSTYK is a major determinant of human urinary tract development, downstream of FGF signaling. (Funded by the National Institutes of Health and others.).

  14. Casein kinases

    Issinger, O G

    1993-01-01

    The present review on casein kinases focuses mainly on the possible metabolic role of CK-2, with special emphasis on its behavior in pathological tissues. From these data at least three ways to regulate CK-2 activity emerge: (i) CK-2 activity changes during embryogenesis, being high at certain...

  15. Kinases and Cancer

    Jonas Cicenas; Egle Zalyte; Amos Bairoch; Pascale Gaudet

    2018-01-01

    Protein kinases are a large family of enzymes catalyzing protein phosphorylation. The human genome contains 518 protein kinase genes, 478 of which belong to the classical protein kinase family and 40 are atypical protein kinases [...

  16. The KRAS Strip Assay for detection of KRAS mutation in Egyptian patients with colorectal cancer (CRC): A pilot study

    Abd El Kader, Y.; Safwat, E.; Kassem, H.A.; Kassem, N.M.; Emera, G.

    2013-01-01

    Background: Epidermal growth factor receptor (EGFR) and its downstream factors KRAS and BRAF are mutated in several types of cancer, affecting the clinical response to EGFR inhibitors. Mutations in the EGFR kinase domain predict sensitivity to the tyrosine kinase inhibitors gefltinib and erlotinib in lung adenocarcinoma, while activating point mutations in KRAS and BRAF confer resistance to the anti-EGFR monoclonal antibody cetuximab in colorectal cancer. The development of new generation methods for systematic mutation screening of these genes will allow more appropriate therapeutic choices. Purpose: Detection of KRAS mutation in Egyptian colorectal cancer (CRC) patients by the KRAS Strip Assay. Methods: Examination of 20 colorectal cancer (CRC) patients is done to detect KRAS mutations by KRAS Strip Assay. For the Strip Assay, a mutant-enriched PCR was followed by hybridization to KRAS-specific probes bound to a nitrocellulose strip. Results: Among 20 patients, KRAS mutations were identified in 80% of patients by the KRAS Strip Assay. Conclusions: Our preliminary results suggest that KRAS Strip Assay is an alternative to protocols currently in use for KRAS mutation detection

  17. Aspergillus nidulans Natural Product Biosynthesis Is Regulated by MpkB, a Putative Pheromone Response Mitogen-Activated Protein Kinase

    Atoui, A.; Bao, D.; Kaur, N.; Grayburn, W.S.; Calvo, A.M.

    2008-01-01

    The Aspergillus nidulans putative mitogen-activated protein kinase encoded by mpkB has a role in natural product biosynthesis. An mpkB mutant exhibited a decrease in sterigmatocystin gene expression and low mycotoxin levels. The mutation also affected the expression of genes involved in penicillin and terrequinone A synthesis. mpkB was necessary for normal expression of laeA, which has been found to regulate secondary metabolism gene clusters. (author)

  18. Familial knockin mutation of LRRK2 causes lysosomal dysfunction and accumulation of endogenous insoluble α-synuclein in neurons.

    Schapansky, Jason; Khasnavis, Saurabh; DeAndrade, Mark P; Nardozzi, Jonathan D; Falkson, Samuel R; Boyd, Justin D; Sanderson, John B; Bartels, Tim; Melrose, Heather L; LaVoie, Matthew J

    2018-03-01

    Missense mutations in the multi-domain kinase LRRK2 cause late onset familial Parkinson's disease. They most commonly with classic proteinopathy in the form of Lewy bodies and Lewy neurites comprised of insoluble α-synuclein, but in rare cases can also manifest tauopathy. The normal function of LRRK2 has remained elusive, as have the cellular consequences of its mutation. Data from LRRK2 null model organisms and LRRK2-inhibitor treated animals support a physiological role for LRRK2 in regulating lysosome function. Since idiopathic and LRRK2-linked PD are associated with the intraneuronal accumulation of protein aggregates, a series of critical questions emerge. First, how do pathogenic mutations that increase LRRK2 kinase activity affect lysosome biology in neurons? Second, are mutation-induced changes in lysosome function sufficient to alter the metabolism of α-synuclein? Lastly, are changes caused by pathogenic mutation sensitive to reversal with LRRK2 kinase inhibitors? Here, we report that mutation of LRRK2 induces modest but significant changes in lysosomal morphology and acidification, and decreased basal autophagic flux when compared to WT neurons. These changes were associated with an accumulation of detergent-insoluble α-synuclein and increased neuronal release of α-synuclein and were reversed by pharmacologic inhibition of LRRK2 kinase activity. These data demonstrate a critical and disease-relevant influence of native neuronal LRRK2 kinase activity on lysosome function and α-synuclein homeostasis. Furthermore, they also suggest that lysosome dysfunction, altered neuronal α-synuclein metabolism, and the insidious accumulation of aggregated protein over decades may contribute to pathogenesis in this late-onset form of familial PD. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Stepwise Exposure of Staphylococcus aureus to Pleuromutilins Is Associated with Stepwise Acquisition of Mutations in rplC and Minimally Affects Susceptibility to Retapamulin▿

    Gentry, Daniel R.; Rittenhouse, Stephen F.; McCloskey, Lynn; Holmes, David J.

    2007-01-01

    To assess their effects on susceptibility to retapamulin in Staphylococcus aureus, first-, second-, and third-step mutants with elevated MICs to tiamulin and other investigational pleuromutilin compounds were isolated and characterized through exposure to high drug concentrations. All first- and second-step mutations were in rplC, encoding ribosomal protein L3. Most third-step mutants acquired a third mutation in rplC. While first- and second-step mutations did cause an elevation in tiamulin and retapamulin MICs, a significant decrease in activity was not seen until a third mutation was acquired. All third-step mutants exhibited severe growth defects, and faster-growing variants arose at a high frequency from most isolates. These faster-growing variants were found to be more susceptible to pleuromutilins. In the case of a mutant with three alterations in rplC, the fast-growing variants acquired an additional mutation in rplC. In the case of fast-growing variants of isolates with two mutations in rplC and at least one mutation at an unmapped locus, one of the two rplC mutations reverted to wild type. These data indicate that mutations in rplC that lead to pleuromutilin resistance have a direct, negative effect on fitness. While reduction in activity of retapamulin against S. aureus can be seen through mutations in rplC, it is likely that target-specific resistance to retapamulin will be slow to emerge due to the need for three mutations for a significant effect on activity and the fitness cost of each mutational step. PMID:17404009

  20. Phenotypic and molecular genetic analysis of Pyruvate Kinase ...

    Jaouani Mouna

    2015-09-26

    Sep 26, 2015 ... to several mutations at the Pyruvate Kinase gene (PKLR) located on chromosome .... Tunisians (Fig. 2) [21]. The screening of whole PKLR gene revealed the presence of ..... newborns: the pitfalls of diagnosis. J Pediatr 2007 ...

  1. The Arabidopsis thaliana lectin receptor kinase LecRK-I.9 is required for full resistance to Pseudomonas syringae and affects jasmonate signalling.

    Balagué, Claudine; Gouget, Anne; Bouchez, Olivier; Souriac, Camille; Haget, Nathalie; Boutet-Mercey, Stéphanie; Govers, Francine; Roby, Dominique; Canut, Hervé

    2017-09-01

    On microbial attack, plants can detect invaders and activate plant innate immunity. For the detection of pathogen molecules or cell wall damage, plants employ receptors that trigger the activation of defence responses. Cell surface proteins that belong to large families of lectin receptor kinases are candidates to function as immune receptors. Here, the function of LecRK-I.9 (At5g60300), a legume-type lectin receptor kinase involved in cell wall-plasma membrane contacts and in extracellular ATP (eATP) perception, was studied through biochemical, gene expression and reverse genetics approaches. In Arabidopsis thaliana, LecRK-I.9 expression is rapidly, highly and locally induced on inoculation with avirulent strains of Pseudomonas syringae pv. tomato (Pst). Two allelic lecrk-I.9 knock-out mutants showed decreased resistance to Pst. Conversely, over-expression of LecRK-I.9 led to increased resistance to Pst. The analysis of defence gene expression suggests an alteration of both the salicylic acid (SA) and jasmonic acid (JA) signalling pathways. In particular, LecRK-I.9 expression during plant-pathogen interaction was dependent on COI1 (CORONATINE INSENSITIVE 1) and JAR1 (JASMONATE RESISTANT 1) components, and JA-responsive transcription factors (TFs) showed altered levels of expression in plants over-expressing LecRK-I.9. A similar misregulation of these TFs was obtained by JA treatment. This study identified LecRK-I.9 as necessary for full resistance to Pst and demonstrated its involvement in the control of defence against pathogens through a regulation of JA signalling components. The role of LecRK-I.9 is discussed with regard to the potential molecular mechanisms linking JA signalling to cell wall damage and/or eATP perception. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  2. Methamphetamine-induced short-term increase and long-term decrease in spatial working memory affects protein Kinase M zeta (PKMζ), dopamine, and glutamate receptors.

    Braren, Stephen H; Drapala, Damian; Tulloch, Ingrid K; Serrano, Peter A

    2014-01-01

    Methamphetamine (MA) is a toxic, addictive drug shown to modulate learning and memory, yet the neural mechanisms are not fully understood. We investigated the effects of 2 weekly injections of MA (30 mg/kg) on working memory using the radial 8-arm maze (RAM) across 5 weeks in adolescent-age mice. MA-treated mice show a significant improvement in working memory performance 1 week following the first MA injection compared to saline-injected controls. Following 5 weeks of MA abstinence mice were re-trained on a reference and working memory version of the RAM to assess cognitive flexibility. MA-treated mice show significantly more working memory errors without effects on reference memory performance. The hippocampus and dorsal striatum were assessed for expression of glutamate receptors subunits, GluA2 and GluN2B; dopamine markers, dopamine 1 receptor (D1), dopamine transporter (DAT) and tyrosine hydroxylase (TH); and memory markers, protein kinase M zeta (PKMζ) and protein kinase C zeta (PKCζ). Within the hippocampus, PKMζ and GluA2 are both significantly reduced after MA supporting the poor memory performance. Additionally, a significant increase in GluN2B and decrease in D1 identifies dysregulated synaptic function. In the striatum, MA treatment increased cytosolic DAT and TH levels associated with dopamine hyperfunction. MA treatment significantly reduced GluN2B while increasing both PKMζ and PKCζ within the striatum. We discuss the potential role of PKMζ/PKCζ in modulating dopamine and glutamate receptors after MA treatment. These results identify potential underlying mechanisms for working memory deficits induced by MA.

  3. Methamphetamine-induced short-term increase and long-term decrease in spatial working memory affects Protein Kinase M zeta (PKMζ, dopamine, and glutamate receptors

    Stephen H Braren

    2014-12-01

    Full Text Available Methamphetamine (MA is a toxic, addictive drug shown to modulate learning and memory, yet the neural mechanisms are not fully understood. We investigated the effects of 2 weekly injections of MA (30 mg/kg on working memory using the radial 8-arm maze (RAM across 5 weeks in adolescent-age mice. MA-treated mice show a significant improvement in working memory performance 1 week following the first MA injection compared to saline-injected controls. Following 5 weeks of MA abstinence mice were re-trained on a reference and working memory version of the RAM to assess cognitive flexibility. MA-treated mice show significantly more working memory errors without effects on reference memory performance. The hippocampus and dorsal striatum were assessed for expression of glutamate receptors subunits, GluA2 and GluN2B; dopamine markers, dopamine 1 receptor (D1, dopamine transporter (DAT and tyrosine hydroxylase (TH; and memory markers, protein kinase M zeta (PKMζ and protein kinase C zeta (PKCζ. Within the hippocampus, PKMζ and GluA2 are both significantly reduced after MA supporting the poor memory performance. Additionally, a significant increase in GluN2B and decrease in D1 identifies dysregulated synaptic function. In the striatum, MA treatment increased cytosolic DAT and TH levels associated with dopamine hyperfunction. MA treatment significantly reduced GluN2B while increasing both PKMζ and PKCζ within the striatum. We discuss the potential role of PKMζ/PKCζ in modulating dopamine and glutamate receptors after MA treatment. These results identify potential underlying mechanisms for working memory deficits induced by MA.

  4. Towards a Molecular Understanding of the Link between Imatinib Resistance and Kinase Conformational Dynamics.

    Silvia Lovera

    2015-11-01

    Full Text Available Due to its inhibition of the Abl kinase domain in the BCR-ABL fusion protein, imatinib is strikingly effective in the initial stage of chronic myeloid leukemia with more than 90% of the patients showing complete remission. However, as in the case of most targeted anti-cancer therapies, the emergence of drug resistance is a serious concern. Several drug-resistant mutations affecting the catalytic domain of Abl and other tyrosine kinases are now known. But, despite their importance and the adverse effect that they have on the prognosis of the cancer patients harboring them, the molecular mechanism of these mutations is still debated. Here by using long molecular dynamics simulations and large-scale free energy calculations complemented by in vitro mutagenesis and microcalorimetry experiments, we model the effect of several widespread drug-resistant mutations of Abl. By comparing the conformational free energy landscape of the mutants with those of the wild-type tyrosine kinases we clarify their mode of action. It involves significant and complex changes in the inactive-to-active dynamics and entropy/enthalpy balance of two functional elements: the activation-loop and the conserved DFG motif. What is more the T315I gatekeeper mutant has a significant impact on the binding mechanism itself and on the binding kinetics.

  5. Missense mutation Lys18Asn in dystrophin that triggers X-linked dilated cardiomyopathy decreases protein stability, increases protein unfolding, and perturbs protein structure, but does not affect protein function.

    Surinder M Singh

    Full Text Available Genetic mutations in a vital muscle protein dystrophin trigger X-linked dilated cardiomyopathy (XLDCM. However, disease mechanisms at the fundamental protein level are not understood. Such molecular knowledge is essential for developing therapies for XLDCM. Our main objective is to understand the effect of disease-causing mutations on the structure and function of dystrophin. This study is on a missense mutation K18N. The K18N mutation occurs in the N-terminal actin binding domain (N-ABD. We created and expressed the wild-type (WT N-ABD and its K18N mutant, and purified to homogeneity. Reversible folding experiments demonstrated that both mutant and WT did not aggregate upon refolding. Mutation did not affect the protein's overall secondary structure, as indicated by no changes in circular dichroism of the protein. However, the mutant is thermodynamically less stable than the WT (denaturant melts, and unfolds faster than the WT (stopped-flow kinetics. Despite having global secondary structure similar to that of the WT, mutant showed significant local structural changes at many amino acids when compared with the WT (heteronuclear NMR experiments. These structural changes indicate that the effect of mutation is propagated over long distances in the protein structure. Contrary to these structural and stability changes, the mutant had no significant effect on the actin-binding function as evident from co-sedimentation and depolymerization assays. These results summarize that the K18N mutation decreases thermodynamic stability, accelerates unfolding, perturbs protein structure, but does not affect the function. Therefore, K18N is a stability defect rather than a functional defect. Decrease in stability and increase in unfolding decrease the net population of dystrophin molecules available for function, which might trigger XLDCM. Consistently, XLDCM patients have decreased levels of dystrophin in cardiac muscle.

  6. LRRK2 Kinase Activity and Biology are Not Uniformly Predicted by its Autophosphorylation and Cellular Phosphorylation Site Status

    April eReynolds

    2014-06-01

    Full Text Available Missense mutations in the Leucine Rich Repeat protein Kinase 2 (LRRK2 gene are the most common genetic predisposition to develop Parkinson’s disease (PD LRRK2 is a large multi-domain phosphoprotein with a GTPase domain and a serine/threonine protein kinase domain whose activity is implicated in neuronal toxicity; however the precise mechanism is unknown. LRRK2 autophosphorylates on several serine/threonine residues across the enzyme and is found constitutively phosphorylated on Ser910, Ser935, Ser955 and Ser973, which are proposed to be regulated by upstream kinases. Here we investigate the phosphoregulation at these sites by analyzing the effects of disease-associated mutations Arg1441Cys, Arg1441Gly, Ala1442Pro, Tyr1699Cys, Ile2012Thr, Gly2019Ser, and Ile2020Thr. We also studied alanine substitutions of phosphosite serines 910, 935, 955 and 973 and specific LRRK2 inhibition on autophosphorylation of LRRK2 Ser1292, Thr1491, Thr2483 and phosphorylation at the cellular sites. We found that mutants in the Roc-COR domains, including Arg1441Cys, Arg1441His, Ala1442Pro and Tyr1699Cys, can positively enhance LRRK2 kinase activity while concomitantly inducing the dephosphorylation of the cellular sites. Mutation of the cellular sites individually did not affect LRRK2 intrinsic kinase activity; however, Ser910/935/955/973Ala mutations trended toward increased kinase activity of LRRK2. Increased cAMP levels did not lead to increased LRRK2 cellular site phosphorylation, 14-3-3 binding or kinase activity. In cells, inhibition of LRRK2 kinase activity leads to dephosphorylation of Ser1292 by Calyculin A and okadaic acid sensitive phosphatases, while the cellular sites are dephosphorylated by Calyculin A sensitive phosphatases. These findings indicate that comparative analysis of both Ser1292 and Ser910/935/955/973 phosphorylation sites will provide important and distinct measures of LRRK2 kinase and biological activity in vitro and in vivo.

  7. THE THN MUTATION OF SCHIZOPHYLLUM-COMMUNE, WHICH SUPPRESSES FORMATION OF AERIAL HYPHAE, AFFECTS EXPRESSION OF THE SC3 HYDROPHOBIN GENE

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SPRINGER, J

    1991-01-01

    The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents

  8. Agents that affect cAMP levels or protein kinase A activity modulate memory consolidation when injected into rat hippocampus but not amygdala

    L. Bevilaqua

    1997-08-01

    Full Text Available Male Wistar rats were trained in one-trial step-down inhibitory avoidance using a 0.4-mA footshock. At various times after training (0, 1.5, 3, 6 and 9 h for the animals implanted into the CA1 region of the hippocampus; 0 and 3 h for those implanted into the amygdala, these animals received microinfusions of SKF38393 (7.5 µg/side, SCH23390 (0.5 µg/side, norepinephrine (0.3 µg/side, timolol (0.3 µg/side, 8-OH-DPAT (2.5 µg/side, NAN-190 (2.5 µg/side, forskolin (0.5 µg/side, KT5720 (0.5 µg/side or 8-Br-cAMP (1.25 µg/side. Rats were tested for retention 24 h after training. When given into the hippocampus 0 h post-training, norepinephrine enhanced memory whereas KT5720 was amnestic. When given 1.5 h after training, all treatments were ineffective. When given 3 or 6 h post-training, 8-Br-cAMP, forskolin, SKF38393, norepinephrine and NAN-190 caused memory facilitation, while KT5720, SCH23390, timolol and 8-OH-DPAT caused retrograde amnesia. Again, at 9 h after training, all treatments were ineffective. When given into the amygdala, norepinephrine caused retrograde facilitation at 0 h after training. The other drugs infused into the amygdala did not cause any significant effect. These data suggest that in the hippocampus, but not in the amygdala, a cAMP/protein kinase A pathway is involved in memory consolidation at 3 and 6 h after training, which is regulated by D1, ß, and 5HT1A receptors. This correlates with data on increased post-training cAMP levels and a dual peak of protein kinase A activity and CREB-P levels (at 0 and 3-6 h in rat hippocampus after training in this task. These results suggest that the hippocampus, but not the amygdala, is involved in long-term storage of step-down inhibitory avoidance in the rat.

  9. The p.A382T TARDBP gene mutation in Sardinian patients affected by Parkinson’s disease and other degenerative parkinsonisms

    Cannas, Antonino; Borghero, Giuseppe; Floris, Gian Luca; Solla, Paolo; Chiò, Adriano; Traynor, Bryan J.; Calvo, Andrea; Restagno, Gabriella; Majounie, Elisa; Costantino, Emanuela; Piras, Valeria; Lavra, Loredana; Pani, Carla; Orofino, Gianni; Di Stefano, Francesca; Tacconi, Paolo; Mascia, Marcello Mario; Muroni, Antonella; Murru, Maria Rita; Tranquilli, Stefania; Corongiu, Daniela; Rolesu, Marcella; Cuccu, Stefania; Marrosu, Francesco; Marrosu, Maria Giovanna

    2013-01-01

    Background Based on our previous finding of the p.A382T founder mutation in ALS patients with concomitant parkinsonism in the Sardinian population, we hypothesized that the same variant may underlie PD and/or other forms of degenerative parkinsonism on this Mediterranean island. Design We screened a cohort of 611 patients with PD (544 cases) and other forms of degenerative parkinsonism (67 cases), and 604 unrelated controls for the c.1144G>A (p.A382T) missense mutation of the TARDBP gene. Results The p.A382T mutation was identified in 9 patients with parkinsonism. Of these, 5 (0.9% of PD patients) presented a typical PD (2 with familiar forms), while 4 patients (6.0% of all other forms of parkinsonism) presented a peculiar clinical presentation quite different from classical atypical parkinsonism with an overlap of extrapyramidal-pyramidal-cognitive clinical signs. The mutation was found in 8 Sardinian controls (1.3%) consistent with a founder mutation in the island population. Conclusions Our findings suggest that the clinical presentation of the p.A382T TARDBP gene mutation may include forms of parkinsonism in which the extrapyramidal signs are the crucial core of the disease at onset. These forms can present PSP or CBD-like clinical signs, with bulbar and/or extrabulbar pyramidal signs and cognitive impairment. No evidence of association has been found between TARDBP gene mutation and typical PD. PMID:23546887

  10. A novel mutation affecting the arginine-137 residue of AVPR2 in dizygous twins leads to nephrogenic diabetes insipidus and attenuated urine exosome aquaporin-2

    Hinrichs, Gitte R; Hansen, Louise H; Nielsen, Maria R

    2016-01-01

    Mutations in the vasopressin V2 receptor gene AVPR2 may cause X-linked nephrogenic diabetes insipidus by defective apical insertion of aquaporin-2 in the renal collecting duct principal cell. Substitution mutations with exchange of arginine at codon 137 can cause nephrogenic syndrome...... of inappropriate antidiuresis or congenital X-linked nephrogenic diabetes insipidus. We present a novel mutation in codon 137 within AVPR2 with substitution of glycine for arginine in male dizygotic twins. Nephrogenic diabetes insipidus was demonstrated by water deprivation test and resistance to vasopressin...

  11. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Timmins, Amy; de Visser, Sam P.

    2017-01-01

    Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM) study on wildtype and mutant structures. In a previous study (Timmins et al., 2017) we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD) study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter. PMID:29170737

  12. Structural investigation of a C-terminal EphA2 receptor mutant: Does mutation affect the structure and interaction properties of the Sam domain?

    Mercurio, Flavia A; Costantini, Susan; Di Natale, Concetta; Pirone, Luciano; Guariniello, Stefano; Scognamiglio, Pasqualina L; Marasco, Daniela; Pedone, Emilia M; Leone, Marilisa

    2017-09-01

    Ephrin A2 receptor (EphA2) plays a key role in cancer, it is up-regulated in several types of tumors and the process of ligand-induced receptor endocytosis, followed by degradation, is considered as a potential path to diminish tumor malignancy. Protein modulators of this mechanism are recruited at the cytosolic Sterile alpha motif (Sam) domain of EphA2 (EphA2-Sam) through heterotypic Sam-Sam associations. These interactions engage the C-terminal helix of EphA2 and close loop regions (the so called End Helix side). In addition, several studies report on destabilizing mutations in EphA2 related to cataract formation and located in/or close to the Sam domain. Herein, we analyzed from a structural point of view, one of these mutants characterized by the insertion of a novel 39 residue long polypeptide at the C-terminus of EphA2-Sam. A 3D structural model was built by computational methods and revealed partial disorder in the acquired C-terminal tail and a few residues participating in an α-helix and two short β-strands. We investigated by CD and NMR studies the conformational properties in solution of two peptides encompassing the whole C-terminal tail and its predicted helical region, respectively. NMR binding experiments demonstrated that these peptides do not interact relevantly with either EphA2-Sam or its interactor Ship2-Sam. Molecular dynamics (MD) simulations further indicated that the EphA2 mutant could be represented only through a conformational ensemble and that the C-terminal tail should not largely wrap the EphA2-Sam End-Helix interface and affect binding to other Sam domains. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Amy Timmins

    2017-11-01

    Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

  14. FLT3 mutations in canine acute lymphocytic leukemia

    Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L

    2011-01-01

    FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias

  15. Duration of streptozotocin-induced diabetes differentially affects p38-mitogen-activated protein kinase (MAPK phosphorylation in renal and vascular dysfunction

    Gupta Akanksha

    2005-03-01

    Full Text Available Abstract Background In the present study we tested the hypothesis that progression of streptozotocin (STZ-induced diabetes (14-days to 28-days would produce renal and vascular dysfunction that correlate with altered p38- mitogen-activated protein kinase (p38-MAPK phosphorylation in kidneys and thoracic aorta. Methods Male Sprague Dawley rats (350–400 g were randomized into three groups: sham (N = 6, 14-days diabetic (N = 6 and 28-days diabetic rats (N = 6. Diabetes was induced using a single tail vein injection of STZ (60 mg/kg, I.V. on the first day. Rats were monitored for 28 days and food, water intake and plasma glucose levels were noted. At both 14-days and 28-days post diabetes blood samples were collected and kidney cortex, medulla and aorta were harvested from each rat. Results The diabetic rats lost body weight at both 14-days (-10% and 28-days (-13% more significantly as compared to sham (+10% group. Glucose levels were significantly elevated in the diabetic rats at both 14-days and 28-days post-STZ administration. Renal dysfunction as evidenced by renal hypertrophy, increased plasma creatinine concentration and reduced renal blood flow was observed in 14-days and 28-days diabetes. Vascular dysfunction as evidenced by decreased carotid blood flow was observed in 14-days and 28-days diabetes. We observed an up-regulation of inducible nitric oxide synthase (iNOS, prepro endothelin-1 (preproET-1 and phosphorylated p38-MAPK in thoracic aorta and kidney cortex but not in kidney medulla in 28-days diabetes group. Conclusion The study provides evidence that diabetes produces vascular and renal dysfunction with a profound effect on signaling mechanisms at later stage of diabetes.

  16. Oncogenic exon 2 mutations in Mediator subunit MED12 disrupt allosteric activation of cyclin C-CDK8/19.

    Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G

    2018-03-30

    Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.

  17. Conformational Dynamics of the Focal Adhesion Targeting Domain Control Specific Functions of Focal Adhesion Kinase in Cells

    Kadaré, Gress

    2015-01-02

    Focal adhesion (FA) kinase (FAK) regulates cell survival and motility by transducing signals from membrane receptors. The C-terminal FA targeting (FAT) domain of FAK fulfils multiple functions, including recruitment to FAs through paxillin binding. Phosphorylation of FAT on Tyr925 facilitates FA disassembly and connects to the MAPK pathway through Grb2 association, but requires dissociation of the first helix (H1) of the four-helix bundle of FAT. We investigated the importance of H1 opening in cells by comparing the properties of FAK molecules containing wild-type or mutated FAT with impaired or facilitated H1 openings. These mutations did not alter the activation of FAK, but selectively affected its cellular functions, including self-association, Tyr925 phosphorylation, paxillin binding, and FA targeting and turnover. Phosphorylation of Tyr861, located between the kinase and FAT domains, was also enhanced by the mutation that opened the FAT bundle. Similarly phosphorylation of Ser910 by ERK in response to bombesin was increased by FAT opening. Although FAK molecules with the mutation favoring FAT opening were poorly recruited at FAs, they efficiently restored FA turnover and cell shape in FAK-deficient cells. In contrast, the mutation preventing H1 opening markedly impaired FAK function. Our data support the biological importance of conformational dynamics of the FAT domain and its functional interactions with other parts of the molecule.

  18. Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall.

    Xayarath, Bobbi; Yother, Janet

    2007-05-01

    Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions of cps2K, cps2J, or cps2H, which encode a UDP-glucose dehydrogenase necessary for side chain synthesis, the putative Wzx transporter (flippase), and the putative Wzy polymerase, respectively, were obtained only in the presence of suppressor mutations. Most of the suppressor mutations were in cps2E, which encodes the initiating glycosyltransferase for capsule synthesis. The cps2K mutants containing the suppressor mutations produced low levels of high-molecular-weight polymer that was detected only in membrane fractions. cps2K-repaired mutants exhibited only modest increases in capsule production due to the effect of the secondary mutation, but capsule was detectable in both membrane and cell wall fractions. Lethality of the cps2K, cps2J, and cps2H mutations was likely due to sequestration of undecaprenyl-phosphate in the capsule pathway and either preclusion of its turnover for utilization in essential pathways or destabilization of the membrane due to an accumulation of lipid-linked intermediates. The results demonstrate that proper polymer assembly requires not only a functional transporter and polymerase but also complete repeat units. A central role for the initiating glycosyltransferase in controlling capsule synthesis is also suggested.

  19. Key clinical features to identify girls with CDKL5 mutations.

    Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydeé; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothée; Afenjar, Alexandra; Rio, Marlène; Héron, Delphine; N'guyen Morel, Marie Ange; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry

    2008-10-01

    Mutations in the human X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of CDKL5-associated encephalopathy. We screened the entire coding region of CDKL5 for mutations in 183 females with encephalopathy with early seizures by denaturing high liquid performance chromatography and direct sequencing, and we identified in 20 unrelated girls, 18 different mutations including 7 novel mutations. These mutations were identified in eight patients with encephalopathy with RTT-like features, five with infantile spasms and seven with encephalopathy with refractory epilepsy. Early epilepsy with normal interictal EEG and severe hypotonia are the key clinical features in identifying patients likely to have CDKL5 mutations. Our study also indicates that these patients clearly exhibit some RTT features such as deceleration of head growth, stereotypies and hand apraxia and that these RTT features become more evident in older and ambulatory patients. However, some RTT signs are clearly absent such as the so called RTT disease profile (period of nearly normal development followed by regression with loss of acquired fine finger skill in early childhood and characteristic intensive eye communication) and the characteristic evolution of the RTT electroencephalogram. Interestingly, in addition to the overall stereotypical symptomatology (age of onset and evolution of the disease) resulting from CDKL5 mutations, atypical forms of CDKL5-related conditions have also been observed. Our data suggest that phenotypic heterogeneity does not correlate with the nature or the position of the mutations or with the pattern of X-chromosome inactivation, but most probably with the functional transcriptional and/or translational consequences of CDKL5

  20. Modifications on the hydrogen bond network by mutations of Escherichia coli copper efflux oxidase affect the process of proton transfer to dioxygen leading to alterations of enzymatic activities

    Kajikawa, Takao; Kataoka, Kunishige [Graduate School of Natural Science and Technology, Kanazawa University, Kakuma, Kanazawa 920-1192 (Japan); Sakurai, Takeshi, E-mail: tsakurai@se.kanazawa-u.ac.jp [Graduate School of Natural Science and Technology, Kanazawa University, Kakuma, Kanazawa 920-1192 (Japan)

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer Proton transfer pathway to dioxygen in CueO was identified. Black-Right-Pointing-Pointer Glu506 is the key amino acid to transport proton. Black-Right-Pointing-Pointer The Ala mutation at Glu506 formed a compensatory proton transfer pathway. Black-Right-Pointing-Pointer The Ile mutation at Glu506 shut down the hydrogen bond network. -- Abstract: CueO has a branched hydrogen bond network leading from the exterior of the protein molecule to the trinuclear copper center. This network transports protons in the four-electron reduction of dioxygen. We replaced the acidic Glu506 and Asp507 residues with the charged and uncharged amino acid residues. Peculiar changes in the enzyme activity of the mutants relative to the native enzyme indicate that an acidic amino acid residue at position 506 is essential for effective proton transport. The Ala mutation resulted in the formation of a compensatory hydrogen bond network with one or two extra water molecules. On the other hand, the Ile mutation resulted in the complete shutdown of the hydrogen bond network leading to loss of enzymatic activities of CueO. In contrast, the hydrogen bond network without the proton transport function was constructed by the Gln mutation. These results exerted on the hydrogen bond network in CueO are discussed in comparison with proton transfers in cytochrome oxidase.

  1. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  2. A novel TNNI2 mutation causes Freeman-Sheldon syndrome in a Chinese family with an affected adult with only facial contractures.

    Li, Xuefu; Jiang, Miao; Han, Weitian; Zhao, Ning; Liu, Wei; Sui, Yu; Lu, Yongping; Li, Jianxin

    2013-09-25

    Distal arthrogryposes (DAs), a clinically and genetically heterogeneous group of disorders characterized by congenital contractures with predominant involvement of the hands and feet, can be classified into at least 12 different forms. These autosomal dominant disorders are of variable expressivity and reduced penetrance. Mutations in sarcomeric protein genes, including troponin I2 (TNNI2), troponin T3 (TNNT3), tropomyosin 2 (TPM2), embryonic myosin heavy chain 3 (MYH3), and myosin binding protein C1 (MYBPC1), have been identified in distal arthrogryposis type 1 (DA1, MIM 108120), type 2B (DA2B, MIM 601680) and type 2A (DA2A)/Freeman-Sheldon syndrome (FSS, MIM 193700). However, mutations causing FSS have only been reported in MYH3. Herein we describe a Chinese DA family whose members meet classical strict criteria for FSS, as well as one member of the family who has isolated facial features consistent with FSS. No disease-causing mutation was found in MYH3. Segregation of microsatellite markers flanking the TNNI2 and TNNT3 genes at 11p15.5 was compatible with linkage. Subsequent sequencing of TNNI2 revealed a novel mutation, c.A493T (p.I165F), located in the C-terminal region, which is critical for proper protein function. This mutation was found to cosegregate with the FSS phenotype in this family, and assessment using SIFT and PolyPhen-2 predicted a damaging effect. To the best of our knowledge, we report the first TNNI2 mutation in classical FSS and describe an atypical adult FSS case with only facial contractures resulting from somatic mosaicism. We infer that DA1, DA2B and FSS represent a phenotypic continuum of the same disorder and provide further genetic evidence for this hypothesis. © 2013.

  3. A splice-site mutation affecting the paired box of PAX3 in a three generation family with Waardenburg syndrome type I (WS1).

    Attaie, A; Kim, E; Wilcox, E R; Lalwani, A K

    1997-06-01

    Waardenburg syndrome, an autosomal dominant disorder characterized by sensorineural hearing loss, pigmentary disturbances and other developmental defects, is the most frequent form of congenital deafness in humans. Mutations in the PAX3 gene, a transcription factor expressed during embryonic development, is associated with WS types I and III. Here we report the identification of a novel acceptor splice site mutation (86-2 A-->G) in the paired domain of the human PAX3 gene causing WS type I in a three generation family.

  4. Kidney adysplasia and variable hydronephrosis, a new mutation affecting the odd-skipped related 1 gene in the mouse, causes variable defects in kidney development and hydronephrosis.

    Davisson, Muriel T; Cook, Susan A; Akeson, Ellen C; Liu, Don; Heffner, Caleb; Gudis, Polyxeni; Fairfield, Heather; Murray, Stephen A

    2015-06-15

    Many genes, including odd-skipped related 1 (Osr1), are involved in regulation of mammalian kidney development. We describe here a new recessive mutation (kidney adysplasia and variable hydronephrosis, kavh) in the mouse that leads to downregulation of Osr1 transcript, causing several kidney defects: agenesis, hypoplasia, and hydronephrosis with variable age of onset. The mutation is closely associated with a reciprocal translocation, T(12;17)4Rk, whose Chromosome 12 breakpoint is upstream from Osr1. The kavh/kavh mutant provides a model to study kidney development and test therapies for hydronephrosis. Copyright © 2015 the American Physiological Society.

  5. Fabry Disease: prevalence of affected males and heterozygotes with pathogenic GLA mutations identified by screening renal, cardiac and stroke clinics, 1995-2017.

    Doheny, Dana; Srinivasan, Ram; Pagant, Silvere; Chen, Brenden; Yasuda, Makiko; Desnick, Robert J

    2018-04-01

    Fabry Disease (FD), an X linked lysosomal storage disease due to pathogenic α-galactosidase A ( GLA ) mutations, results in two major subtypes, the early-onset Type 1 'Classic' and the Type 2 'Later-Onset' phenotypes. To identify previously unrecognised patients, investigators screened cardiac, renal and stroke clinics by enzyme assays. However, some screening studies did not perform confirmatory GLA mutation analyses, and many included recently recognised 'benign/likely-benign' variants, thereby inflating prevalence estimates. Online databases were searched for all FD screening studies in high-risk clinics (1995-2017). Studies reporting GLA mutations were re-analysed for pathogenic mutations, sex and phenotype. Phenotype-specific and sex-specific prevalence rates were determined. Of 67 studies, 63 that screened 51363patients (33943M and 17420F) and provided GLA mutations were reanalysed for disease-causing mutations. Of reported GLA mutations, benign variants occurred in 47.9% of males and 74.1% of females. The following were the revised prevalence estimates: among 36820 (23954M and 12866F) haemodialysis screenees, 0.21% males and 0.15% females; among 3074 (2031M and 1043F) renal transplant screenees, 0.25% males and no females; among 5491 (4054M and 1437F) cardiac screenees, 0.94% males and 0.90% females; and among 5978 (3904M and 2074F) stroke screenees, 0.13% males and 0.14% females. Among male and female screenees with pathogenic mutations, the type 1 Classic phenotype was predominant (~60%), except more male cardiac patients (75%) had type 2 Later-Onset phenotype. Compared with previous findings, reanalysis of 63 studies increased the screenee numbers (~3.4-fold), eliminated 20 benign/likely benign variants, and provided more accurate sex-specific and phenotype-specific prevalence estimates, ranging from ~0.13% of stroke to ~0.9% of cardiac male or female screenees. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article

  6. The mvp2 mutation affects the generative transition through the modification of transcriptome pattern, salicylic acid and cytokinin metabolism in Triticum monococcum

    Boldizsár, A.; Vaňková, Radomíra; Novák, A.; Kalapos, S.; Gulyás, Z.; Pál, M.; Floková, Kristýna; Janda, T.; Galiba, G.; Kocsy, G.

    2016-01-01

    Roč. 202, SEP 1 (2016), s. 21-33 ISSN 0176-1617 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Cytokinin * mvp2 mutation * Triticum monococcum Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.121, year: 2016

  7. Recurrent De Novo Mutations Affecting Residue Arg1 38 of Pyrroline-5-Carboxylate Synthase Cause a Progeroid Form of Autosomal-Dominant Cutis Laxa

    Fischer-Zirnsak, Björn; Escande-Beillard, Nathalie; Ganesh, Jaya; Tan, Yu Xuan; Al Bughaili, Mohammed; Lin, Angela E.; Sahai, Inderneel; Bahena, Paulina; Reichert, Sara L.; Loh, Abigail; Wright, Graham D.; Liu, Jaron; Rahikkala, Elisa; Pivnick, Eniko K.; Choudhri, Asim F.; Krüger, Ulrike; Zemojtel, Tomasz; van Ravenswaaij-Arts, Conny; Mostafavi, Roya; Stolte-Dijkstra, Irene; Symoens, Sofie; Pajunen, Leila; Al-Gazali, Lihadh; Meierhofer, David; Robinson, Peter N.; Mundlos, Stefan; Villarroel, Camilo E.; Byers, Peter; Masri, Amira; Robertson, Stephen P.; Schwarze, Ulrike; Callewaert, Bert; Reversade, Bruno; Kornak, Uwe

    2015-01-01

    Progeroid disorders overlapping with De Barsy syndrome (DBS) are collectively denoted as autosomal-recessive cutis laxa type 3 (ARCL3). They are caused by biallelic mutations in PYCR1 or ALDH18A1, encoding pyrroline-5-carboxylate reductase 1 and pyrroline-5-carboxylate synthase (P5CS), respectively,

  8. Mutations within the LINC-HELLP non-coding RNA differentially bind ribosomal and RNA splicing complexes and negatively affect trophoblast differentiation

    van Dijk, M.; Visser, A.; Buabeng, K.M.L.; Poutsma, A.; van der Schors, R.C.; Oudejans, C.B.M.

    2015-01-01

    LINC-HELLP, showing chromosomal linkage with the pregnancy-specific HELLP syndrome in Dutch families, reduces differentiation from a proliferative to an invasive phenotype of first-trimester extravillous trophoblasts. Here we show that mutations in LINC-HELLP identified in HELLP families negatively

  9. Genotype-Phenotype Correlation in NF1: Evidence for a More Severe Phenotype Associated with Missense Mutations Affecting NF1 Codons 844–848

    Koczkowska, M. (Magdalena); Chen, Y. (Yunjia); Callens, T. (Tom); Gomes, A. (Alicia); Sharp, A. (Angela); Johnson, S. (Sherrell); Hsiao, M.-C. (Meng-Chang); Chen, Z. (Zhenbin); Balasubramanian, M. (Meena); Barnett, C.P. (Christopher P.); Becker, T.A. (Troy A.); Ben-Shachar, S. (Shay); D.R. Bertola (Débora Romeo); J.O. Blakeley (Jaishri O.); Burkitt-Wright, E.M.M. (Emma M.M.); Callaway, A. (Alison); Crenshaw, M. (Melissa); Cunha, K.S. (Karin S.); Cunningham, M. (Mitch); M.D. D'Agostino (Maria Daniela); K. Dahan (Karin); De Luca, A. (Alessandro); A. Destrée (Anne); Dhamija, R. (Radhika); Eoli, M. (Marica); Evans, D.G.R. (D. Gareth R.); Galvin-Parton, P. (Patricia); George-Abraham, J.K. (Jaya K.); K.W. Gripp (Karen); Guevara-Campos, J. (Jose); Hanchard, N.A. (Neil A.); Hernández-Chico, C. (Concepcion); Immken, L. (LaDonna); S. Janssens (Sandra); K.J. Jones (Kristi); Keena, B.A. (Beth A.); Kochhar, A. (Aaina); Liebelt, J. (Jan); Martir-Negron, A. (Arelis); Mahoney, M.J. (Maurice J.); I. Maystadt (Isabelle); McDougall, C. (Carey); M. McEntagart (Meriel); N.J. Mendelsohn; Miller, D.T. (David T.); G. Mortier (Geert); J. Morton (Jenny); Pappas, J. (John); S.R. Plotkin (Scott R.); Pond, D. (Dinel); Rosenbaum, K. (Kenneth); Rubin, K. (Karol); Russell, L. (Laura); Rutledge, L.S. (Lane S.); Saletti, V. (Veronica); Schonberg, R. (Rhonda); Schreiber, A. (Allison); Seidel, M. (Meredith); Siqveland, E. (Elizabeth); D.W. Stockton (David); Trevisson, E. (Eva); N.J. Ullrich (Nicole J.); M. Upadhyaya (Meena); A.S. Thornton (Andrew); H. Verhelst (H.); M.R. Wallace (Margaret); Yap, Y.-S. (Yoon-Sim); Zackai, E. (Elaine); Zonana, J. (Jonathan); Zurcher, V. (Vickie); K. Claes (Kathleen); Martin, Y. (Yolanda); B. Korf (Bruce); E. Legius (Eric); L.M. Messiaen (Ludwine)

    2018-01-01

    textabstractNeurofibromatosis type 1 (NF1), a common genetic disorder with a birth incidence of 1:2,000–3,000, is characterized by a highly variable clinical presentation. To date, only two clinically relevant intragenic genotype-phenotype correlations have been reported for NF1 missense mutations

  10. A new LH receptor splice mutation responsible for male hypogonadism with subnormal sperm production in the propositus, and infertility with regular cycles in an affected sister

    M.W.P. Bruysters (Martijn); S. Christin-Maitre (Sophie); M. Verhoef-Post (Miriam); C. Sultan; J. Auger; I. Faugeron; L. Larue; S. Lumbroso; A.P.N. Themmen (Axel); P. Bouchard (Philippe)

    2008-01-01

    textabstractBACKGROUND: Inactivating LH receptor (LHR) mutations have been described so far in men as well as in women. Phenotypes in men have been variable with in nearly all cases impairment of sex differentiation or azoospermia. We report a milder reproductive phenotype both in a male patient and

  11. Phosphatidylinositol 3-Kinase (PI3K) and phosphatidylinositol 3-kinase-related kinase (PIKK) inhibitors: importance of the morpholine ring

    Andrs, M.; Kobarecny, J.; Jun, D.; Hodný, Zdeněk; Bartek, Jiří; Kuca, K.

    2015-01-01

    Roč. 58, č. 1 (2015), s. 41-71 ISSN 0022-2623 R&D Projects: GA MŠk(CZ) CZ.1.07/2.3.00/30.0044 Grant - others:University Hospital Hradec Kralove(CZ) 00179906; Faculty of Military Health Sciences, University of Defence(CZ) SV/FVZ201402 Institutional support: RVO:68378050 Keywords : DEPENDENT PROTEIN-KINASE * STRAND BREAK REPAIR * SELECTIVE PI3K-BETA INHIBITORS * TELANGIECTASIA MUTATED KINASE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.589, year: 2015

  12. SH2 domains: modulators of nonreceptor tyrosine kinase activity.

    Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan

    2009-12-01

    The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed that the presence of the SH2 domain is frequently required for catalytic activity, suggesting a crucial function stabilizing the active state of many nonreceptor tyrosine kinases. Recently, the structure of the SH2-kinase domain of Fes revealed that the SH2 domain stabilizes the active kinase conformation by direct interactions with the regulatory helix alphaC. Stabilizing interactions between the SH2 and the kinase domains have also been observed in the structures of active Csk and Abl. Interestingly, mutations in the SH2 domain found in human disease can be explained by SH2 domain destabilization or incorrect positioning of the SH2. Here we summarize our understanding of mechanisms that lead to tyrosine kinase activation by direct interactions mediated by the SH2 domain and discuss how mutations in the SH2 domain trigger kinase inactivation.

  13. Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

    Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2010-01-01

    RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

  14. Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations.

    Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela

    2011-03-01

    Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.

  15. Pantethine treatment is effective in recovering the disease phenotype induced by ketogenic diet in a pantothenate kinase-associated neurodegeneration mouse model

    Brunetti, Dario; Dusi, Sabrina; Giordano, Carla; Lamperti, Costanza; Morbin, Michela; Fugnanesi, Valeria; Marchet, Silvia; Fagiolari, Gigliola; Sibon, Ody; Moggio, Maurizio; d'Amati, Giulia; Tiranti, Valeria

    Pantothenate kinase-associated neurodegeneration, caused by mutations in the PANK2 gene, is an autosomal recessive disorder characterized by dystonia, dysarthria, rigidity, pigmentary retinal degeneration and brain iron accumulation. PANK2 encodes the mitochondrial enzyme pantothenate kinase type 2,

  16. SQSTM1 Mutations and Glaucoma.

    Todd E Scheetz

    Full Text Available Glaucoma is the most common cause of irreversible blindness worldwide. One subset of glaucoma, normal tension glaucoma (NTG occurs in the absence of high intraocular pressure. Mutations in two genes, optineurin (OPTN and TANK binding kinase 1 (TBK1, cause familial NTG and have known roles in the catabolic cellular process autophagy. TKB1 encodes a kinase that phosphorylates OPTN, an autophagy receptor, which ultimately activates autophagy. The sequestosome (SQSTM1 gene also encodes an autophagy receptor and also is a target of TBK1 phosphorylation. Consequently, we hypothesized that mutations in SQSTM1 may also cause NTG. We tested this hypothesis by searching for glaucoma-causing mutations in a cohort of NTG patients (n = 308 and matched controls (n = 157 using Sanger sequencing. An additional 1098 population control samples were also analyzed using whole exome sequencing. A total of 17 non-synonymous mutations were detected which were not significantly skewed between cases and controls when analyzed separately, or as a group (p > 0.05. These data suggest that SQSTM1 mutations are not a common cause of NTG.

  17. A Costa Rican family affected with Charcot-Marie-Tooth disease due to the myelin protein zero (MPZ p.Thr124Met mutation shares the Belgian haplotype

    Alejandro Leal

    2014-12-01

    Full Text Available The p.Thr124Met mutation in the myelin protein zero (MPZ causes the Charcot-Marie-Tooth disease type 2J, a peripheral neuropathy with additional symptoms as pupillary alterations and deafness. It was observed in several families around the world originating e. g. from Germany, Belgium, Japan, Italy and North America. Here we report Central American patients originating from a family in Costa Rica carrying this mutation. Clinical, electrophysiological and molecular analysis of patients and controls were performed, including gene and linked markers´ sequencing. Carriers share almost the entire haplotype with two non related Belgian CMT patients. As a result of the haplotype analysis, based on ten markers (seven SNPs, two microsatellites and an intronic polyA stretch, the founder effect hypothesis for this allele migration is suggestive. Rev. Biol. Trop. 62 (4: 1285-1293. Epub 2014 December 01.

  18. Resistance mutations of Pro197, Asp376 and Trp574 in the acetohydroxyacid synthase (AHAS) affect pigments, growths, and competitiveness of Descurainia sophia L.

    Zhang, Yongzhi; Xu, Yufang; Wang, Shipeng; Li, Xuefeng; Zheng, Mingqi

    2017-11-27

    D. Sophia is one of the most problematic weed species infesting winter wheat in China, and has evolved high resistance to tribenuron-methyl. Amino acid substitutions at site of Pro197, Asp376 and Trp574 in acetohydroxyacid synthase (AHAS) were mainly responsible for D. sophia resistance to tribenuron-methyl. In this study, D. sophia plant individually homozygous for specific AHAS mutation (Pro197Leu, Pro197His, Pro197Ser, Pro197Thr, Asp376Glu and Trp574Leu) were generated. In addition, the effects of resistance mutations on pigments, growths and competitiveness of susceptible (S) and resistant (R) plants of D. sophia were investigated. The results indicated the R plants carrying Pro197Leu or Pro197His or Asp376Glu or Trp574Leu displayed stronger competitiveness than S plants. The adverse effects on R plants aggravated with the increase of R plants proportion, which made the R plants against domination the weed community in absent of herbicide selection. Therefore, these resistance mutation have no obvious adverse effects on the pigments (chlorophyll a, chlorophyll b and carotenoid), relative growth rates (RGR), leaf area ratio (LAR) and net assimilation rate (NAR) of R plants.

  19. Mutations in the Atp1p and Atp3p subunits of yeast ATP synthase differentially affect respiration and fermentation in Saccharomyces cerevisiae.

    Francis, Brian R; White, Karen H; Thorsness, Peter E

    2007-04-01

    ATP1-111, a suppressor of the slow-growth phenotype of yme1Delta lacking mitochondrial DNA is due to the substitution of phenylalanine for valine at position 111 of the alpha-subunit of mitochondrial ATP synthase (Atp1p in yeast). The suppressing activity of ATP1-111 requires intact beta (Atp2p) and gamma (Atp3p) subunits of mitochondrial ATP synthase, but not the stator stalk subunits b (Atp4p) and OSCP (Atp5p). ATP1-111 and other similarly suppressing mutations in ATP1 and ATP3 increase the growth rate of wild-type strains lacking mitochondrial DNA. These suppressing mutations decrease the growth rate of yeast containing an intact mitochondrial chromosome on media requiring oxidative phosphorylation, but not when grown on fermentable media. Measurement of chronological aging of yeast in culture reveals that ATP1 and ATP3 suppressor alleles in strains that contain mitochondrial DNA are longer lived than the isogenic wild-type strain. In contrast, the chronological life span of yeast cells lacking mitochondrial DNA and containing these mutations is shorter than that of the isogenic wild-type strain. Spore viability of strains bearing ATP1-111 is reduced compared to wild type, although ATP1-111 enhances the survival of spores that lacked mitochondrial DNA.

  20. Structural changes induced by L50P and I61T single mutations of ubiquitin affect cell cycle progression while impairing its regulatory and degradative functions in Saccharomyces cerevisiae.

    Doshi, Ankita; Sharma, Mrinal; Prabha, C Ratna

    2017-06-01

    Posttranslational conjugation of ubiquitin to proteins either regulates their function directly or concentration through ubiquitination dependent degradation. High degree of conservation of ubiquitin's sequence implies structural and functional importance of the conserved residues. Ubiquitin gene of Saccharomyces cerevisiae was evolved in vitro by us to study the significance of conserved residues. Present study investigates the structural changes in the protein resulting from the single mutations UbS20F, UbA46S, UbL50P, UbI61T and their functional consequences in the SUB60 strain of S. cerevisiae. Expression of UbL50P and UbI61T decreased Cdc28 protein kinase, enhanced Fus3 levels, caused dosage dependent lethality and at sublethal level produced drastic effects on stress tolerance, protein sorting, protein degradation by ubiquitin fusion degradation pathway and by lysosomes. UbS20F and UbA46S produced insignificant effects over the cells. All four mutations of ubiquitin were incorporated into polyubiquitin. However, polyubiquitination with K63 linkage decreased significantly in cells expressing UbL50P and UbI61T. Structural studies on UbL50P and UbI61T revealed distorted structure with greatly reduced α-helical and elevated β-sheet contents, while UbS20F and UbA46S show mild structural alterations. Our results on functional efficacy of ubiquitin in relation to structural integrity may be useful for designing inhibitors to investigate and modulate eukaryotic cellular dynamics. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Phosphoinositide-3-Kinase Signaling in Human Natural Killer Cells: New Insights from Primary Immunodeficiency

    Emily M. Mace

    2018-03-01

    Full Text Available Human natural killer (NK cells play a critical role in the control of viral infections and malignancy. Their importance in human health and disease is illustrated by severe viral infections in patients with primary immunodeficiencies that affect NK cell function and/or development. The recent identification of patients with phosphoinositide-3-kinase (PI3K-signaling pathway mutations that can cause primary immunodeficiency provides valuable insight into the role that PI3K signaling plays in human NK cell maturation and lytic function. There is a rich literature that demonstrates a requirement for PI3K in multiple key aspects of NK cell biology, including development/maturation, homing, priming, and function. Here, I briefly review these previous studies and place them in context with recent findings from the study of primary immunodeficiency patients, particularly those with hyperactivating mutations in PI3Kδ signaling.

  2. Expression and Purification of PI3 Kinase {alpha} and Development of an ATP Depletion and an AlphaScreen PI3 Kinase Activity Assay

    Boldyreff, Brigitte; Rasmussen, Tine L; Jensen, Hans H

    2008-01-01

    Phosphoinositide-3-kinases are important targets for drug development because many proteins in the PI3 kinase signaling pathway are mutated, hyperactivated, or overexpressed in human cancers. Here, the authors coexpressed the human class Ia PI3 kinase p110alpha catalytic domain with an N-terminal....... In parallel, a second assay format using the AlphaScreen technology was optimized to measure PI3 kinase activity. Both assay formats used should be suitable for high-throughput screening for the identification of PI3 kinase inhibitors. (Journal of Biomolecular Screening XXXX:xx-xx)....

  3. Thymidine kinases in archaea

    Clausen, A.R.; Matakos, A.; Sandrini, Michael

    2006-01-01

    Twenty-six fully sequenced archaeal genomes were searched for genes coding for putative deoxyribonucleoside kinases (dNKs). We identified only 5 human-like thymidine kinase 1 genes (TK1s) and none for non-TK1 kinases. Four TK1s were identified in the Euryarchaea and one was found in the Crenarcha...

  4. Recurrent gastrointestinal hemorrhage in treatment with dasatinib in a patient showing SMAD4 mutation with acute lymphoblastic leukemia Philadelphia positive and juvenile polyposis hereditary hemorrhagic telangiectasia syndrome

    Chiara Sartor

    2013-07-01

    Full Text Available We report a case of a patient affected by juvenile polyposis and hereditary hemorrhagic telangiectasia linked to a SMAD4 mutation who developed acute lymphoblastic leukemia positive for the Philadelphia chromosome translocation and with a complex karyotype. During the treatment with the tyrosine kinase inhibitor dasatinib the patient presented recurrent severe gastrointestinal hemorrhages linked to the genetic background and aggravated by thrombocytopenia.

  5. Myosin light chain kinase phosphorylation in tracheal smooth muscle

    Stull, J.T.; Hsu, L.C.; Tansey, M.G.; Kamm, K.E.

    1990-01-01

    Purified myosin light chain kinase from smooth muscle is phosphorylated by cyclic AMP-dependent protein kinase, protein kinase C, and the multifunctional calmodulin-dependent protein kinase II. Because phosphorylation in a specific site (site A) by any one of these kinases desensitizes myosin light chain kinase to activation by Ca2+/calmodulin, kinase phosphorylation could play an important role in regulating smooth muscle contractility. This possibility was investigated in 32 P-labeled bovine tracheal smooth muscle. Treatment of tissues with carbachol, KCl, isoproterenol, or phorbol 12,13-dibutyrate increased the extent of kinase phosphorylation. Six primary phosphopeptides (A-F) of myosin light chain kinase were identified. Site A was phosphorylated to an appreciable extent only with carbachol or KCl, agents which contract tracheal smooth muscle. The extent of site A phosphorylation correlated to increases in the concentration of Ca2+/calmodulin required for activation. These results show that cyclic AMP-dependent protein kinase and protein kinase C do not affect smooth muscle contractility by phosphorylating site A in myosin light chain kinase. It is proposed that phosphorylation of myosin light chain kinase in site A in contracting tracheal smooth muscle may play a role in the reported desensitization of contractile elements to activation by Ca2+

  6. Mediator kinase module and human tumorigenesis.

    Clark, Alison D; Oldenbroek, Marieke; Boyer, Thomas G

    2015-01-01

    Mediator is a conserved multi-subunit signal processor through which regulatory informatiosn conveyed by gene-specific transcription factors is transduced to RNA Polymerase II (Pol II). In humans, MED13, MED12, CDK8 and Cyclin C (CycC) comprise a four-subunit "kinase" module that exists in variable association with a 26-subunit Mediator core. Genetic and biochemical studies have established the Mediator kinase module as a major ingress of developmental and oncogenic signaling through Mediator, and much of its function in signal-dependent gene regulation derives from its resident CDK8 kinase activity. For example, CDK8-targeted substrate phosphorylation impacts transcription factor half-life, Pol II activity and chromatin chemistry and functional status. Recent structural and biochemical studies have revealed a precise network of physical and functional subunit interactions required for proper kinase module activity. Accordingly, pathologic change in this activity through altered expression or mutation of constituent kinase module subunits can have profound consequences for altered signaling and tumor formation. Herein, we review the structural organization, biological function and oncogenic potential of the Mediator kinase module. We focus principally on tumor-associated alterations in kinase module subunits for which mechanistic relationships as opposed to strictly correlative associations are established. These considerations point to an emerging picture of the Mediator kinase module as an oncogenic unit, one in which pathogenic activation/deactivation through component change drives tumor formation through perturbation of signal-dependent gene regulation. It follows that therapeutic strategies to combat CDK8-driven tumors will involve targeted modulation of CDK8 activity or pharmacologic manipulation of dysregulated CDK8-dependent signaling pathways.

  7. cAMP-dependent kinase does not modulate the Slack sodium-activated potassium channel.

    Nuwer, Megan O; Picchione, Kelly E; Bhattacharjee, Arin

    2009-09-01

    The Slack gene encodes a Na(+)-activated K(+) channel and is expressed in many different types of neurons. Like the prokaryotic Ca(2+)-gated K(+) channel MthK, Slack contains two 'regulator of K(+) conductance' (RCK) domains within its carboxy terminal, domains likely involved in Na(+) binding and channel gating. It also contains multiple consensus protein kinase C (PKC) and protein kinase A (PKA) phosphorylation sites and although regulated by protein kinase C (PKC) phosphorylation, modulation by PKA has not been determined. To test if PKA directly regulates Slack, nystatin-perforated patch whole-cell currents were recorded from a human embryonic kidney (HEK-293) cell line stably expressing Slack. Bath application of forskolin, an adenylate cyclase activator, caused a rapid and complete inhibition of Slack currents however, the inactive homolog of forskolin, 1,9-dideoxyforskolin caused a similar effect. In contrast, bath application of 8-bromo-cAMP did not affect the amplitude nor the activation kinetics of Slack currents. In excised inside-out patch recordings, direct application of the PKA catalytic subunit to patches did not affect the open probability of Slack channels nor was open probability affected by direct application of protein phosphatase 2B. Preincubation of cells with the protein kinase A inhibitor KT5720 also did not change current density. Finally, mutating the consensus phosphorylation site located between RCK domain 1 and domain 2 from serine to glutamate did not affect current activation kinetics. We conclude that unlike PKC, phosphorylation by PKA does not acutely modulate the function and gating activation kinetics of Slack channels.

  8. Oncoprotein protein kinase antibody kit

    Karin, Michael [San Diego, CA; Hibi, Masahiko [San Diego, CA; Lin, Anning [La Jolla, CA

    2008-12-23

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  9. Identification of a novel mutation in RIPK4 in a kindred with phenotypic features of Bartsocas-Papas and CHAND syndromes.

    Gollasch, Benjamin; Basmanav, Fitnat Buket; Nanda, Arti; Fritz, Günter; Mahmoudi, Hassnaa; Thiele, Holger; Wehner, Maria; Wolf, Sabrina; Altmüller, Janine; Nürnberg, Peter; Frank, Jorge; Betz, Regina C

    2015-11-01

    Three children from an expanded consanguineous Kuwaiti kindred presented with ankyloblepharon, sparse and curly hair, and hypoplastic nails, suggestive of CHAND syndrome (OMIM 214350) that belongs to the heterogeneous spectrum of ectodermal dysplasias. After exclusion of pathogenic mutations in TP63 we performed homozygosity mapping, followed by exome sequencing of one affected individual. We initially identified three homozygous mutations in the linked region, located in PWP2, MX2 and RIPK4. Recently, mutations in RIPK4 have been reported in Bartsocas-Papas syndrome (OMIM 263650) that shows overlapping clinical symptoms with the phenotype observed in the affected individuals studied here. Subsequent analysis of affected and non-affected family members showed that mutation c.850G>A (p.Glu284Lys) in RIPK4 was in complete segregation with the disease phenotype, in accordance with an autosomal recessive inheritance pattern, thus supporting pathogenicity of this variant. Interestingly, however, our patients did not have cleft lip/palate, a common feature encountered in Bartsocas-Papas syndrome. Whereas in Bartsocas-Papas syndromes missense mutations are usually located within the serin/threonin kinase of RIPK4, the mutation detected in our family resides just outside of the kinase domain, which could explain the milder phenotype. Our data raise the question if CHAND syndrome indeed is a distinct entity. Alternatively, CHAND and Bartsocas-Papas syndrome might be allelic disorders or RIPK4 mutations could confer varying degrees of phenotypic severity, depending on their localization within or outside functionally important domains. Our findings indicate that making an accurate diagnosis based only on the prevailing clinical symptoms is challenging. © 2015 Wiley Periodicals, Inc.

  10. Mutations and chromosomal aberrations

    Kihlman, B.A.

    1977-01-01

    The genetic changes of mutations and chromosomal aberrations are discussed. The consequences of both depend not only on the type of genetic change produced but also on the type of cell that is affected and on the development stage of the organism. (C.F.)

  11. GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.

    Livide, Gabriella; Patriarchi, Tommaso; Amenduni, Mariangela; Amabile, Sonia; Yasui, Dag; Calcagno, Eleonora; Lo Rizzo, Caterina; De Falco, Giulia; Ulivieri, Cristina; Ariani, Francesca; Mari, Francesca; Mencarelli, Maria Antonietta; Hell, Johannes Wilhelm; Renieri, Alessandra; Meloni, Ilaria

    2015-02-01

    Rett syndrome is a monogenic disease due to de novo mutations in either MECP2 or CDKL5 genes. In spite of their involvement in the same disease, a functional interaction between the two genes has not been proven. MeCP2 is a transcriptional regulator; CDKL5 encodes for a kinase protein that might be involved in the regulation of gene expression. Therefore, we hypothesized that mutations affecting the two genes may lead to similar phenotypes by dysregulating the expression of common genes. To test this hypothesis we used induced pluripotent stem (iPS) cells derived from fibroblasts of one Rett patient with a MECP2 mutation (p.Arg306Cys) and two patients with mutations in CDKL5 (p.Gln347Ter and p.Thr288Ile). Expression profiling was performed in CDKL5-mutated cells and genes of interest were confirmed by real-time RT-PCR in both CDKL5- and MECP2-mutated cells. The only major change in gene expression common to MECP2- and CDKL5-mutated cells was for GRID1, encoding for glutamate D1 receptor (GluD1), a member of the δ-family of ionotropic glutamate receptors. GluD1 does not form AMPA or NMDA glutamate receptors. It acts like an adhesion molecule by linking the postsynaptic and presynaptic compartments, preferentially inducing the inhibitory presynaptic differentiation of cortical neurons. Our results demonstrate that GRID1 expression is downregulated in both MECP2- and CDKL5-mutated iPS cells and upregulated in neuronal precursors and mature neurons. These data provide novel insights into disease pathophysiology and identify possible new targets for therapeutic treatment of Rett syndrome.

  12. A cGMP kinase mutant with increased sensitivity to the protein kinase inhibitor peptide PKI(5-24).

    Ruth, P; Kamm, S; Nau, U; Pfeifer, A; Hofmann, F

    1996-01-01

    Synthetic peptides corresponding to the active domain of the heat-stable inhibitor protein PKI are very potent inhibitors of cAMP-dependent protein kinase, but are extremely weak inhibitors of cGMP-dependent protein kinase. In this study, we tried to confer PKI sensitivity to cGMP kinase by site-directed mutagenesis. The molecular requirements for high affinity inhibition by PKI were deduced from the crystal structure of the cAMP kinase/PKI complex. A prominent site of interaction are residues Tyr235 and Phe239 in the catalytic subunit, which from a sandwich-like structure with Phe10 of the PKI(5-24) peptide. To increase the sensitivity for PKI, the cGMP kinase codons at the corresponding sites, Ser555 and Ser559, were changed to Tyr and Phe. The mutant cGMP kinase was stimulated half maximally by cGMP at 3-fold higher concentrations (240 nM) than the wild type (77 nM). Wild type and mutant cGMP kinase did not differ significantly in their Km and Vmax for three different substrate peptides. The PKI(5-24) peptide inhibited phosphotransferase activity of the mutant cGMP kinase with higher potency than that of wild type, with Ki values of 42 +/- .3 microM and 160 +/- .7 microM, respectively. The increased affinity of the mutant cGMP kinase was specific for the PKI(5-24) peptide. Mutation of the essential Phe10 in the PKI(5-24) sequence to an Ala yielded a peptide that inhibited mutant and wild type cGMP kinase with similar potency, with Ki values of 160 +/- 11 and 169 +/- 27 microM, respectively. These results suggest that the mutations Ser555Tyr and Ser559Phe are required, but not sufficient, for high affinity inhibition of cGMP kinase by PKI.

  13. A novel A792D mutation in the CSF1R gene causes hereditary diffuse leukoencephalopathy with axonal spheroids characterized by slow progression

    Sakiho Ueda

    2015-03-01

    Full Text Available Hereditary diffuse leukoencephalopathy with spheroids (HDLS is an autosomal dominant white matter disease that causes adult-onset cognitive impairment. The clinical manifestations are a variable combination of personality and behavioral changes, cognitive decline, parkinsonism, spasticity, and epilepsy. In 2012, mutations in the gene encoding colony stimulating factor 1 receptor (CSF1R were identified as the cause of HDLS. As the numbers of reported mutations are limited, the understanding of whole pathogenesis needs accumulation of disease-causing mutations with detailed clinical descriptions. We describe a Japanese family with autosomal dominant adult-onset cognitive impairment and characteristic white matter lesions. Genetic testing revealed a novel p.A792D mutation in the tyrosine kinase domain of CSF1R in two affected family members. The symptom profile of the present cases mostly matched the previously reported cases, with the notable exceptions of late-onset and long disease duration.

  14. Identification of FASTKD2 compound heterozygous mutations as the underlying cause of autosomal recessive MELAS-like syndrome.

    Yoo, Da Hye; Choi, Young-Chul; Nam, Da Eun; Choi, Sun Seong; Kim, Ji Won; Choi, Byung-Ok; Chung, Ki Wha

    2017-07-01

    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is a condition that affects many parts of the body, particularly the brain and muscles. This study examined a Korean MELAS-like syndrome patient with seizure, stroke-like episode, and optic atrophy. Target sequencing of whole mtDNA and 73 nuclear genes identified compound heterozygous mutations p.R205X and p.L255P in the FASTKD2. Each of his unaffected parents has one of the two mutations, and both mutations were not found in 302 controls. FASTKD2 encodes a FAS-activated serine-threonine (FAST) kinase domain 2 which locates in the mitochondrial inner compartment. A FASTKD2 nonsense mutation was once reported as the cause of a recessive infantile mitochondrial encephalomyopathy. The present case showed relatively mild symptoms with a late onset age, compared to a previous patient with FASTKD2 mutation, implicating an inter-allelic clinical heterogeneity. Because this study is the second report of an autosomal recessive mitochondrial encephalomyopathy patient with a FASTKD2 mutation, it will extend the phenotypic spectrum of the FASTKD2 mutation. Copyright © 2017. Published by Elsevier B.V.

  15. Systematic screening for mutations in the 5{prime}-regulatory region of the human dopamine D{sub 1} receptor (DRD1) gene in patients with schizophrenia and bipolar affective disorder

    Cichon, S.; Noethen, M.M.; Stoeber, G. [Univ. of Bonn (Germany)] [and others

    1996-07-26

    A possible dysregulation of dopaminergic neurotransmission has been implicated in a variety of neuropsychiatric diseases. In the present study we systematically searched for the presence of mutations in the 5{prime}-flanking region of the dopamine D{sub 1} receptor (DRD1) gene. This region has previously been shown to contain a functional promoter. We investigated 119 unrelated individuals (including 36 schizophrenic patients, 38 bipolar affective patients, and 45 healthy controls) using single-strand conformation analysis (SSCA). Eleven overlapping PCR fragments covered 2,189 bp of DNA sequence. We identified six single base substitutions: -2218T/C, -2102C/A, -2030T/C, -1992G/A, -1251G/C, and -800T/C. None of the mutations was found to be located in regions which have important influence on the level of transcriptional activity. Allele frequencies were similar in patients and controls, indicating that genetic variation in the 5{prime}-regulatory region of the DRD1 gene is unlikely to play a frequent, major role in the genetic predisposition to either schizophrenia or bipolar affective disorder. 31 refs., 3 tabs.

  16. Severe fluoropyrimidine toxicity due to novel and rare DPYD missense mutations, deletion and genomic amplification affecting DPD activity and mRNA splicing

    van Kuilenburg, André B P; Meijer, Judith; Maurer, Dirk

    2017-01-01

    Dihydropyrimidine dehydrogenase (DPD) is the initial and rate-limiting enzyme in the catabolism of 5-fluorouracil (5FU). Genetic variations in DPD have emerged as predictive risk factors for severe fluoropyrimidine toxicity. Here, we report novel and rare genetic variants underlying DPD deficiency...... in 9 cancer patients presenting with severe fluoropyrimidine-associated toxicity. All patients possessed a strongly reduced DPD activity, ranging from 9 to 53% of controls. Analysis of the DPD gene (DPYD) showed the presence of 21 variable sites including 4 novel and 4 very rare aberrations: 3 missense...... of exon 4 immediately upstream of the mutated splice-donor site in the process of DPD pre-mRNA splicing. A lethal toxicity in two DPD patients suggests that fluoropyrimidines combined with other therapies such as radiotherapy might be particularly toxic for DPD deficient patients. Our study advocates...

  17. Identification and characterization of dwarf 62, a loss-of-function mutation in DLT/OsGRAS-32 affecting gibberellin metabolism in rice.

    Li, Wenqiang; Wu, Jianguo; Weng, Shili; Zhang, Yujiang; Zhang, Dapeng; Shi, Chunhai

    2010-11-01

    A dwarf mutant, dwarf 62 (d62), was isolated from rice cultivar 93-11 by mutagenesis with γ-rays. Under normal growth conditions, the mutant had multiple abnormal phenotypes, such as dwarfism, wide and dark-green leaf blades, reduced tiller numbers, late and asynchronous heading, short roots, partial male sterility, etc. Genetic analysis indicated that the abnormal phenotypes were controlled by the recessive mutation of a single nuclear gene. Using molecular markers, the D62 gene was fine mapped in 131-kb region at the short arm of chromosome 6. Positional cloning of D62 gene revealed that it was the same locus as DLT/OsGRAS-32, which encodes a member of the GRAS family. In previous studies, the DLT/OsGRAS-32 is confirmed to play positive roles in brassinosteroid (BR) signaling. Sequence analysis showed that the d62 carried a 2-bp deletion in ORF region of D62 gene which led to a loss-of-function mutation. The function of D62 gene was confirmed by complementation experiment. RT-PCR analysis and promoter activity analysis showed that the D62 gene expressed in all tested tissues including roots, stems, leaves and panicles of rice plant. The d62 mutant exhibited decreased activity of α-amylase in endosperm and reduced content of endogenous GA(1). The expression levels of gibberellin (GA) biosynthetic genes including OsCPS1, OsKS1, OsKO1, OsKAO, OsGA20ox2/SD1 and OsGA2ox3 were significantly increased in d62 mutant. Briefly, these results demonstrated that the D62 (DLT/OsGRAS-32) not only participated in the regulation of BR signaling, but also influenced GA metabolism in rice.

  18. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

    Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

    2002-01-01

    DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

  19. JAK and MPL mutations in myeloid malignancies.

    Tefferi, Ayalew

    2008-03-01

    The Janus family of non-receptor tyrosine kinases (JAK1, JAK2, JAK3 and tyrosine kinase 2) transduces signals downstream of type I and II cytokine receptors via signal transducers and activators of transcription (STATs). JAK3 is important in lymphoid and JAK2 in myeloid cell proliferation and differentiation. The thrombopoietin receptor MPL is one of several JAK2 cognate receptors and is essential for myelopoiesis in general and megakaryopoiesis in particular. Germline loss-of-function (LOF) JAK3 and MPL mutations cause severe combined immunodeficiency and congenital amegakaryocytic thrombocytopenia, respectively. Germline gain-of-function (GOF) MPL mutation (MPLS505N) causes familial thrombocytosis. Somatic JAK3 (e.g. JAK3A572V, JAK3V722I, JAK3P132T) and fusion JAK2 (e.g. ETV6-JAK2, PCM1-JAK2, BCR-JAK2) mutations have respectively been described in acute megakaryocytic leukemia and acute leukemia/chronic myeloid malignancies. However, current attention is focused on JAK2 (e.g. JAK2V617F, JAK2 exon 12 mutations) and MPL (e.g. MPLW515L/K/S, MPLS505N) mutations associated with myeloproliferative neoplasms (MPNs). A JAK2 mutation, primarily JAK2V617F, is invariably associated with polycythemia vera (PV). The latter mutation also occurs in the majority of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF). MPL mutational frequency in MPNs is substantially less (<10%). In general, despite a certain degree of genotype - phenotype correlations, the prognostic relevance of harbouring one of these mutations, or their allele burden when present, remains dubious. Regardless, based on the logical assumption that amplified JAK-STAT signalling is central to the pathogenesis of PV, ET and PMF, several anti-JAK2 tyrosine kinase inhibitors have been developed and are currently being tested in humans with these disorders.

  20. Key Clinical Features to Identify Girls with "CDKL5" Mutations

    Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydee; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothee; Afenjar, Alexandra; Rio, Marlene; Heron, Delphine; Morel, Marie Ange N'Guyen; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry

    2008-01-01

    Mutations in the human X-linked cyclin-dependent kinase-like 5 ("CDKL5") gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of…

  1. Screening for calreticulin mutations in a cohort of patients suspected ...

    Background. The discovery of calreticulin (CALR) has shown it to be the second most frequent mutation after the Janus Kinase 2 (JAK2) mutation in myeloproliferative neoplasms (MPNs). Its structure indicates various functions, of which two are to ensure calcium homeostasis and proper folding of other target proteins.

  2. Second-generation inhibitors of Bruton tyrosine kinase

    Jingjing Wu

    2016-09-01

    Full Text Available Abstract Bruton tyrosine kinase (BTK is a critical effector molecule for B cell development and plays a major role in lymphoma genesis. Ibrutinib is the first-generation BTK inhibitor. Ibrutinib has off-target effects on EGFR, ITK, and Tec family kinases, which explains the untoward effects of ibrutinib. Resistance to ibrutinib was also reported. The C481S mutation in the BTK kinase domain was reported to be a major mechanism of resistance to ibrutinib. This review summarizes the clinical development of novel BTK inhibitors, ACP-196 (acalabrutinib, ONO/GS-4059, and BGB-3111.

  3. Janus kinase inhibitors: jackpot or potluck?

    Pavithran Keechilat

    2012-06-01

    Full Text Available The reports of a unique mutation in the Janus kinase-2 gene (JAK2 in polycythemia vera by several independent groups in 2005 quickly spurred the development of the Janus kinase inhibitors. In one of the great victories of translational research in recent times, the first smallmolecule Janus kinase inhibitor ruxolitinib entered a phase I trial in 2007. With the approval of ruxolitinib by the US Federal Drug Administration in November 2011 for high-risk and intermediate-2 risk myelofibrosis, a change in paradigm has occurred in the management of a subset of myeloproliferative neoplasms (MPN: primary myelofibrosis, post-polycythemia vera myelofibrosis, and post-essential thrombocythemia myelofibrosis. Whereas the current evidence for ruxolitinib only covers high-risk and intermediate-2 risk myelofibrosis, inhibitors with greater potency are likely to offer better disease control and survival advantage in patients belonging to these categories, and possibly to the low-risk and intermediate-1 risk categories of MPN as well. But use of the Janus kinase inhibitors also probably has certain disadvantages, such as toxicity, resistance, withdrawal phenomenon, non-reversal of histology, and an implausible goal of disease clone eradication, some of which could offset the gains. In spite of this, Janus kinase inhibitors are here to stay, and for use in more than just myeloproliferative neoplasms.

  4. C. elegans serine-threonine kinase KIN-29 modulates TGFβ signaling and regulates body size formation

    Cohen Stephen

    2005-04-01

    Full Text Available Background In C. elegans there are two well-defined TGFβ-like signaling pathways. The Sma/Mab pathway affects body size morphogenesis, male tail development and spicule formation while the Daf pathway regulates entry into and exit out of the dauer state. To identify additional factors that modulate TGFβ signaling in the Sma/Mab pathway, we have undertaken a genetic screen for small animals and have identified kin-29. Results kin-29 encodes a protein with a cytoplasmic serine-threonine kinase and a novel C-terminal domain. The kinase domain is a distantly related member of the EMK (ELKL motif kinase family, which interacts with microtubules. We show that the serine-threonine kinase domain has in vitro activity. kin-29 mutations result in small animals, but do not affect male tail morphology as do several of the Sma/Mab signal transducers. Adult worms are smaller than the wild-type, but also develop more slowly. Rescue by kin-29 is achieved by expression in neurons or in the hypodermis. Interaction with the dauer pathway is observed in double mutant combinations, which have been seen with Sma/Mab pathway mutants. We show that kin-29 is epistatic to the ligand dbl-1, and lies upstream of the Sma/Mab pathway target gene, lon-1. Conclusion kin-29 is a new modulator of the Sma/Mab pathway. It functions in neurons and in the hypodermis to regulate body size, but does not affect all TGFβ outputs, such as tail morphogenesis.

  5. Effect of starvation, diabetes and insulin on the casein kinase 2 from rat liver cytosol.

    Martos, C; Plana, M; Guasch, M D; Itarte, E

    1985-01-01

    Starvation, diabetes and insulin did not alter the concentration of casein kinases in rat liver cytosol. However, the Km for casein of casein kinase 2 from diabetic rats was about 2-fold lower than that from control animals. Administration of insulin to control rats did not alter this parameter, but increased the Km for casein of casein kinase 2 in diabetic rats. Starvation did not affect the kinetic constants of casein kinases. The effect of diabetes on casein kinase 2 persisted after partia...

  6. Gas stunning with CO2 affected meat color, lipid peroxidation, oxidative stress, and gene expression of mitogen-activated protein kinases, glutathione S-transferases, and Cu/Zn-superoxide dismutase in the skeletal muscles of broilers.

    Xu, Lei; Zhang, Haijun; Yue, Hongyuan; Wu, Shugeng; Yang, Haiming; Wang, Zhiyue; Qi, Guanghai

    2018-01-01

    Meat color and lipid peroxidation are important traits related to meat quality. CO 2 concentration is a critical factor that can affect meat quality in the commercial use of gas stunning (GS). However, the effect and mechanism of CO 2 stunning on meat color and lipid peroxidation during long-term storage remain poorly studied. We aimed to study the effects of GS methods, especially CO 2 concentration, on meat color and meat lipid peroxidation in broilers during long-term storage at 4 °C and to explore the potential mechanism of meat color change via lipid peroxidation and the inner lipid peroxide scavenging system. Eighteen broilers were sacrificed after exposure to one of the following gas mixtures for 90 s: 40% CO 2  + 21% O 2  + 39% N 2 (G40%), 79% CO 2  + 21% O 2 (G79%), or no stunning (0% CO 2 , control). Meat color, serum variables, enzyme activities, and the gene expression of mitogen-activated protein kinase ( MAPK ), nuclear factor-erythroid 2-related factor 2 ( Nrf2 ), glutathione S-transferase ( GST ) and superoxide dismutase ( SOD ) were determined. The concentrations of serum triiodothyronine (T3, P  = 0.03) and the ratio of serum free triiodothyronine/free thyroxine (FT3/FT4, P  meat and the TBARS 3 d in thigh meat ( P  meat ( r  = - 0.63, P  meat and in the thigh meat ( r  = - 0.57, P  = 0.01; and r  = - 0.53, P  = 0.03 respectively). Compared with the control group, Lightness (L*) 1 d ( P =  0.03) and L* 9 d ( P meat of both the G40% and G79% groups. The values of yellowness (b*) 3 d ( P =  0.01), b* 6 d ( P meat were lower in both the G40% and G79% groups than in the control group. In the breast muscle, the mRNA levels of c-Jun N-terminal kinase 2 ( JNK2, P  = 0.03), GSTT1 ( P  = 0.04), and SOD1 ( P  = 0.05) were decreased, and the mRNA levels of JNK1 ( P  = 0.07), Nrf2 ( P  = 0.09), and GSTA3 ( P  = 0.06) were slightly lower in both the G40% and G79% groups

  7. The mutation of carotenoids affects the energy transfer in LH2 light harvesting complexes from Rhodobacter sphaeroides 601 at room temperature

    Liu Weimin; Liu Yuan; Guo Lijun; Xu Chunhe; Qian Shixiong

    2006-01-01

    Energy transfer in two kinds of peripheral antenna complexes LH2 from Rhodobacter sphaeroides 601 was studied by absorption, fluorescence emission, time-resolved fluorescence and femtosecond transient absorption spectroscopy at room temperature. These two complexes are LH2 (RS601) and green carotenoid mutated LH2 (GM309). The obtained results demonstrate that: (a) compared with spheroidenes, which have ten carbon-carbon double bonds in native RS601, carotenoids in GM309 were identified as containing neurosporenes with nine carbon-carbon double bonds, which show a significant blue shift of ∼20 nm in the three absorption peaks because of the higher energy levels of neurosporene than those of spheroidene, (b) the higher energy levels of neurosporene in GM309 induce a lower B800 → B850 energy transfer rate and efficiency as compared to that in RS601 resulting from the relatively higher band gap between the donor of B800 and the bridge of the carotenoids (c) the same lifetime of the B850 excited singlet state is observed in these two LH2 complexes

  8. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  9. Arabidopsis thickvein mutation affects vein thickness and organ vascularization, and resides in a provascular cell-specific spermine synthase involved in vein definition and in polar auxin transport.

    Clay, Nicole K; Nelson, Timothy

    2005-06-01

    Polar auxin transport has been implicated in the induction of vascular tissue and in the definition of vein positions. Leaves treated with chemical inhibitors of polar auxin transport exhibited vascular phenotypes that include increased vein thickness and vascularization. We describe a recessive mutant, thickvein (tkv), which develops thicker veins in leaves and in inflorescence stems. The increased vein thickness is attributable to an increased number of vascular cells. Mutant plants have smaller leaves and shorter inflorescence stems, and this reduction in organ size and height is accompanied by an increase in organ vascularization, which appears to be attributable to an increase in the recruitment of cells into veins. Furthermore, although floral development is normal, auxin transport in the inflorescence stem is significantly reduced in the mutant, suggesting that the defect in auxin transport is responsible for the vascular phenotypes. In the primary root, the veins appear morphologically normal, but root growth in the tkv mutant is hypersensitive to exogenous cytokinin. The tkv mutation was found to reside in the ACL5 gene, which encodes a spermine synthase and whose expression is specific to provascular cells. We propose that ACL5/TKV is involved in vein definition (defining the boundaries between veins and nonvein regions) and in polar auxin transport, and that polyamines are involved in this process.

  10. ERBB4 Mutations that Disrupt the Neuregulin-ErbB4 Pathway Cause Amyotrophic Lateral Sclerosis Type 19

    Takahashi, Yuji; Fukuda, Yoko; Yoshimura, Jun; Toyoda, Atsushi; Kurppa, Kari; Moritoyo, Hiroyoko; Belzil, Veronique V.; Dion, Patrick A.; Higasa, Koichiro; Doi, Koichiro; Ishiura, Hiroyuki; Mitsui, Jun; Date, Hidetoshi; Ahsan, Budrul; Matsukawa, Takashi; Ichikawa, Yaeko; Moritoyo, Takashi; Ikoma, Mayumi; Hashimoto, Tsukasa; Kimura, Fumiharu; Murayama, Shigeo; Onodera, Osamu; Nishizawa, Masatoyo; Yoshida, Mari; Atsuta, Naoki; Sobue, Gen; Fifita, Jennifer A.; Williams, Kelly L.; Blair, Ian P.; Nicholson, Garth A.; Gonzalez-Perez, Paloma; Brown, Robert H.; Nomoto, Masahiro; Elenius, Klaus; Rouleau, Guy A.; Fujiyama, Asao; Morishita, Shinichi; Goto, Jun; Tsuji, Shoji

    2013-01-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurological disorder characterized by the degeneration of motor neurons and typically results in death within 3–5 years from onset. Familial ALS (FALS) comprises 5%–10% of ALS cases, and the identification of genes associated with FALS is indispensable to elucidating the molecular pathogenesis. We identified a Japanese family affected by late-onset, autosomal-dominant ALS in which mutations in genes known to be associated with FALS were excluded. A whole- genome sequencing and parametric linkage analysis under the assumption of an autosomal-dominant mode of inheritance with incomplete penetrance revealed the mutation c.2780G>A (p. Arg927Gln) in ERBB4. An extensive mutational analysis revealed the same mutation in a Canadian individual with familial ALS and a de novo mutation, c.3823C>T (p. Arg1275Trp), in a Japanese simplex case. These amino acid substitutions involve amino acids highly conserved among species, are predicted as probably damaging, and are located within a tyrosine kinase domain (p. Arg927Gln) or a C-terminal domain (p. Arg1275Trp), both of which mediate essential functions of ErbB4 as a receptor tyrosine kinase. Functional analysis revealed that these mutations led to a reduced autophosphorylation of ErbB4 upon neuregulin-1 (NRG-1) stimulation. Clinical presentations of the individuals with mutations were characterized by the involvement of both upper and lower motor neurons, a lack of obvious cognitive dysfunction, and relatively slow progression. This study indicates that disruption of the neuregulin-ErbB4 pathway is involved in the pathogenesis of ALS and potentially paves the way for the development of innovative therapeutic strategies such using NRGs or their agonists to upregulate ErbB4 functions. PMID:24119685

  11. A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV).

    Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey

    2017-01-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.

  12. Systematic reconstruction of autism biology from massive genetic mutation profiles.

    Luo, Weijun; Zhang, Chaolin; Jiang, Yong-Hui; Brouwer, Cory R

    2018-04-01

    Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3',5'-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein-coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity.

  13. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  14. STAT3 mutations correlated with hyper-IgE syndrome lead to ...

    Of all the causes identified for the disease hyper-immunoglobulinemia E syndrome (HIES), a homozygous mutation in tyrosine kinase2 (TYK2) and heterozygous mutations in STAT3 are implicated the defects in Jak/STAT signalling pathway in the pathogenesis of HIES. Mutations of STAT3 have been frequently clinically ...

  15. New contribution on the LRRK2 G2019S mutation associated to ...

    ... generations ago. Conclusion: Our conclusion is that the G2019S mutation of the LRRK2 gene originates 3,840 (95% CI 3,210-5,400) years ago in parkinsonian Moroccan Berbers patients. Key words: Parkinson's disease (PD), Leucine-rich repeat kinase 2 (LRRK2) gene, G2019S mutation, Haplotype, Founding mutation.

  16. A structural systems biology approach for quantifying the systemic consequences of missense mutations in proteins.

    Tammy M K Cheng

    Full Text Available Gauging the systemic effects of non-synonymous single nucleotide polymorphisms (nsSNPs is an important topic in the pursuit of personalized medicine. However, it is a non-trivial task to understand how a change at the protein structure level eventually affects a cell's behavior. This is because complex information at both the protein and pathway level has to be integrated. Given that the idea of integrating both protein and pathway dynamics to estimate the systemic impact of missense mutations in proteins remains predominantly unexplored, we investigate the practicality of such an approach by formulating mathematical models and comparing them with experimental data to study missense mutations. We present two case studies: (1 interpreting systemic perturbation for mutations within the cell cycle control mechanisms (G2 to mitosis transition for yeast; (2 phenotypic classification of neuron-related human diseases associated with mutations within the mitogen-activated protein kinase (MAPK pathway. We show that the application of simplified mathematical models is feasible for understanding the effects of small sequence changes on cellular behavior. Furthermore, we show that the systemic impact of missense mutations can be effectively quantified as a combination of protein stability change and pathway perturbation.

  17. Muscle phosphorylase kinase deficiency

    Preisler, N; Orngreen, M C; Echaniz-Laguna, A

    2012-01-01

    To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD).......To examine metabolism during exercise in 2 patients with muscle phosphorylase kinase (PHK) deficiency and to further define the phenotype of this rare glycogen storage disease (GSD)....

  18. Epidermal growth factor receptor activation in glioblastoma through novel missense mutations in the extracellular domain.

    Jeffrey C Lee

    2006-12-01

    Full Text Available Protein tyrosine kinases are important regulators of cellular homeostasis with tightly controlled catalytic activity. Mutations in kinase-encoding genes can relieve the autoinhibitory constraints on kinase activity, can promote malignant transformation, and appear to be a major determinant of response to kinase inhibitor therapy. Missense mutations in the EGFR kinase domain, for example, have recently been identified in patients who showed clinical responses to EGFR kinase inhibitor therapy.Encouraged by the promising clinical activity of epidermal growth factor receptor (EGFR kinase inhibitors in treating glioblastoma in humans, we have sequenced the complete EGFR coding sequence in glioma tumor samples and cell lines. We identified novel missense mutations in the extracellular domain of EGFR in 13.6% (18/132 of glioblastomas and 12.5% (1/8 of glioblastoma cell lines. These EGFR mutations were associated with increased EGFR gene dosage and conferred anchorage-independent growth and tumorigenicity to NIH-3T3 cells. Cells transformed by expression of these EGFR mutants were sensitive to small-molecule EGFR kinase inhibitors.Our results suggest extracellular missense mutations as a novel mechanism for oncogenic EGFR activation and may help identify patients who can benefit from EGFR kinase inhibitors for treatment of glioblastoma.

  19. Two families with normosmic congenital hypogonadotropic hypogonadism and biallelic mutations in KISS1R (KISS1 receptor: clinical evaluation and molecular characterization of a novel mutation.

    Frédéric Brioude

    Full Text Available CONTEXT: KISS1R mutations have been reported in few patients with normosmic congenital hypogonadotropic hypogonadism (nCHH (OMIM #146110. OBJECTIVE: To describe in detail nCHH patients with biallelic KISS1R mutations belonging to 2 unrelated families, and to functionally characterize a novel KISS1R mutation. RESULTS: An original mutant, p.Tyr313His, was found in the homozygous state in 3 affected kindred (2 females and 1 male from a consanguineous Portuguese family. This mutation, located in the seventh transmembrane domain, affects a highly conserved amino acid, perturbs the conformation of the transmembrane segment, and impairs MAP kinase signaling and intracellular calcium release. In the second family, a French Caucasian male patient with nCHH was found to carry two recurrent mutations in the compound heterozygous state (p.Leu102Pro/Stop399Arg. In this man, pulsatile GnRH (Gonadotropin Releasing Hormone administration restored pulsatile LH (Luteinizing Hormone secretion and testicular hormone secretion. Later, long-term combined gonadotropin therapy induced spermatogenesis, enabling 3 successive pregnancies that resulted in 2 miscarriages and the birth of a healthy boy. CONCLUSION: We show that a novel loss-of-function mutation (p.Tyr313His in the KISS1R gene can cause familial nCHH, revealing the crucial role of this amino acid in KISS1R function. The observed restoration of gonadotropin secretion by exogenous GnRH administration further supports, in humans, the hypothalamic origin of the gonadotropin deficiency in this genetic form of nCHH.

  20. EGFR Mutation Status in Uighur Lung Adenocarcinoma Patients

    Li SHAN

    2013-02-01

    Full Text Available Background and objective Epidermal growth factor receptor (EGFR, a transmembrane protein, is a member of the tyrosine kinase family. Gefitinib, an EGFR tyrosine-kinase inhibitors, has shown a high response rate in the treatment of lung cancer in patients with EGFR mutation. However, significant differences in EGFR mutations exist among different ethnic groups. The aim of this study is to investigate the prevalence of EGFR mutations in Uighur lung adenocarcinoma patients by using a rapid and sensitive detection method and to analyze EGFR mutation differences compared with Han lung adenocarcinoma patients. Methods We examined lung adenocarcinoma tissues from 138 patients, including 68 Uighur lung adenocarcinoma patients and 70 Han lung adenocarcinoma patients, for EGFR mutations in exons 18, 19, 20, and 21 by using the amplification refractory mutation system (ARMS PCR method. The mutation differences between Uighur and Han lung adenocarcinoma were compared by using the chi-square test method. Results EGFR mutations were detected in 43 (31.2% of the 138 lung adenocarcinoma patients. EGFR mutations were detected in 11 (16.2% of the 68 Uighur lung adenocarcinoma patients and in 32 (45.7% of the 70 Han lung adenocarcinoma patients. Significant differences were observed in the EGFR mutations between Uighur lung adenocarcinoma patients and Han lung adenocarcinoma patients (P<0.001. Conclusion Our results indicate that the EGFR mutation in Uighur lung adenocarcinoma patients (16.2% is significantly lower than that in Han lung adenocarcinoma patients (45.7%.

  1. Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions.

    Groveman, Bradley R; Xue, Sheng; Marin, Vedrana; Xu, Jindong; Ali, Mohammad K; Bienkiewicz, Ewa A; Yu, Xian-Min

    2011-02-01

    Previous studies demonstrated that intra-domain interactions between Src family kinases (SFKs), stabilized by binding of the phosphorylated C-terminus to the SH2 domain and/or binding of the SH2 kinase linker to the SH3 domain, lock the molecules in a closed conformation, disrupt the kinase active site, and inactivate SFKs. Here we report that the up-regulation of N-methyl-D-aspartate receptors (NMDARs) induced by expression of constitutively active neuronal Src (n-Src), in which the C-terminus tyrosine is mutated to phenylalanine (n-Src/Y535F), is significantly reduced by dysfunctions of the SH2 and/or SH3 domains of the protein. Furthermore, we found that dysfunctions of SH2 and/or SH3 domains reduce auto-phosphorylation of the kinase activation loop, depress kinase activity, and decrease NMDAR phosphorylation. The SH2 domain plays a greater regulatory role than the SH3 domain. Our data also show that n-Src binds directly to the C-terminus of the NMDAR NR2A subunit in vitro, with a K(D) of 108.2 ± 13.3 nM. This binding is not Src kinase activity-dependent, and dysfunctions of the SH2 and/or SH3 domains do not significantly affect the binding. These data indicate that the SH2 and SH3 domains may function to promote the catalytic activity of active n-Src, which is important in the regulation of NMDAR functions. © 2010 The Authors Journal compilation © 2010 FEBS.

  2. KIT Mutation and Loss of 14q May Be Sufficient for the Development of Clinically Symptomatic Very Low-Risk GIST.

    Olaf Karl Klinke

    Full Text Available The aim of this study was to determine the minimal set of genetic alterations required for the development of a very low risk clinically symptomatic gastro-intestinal stromal tumour within the stomach wall. We studied the genome of a very low-risk gastric gastro-intestinal stromal tumour by whole-genome sequencing, comparative genomic hybridisation and methylation profiling. The studied tumour harboured two typical genomic lesions: loss of the long arm of chromosome 14 and an activating mutation in exon 11 of KIT. Besides these genetic lesions, only two point mutations that may affect tumour progression were identified: A frame-shift deletion in RNF146 and a missense mutation in a zinc finger of ZNF407. Whilst the frameshift deletion in RNF146 seemed to be restricted to this particular tumour, a similar yet germline mutation in ZNF407 was found in a panel of 52 gastro-intestinal stromal tumours from different anatomical sites and different categories. Germline polymorphisms in the mitotic checkpoint proteins Aurora kinase A and BUB1 kinase B may have furthered tumour growth. The epigenetic profile of the tumour matches that of other KIT-mutant tumours. We have identified mutations in three genes and loss of the long arm of chromosome 14 as the so far minimal set of genetic abnormalities sufficient for the development of a very low risk clinically symptomatic gastric stromal tumour.

  3. Phosphoproteomics-mediated identification of Fer kinase as a target of mutant Shp2 in Noonan and LEOPARD syndrome.

    Jeroen Paardekooper Overman

    Full Text Available Noonan syndrome (NS and LEOPARD syndrome (LS cause congenital afflictions such as short stature, hypertelorism and heart defects. More than 50% of NS and almost all of LS cases are caused by activating and inactivating mutations of the phosphatase Shp2, respectively. How these biochemically opposing mutations lead to similar clinical outcomes is not clear. Using zebrafish models of NS and LS and mass spectrometry-based phosphotyrosine proteomics, we identified a down-regulated peptide of Fer kinase in both NS and LS. Further investigation showed a role for Fer during development, where morpholino-based knockdown caused craniofacial defects, heart edema and short stature. During gastrulation, loss of Fer caused convergence and extension defects without affecting cell fate. Moreover, Fer knockdown cooperated with NS and LS, but not wild type Shp2 to induce developmental defects, suggesting a role for Fer in the pathogenesis of both NS and LS.

  4. Restoration of adenosine deaminase-deficient human thymocyte development in vitro by inhibition of deoxynucleoside kinases.

    Joachims, Michelle L; Marble, Patrick A; Laurent, Aletha B; Pastuszko, Peter; Paliotta, Marco; Blackburn, Michael R; Thompson, Linda F

    2008-12-01

    Mutations in the gene encoding adenosine deaminase (ADA), a purine salvage enzyme, lead to immunodeficiency in humans. Although ADA deficiency has been analyzed in cell culture and murine models, information is lacking concerning its impact on the development of human thymocytes. We have used chimeric human/mouse fetal thymic organ culture to study ADA-deficient human thymocyte development in an "in vivo-like" environment where toxic metabolites accumulate in situ. Inhibition of ADA during human thymocyte development resulted in a severe reduction in cellular expansion as well as impaired differentiation, largely affecting mature thymocyte populations. Thymocyte differentiation was not blocked at a discrete stage; rather, the paucity of mature thymocytes was due to the induction of apoptosis as evidenced by activation of caspases and was accompanied by the accumulation of intracellular dATP. Inhibition of adenosine kinase and deoxycytidine kinase prevented the accumulation of dATP and restored thymocyte differentiation and proliferation. Our work reveals that multiple deoxynucleoside kinases are involved in the phosphorylation of deoxyadenosine when ADA is absent, and suggests an alternate therapeutic strategy for treatment of ADA-deficient patients.

  5. Overexpression of an Arabidopsis cysteine-rich receptor-like protein kinase, CRK5, enhances abscisic acid sensitivity and confers drought tolerance

    Lu, Kai; Liang, Shan; Wu, Zhen; Bi, Chao; Yu, Yong-Tao; Wang, Xiao-Fang; Zhang, Da-Peng

    2016-01-01

    Receptor-like kinases (RLKs) have been reported to regulate many developmental and defense process, but only a few members have been functionally characterized. In the present study, our observations suggest that one of the RLKs, a membrane-localized cysteine-rich receptor-like protein kinase, CRK5, is involved in abscisic acid (ABA) signaling in Arabidopsis thaliana. Overexpression of CRK5 increases ABA sensitivity in ABA-induced early seedling growth arrest and promotion of stomatal closure and inhibition of stomatal opening. Interestingly, and importantly, overexpression of CRK5 enhances plant drought tolerance without affecting plant growth at the mature stages and plant productivity. Transgenic lines overexpressing a mutated form of CRK5, CRK5 K372E with the change of the 372nd conserved amino acid residue from lysine to glutamic acid in its kinase domain, result in wild-type ABA and drought responses, supporting the role of CRK5 in ABA signaling. The loss-of-function mutation of the CRK5 gene does not affect the ABA response, while overexpression of two homologs of CRK5, CRK4 and CRK19, confers ABA responses, suggesting that these CRK members function redundantly. We further showed that WRKY18, WRKY40 and WRKY60 transcription factors repress the expression of CRK5, and that CRK5 likely functions upstream of ABI2 in ABA signaling. These findings help in understanding the complex ABA signaling network. PMID:27406784

  6. Recent Progress on Liver Kinase B1 (LKB1: Expression, Regulation, Downstream Signaling and Cancer Suppressive Function

    Ren-You Gan

    2014-09-01

    Full Text Available Liver kinase B1 (LKB1, known as a serine/threonine kinase, has been identified as a critical cancer suppressor in many cancer cells. It is a master upstream kinase of 13 AMP-activated protein kinase (AMPK-related protein kinases, and possesses versatile biological functions. LKB1 gene is mutated in many cancers, and its protein can form different protein complexes with different cellular localizations in various cell types. The expression of LKB1 can be regulated through epigenetic modification, transcriptional regulation and post-translational modification. LKB1 dowcnstream pathways mainly include AMPK, microtubule affinity regulating kinase (MARK, salt-inducible kinase (SIK, sucrose non-fermenting protein-related kinase (SNRK and brain selective kinase (BRSK signalings, etc. This review, therefore, mainly discusses recent studies about the expression, regulation, downstream signaling and cancer suppressive function of LKB1, which can be helpful for better understanding of this molecular and its significance in cancers.

  7. Frequent Nuclear/Cytoplasmic Localization of β-Catenin without Exon 3 Mutations in Malignant Melanoma

    Rimm, David L.; Caca, Karel; Hu, Gang; Harrison, Frank B.; Fearon, Eric R.

    1999-01-01

    β-Catenin has a critical role in E-cadherin-mediated cell-cell adhesion, and it also functions as a downstream signaling molecule in the wnt pathway. Mutations in the putative glycogen synthase kinase 3β phosphorylation sites near the β-catenin amino terminus have been found in some cancers and cancer cell lines. The mutations render β-catenin resistant to regulation by a complex containing the glycogen synthase kinase 3β, adenomatous polyposis coli, and axin proteins. As a result, β-catenin accumulates in the cytosol and nucleus and activates T-cell factor/lymphoid enhancing factor transcription factors. Previously, 6 of 27 melanoma cell lines were found to have β-catenin exon 3 mutations affecting the N-terminal phosphorylation sites (Rubinfeld B, Robbins P, Elgamil M, Albert I, Porfiri E, Polakis P: Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 1997, 275:1790–1792). To assess the role of β-catenin defects in primary melanomas, we undertook immunohistochemical and DNA sequencing studies in 65 melanoma specimens. Nuclear and/or cytoplasmic localization of β-catenin, a potential indicator of wnt pathway activation, was seen focally within roughly one third of the tumors, though a clonal somatic mutation in β-catenin was found in only one case (codon 45 Ser→Pro). Our findings demonstrate that β-catenin mutations are rare in primary melanoma, in contrast to the situation in melanoma cell lines. Nonetheless, activation of β-catenin, as indicated by its nuclear and/or cytoplasmic localization, appears to be frequent in melanoma, and in some cases, it may reflect focal and transient activation of the wnt pathway within the tumor. PMID:10027390

  8. Identifying kinase dependency in cancer cells by integrating high-throughput drug screening and kinase inhibition data.

    Ryall, Karen A; Shin, Jimin; Yoo, Minjae; Hinz, Trista K; Kim, Jihye; Kang, Jaewoo; Heasley, Lynn E; Tan, Aik Choon

    2015-12-01

    Targeted kinase inhibitors have dramatically improved cancer treatment, but kinase dependency for an individual patient or cancer cell can be challenging to predict. Kinase dependency does not always correspond with gene expression and mutation status. High-throughput drug screens are powerful tools for determining kinase dependency, but drug polypharmacology can make results difficult to interpret. We developed Kinase Addiction Ranker (KAR), an algorithm that integrates high-throughput drug screening data, comprehensive kinase inhibition data and gene expression profiles to identify kinase dependency in cancer cells. We applied KAR to predict kinase dependency of 21 lung cancer cell lines and 151 leukemia patient samples using published datasets. We experimentally validated KAR predictions of FGFR and MTOR dependence in lung cancer cell line H1581, showing synergistic reduction in proliferation after combining ponatinib and AZD8055. KAR can be downloaded as a Python function or a MATLAB script along with example inputs and outputs at: http://tanlab.ucdenver.edu/KAR/. aikchoon.tan@ucdenver.edu. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. The Ste20 kinase misshapen regulates both photoreceptor axon targeting and dorsal closure, acting downstream of distinct signals.

    Su, Y C; Maurel-Zaffran, C; Treisman, J E; Skolnik, E Y

    2000-07-01

    We have previously shown that the Ste20 kinase encoded by misshapen (msn) functions upstream of the c-Jun N-terminal kinase (JNK) mitogen-activated protein kinase module in Drosophila. msn is required to activate the Drosophila JNK, Basket (Bsk), to promote dorsal closure of the embryo. A mammalian homolog of Msn, Nck interacting kinase, interacts with the SH3 domains of the SH2-SH3 adapter protein Nck. We now show that Msn likewise interacts with Dreadlocks (Dock), the Drosophila homolog of Nck. dock is required for the correct targeting of photoreceptor axons. We have performed a structure-function analysis of Msn in vivo in Drosophila in order to elucidate the mechanism whereby Msn regulates JNK and to determine whether msn, like dock, is required for the correct targeting of photoreceptor axons. We show that Msn requires both a functional kinase and a C-terminal regulatory domain to activate JNK in vivo in Drosophila. A mutation in a PXXP motif on Msn that prevents it from binding to the SH3 domains of Dock does not affect its ability to rescue the dorsal closure defect in msn embryos, suggesting that Dock is not an upstream regulator of msn in dorsal closure. Larvae with only this mutated form of Msn show a marked disruption in photoreceptor axon targeting, implicating an SH3 domain protein in this process; however, an activated form of Msn is not sufficient to rescue the dock mutant phenotype. Mosaic analysis reveals that msn expression is required in photoreceptors in order for their axons to project correctly. The data presented here genetically link msn to two distinct biological events, dorsal closure and photoreceptor axon pathfinding, and thus provide the first evidence that Ste20 kinases of the germinal center kinase family play a role in axonal pathfinding. The ability of Msn to interact with distinct classes of adapter molecules in dorsal closure and photoreceptor axon pathfinding may provide the flexibility that allows it to link to distinct

  10. Functional characterization of a constitutively active kinase variant of Arabidopsis phototropin 1.

    Petersen, Jan; Inoue, Shin-Ichiro; Kelly, Sharon M; Sullivan, Stuart; Kinoshita, Toshinori; Christie, John M

    2017-08-18

    Phototropins (phots) are plasma membrane-associated serine/threonine kinases that coordinate a range of processes linked to optimizing photosynthetic efficiency in plants. These photoreceptors contain two light-, oxygen-, or voltage-sensing (LOV) domains within their N terminus, with each binding one molecule of flavin mononucleotide as a UV/blue light-absorbing chromophore. Although phots contain two LOV domains, light-induced activation of the C-terminal kinase domain and subsequent receptor autophosphorylation is controlled primarily by the A'α-LOV2-Jα photosensory module. Mutations that disrupt interactions between the LOV2 core and its flanking helical segments can uncouple this mode of light regulation. However, the impact of these mutations on phot function in Arabidopsis has not been explored. Here we report that histidine substitution of Arg-472 located within the A'α-helix of Arabidopsis phot1 constitutively activates phot1 kinase activity in vitro without affecting LOV2 photochemistry. Expression analysis of phot1 R472H in the phot-deficient mutant confirmed that it is autophosphorylated in darkness in vivo but unable to initiate phot1 signaling in the absence of light. Instead, we found that phot1 R472H is poorly functional under low-light conditions but can restore phototropism, chloroplast accumulation, stomatal opening, and leaf positioning and expansion at higher light intensities. Our findings suggest that Arabidopsis can adapt to the elevated phosphorylation status of the phot1 R472H mutant in part by reducing its stability, whereas the activity of the mutant under high-light conditions can be attributed to additional increases in LOV2-mediated photoreceptor autophosphorylation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Hepatitis C Virus Particle Assembly Involves Phosphorylation of NS5A by the c-Abl Tyrosine Kinase.

    Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Sun, Xuedong; Honjoh, Chisato; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao

    2015-09-04

    Hepatitis C virus (HCV) nonstructural protein 5A (NS5A) is thought to regulate the replication of viral RNA and the assembly of virus particles in a serine/threonine phosphorylation-dependent manner. However, the host kinases that phosphorylate NS5A have not been fully identified. Here, we show that HCV particle assembly involves the phosphorylation of NS5A by the c-Abl tyrosine kinase. Pharmacological inhibition or knockdown of c-Abl reduces the production of infectious HCV (J6/JFH1) particles in Huh-7.5 cells without markedly affecting viral RNA translation and replication. NS5A is tyrosine-phosphorylated in HCV-infected cells, and this phosphorylation is also reduced by the knockdown of c-Abl. Mutational analysis reveals that NS5A tyrosine phosphorylation is dependent, at least in part, on Tyr(330) (Tyr(2306) in polyprotein numbering). Mutation of this residue to phenylalanine reduces the production of infectious HCV particles but does not affect the replication of the JFH1 subgenomic replicon. These findings suggest that c-Abl promotes HCV particle assembly by phosphorylating NS5A at Tyr(330). © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Profiling bacterial kinase activity using a genetic circuit

    van der Helm, Eric; Bech, Rasmus; Lehning, Christina Eva

    Phosphorylation is a post-translational modification that regulates the activity of several key proteins in bacteria and eukaryotes. Accordingly, a variety of tools has been developed to measure kinase activity. To couple phosphorylation to an in vivo fluorescent readout we used the Bacillus...... subtilis kinase PtkA, transmembrane activator TkmA and the repressor FatR to construct a genetic circuit in E. coli. By tuning the repressor and kinase expression level at the same time, we were able to show a 4.2-fold increase in signal upon kinase induction. We furthermore validated that the previously...... reported FatR Y45E mutation1 attenuates operator repression. This genetic circuit provides a starting point for computational protein design and a metagenomic library-screening tool....

  13. Gene mutations in hepatocellular adenomas

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  14. Pyruvate kinase blood test

    ... medlineplus.gov/ency/article/003357.htm Pyruvate kinase blood test To use the sharing features on this page, ... energy when oxygen levels are low. How the Test is Performed A blood sample is needed. In the laboratory, white blood ...

  15. Characterization of a mutation commonly associated with persistent stuttering: evidence for a founder mutation

    Fedyna, Alison; Drayna, Dennis; Kang, Changsoo

    2010-01-01

    Stuttering is a disorder which affects the fluency of speech. It has been shown to have high heritability, and has recently been linked to mutations in the GNPTAB gene. One such mutation, Glu1200Lys, has been repeatedly observed in unrelated families and individual cases. Eight unrelated individuals carrying this mutation were analyzed in an effort to distinguish whether these arise from repeated mutation at the same site, or whether they represent a founder mutation with a single origin. Results show that all 12 chromosomes carrying this mutation share a common haplotype in this region, indicating it is a founder mutation. Further analysis estimated the age of this allele to be ~572 generations. Construction of a cladogram tracing the mutation through our study sample also supports the founder mutation hypothesis. PMID:20944643

  16. Recurrent occurrences of CDKL5 mutations in patients with epileptic encephalopathy.

    Yamamoto, Toshiyuki; Shimojima, Keiko; Kimura, Nobusuke; Mogami, Yukiko; Usui, Daisuke; Takayama, Rumiko; Ikeda, Hiroko; Imai, Katsumi

    2015-01-01

    The cyclin-dependent kinase-like 5 gene (CDKL5) is recognized as one of the genes responsible for epileptic encephalopathy. We identified CDKL5 mutations in five Japanese patients (one male and four female) with epileptic encephalopathy. Although all mutations were of de novo origin, they were located in the same positions as previously reported pathogenic mutations. These recurrent occurrences of de novo mutations in the same loci may indicate hot spots of nucleotide alteration.

  17. Germline mutations in MAP3K6 are associated with familial gastric cancer.

    Daniel Gaston

    2014-10-01

    Full Text Available Gastric cancer is among the leading causes of cancer-related deaths worldwide. While heritable forms of gastric cancer are relatively rare, identifying the genes responsible for such cases can inform diagnosis and treatment for both hereditary and sporadic cases of gastric cancer. Mutations in the E-cadherin gene, CDH1, account for 40% of the most common form of familial gastric cancer (FGC, hereditary diffuse gastric cancer (HDGC. The genes responsible for the remaining forms of FGC are currently unknown. Here we examined a large family from Maritime Canada with FGC without CDH1 mutations, and identified a germline coding variant (p.P946L in mitogen-activated protein kinase kinase kinase 6 (MAP3K6. Based on conservation, predicted pathogenicity and a known role of the gene in cancer predisposition, MAP3K6 was considered a strong candidate and was investigated further. Screening of an additional 115 unrelated individuals with non-CDH1 FGC identified the p.P946L MAP3K6 variant, as well as four additional coding variants in MAP3K6 (p.F849Sfs*142, p.P958T, p.D200Y and p.V207G. A somatic second-hit variant (p.H506Y was present in DNA obtained from one of the tumor specimens, and evidence of DNA hypermethylation within the MAP3K6 gene was observed in DNA from the tumor of another affected individual. These findings, together with previous evidence from mouse models that MAP3K6 acts as a tumor suppressor, and studies showing the presence of somatic mutations in MAP3K6 in non-hereditary gastric cancers and gastric cancer cell lines, point towards MAP3K6 variants as a predisposing factor for FGC.

  18. The Arabidopsis arc5 and arc6 mutations differentially affect plastid morphology in pavement and guard cells in the leaf epidermis.

    Fujiwara, Makoto T; Yasuzawa, Mana; Kojo, Kei H; Niwa, Yasuo; Abe, Tomoko; Yoshida, Shigeo; Nakano, Takeshi; Itoh, Ryuuichi D

    2018-01-01

    of epidermal plastids, and indicate that dysfunctions in ARC5 and ARC6 differentially affect plastid replication among mesophyll cells, PCs, and GCs within a single leaf.

  19. Generation of KCL018 research grade human embryonic stem cell line carrying a mutation in the DMPK gene

    Cristian Miere

    2016-03-01

    Full Text Available The KCL018 human embryonic stem cell line was derived from an embryo donated for research that carried an autosomal dominant mutation affecting one allele of the DMPK gene encoding the dystrophia myotonica protein kinase (2200 trinucleotide repeats; 14 for the normal allele. The ICM was isolated using laser microsurgery and plated on γ-irradiated human foreskin fibroblasts. Both the derivation and cell line propagation were performed in an animal product-free environment. Pluripotent state and differentiation potential were confirmed by in vitro assays.

  20. Structure of the intact ATM/Tel1 kinase

    Wang, Xuejuan; Chu, Huanyu; Lv, Mengjuan; Zhang, Zhihui; Qiu, Shuwan; Liu, Haiyan; Shen, Xuetong; Wang, Weiwu; Cai, Gang

    2016-05-01

    The ataxia-telangiectasia mutated (ATM) protein is an apical kinase that orchestrates the multifaceted DNA-damage response. Normally, ATM kinase is in an inactive, homodimer form and is transformed into monomers upon activation. Besides a conserved kinase domain at the C terminus, ATM contains three other structural modules, referred to as FAT, FATC and N-terminal helical solenoid. Here we report the first cryo-EM structure of ATM kinase, which is an intact homodimeric ATM/Tel1 from Schizosaccharomyces pombe. We show that two monomers directly contact head-to-head through the FAT and kinase domains. The tandem N-terminal helical solenoid tightly packs against the FAT and kinase domains. The structure suggests that ATM/Tel1 dimer interface and the consecutive HEAT repeats inhibit the binding of kinase substrates and regulators by steric hindrance. Our study provides a structural framework for understanding the mechanisms of ATM/Tel1 regulation as well as the development of new therapeutic agents.

  1. Loss of thymidine kinase 2 alters neuronal bioenergetics and leads to neurodegeneration.

    Bartesaghi, Stefano; Betts-Henderson, Joanne; Cain, Kelvin; Dinsdale, David; Zhou, Xiaoshan; Karlsson, Anna; Salomoni, Paolo; Nicotera, Pierluigi

    2010-05-01

    Mutations of thymidine kinase 2 (TK2), an essential component of the mitochondrial nucleotide salvage pathway, can give rise to mitochondrial DNA (mtDNA) depletion syndromes (MDS). These clinically heterogeneous disorders are characterized by severe reduction in mtDNA copy number in affected tissues and are associated with progressive myopathy, hepatopathy and/or encephalopathy, depending in part on the underlying nuclear genetic defect. Mutations of TK2 have previously been associated with an isolated myopathic form of MDS (OMIM 609560). However, more recently, neurological phenotypes have been demonstrated in patients carrying TK2 mutations, thus suggesting that loss of TK2 results in neuronal dysfunction. Here, we directly address the role of TK2 in neuronal homeostasis using a knockout mouse model. We demonstrate that in vivo loss of TK2 activity leads to a severe ataxic phenotype, accompanied by reduced mtDNA copy number and decreased steady-state levels of electron transport chain proteins in the brain. In TK2-deficient cerebellar neurons, these abnormalities are associated with impaired mitochondrial bioenergetic function, aberrant mitochondrial ultrastructure and degeneration of selected neuronal types. Overall, our findings demonstrate that TK2 deficiency leads to neuronal dysfunction in vivo, and have important implications for understanding the mechanisms of neurological impairment in MDS.

  2. Loss of ATM kinase activity leads to embryonic lethality in mice.

    Daniel, Jeremy A; Pellegrini, Manuela; Lee, Baeck-Seung; Guo, Zhi; Filsuf, Darius; Belkina, Natalya V; You, Zhongsheng; Paull, Tanya T; Sleckman, Barry P; Feigenbaum, Lionel; Nussenzweig, André

    2012-08-06

    Ataxia telangiectasia (A-T) mutated (ATM) is a key deoxyribonucleic acid (DNA) damage signaling kinase that regulates DNA repair, cell cycle checkpoints, and apoptosis. The majority of patients with A-T, a cancer-prone neurodegenerative disease, present with null mutations in Atm. To determine whether the functions of ATM are mediated solely by its kinase activity, we generated two mouse models containing single, catalytically inactivating point mutations in Atm. In this paper, we show that, in contrast to Atm-null mice, both D2899A and Q2740P mutations cause early embryonic lethality in mice, without displaying dominant-negative interfering activity. Using conditional deletion, we find that the D2899A mutation in adult mice behaves largely similar to Atm-null cells but shows greater deficiency in homologous recombination (HR) as measured by hypersensitivity to poly (adenosine diphosphate-ribose) polymerase inhibition and increased genomic instability. These results may explain why missense mutations with no detectable kinase activity are rarely found in patients with classical A-T. We propose that ATM kinase-inactive missense mutations, unless otherwise compensated for, interfere with HR during embryogenesis.

  3. BRAF mutation in hairy cell leukemia

    Ahmad Ahmadzadeh

    2014-09-01

    Full Text Available BRAF is a serine/threonine kinase with a regulatory role in the mitogen-activated protein kinase (MAPK signaling pathway. A mutation in the RAF gene, especially in BRAF protein, leads to an increased stimulation of this cascade, causing uncontrolled cell division and development of malignancy. Several mutations have been observed in the gene coding for this protein in a variety of human malignancies, including hairy cell leukemia (HCL. BRAF V600E is the most common mutation reported in exon15 of BRAF, which is observed in almost all cases of classic HCL, but it is negative in other B-cell malignancies, including the HCL variant. Therefore it can be used as a marker to differentiate between these B-cell disorders. We also discuss the interaction between miRNAs and signaling pathways, including MAPK, in HCL. When this mutation is present, the use of BRAF protein inhibitors may represent an effective treatment. In this review we have evaluated the role of the mutation of the BRAF gene in the pathogenesis and progression of HCL.

  4. A Novel Method to Screen for Dominant Negative ATM Mutations in Familial Breast Cancer

    Khanna, Kum K; Chenevix-Trench, Georgia; Grimmond, Sean

    2005-01-01

    The aim of this proposal is to identify families carrying potentially pathogenic A TM mutations by assaying for ATM kinase activity in cell lines derived from individuals with multiple cases of breast...

  5. HER2 activating mutations are targets for colorectal cancer treatment.

    Kavuri, Shyam M; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M; Migliardi, Giorgia; Searleman, Adam C; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A; Bertotti, Andrea; Bose, Ron

    2015-08-01

    The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of patients with colorectal cancer. Introduction of the HER2 mutations S310F, L755S, V777L, V842I, and L866M into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutants are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors neratinib and afatinib. HER2 gene sequencing of 48 cetuximab-resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) wild-type (WT) colorectal cancer patient-derived xenografts (PDX) identified 4 PDXs with HER2 mutations. HER2-targeted therapies were tested on two PDXs. Treatment with a single HER2-targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2-targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2-mutated PDXs. HER2 activating mutations cause EGFR antibody resistance in colorectal cell lines, and PDXs with HER2 mutations show durable tumor regression when treated with dual HER2-targeted therapy. These data provide a strong preclinical rationale for clinical trials targeting HER2 activating mutations in metastatic colorectal cancer. ©2015 American Association for Cancer Research.

  6. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  7. a photoreceptor gene mutation in an indigenous black african family

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  8. TRESK background K(+ channel is inhibited by PAR-1/MARK microtubule affinity-regulating kinases in Xenopus oocytes.

    Gabriella Braun

    Full Text Available TRESK (TWIK-related spinal cord K(+ channel, KCNK18 is a major background K(+ channel of sensory neurons. Dominant-negative mutation of TRESK is linked to familial migraine. This important two-pore domain K(+ channel is uniquely activated by calcineurin. The calcium/calmodulin-dependent protein phosphatase directly binds to the channel and activates TRESK current several-fold in Xenopus oocytes and HEK293 cells. We have recently shown that the kinase, which is responsible for the basal inhibition of the K(+ current, is sensitive to the adaptor protein 14-3-3. Therefore we have examined the effect of the 14-3-3-inhibited PAR-1/MARK, microtubule-associated-protein/microtubule affinity-regulating kinase on TRESK in the Xenopus oocyte expression system. MARK1, MARK2 and MARK3 accelerated the return of TRESK current to the resting state after the calcium-dependent activation. Several other serine-threonine kinase types, generally involved in the modulation of other ion channels, failed to influence TRESK current recovery. MARK2 phosphorylated the primary determinant of regulation, the cluster of three adjacent serine residues (S274, 276 and 279 in the intracellular loop of mouse TRESK. In contrast, serine 264, the 14-3-3-binding site of TRESK, was not phosphorylated by the kinase. Thus MARK2 selectively inhibits TRESK activity via the S274/276/279 cluster, but does not affect the direct recruitment of 14-3-3 to the channel. TRESK is the first example of an ion channel phosphorylated by the dynamically membrane-localized MARK kinases, also known as general determinants of cellular polarity. These results raise the possibility that microtubule dynamics is coupled to the regulation of excitability in the neurons, which express TRESK background potassium channel.

  9. The target landscape of clinical kinase drugs.

    Klaeger, Susan; Heinzlmeir, Stephanie; Wilhelm, Mathias; Polzer, Harald; Vick, Binje; Koenig, Paul-Albert; Reinecke, Maria; Ruprecht, Benjamin; Petzoldt, Svenja; Meng, Chen; Zecha, Jana; Reiter, Katrin; Qiao, Huichao; Helm, Dominic; Koch, Heiner; Schoof, Melanie; Canevari, Giulia; Casale, Elena; Depaolini, Stefania Re; Feuchtinger, Annette; Wu, Zhixiang; Schmidt, Tobias; Rueckert, Lars; Becker, Wilhelm; Huenges, Jan; Garz, Anne-Kathrin; Gohlke, Bjoern-Oliver; Zolg, Daniel Paul; Kayser, Gian; Vooder, Tonu; Preissner, Robert; Hahne, Hannes; Tõnisson, Neeme; Kramer, Karl; Götze, Katharina; Bassermann, Florian; Schlegl, Judith; Ehrlich, Hans-Christian; Aiche, Stephan; Walch, Axel; Greif, Philipp A; Schneider, Sabine; Felder, Eduard Rudolf; Ruland, Juergen; Médard, Guillaume; Jeremias, Irmela; Spiekermann, Karsten; Kuster, Bernhard

    2017-12-01

    Kinase inhibitors are important cancer therapeutics. Polypharmacology is commonly observed, requiring thorough target deconvolution to understand drug mechanism of action. Using chemical proteomics, we analyzed the target spectrum of 243 clinically evaluated kinase drugs. The data revealed previously unknown targets for established drugs, offered a perspective on the "druggable" kinome, highlighted (non)kinase off-targets, and suggested potential therapeutic applications. Integration of phosphoproteomic data refined drug-affected pathways, identified response markers, and strengthened rationale for combination treatments. We exemplify translational value by discovering SIK2 (salt-inducible kinase 2) inhibitors that modulate cytokine production in primary cells, by identifying drugs against the lung cancer survival marker MELK (maternal embryonic leucine zipper kinase), and by repurposing cabozantinib to treat FLT3-ITD-positive acute myeloid leukemia. This resource, available via the ProteomicsDB database, should facilitate basic, clinical, and drug discovery research and aid clinical decision-making. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  10. Ribosomal S6 Kinase Cooperates with Casein Kinase 2 to Modulate the Drosophila Circadian Molecular Oscillator

    Akten, Bikem; Tangredi, Michelle M.; Jauch, Eike; Roberts, Mary A.; Ng, Fanny; Raabe, Thomas; Jackson, F. Rob

    2009-01-01

    There is a universal requirement for post-translational regulatory mechanisms in circadian clock systems. Previous work in Drosophila has identified several kinases, phosphatases and an E3 ligase that are critical for determining the nuclear translocation and/or stability of clock proteins. The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. In mammals, RSK1 is a light- and clock-regulated kinase known to be activated by the MAPK pathway, but there is no direct evidence that it functions as a component of the circadian system. Here, we show that Drosophila S6KII RNA displays rhythms in abundance, indicative of circadian control. Importantly, an S6KII null mutant exhibits a short-period circadian phenotype that can be rescued by expression of the wild-type gene in clock neurons, indicating a role for S6KII in the molecular oscillator. Peak PER clock protein expression is elevated in the mutant, indicative of enhanced stability, whereas per mRNA level is decreased, consistent with enhanced feedback repression. Gene reporter assays show that decreased S6KII is associated with increased PER repression. Surprisingly, we demonstrate a physical interaction between S6KII and the Casein Kinase 2 regulatory subunit (CK2β), suggesting a functional relationship between the two kinases. In support of such a relationship, there are genetic interactions between S6KII and CK2 mutations, in vivo, which indicate that CK2 activity is required for S6KII action. We propose that the two kinases cooperate within clock neurons to fine-tune circadian period, improving the precision of the clock mechanism. PMID:19144847

  11. SOCS proteins in regulation of receptor tyrosine kinase signaling

    Kazi, Julhash U.; Kabir, Nuzhat N.; Flores Morales, Amilcar

    2014-01-01

    Receptor tyrosine kinases (RTKs) are a family of cell surface receptors that play critical roles in signal transduction from extracellular stimuli. Many in this family of kinases are overexpressed or mutated in human malignancies and thus became an attractive drug target for cancer treatment....... The signaling mediated by RTKs must be tightly regulated by interacting proteins including protein-tyrosine phosphatases and ubiquitin ligases. The suppressors of cytokine signaling (SOCS) family proteins are well-known negative regulators of cytokine receptors signaling consisting of eight structurally similar...

  12. An antisense oligodeoxynucleotide targeted against the type IIβ regulatory subunit mRNA of protein kinase inhibits cAMP-induced differentiation in HL-60 leukemia cells without affecting phorbol ester effects

    Tortora, G.; Clair, T.; Cho-Chung, Y.S.

    1990-01-01

    The type II β regulatory subunit of cAMP-dependent protein kinase (RII β ) has been hypothesized to play an important role in the growth inhibition and differentiation induced by site-selective cAMP analogs in human cancer cells, but direct proof of this function has been lacking. To address this tissue, HL-60 human promyelocytic leukemia cells were exposed to RII β antisense synthetic oligodeoxynucleotide, and the effects on cAMP-induced growth regulation were examined. Exposure of these cells to RII β antisense oligodeoxynucleotide resulted in a decrease in cAMP analog-induced growth inhibition and differentiation without apparent effect on differentiation induced by phorbol esters. This loss in cAMP growth regulatory function correlated with a decrease in basal and induced levels of RII β protein. Exposure to RII β sense, RI α and RII α antisense, or irrelevant oligodeoxynucleotides had no such effect. These results show that the RII β regulatory subunit of protein kinase plays a critical role in the cAMP-induced growth regulation of HL-60 leukemia cells

  13. Enterococcus faecalis phosphomevalonate kinase

    Doun, Stephanie S.; Burgner, John W.; Briggs, Scott D.; Rodwell, Victor W.

    2005-01-01

    The six enzymes of the mevalonate pathway of isopentenyl diphosphate biosynthesis represent potential for addressing a pressing human health concern, the development of antibiotics against resistant strains of the Gram-positive streptococci. We previously characterized the first four of the mevalonate pathway enzymes of Enterococcus faecalis, and here characterize the fifth, phosphomevalonate kinase (E.C. 2.7.4.2). E. faecalis genomic DNA and the polymerase chain reaction were used to clone DNA thought to encode phosphomevalonate kinase into pET28b(+). Double-stranded DNA sequencing verified the sequence of the recombinant gene. The encoded N-terminal hexahistidine-tagged protein was expressed in Escherichia coli with induction by isopropylthiogalactoside and purified by Ni++ affinity chromatography, yield 20 mg protein per liter. Analysis of the purified protein by MALDI-TOF mass spectrometry established it as E. faecalis phosphomevalonate kinase. Analytical ultracentrifugation revealed that the kinase exists in solution primarily as a dimer. Assay for phosphomevalonate kinase activity used pyruvate kinase and lactate dehydrogenase to couple the formation of ADP to the oxidation of NADH. Optimal activity occurred at pH 8.0 and at 37°C. The activation energy was ~5.6 kcal/mol. Activity with Mn++, the preferred cation, was optimal at about 4 mM. Relative rates using different phosphoryl donors were 100 (ATP), 3.6 (GTP), 1.6 (TTP), and 0.4 (CTP). Km values were 0.17 mM for ATP and 0.19 mM for (R,S)-5-phosphomevalonate. The specific activity of the purified enzyme was 3.9 μmol substrate converted per minute per milligram protein. Applications to an immobilized enzyme bioreactor and to drug screening and design are discussed. PMID:15802646

  14. Recurrent PTPRB and PLCG1 mutations in angiosarcoma.

    Behjati, Sam; Tarpey, Patrick S; Sheldon, Helen; Martincorena, Inigo; Van Loo, Peter; Gundem, Gunes; Wedge, David C; Ramakrishna, Manasa; Cooke, Susanna L; Pillay, Nischalan; Vollan, Hans Kristian M; Papaemmanuil, Elli; Koss, Hans; Bunney, Tom D; Hardy, Claire; Joseph, Olivia R; Martin, Sancha; Mudie, Laura; Butler, Adam; Teague, Jon W; Patil, Meena; Steers, Graham; Cao, Yu; Gumbs, Curtis; Ingram, Davis; Lazar, Alexander J; Little, Latasha; Mahadeshwar, Harshad; Protopopov, Alexei; Al Sannaa, Ghadah A; Seth, Sahil; Song, Xingzhi; Tang, Jiabin; Zhang, Jianhua; Ravi, Vinod; Torres, Keila E; Khatri, Bhavisha; Halai, Dina; Roxanis, Ioannis; Baumhoer, Daniel; Tirabosco, Roberto; Amary, M Fernanda; Boshoff, Chris; McDermott, Ultan; Katan, Matilda; Stratton, Michael R; Futreal, P Andrew; Flanagan, Adrienne M; Harris, Adrian; Campbell, Peter J

    2014-04-01

    Angiosarcoma is an aggressive malignancy that arises spontaneously or secondarily to ionizing radiation or chronic lymphoedema. Previous work has identified aberrant angiogenesis, including occasional somatic mutations in angiogenesis signaling genes, as a key driver of angiosarcoma. Here we employed whole-genome, whole-exome and targeted sequencing to study the somatic changes underpinning primary and secondary angiosarcoma. We identified recurrent mutations in two genes, PTPRB and PLCG1, which are intimately linked to angiogenesis. The endothelial phosphatase PTPRB, a negative regulator of vascular growth factor tyrosine kinases, harbored predominantly truncating mutations in 10 of 39 tumors (26%). PLCG1, a signal transducer of tyrosine kinases, encoded a recurrent, likely activating p.Arg707Gln missense variant in 3 of 34 cases (9%). Overall, 15 of 39 tumors (38%) harbored at least one driver mutation in angiogenesis signaling genes. Our findings inform and reinforce current therapeutic efforts to target angiogenesis signaling in angiosarcoma.

  15. From Phosphosites to Kinases

    Munk, Stephanie; Refsgaard, Jan C; Olsen, Jesper V

    2016-01-01

    Kinases play a pivotal role in propagating the phosphorylation-mediated signaling networks in living cells. With the overwhelming quantities of phosphoproteomics data being generated, the number of identified phosphorylation sites (phosphosites) is ever increasing. Often, proteomics investigations...... sequence motifs, mostly based on large scale in vivo and in vitro experiments. The context of the kinase and the phosphorylated proteins in a biological system is equally important for predicting association between the enzymes and substrates, an aspect that is also being tackled with available...

  16. Nuclear localization of Lyn tyrosine kinase mediated by inhibition of its kinase activity

    Ikeda, Kikuko; Nakayama, Yuji; Togashi, Yuuki; Obata, Yuuki; Kuga, Takahisa; Kasahara, Kousuke; Fukumoto, Yasunori; Yamaguchi, Naoto

    2008-01-01

    Src-family kinases, cytoplasmic enzymes that participate in various signaling events, are found at not only the plasma membrane but also subcellular compartments, such as the nucleus, the Golgi apparatus and late endosomes/lysosomes. Lyn, a member of the Src-family kinases, is known to play a role in DNA damage response and cell cycle control in the nucleus. However, it is still unclear how the localization of Lyn to the nucleus is regulated. Here, we investigated the mechanism of the distribution of Lyn between the cytoplasm and the nucleus in epitheloid HeLa cells and hematopoietic THP-1 cells. Lyn was definitely detected in purified nuclei by immunofluorescence and immunoblotting analyses. Nuclear accumulation of Lyn was enhanced upon treatment of cells with leptomycin B (LMB), an inhibitor of Crm1-mediated nuclear export. Moreover, Lyn mutants lacking the sites for lipid modification were highly accumulated in the nucleus upon LMB treatment. Intriguingly, inhibition of the kinase activity of Lyn by SU6656, Csk overexpression, or point mutation in the ATP-binding site induced an increase in nuclear Lyn levels. These results suggest that Lyn being imported into and rapidly exported from the nucleus preferentially accumulates in the nucleus by inhibition of the kinase activity and lipid modification

  17. Frequency and Prognostic Relevance of FLT3 Mutations in Saudi Acute Myeloid Leukemia Patients

    Ghaleb Elyamany

    2014-01-01

    Full Text Available The Fms-like tyrosine kinase-3 (FLT3 is a receptor tyrosine kinase that plays a key role in cell survival, proliferation, and differentiation of hematopoietic stem cells. Mutations of FLT3 were first described in 1997 and account for the most frequent molecular mutations in acute myeloid leukemia (AML. AML patients with FLT3 internal tandem duplication (ITD mutations have poor cure rates the prognostic significance of point mutations; tyrosine kinase domain (TKD is still unclear. We analyzed the frequency of FLT3 mutations (ITD and D835 in patients with AML at diagnosis; no sufficient data currently exist regarding FLT3 mutations in Saudi AML patients. This study was aimed at evaluating the frequency of FLT3 mutations in patients with AML and its significance for prognosis. The frequency of FLT3 mutations in our study (18.56% was lower than many of the reported studies, FLT3-ITD mutations were observed in 14.4%, and FLT3-TKD in 4.1%, of 97 newly diagnosed AML patients (82 adult and 15 pediatric. Our data show significant increase of FLT3 mutations in male more than female (13 male, 5 female. Our results support the view that FLT3-ITD mutation has strong prognostic factor in AML patients and is associated with high rate of relapse, and high leucocytes and blast count at diagnosis and relapse.

  18. SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

    Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

    1997-10-31

    Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

  19. Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency.

    Garone, Caterina; Garcia-Diaz, Beatriz; Emmanuele, Valentina; Lopez, Luis C; Tadesse, Saba; Akman, Hasan O; Tanji, Kurenai; Quinzii, Catarina M; Hirano, Michio

    2014-08-01

    Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2(-/-)) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-old Tk2(-/-) mice treated with dCMP+dTMP 200 mg/kg/day each (Tk2(-/-200dCMP/) (dTMP)) demonstrated that in mutant animals, the compounds raise dTTP concentrations, increase levels of mtDNA, ameliorate defects of mitochondrial respiratory chain enzymes, and significantly prolong their lifespan (34 days with treatment versus 13 days untreated). A second trial of dCMP+dTMP each at 400 mg/kg/day showed even greater phenotypic and biochemical improvements. In conclusion, dCMP/dTMP supplementation is the first effective pharmacologic treatment for Tk2 deficiency. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  20. Thermostability promotes the cooperative function of split adenylate kinases.

    Nguyen, Peter Q; Liu, Shirley; Thompson, Jeremy C; Silberg, Jonathan J

    2008-05-01

    Proteins can often be cleaved to create inactive polypeptides that associate into functional complexes through non-covalent interactions, but little is known about what influences the cooperative function of the ensuing protein fragments. Here, we examine whether protein thermostability affects protein fragment complementation by characterizing the function of split adenylate kinases from the mesophile Bacillus subtilis (AKBs) and the hyperthermophile Thermotoga neapolitana (AKTn). Complementation studies revealed that the split AKTn supported the growth of Escherichia coli with a temperature-sensitive AK, but not the fragmented AKBs. However, weak complementation occurred when the AKBs fragments were fused to polypeptides that strongly associate, and this was enhanced by a Q16L mutation that thermostabilizes the full-length protein. To examine how the split AK homologs differ in structure and function, their catalytic activity, zinc content, and circular dichroism spectra were characterized. The reconstituted AKTn had higher levels of zinc, greater secondary structure, and >10(3)-fold more activity than the AKBs pair, albeit 17-fold less active than full-length AKTn. These findings provide evidence that the design of protein fragments that cooperatively function can be improved by choosing proteins with the greatest thermostability for bisection, and they suggest that this arises because hyperthermophilic protein fragments exhibit greater residual structure compared to their mesophilic counterparts.

  1. Retinitis pigmentosa: mutations in a receptor tyrosine kinase gene ...

    patients show early and severe impairment of pure rod responses (Pagon 1993). ... is characterized by total blindness or greatly impaired vision at birth or within ... gene, Mertk, in the Royal College of Surgeons (RCS) rat (D'Cruz et al 2000) ...

  2. Rare beneficial mutations can halt Muller's ratchet

    Balick, Daniel; Goyal, Sidhartha; Jerison, Elizabeth; Neher, Richard; Shraiman, Boris; Desai, Michael

    2012-02-01

    In viral, bacterial, and other asexual populations, the vast majority of non-neutral mutations are deleterious. This motivates the application of models without beneficial mutations. Here we show that the presence of surprisingly few compensatory mutations halts fitness decay in these models. Production of deleterious mutations is balanced by purifying selection, stabilizing the fitness distribution. However, stochastic vanishing of fitness classes can lead to slow fitness decay (i.e. Muller's ratchet). For weakly deleterious mutations, production overwhelms purification, rapidly decreasing population fitness. We show that when beneficial mutations are introduced, a stable steady state emerges in the form of a dynamic mutation-selection balance. We argue this state is generic for all mutation rates and population sizes, and is reached as an end state as genomes become saturated by either beneficial or deleterious mutations. Assuming all mutations have the same magnitude selective effect, we calculate the fraction of beneficial mutations necessary to maintain the dynamic balance. This may explain the unexpected maintenance of asexual genomes, as in mitochondria, in the presence of selection. This will affect in the statistics of genetic diversity in these populations.

  3. Mutation breeding in jute

    Joshua, D.C.

    1980-01-01

    Mutagenic studies in jute in general dealt with the morphological abnormalities of the M 1 generation in great detail. Of late, induction of a wide spectrum of viable mutations have been reported in different varieties of both the species. Mutations affecting several traits of agronomic importance such as, plant height, time of flowering, fibre yield and quality, resistance to pests and diseases are also available. Cytological analysis of a large collection of induced mutants resulted in the isolation of seven trisomics in an olitorius variety. Several anatomical parameters which are the components of fibre yield, have also received attention. Some mutants with completely altered morphology were used for interpreting the evolution of leaf shape in Tiliaceas and related families. A capsularis variety developed using mutation breeding technique has been released for cultivation. Several others, including derivatives of inter-mutant hybridization have been found to perform well at different locations in the All India Coordinated Trials. Presently, chemical mutagenesis and induction of mutants of physiological significance are receiving considerable attention. The induced variability is being used in genetic and linkage studies. (author)

  4. Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors

    Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma

    2006-01-01

    Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs

  5. Quantitative and Dynamic Imaging of ATM Kinase Activity.

    Nyati, Shyam; Young, Grant; Ross, Brian Dale; Rehemtulla, Alnawaz

    2017-01-01

    Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including DNA double-strand breaks (DSBs). ATM activation results in the initiation of a complex cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally, protein kinases have been analyzed in vitro using biochemical methods (kinase assays using purified proteins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosensors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to enable interrogation of kinase activities in live cells with a high signal to background. We have genetically engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphorylation of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing complementation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.

  6. SH2-dependent autophosphorylation within the Tec family kinase Itk.

    Joseph, Raji E; Severin, Andrew; Min, Lie; Fulton, D Bruce; Andreotti, Amy H

    2009-08-07

    The Tec family kinase, Itk (interleukin-2 tyrosine kinase), undergoes an in cis autophosphorylation on Y180 within its Src homology 3 (SH3) domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening Src homology 2 (SH2) domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full-length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the betaD strand. These results are extended into Btk (Bruton's tyrosine kinase), a Tec family kinase linked to the B-cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA-causing mutations might impair Btk phosphorylation.

  7. Experimental evolution and the dynamics of genomic mutation rate modifiers.

    Raynes, Y; Sniegowski, P D

    2014-11-01

    Because genes that affect mutation rates are themselves subject to mutation, mutation rates can be influenced by natural selection and other evolutionary forces. The population genetics of mutation rate modifier alleles has been a subject of theoretical interest for many decades. Here, we review experimental contributions to our understanding of mutation rate modifier dynamics. Numerous evolution experiments have shown that mutator alleles (modifiers that elevate the genomic mutation rate) can readily rise to high frequencies via genetic hitchhiking in non-recombining microbial populations. Whereas these results certainly provide an explanatory framework for observations of sporadically high mutation rates in pathogenic microbes and in cancer lineages, it is nonetheless true that most natural populations have very low mutation rates. This raises the interesting question of how mutator hitchhiking is suppressed or its phenotypic effect reversed in natural populations. Very little experimental work has addressed this question; with this in mind, we identify some promising areas for future experimental investigation.

  8. Somatic mutations in histiocytic sarcoma identified by next generation sequencing.

    Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo

    2016-08-01

    Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.

  9. EGFR kinase-dependent and kinase-independent roles in clear cell renal cell carcinoma.

    Cossu-Rocca, Paolo; Muroni, Maria R; Sanges, Francesca; Sotgiu, Giovanni; Asunis, Anna; Tanca, Luciana; Onnis, Daniela; Pira, Giovanna; Manca, Alessandra; Dore, Simone; Uras, Maria G; Ena, Sara; De Miglio, Maria R

    2016-01-01

    Epidermal growth factor receptor (EGFR) is associated with progression of many epithelial malignancies and represents a significant therapeutic target. Although clear cell renal cell carcinoma (CCRCC) has been widely investigated for EGFR molecular alterations, genetic evidences of EGFR gene activating mutations and/or gene amplification have been rarely confirmed in the literature. Therefore, until now EGFR-targeted therapies in clinical trials have been demonstrated unsuccessful. New evidence has been given about the interactions between EGFR and the sodium glucose co-transporter-1 (SGLT1) in maintaining the glucose basal intracellular level to favour cancer cell growth and survival; thus a new functional role may be attributed to EGFR, regardless of its kinase activity. To define the role of EGFR in CCRCC an extensive investigation of genetic changes and functional kinase activities was performed in a series of tumors by analyzing the EGFR mutational status and expression profile, together with the protein expression of downstream signaling pathways members. Furthermore, we investigated the co-expression of EGFR and SGLT1 proteins and their relationships with clinic-pathological features in CCRCC. EGFR protein expression was identified in 98.4% of CCRCC. Furthermore, it was described for the first time that SGLT1 is overexpressed in CCRCC (80.9%), and that co-expression with EGFR is appreciable in 79.4% of the tumours. Moreover, the activation of downstream EGFR pathways was found in about 79.4% of SGLT1-positive CCRCCs. The mutational status analysis of EGFR failed to demonstrate mutations on exons 18 to 24 and the presence of EGFR-variantIII (EGFRvIII) in all CCRCCs analyzed. FISH analysis revealed absence of EGFR amplification, and high polysomy of chromosome 7. Finally, the EGFR gene expression profile showed gene overexpression in 38.2% of CCRCCs. Our study contributes to define the complexity of EGFR role in CCRCC, identifying its bivalent kinase

  10. Kinase Associated-1 Domains Drive MARK/PAR1 Kinases to Membrane Targets by Binding Acidic Phospholipids

    Moravcevic, Katarina; Mendrola, Jeannine M.; Schmitz, Karl R.; Wang, Yu-Hsiu; Slochower, David; Janmey, Paul A.; Lemmon, Mark A. (UPENN-MED)

    2011-09-28

    Phospholipid-binding modules such as PH, C1, and C2 domains play crucial roles in location-dependent regulation of many protein kinases. Here, we identify the KA1 domain (kinase associated-1 domain), found at the C terminus of yeast septin-associated kinases (Kcc4p, Gin4p, and Hsl1p) and human MARK/PAR1 kinases, as a membrane association domain that binds acidic phospholipids. Membrane localization of isolated KA1 domains depends on phosphatidylserine. Using X-ray crystallography, we identified a structurally conserved binding site for anionic phospholipids in KA1 domains from Kcc4p and MARK1. Mutating this site impairs membrane association of both KA1 domains and intact proteins and reveals the importance of phosphatidylserine for bud neck localization of yeast Kcc4p. Our data suggest that KA1 domains contribute to coincidence detection, allowing kinases to bind other regulators (such as septins) only at the membrane surface. These findings have important implications for understanding MARK/PAR1 kinases, which are implicated in Alzheimer's disease, cancer, and autism.

  11. Molecular Imaging of the ATM Kinase Activity

    Williams, Terence M. [Department of Radiation Oncology, Ohio State University, Columbus, Ohio (United States); Nyati, Shyam [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Center for Molecular Imaging, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Ross, Brian D. [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Department of Radiology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Rehemtulla, Alnawaz, E-mail: alnawaz@umich.edu [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan