Characterization of pathogenic germline mutations in human Protein Kinases
Directory of Open Access Journals (Sweden)
Orengo Christine A
2011-07-01
Full Text Available Abstract Background Protein Kinases are a superfamily of proteins involved in crucial cellular processes such as cell cycle regulation and signal transduction. Accordingly, they play an important role in cancer biology. To contribute to the study of the relation between kinases and disease we compared pathogenic mutations to neutral mutations as an extension to our previous analysis of cancer somatic mutations. First, we analyzed native and mutant proteins in terms of amino acid composition. Secondly, mutations were characterized according to their potential structural effects and finally, we assessed the location of the different classes of polymorphisms with respect to kinase-relevant positions in terms of subfamily specificity, conservation, accessibility and functional sites. Results Pathogenic Protein Kinase mutations perturb essential aspects of protein function, including disruption of substrate binding and/or effector recognition at family-specific positions. Interestingly these mutations in Protein Kinases display a tendency to avoid structurally relevant positions, what represents a significant difference with respect to the average distribution of pathogenic mutations in other protein families. Conclusions Disease-associated mutations display sound differences with respect to neutral mutations: several amino acids are specific of each mutation type, different structural properties characterize each class and the distribution of pathogenic mutations within the consensus structure of the Protein Kinase domain is substantially different to that for non-pathogenic mutations. This preferential distribution confirms previous observations about the functional and structural distribution of the controversial cancer driver and passenger somatic mutations and their use as a proxy for the study of the involvement of somatic mutations in cancer development.
Novel mutations associated with pyruvate kinase deficiency in Brazil
Directory of Open Access Journals (Sweden)
Maria Carolina Costa Melo Svidnicki
2018-01-01
Full Text Available Background: Pyruvate kinase deficiency is a hereditary disease that affects the glycolytic pathway of the red blood cell, causing nonspherocytic hemolytic anemia. The disease is transmitted as an autosomal recessive trait and shows a marked variability in clinical expression. This study reports on the molecular characterization of ten Brazilian pyruvate kinase-deficient patients and the genotype–phenotype correlations. Method: Sanger sequencing and in silico analysis were carried out to identify and characterize the genetic mutations. A non-affected group of Brazilian individuals were also screened for the most commonly reported variants (c.1456C>T and c.1529G>A. Results: Ten different variants were identified in the PKLR gene, of which three are reported here for the first time: p.Leu61Gln, p.Ala137Val and p.Ala428Thr. All the three missense variants involve conserved amino acids, providing a rationale for the observed enzyme deficiency. The allelic frequency of c.1456C>T was 0.1% and the 1529G>A variant was not found. Conclusion: This is the first comprehensive report on molecular characterization of pyruvate kinase deficiency from South America. The results allowed us to correlate the severity of the clinical phenotype with the identified variants. Keywords: Red cell disorder, Pyruvate kinase, Mutation, Hemolytic anemia, PKLR gene
Vilarinho, Sílvia; Sari, Sinan; Yilmaz, Güldal; Stiegler, Amy L; Boggon, Titus J; Jain, Dhanpat; Akyol, Gulen; Dalgic, Buket; Günel, Murat; Lifton, Richard P
2016-06-01
Despite advances in the diagnosis and management of idiopathic noncirrhotic portal hypertension, its pathogenesis remains elusive. Insight may be gained from study of early-onset familial idiopathic noncirrhotic portal hypertension, in which Mendelian mutations may account for disease. We performed exome sequencing of eight subjects from six kindreds with onset of portal hypertension of indeterminate etiology during infancy or childhood. Three subjects from two consanguineous families shared the identical rare homozygous p.N46S mutation in DGUOK, a deoxyguanosine kinase required for mitochondrial DNA replication; haplotype sharing demonstrated that the mutation in the two families was inherited from a remote common ancestor. All three affected subjects had stable portal hypertension with noncirrhotic liver disease for 6-16 years of follow-up. This mutation impairs adenosine triphosphate binding and reduces catalytic activity. Loss-of-function mutations in DGUOK have previously been implicated in cirrhosis and liver failure but not in isolated portal hypertension. Interestingly, treatment of patients with human immunodeficiency viral infection with the nucleoside analogue didanosine is known to cause portal hypertension in a subset of patients and lowers deoxyguanosine kinase levels in vitro; the current findings implicate these effects on deoxyguanosine kinase in the causal mechanism. Our findings provide new insight into the mechanisms mediating inherited and acquired noncirrhotic portal hypertension, expand the phenotypic spectrum of DGUOK deficiency, and provide a new genetic test for a specific cause of idiopathic noncirrhotic portal hypertension. (Hepatology 2016;63:1977-1986). © 2016 by the American Association for the Study of Liver Diseases.
Complement Mutations in Diacylglycerol Kinase-ε–Associated Atypical Hemolytic Uremic Syndrome
Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago
2014-01-01
Background and objectives Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Design, setting, participants, & measurements Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Results Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol
Complement mutations in diacylglycerol kinase-ε-associated atypical hemolytic uremic syndrome.
Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago
2014-09-05
Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol kinase-ε and C3 mutations. Data suggest that complement dysregulation influences
Impact of kinase activating and inactivating patient mutations on binary PKA interactions.
Röck, Ruth; Mayrhofer, Johanna E; Bachmann, Verena; Stefan, Eduard
2015-01-01
The second messenger molecule cAMP links extracellular signals to intracellular responses. The main cellular cAMP effector is the compartmentalized protein kinase A (PKA). Upon receptor initiated cAMP-mobilization, PKA regulatory subunits (R) bind cAMP thereby triggering dissociation and activation of bound PKA catalytic subunits (PKAc). Mutations in PKAc or RIa subunits manipulate PKA dynamics and activities which contribute to specific disease patterns. Mutations activating cAMP/PKA signaling contribute to carcinogenesis or hormone excess, while inactivating mutations cause hormone deficiency or resistance. Here we extended the application spectrum of a Protein-fragment Complementation Assay based on the Renilla Luciferase to determine binary protein:protein interactions (PPIs) of the PKA network. We compared time- and dose-dependent influences of cAMP-elevation on mutually exclusive PPIs of PKAc with the phosphotransferase inhibiting RIIb and RIa subunits and the protein kinase inhibitor peptide (PKI). We analyzed PKA dynamics following integration of patient mutations into PKAc and RIa. We observed that oncogenic modifications of PKAc(L206R) and RIa(Δ184-236) as well as rare disease mutations in RIa(R368X) affect complex formation of PKA and its responsiveness to cAMP elevation. With the cell-based PKA PPI reporter platform we precisely quantified the mechanistic details how inhibitory PKA interactions and defined patient mutations contribute to PKA functions.
A novel mutation in the tyrosine kinase domain of ERBB2 in hepatocellular carcinoma
International Nuclear Information System (INIS)
Bekaii-Saab, Tanios; Williams, Nita; Plass, Christoph; Calero, Miguel Villalona; Eng, Charis
2006-01-01
Several studies showed that gain-of-function somatic mutations affecting the catalytic domain of EGFR in non-small cell lung carcinomas were associated with response to gefitinib and erlotinib, both EGFR-tyrosine kinase inhibitors. In addition, 4% of non-small cell lung carcinomas were shown to have ERBB2 mutations in the kinase domain. In our study, we sought to determine if similar respective gain-of-function EGFR and ERBB2 mutations were present in hepatoma and/or biliary cancers. We extracted genomic DNA from 40 hepatoma (18) and biliary cancers (22) samples, and 44 adenocarcinomas of the lung, this latter as a positive control for mutation detection. We subjected those samples to PCR-based semi-automated double stranded nucleotide sequencing targeting exons 18–21 of EGFR and ERBB2. All samples were tested against matched normal DNA. We found 11% of hepatoma, but no biliary cancers, harbored a novel ERBB2 H878Y mutation in the activating domain. These newly described mutations may play a role in predicting response to EGFR-targeted therapy in hepatoma and their role should be explored in prospective studies
Mutation of serine 1333 in the ATR HEAT repeats creates a hyperactive kinase.
Directory of Open Access Journals (Sweden)
Jessica W Luzwick
Full Text Available Subcellular localization, protein interactions, and post-translational modifications regulate the DNA damage response kinases ATR, ATM, and DNA-PK. During an analysis of putative ATR phosphorylation sites, we found that a single mutation at S1333 creates a hyperactive kinase. In vitro and in cells, mutation of S1333 to alanine (S1333A-ATR causes elevated levels of kinase activity with and without the addition of the protein activator TOPBP1. S1333 mutations to glycine, arginine, or lysine also create a hyperactive kinase, while mutation to aspartic acid decreases ATR activity. S1333A-ATR maintains the G2 checkpoint and promotes completion of DNA replication after transient exposure to replication stress but the less active kinase, S1333D-ATR, has modest defects in both of these functions. While we find no evidence that S1333 is phosphorylated in cultured cells, our data indicate that small changes in the HEAT repeats can have large effects on kinase activity. These mutants may serve as useful tools for future studies of the ATR pathway.
Kin-Driver: a database of driver mutations in protein kinases.
Simonetti, Franco L; Tornador, Cristian; Nabau-Moretó, Nuria; Molina-Vila, Miguel A; Marino-Buslje, Cristina
2014-01-01
Somatic mutations in protein kinases (PKs) are frequent driver events in many human tumors, while germ-line mutations are associated with hereditary diseases. Here we present Kin-driver, the first database that compiles driver mutations in PKs with experimental evidence demonstrating their functional role. Kin-driver is a manual expert-curated database that pays special attention to activating mutations (AMs) and can serve as a validation set to develop new generation tools focused on the prediction of gain-of-function driver mutations. It also offers an easy and intuitive environment to facilitate the visualization and analysis of mutations in PKs. Because all mutations are mapped onto a multiple sequence alignment, analogue positions between kinases can be identified and tentative new mutations can be proposed for studying by transferring annotation. Finally, our database can also be of use to clinical and translational laboratories, helping them to identify uncommon AMs that can correlate with response to new antitumor drugs. The website was developed using PHP and JavaScript, which are supported by all major browsers; the database was built using MySQL server. Kin-driver is available at: http://kin-driver.leloir.org.ar/ © The Author(s) 2014. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
Anshuman Dixit
2009-08-01
Full Text Available Structural and functional studies of the ABL and EGFR kinase domains have recently suggested a common mechanism of activation by cancer-causing mutations. However, dynamics and mechanistic aspects of kinase activation by cancer mutations that stimulate conformational transitions and thermodynamic stabilization of the constitutively active kinase form remain elusive. We present a large-scale computational investigation of activation mechanisms in the ABL and EGFR kinase domains by a panel of clinically important cancer mutants ABL-T315I, ABL-L387M, EGFR-T790M, and EGFR-L858R. We have also simulated the activating effect of the gatekeeper mutation on conformational dynamics and allosteric interactions in functional states of the ABL-SH2-SH3 regulatory complexes. A comprehensive analysis was conducted using a hierarchy of computational approaches that included homology modeling, molecular dynamics simulations, protein stability analysis, targeted molecular dynamics, and molecular docking. Collectively, the results of this study have revealed thermodynamic and mechanistic catalysts of kinase activation by major cancer-causing mutations in the ABL and EGFR kinase domains. By using multiple crystallographic states of ABL and EGFR, computer simulations have allowed one to map dynamics of conformational fluctuations and transitions in the normal (wild-type and oncogenic kinase forms. A proposed multi-stage mechanistic model of activation involves a series of cooperative transitions between different conformational states, including assembly of the hydrophobic spine, the formation of the Src-like intermediate structure, and a cooperative breakage and formation of characteristic salt bridges, which signify transition to the active kinase form. We suggest that molecular mechanisms of activation by cancer mutations could mimic the activation process of the normal kinase, yet exploiting conserved structural catalysts to accelerate a conformational transition
Comparative active-site mutation study of human and Caenorhabditis elegans thymidine kinase 1
DEFF Research Database (Denmark)
Skovgaard, Tine; Uhlin, Ulla; Munch-Petersen, Birgitte
2012-01-01
surrounding the substrate base. In CeTK1, some of these mutations led to increased activity with deoxycytidine and deoxyguanosine, two unusual substrates for TK1-like kinases. In HuTK1, mutation of T163 to S resulted in a kinase with a 140-fold lower K(m) for the antiviral nucleoside analogue 3'-azido-3...
Identification of a Non-Gatekeeper Hot Spot for Drug-Resistant Mutations in mTOR Kinase.
Wu, Tzung-Ju; Wang, Xiaowen; Zhang, Yanjie; Meng, Linghua; Kerrigan, John E; Burley, Stephen K; Zheng, X F Steven
2015-04-21
Protein kinases are therapeutic targets for human cancer. However, "gatekeeper" mutations in tyrosine kinases cause acquired clinical resistance, limiting long-term treatment benefits. mTOR is a key cancer driver and drug target. Numerous small-molecule mTOR kinase inhibitors have been developed, with some already in human clinical trials. Given our clinical experience with targeted therapeutics, acquired drug resistance in mTOR is thought likely, but not yet documented. Herein, we describe identification of a hot spot (L2185) for drug-resistant mutations, which is distinct from the gatekeeper site, and a chemical scaffold refractory to drug-resistant mutations. We also provide new insights into mTOR kinase structure and function. The hot spot mutations are potentially useful as surrogate biomarkers for acquired drug resistance in ongoing clinical trials and future treatments and for the design of the next generation of mTOR-targeted drugs. Our study provides a foundation for further research into mTOR kinase function and targeting. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Phosphorylation of the Yeast Choline Kinase by Protein Kinase C
Choi, Mal-Gi; Kurnov, Vladlen; Kersting, Michael C.; Sreenivas, Avula; Carman, George M.
2005-01-01
The Saccharomyces cerevisiae CKI1-encoded choline kinase catalyzes the committed step in phosphatidylcholine synthesis via the Kennedy pathway. The enzyme is phosphorylated on multiple serine residues, and some of this phosphorylation is mediated by protein kinase A. In this work, we examined the hypothesis that choline kinase is also phosphorylated by protein kinase C. Using choline kinase as a substrate, protein kinase C activity was dose- and time-dependent, and dependent on the concentrations of choline kinase (Km = 27 μg/ml) and ATP (Km = 15 μM). This phosphorylation, which occurred on a serine residue, was accompanied by a 1.6-fold stimulation of choline kinase activity. The synthetic peptide SRSSS25QRRHS (Vmax/Km = 17.5 mM-1 μmol min-1 mg-1) that contains the protein kinase C motif for Ser25 was a substrate for protein kinase C. A Ser25 to Ala (S25A) mutation in choline kinase resulted in a 60% decrease in protein kinase C phosphorylation of the enzyme. Phosphopeptide mapping analysis of the S25A mutant enzyme confirmed that Ser25 was a protein kinase C target site. In vivo, the S25A mutation correlated with a decrease (55%) in phosphatidylcholine synthesis via the Kennedy pathway whereas an S25D phosphorylation site mimic correlated with an increase (44%) in phosphatidylcholine synthesis. Whereas the S25A (protein kinase C site) mutation did not affect the phosphorylation of choline kinase by protein kinase A, the S30A (protein kinase A site) mutation caused a 46% reduction in enzyme phosphorylation by protein kinase C. A choline kinase synthetic peptide (SQRRHS30LTRQ) containing Ser30 was a substrate (Vmax/Km = 3.0 mM−1 μmol min−1 mg−1) for protein kinase C. Comparison of phosphopeptide maps of the wild type and S30A mutant choline kinase enzymes phosphorylated by protein kinase C confirmed that Ser30 was also a target site for protein kinase C. PMID:15919656
Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.
Directory of Open Access Journals (Sweden)
Harry F Heijnen
Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.
Directory of Open Access Journals (Sweden)
Jenifer L Marks
2007-05-01
Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.
Akula, Sravani; Kamasani, Swapna; Sivan, Sree Kanth; Manga, Vijjulatha; Vudem, Dashavantha Reddy; Kancha, Rama Krishna
2018-05-01
A significant proportion of patients with lung cancer carry mutations in the EGFR kinase domain. The presence of a deletion mutation in exon 19 or L858R point mutation in the EGFR kinase domain has been shown to cause enhanced efficacy of inhibitor treatment in patients with NSCLC. Several less frequent (uncommon) mutations in the EGFR kinase domain with potential implications in treatment response have also been reported. The role of a limited number of uncommon mutations in drug sensitivity was experimentally verified. However, a huge number of these mutations remain uncharacterized for inhibitor sensitivity or resistance. A large-scale computational analysis of clinically reported 298 point mutants of EGFR kinase domain has been performed, and drug sensitivity profiles for each mutant toward seven kinase inhibitors has been determined by molecular docking. In addition, the relative inhibitor binding affinity toward each drug as compared with that of adenosine triphosphate was calculated for each mutant. The inhibitor sensitivity profiles predicted in this study for a set of previously characterized mutants correlated well with the published clinical, experimental, and computational data. Both the single and compound mutations displayed differential inhibitor sensitivity toward first- and next-generation kinase inhibitors. The present study provides predicted drug sensitivity profiles for a large panel of uncommon EGFR mutations toward multiple inhibitors, which may help clinicians in deciding mutant-specific treatment strategies. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
Novel mutations in cyclin-dependent kinase-like 5 (CDKL5) gene in Indian cases of Rett syndrome.
Das, Dhanjit Kumar; Mehta, Bhakti; Menon, Shyla R; Raha, Sarbani; Udani, Vrajesh
2013-03-01
Rett syndrome is a severe neurodevelopmental disorder, almost exclusively affecting females and characterized by a wide spectrum of clinical manifestations. Both the classic and atypical forms of Rett syndrome are primarily due to mutations in the methyl-CpG-binding protein 2 (MECP2) gene. Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with atypical Rett syndrome, X-linked infantile spasms sharing common features of generally early-onset seizures and mental retardation. CDKL5 is known as serine/threonine protein kinase 9 (STK9) and is mapped to the Xp22 region. It has a conserved serine/threonine kinase domain within its amino terminus and a large C-terminal region. Disease-causing mutations are distributed in both the amino terminal domain and in the large C-terminal domain. We have screened the CDKL5 gene in 44 patients with atypical Rett syndrome who had tested negative for MECP2 gene mutations and have identified 6 sequence variants, out of which three were novel and three known mutations. Two of these novel mutations p.V966I and p.A1011V were missense and p.H589H a silent mutation. Other known mutations identified were p.V999M, p.Q791P and p.T734A. Sequence homology for all the mutations revealed that the two mutations (p.Q791P and p.T734A) were conserved across species. This indicated the importance of these residues in structure and function of the protein. The damaging effects of these mutations were analysed in silico using PolyPhen-2 online software. The PolyPhen-2 scores of p.Q791P and p.T734A were 0.998 and 0.48, revealing that these mutations could be deleterious and might have potential functional effect. All other mutations had a low score suggesting that they might not alter the activity of CDKL5. We have also analysed the position of the mutations in the CDKL5 protein and found that all the mutations were present in the C-terminal domain of the protein. The C-terminal domain is required for
Directory of Open Access Journals (Sweden)
Xu PP
2017-09-01
Full Text Available Peipei Xu,1 Dan Guo,2 Xiaoyan Shao,1 Miaoxin Peng,1 Bing Chen2 1Department of Hematology, Drum Tower Hospital, School of Medicine, Nanjing University, 2Department of Hematology, Nanjing Drum Tower Hospital Clinical College of Nanjing Medical University, Nanjing, People’s Republic of China Background: TKIs are the first-line treatment for patients with Ph-positive (Ph+ leukemia. However, drug resistance is frequently observed, mainly due to mutations within the breakpoint cluster region-Abelson leukemia virus (BCR-ABL kinase domain. The T315I substitution confers complete resistance to TKIs. The aim of this study was to analyze the clinical characteristics of 17 patients with T315I mutation after TKI treatment and provide a basis for prognosis.Patients and methods: The clinical data of 17 TKI-resistant Ph+ leukemia patients who were found to have a ABL kinase domain mutation from September 2008 to January 2017 were collected. Karyotypes and BCR-ABL fusion gene were analyzed by R-banding and fluorescence in situ hybridization, respectively. Total RNA was extracted by TRIzol reagent, and the ABL kinase domain mutation was detected by direct sequencing.Results: A total of 17 patients reached effective remission including major molecular response and complete cytogenetic response. However, all the patients subsequently developed a T315I mutation after treatment with TKIs. The rate of the BCR-ABL fusion gene in most of the patients who developed the T315I mutation was significantly higher than that before the mutation. At initial diagnosis, patients average platelet count was 149.7×109/L, whereas the average platelet count was only 53.88×109/L after the T315I mutation (P<0.01. The results also showed that the survival time of patients with a high proportion of blast cells or a high number of white blood cells was obviously shortened.Conclusion: Patients platelet count decreased when detected with the T315I mutation compared with the initial
Wang, Liya; Limongelli, Anna; Vila, Maya R; Carrara, Franco; Zeviani, Massimo; Eriksson, Staffan
2005-01-01
Thymidine kinase 2 (TK2) and deoxyguanosine kinase (dGK) are the two key enzymes in mitochondrial DNA (mtDNA) precursor synthesis. Deficiencies in TK2 or dGK activity, due to genetic alteration, have been shown to cause tissue-specific depletion of mtDNA. In the case of TK2 deficiency, affected individuals suffer severe myopathy and, in the case of dGK deficiency, devastating liver or multi-systemic disease. Here, we report clinical and biochemical findings from two patients with mtDNA depletion syndrome. Patient A was a compound heterozygote carrying the previously reported T77M mutation and a novel mutation (R161K) in the TK2 gene. Patient B carried a novel mutation (L250S) in the dGK gene. The clinical symptoms of patient A included muscular weakness and exercise intolerance due to a severe mitochondrial myopathy associated with a 92% reduction in mtDNA. There was minimal involvement of other organs. Patient B suffered from rapidly progressive, early onset fatal liver failure associated with profoundly decreased mtDNA levels in liver and, to a lesser extent, in skeletal muscle. Site-directed mutagenesis was used to introduce the mutations detected in patients A and B into the TK2 and dGK cDNAs, respectively. We then characterized each of these recombinant enzymes. Catalytic activities of the three mutant enzymes were reduced to about 2-4% for TK2 and 0.5% for dGK as compared to the wild-type enzymes. Altered competition between dCyd and dThd was observed for the T77M mutant. The residual activities of the two mitochondrial enzymes correlated directly with disease development.
Mutation Study of Two Thymidine Kinases
DEFF Research Database (Denmark)
Skovgaard, Tine; Munch-Petersen, Birgitte; Eklund, Hans
that phosphorylates all the natural deoxyribonucleosides and like insects, C. elegans only contains a single deoxyribonucleoside kinase-like gene. In contrast to the insects, however, the protein encoded by the elegans gene is 46 % identical to human TK1 (HuTK1) and have no homology to the insect kinase. Like HuTK1...... the C. elegans kinase (CeTK1) has thymidine as the preferred substrate, but it also displays activity with deoxyguanosine, though with high Km. A number of point mutations have been introduced in the active site of both the human and elegans TK's in order to change the substrate specificity away from...... not phosphorylate the anticancer analog 1-β-D-arabinofuranosylcytosine (AraC), however. The HuTK1 mutant has been crystallized, and azidothymidine monophosphate has been modelled into the active site....
International Nuclear Information System (INIS)
Zolkipli, Zarazuela; Surtees, Robert; Dahmoush, Hisham; Saunders, Dawn E.; Kling Chong, W.K.
2006-01-01
It has been postulated that all patients with pantothenate kinase 2 (PANK2) mutations causing pantothenate-kinase-associated neurodegeneration (PKAN) are associated with the 'eye-of-the-tiger' sign on MRI. We report a pair of siblings who presented with dystonia and who have been found to be homozygous for 104C>A, S35X mutation, confirming the diagnosis of PKAN. They do not have the typical iron deposition in the globi pallida or substantia nigra on MR imaging. (orig.)
Targeting oncoprotein stability overcomes drug resistance caused by FLT3 kinase domain mutations.
Directory of Open Access Journals (Sweden)
Chuanjiang Yu
Full Text Available FLT3 is the most frequently mutated kinase in acute myeloid leukemia (AML. Internal tandem duplications (ITDs in the juxta-membrane region constitute the majority of activating FLT3 mutations. Several FLT3 kinase inhibitors were developed and tested in the clinic with significant success. However, recent studies have reported the development of secondary drug resistance in patients treated with FLT3 inhibitors. Since FLT3-ITD is an HSP90 client kinase, we here explored if targeting the stability of drug-resistant FLT3 mutant protein could be a potential therapeutic option. We observed that HSP90 inhibitor treatment resulted in the degradation of inhibitor-resistant FLT3-ITD mutants and selectively induced toxicity in cells expressing FLT3-ITD mutants. Thus, HSP90 inhibitors provide a potential therapeutic choice to overcome secondary drug resistance following TKI treatment in FLT3-ITD positive AML.
Identifying pathways affected by cancer mutations.
Iengar, Prathima
2017-12-16
Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Vorechovský, I; Luo, L; Hertz, Jens Michael
1997-01-01
Mutation pattern was characterized in the Bruton's tyrosine kinase gene (BTK) in 26 patients with X-linked agammaglobulinemia, the first described immunoglobulin deficiency, and was related to BTK expression. A total of 24 different mutations were identified. Most BTK mutations were found to result...
Directory of Open Access Journals (Sweden)
Yang Shu
Full Text Available Recent studies have linked certain single nucleotide polymorphisms in the leucine-rich repeat kinase 2 (LRRK2 gene with Parkinson's disease (PD. Among the mutations, LRRK2 c.4883G>C (R1628P variant was identified to have a significant association with the risk of PD in ethnic Han-Chinese populations. But the molecular pathological mechanisms of R1628P mutation in PD is still unknown.Unlike other LRRK2 mutants in the Roc-COR-Kinase domain, the R1628P mutation didn't alter the LRRK2 kinase activity and promote neuronal death directly. LRRK2 R1628P mutation increased the binding affinity of LRRK2 with Cyclin-dependent kinase 5 (Cdk5. Interestingly, R1628P mutation turned its adjacent amino acid residue S1627 on LRRK2 protein to a novel phosphorylation site of Cdk5, which could be defined as a typical type II (+ phosphorylation-related single nucleotide polymorphism. Importantly, we showed that the phosphorylation of S1627 by Cdk5 could activate the LRRK2 kinase, and neurons ectopically expressing R1628P displayed a higher sensitivity to 1-methyl-4-phenylpyridinium, a bioactive metabolite of environmental toxin MPTP, in a Cdk5-dependent manner.Our data indicate that Parkinson-related LRRK2 mutation R1628P leads to Cdk5 phosphorylation of LRRK2 at S1627, which would upregulate the kinase activity of LRRK2 and consequently cause neuronal death.
Boulbes, Delphine R.; Arold, Stefan T.; Chauhan, Gaurav B.; Blachno, Korina V.; Deng, Nanfu; Chang, Wei-Chao; Jin, Quanri; Huang, Tzu-Hsuan; Hsu, Jung-Mao; Brady, Samuel W.; Bartholomeusz, Chandra; Ladbury, John E.; Stone, Steve; Yu, Dihua; Hung, Mien-Chie; Esteva, Francisco J.
2014-01-01
Resistance to HER2-targeted therapies remains a major obstacle in the treatment of HER2-overexpressing breast cancer. Understanding the molecular pathways that contribute to the development of drug resistance is needed to improve the clinical utility of novel agents, and to predict the success of targeted personalized therapy based on tumor-specific mutations. Little is known about the clinical significance of HER family mutations in breast cancer. Because mutations within HER1/EGFR are predictive of response to tyrosine kinase inhibitors (TKI) in lung cancer, we investigated whether mutations in HER family kinase domains are predictive of response to targeted therapy in HER2-overexpressing breast cancer. We sequenced the HER family kinase domains from 76 HER2-overexpressing invasive carcinomas and identified 12 missense variants. Patients whose tumors carried any of these mutations did not respond to HER2 directed therapy in the metastatic setting. We developed mutant cell lines and used structural analyses to determine whether changes in protein conformation could explain the lack of response to therapy. We also functionally studied all HER2 mutants and showed that they conferred an aggressive phenotype and altered effects of the TKI lapatinib. Our data demonstrate that mutations in the finely tuned HER kinase domains play a critical function in breast cancer progression and may serve as prognostic and predictive markers.
Boulbes, Delphine R.
2014-11-11
Resistance to HER2-targeted therapies remains a major obstacle in the treatment of HER2-overexpressing breast cancer. Understanding the molecular pathways that contribute to the development of drug resistance is needed to improve the clinical utility of novel agents, and to predict the success of targeted personalized therapy based on tumor-specific mutations. Little is known about the clinical significance of HER family mutations in breast cancer. Because mutations within HER1/EGFR are predictive of response to tyrosine kinase inhibitors (TKI) in lung cancer, we investigated whether mutations in HER family kinase domains are predictive of response to targeted therapy in HER2-overexpressing breast cancer. We sequenced the HER family kinase domains from 76 HER2-overexpressing invasive carcinomas and identified 12 missense variants. Patients whose tumors carried any of these mutations did not respond to HER2 directed therapy in the metastatic setting. We developed mutant cell lines and used structural analyses to determine whether changes in protein conformation could explain the lack of response to therapy. We also functionally studied all HER2 mutants and showed that they conferred an aggressive phenotype and altered effects of the TKI lapatinib. Our data demonstrate that mutations in the finely tuned HER kinase domains play a critical function in breast cancer progression and may serve as prognostic and predictive markers.
Mutations and phenotype in isolated glycerol kinase deficiency
Energy Technology Data Exchange (ETDEWEB)
Walker, A.P.; Muscatelli, F.; Stafford, A.N.; Monaco, A.P. [Inst. of Molecular Medicine, Oxford (United Kingdom)] [and others
1996-06-01
We demonstrate that isolated glycerol kinase (GK) deficiency in three families results from mutation of the Xp21 GK gene. GK mutations were detected in four patients with widely differing phenotypes. Patient 1 had a splice-site mutation causing premature termination. His general health was good despite absent GK activity, indicating that isolated GK deficiency can be silent. Patient 2 had GK deficiency and a severe phenotype involving psychomotor retardation and growth delay, bone dysplasia, and seizures, similar to the severe phenotype of one of the first described cases of GK deficiency. His younger brother, patient 3, also had GK deficiency, but so far his development has been normal. GK exon 17 was deleted in both brothers, implicating additional factors in causation of the severe phenotype of patient 2. Patient 4 had both GK deficiency with mental retardation and a GK missense mutation (D440V). Possible explanations for the phenotypic variation of these four patients include ascertainment bias; metabolic or environmental stress as a precipitating factor in revealing GK-related changes, as has previously been described in juvenile GK deficiency; and interactions with functional polymorphisms in other genes that alter the effect of GK deficiency on normal development. 36 refs., 4 figs., 1 tab.
Frangini, Miriam; Rampazzo, Chiara; Franzolin, Elisa; Lara, Mari-Carmen; Vilà, Maya R; Martí, Ramon; Bianchi, Vera
2009-02-01
Mitochondrial thymidine kinase (TK2) catalyzes the phosphorylation of thymidine in mitochondria. Its function becomes essential for dTTP synthesis in noncycling cells, where cytosolic dTTP synthesis via R1/R2 ribonucleotide reductase and thymidine kinase 1 is turned down. Mutations in the nuclear gene for TK2 cause a fatal mtDNA depletion syndrome. Only selected cell types are affected, suggesting that the other cells compensate for the TK2 deficiency by adapting the enzyme network that regulates dTTP synthesis outside S-phase. Here we looked for such metabolic adaptation in quiescent cultures of fibroblasts from two TK2-deficient patients with a slow-progressing syndrome. In cell extracts, we measured the activities of TK2, deoxycytidine kinase, thymidine phosphorylase, deoxynucleotidases and the amounts of the three ribonucleotide reductase subunits. Patient cells contained 40% or 5% TK2 activity and unchanged activities of the other enzymes. However, their mitochondrial and cytosolic dTTP pools were unchanged, and also the overall composition of the dNTP pools was normal. TK2-dependent phosphorylation of [(3)H]thymidine in intact cells and the turnover of the dTTP pool showed that even the fibroblasts with 5% residual TK2 activity synthesized dTTP at an almost normal rate. Normal fibroblasts apparently contain more TK2 than needed to maintain dTTP during quiescence, which would explain why TK2-mutated fibroblasts do not manifest mtDNA depletion despite their reduced TK2 activity.
Directory of Open Access Journals (Sweden)
Rafael Herrera-Esparza
2013-01-01
Full Text Available Fibrodysplasia ossificans progressiva (FOP is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2. A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP signalling that causes FOP.
Koltes, James E; Mishra, Bishnu P; Kumar, Dinesh; Kataria, Ranjit S; Totir, Liviu R; Fernando, Rohan L; Cobbold, Rowland; Steffen, David; Coppieters, Wouter; Georges, Michel; Reecy, James M
2009-11-17
Historically, dwarfism was the major genetic defect in U.S. beef cattle. Aggressive culling and sire testing were used to minimize its prevalence; however, neither of these practices can eliminate a recessive genetic defect. We assembled a 4-generation pedigree to identify the mutation underlying dwarfism in American Angus cattle. An adaptation of the Elston-Steward algorithm was used to overcome small pedigree size and missing genotypes. The dwarfism locus was fine-mapped to BTA6 between markers AFR227 and BM4311. Four candidate genes were sequenced, revealing a nonsense mutation in exon 15 of cGMP-dependant type II protein kinase (PRKG2). This C/T transition introduced a stop codon (R678X) that truncated 85 C-terminal amino acids, including a large portion of the kinase domain. Of the 75 mutations discovered in this region, only this mutation was 100% concordant with the recessive pattern of inheritance in affected and carrier individuals (log of odds score = 6.63). Previous research has shown that PRKG2 regulates SRY (sex-determining region Y) box 9 (SOX9)-mediated transcription of collagen 2 (COL2). We evaluated the ability of wild-type (WT) or R678X PRKG2 to regulate COL2 expression in cell culture. Real-time PCR results confirmed that COL2 is overexpressed in cells that overexpressed R678X PRKG2 as compared with WT PRKG2. Furthermore, COL2 and COL10 mRNA expression was increased in dwarf cattle compared with unaffected cattle. These experiments indicate that the R678X mutation is functional, resulting in a loss of PRKG2 regulation of COL2 and COL10 mRNA expression. Therefore, we present PRKG2 R678X as a causative mutation for dwarfism cattle.
Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D
2015-11-01
Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
X-linked agammaglobulinemia - first case with Bruton tyrosine kinase mutation from Pakistan.
Zaidi, Samreen Kulsom; Qureshi, Sonia; Qamar, Farah Naz
2017-03-01
X-linked agammaglobulinemia (XLA) is a primary immunodeficiency with more than 600 mutations in Bruton tyrosine kinase (Bkt) gene which are responsible for early-onset agammaglobulinemia and repeated infections. Herein we present a case of a 3-year-old boy with history of repeated diarrhoea and an episode of meningoencephalitis with hemiplegia. The workup showed extremely low levels of immunoglobulin with low CD+19 cells. Genetic analysis showed Btk mutation 18 c.1883delCp.T628fs. To the best of our knowledge this is the first report of a case of XLA confirmed by molecular technique from Pakistan.
Somatic mutations affect key pathways in lung adenocarcinoma
Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.
2009-01-01
Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947
Adrenal incidentaloma and the Janus Kinase 2 V617F mutation: A case-based review of the literature
Directory of Open Access Journals (Sweden)
Mustafa Unubol
2013-01-01
Full Text Available Adrenal incidentaloma was detected in an 81-year-old male patient and a 37-year-old female patient who had been diagnosed with essential thrombocytosis. Each patient′s Janus Kinase 2 (JAK2 V617F mutation was positive, and they were evaluated as having non-functional adrenal incidentaloma. The JAK2 activates the signal transducers and activators of transcription (STAT proteins which then activate the phosphoinositol-3 kinases, Ras, mitogen-activated protein (MAP kinases, and transcription. Constitutive activation causes cell proliferation and dysregulation of apoptosis. It is thought that STAT3 activation-mediated JAK family kinases have a central role in the solid tumor cell series. Permanent activation of STAT3 and STAT5 causes tumor cell proliferation, survival, metastasis, and an increase in tumor-mediated inflammation in solid and hematologic tumors. According to our literature screening, irregular JAK signaling, seen at the pathogenesis of many solid and hematologic tumors, has not been previously evaluated with regard to adrenal tumors. As a result, our cases are the first coexistence of JAK V617F mutation with adrenal incidentaloma in the literature. Because of this, we think that JAK2 mutation must be evaluated to clarify the etiology of adrenal incidentalomas.
Facchinetti, Francesco; Loriot, Yohann; Kuo, Mei-Shiue; Mahjoubi, Linda; Lacroix, Ludovic; Planchard, David; Besse, Benjamin; Farace, Françoise; Auger, Nathalie; Remon, Jordi; Scoazec, Jean-Yves; André, Fabrice; Soria, Jean-Charles; Friboulet, Luc
2016-12-15
The identification of molecular mechanisms conferring resistance to tyrosine kinase inhibitor (TKI) is a key step to improve therapeutic results for patients with oncogene addiction. Several alterations leading to EGFR and anaplastic lymphoma kinase (ALK) resistance to TKI therapy have been described in non-small cell lung cancer (NSCLC). Only two mutations in the ROS1 kinase domain responsible for crizotinib resistance have been described in patients thus far. A patient suffering from a metastatic NSCLC harboring an ezrin (EZR)-ROS1 fusion gene developed acquired resistance to the ALK/ROS1 inhibitor crizotinib. Molecular analysis (whole-exome sequencing, CGH) and functional studies were undertaken to elucidate the mechanism of resistance. Based on this case, we took advantage of the structural homology of ROS1 and ALK to build a predictive model for drug sensitivity regarding future ROS1 mutations. Sequencing revealed a dual mutation, S1986Y and S1986F, in the ROS1 kinase domain. Functional in vitro studies demonstrated that ROS1 harboring either the S1986Y or the S1986F mutation, while conferring resistance to crizotinib and ceritinib, was inhibited by lorlatinib (PF-06463922). The patient's clinical response confirmed the potency of lorlatinib against S1986Y/F mutations. The ROS1 S1986Y/F and ALK C1156Y mutations are homologous and displayed similar sensitivity patterns to ALK/ROS1 TKIs. We extended this analogy to build a model predicting TKI efficacy against potential ROS1 mutations. Clinical evidence, in vitro validation, and homology-based prediction provide guidance for treatment decision making for patients with ROS1-rearranged NSCLC who progressed on crizotinib. Clin Cancer Res; 22(24); 5983-91. ©2016 AACR. ©2016 American Association for Cancer Research.
International Nuclear Information System (INIS)
Haupt, Armin; Dahl, Andreas; Lappe, Michael; Lehrach, Hans; Gonzalez, Cayetano; Drewes, Gerard; Lange, Bodo MH; Joberty, Gerard; Bantscheff, Marcus; Fröhlich, Holger; Stehr, Henning; Schweiger, Michal R; Fischer, Axel; Kerick, Martin; Boerno, Stefan T
2012-01-01
The heat shock protein 90 (Hsp90) is required for the stability of many signalling kinases. As a target for cancer therapy it allows the simultaneous inhibition of several signalling pathways. However, its inhibition in healthy cells could also lead to severe side effects. This is the first comprehensive analysis of the response to Hsp90 inhibition at the kinome level. We quantitatively profiled the effects of Hsp90 inhibition by geldanamycin on the kinome of one primary (Hs68) and three tumour cell lines (SW480, U2OS, A549) by affinity proteomics based on immobilized broad spectrum kinase inhibitors ('kinobeads'). To identify affected pathways we used the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway classification. We combined Hsp90 and proteasome inhibition to identify Hsp90 substrates in Hs68 and SW480 cells. The mutational status of kinases from the used cell lines was determined using next-generation sequencing. A mutation of Hsp90 candidate client RIPK2 was mapped onto its structure. We measured relative abundances of > 140 protein kinases from the four cell lines in response to geldanamycin treatment and identified many new potential Hsp90 substrates. These kinases represent diverse families and cellular functions, with a strong representation of pathways involved in tumour progression like the BMP, MAPK and TGF-beta signalling cascades. Co-treatment with the proteasome inhibitor MG132 enabled us to classify 64 kinases as true Hsp90 clients. Finally, mutations in 7 kinases correlate with an altered response to Hsp90 inhibition. Structural modelling of the candidate client RIPK2 suggests an impact of the mutation on a proposed Hsp90 binding domain. We propose a high confidence list of Hsp90 kinase clients, which provides new opportunities for targeted and combinatorial cancer treatment and diagnostic applications
Lesko, Nicole; Naess, Karin; Wibom, Rolf; Solaroli, Nicola; Nennesmo, Inger; von Döbeln, Ulrika; Karlsson, Anna; Larsson, Nils-Göran
2010-03-01
Deficiency of thymidine kinase-2 (TK2) has been described in children with early onset fatal skeletal myopathy. TK2 is a mitochondrial deoxyribonucleoside kinase required for the phosphorylation of deoxycytidine and deoxythymidine and hence is vital for the maintenance of a balanced mitochondrial dNTP pool in post-mitotic tissues. We describe a patient with two novel TK2 mutations, which caused disease onset shortly after birth and death at the age of three months. One mutation (219insCG) generated an early stop codon, thus preventing the synthesis of a functional protein. The second mutation (R130W) resulted in an amino acid substitution, which caused a severe reduction (TK2 enzyme activity. These two novel TK2 mutations cause an extremely severe phenotype with overwhelming central nervous system symptoms not commonly seen in patients with TK2-deficiency. We conclude that the severe clinical presentation in this patient was due to a virtual lack of mitochondrial TK2 activity. Copyright 2009 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Zafar Iqbal
Full Text Available BACKGROUND: BCR-ABL kinase domain mutations are infrequently detected in newly diagnosed chronic-phase chronic myeloid leukemia (CML patients. Recent studies indicate the presence of pre-existing BCR-ABL mutations in a higher percentage of CML patients when CD34+ stem/progenitor cells are investigated using sensitive techniques, and these mutations are associated with imatinib resistance and disease progression. However, such studies were limited to smaller number of patients. METHODS: We investigated BCR-ABL kinase domain mutations in CD34+ cells from 100 chronic-phase CML patients by multiplex allele-specific PCR and sequencing at diagnosis. Mutations were re-investigated upon manifestation of imatinib resistance using allele-specific PCR and direct sequencing of BCR-ABL kinase domain. RESULTS: Pre-existing BCR-ABL mutations were detected in 32/100 patients and included F311L, M351T, and T315I. After a median follow-up of 30 months (range 8-48, all patients with pre-existing BCR-ABL mutations exhibited imatinib resistance. Of the 68 patients without pre-existing BCR-ABL mutations, 24 developed imatinib resistance; allele-specific PCR and BCR-ABL kinase domain sequencing detected mutations in 22 of these patients. All 32 patients with pre-existing BCR-ABL mutations had the same mutations after manifestation of imatinib-resistance. In imatinib-resistant patients without pre-existing BCR-ABL mutations, we detected F311L, M351T, Y253F, and T315I mutations. All imatinib-resistant patients except T315I and Y253F mutations responded to imatinib dose escalation. CONCLUSION: Pre-existing BCR-ABL mutations can be detected in a substantial number of chronic-phase CML patients by sensitive allele-specific PCR technique using CD34+ cells. These mutations are associated with imatinib resistance if affecting drug binding directly or indirectly. After the recent approval of nilotinib, dasatinib, bosutinib and ponatinib for treatment of chronic myeloid
Directory of Open Access Journals (Sweden)
Wang WX
2016-01-01
Full Text Available Wenxian Wang,1 Xiaowen Jiang,1 Zhengbo Song,1,2 Yiping Zhang1,2 1Department of Chemotherapy, Zhejiang Cancer Hospital, 2Key Laboratory Diagnosis and Treatment Technology on Thoracic Oncology, Hangzhou, Zhejiang, People’s Republic of China Abstract: Anaplastic lymphoma kinase (ALK rearrangement lung cancer responds to ALK tyrosine kinase inhibitors. It is known that many cases ultimately acquired resistance to crizotinib. However, a case of primary resistance is rare. We present a case of harboring exon 19 deletion in epidermal growth factor receptor in ALK rearranged lung adenocarcinoma, who experienced a partial tumor response to icotinib after failure with crizotinib therapy and chemotherapy. Considering the partial response, we conclude that it is important to find the cause of resistance to crizotinib. We detected gene mutations with plasma by the next-generation sequencing; the next-generation sequencing demonstrates an attractive system to identify mutations improving the outcome of patients with a deadly disease. Keywords: non-small cell lung cancer, anaplastic lymphoma kinase, crizotinib, epidermal growth factor receptor
DEFF Research Database (Denmark)
Klein, H H; Müller, R; Vestergaard, H
1999-01-01
We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...
Chaudhari, Aditi; Krumlinde, Daniel; Lundqvist, Annika; Akyürek, Levent M; Bandaru, Sashidhar; Skålén, Kristina; Ståhlman, Marcus; Borén, Jan; Wettergren, Yvonne; Ejeskär, Katarina; Rotter Sopasakis, Victoria
2015-10-01
The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) catalytic subunit p110α is the most frequently mutated kinase in human cancer, and the hot spot mutations E542K, E545K, and H1047R are the most common mutations in p110α. Very little is known about the metabolic consequences of the hot spot mutations of p110α in vivo. In this study, we used adenoviral gene transfer in mice to investigate the effects of the E545K and H1047R mutations on hepatic and whole-body glucose metabolism. We show that hepatic expression of these hot spot mutations results in rapid hepatic steatosis, paradoxically accompanied by increased glucose tolerance, and marked glycogen accumulation. In contrast, wild-type p110α expression does not lead to hepatic accumulation of lipids or glycogen despite similar degrees of upregulated glycolysis and expression of lipogenic genes. The reprogrammed metabolism of the E545K and H1047R p110α mutants was surprisingly not dependent on altered p110α lipid kinase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Ben–Baruch, Noa Efrat; Bose, Ron; Kavuri, Shyam M.; Ma, Cynthia X.; Ellis, Matthew J.
2015-01-01
Activating mutations in the HER2 tyrosine kinase have been identified in human breast cancers that lack HER2 gene amplification. These patients are not candidates for HER2 targeted drugs under current standards of care, but preclinical data strongly suggest that these patients will benefit from anti-HER2 drugs. In this case report, we describe a young woman with metastatic breast cancer whose tumor was found to carry a HER2 L755S mutation, which is in the kinase domain of HER2. Treatment with the second generation HER2/EGFR tyrosine kinase inhibitor, neratinib, resulted in partial response and dramatic improvement in the patient’s function status. This partial response lasted 11 months and when the patient’s cancer progressed, she was treated with neratinib plus capecitabine and her cancer again responded. This second response parallels the benefit seen with continuing trastuzumab in HER2 amplified breast cancer after disease progression. This case is the first report, to our knowledge, of successful single agent treatment of HER2 mutated breast cancer. Two clinical trials of neratinib for HER2 mutated, metastatic breast cancer are currently enrolling patients. Further, data from The Cancer Genome Atlas project have identified HER2 mutations in a wide range of solid tumors, including bladder, colorectal, and non-small cell lung cancer, suggesting that clinical trials of neratinib or neratinib-based combinations for HER2 mutated solid tumors is warranted. PMID:26358790
Ben-Baruch, Noa Efrat; Bose, Ron; Kavuri, Shyam M; Ma, Cynthia X; Ellis, Matthew J
2015-09-01
Activating mutations in the HER2 tyrosine kinase have been identified in human breast cancers that lack HER2 gene amplification. These patients are not candidates for HER2-targeted drugs under current standards of care, but preclinical data strongly suggest that these patients will benefit from anti-HER2 drugs. This case report describes a young woman with metastatic breast cancer whose tumor was found to carry a HER2 L755S mutation, which is in the kinase domain of HER2. Treatment with the second-generation HER2/EGFR tyrosine kinase inhibitor neratinib resulted in partial response and dramatic improvement in the patient's functional status. This partial response lasted 11 months, and when the patient's cancer progressed, she was treated with neratinib plus capecitabine and her cancer again responded. This second response parallels the benefit seen with continuing trastuzumab in HER2-amplified breast cancer after disease progression. This case represents the first report, to our knowledge, of successful single-agent treatment of HER2-mutated breast cancer. Two clinical trials of neratinib for HER2-mutated metastatic breast cancer are currently enrolling patients. Further, data from The Cancer Genome Atlas project have identified HER2 mutations in a wide range of solid tumors, including bladder, colorectal, and non-small cell lung cancers, suggesting that clinical trials of neratinib or neratinib-based combinations for HER2-mutated solid tumors is warranted. Copyright © 2015 by the National Comprehensive Cancer Network.
Harms, Frederike L; Alawi, Malik; Amor, David J; Tan, Tiong Y; Cuturilo, Goran; Lissewski, Christina; Brinkmann, Julia; Schanze, Denny; Kutsche, Kerstin; Zenker, Martin
2018-02-01
Noonan syndrome is characterized by typical craniofacial dysmorphism, postnatal growth retardation, congenital heart defect, and learning difficulties and belongs to the RASopathies, a group of neurodevelopmental disorders caused by germline mutations in genes encoding components of the RAS-MAPK pathway. Mutations in the RAF1 gene are associated with Noonan syndrome, with a high prevalence of hypertrophic cardiomyopathy (HCM). RAF1 mutations cluster in exons encoding the conserved region 2 (CR2), the kinase activation segment of the CR3 domain, and the C-terminus. We present two boys with Noonan syndrome and the identical de novo RAF1 missense variant c.1082G>C/p.(Gly361Ala) affecting the CR3, but located outside the kinase activation segment. The p.(Gly361Ala) mutation has been identified as a RAF1 allele conferring resistance to RAF inhibitors. This amino acid change favors a RAF1 conformation that allows for enhanced RAF dimerization and increased intrinsic kinase activity. Both patients with Noonan syndrome showed typical craniofacial dysmorphism, macrocephaly, and short stature. One individual developed HCM and was diagnosed with a disseminated oligodendroglial-like leptomeningeal tumor (DOLT) of childhood at the age of 9 years. While there is a well-established association of NS with malignant tumors, especially childhood hemato-oncological diseases, brain tumors have rarely been reported in Noonan syndrome. Our data demonstrate that mutation scanning of the entire coding region of genes associated with Noonan syndrome is mandatory not to miss rare variants located outside the known mutational hotspots. © 2017 Wiley Periodicals, Inc.
LENUS (Irish Health Repository)
Abdul-Jalil, Khairun I
2014-08-01
Locally advanced rectal cancer (LARC: T3\\/4 and\\/or node-positive) is treated with preoperative\\/neoadjuvant chemoradiotherapy (CRT), but responses are not uniform. The phosphatidylinositol 3-kinase (PI3K), MAP kinase (MAPK), and related pathways are implicated in rectal cancer tumorigenesis. Here, we investigated the association between genetic mutations in these pathways and LARC clinical outcomes.
Chanprasert, Sirisak; Wang, Jing; Weng, Shao-Wen; Enns, Gregory M; Boué, Daniel R; Wong, Brenda L; Mendell, Jerry R; Perry, Deborah A; Sahenk, Zarife; Craigen, William J; Alcala, Francisco J Climent; Pascual, Juan M; Melancon, Serge; Zhang, Victor Wei; Scaglia, Fernando; Wong, Lee-Jun C
2013-01-01
Mitochondrial DNA (mtDNA) depletion syndromes (MDSs) are a clinically and molecularly heterogeneous group of mitochondrial cytopathies characterized by severe mtDNA copy number reduction in affected tissues. Clinically, MDSs are mainly categorized as myopathic, encephalomyopathic, hepatocerebral, or multi-systemic forms. To date, the myopathic form of MDS is mainly caused by mutations in the TK2 gene, which encodes thymidine kinase 2, the first and rate limiting step enzyme in the phosphorylation of pyrimidine nucleosides. We analyzed 9 unrelated families with 11 affected subjects exhibiting the myopathic form of MDS, by sequencing the TK2 gene. Twelve mutations including 4 novel mutations were detected in 9 families. Skeletal muscle specimens were available from 7 out of 11 subjects. Respiratory chain enzymatic activities in skeletal muscle were measured in 6 subjects, and enzymatic activities were reduced in 3 subjects. Quantitative analysis of mtDNA content in skeletal muscle was performed in 5 subjects, and marked mtDNA content reduction was observed in each. In addition, we outline the molecular and clinical characteristics of this syndrome in a total of 52 patients including those previously reported, and a total of 36 TK2 mutations are summarized. Clinically, hypotonia and proximal muscle weakness are the major phenotypes present in all subjects. In summary, our study expands the molecular and clinical spectrum associated with TK2 deficiency. © 2013.
Directory of Open Access Journals (Sweden)
Huiyong Sun
2014-07-01
Full Text Available Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance.
Directory of Open Access Journals (Sweden)
Zhang Y
2013-11-01
Full Text Available Yiliang Zhang,1,* Yihua Sun,1,* Lei Wang,1 Ting Ye,1 Yunjian Pan,1 Haichuan Hu,1 Yongfu Yu,2 Naiqing Zhao,2 Yanyan Song,3 David Garfield,4 Haiquan Chen1 1Department of Thoracic Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, 2Department of Biostatistics, School of Public Health, Fudan University, 3Department of Pharmacology and Biostatistics, Institute of Medical Science, Shanghai Jiaotong University School of Medicine, 4ProMed Cancer Centers, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: This aim of this study was to compare the efficacy of first-line tyrosine kinase inhibitor therapy followed, upon progression, by chemotherapy with the reverse sequence in patients with EGFR-mutated non-small cell lung cancer (NSCLC in terms of overall survival. Methods: We performed a meta-analysis of studies that met the following criteria: Phase III clinical trial comparing the sequencing of epidermal growth factor receptor (EGFR tyrosine kinase inhibitors with chemotherapy in the treatment of advanced EGFR-mutated NSCLC; activating mutations reported; and availability of hazard ratio estimates with 95% confidence intervals (CIs for overall survival. Results: Six clinical trials were included in this study. The pooled hazard ratio for overall survival of the EGFR-mutated population that completed sequential treatment was 1.03 (95% CI 0.86–1.22, P=0.776. There was no statistically significant heterogeneity between the studies (tau2 =0; I2=0, 95% CI 0–0.37, P=0.548. Evidence of marked publication bias for the two treatment sequences was insufficient (P=0.145. Conclusion: In patients with advanced NSCLC and activating EGFR mutations, first-line chemotherapy followed upon progression by a tyrosine kinase inhibitor was not inferior in terms of overall survival compared with the inverse sequence. This may serve as an indication that
Male Hypogonadism and Germ Cell Loss Caused by a Mutation in Polo-Like Kinase 4
Harris, Rebecca M.; Weiss, Jeffrey
2011-01-01
The genetic etiologies of male infertility remain largely unknown. To identify genes potentially involved in spermatogenesis and male infertility, we performed genome-wide mutagenesis in mice with N-ethyl-N-nitrosourea and identified a line with dominant hypogonadism and patchy germ cell loss. Genomic mapping and DNA sequence analysis identified a novel heterozygous missense mutation in the kinase domain of Polo-like kinase 4 (Plk4), altering an isoleucine to asparagine at residue 242 (I242N). Genetic complementation studies using a gene trap line with disruption in the Plk4 locus confirmed that the putative Plk4 missense mutation was causative. Plk4 is known to be involved in centriole formation and cell cycle progression. However, a specific role in mammalian spermatogenesis has not been examined. PLK4 was highly expressed in the testes both pre- and postnatally. In the adult, PLK4 expression was first detected in stage VIII pachytene spermatocytes and was present through step 16 elongated spermatids. Because the homozygous Plk4I242N/I242N mutation was embryonic lethal, all analyses were performed using the heterozygous Plk4+/I242N mice. Testis size was reduced by 17%, and histology revealed discrete regions of germ cell loss, leaving only Sertoli cells in these defective tubules. Testis cord formation (embryonic day 13.5) was normal. Testis histology was also normal at postnatal day (P)1, but germ cell loss was detected at P10 and subsequent ages. We conclude that the I242N heterozygous mutation in PLK4 is causative for patchy germ cell loss beginning at P10, suggesting a role for PLK4 during the initiation of spermatogenesis. PMID:21791561
Zhu, Shun; Travis, Sue M; Elcock, Adrian H
2013-07-09
A major current challenge for drug design efforts focused on protein kinases is the development of drug resistance caused by spontaneous mutations in the kinase catalytic domain. The ubiquity of this problem means that it would be advantageous to develop fast, effective computational methods that could be used to determine the effects of potential resistance-causing mutations before they arise in a clinical setting. With this long-term goal in mind, we have conducted a combined experimental and computational study of the thermodynamic effects of active-site mutations on a well-characterized and high-affinity interaction between a protein kinase and a small-molecule inhibitor. Specifically, we developed a fluorescence-based assay to measure the binding free energy of the small-molecule inhibitor, SB203580, to the p38α MAP kinase and used it measure the inhibitor's affinity for five different kinase mutants involving two residues (Val38 and Ala51) that contact the inhibitor in the crystal structure of the inhibitor-kinase complex. We then conducted long, explicit-solvent thermodynamic integration (TI) simulations in an attempt to reproduce the experimental relative binding affinities of the inhibitor for the five mutants; in total, a combined simulation time of 18.5 μs was obtained. Two widely used force fields - OPLS-AA/L and Amber ff99SB-ILDN - were tested in the TI simulations. Both force fields produced excellent agreement with experiment for three of the five mutants; simulations performed with the OPLS-AA/L force field, however, produced qualitatively incorrect results for the constructs that contained an A51V mutation. Interestingly, the discrepancies with the OPLS-AA/L force field could be rectified by the imposition of position restraints on the atoms of the protein backbone and the inhibitor without destroying the agreement for other mutations; the ability to reproduce experiment depended, however, upon the strength of the restraints' force constant
Hoppmann, Julia; Gesing, Julia; Silve, Caroline; Leroy, Chrystel; Bertsche, Astrid; Hirsch, Franz Wolfgang; Kiess, Wieland; Pfäffle, Roland; Schuster, Volker
2017-01-01
Acrodysostosis is a very rare congenital multisystem condition characterized by skeletal dysplasia with severe brachydactyly, midfacial hypoplasia, and short stature, varying degrees of intellectual disability, and possible resistance to multiple G protein-coupled receptor signalling hormones. Two distinct subtypes are differentiated: acrodysostosis type 1 resulting from defects in protein kinase type 1-α regulatory subunit and acrodysostosis type 2 caused by mutations in phosphodiesterase 4D (PDE4D). Most cases are sporadic. We report on a rare multigenerational familial case of acrodysostosis type 2 due to a novel autosomal dominantly inherited PDE4D mutation. A 3.5-year-old boy presented with short stature, midfacial hypoplasia, severe brachydactyly, developmental delay, and behavioural problems. Laboratory investigations revealed mild thyrotropin resistance. His mother shared some characteristic features, such as midfacial hypoplasia and severe brachydactyly, but did not show short stature, intellectual disability or hormonal resistance. Genetic analysis identified the identical, novel heterozygous missense mutation of the PDE4D gene c.569C>T (p.Ser190Phe) in both patients. This case illustrates the significant phenotypic variability of acrodysostosis even within one family with identical mutations. Hence, a specific clinical diagnosis of acrodysostosis remains challenging because of great interindividual variability and a substantial overlap of the two subtypes as well as with other related Gsα-cAMP-signalling-linked disorders. PMID:28515031
Directory of Open Access Journals (Sweden)
Shantashri Vaidya
Full Text Available BACKGROUND: Mutations in the ABL kinase domain and SH3-SH2 domain of the BCR/ABL gene and amplification of the Philadelphia chromosome are the two important BCR/ABL dependent mechanisms of imatinib resistance. Here, we intended to study the role played by TKI, imatinib, in selection of gene mutations and development of chromosomal abnormalities in Indian CML patients. METHODS: Direct sequencing methodology was employed to detect mutations and conventional cytogenetics was done to identify Philadelphia duplication. RESULTS: Among the different mechanisms of imatinib resistance, kinase domain mutations (39% of the BCR/ABL gene were seen to be more prevalent, followed by mutations in the SH3-SH2 domain (4% and then BCR/ABL amplification with the least frequency (1%. The median duration of occurrence of mutation was significantly shorter for patients with front line imatinib than those pre-treated with hydroxyurea. Patients with high Sokal score (p = 0.003 showed significantly higher incidence of mutations, as compared to patients with low/intermediate score. Impact of mutations on the clinical outcome in AP and BC was observed to be insignificant. Of the 94 imatinib resistant patients, only 1 patient exhibited duplication of Philadelphia chromosome, suggesting a less frequent occurrence of this abnormality in Indian CML patients. CONCLUSION: Close monitoring at regular intervals and proper analysis of the disease resistance would facilitate early detection of resistance and thus aid in the selection of the most appropriate therapy.
Lagier-Tourenne, Clotilde; Tazir, Meriem; López, Luis Carlos; Quinzii, Catarina M; Assoum, Mirna; Drouot, Nathalie; Busso, Cleverson; Makri, Samira; Ali-Pacha, Lamia; Benhassine, Traki; Anheim, Mathieu; Lynch, David R; Thibault, Christelle; Plewniak, Frédéric; Bianchetti, Laurent; Tranchant, Christine; Poch, Olivier; DiMauro, Salvatore; Mandel, Jean-Louis; Barros, Mario H; Hirano, Michio; Koenig, Michel
2008-03-01
Muscle coenzyme Q(10) (CoQ(10) or ubiquinone) deficiency has been identified in more than 20 patients with presumed autosomal-recessive ataxia. However, mutations in genes required for CoQ(10) biosynthetic pathway have been identified only in patients with infantile-onset multisystemic diseases or isolated nephropathy. Our SNP-based genome-wide scan in a large consanguineous family revealed a locus for autosomal-recessive ataxia at chromosome 1q41. The causative mutation is a homozygous splice-site mutation in the aarF-domain-containing kinase 3 gene (ADCK3). Five additional mutations in ADCK3 were found in three patients with sporadic ataxia, including one known to have CoQ(10) deficiency in muscle. All of the patients have childhood-onset cerebellar ataxia with slow progression, and three of six have mildly elevated lactate levels. ADCK3 is a mitochondrial protein homologous to the yeast COQ8 and the bacterial UbiB proteins, which are required for CoQ biosynthesis. Three out of four patients tested showed a low endogenous pool of CoQ(10) in their fibroblasts or lymphoblasts, and two out of three patients showed impaired ubiquinone synthesis, strongly suggesting that ADCK3 is also involved in CoQ(10) biosynthesis. The deleterious nature of the three identified missense changes was confirmed by the introduction of them at the corresponding positions of the yeast COQ8 gene. Finally, a phylogenetic analysis shows that ADCK3 belongs to the family of atypical kinases, which includes phosphoinositide and choline kinases, suggesting that ADCK3 plays an indirect regulatory role in ubiquinone biosynthesis possibly as part of a feedback loop that regulates ATP production.
Mutations in DSTYK and dominant urinary tract malformations.
Sanna-Cherchi, Simone; Sampogna, Rosemary V; Papeta, Natalia; Burgess, Katelyn E; Nees, Shannon N; Perry, Brittany J; Choi, Murim; Bodria, Monica; Liu, Yan; Weng, Patricia L; Lozanovski, Vladimir J; Verbitsky, Miguel; Lugani, Francesca; Sterken, Roel; Paragas, Neal; Caridi, Gianluca; Carrea, Alba; Dagnino, Monica; Materna-Kiryluk, Anna; Santamaria, Giuseppe; Murtas, Corrado; Ristoska-Bojkovska, Nadica; Izzi, Claudia; Kacak, Nilgun; Bianco, Beatrice; Giberti, Stefania; Gigante, Maddalena; Piaggio, Giorgio; Gesualdo, Loreto; Vukic, Durdica Kosuljandic; Vukojevic, Katarina; Saraga-Babic, Mirna; Saraga, Marijan; Gucev, Zoran; Allegri, Landino; Latos-Bielenska, Anna; Casu, Domenica; State, Matthew; Scolari, Francesco; Ravazzolo, Roberto; Kiryluk, Krzysztof; Al-Awqati, Qais; D'Agati, Vivette D; Drummond, Iain A; Tasic, Velibor; Lifton, Richard P; Ghiggeri, Gian Marco; Gharavi, Ali G
2013-08-15
Congenital abnormalities of the kidney and the urinary tract are the most common cause of pediatric kidney failure. These disorders are highly heterogeneous, and the etiologic factors are poorly understood. We performed genomewide linkage analysis and whole-exome sequencing in a family with an autosomal dominant form of congenital abnormalities of the kidney or urinary tract (seven affected family members). We also performed a sequence analysis in 311 unrelated patients, as well as histologic and functional studies. Linkage analysis identified five regions of the genome that were shared among all affected family members. Exome sequencing identified a single, rare, deleterious variant within these linkage intervals, a heterozygous splice-site mutation in the dual serine-threonine and tyrosine protein kinase gene (DSTYK). This variant, which resulted in aberrant splicing of messenger RNA, was present in all affected family members. Additional, independent DSTYK mutations, including nonsense and splice-site mutations, were detected in 7 of 311 unrelated patients. DSTYK is highly expressed in the maturing epithelia of all major organs, localizing to cell membranes. Knockdown in zebrafish resulted in developmental defects in multiple organs, which suggested loss of fibroblast growth factor (FGF) signaling. Consistent with this finding is the observation that DSTYK colocalizes with FGF receptors in the ureteric bud and metanephric mesenchyme. DSTYK knockdown in human embryonic kidney cells inhibited FGF-stimulated phosphorylation of extracellular-signal-regulated kinase (ERK), the principal signal downstream of receptor tyrosine kinases. We detected independent DSTYK mutations in 2.3% of patients with congenital abnormalities of the kidney or urinary tract, a finding that suggests that DSTYK is a major determinant of human urinary tract development, downstream of FGF signaling. (Funded by the National Institutes of Health and others.).
Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin
McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.
2015-01-01
Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202
Directory of Open Access Journals (Sweden)
Chou Sunwen
2009-01-01
Full Text Available Abstract The UL97 kinase has been shown to phosphorylate and inactivate the retinoblastoma protein (Rb and has three consensus Rb-binding motifs that might contribute to this activity. Recombinant viruses containing mutations in the Rb-binding motifs generally replicated well in human foreskin fibroblasts with only a slight delay in replication kinetics. Their susceptibility to the specific UL97 kinase inhibitor, maribavir, was also examined. Mutation of the amino terminal motif, which is involved in the inactivation of Rb, also renders the virus hypersensitive to the drug and suggests that the motif may play a role in its mechanism of action.
Hyper-immunoglobulin D syndrome with novel mutations in an afebrile infant.
Cadmus, Simi D; Green, Reid; Carrasco, Ruy; Levy, Moise L; Diaz, Lucia Z
2018-03-30
Hyper-immunoglobulin D syndrome is a rare autosomal-recessive autoinflammatory syndrome in which a mevalonate kinase deficiency results due to mutations of the mevalonate kinase gene. We report a case of an Asian male infant who was found to have hyper-immunoglobulin D syndrome in the absence of fever. His skin manifestations included cephalic pustulosis as well recurrent transient and fixed pink plaques and nodules on the face and extremities. Subsequent examination revealed hyper-immunoglobulin D syndrome with two novel allelic mutations in the mevalonate kinase gene: c.895G > A (p.D299N) and c.1168C > T (p.Q390). It is important for dermatologists to recognize the varied cutaneous presentations of hyper-immunoglobulin D syndrome because rapid diagnosis and treatment can significantly affect outcomes. © 2018 Wiley Periodicals, Inc.
Koshikawa, Nobuko; Hayashi, Jun-Ichi; Nakagawara, Akira; Takenaga, Keizo
2009-11-27
Lewis lung carcinoma-derived high metastatic A11 cells constitutively overexpress hypoxia-inducible factor (HIF)-1alpha mRNA compared with low metastatic P29 cells. Because A11 cells exclusively possess a G13997A mutation in the mitochondrial NADH dehydrogenase subunit 6 (ND6) gene, we addressed here a causal relationship between the ND6 mutation and the activation of HIF-1alpha transcription, and we investigated the potential mechanism. Using trans-mitochondrial cybrids between A11 and P29 cells, we found that the ND6 mutation was directly involved in HIF-1alpha mRNA overexpression. Stimulation of HIF-1alpha transcription by the ND6 mutation was mediated by overproduction of reactive oxygen species (ROS) and subsequent activation of phosphatidylinositol 3-kinase (PI3K)-Akt and protein kinase C (PKC) signaling pathways. The up-regulation of HIF-1alpha transcription was abolished by mithramycin A, an Sp1 inhibitor, but luciferase reporter and chromatin immunoprecipitation assays indicated that Sp1 was necessary but not sufficient for HIF-1alpha mRNA overexpression in A11 cells. On the other hand, trichostatin A, a histone deacetylase (HDAC) inhibitor, markedly suppressed HIF-1alpha transcription in A11 cells. In accordance with this, HDAC activity was high in A11 cells but low in P29 cells and in A11 cells treated with the ROS scavenger ebselene, the PI3K inhibitor LY294002, and the PKC inhibitor Ro31-8220. These results suggest that the ROS-generating ND6 mutation increases HIF-1alpha transcription via the PI3K-Akt/PKC/HDAC pathway, leading to HIF-1alpha protein accumulation in hypoxic tumor cells.
Clinical phenotype of 5 females with a CDKL5 mutation.
Stalpers, Xenia L; Spruijt, Liesbeth; Yntema, Helger G; Verrips, Aad
2012-01-01
Mutations in the X-linked cyclin dependent kinase like 5 (CDKL5) gene have been reported in approximately 80 patients since the first description in 2003. The clinical presentation partly corresponds with Rett syndrome, considering clinical features as intellectual disability, hypotonia, and poor visual, language, and motor development. However, these patients do not meet the consensus criteria for Rett syndrome since they lack the clear period of regression. Furthermore, in contrast to Rett syndrome, patients with CDKL5 mutations, have seizures or infantile spasms starting in the first weeks of life. We present clinical phenotype of 5 girls having a mutation in the CDKL5 gene. All mutations are novel and are pathogenic since they either lead to a frameshift in the reading frame or affect a consensus splice site. Four of the mutations are detected de novo in the affected girl.
Directory of Open Access Journals (Sweden)
Yi-Hung Carol Tan
2010-01-01
Full Text Available Non-small cell lung cancer (NSCLC is a heterogeneous group of disorders with a number of genetic and proteomic alterations. c-CBL is an E3 ubiquitin ligase and adaptor molecule important in normal homeostasis and cancer. We determined the genetic variations of c-CBL, relationship to receptor tyrosine kinases (EGFR and MET, and functionality in NSCLC.Using archival formalin-fixed paraffin embedded (FFPE extracted genomic DNA, we show that c-CBL mutations occur in somatic fashion for lung cancers. c-CBL mutations were not mutually exclusive of MET or EGFR mutations; however they were independent of p53 and KRAS mutations. In normal/tumor pairwise analysis, there was significant loss of heterozygosity (LOH for the c-CBL locus (22%, n = 8/37 and none of these samples revealed any mutation in the remaining copy of c-CBL. The c-CBL LOH also positively correlated with EGFR and MET mutations observed in the same samples. Using select c-CBL somatic mutations such as S80N/H94Y, Q249E and W802* (obtained from Caucasian, Taiwanese and African-American samples, respectively transfected in NSCLC cell lines, there was increased cell viability and cell motility.Taking the overall mutation rate of c-CBL to be a combination as somatic missense mutation and LOH, it is clear that c-CBL is highly mutated in lung cancers and may play an essential role in lung tumorigenesis and metastasis.
Loss of thymidine kinase 2 alters neuronal bioenergetics and leads to neurodegeneration
Bartesaghi, Stefano; Betts-Henderson, Joanne; Cain, Kelvin; Dinsdale, David; Zhou, Xiaoshan; Karlsson, Anna; Salomoni, Paolo; Nicotera, Pierluigi
2010-01-01
Mutations of thymidine kinase 2 (TK2), an essential component of the mitochondrial nucleotide salvage pathway, can give rise to mitochondrial DNA (mtDNA) depletion syndromes (MDS). These clinically heterogeneous disorders are characterized by severe reduction in mtDNA copy number in affected tissues and are associated with progressive myopathy, hepatopathy and/or encephalopathy, depending in part on the underlying nuclear genetic defect. Mutations of TK2 have previously been associated with a...
A dynamically coupled allosteric network underlies binding cooperativity in Src kinase.
Foda, Zachariah H; Shan, Yibing; Kim, Eric T; Shaw, David E; Seeliger, Markus A
2015-01-20
Protein tyrosine kinases are attractive drug targets because many human diseases are associated with the deregulation of kinase activity. However, how the catalytic kinase domain integrates different signals and switches from an active to an inactive conformation remains incompletely understood. Here we identify an allosteric network of dynamically coupled amino acids in Src kinase that connects regulatory sites to the ATP- and substrate-binding sites. Surprisingly, reactants (ATP and peptide substrates) bind with negative cooperativity to Src kinase while products (ADP and phosphopeptide) bind with positive cooperativity. We confirm the molecular details of the signal relay through the allosteric network by biochemical studies. Experiments on two additional protein tyrosine kinases indicate that the allosteric network may be largely conserved among these enzymes. Our work provides new insights into the regulation of protein tyrosine kinases and establishes a potential conduit by which resistance mutations to ATP-competitive kinase inhibitors can affect their activity.
Lamin A/C mutation affecting primarily the right side of the heart
Directory of Open Access Journals (Sweden)
Laura Ollila
2013-04-01
Full Text Available LMNA mutations are amongst the most important causes of familial dilated cardiomyopathy. The most important cause of arrhythmogenic right ventricular cardiomyopathy (ARVC is desmosomal pathology. The aim of the study was to elucidate the role of LMNA mutations among Finnish cardiomyopathy patients. We screened 135 unrelated cardiomyopathy patients for LMNA mutations. Because of unusual phenotype, two patients were screened for the known Finnish ARVC-related mutations of desmosomal genes, and their Plakophilin-2b gene was sequenced. Myocardial samples from two patients were examined by immunohistochemical plakoglobin staining and in one case by electron microscopy. We found a new LMNA mutation Phe237Ser in a family of five affected members with a cardiomyopathy affecting primarily the right side of the heart. The phenotype resembles ARVC but does not fulfill the Task Force Criteria. The main clinical manifestations of the mutation were severe tricuspid insufficiency, right ventricular enlargement and failure. Three of the affected patients died of the heart disease, and the two living patients received heart transplants at ages 44 and 47. Electron microscopy showed nuclear blebbing compatible with laminopathy. Immunohisto - chemical analysis did not suggest desmosomal pathology. No desmosomal mutations were found. The Phe237Ser LMNA mutation causes a phenotype different from traditional cardiolaminopathy. Our findings suggest that cardiomyopathy affecting primarily the right side of the heart is not always caused by desmosomal pathology. Our observations highlight the challenges in classifying cardiomyopathies, as there often is significant overlap between the traditional categories.
Tyrosine kinase domain mutations of EGFR gene in head and neck squamous cell carcinoma
Directory of Open Access Journals (Sweden)
Vatte C
2017-03-01
Full Text Available Chittibabu Vatte,1 Ali M Al Amri,2 Cyril Cyrus,1 Shahanas Chathoth,1 Sadananda Acharya,3 Tariq Mohammad Hashim,4 Zhara Al Ali,2 Saleh Tawfeeq Alshreadah,2 Ahmed Alsayyah,4 Amein K Al-Ali5 1Department of Genetic Research, Institute for Research and Medical Consultation, University of Dammam, Dammam, 2Department of Internal Medicine, King Fahd Hospital of the University, University of Dammam, Al-Khobar, 3Department of Stemcell Research, Institute for Research and Medical Consultation, 4Department of Pathology, King Fahd Hospital of the University, University of Dammam, Al-Khobar, 5Department of Biochemistry, College of Medicine, University of Dammam, Dammam, Kingdom of Saudi Arabia Background: Epidermal growth factor receptor (EGFR is a commonly altered gene that is identified in various cancers, including head and neck squamous cell carcinoma (HNSCC. Therefore, EGFR is a promising molecular marker targeted by monoclonal antibodies and small molecule inhibitors targeting the tyrosine kinase (TK domain. Objective: The objective of this study was to investigate the spectrum of mutations in exons 18, 19, 20, and 21 of the EGFR gene in HNSCC patients. Materials and methods: This retrospective study included 47 confirmed HNSCC cases. Mutations in the TK domain, exons 18, 19, 20, and 21 of the EGFR gene, were detected by Scorpion® chemistry and ARMS® technologies on Rotor-Gene Q real-time polymerase chain reaction.Results: The tumors exhibited EGFR-TK domain mutations in 57% of cases. Four cases of T790M mutations were reported for the first time among HNSCC patients. Out of the total mutations, L861Q (exon 21, exon 20 insertions and deletions of exon 19 accounted for the majority of mutations (21%, 19%, and 17%, respectively. EGFR mutation status was correlated with the higher grade (P=0.026 and advanced stage (P=0.034 of HNSCC tumors.Conclusion: Higher frequency of EGFR-TK domain mutations together with the presence of the T790M mutation suggests
International Nuclear Information System (INIS)
Miyanaga, Akihiko; Kawamoto, Masashi; Tsuchiya, Shinichi; Hagiwara, Koichi; Soda, Manabu; Takeuchi, Kengo; Yamamoto, Nobuyuki; Mano, Hiroyuki; Ishikawa, Yuichi; Gemma, Akihiko; Shimizu, Kumi; Noro, Rintaro; Seike, Masahiro; Kitamura, Kazuhiro; Kosaihira, Seiji; Minegishi, Yuji; Shukuya, Takehito; Yoshimura, Akinobu
2013-01-01
The EML4–ALK (echinoderm microtubule-associated protein-like 4 gene and the anaplastic lymphoma kinase gene) fusion oncogene represents a novel molecular target in a small subset of non–small–cell lung cancers (NSCLCs). The EML4–ALK fusion gene occurs generally in NSCLC without mutations in epidermal growth factor receptor (EGFR) and KRAS. We report that a case of EML4–ALK-positive NSCLC with EGFR mutation had a response of stable disease to both an EGFR tyrosine kinase inhibitor (EGFR-TKI) and ALK inhibitor. We described the first clinical report of a patient with EML4–ALK-positive NSCLC with EGFR mutation that had a response of stable disease to both single-agent EGFR-TKI and ALK inhibitor. EML4–ALK translocation may be associated with resistance to EGFR-TKI, and EGFR signaling may contribute to resistance to ALK inhibitor in EML4–ALK-positive NSCLC
JAK2 Exon 12 Mutations in Polycythemia Vera and Idiopathic Erythrocytosis
Scott, Linda M.; Tong, Wei; Levine, Ross L.; Scott, Mike A.; Beer, Philip A.; Stratton, Michael R.; Futreal, P. Andrew; Erber, Wendy N.; McMullin, Mary Frances; Harrison, Claire N.; Warren, Alan J.; Gilliland, D. Gary; Lodish, Harvey F.; Green, Anthony R.
2010-01-01
BACKGROUND The V617F mutation, which causes the substitution of phenylalanine for valine at position 617 of the Janus kinase (JAK) 2 gene (JAK2), is often present in patients with polycythemia vera, essential thrombocythemia, and idiopathic myelofibrosis. However, the molecular basis of these myeloproliferative disorders in patients without the V617F mutation is unclear. METHODS We searched for new mutations in members of the JAK and signal transducer and activator of transcription (STAT) gene families in patients with V617F-negative polycythemia vera or idiopathic erythrocytosis. The mutations were characterized biochemically and in a murine model of bone marrow transplantation. RESULTS We identified four somatic gain-of-function mutations affecting JAK2 exon 12 in 10 V617F-negative patients. Those with a JAK2 exon 12 mutation presented with an isolated erythrocytosis and distinctive bone marrow morphology, and several also had reduced serum erythropoietin levels. Erythroid colonies could be grown from their blood samples in the absence of exogenous erythropoietin. All such erythroid colonies were heterozygous for the mutation, whereas colonies homozygous for the mutation occur in most patients with V617F-positive polycythemia vera. BaF3 cells expressing the murine erythropoietin receptor and also carrying exon 12 mutations could proliferate without added interleukin-3. They also exhibited increased phosphorylation of JAK2 and extracellular regulated kinase 1 and 2, as compared with cells transduced by wild-type JAK2 or V617F JAK2. Three of the exon 12 mutations included a substitution of leucine for lysine at position 539 of JAK2. This mutation resulted in a myeloproliferative phenotype, including erythrocytosis, in a murine model of retroviral bone marrow transplantation. CONCLUSIONS JAK2 exon 12 mutations define a distinctive myeloproliferative syndrome that affects patients who currently receive a diagnosis of polycythemia vera or idiopathic erythrocytosis
Mini Screening of Kinase Inhibitors Affecting Period-length of Mammalian Cellular Circadian Clock
International Nuclear Information System (INIS)
Yagita, Kazuhiro; Yamanaka, Iori; Koinuma, Satoshi; Shigeyoshi, Yasufumi; Uchiyama, Yasuo
2009-01-01
In mammalian circadian rhythms, the transcriptional-translational feedback loop (TTFL) consisting of a set of clock genes is believed to elicit the circadian clock oscillation. The TTFL model explains that the accumulation and degradation of mPER and mCRY proteins control the period-length (tau) of the circadian clock. Although recent studies revealed that the Casein Kinase Iεδ (CKIεδ) regurates the phosphorylation of mPER proteins and the circadian period-length, other kinases are also likely to contribute the phosphorylation of mPER. Here, we performed small scale screening using 84 chemical compounds known as kinase inhibitors to identify candidates possibly affecting the circadian period-length in mammalian cells. Screening by this high-throughput real-time bioluminescence monitoring system revealed that the several chemical compounds apparently lengthened the cellular circadian clock oscillation. These compounds are known as inhibitors against kinases such as Casein Kinase II (CKII), PI3-kinase (PI3K) and c-Jun N-terminal Kinase (JNK) in addition to CKIεδ. Although these kinase inhibitors may have some non-specific effects on other factors, our mini screening identified new candidates contributing to period-length control in mammalian cells
Marcé, Silvia; Zamora, Lurdes; Cabezón, Marta; Xicoy, Blanca; Boqué, Concha; Fernández, Cristalina; Grau, Javier; Navarro, José-Tomás; Fernández de Sevilla, Alberto; Ribera, Josep-Maria; Feliu, Evarist; Millá, Fuensanta
2013-08-04
Tyrosine kinase inhibitors (TKI) have improved the management of patients with chronic myeloid leukemia (CML). However, a significant proportion of patients do not achieve the optimal response or are resistant to TKI. ABL kinase domain mutations have been extensively implicated in the pathogenesis of TKI resistance. Treatment with second-generation TKI has produced high rates of hematologic and cytogenetic responses in mutated ABL patients. The aim of this study was to determine the type and frequency of ABL mutations in patients who were resistant to imatinib or had lost the response, and to analyze the effect of second-generation TKI on their outcome. The presence of ABL mutations in 45 CML patients resistant to imatinib was evaluated by direct sequencing and was correlated with the results of the cytogenetic study (performed in 39 cases). The outcome of these patients after therapy with nilotinib or dasatinib was analyzed. ABL mutations were detected in 14 out of 45 resistant patients. Patients with clonal cytogenetic evolution tended to develop mutations more frequently than those without clonal evolution. Nine out of the 15 patients with ABL mutation responded to a treatment switch to nilotinib (n=4), dasatinib (n=2), interferon (n=1) or hematopoietic stem cell transplantation (n=2). The frequency of ABL mutations in CML patients resistant to imatinib is high and is more frequent among those with clonal cytogenetic evolution. The change to second-generation TKI can overcome imatinib resistance in most of the mutated patients. Copyright © 2012 Elsevier España, S.L. All rights reserved.
Prewitt, Allison R.; Ghose, Sampa; Frump, Andrea L.; Datta, Arumima; Austin, Eric D.; Kenworthy, Anne K.; de Caestecker, Mark P.
2015-01-01
Hereditary pulmonary arterial hypertension (HPAH) is a rare, fatal disease of the pulmonary vasculature. The majority of HPAH patients inherit mutations in the bone morphogenetic protein type 2 receptor gene (BMPR2), but how these promote pulmonary vascular disease is unclear. HPAH patients have features of pulmonary endothelial cell (PEC) dysfunction including increased vascular permeability and perivascular inflammation associated with decreased PEC barrier function. Recently, frameshift mutations in the caveolar structural protein gene Caveolin-1 (CAV-1) were identified in two patients with non-BMPR2-associated HPAH. Because caveolae regulate endothelial function and vascular permeability, we hypothesized that defects in caveolar function might be a common mechanism by which BMPR2 mutations promote pulmonary vascular disease. To explore this, we isolated PECs from mice carrying heterozygous null Bmpr2 mutations (Bmpr2+/−) similar to those found in the majority of HPAH patients. We show that Bmpr2+/− PECs have increased numbers and intracellular localization of caveolae and caveolar structural proteins CAV-1 and Cavin-1 and that these defects are reversed after blocking endocytosis with dynasore. SRC kinase is also constitutively activated in Bmpr2+/− PECs, and localization of CAV-1 to the plasma membrane is restored after treating Bmpr2+/− PECs with the SRC kinase inhibitor 3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (PP2). Late outgrowth endothelial progenitor cells isolated from HPAH patients show similar increased activation of SRC kinase. Moreover, Bmpr2+/− PECs have impaired endothelial barrier function, and barrier function is restored after treatment with PP2. These data suggest that heterozygous null BMPR2 mutations promote SRC-dependent caveolar trafficking defects in PECs and that this may contribute to pulmonary endothelial barrier dysfunction in HPAH patients. PMID:25411245
Yang, Guangdie; Yao, Yinan; Zhou, Jianya; Zhao, Qiong
2012-06-01
Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small cell lung cancer (NSCLC). Our study demonstrated the antitumor effects of icotinib hydrochloride, a highly selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI), in two EGFR-mutated lung cancer cell lines compared to A549, a cell line without EGFR mutations. We incubated PC-9 and HCC827 human lung cancer cell lines both with (E746-A750) mutations with various concentrations of icotinib and gefitinib for 48 h. Cell proliferation and migration were determined using a real-time cell invasion and migration assay and cytotoxicity assay. Apoptosis was assessed by measuring Annexin V staining using flow cytometry. The antitumor effects of icotinib compared to gefitinib were similar and were most effective in reducing the proliferation of EGFR-mutated cells compared to non-mutated controls. Our results suggest the possibility of icotinib as a new therapeutic agent of EGFR-mutated cancer cells, which has the potential to be used in the first-line treatment of EGFR-mutated NSCLC.
Dean, Derek M; Maroja, Luana S; Cottrill, Sarah; Bomkamp, Brent E; Westervelt, Kathleen A; Deitcher, David L
2015-11-27
Inositol 1,4,5-trisphosphate (IP3) regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs) bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy), a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2), a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80(ts) indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling. Copyright © 2016 Dean et al.
Directory of Open Access Journals (Sweden)
Derek M. Dean
2016-02-01
Full Text Available Inositol 1,4,5-trisphosphate (IP3 regulates a host of biological processes from egg activation to cell death. When IP3-specific receptors (IP3Rs bind to IP3, they release calcium from the ER into the cytoplasm, triggering a variety of cell type- and developmental stage-specific responses. Alternatively, inositol polyphosphate kinases can phosphorylate IP3; this limits IP3R activation by reducing IP3 levels, and also generates new signaling molecules altogether. These divergent pathways draw from the same IP3 pool yet cause very different cellular responses. Therefore, controlling the relative rates of IP3R activation vs. phosphorylation of IP3 is essential for proper cell functioning. Establishing a model system that sensitively reports the net output of IP3 signaling is crucial for identifying the controlling genes. Here we report that mutant alleles of wavy (wy, a classic locus of the fruit fly Drosophila melanogaster, map to IP3 3-kinase 2 (IP3K2, a member of the inositol polyphosphate kinase gene family. Mutations in wy disrupt wing structure in a highly specific pattern. RNAi experiments using GAL4 and GAL80ts indicated that IP3K2 function is required in the wing discs of early pupae for normal wing development. Gradations in the severity of the wy phenotype provide high-resolution readouts of IP3K2 function and of overall IP3 signaling, giving this system strong potential as a model for further study of the IP3 signaling network. In proof of concept, a dominant modifier screen revealed that mutations in IP3R strongly suppress the wy phenotype, suggesting that the wy phenotype results from reduced IP4 levels, and/or excessive IP3R signaling.
Nonsense mutations in the human β-globin gene affect mRNA metabolism
International Nuclear Information System (INIS)
Baserga, S.J.; Benz, E.J. Jr.
1988-01-01
A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation
Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O
2015-05-29
The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Sadiq, M.A.; Ahmed, S.; Ali, N.
2013-01-01
To determine the frequency of Janus associated kinase 2 mutation in the patients of BCR-ABL negative classical myeloproliferative neoplasms. Study Design: Cross-sectional descriptive study Place and Duration of Study: Molecular Department of Haematology, Armed Forces Institute of Pathology (AFIP), Rawalpindi from Jul 2011 to Jul 2012. Patients and Methods: Ninety three consecutive patients of Polycythaemia vera (PV), Essential thrombocythaemia (ET) and Idiopathic myelofibrosis (IMF) diagnosed by the conventional haematological criteria were included in the study. All patients were screened for G-T point mutation (V617F) in the JAK2 gene on chromosome 9 by an allele specific PCR. Results: Out of the 93 myeloproliferative neoplasm (MPN) patients, 33(35%) had polycythaemia vera, 36(39%) had essential thrombocythaemia and 24(26%) had idiopathic myelofibrosis. JAK2 mutation was seen in 64/93 (69%) patients including 33/33(100%) in PV, 19/36(52.6%) in ET and 12/24(50%) in IMF. Conclusion: Classical myeloproliferative neoplasms are an important group of heamatological disorder in our country. JAK2 gene mutation is seen in significant proportion of these disorders (69%). JAK2 mutation analysis can be used to differentiate between polycythemia vera and secondary polycythemia in most cases with near certainty, where it was found in 100% of the cases. (author)
Directory of Open Access Journals (Sweden)
Priscila Da Silva Figueiredo Celestino Gomes
Full Text Available The receptors tyrosine kinases (RTKs for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V and CSF-1R (mutation D802V by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii the electrostatic interactions are a decisive factor affecting the binding energy; (iii the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R and D816V (KIT mutations; (iv the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.
Tyrosine kinase inhibitors: Multi-targeted or single-targeted?
Broekman, Fleur; Giovannetti, Elisa; Peters, Godefridus J
2011-02-10
Since in most tumors multiple signaling pathways are involved, many of the inhibitors in clinical development are designed to affect a wide range of targeted kinases. The most important tyrosine kinase families in the development of tyrosine kinase inhibitors are the ABL, SCR, platelet derived growth factor, vascular endothelial growth factor receptor and epidermal growth factor receptor families. Both multi-kinase inhibitors and single-kinase inhibitors have advantages and disadvantages, which are related to potential resistance mechanisms, pharmacokinetics, selectivity and tumor environment. In different malignancies various tyrosine kinases are mutated or overexpressed and several resistance mechanisms exist. Pharmacokinetics is influenced by interindividual differences and differs for two single targeted inhibitors or between patients treated by the same tyrosine kinase inhibitor. Different tyrosine kinase inhibitors have various mechanisms to achieve selectivity, while differences in gene expression exist between tumor and stromal cells. Considering these aspects, one type of inhibitor can generally not be preferred above the other, but will depend on the specific genetic constitution of the patient and the tumor, allowing personalized therapy. The most effective way of cancer treatment by using tyrosine kinase inhibitors is to consider each patient/tumor individually and to determine the strategy that specifically targets the consequences of altered (epi)genetics of the tumor. This strategy might result in treatment by a single multi kinase inhibitor for one patient, but in treatment by a couple of single kinase inhibitors for other patients.
Loss of ATM kinase activity leads to embryonic lethality in mice.
Daniel, Jeremy A; Pellegrini, Manuela; Lee, Baeck-Seung; Guo, Zhi; Filsuf, Darius; Belkina, Natalya V; You, Zhongsheng; Paull, Tanya T; Sleckman, Barry P; Feigenbaum, Lionel; Nussenzweig, André
2012-08-06
Ataxia telangiectasia (A-T) mutated (ATM) is a key deoxyribonucleic acid (DNA) damage signaling kinase that regulates DNA repair, cell cycle checkpoints, and apoptosis. The majority of patients with A-T, a cancer-prone neurodegenerative disease, present with null mutations in Atm. To determine whether the functions of ATM are mediated solely by its kinase activity, we generated two mouse models containing single, catalytically inactivating point mutations in Atm. In this paper, we show that, in contrast to Atm-null mice, both D2899A and Q2740P mutations cause early embryonic lethality in mice, without displaying dominant-negative interfering activity. Using conditional deletion, we find that the D2899A mutation in adult mice behaves largely similar to Atm-null cells but shows greater deficiency in homologous recombination (HR) as measured by hypersensitivity to poly (adenosine diphosphate-ribose) polymerase inhibition and increased genomic instability. These results may explain why missense mutations with no detectable kinase activity are rarely found in patients with classical A-T. We propose that ATM kinase-inactive missense mutations, unless otherwise compensated for, interfere with HR during embryogenesis.
PROGRANULIN MUTATIONS AFFECTS BRAIN OSCILLATORY ACTIVITY IN FRONTO-TEMPORAL DEMENTIA
Directory of Open Access Journals (Sweden)
Davide Vito Moretti
2016-02-01
Full Text Available Background: mild cognitive impairment (MCI is a clinical stage indicating a prodromal phase of dementia. This practical concept could be used also for fronto-temporal dementia (FTD. Progranulin (PGRN has been recently recognized as a useful diagnostic biomarker for fronto-temporal lobe degeneration (FTLD due to GRN null mutations. Electroencephalography (EEG is a reliable tool in detecting brain networks changes. The working hypothesis of the present study is that EEG oscillations could detect different modifications among FTLD stages (FTD-MCI versus overt FTD as well as differences between GRN mutation carriers versus non carriers in patients with overt FTD. Methods: EEG in all patients and PGRN dosage in patients with a clear FTD were detected. The cognitive state has been investigated through mini mental state examination (MMSE. Results: MCI-FTD showed a significant lower spectral power in both alpha and theta oscillations as compared to overt FTD. GRN mutations carriers affected by FTLD show an increase in high alpha and decrease in theta oscillations as compared to non-carriers.Conclusion: EEG frequency rhythms are sensible to different stage of FTD and could detect changes in brain oscillatory activity affected by GRN mutations
Sergerie, Yan; Boivin, Guy
2008-01-01
Drug-resistant herpes simplex virus type 1 (HSV-1) recombinant strains harboring mutations in the thymidine kinase and/or the DNA polymerase genes were evaluated for their susceptibility to various antivirals in the presence of 25 microg/ml of hydroxyurea (HyU). The latter compound decreased the 50% inhibitory concentrations of acyclovir by 1.5-3.8-fold and that of cidofovir by 2.7-14.4-fold. However, HyU did not affect the susceptibilities of the various recombinant mutants to foscarnet. Hydroxyurea, a ribonucleotide reductase inhibitor, can increase the activity of nucleoside/nucleotide analogues against drug-resistant viruses.
Directory of Open Access Journals (Sweden)
Orr Ashenberg
2017-03-01
Full Text Available The innate-immune restriction factor MxA inhibits influenza replication by targeting the viral nucleoprotein (NP. Human influenza virus is more resistant than avian influenza virus to inhibition by human MxA, and prior work has compared human and avian viral strains to identify amino-acid differences in NP that affect sensitivity to MxA. However, this strategy is limited to identifying sites in NP where mutations that affect MxA sensitivity have fixed during the small number of documented zoonotic transmissions of influenza to humans. Here we use an unbiased deep mutational scanning approach to quantify how all single amino-acid mutations to NP affect MxA sensitivity in the context of replication-competent virus. We both identify new sites in NP where mutations affect MxA resistance and re-identify mutations known to have increased MxA resistance during historical adaptations of influenza to humans. Most of the sites where mutations have the greatest effect are almost completely conserved across all influenza A viruses, and the amino acids at these sites confer relatively high resistance to MxA. These sites cluster in regions of NP that appear to be important for its recognition by MxA. Overall, our work systematically identifies the sites in influenza nucleoprotein where mutations affect sensitivity to MxA. We also demonstrate a powerful new strategy for identifying regions of viral proteins that affect inhibition by host factors.
Vickrey, Anna I.; Domyan, Eric T.; Horvath, Martin P.; Shapiro, Michael D.
2015-01-01
Head crests are important display structures in wild bird species and are also common in domesticated lineages. Many breeds of domestic rock pigeon (Columba livia) have crests of reversed occipital feathers, and this recessive trait is associated with a nonsynonymous coding mutation in the intracellular kinase domain of EphB2 (Ephrin receptor B2). The domestic ringneck dove (Streptopelia risoria) also has a recessive crested morph with reversed occipital feathers, and interspecific crosses between crested doves and pigeons produce crested offspring, suggesting a similar genetic basis for this trait in both species. We therefore investigated EphB2 as a candidate for the head crest phenotype of ringneck doves and identified a nonsynonymous coding mutation in the intracellular kinase domain that is significantly associated with the crested morph. This mutation is over 100 amino acid positions away from the crest mutation found in rock pigeons, yet both mutations are predicted to negatively affect the function of ATP-binding pocket. Furthermore, bacterial toxicity assays suggest that “crest” mutations in both species severely impact kinase activity. We conclude that head crests are associated with different mutations in the same functional domain of the same gene in two different columbid species, thereby representing striking evolutionary convergence in morphology and molecules. PMID:26104009
Moschini, Ilaria; Dell'Anna, Cristina; Losardo, Pier Luigi; Bordi, Paola; D'Abbiero, Nunziata; Tiseo, Marcello
2015-01-01
Non-small-cell lung cancer (NSCLC) occurs, approximately, in 80-85% of all cases of lung cancer. The majority of patients present locally advanced or metastatic disease when diagnosed, with poor prognosis. The discovery of activating mutations in the EGFR gene has started a new era of personalized treatment for NSCLC patients. To improve the treatment outcome in patients with unresectable NSCLC and, in particular, EGFR mutated, a combined strategy of radiotherapy and medical treatment can be undertaken. In this review we will discuss preclinical data regarding EGF receptor (EGFR) tyrosine kinase inhibitors (TKIs) and radiotherapy, available clinical trials investigating efficacy and toxicity of combined treatment (thoracic or whole brain radiotherapy and EGFR-TKIs) and, also, the role of local radiation in mutated EGFR patients who developed EGFR-TKI resistance.
Directory of Open Access Journals (Sweden)
Arístegui Javier
2011-06-01
Full Text Available Abstract Background Congenital insensitivity to pain with anhidrosis (CIPA is a rare autosomal recessive genetic disease characterized by the lack of reaction to noxious stimuli and anhidrosis. It is caused by mutations in the NTRK1 gene, which encodes the high affinity tyrosine kinase receptor I for Neurotrophic Growth Factor (NGF. Case Presentation We present the case of a female patient diagnosed with CIPA at the age of 8 months. The patient is currently 6 years old and her psychomotor development conforms to her age (RMN, SPECT and psychological study are in the range of normality. PCR amplification of DNA, followed by direct sequencing, was used to investigate the presence of NTRK1 gene mutations. Reverse transcriptase (RT-PCR amplification of RNA, followed by cloning and sequencing of isolated RT-PCR products was used to characterize the effect of the mutations on NTRK1 mRNA splicing. The clinical diagnosis of CIPA was confirmed by the detection of two splice-site mutations in NTRK1, revealing that the patient was a compound heterozygote at this gene. One of these alterations, c.574+1G>A, is located at the splice donor site of intron 5. We also found a second mutation, c.2206-2 A>G, not previously reported in the literature, which is located at the splice acceptor site of intron 16. Each parent was confirmed to be a carrier for one of the mutations by DNA sequencing analysis. It has been proposed that the c.574+1G>A mutation would cause exon 5 skipping during NTRK1 mRNA splicing. We could confirm this prediction and, more importantly, we provide evidence that the novel c.2206-2A>G mutation also disrupts normal NTRK1 splicing, leading to the use of an alternative splice acceptor site within exon 17. As a consequence, this mutation would result in the production of a mutant NTRK1 protein with a seven aminoacid in-frame deletion in its tyrosine kinase domain. Conclusions We present the first description of a CIPA-associated NTRK1 mutation
Directory of Open Access Journals (Sweden)
April eReynolds
2014-06-01
Full Text Available Missense mutations in the Leucine Rich Repeat protein Kinase 2 (LRRK2 gene are the most common genetic predisposition to develop Parkinson’s disease (PD LRRK2 is a large multi-domain phosphoprotein with a GTPase domain and a serine/threonine protein kinase domain whose activity is implicated in neuronal toxicity; however the precise mechanism is unknown. LRRK2 autophosphorylates on several serine/threonine residues across the enzyme and is found constitutively phosphorylated on Ser910, Ser935, Ser955 and Ser973, which are proposed to be regulated by upstream kinases. Here we investigate the phosphoregulation at these sites by analyzing the effects of disease-associated mutations Arg1441Cys, Arg1441Gly, Ala1442Pro, Tyr1699Cys, Ile2012Thr, Gly2019Ser, and Ile2020Thr. We also studied alanine substitutions of phosphosite serines 910, 935, 955 and 973 and specific LRRK2 inhibition on autophosphorylation of LRRK2 Ser1292, Thr1491, Thr2483 and phosphorylation at the cellular sites. We found that mutants in the Roc-COR domains, including Arg1441Cys, Arg1441His, Ala1442Pro and Tyr1699Cys, can positively enhance LRRK2 kinase activity while concomitantly inducing the dephosphorylation of the cellular sites. Mutation of the cellular sites individually did not affect LRRK2 intrinsic kinase activity; however, Ser910/935/955/973Ala mutations trended toward increased kinase activity of LRRK2. Increased cAMP levels did not lead to increased LRRK2 cellular site phosphorylation, 14-3-3 binding or kinase activity. In cells, inhibition of LRRK2 kinase activity leads to dephosphorylation of Ser1292 by Calyculin A and okadaic acid sensitive phosphatases, while the cellular sites are dephosphorylated by Calyculin A sensitive phosphatases. These findings indicate that comparative analysis of both Ser1292 and Ser910/935/955/973 phosphorylation sites will provide important and distinct measures of LRRK2 kinase and biological activity in vitro and in vivo.
Schapansky, Jason; Khasnavis, Saurabh; DeAndrade, Mark P; Nardozzi, Jonathan D; Falkson, Samuel R; Boyd, Justin D; Sanderson, John B; Bartels, Tim; Melrose, Heather L; LaVoie, Matthew J
2018-03-01
Missense mutations in the multi-domain kinase LRRK2 cause late onset familial Parkinson's disease. They most commonly with classic proteinopathy in the form of Lewy bodies and Lewy neurites comprised of insoluble α-synuclein, but in rare cases can also manifest tauopathy. The normal function of LRRK2 has remained elusive, as have the cellular consequences of its mutation. Data from LRRK2 null model organisms and LRRK2-inhibitor treated animals support a physiological role for LRRK2 in regulating lysosome function. Since idiopathic and LRRK2-linked PD are associated with the intraneuronal accumulation of protein aggregates, a series of critical questions emerge. First, how do pathogenic mutations that increase LRRK2 kinase activity affect lysosome biology in neurons? Second, are mutation-induced changes in lysosome function sufficient to alter the metabolism of α-synuclein? Lastly, are changes caused by pathogenic mutation sensitive to reversal with LRRK2 kinase inhibitors? Here, we report that mutation of LRRK2 induces modest but significant changes in lysosomal morphology and acidification, and decreased basal autophagic flux when compared to WT neurons. These changes were associated with an accumulation of detergent-insoluble α-synuclein and increased neuronal release of α-synuclein and were reversed by pharmacologic inhibition of LRRK2 kinase activity. These data demonstrate a critical and disease-relevant influence of native neuronal LRRK2 kinase activity on lysosome function and α-synuclein homeostasis. Furthermore, they also suggest that lysosome dysfunction, altered neuronal α-synuclein metabolism, and the insidious accumulation of aggregated protein over decades may contribute to pathogenesis in this late-onset form of familial PD. Copyright © 2017 Elsevier Inc. All rights reserved.
Ávila-Fernández, Almudena; Cantalapiedra, Diego; Aller, Elena; Vallespín, Elena; Aguirre-Lambán, Jana; Blanco-Kelly, Fiona; Corton, M; Riveiro-Álvarez, Rosa; Allikmets, Rando; Trujillo-Tiebas, María José; Millán, José M; Cremers, Frans P M; Ayuso, Carmen
2010-12-03
Retinitis pigmentosa (RP) is a genetically heterogeneous disorder characterized by progressive loss of vision. The aim of this study was to identify the causative mutations in 272 Spanish families using a genotyping microarray. 272 unrelated Spanish families, 107 with autosomal recessive RP (arRP) and 165 with sporadic RP (sRP), were studied using the APEX genotyping microarray. The families were also classified by clinical criteria: 86 juveniles and 186 typical RP families. Haplotype and sequence analysis were performed to identify the second mutated allele. At least one-gene variant was found in 14% and 16% of the juvenile and typical RP groups respectively. Further study identified four new mutations, providing both causative changes in 11% of the families. Retinol Dehydrogenase 12 (RDH12) was the most frequently mutated gene in the juvenile RP group, and Usher Syndrome 2A (USH2A) and Ceramide Kinase-Like (CERKL) were the most frequently mutated genes in the typical RP group. The only variant found in CERKL was p.Arg257Stop, the most frequent mutation. The genotyping microarray combined with segregation and sequence analysis allowed us to identify the causative mutations in 11% of the families. Due to the low number of characterized families, this approach should be used in tandem with other techniques.
Springuel, Lorraine; Losdyck, Elisabeth; Saussoy, Pascale; Turcq, Béatrice; Mahon, François-Xavier; Knoops, Laurent; Renauld, Jean-Christophe
2016-12-01
Genomic instability drives cancer progression by promoting genetic abnormalities that allow for the multi-step clonal selection of cells with growth advantages. We previously reported that the IL-9-dependent TS1 cell line sequentially acquired activating substitutions in JAK1 and JAK3 upon successive selections for growth factor independent and JAK inhibitor-resistant cells, suggestive of a defect in mutation avoidance mechanisms. In the first part of this paper, we discovered that the gene encoding mutL homolog-1 (MLH1), a key component of the DNA mismatch repair system, is silenced by promoter methylation in TS1 cells. By means of stable ectopic expression and RNA interference methods, we showed that the high frequencies of growth factor-independent and inhibitor-resistant cells with activating JAK mutations can be attributed to the absence of MLH1 expression. In the second part of this paper, we confirm the clinical relevance of our findings by showing that chronic myeloid leukemia relapses upon ABL-targeted therapy correlated with a lower expression of MLH1 messenger RNA. Interestingly, the mutational profile observed in our TS1 model, characterized by a strong predominance of T:A>C:G transitions, was identical to the one described in the literature for primitive cells derived from chronic myeloid leukemia patients. Taken together, our observations demonstrate for the first time a causal relationship between MLH1-deficiency and incidence of oncogenic point mutations in tyrosine kinases driving cell transformation and acquired resistance to kinase-targeted cancer therapies.
MeCP2 Rett mutations affect large scale chromatin organization
DEFF Research Database (Denmark)
Gupta, Noopur Agarwal; Becker, Annette; Jost, K Laurence
2011-01-01
Rett syndrome is a neurological, X chromosomal-linked disorder associated with mutations in the MECP2 gene. MeCP2 protein has been proposed to play a role in transcriptional regulation as well as in chromatin architecture. Since MeCP2 mutant cells exhibit surprisingly mild changes in gene...... expression, we have now explored the possibility that Rett mutations may affect the ability of MeCP2 to bind and organize chromatin. We found that all but one of the 21 missense MeCP2 mutants analyzed accumulated at heterochromatin and about half of them were significantly affected. Furthermore, two......-thirds of all mutants showed a significantly decreased ability to cluster heterochromatin. Three mutants containing different proline substitutions (P101H, P101R and P152R) were severely affected only in heterochromatin clustering and located far away from the DNA interface in the MeCP2 methyl-binding domain...
International Nuclear Information System (INIS)
Abd El Kader, Y.; Safwat, E.; Kassem, H.A.; Kassem, N.M.; Emera, G.
2013-01-01
Background: Epidermal growth factor receptor (EGFR) and its downstream factors KRAS and BRAF are mutated in several types of cancer, affecting the clinical response to EGFR inhibitors. Mutations in the EGFR kinase domain predict sensitivity to the tyrosine kinase inhibitors gefltinib and erlotinib in lung adenocarcinoma, while activating point mutations in KRAS and BRAF confer resistance to the anti-EGFR monoclonal antibody cetuximab in colorectal cancer. The development of new generation methods for systematic mutation screening of these genes will allow more appropriate therapeutic choices. Purpose: Detection of KRAS mutation in Egyptian colorectal cancer (CRC) patients by the KRAS Strip Assay. Methods: Examination of 20 colorectal cancer (CRC) patients is done to detect KRAS mutations by KRAS Strip Assay. For the Strip Assay, a mutant-enriched PCR was followed by hybridization to KRAS-specific probes bound to a nitrocellulose strip. Results: Among 20 patients, KRAS mutations were identified in 80% of patients by the KRAS Strip Assay. Conclusions: Our preliminary results suggest that KRAS Strip Assay is an alternative to protocols currently in use for KRAS mutation detection
MVP-Associated Filamin A Mutations Affect FlnA-PTPN12 (PTP-PEST) Interactions.
Duval, Damien; Labbé, Pauline; Bureau, Léa; Le Tourneau, Thierry; Norris, Russell A; Markwald, Roger R; Levine, Robert; Schott, Jean-Jacques; Mérot, Jean
2015-09-08
Although the genetic basis of mitral valve prolapse (MVP) has now been clearly established, the molecular and cellular mechanisms involved in the pathological processes associated to a specific mutation often remain to be determined. The FLNA gene (encoding Filamin A; FlnA) was the first gene associated to non-syndromic X-linked myxomatous valvular dystrophy, but the impacts of the mutations on its function remain un-elucidated. Here, using the first repeats (1-8) of FlnA as a bait in a yeast two-hybrid screen, we identified the tyrosine phosphatase PTPN12 (PTP-PEST) as a specific binding partner of this region of FlnA protein. In addition, using yeast two-hybrid trap assay pull down and co-immunoprecipitation experiments, we showed that the MVP-associated FlnA mutations (G288R, P637Q, H743P) abolished FlnA/PTPN12 interactions. PTPN12 is a key regulator of signaling pathways involved in cell-extracellular matrix (ECM) crosstalk, cellular responses to mechanical stress that involve integrins, focal adhesion transduction pathways, and actin cytoskeleton dynamics. Interestingly, we showed that the FlnA mutations impair the activation status of two PTPN12 substrates, the focal adhesion associated kinase Src, and the RhoA specific activating protein p190RhoGAP. Together, these data point to PTPN12/FlnA interaction and its weakening by FlnA mutations as a mechanism potentially involved in the physiopathology of FlnA-associated MVP.
MVP-Associated Filamin A Mutations Affect FlnA-PTPN12 (PTP-PEST Interactions
Directory of Open Access Journals (Sweden)
Damien Duval
2015-09-01
Full Text Available Although the genetic basis of mitral valve prolapse (MVP has now been clearly established, the molecular and cellular mechanisms involved in the pathological processes associated to a specific mutation often remain to be determined. The FLNA gene (encoding Filamin A; FlnA was the first gene associated to non-syndromic X-linked myxomatous valvular dystrophy, but the impacts of the mutations on its function remain un-elucidated. Here, using the first repeats (1–8 of FlnA as a bait in a yeast two-hybrid screen, we identified the tyrosine phosphatase PTPN12 (PTP-PEST as a specific binding partner of this region of FlnA protein. In addition, using yeast two-hybrid trap assay pull down and co-immunoprecipitation experiments, we showed that the MVP-associated FlnA mutations (G288R, P637Q, H743P abolished FlnA/PTPN12 interactions. PTPN12 is a key regulator of signaling pathways involved in cell-extracellular matrix (ECM crosstalk, cellular responses to mechanical stress that involve integrins, focal adhesion transduction pathways, and actin cytoskeleton dynamics. Interestingly, we showed that the FlnA mutations impair the activation status of two PTPN12 substrates, the focal adhesion associated kinase Src, and the RhoA specific activating protein p190RhoGAP. Together, these data point to PTPN12/FlnA interaction and its weakening by FlnA mutations as a mechanism potentially involved in the physiopathology of FlnA-associated MVP.
Directory of Open Access Journals (Sweden)
Silvia Lovera
2015-11-01
Full Text Available Due to its inhibition of the Abl kinase domain in the BCR-ABL fusion protein, imatinib is strikingly effective in the initial stage of chronic myeloid leukemia with more than 90% of the patients showing complete remission. However, as in the case of most targeted anti-cancer therapies, the emergence of drug resistance is a serious concern. Several drug-resistant mutations affecting the catalytic domain of Abl and other tyrosine kinases are now known. But, despite their importance and the adverse effect that they have on the prognosis of the cancer patients harboring them, the molecular mechanism of these mutations is still debated. Here by using long molecular dynamics simulations and large-scale free energy calculations complemented by in vitro mutagenesis and microcalorimetry experiments, we model the effect of several widespread drug-resistant mutations of Abl. By comparing the conformational free energy landscape of the mutants with those of the wild-type tyrosine kinases we clarify their mode of action. It involves significant and complex changes in the inactive-to-active dynamics and entropy/enthalpy balance of two functional elements: the activation-loop and the conserved DFG motif. What is more the T315I gatekeeper mutant has a significant impact on the binding mechanism itself and on the binding kinetics.
Deoxyribonucleoside kinases in mitochondrial DNA depletion.
Saada-Reisch, Ann
2004-10-01
Mitochondrial DNA (mtDNA) depletion syndromes (MDS) are a heterogeneous group of mitochondrial disorders, manifested by a decreased mtDNA copy number and respiratory chain dysfunction. Primary MDS are inherited autosomally and may affect a single organ or multiple tissues. Mutated mitochondrial deoxyribonucleoside kinases; deoxyguanosine kinase (dGK) and thymidine kinase 2 (TK2), were associated with the hepatocerebral and myopathic forms of MDS respectively. dGK and TK2 are key enzymes in the mitochondrial nucleotide salvage pathway, providing the mitochondria with deoxyribonucleotides (dNP) essential for mtDNA synthesis. Although the mitochondrial dNP pool is physically separated from the cytosolic one, dNP's may still be imported through specific transport. Non-replicating tissues, where cytosolic dNP supply is down regulated, are thus particularly vulnerable to dGK and TK2 deficiency. The overlapping substrate specificity of deoxycytidine kinase (dCK) may explain the relative sparing of muscle in dGK deficiency, while low basal TK2 activity render this tissue susceptible to TK2 deficiency. The precise pathophysiological mechanisms of mtDNA depletion due to dGK and TK2 deficiencies remain to be determined, though recent findings confirm that it is attributed to imbalanced dNTP pools.
Czech Academy of Sciences Publication Activity Database
Andrs, M.; Kobarecny, J.; Jun, D.; Hodný, Zdeněk; Bartek, Jiří; Kuca, K.
2015-01-01
Roč. 58, č. 1 (2015), s. 41-71 ISSN 0022-2623 R&D Projects: GA MŠk(CZ) CZ.1.07/2.3.00/30.0044 Grant - others:University Hospital Hradec Kralove(CZ) 00179906; Faculty of Military Health Sciences, University of Defence(CZ) SV/FVZ201402 Institutional support: RVO:68378050 Keywords : DEPENDENT PROTEIN-KINASE * STRAND BREAK REPAIR * SELECTIVE PI3K-BETA INHIBITORS * TELANGIECTASIA MUTATED KINASE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.589, year: 2015
Jin, Ying; Shao, Yang; Shi, Xun; Lou, Guangyuan; Zhang, Yiping; Wu, Xue; Tong, Xiaoling; Yu, Xinmin
2016-01-01
Patients with advanced non-small-cell lung cancer (NSCLC) harboring sensitive epithelial growth factor receptor (EGFR) mutations invariably develop acquired resistance to EGFR tyrosine kinase inhibitors (TKIs). Identification of actionable genetic alterations conferring drug-resistance can be helpful for guiding the subsequent treatment decision. One of the major resistant mechanisms is secondary EGFR-T790M mutation. Other mechanisms, such as HER2 and MET amplifications, and PIK3CA mutations, were also reported. However, the mechanisms in the remaining patients are still unknown. In this study, we performed mutational profiling in a cohort of 83 NSCLC patients with TKI-sensitizing EGFR mutations at diagnosis and acquired resistance to three different first-generation EGFR TKIs using targeted next generation sequencing (NGS) of 416 cancer-related genes. In total, we identified 322 genetic alterations with a median of 3 mutations per patient. 61% of patients still exhibit TKI-sensitizing EGFR mutations, and 36% of patients acquired EGFR-T790M. Besides other known resistance mechanisms, we identified TET2 mutations in 12% of patients. Interestingly, we also observed SOX2 amplification in EGFR-T790M negative patients, which are restricted to Icotinib treatment resistance, a drug widely used in Chinese NSCLC patients. Our study uncovered mutational profiles of NSCLC patients with first-generation EGFR TKIs resistance with potential therapeutic implications. PMID:27528220
Martinez-Serra, Jordi; Gutiérrez, Antonio; Marcús, Toni F; Soverini, Simona; Amat, Juan Carlos; Navarro-Palou, María; Ros, Teresa; Bex, Teresa; Ballester, Carmen; Bauça, Josep Miquel; SanFelix, Sara; Novo, Andrés; Vidal, Carmen; Santos, Carmen; Besalduch, Joan
2012-03-01
Within the laboratory protocols, used for the study of BCR-ABL resistance mutations in chronic myeloid leukemia patients treated with Imatinib, direct sequencing remains the reference method. Since the incidence of patients with a mutation-related loss of response is not very high, it is very useful in the routine laboratory to perform a fast pre-screening method. With this in mind, we have designed a new technique, based on a single Real-Time FRET-based PCR, followed by a study of melting peaks. This new tool, developed in a LightCycler 2.0, combines four different fluorescence channels for the simultaneous detection, in a single close tube, of critical mutations within the ABL kinase domain. Assay evaluation performed on 33 samples, previously genotyped by sequentiation, resulted in full concordance of results. This new methodology detects in a few steps the presence of critical mutations associated to Imatinib resistance. Copyright © 2012 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sprowles, Amy; Robinson, Dan; Wu Yimi; Kung, H.-J.; Wisdom, Ron
2005-01-01
The mammalian JNK signaling pathway regulates the transcriptional response of cells to environmental stress, including UV irradiation. This signaling pathway is composed of a classical MAP kinase cascade; activation results in phosphorylation of the transcription factor substrates c-Jun and ATF2, and leads to changes in gene expression. The defining components of this pathway are conserved in the fission yeast S. pombe, where the genetic studies have shown that the ability of the JNK homolog Spc1 to be activated in response to UV irradiation is dependent on the presence of the transcription factor substrate Atf1. We have used genetic analysis to define the role of c-Jun in activation of the mammalian JNK signaling pathway. Our results show that optimal activation of JNK requires the presence of its transcription factor substrate c-Jun. Mutational analysis shows that the ability of c-Jun to support efficient activation of JNK requires the ability of Jun to bind DNA, suggesting a transcriptional mechanism. Consistent with this, we show that c-Jun represses the expression of several MAP kinase phosphatases. In the absence of c-Jun, the increased expression of MAP kinase phosphatases leads to impaired activation of the ERK, JNK, and p38 MAP kinases after pathway activation. The results show that one function of c-Jun is to regulate the efficiency of signaling by the ERK, p38, and JNK MAP kinases, a function that is likely to affect cellular responses to many different stimuli
Epilepsy caused by CDKL5 mutations.
Castrén, Maija; Gaily, Eija; Tengström, Carola; Lähdetie, Jaana; Archer, Hayley; Ala-Mello, Sirpa
2011-01-01
Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been identified in female patients with early onset epileptic encephalopathy and severe mental retardation with a Rett-like phenotype. Subsequently CDKL5 mutations were shown to be associated with more diverse phenotypes including mild epilepsy and autism without epilepsy. Furthermore, CDKL5 mutations were found in patients with Angelman-like phenotype. The severity of epilepsy associated with CDKL5 mutations was recently shown to correlate with the type of CDKL5 mutations and epilepsy was identified to involve three distinct sequential stages. Here, we describe the phenotype of a severe form of neurodevelopmental disease in a female patient with a de novo nonsense mutation of the CDKL5 gene c.175C > T (p.R59X) affecting the catalytic domain of CDKL5 protein. Mutations in the CDKL5 gene are less common in males and can be associated with a genomic deletion as found in our male patient with a deletion of 0.3 Mb at Xp22.13 including the CDKL5 gene. We review phenotypes associated with CDKL5 mutations and examine putative relationships between the clinical epilepsy phenotype and the type of the mutation in the CDKL5 gene. © 2010 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
Gollasch, Benjamin; Basmanav, Fitnat Buket; Nanda, Arti; Fritz, Günter; Mahmoudi, Hassnaa; Thiele, Holger; Wehner, Maria; Wolf, Sabrina; Altmüller, Janine; Nürnberg, Peter; Frank, Jorge; Betz, Regina C
2015-11-01
Three children from an expanded consanguineous Kuwaiti kindred presented with ankyloblepharon, sparse and curly hair, and hypoplastic nails, suggestive of CHAND syndrome (OMIM 214350) that belongs to the heterogeneous spectrum of ectodermal dysplasias. After exclusion of pathogenic mutations in TP63 we performed homozygosity mapping, followed by exome sequencing of one affected individual. We initially identified three homozygous mutations in the linked region, located in PWP2, MX2 and RIPK4. Recently, mutations in RIPK4 have been reported in Bartsocas-Papas syndrome (OMIM 263650) that shows overlapping clinical symptoms with the phenotype observed in the affected individuals studied here. Subsequent analysis of affected and non-affected family members showed that mutation c.850G>A (p.Glu284Lys) in RIPK4 was in complete segregation with the disease phenotype, in accordance with an autosomal recessive inheritance pattern, thus supporting pathogenicity of this variant. Interestingly, however, our patients did not have cleft lip/palate, a common feature encountered in Bartsocas-Papas syndrome. Whereas in Bartsocas-Papas syndromes missense mutations are usually located within the serin/threonin kinase of RIPK4, the mutation detected in our family resides just outside of the kinase domain, which could explain the milder phenotype. Our data raise the question if CHAND syndrome indeed is a distinct entity. Alternatively, CHAND and Bartsocas-Papas syndrome might be allelic disorders or RIPK4 mutations could confer varying degrees of phenotypic severity, depending on their localization within or outside functionally important domains. Our findings indicate that making an accurate diagnosis based only on the prevailing clinical symptoms is challenging. © 2015 Wiley Periodicals, Inc.
Forstner, M; Müller, A; Rognan, D; Kriechbaum, M; Wallimann, T
1998-07-01
We show that the mutation of an uncharged residue far from the active site to another uncharged residue can have effects on the active site without disturbing the overall structure of the protein. Cis-proline 207 of mitochondrial creatine kinase was mutated to alanine. The mutant showed a decrease in the pH-optimum for ATP synthesis by 1.5 units while the maximum relative activity was lowered to 53% of the wild-type enzyme. In the direction of ATP consumption, the pH optimum was lowered by 1.3 units and the maximum relative activity was 49% of the wild-type enzyme. The enzyme kinetic parameters Km and Kd for the substrates did not change dramatically, indicating a largely unperturbed active site. Small-angle X-ray scattering was used to investigate the structural change concomitant with the mutation, yielding a scattering profile only slightly different from that of the wild-type enzyme. Neither the radius of gyration nor the molecular mass showed any significant differences, leading to the conclusion that quarternary organization and fold of the mutant and the wild-type enzymes were similar. Theoretical analysis suggests the most probable primary source of structural change to be a transition of residue 207 peptide bond torsional angle co from the cis to the trans configuration.
Westwood, Marie; Joore, Manuela; Whiting, Penny; Asselt, Thea; Ramaekers, Bram; Armstrong, Nigel; Misso, Kate; Severens, Hans; Kleijnen, Jos
2014-01-01
markdownabstract__Abstract__ Background: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment with standard chemotherapy. Patients with NSCLC are therefore tested for EGFR-TK tumour gene mutations to inform treatment decisions. There are a variety of tests available to detect these mutations. T...
García-Cazorla, Angels; Oyarzabal, Alfonso; Fort, Joana; Robles, Concepción; Castejón, Esperanza; Ruiz-Sala, Pedro; Bodoy, Susanna; Merinero, Begoña; Lopez-Sala, Anna; Dopazo, Joaquín; Nunes, Virginia; Ugarte, Magdalena; Artuch, Rafael; Palacín, Manuel; Rodríguez-Pombo, Pilar; Alcaide, Patricia; Navarrete, Rosa; Sanz, Paloma; Font-Llitjós, Mariona; Vilaseca, Ma Antonia; Ormaizabal, Aida; Pristoupilova, Anna; Agulló, Sergi Beltran
2014-04-01
Inactivating mutations in the BCKDK gene, which codes for the kinase responsible for the negative regulation of the branched-chain α-keto acid dehydrogenase complex (BCKD), have recently been associated with a form of autism in three families. In this work, two novel exonic BCKDK mutations, c.520C>G/p.R174G and c.1166T>C/p.L389P, were identified at the homozygous state in two unrelated children with persistently reduced body fluid levels of branched-chain amino acids (BCAAs), developmental delay, microcephaly, and neurobehavioral abnormalities. Functional analysis of the mutations confirmed the missense character of the c.1166T>C change and showed a splicing defect r.[520c>g;521_543del]/p.R174Gfs1*, for c.520C>G due to the presence of a new donor splice site. Mutation p.L389P showed total loss of kinase activity. Moreover, patient-derived fibroblasts showed undetectable (p.R174Gfs1*) or barely detectable (p.L389P) levels of BCKDK protein and its phosphorylated substrate (phospho-E1α), resulting in increased BCKD activity and the very rapid BCAA catabolism manifested by the patients' clinical phenotype. Based on these results, a protein-rich diet plus oral BCAA supplementation was implemented in the patient homozygous for p.R174Gfs1*. This treatment normalized plasma BCAA levels and improved growth, developmental and behavioral variables. Our results demonstrate that BCKDK mutations can result in neurobehavioral deficits in humans and support the rationale for dietary intervention. © 2014 WILEY PERIODICALS, INC.
Energy Technology Data Exchange (ETDEWEB)
Kim, Chae Hyun; Choi, Yoon Jung; Choi, Seon Hyeong; Rho, Myong Ho Kook Shin Ho; Chung, Eun Chul [Dept. of Radiology, Kangbuk Samsung Hospital, Sungkyunkwan University College of Medicine, Seoul (Korea, Republic of); Chae, Seoung Wan; Kim, Dong Hoon; Sohn, Jin Hee [Dept. of Radiology, Kangbuk Samsung Hospital, Sungkyunkwan University College of Medicine, Seoul (Korea, Republic of); Yun, Ji Sup [Dept. of Radiology, Kangbuk Samsung Hospital, Sungkyunkwan University College of Medicine, Seoul (Korea, Republic of)
2012-01-15
To study the prevalence of B type Raf kinase (BRAF) mutations, and to evaluate the ultrasonographic and clinicopathological features associated with thyroid cytology of indeterminate nodules. We assessed the presence or absence of BRAF mutation in 44 specimens from patients with cytologically indeterminate thyroid nodules according to two consecutive preoperative fine needle aspiration cytology procedures. In 9 specimens, the test for BRAF mutation was not possible due to scant cellularity. DNA was extracted from the atypical cells and then analyzed for the BRAF V600E mutation by pyrosequencing. The ultrasonographic and clinicopathological features of the patients were characterized according to their mutation status. The BRAF V600E mutation was present in 17 (48.6%) of 35 patients with indeterminate cytology results and in 17 (54.8%) of the 31 patients with papillary thyroid cancer (PTC). Twenty two of 35 cytologically indeterminate nodules had calcifications, and among them 14 cases were proven to be positive for BRAF V600E mutations. Extrathyroid extension was significantly more frequent in the presence of the BRAF V600E mutation (p = 0.027), while tumor size, lympho-vascular invasion, or lymph node metastasis were not associated with the mutation. Screening for BRAF V600E mutations in conjunction with cytology may increase the diagnostic accuracy for PTC with indeterminate cytology results.
International Nuclear Information System (INIS)
Kim, Chae Hyun; Choi, Yoon Jung; Choi, Seon Hyeong; Rho, Myong Ho Kook Shin Ho; Chung, Eun Chul; Chae, Seoung Wan; Kim, Dong Hoon; Sohn, Jin Hee; Yun, Ji Sup
2012-01-01
To study the prevalence of B type Raf kinase (BRAF) mutations, and to evaluate the ultrasonographic and clinicopathological features associated with thyroid cytology of indeterminate nodules. We assessed the presence or absence of BRAF mutation in 44 specimens from patients with cytologically indeterminate thyroid nodules according to two consecutive preoperative fine needle aspiration cytology procedures. In 9 specimens, the test for BRAF mutation was not possible due to scant cellularity. DNA was extracted from the atypical cells and then analyzed for the BRAF V600E mutation by pyrosequencing. The ultrasonographic and clinicopathological features of the patients were characterized according to their mutation status. The BRAF V600E mutation was present in 17 (48.6%) of 35 patients with indeterminate cytology results and in 17 (54.8%) of the 31 patients with papillary thyroid cancer (PTC). Twenty two of 35 cytologically indeterminate nodules had calcifications, and among them 14 cases were proven to be positive for BRAF V600E mutations. Extrathyroid extension was significantly more frequent in the presence of the BRAF V600E mutation (p = 0.027), while tumor size, lympho-vascular invasion, or lymph node metastasis were not associated with the mutation. Screening for BRAF V600E mutations in conjunction with cytology may increase the diagnostic accuracy for PTC with indeterminate cytology results.
Pardanani, A; Hood, J; Lasho, T; Levine, R L; Martin, M B; Noronha, G; Finke, C; Mak, C C; Mesa, R; Zhu, H; Soll, R; Gilliland, D G; Tefferi, A
2007-08-01
JAK2V617F and MPLW515L/K represent recently identified mutations in myeloproliferative disorders (MPD) that cause dysregulated JAK-STAT signaling, which is implicated in MPD pathogenesis. We developed TG101209, an orally bioavailable small molecule that potently inhibits JAK2 (IC(50)=6 nM), FLT3 (IC(50)=25 nM) and RET (IC(50)=17 nM) kinases, with significantly less activity against other tyrosine kinases including JAK3 (IC(50)=169 nM). TG101209 inhibited growth of Ba/F3 cells expressing JAK2V617F or MPLW515L mutations with an IC(50) of approximately 200 nM. In a human JAK2V617F-expressing acute myeloid leukemia cell line, TG101209-induced cell cycle arrest and apoptosis, and inhibited phosphorylation of JAK2V617F, STAT5 and STAT3. Therapeutic efficacy of TG101209 was demonstrated in a nude mouse model. Furthermore, TG101209 suppressed growth of hematopoietic colonies from primary progenitor cells harboring JAK2V617F or MPL515 mutations.
Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency
Garone, Caterina; Garc??a-D??az, Beatriz; Emmanuele, Valentina; L??pez Garc??a, Luis Carlos; Tadesse, Saba; Akman, Hasan O.; Tanji, Kurenai; Quinzii, Catarina M.; Hirano, Michio
2014-01-01
Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2 −/− ) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-...
Directory of Open Access Journals (Sweden)
Jeffrey C Lee
2006-12-01
Full Text Available Protein tyrosine kinases are important regulators of cellular homeostasis with tightly controlled catalytic activity. Mutations in kinase-encoding genes can relieve the autoinhibitory constraints on kinase activity, can promote malignant transformation, and appear to be a major determinant of response to kinase inhibitor therapy. Missense mutations in the EGFR kinase domain, for example, have recently been identified in patients who showed clinical responses to EGFR kinase inhibitor therapy.Encouraged by the promising clinical activity of epidermal growth factor receptor (EGFR kinase inhibitors in treating glioblastoma in humans, we have sequenced the complete EGFR coding sequence in glioma tumor samples and cell lines. We identified novel missense mutations in the extracellular domain of EGFR in 13.6% (18/132 of glioblastomas and 12.5% (1/8 of glioblastoma cell lines. These EGFR mutations were associated with increased EGFR gene dosage and conferred anchorage-independent growth and tumorigenicity to NIH-3T3 cells. Cells transformed by expression of these EGFR mutants were sensitive to small-molecule EGFR kinase inhibitors.Our results suggest extracellular missense mutations as a novel mechanism for oncogenic EGFR activation and may help identify patients who can benefit from EGFR kinase inhibitors for treatment of glioblastoma.
A cGMP kinase mutant with increased sensitivity to the protein kinase inhibitor peptide PKI(5-24).
Ruth, P; Kamm, S; Nau, U; Pfeifer, A; Hofmann, F
1996-01-01
Synthetic peptides corresponding to the active domain of the heat-stable inhibitor protein PKI are very potent inhibitors of cAMP-dependent protein kinase, but are extremely weak inhibitors of cGMP-dependent protein kinase. In this study, we tried to confer PKI sensitivity to cGMP kinase by site-directed mutagenesis. The molecular requirements for high affinity inhibition by PKI were deduced from the crystal structure of the cAMP kinase/PKI complex. A prominent site of interaction are residues Tyr235 and Phe239 in the catalytic subunit, which from a sandwich-like structure with Phe10 of the PKI(5-24) peptide. To increase the sensitivity for PKI, the cGMP kinase codons at the corresponding sites, Ser555 and Ser559, were changed to Tyr and Phe. The mutant cGMP kinase was stimulated half maximally by cGMP at 3-fold higher concentrations (240 nM) than the wild type (77 nM). Wild type and mutant cGMP kinase did not differ significantly in their Km and Vmax for three different substrate peptides. The PKI(5-24) peptide inhibited phosphotransferase activity of the mutant cGMP kinase with higher potency than that of wild type, with Ki values of 42 +/- .3 microM and 160 +/- .7 microM, respectively. The increased affinity of the mutant cGMP kinase was specific for the PKI(5-24) peptide. Mutation of the essential Phe10 in the PKI(5-24) sequence to an Ala yielded a peptide that inhibited mutant and wild type cGMP kinase with similar potency, with Ki values of 160 +/- 11 and 169 +/- 27 microM, respectively. These results suggest that the mutations Ser555Tyr and Ser559Phe are required, but not sufficient, for high affinity inhibition of cGMP kinase by PKI.
Xu, Qifang; Malecka, Kimberly L.; Fink, Lauren; Jordan, E. Joseph; Duffy, Erin; Kolander, Samuel; Peterson, Jeffrey; Dunbrack, Roland L.
2016-01-01
Protein kinase autophosphorylation is a common regulatory mechanism in cell signaling pathways. Crystal structures of several homomeric protein kinase complexes have a serine, threonine, or tyrosine autophosphorylation site of one kinase monomer located in the active site of another monomer, a structural complex that we call an “autophosphorylation complex.” We developed and applied a structural bioinformatics method to identify all such autophosphorylation kinase complexes in X-ray crystallographic structures in the Protein Data Bank (PDB). We identified 15 autophosphorylation complexes in the PDB, of which 5 complexes had not previously been described in the publications describing the crystal structures. These 5 consist of tyrosine residues in the N-terminal juxtamembrane regions of colony stimulating factor 1 receptor (CSF1R, Tyr561) and EPH receptor A2 (EPHA2, Tyr594), tyrosine residues in the activation loops of the SRC kinase family member LCK (Tyr394) and insulin-like growth factor 1 receptor (IGF1R, Tyr1166), and a serine in a nuclear localization signal region of CDC-like kinase 2 (CLK2, Ser142). Mutations in the complex interface may alter autophosphorylation activity and contribute to disease; therefore we mutated residues in the autophosphorylation complex interface of LCK and found that two mutations impaired autophosphorylation (T445V and N446A) and mutation of Pro447 to Ala, Gly, or Leu increased autophosphorylation. The identified autophosphorylation sites are conserved in many kinases, suggesting that, by homology, these complexes may provide insight into autophosphorylation complex interfaces of kinases that are relevant drug targets. PMID:26628682
Directory of Open Access Journals (Sweden)
Dennis Y. Kim
2017-05-01
Full Text Available Severe appetite and weight loss define the eating disorder anorexia nervosa, and can also accompany the progression of some neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS. Although acute loss of hypothalamic neurons that produce appetite-stimulating neuropeptide Y (Npy and agouti-related peptide (Agrp in adult mice or in mice homozygous for the anorexia (anx mutation causes aphagia, our understanding of the factors that help maintain appetite regulatory circuitry is limited. Here we identify a mutation (C19T that converts an arginine to a tryptophan (R7W in the TYRO3 protein tyrosine kinase 3 (Tyro3 gene, which resides within the anx critical interval, as contributing to the severity of anx phenotypes. Our observation that, like Tyro3−/− mice, anx/anx mice exhibit abnormal secondary platelet aggregation suggested that the C19T Tyro3 variant might have functional consequences. Tyro3 is expressed in the hypothalamus and other brain regions affected by the anx mutation, and its mRNA localization appeared abnormal in anx/anx brains by postnatal day 19 (P19. The presence of wild-type Tyro3 transgenes, but not an R7W-Tyro3 transgene, doubled the weight and lifespans of anx/anx mice and near-normal numbers of hypothalamic Npy-expressing neurons were present in Tyro3-transgenic anx/anx mice at P19. Although no differences in R7W-Tyro3 signal sequence function or protein localization were discernible in vitro, distribution of R7W-Tyro3 protein differed from that of Tyro3 protein in the cerebellum of transgenic wild-type mice. Thus, R7W-Tyro3 protein localization deficits are only detectable in vivo. Further analyses revealed that the C19T Tyro3 mutation is present in a few other mouse strains, and hence is not the causative anx mutation, but rather an anx modifier. Our work shows that Tyro3 has prosurvival roles in the appetite regulatory circuitry and could also provide useful insights towards the development of interventions
Verma, Sonal; Kumar, Madhu; Kumari, Malti; Mehrotra, Raj; Kushwaha, R A S; Goel, Madhumati; Kumar, Ashutosh; Kant, Surya
2017-07-01
Lung cancer is one of the leading causes of cancer related death. Targeted treatment for specific markers may help in reducing the cancer related morbidity and mortality. To study expression of Anaplastic Lymphoma Kinase (ALK)and Epidermal Growth Factor Receptor (EGFR) mutations in patients of Non-Small Cell Lung Cancer NSCLC, that are the targets for specific ALK inhibitors and EGFR tyrosine kinase inhibitors. Total 69 cases of histologically diagnosed NSCLC were examined retrospectively for immunohistochemical expression of EGFR and ALK, along with positive control of normal placental tissue and anaplastic large cell lymphoma respectively. Of the NSCLC, Squamous Cell Carcinoma (SCC) accounted for 71.0% and adenocarcinoma was 26.1%. ALK expression was seen in single case of 60-year-old female, non-smoker with adenocarcinoma histology. EGFR expression was seen in both SCC (59.18%) and adenocarcinoma in (77.78%) accounting for 63.77% of all cases. Both ALK and EGFR mutation were mutually exclusive. EGFR expression was seen in 63.77% of cases, highlighting the importance of its use in routine analysis, for targeted therapy and better treatment results. Although, ALK expression was seen in 1.45% of all cases, it is an important biomarker in targeted cancer therapy. Also, the mutually exclusive expression of these two markers need further studies to develop a diagnostic algorithm for NSCLC patients.
SH2 domains: modulators of nonreceptor tyrosine kinase activity.
Filippakopoulos, Panagis; Müller, Susanne; Knapp, Stefan
2009-12-01
The Src homology 2 (SH2) domain is a sequence-specific phosphotyrosine-binding module present in many signaling molecules. In cytoplasmic tyrosine kinases, the SH2 domain is located N-terminally to the catalytic kinase domain (SH1) where it mediates cellular localization, substrate recruitment, and regulation of kinase activity. Initially, structural studies established a role of the SH2 domain stabilizing the inactive state of Src family members. However, biochemical characterization showed that the presence of the SH2 domain is frequently required for catalytic activity, suggesting a crucial function stabilizing the active state of many nonreceptor tyrosine kinases. Recently, the structure of the SH2-kinase domain of Fes revealed that the SH2 domain stabilizes the active kinase conformation by direct interactions with the regulatory helix alphaC. Stabilizing interactions between the SH2 and the kinase domains have also been observed in the structures of active Csk and Abl. Interestingly, mutations in the SH2 domain found in human disease can be explained by SH2 domain destabilization or incorrect positioning of the SH2. Here we summarize our understanding of mechanisms that lead to tyrosine kinase activation by direct interactions mediated by the SH2 domain and discuss how mutations in the SH2 domain trigger kinase inactivation.
DEFF Research Database (Denmark)
Storr, Helen L; Metherell, Louise A; Dias, Renuka
2010-01-01
Primary pigmented nodular adrenocortical disease (PPNAD) is associated with inactivating germline protein kinase A regulatory subunit type 1-alpha (PRKAR1A) mutations and loss of heterozygosity at the 17q22-24 locus in approximately 50% patients. PRKAR1A mutations are observed in both isolated PP...... PPNAD (iPPNAD) and Carney complex (CNC). Most mutations result in a functionally null-allele and exhibit high penetrance. We genotyped members of an extended family for a novel PRKAR1A mutation and undertook detailed phenotyping for CNC in the affected individuals....
Akman, Hasan O.; Dorado, Beatriz; López, Luis C.; García-Cazorla, Ángeles; Vilà, Maya R.; Tanabe, Lauren M.; Dauer, William T.; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio
2008-01-01
Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous...
Mendelian and non-mendelian mutations affecting surface antigen expression in Paramecium tetraurelia
International Nuclear Information System (INIS)
Epstein, L.M.; Forney, J.D.
1984-01-01
A screening procedure was devised for the isolation of X-ray-induced mutations affecting the expression of the A immobilization antigen (i-antigen) in Paramecium tetraurelia. Two of the mutations isolated by this procedure proved to be in modifier genes. The two genes are unlinked to each other and unlinked to the structural A i-antigen gene. These are the first modifier genes identified in a Paramecium sp. that affect surface antigen expression. Another mutation was found to be a deletion of sequences just downstream from the A i-antigen gene. In cells carrying this mutation, the A i-antigen gene lies in close proximity to the end of a macronuclear chromosome. The expression of the A i-antigen is not affected in these cells, demonstrating that downstream sequences are not important for the regulation and expression of the A i-antigen gene. A stable cell line was also recovered which shows non-Mendelian inheritance of a macronuclear deletion of the A i-antigen gene. This mutant does not contain the gene in its macronucleus, but contains a complete copy of the gene in its micronucleus. In the cytoplasm of wild-type animals, the micronuclear gene is included in the developing macronucleus; in the cytoplasm of the mutant, the incorporation of the A i-antigen gene into the macronucleus is inhibited. This is the first evidence that a mechanism is available in ciliates to control the expression of a gene by regulating its incorporation into developing macronuclei
SQSTM1 Mutations and Glaucoma.
Directory of Open Access Journals (Sweden)
Todd E Scheetz
Full Text Available Glaucoma is the most common cause of irreversible blindness worldwide. One subset of glaucoma, normal tension glaucoma (NTG occurs in the absence of high intraocular pressure. Mutations in two genes, optineurin (OPTN and TANK binding kinase 1 (TBK1, cause familial NTG and have known roles in the catabolic cellular process autophagy. TKB1 encodes a kinase that phosphorylates OPTN, an autophagy receptor, which ultimately activates autophagy. The sequestosome (SQSTM1 gene also encodes an autophagy receptor and also is a target of TBK1 phosphorylation. Consequently, we hypothesized that mutations in SQSTM1 may also cause NTG. We tested this hypothesis by searching for glaucoma-causing mutations in a cohort of NTG patients (n = 308 and matched controls (n = 157 using Sanger sequencing. An additional 1098 population control samples were also analyzed using whole exome sequencing. A total of 17 non-synonymous mutations were detected which were not significantly skewed between cases and controls when analyzed separately, or as a group (p > 0.05. These data suggest that SQSTM1 mutations are not a common cause of NTG.
Energy Technology Data Exchange (ETDEWEB)
Muchir, Antoine, E-mail: a.muchir@institut-myologie.org [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Wu, Wei [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Sera, Fusako; Homma, Shunichi [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Worman, Howard J., E-mail: hjw14@columbia.edu [Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, NY (United States); Department of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, NY (United States)
2014-10-03
Highlights: • Both ACE and MEK1/2 inhibition are beneficial on cardiac function in Lmna cardiomyopathy. • MEK1/2 inhibitor has beneficial effects beyond ACE inhibition for Lmna cardiomyopathy. • These results provide further preclinical rationale for a clinical trial of a MEK1/2 inhibitor. - Abstract: Background: Mutations in the LMNA gene encoding A-type nuclear lamins can cause dilated cardiomyopathy with or without skeletal muscular dystrophy. Previous studies have shown abnormally increased extracellular signal-regulated kinase 1/2 activity in hearts of Lmna{sup H222P/H222P} mice, a small animal model. Inhibition of this abnormal signaling activity with a mitogen-activated protein kinase kinase 1/2 (MEK1/2) inhibitor has beneficial effects on heart function and survival in these mice. However, such treatment has not been examined relative to any standard of care intervention for dilated cardiomyopathy or heart failure. We therefore examined the effects of an angiotensin II converting enzyme (ACE) inhibitor on left ventricular function in Lmna{sup H222P/H222P} mice and assessed if adding a MEK1/2 inhibitor would provide added benefit. Methods: Male Lmna{sup H222P/H222P} mice were treated with the ACE inhibitor benazepril, the MEK1/2 inhibitor selumetinib or both. Transthoracic echocardiography was used to measure left ventricular diameters and fractional shortening was calculated. Results: Treatment of Lmna{sup H222P/H222P} mice with either benazepril or selumetinib started at 8 weeks of age, before the onset of detectable left ventricular dysfunction, lead to statistically significantly increased fractional shortening compared to placebo at 16 weeks of age. There was a trend towards a great value for fractional shortening in the selumetinib-treated mice. When treatment was started at 16 weeks of age, after the onset of left ventricular dysfunction, the addition of selumetinib treatment to benazepril lead to a statistically significant increase in left
International Nuclear Information System (INIS)
Muchir, Antoine; Wu, Wei; Sera, Fusako; Homma, Shunichi; Worman, Howard J.
2014-01-01
Highlights: • Both ACE and MEK1/2 inhibition are beneficial on cardiac function in Lmna cardiomyopathy. • MEK1/2 inhibitor has beneficial effects beyond ACE inhibition for Lmna cardiomyopathy. • These results provide further preclinical rationale for a clinical trial of a MEK1/2 inhibitor. - Abstract: Background: Mutations in the LMNA gene encoding A-type nuclear lamins can cause dilated cardiomyopathy with or without skeletal muscular dystrophy. Previous studies have shown abnormally increased extracellular signal-regulated kinase 1/2 activity in hearts of Lmna H222P/H222P mice, a small animal model. Inhibition of this abnormal signaling activity with a mitogen-activated protein kinase kinase 1/2 (MEK1/2) inhibitor has beneficial effects on heart function and survival in these mice. However, such treatment has not been examined relative to any standard of care intervention for dilated cardiomyopathy or heart failure. We therefore examined the effects of an angiotensin II converting enzyme (ACE) inhibitor on left ventricular function in Lmna H222P/H222P mice and assessed if adding a MEK1/2 inhibitor would provide added benefit. Methods: Male Lmna H222P/H222P mice were treated with the ACE inhibitor benazepril, the MEK1/2 inhibitor selumetinib or both. Transthoracic echocardiography was used to measure left ventricular diameters and fractional shortening was calculated. Results: Treatment of Lmna H222P/H222P mice with either benazepril or selumetinib started at 8 weeks of age, before the onset of detectable left ventricular dysfunction, lead to statistically significantly increased fractional shortening compared to placebo at 16 weeks of age. There was a trend towards a great value for fractional shortening in the selumetinib-treated mice. When treatment was started at 16 weeks of age, after the onset of left ventricular dysfunction, the addition of selumetinib treatment to benazepril lead to a statistically significant increase in left ventricular fractional
DEFF Research Database (Denmark)
Nicolini, Franck E; Ibrahim, Amr R; Soverini, Simona
2013-01-01
The BCR-ABL T315I mutation confers resistance to currently licensed tyrosine kinase inhibitors in chronic myelogenous leukemia. However, the impact of this mutation on survival in early stages of disease, in chronic phase, has never been detailed. Using matched pair analysis, a cohort of 64...... patients with chronic phase chronic myelogenous leukemia harboring a T315I mutation and resistant to imatinib mesylate was compared to a similar cohort of 53 chronic phase patients resistant to imatinib, but with no detectable T315I mutation, in the pre-ponatinib era. These patients were matched according...... to age at diagnosis, interval between disease diagnosis and start of imatinib treatment, and duration of imatinib therapy. Kaplan-Meier survival analyses demonstrated the significant negative impact of the presence of the T315I mutation on overall survival (since imatinib-resistance: 48.4 months for T315...
The callipyge mutation and other genes that affect muscle hypertrophy in sheep
Directory of Open Access Journals (Sweden)
Cockett Noelle E
2005-12-01
Full Text Available Abstract Genetic strategies to improve the profitability of sheep operations have generally focused on traits for reproduction. However, natural mutations exist in sheep that affect muscle growth and development, and the exploitation of these mutations in breeding strategies has the potential to significantly improve lamb-meat quality. The best-documented mutation for muscle development in sheep is callipyge (CLPG, which causes a postnatal muscle hypertrophy that is localized to the pelvic limbs and loin. Enhanced skeletal muscle growth is also observed in animals with the Carwell (or rib-eye muscling mutation, and a double-muscling phenotype has been documented for animals of the Texel sheep breed. However, the actual mutations responsible for these muscular hypertrophy phenotypes in sheep have yet to be identified, and further characterization of the genetic basis for these phenotypes will provide insight into the biological control of muscle growth and body composition.
Ringwald, Johanna; Wochnowski, Christina; Bosse, Kristin; Giel, Katrin Elisabeth; Schäffeler, Norbert; Zipfel, Stephan; Teufel, Martin
2016-10-01
Understanding the intermediate- and long-term psychological consequences of genetic testing for cancer patients has led to encouraging research, but a clear consensus of the psychosocial impact and clinical routine for cancer-affected BRCA1 and BRCA2 mutation carriers is still missing. We performed a systematic review of intermediate- and long-term studies investigating the psychological impact like psychological distress, anxiety, and depression in cancer-affected BRCA mutation carriers compared to unaffected mutation carriers. This review included the screening of 1243 studies. Eight intermediate- and long-term studies focusing on distress, anxiety, and depression symptoms among cancer-affected mutation carriers at least six months after the disclosure of genetic testing results were included. Studies reported a great variety of designs, methods, and patient outcomes. We found evidence indicating that cancer-affected mutation carriers experienced a negative effect in relation to psychological well-being in terms of an increase in symptoms of distress, anxiety, and depression in the first months after test disclosure. In the intermediate- and long-term, no significant clinical relevant symptoms occurred. However, none of the included studies used specific measurements, which can clearly identify psychological burdens of cancer-affected mutation carriers. We concluded that current well-implemented distress screening instruments are not sufficient for precisely identifying the psychological burden of genetic testing. Therefore, future studies should implement coping strategies, specific personality structures, the impact of genetic testing, supportive care needs and disease management behaviour to clearly screen for the possible intermediate- and long-term psychological impact of a positive test disclosure.
Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang
2013-12-01
The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.
EGFR kinase-dependent and kinase-independent roles in clear cell renal cell carcinoma.
Cossu-Rocca, Paolo; Muroni, Maria R; Sanges, Francesca; Sotgiu, Giovanni; Asunis, Anna; Tanca, Luciana; Onnis, Daniela; Pira, Giovanna; Manca, Alessandra; Dore, Simone; Uras, Maria G; Ena, Sara; De Miglio, Maria R
2016-01-01
Epidermal growth factor receptor (EGFR) is associated with progression of many epithelial malignancies and represents a significant therapeutic target. Although clear cell renal cell carcinoma (CCRCC) has been widely investigated for EGFR molecular alterations, genetic evidences of EGFR gene activating mutations and/or gene amplification have been rarely confirmed in the literature. Therefore, until now EGFR-targeted therapies in clinical trials have been demonstrated unsuccessful. New evidence has been given about the interactions between EGFR and the sodium glucose co-transporter-1 (SGLT1) in maintaining the glucose basal intracellular level to favour cancer cell growth and survival; thus a new functional role may be attributed to EGFR, regardless of its kinase activity. To define the role of EGFR in CCRCC an extensive investigation of genetic changes and functional kinase activities was performed in a series of tumors by analyzing the EGFR mutational status and expression profile, together with the protein expression of downstream signaling pathways members. Furthermore, we investigated the co-expression of EGFR and SGLT1 proteins and their relationships with clinic-pathological features in CCRCC. EGFR protein expression was identified in 98.4% of CCRCC. Furthermore, it was described for the first time that SGLT1 is overexpressed in CCRCC (80.9%), and that co-expression with EGFR is appreciable in 79.4% of the tumours. Moreover, the activation of downstream EGFR pathways was found in about 79.4% of SGLT1-positive CCRCCs. The mutational status analysis of EGFR failed to demonstrate mutations on exons 18 to 24 and the presence of EGFR-variantIII (EGFRvIII) in all CCRCCs analyzed. FISH analysis revealed absence of EGFR amplification, and high polysomy of chromosome 7. Finally, the EGFR gene expression profile showed gene overexpression in 38.2% of CCRCCs. Our study contributes to define the complexity of EGFR role in CCRCC, identifying its bivalent kinase
International Nuclear Information System (INIS)
Inagaki, Yuichi; Mitsutake, Susumu; Igarashi, Yasuyuki
2006-01-01
Retinitis pigmentosa (RP) is a genetically heterogeneous disease characterized by degeneration of the retina. A mutation in a new ceramide kinase (CERK) homologous gene, named CERK-like protein (CERKL), was found to cause autosomal recessive retinitis pigmentosa (RP26). Here, we show a point mutation of one of two putative nuclear localization signal (NLS) sequences inhibited the nuclear localization of the protein. Furthermore, the tetra-GFP-tagged NLS, which cannot passively enter the nucleus, was observed not only in the nucleus but also in the nucleolus. Our results provide First evidence of the active nuclear import of CERKL and suggest that the identified NLS might be responsible for nucleolar retention of the protein. As recent studies have shown other RP-related proteins are localized in the nucleus or the nucleolus, our identification of NLS in CERKL suggests that CERKL likely plays important roles for retinal functions in the nucleus and the nucleolus
Crystal Structure of Ripk4 Reveals Dimerization-Dependent Kinase Activity.
Huang, Christine S; Oberbeck, Nina; Hsiao, Yi-Chun; Liu, Peter; Johnson, Adam R; Dixit, Vishva M; Hymowitz, Sarah G
2018-05-01
Receptor-interacting protein kinase 4 (RIPK4) is a highly conserved regulator of epidermal differentiation. Members of the RIPK family possess a common kinase domain as well as unique accessory domains that likely dictate subcellular localization and substrate preferences. Mutations in human RIPK4 manifest as Bartsocas-Papas syndrome (BPS), a genetic disorder characterized by severe craniofacial and limb abnormalities. We describe the structure of the murine Ripk4 (MmRipk4) kinase domain, in ATP- and inhibitor-bound forms. The crystallographic dimer of MmRipk4 is similar to those of RIPK2 and BRAF, and we show that the intact dimeric entity is required for MmRipk4 catalytic activity through a series of engineered mutations and cell-based assays. We also assess the impact of BPS mutations on protein structure and activity to elucidate the molecular origins of the disease. Copyright © 2018 Elsevier Ltd. All rights reserved.
Zhou, Xiaona; Hao, Hongmei; Zhang, Yuguo; Bai, Yili; Zhu, Wenbo; Qin, Yunxia; Yuan, Feifei; Zhao, Feiyi; Wang, Mengyao; Hu, Jingjiang; Xu, Hong; Guo, Aiguang; Zhao, Huixian; Zhao, Yang; Cao, Cuiling; Yang, Yongqing; Schumaker, Karen S.; Guo, Yan; Xie, Chang Gen
2015-01-01
Abscisic acid (ABA) plays an essential role in seed germination. In this study, we demonstrate that one SNF1-RELATED PROTEIN KINASE3-type protein kinase, SOS2-LIKE PROTEIN KINASE5 (PKS5), is involved in ABA signal transduction via the phosphorylation of an interacting protein, ABSCISIC ACID-INSENSITIVE5 (ABI5). We found that pks5-3 and pks5-4, two previously identified PKS5 superactive kinase mutants with point mutations in the PKS5 FISL/NAF (a conserved peptide that is necessary for interaction with SOS3 or SOS3-LIKE CALCIUM BINDING PROTEINs) motif and the kinase domain, respectively, are hypersensitive to ABA during seed germination. PKS5 was found to interact with ABI5 in yeast (Saccharomyces cerevisiae), and this interaction was further confirmed in planta using bimolecular fluorescence complementation. Genetic studies revealed that ABI5 is epistatic to PKS5. PKS5 phosphorylates a serine (Ser) residue at position 42 in ABI5 and regulates ABA-responsive gene expression. This phosphorylation was induced by ABA in vivo and transactivated ABI5. Expression of ABI5, in which Ser-42 was mutated to alanine, could not fully rescue the ABA-insensitive phenotypes of the abi5-8 and pks5-4abi5-8 mutants. In contrast, mutating Ser-42 to aspartate rescued the ABA insensitivity of these mutants. These data demonstrate that PKS5-mediated phosphorylation of ABI5 at Ser-42 is critical for the ABA regulation of seed germination and gene expression in Arabidopsis (Arabidopsis thaliana). PMID:25858916
Yamamoto, Kenta; Wang, Jiguang; Sprinzen, Lisa; Xu, Jun; Haddock, Christopher J; Li, Chen; Lee, Brian J; Loredan, Denis G; Jiang, Wenxia; Vindigni, Alessandro; Wang, Dong; Rabadan, Raul; Zha, Shan
2016-06-15
Missense mutations in ATM kinase, a master regulator of DNA damage responses, are found in many cancers, but their impact on ATM function and implications for cancer therapy are largely unknown. Here we report that 72% of cancer-associated ATM mutations are missense mutations that are enriched around the kinase domain. Expression of kinase-dead ATM (Atm(KD/-)) is more oncogenic than loss of ATM (Atm(-/-)) in mouse models, leading to earlier and more frequent lymphomas with Pten deletions. Kinase-dead ATM protein (Atm-KD), but not loss of ATM (Atm-null), prevents replication-dependent removal of Topo-isomerase I-DNA adducts at the step of strand cleavage, leading to severe genomic instability and hypersensitivity to Topo-isomerase I inhibitors. Correspondingly, Topo-isomerase I inhibitors effectively and preferentially eliminate Atm(KD/-), but not Atm-proficientor Atm(-/-) leukemia in animal models. These findings identify ATM kinase-domain missense mutations as a potent oncogenic event and a biomarker for Topo-isomerase I inhibitor based therapy.
A kinase-dependent feedforward loop affects CREBB stability and long term memory formation.
Lee, Pei-Tseng; Lin, Guang; Lin, Wen-Wen; Diao, Fengqiu; White, Benjamin H; Bellen, Hugo J
2018-02-23
In Drosophila , long-term memory (LTM) requires the cAMP-dependent transcription factor CREBB, expressed in the mushroom bodies (MB) and phosphorylated by PKA. To identify other kinases required for memory formation, we integrated Trojan exons encoding T2A-GAL4 into genes encoding putative kinases and selected for genes expressed in MB. These lines were screened for learning/memory deficits using UAS-RNAi knockdown based on an olfactory aversive conditioning assay. We identified a novel, conserved kinase, Meng-Po ( MP , CG11221 , SBK1 in human), the loss of which severely affects 3 hr memory and 24 hr LTM, but not learning. Remarkably, memory is lost upon removal of the MP protein in adult MB but restored upon its reintroduction. Overexpression of MP in MB significantly increases LTM in wild-type flies showing that MP is a limiting factor for LTM. We show that PKA phosphorylates MP and that both proteins synergize in a feedforward loop to control CREBB levels and LTM. key words: Drosophila, Mushroom bodies, SBK1, deGradFP, T2A-GAL4, MiMIC.
DEFF Research Database (Denmark)
Boldyreff, Brigitte; Rasmussen, Tine L; Jensen, Hans H
2008-01-01
Phosphoinositide-3-kinases are important targets for drug development because many proteins in the PI3 kinase signaling pathway are mutated, hyperactivated, or overexpressed in human cancers. Here, the authors coexpressed the human class Ia PI3 kinase p110alpha catalytic domain with an N-terminal....... In parallel, a second assay format using the AlphaScreen technology was optimized to measure PI3 kinase activity. Both assay formats used should be suitable for high-throughput screening for the identification of PI3 kinase inhibitors. (Journal of Biomolecular Screening XXXX:xx-xx)....
BRAF mutation in hairy cell leukemia
Directory of Open Access Journals (Sweden)
Ahmad Ahmadzadeh
2014-09-01
Full Text Available BRAF is a serine/threonine kinase with a regulatory role in the mitogen-activated protein kinase (MAPK signaling pathway. A mutation in the RAF gene, especially in BRAF protein, leads to an increased stimulation of this cascade, causing uncontrolled cell division and development of malignancy. Several mutations have been observed in the gene coding for this protein in a variety of human malignancies, including hairy cell leukemia (HCL. BRAF V600E is the most common mutation reported in exon15 of BRAF, which is observed in almost all cases of classic HCL, but it is negative in other B-cell malignancies, including the HCL variant. Therefore it can be used as a marker to differentiate between these B-cell disorders. We also discuss the interaction between miRNAs and signaling pathways, including MAPK, in HCL. When this mutation is present, the use of BRAF protein inhibitors may represent an effective treatment. In this review we have evaluated the role of the mutation of the BRAF gene in the pathogenesis and progression of HCL.
JAK and MPL mutations in myeloid malignancies.
Tefferi, Ayalew
2008-03-01
The Janus family of non-receptor tyrosine kinases (JAK1, JAK2, JAK3 and tyrosine kinase 2) transduces signals downstream of type I and II cytokine receptors via signal transducers and activators of transcription (STATs). JAK3 is important in lymphoid and JAK2 in myeloid cell proliferation and differentiation. The thrombopoietin receptor MPL is one of several JAK2 cognate receptors and is essential for myelopoiesis in general and megakaryopoiesis in particular. Germline loss-of-function (LOF) JAK3 and MPL mutations cause severe combined immunodeficiency and congenital amegakaryocytic thrombocytopenia, respectively. Germline gain-of-function (GOF) MPL mutation (MPLS505N) causes familial thrombocytosis. Somatic JAK3 (e.g. JAK3A572V, JAK3V722I, JAK3P132T) and fusion JAK2 (e.g. ETV6-JAK2, PCM1-JAK2, BCR-JAK2) mutations have respectively been described in acute megakaryocytic leukemia and acute leukemia/chronic myeloid malignancies. However, current attention is focused on JAK2 (e.g. JAK2V617F, JAK2 exon 12 mutations) and MPL (e.g. MPLW515L/K/S, MPLS505N) mutations associated with myeloproliferative neoplasms (MPNs). A JAK2 mutation, primarily JAK2V617F, is invariably associated with polycythemia vera (PV). The latter mutation also occurs in the majority of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF). MPL mutational frequency in MPNs is substantially less (<10%). In general, despite a certain degree of genotype - phenotype correlations, the prognostic relevance of harbouring one of these mutations, or their allele burden when present, remains dubious. Regardless, based on the logical assumption that amplified JAK-STAT signalling is central to the pathogenesis of PV, ET and PMF, several anti-JAK2 tyrosine kinase inhibitors have been developed and are currently being tested in humans with these disorders.
Kinome-wide Decoding of Network-Attacking Mutations Rewiring Cancer Signaling
DEFF Research Database (Denmark)
Creixell, Pau; Schoof, Erwin M; Simpson, Craig D.
2015-01-01
Cancer cells acquire pathological phenotypes through accumulation of mutations that perturb signaling networks. However, global analysis of these events is currently limited. Here, we identify six types of network-attacking mutations (NAMs), including changes in kinase and SH2 modulation, network...... and experimentally validated several NAMs, including PKCγ M501I and PKD1 D665N, which encode specificity switches analogous to the appearance of kinases de novo within the kinome. We discover mutant molecular logic gates, a drift toward phospho-threonine signaling, weakening of phosphorylation motifs, and kinase...
cAMP-dependent kinase does not modulate the Slack sodium-activated potassium channel.
Nuwer, Megan O; Picchione, Kelly E; Bhattacharjee, Arin
2009-09-01
The Slack gene encodes a Na(+)-activated K(+) channel and is expressed in many different types of neurons. Like the prokaryotic Ca(2+)-gated K(+) channel MthK, Slack contains two 'regulator of K(+) conductance' (RCK) domains within its carboxy terminal, domains likely involved in Na(+) binding and channel gating. It also contains multiple consensus protein kinase C (PKC) and protein kinase A (PKA) phosphorylation sites and although regulated by protein kinase C (PKC) phosphorylation, modulation by PKA has not been determined. To test if PKA directly regulates Slack, nystatin-perforated patch whole-cell currents were recorded from a human embryonic kidney (HEK-293) cell line stably expressing Slack. Bath application of forskolin, an adenylate cyclase activator, caused a rapid and complete inhibition of Slack currents however, the inactive homolog of forskolin, 1,9-dideoxyforskolin caused a similar effect. In contrast, bath application of 8-bromo-cAMP did not affect the amplitude nor the activation kinetics of Slack currents. In excised inside-out patch recordings, direct application of the PKA catalytic subunit to patches did not affect the open probability of Slack channels nor was open probability affected by direct application of protein phosphatase 2B. Preincubation of cells with the protein kinase A inhibitor KT5720 also did not change current density. Finally, mutating the consensus phosphorylation site located between RCK domain 1 and domain 2 from serine to glutamate did not affect current activation kinetics. We conclude that unlike PKC, phosphorylation by PKA does not acutely modulate the function and gating activation kinetics of Slack channels.
Immunodeficiency associated with a nonsense mutation of IKBKB
DEFF Research Database (Denmark)
Nielsen, Christian; Jakobsen, Marianne A; Larsen, Martin Jakob
2014-01-01
We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory insufficie......We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory...... no explanation before whole exome sequencing revealed a novel mutation abrogating signaling through the canonical NF-κB pathway....
Kadaré, Gress
2015-01-02
Focal adhesion (FA) kinase (FAK) regulates cell survival and motility by transducing signals from membrane receptors. The C-terminal FA targeting (FAT) domain of FAK fulfils multiple functions, including recruitment to FAs through paxillin binding. Phosphorylation of FAT on Tyr925 facilitates FA disassembly and connects to the MAPK pathway through Grb2 association, but requires dissociation of the first helix (H1) of the four-helix bundle of FAT. We investigated the importance of H1 opening in cells by comparing the properties of FAK molecules containing wild-type or mutated FAT with impaired or facilitated H1 openings. These mutations did not alter the activation of FAK, but selectively affected its cellular functions, including self-association, Tyr925 phosphorylation, paxillin binding, and FA targeting and turnover. Phosphorylation of Tyr861, located between the kinase and FAT domains, was also enhanced by the mutation that opened the FAT bundle. Similarly phosphorylation of Ser910 by ERK in response to bombesin was increased by FAT opening. Although FAK molecules with the mutation favoring FAT opening were poorly recruited at FAs, they efficiently restored FA turnover and cell shape in FAK-deficient cells. In contrast, the mutation preventing H1 opening markedly impaired FAK function. Our data support the biological importance of conformational dynamics of the FAT domain and its functional interactions with other parts of the molecule.
Tlili, Abdelaziz; Al Mutery, Abdullah; Kamal Eddine Ahmad Mohamed, Walaa; Mahfood, Mona; Hadj Kacem, Hassen
2017-11-01
Mutations in the gap junction protein beta 2 (GJB2) gene are responsible for more cases of nonsyndromic recessive hearing loss than any other gene. The purpose of our study was to evaluate the prevalence of GJB2 mutations among affected individuals from United Arab Emirates (UAE). There were 50 individuals diagnosed with hereditary hearing loss and 120 healthy individuals enrolled in the study. The Sanger sequencing method was used to screen the GJB2 coding region in all affected individuals. The c.-1G>A variant was determined by the polymerase chain reaction-restriction fragment length polymorphism method in normal individuals. Nine cases with bi-allelic mutations and three cases with mono-allelic mutations were detected in 12 out of 50 patients (24%). The homozygous mutation c.35delG was identified as the cause of hearing loss in six participants (12%). The mutation c.506G>A was identified in three affected individuals (6%). The allelic frequency (14%) and low percentage of individuals that were homozygous (2%) for the c.35delG mutation suggest that there are other genes responsible for nonsyndromic deafness in the UAE population. The results reported here are a preliminary step in collecting epidemiological data regarding autosomal recessive nonsyndromic hearing loss related to GJB2 gene mutations among the UAE population. The c.35delG mutation of the GJB2 gene is the most frequently seen causative mutation in the UAE and is followed by the p.Cys169Tyr mutation.
A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).
Dhanasekar, P; Reddy, K S
2015-02-01
Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.
Hepatitis C Virus Particle Assembly Involves Phosphorylation of NS5A by the c-Abl Tyrosine Kinase.
Yamauchi, Shota; Takeuchi, Kenji; Chihara, Kazuyasu; Sun, Xuedong; Honjoh, Chisato; Yoshiki, Hatsumi; Hotta, Hak; Sada, Kiyonao
2015-09-04
Hepatitis C virus (HCV) nonstructural protein 5A (NS5A) is thought to regulate the replication of viral RNA and the assembly of virus particles in a serine/threonine phosphorylation-dependent manner. However, the host kinases that phosphorylate NS5A have not been fully identified. Here, we show that HCV particle assembly involves the phosphorylation of NS5A by the c-Abl tyrosine kinase. Pharmacological inhibition or knockdown of c-Abl reduces the production of infectious HCV (J6/JFH1) particles in Huh-7.5 cells without markedly affecting viral RNA translation and replication. NS5A is tyrosine-phosphorylated in HCV-infected cells, and this phosphorylation is also reduced by the knockdown of c-Abl. Mutational analysis reveals that NS5A tyrosine phosphorylation is dependent, at least in part, on Tyr(330) (Tyr(2306) in polyprotein numbering). Mutation of this residue to phenylalanine reduces the production of infectious HCV particles but does not affect the replication of the JFH1 subgenomic replicon. These findings suggest that c-Abl promotes HCV particle assembly by phosphorylating NS5A at Tyr(330). © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Brigitte Sophia Winkler
2015-02-01
Full Text Available The prognosis of lymphoid neoplasms has improved considerably during the last decades. However, treatment response for some lymphoid neoplasms is still poor, indicating the need for new therapeutic approaches. One promising new strategy is the inhibition of kinases regulating key signal transduction pathways, which are of central importance in tumorigenesis. Kinases of the CK1 family may represent an attractive drug target since CK1 expression and/or activity are associated with the pathogenesis of malignant diseases. Over the last years efforts were taken to develop highly potent and selective CK1-specific inhibitor compounds and their therapeutic potential has now to be proved in pre-clinical trials. Therefore, we analyzed expression and mutational status of CK1δ in several cell lines representing established lymphoma entities, and also measured the mRNA expression level in primary lymphoma tissue as well as non-neoplastic blood cells. For a selection of lymphoma cell lines we furthermore determined CK1δ kinase activity and demonstrated therapeutic potential of CK1-specific inhibitors as a putative therapeutic option in the treatment of lymphoid neoplasms.
Ryall, Karen A; Shin, Jimin; Yoo, Minjae; Hinz, Trista K; Kim, Jihye; Kang, Jaewoo; Heasley, Lynn E; Tan, Aik Choon
2015-12-01
Targeted kinase inhibitors have dramatically improved cancer treatment, but kinase dependency for an individual patient or cancer cell can be challenging to predict. Kinase dependency does not always correspond with gene expression and mutation status. High-throughput drug screens are powerful tools for determining kinase dependency, but drug polypharmacology can make results difficult to interpret. We developed Kinase Addiction Ranker (KAR), an algorithm that integrates high-throughput drug screening data, comprehensive kinase inhibition data and gene expression profiles to identify kinase dependency in cancer cells. We applied KAR to predict kinase dependency of 21 lung cancer cell lines and 151 leukemia patient samples using published datasets. We experimentally validated KAR predictions of FGFR and MTOR dependence in lung cancer cell line H1581, showing synergistic reduction in proliferation after combining ponatinib and AZD8055. KAR can be downloaded as a Python function or a MATLAB script along with example inputs and outputs at: http://tanlab.ucdenver.edu/KAR/. aikchoon.tan@ucdenver.edu. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Mutations affecting components of the SWI/SNF complex cause Coffin-Siris syndrome.
Tsurusaki, Yoshinori; Okamoto, Nobuhiko; Ohashi, Hirofumi; Kosho, Tomoki; Imai, Yoko; Hibi-Ko, Yumiko; Kaname, Tadashi; Naritomi, Kenji; Kawame, Hiroshi; Wakui, Keiko; Fukushima, Yoshimitsu; Homma, Tomomi; Kato, Mitsuhiro; Hiraki, Yoko; Yamagata, Takanori; Yano, Shoji; Mizuno, Seiji; Sakazume, Satoru; Ishii, Takuma; Nagai, Toshiro; Shiina, Masaaki; Ogata, Kazuhiro; Ohta, Tohru; Niikawa, Norio; Miyatake, Satoko; Okada, Ippei; Mizuguchi, Takeshi; Doi, Hiroshi; Saitsu, Hirotomo; Miyake, Noriko; Matsumoto, Naomichi
2012-03-18
By exome sequencing, we found de novo SMARCB1 mutations in two of five individuals with typical Coffin-Siris syndrome (CSS), a rare autosomal dominant anomaly syndrome. As SMARCB1 encodes a subunit of the SWItch/Sucrose NonFermenting (SWI/SNF) complex, we screened 15 other genes encoding subunits of this complex in 23 individuals with CSS. Twenty affected individuals (87%) each had a germline mutation in one of six SWI/SNF subunit genes, including SMARCB1, SMARCA4, SMARCA2, SMARCE1, ARID1A and ARID1B.
M. Westwood (Marie); M.A. Joore (Manuela); P. Whiting (Penny); T. van Asselt (Thea); B.L.T. Ramaekers (Bram); N. Armstrong (Nigel); K. Misso (Kate); J.L. Severens (Hans); J. Kleijnen (Jos)
2014-01-01
markdownabstract__Abstract__ Background: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment
Muleya, Victor
2014-09-23
Background: A number of receptor kinases contain guanylate cyclase (GC) catalytic centres encapsulated in the cytosolic kinase domain. A prototypical example is the phytosulfokine receptor 1 (PSKR1) that is involved in regulating growth responses in plants. PSKR1 contains both kinase and GC activities however the underlying mechanisms regulating the dual functions have remained elusive. Findings: Here, we confirm the dual activity of the cytoplasmic domain of the PSKR1 receptor. We show that mutations within the guanylate cyclase centre modulate the GC activity while not affecting the kinase catalytic activity. Using physiologically relevant Ca2+ levels, we demonstrate that its GC activity is enhanced over two-fold by Ca2+ in a concentration-dependent manner. Conversely, increasing Ca2+ levels inhibits kinase activity up to 500-fold at 100 nM Ca2+. Conclusions: Changes in calcium at physiological levels can regulate the kinase and GC activities of PSKR1. We therefore propose a functional model of how calcium acts as a bimodal switch between kinase and GC activity in PSKR1 that could be relevant to other members of this novel class of ligand-activated receptor kinases.
Directory of Open Access Journals (Sweden)
Komiyama NH
2006-06-01
Full Text Available Abstract Background Genetically manipulated embryonic stem (ES cell derived neurons (ESNs provide a powerful system with which to study the consequences of gene manipulation in mature, synaptically connected neurons in vitro. Here we report a study of focal adhesion kinase (FAK, which has been implicated in synapse formation and regulation of ion channels, using the ESN system to circumvent the embryonic lethality of homozygous FAK mutant mice. Results Mouse ES cells carrying homozygous null mutations (FAK-/- were generated and differentiated in vitro into neurons. FAK-/- ESNs extended axons and dendrites and formed morphologically and electrophysiologically intact synapses. A detailed study of NMDA receptor gated currents and voltage sensitive calcium currents revealed no difference in their magnitude, or modulation by tyrosine kinases. Conclusion FAK does not have an obligatory role in neuronal differentiation, synapse formation or the expression of NMDA receptor or voltage-gated calcium currents under the conditions used in this study. The use of genetically modified ESNs has great potential for rapidly and effectively examining the consequences of neuronal gene manipulation and is complementary to mouse studies.
Westwood, Marie; Joore, Manuela; Whiting, Penny; van Asselt, Thea; Ramaekers, Bram; Armstrong, Nigel; Misso, Kate; Severens, Johan; Kleijnen, Jos
BACKGROUND: Non-small cell lung cancer (NSCLC) is the most common form of lung cancer. Some epidermal growth factor receptor tyrosine kinase (EGFR-TK) mutations make tumours responsive to treatment with EGFR-TK inhibitors (EGFR-TKIs) but less responsive to treatment with standard chemotherapy.
Energy Technology Data Exchange (ETDEWEB)
Moravcevic, Katarina; Mendrola, Jeannine M.; Schmitz, Karl R.; Wang, Yu-Hsiu; Slochower, David; Janmey, Paul A.; Lemmon, Mark A. (UPENN-MED)
2011-09-28
Phospholipid-binding modules such as PH, C1, and C2 domains play crucial roles in location-dependent regulation of many protein kinases. Here, we identify the KA1 domain (kinase associated-1 domain), found at the C terminus of yeast septin-associated kinases (Kcc4p, Gin4p, and Hsl1p) and human MARK/PAR1 kinases, as a membrane association domain that binds acidic phospholipids. Membrane localization of isolated KA1 domains depends on phosphatidylserine. Using X-ray crystallography, we identified a structurally conserved binding site for anionic phospholipids in KA1 domains from Kcc4p and MARK1. Mutating this site impairs membrane association of both KA1 domains and intact proteins and reveals the importance of phosphatidylserine for bud neck localization of yeast Kcc4p. Our data suggest that KA1 domains contribute to coincidence detection, allowing kinases to bind other regulators (such as septins) only at the membrane surface. These findings have important implications for understanding MARK/PAR1 kinases, which are implicated in Alzheimer's disease, cancer, and autism.
Second-generation inhibitors of Bruton tyrosine kinase
Directory of Open Access Journals (Sweden)
Jingjing Wu
2016-09-01
Full Text Available Abstract Bruton tyrosine kinase (BTK is a critical effector molecule for B cell development and plays a major role in lymphoma genesis. Ibrutinib is the first-generation BTK inhibitor. Ibrutinib has off-target effects on EGFR, ITK, and Tec family kinases, which explains the untoward effects of ibrutinib. Resistance to ibrutinib was also reported. The C481S mutation in the BTK kinase domain was reported to be a major mechanism of resistance to ibrutinib. This review summarizes the clinical development of novel BTK inhibitors, ACP-196 (acalabrutinib, ONO/GS-4059, and BGB-3111.
Autoregulation of kinase dephosphorylation by ATP binding in AGC protein kinases.
Chan, Tung O; Pascal, John M; Armen, Roger S; Rodeck, Ulrich
2012-02-01
AGC kinases, including the three Akt (protein kinase B) isoforms, protein kinase A (PKA) and all protein kinase C (PKC) isoforms, require activation loop phosphorylation (threonine 308 in Akt1) as well as phosphorylation of a C-terminal residue (serine 473 in Akt1) for catalytic activity and phosphorylation of downstream targets. Conversely, phosphatases reverse these phosphorylations. Virtually all cellular processes are affected by AGC kinases, a circumstance that has led to intense scrutiny of the molecular mechanisms that regulate phosphorylation of these kinases. Here, we review a new layer of control of phosphorylation in Akt, PKA and PKC pointing to ATP binding pocket occupancy as a means to decelerate dephosphorylation of these and, potentially, other kinases. This additional level of kinase regulation opens the door to search for new functional motifs for the rational design of non- ATP-competitive kinase inhibitors that discriminate within and between protein kinase families.
New mutations affecting induced mutagenesis in yeast.
Lawrence, C W; Krauss, B R; Christensen, R B
1985-01-01
Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.
Recurrent PTPRB and PLCG1 mutations in angiosarcoma.
Behjati, Sam; Tarpey, Patrick S; Sheldon, Helen; Martincorena, Inigo; Van Loo, Peter; Gundem, Gunes; Wedge, David C; Ramakrishna, Manasa; Cooke, Susanna L; Pillay, Nischalan; Vollan, Hans Kristian M; Papaemmanuil, Elli; Koss, Hans; Bunney, Tom D; Hardy, Claire; Joseph, Olivia R; Martin, Sancha; Mudie, Laura; Butler, Adam; Teague, Jon W; Patil, Meena; Steers, Graham; Cao, Yu; Gumbs, Curtis; Ingram, Davis; Lazar, Alexander J; Little, Latasha; Mahadeshwar, Harshad; Protopopov, Alexei; Al Sannaa, Ghadah A; Seth, Sahil; Song, Xingzhi; Tang, Jiabin; Zhang, Jianhua; Ravi, Vinod; Torres, Keila E; Khatri, Bhavisha; Halai, Dina; Roxanis, Ioannis; Baumhoer, Daniel; Tirabosco, Roberto; Amary, M Fernanda; Boshoff, Chris; McDermott, Ultan; Katan, Matilda; Stratton, Michael R; Futreal, P Andrew; Flanagan, Adrienne M; Harris, Adrian; Campbell, Peter J
2014-04-01
Angiosarcoma is an aggressive malignancy that arises spontaneously or secondarily to ionizing radiation or chronic lymphoedema. Previous work has identified aberrant angiogenesis, including occasional somatic mutations in angiogenesis signaling genes, as a key driver of angiosarcoma. Here we employed whole-genome, whole-exome and targeted sequencing to study the somatic changes underpinning primary and secondary angiosarcoma. We identified recurrent mutations in two genes, PTPRB and PLCG1, which are intimately linked to angiogenesis. The endothelial phosphatase PTPRB, a negative regulator of vascular growth factor tyrosine kinases, harbored predominantly truncating mutations in 10 of 39 tumors (26%). PLCG1, a signal transducer of tyrosine kinases, encoded a recurrent, likely activating p.Arg707Gln missense variant in 3 of 34 cases (9%). Overall, 15 of 39 tumors (38%) harbored at least one driver mutation in angiogenesis signaling genes. Our findings inform and reinforce current therapeutic efforts to target angiogenesis signaling in angiosarcoma.
International Nuclear Information System (INIS)
Ivanov, E.L.; Kovaltzova, S.V.; Kassinova, G.V.; Gracheva, L.M.; Korolev, V.G.; Zakharov, I.A.
1986-01-01
The authors have studied the molecular nature of ade2 mutations induced by UV light and bifunctional acridine-mustard (BAM) in wild-type (RAD) and in excision-deficient (rad2) strains of the yeast, Saccharomyces cerevisiae. In the RAD strain, UV causes 45% GC → AT transitions among all mutations; in the rad2 strain this value is 77%. BAM was shown to be highly specific for frameshift mutagenesis: 60% frameshifts in the RAD strain, and as many as 84% frameshifts in the rad2 strain were induced. Therefore, the rad2 mutation affects the specificity of UV- and BAM-induced mutagenesis in yeast. Experimental data agree with the view that the majority of mutations in the RAD strain are induced by a prereplicative mechanism, whereas mutations in the rad2 strain are predominantly postreplicative events. (Auth.)
Directory of Open Access Journals (Sweden)
Axel eCloeckaert
2013-07-01
Full Text Available A screening for non-target mutations affecting fluoroquinolone susceptibility was conducted in epidemic multidrug-resistant Salmonella enterica serovar Kentucky ST198. Among a panel of representative isolates (n=30, covering the epidemic, only three showed distinct mutations in ramR resulting in enhanced expression of genes encoding the AcrAB-TolC efflux system and low increase in ciprofloxacin MIC. No mutations were detected in other regulatory regions of this efflux system. Ciprofloxacin resistance in serovar Kentucky ST198 is thus currently mainly due to multiple target gene mutations.
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Autoregulation of kinase dephosphorylation by ATP binding to AGC protein kinases
Pascal, John M; Armen, Roger S
2012-01-01
AGC kinases, including the three Akt (protein kinase B) isoforms, protein kinase A (PKA) and all protein kinase C (PKC) isoforms, require activation loop phosphorylation (threonine 308 in Akt1) as well as phosphorylation of a C-terminal residue (serine 473 in Akt1) for catalytic activity and phosphorylation of downstream targets. Conversely, phosphatases reverse these phosphorylations. Virtually all cellular processes are affected by AGC kinases, a circumstance that has led to intense scrutiny of the molecular mechanisms that regulate phosphorylation of these kinases. Here, we review a new layer of control of phosphorylation in Akt, PKA and PKC pointing to ATP binding pocket occupancy as a means to decelerate dephosphorylation of these and, potentially, other kinases. This additional level of kinase regulation opens the door to search for new functional motifs for the rational design of non-ATP-competitive kinase inhibitors that discriminate within and between protein kinase families. PMID:22262182
EGFR Mutation Status in Uighur Lung Adenocarcinoma Patients
Directory of Open Access Journals (Sweden)
Li SHAN
2013-02-01
Full Text Available Background and objective Epidermal growth factor receptor (EGFR, a transmembrane protein, is a member of the tyrosine kinase family. Gefitinib, an EGFR tyrosine-kinase inhibitors, has shown a high response rate in the treatment of lung cancer in patients with EGFR mutation. However, significant differences in EGFR mutations exist among different ethnic groups. The aim of this study is to investigate the prevalence of EGFR mutations in Uighur lung adenocarcinoma patients by using a rapid and sensitive detection method and to analyze EGFR mutation differences compared with Han lung adenocarcinoma patients. Methods We examined lung adenocarcinoma tissues from 138 patients, including 68 Uighur lung adenocarcinoma patients and 70 Han lung adenocarcinoma patients, for EGFR mutations in exons 18, 19, 20, and 21 by using the amplification refractory mutation system (ARMS PCR method. The mutation differences between Uighur and Han lung adenocarcinoma were compared by using the chi-square test method. Results EGFR mutations were detected in 43 (31.2% of the 138 lung adenocarcinoma patients. EGFR mutations were detected in 11 (16.2% of the 68 Uighur lung adenocarcinoma patients and in 32 (45.7% of the 70 Han lung adenocarcinoma patients. Significant differences were observed in the EGFR mutations between Uighur lung adenocarcinoma patients and Han lung adenocarcinoma patients (P<0.001. Conclusion Our results indicate that the EGFR mutation in Uighur lung adenocarcinoma patients (16.2% is significantly lower than that in Han lung adenocarcinoma patients (45.7%.
Qiu, Yixuan; Hassaninasab, Azam; Han, Gil-Soo; Carman, George M
2016-12-16
In the yeast Saccharomyces cerevisiae, Dgk1 diacylglycerol (DAG) kinase catalyzes the CTP-dependent phosphorylation of DAG to form phosphatidic acid (PA). The enzyme in conjunction with Pah1 PA phosphatase controls the levels of PA and DAG for the synthesis of triacylglycerol and membrane phospholipids, the growth of the nuclear/endoplasmic reticulum membrane, and the formation of lipid droplets. Little is known about how DAG kinase activity is regulated by posttranslational modification. In this work, we examined the phosphorylation of Dgk1 DAG kinase by casein kinase II (CKII). When phosphate groups were globally reduced using nonspecific alkaline phosphatase, Triton X-100-solubilized membranes from DGK1-overexpressing cells showed a 7.7-fold reduction in DAG kinase activity; the reduced enzyme activity could be increased 5.5-fold by treatment with CKII. Dgk1(1-77) expressed heterologously in Escherichia coli was phosphorylated by CKII on a serine residue, and its phosphorylation was dependent on time as well as on the concentrations of CKII, ATP, and Dgk1(1-77). We used site-specific mutagenesis, coupled with phosphorylation analysis and phosphopeptide mapping, to identify Ser-45 and Ser-46 of Dgk1 as the CKII target sites, with Ser-46 being the major phosphorylation site. In vivo, the S46A and S45A/S46A mutations of Dgk1 abolished the stationary phase-dependent stimulation of DAG kinase activity. In addition, the phosphorylation-deficient mutations decreased Dgk1 function in PA production and in eliciting pah1Δ phenotypes, such as the expansion of the nuclear/endoplasmic reticulum membrane, reduced lipid droplet formation, and temperature sensitivity. This work demonstrates that the CKII-mediated phosphorylation of Dgk1 regulates its function in the production of PA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Qiu, Yixuan; Hassaninasab, Azam; Han, Gil-Soo; Carman, George M.
2016-01-01
In the yeast Saccharomyces cerevisiae, Dgk1 diacylglycerol (DAG) kinase catalyzes the CTP-dependent phosphorylation of DAG to form phosphatidic acid (PA). The enzyme in conjunction with Pah1 PA phosphatase controls the levels of PA and DAG for the synthesis of triacylglycerol and membrane phospholipids, the growth of the nuclear/endoplasmic reticulum membrane, and the formation of lipid droplets. Little is known about how DAG kinase activity is regulated by posttranslational modification. In this work, we examined the phosphorylation of Dgk1 DAG kinase by casein kinase II (CKII). When phosphate groups were globally reduced using nonspecific alkaline phosphatase, Triton X-100-solubilized membranes from DGK1-overexpressing cells showed a 7.7-fold reduction in DAG kinase activity; the reduced enzyme activity could be increased 5.5-fold by treatment with CKII. Dgk1(1–77) expressed heterologously in Escherichia coli was phosphorylated by CKII on a serine residue, and its phosphorylation was dependent on time as well as on the concentrations of CKII, ATP, and Dgk1(1–77). We used site-specific mutagenesis, coupled with phosphorylation analysis and phosphopeptide mapping, to identify Ser-45 and Ser-46 of Dgk1 as the CKII target sites, with Ser-46 being the major phosphorylation site. In vivo, the S46A and S45A/S46A mutations of Dgk1 abolished the stationary phase-dependent stimulation of DAG kinase activity. In addition, the phosphorylation-deficient mutations decreased Dgk1 function in PA production and in eliciting pah1Δ phenotypes, such as the expansion of the nuclear/endoplasmic reticulum membrane, reduced lipid droplet formation, and temperature sensitivity. This work demonstrates that the CKII-mediated phosphorylation of Dgk1 regulates its function in the production of PA. PMID:27834677
Suda, Kenichi; Mizuuchi, Hiroshi; Maehara, Yoshihiko; Mitsudomi, Tetsuya
2012-12-01
Lung cancers that harbor somatic activating mutations in the gene for the epidermal growth factor receptor (EGFR) depend on mutant EGFR for their proliferation and survival; therefore, lung cancer patients with EGFR mutations often dramatically respond to orally available EGFR tyrosine kinase inhibitors (TKIs). However, emergence of acquired resistance is virtually inevitable, thus limiting improvement in patient outcomes. To elucidate and overcome this acquired resistance, multidisciplinary basic and clinical investigational approaches have been applied, using in vitro cell line models or samples obtained from lung cancer patients treated with EGFR-TKIs. These efforts have revealed several acquired resistance mechanisms and candidates, including EGFR secondary mutations (T790M and other rare mutations), MET amplification, PTEN downregulation, CRKL amplification, high-level HGF expression, FAS-NFκB pathway activation, epithelial-mesenchymal transition, and conversion to small cell lung cancer. Interestingly, cancer cells harbor potential destiny and ductility together in acquiring resistance to EGFR-TKIs, as shown in in vitro acquired resistance models. Molecular mechanisms of "reversible EGFR-TKI tolerance" that occur in early phase EGFR-TKI exposure have been identified in cell line models. Furthermore, others have reported molecular markers that can predict response to EGFR-TKIs in clinical settings. Deeper understanding of acquired resistance mechanisms to EGFR-TKIs, followed by the development of molecular target drugs that can overcome the resistance, might turn this fatal disease into a chronic disorder.
Frequency and Prognostic Relevance of FLT3 Mutations in Saudi Acute Myeloid Leukemia Patients
Directory of Open Access Journals (Sweden)
Ghaleb Elyamany
2014-01-01
Full Text Available The Fms-like tyrosine kinase-3 (FLT3 is a receptor tyrosine kinase that plays a key role in cell survival, proliferation, and differentiation of hematopoietic stem cells. Mutations of FLT3 were first described in 1997 and account for the most frequent molecular mutations in acute myeloid leukemia (AML. AML patients with FLT3 internal tandem duplication (ITD mutations have poor cure rates the prognostic significance of point mutations; tyrosine kinase domain (TKD is still unclear. We analyzed the frequency of FLT3 mutations (ITD and D835 in patients with AML at diagnosis; no sufficient data currently exist regarding FLT3 mutations in Saudi AML patients. This study was aimed at evaluating the frequency of FLT3 mutations in patients with AML and its significance for prognosis. The frequency of FLT3 mutations in our study (18.56% was lower than many of the reported studies, FLT3-ITD mutations were observed in 14.4%, and FLT3-TKD in 4.1%, of 97 newly diagnosed AML patients (82 adult and 15 pediatric. Our data show significant increase of FLT3 mutations in male more than female (13 male, 5 female. Our results support the view that FLT3-ITD mutation has strong prognostic factor in AML patients and is associated with high rate of relapse, and high leucocytes and blast count at diagnosis and relapse.
Directory of Open Access Journals (Sweden)
Anna Binda
2018-03-01
Full Text Available Inwardly rectifying potassium channels (Kir have been historically associated to several cardiovascular disorders. In particular, loss-of-function mutations in the Kir2.1 channel have been reported in cases affected by Andersen-Tawil syndrome while gain-of-function mutations in the same channel cause the short QT3 syndrome. Recently, a missense mutation in Kir2.1, as well as mutations in the Kir4.1, were reported to be involved in autism spectrum disorders (ASDs suggesting a role of potassium channels in these diseases and introducing the idea of the existence of K+ channel ASDs. Here, we report the identification in an Italian affected family of a novel missense mutation (p.Phe58Ser in the KCNJ2 gene detected in heterozygosity in a proband affected by autism and borderline for short QT syndrome type 3. The mutation is located in the N-terminal region of the gene coding for the Kir2.1 channel and in particular in a very conserved domain. In vitro assays demonstrated that this mutation results in an increase of the channel conductance and in its open probability. This gain-of-function of the protein is consistent with the autistic phenotype, which is normally associated to an altered neuronal excitability.
Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G
2018-03-30
Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.
Structure of the intact ATM/Tel1 kinase
Wang, Xuejuan; Chu, Huanyu; Lv, Mengjuan; Zhang, Zhihui; Qiu, Shuwan; Liu, Haiyan; Shen, Xuetong; Wang, Weiwu; Cai, Gang
2016-05-01
The ataxia-telangiectasia mutated (ATM) protein is an apical kinase that orchestrates the multifaceted DNA-damage response. Normally, ATM kinase is in an inactive, homodimer form and is transformed into monomers upon activation. Besides a conserved kinase domain at the C terminus, ATM contains three other structural modules, referred to as FAT, FATC and N-terminal helical solenoid. Here we report the first cryo-EM structure of ATM kinase, which is an intact homodimeric ATM/Tel1 from Schizosaccharomyces pombe. We show that two monomers directly contact head-to-head through the FAT and kinase domains. The tandem N-terminal helical solenoid tightly packs against the FAT and kinase domains. The structure suggests that ATM/Tel1 dimer interface and the consecutive HEAT repeats inhibit the binding of kinase substrates and regulators by steric hindrance. Our study provides a structural framework for understanding the mechanisms of ATM/Tel1 regulation as well as the development of new therapeutic agents.
International Nuclear Information System (INIS)
Atoui, A.; Bao, D.; Kaur, N.; Grayburn, W.S.; Calvo, A.M.
2008-01-01
The Aspergillus nidulans putative mitogen-activated protein kinase encoded by mpkB has a role in natural product biosynthesis. An mpkB mutant exhibited a decrease in sterigmatocystin gene expression and low mycotoxin levels. The mutation also affected the expression of genes involved in penicillin and terrequinone A synthesis. mpkB was necessary for normal expression of laeA, which has been found to regulate secondary metabolism gene clusters. (author)
International Nuclear Information System (INIS)
Wang Zhidong; Hu Ruifa
2002-01-01
The research developed a production function on crop varieties developed by mutation method in order to explore factors affecting the development of new varieties. It is found that the research investment, human capital and radiation facilities were the most important factors that affected the development and cultivation area of new varieties through the mutation method. It is concluded that not all institutions involved in the breeding activities using mutation method must have radiation facilities and the national government only needed to invest in those key research institutes, which had strong research capacities. The saved research budgets can be used in the entrusting the institutes that have stronger research capacities with irradiating more breeding materials developed by the institutes that have weak research capacities, by which more opportunities to breed better varieties can be created
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
Directory of Open Access Journals (Sweden)
Frédéric Brioude
Full Text Available CONTEXT: KISS1R mutations have been reported in few patients with normosmic congenital hypogonadotropic hypogonadism (nCHH (OMIM #146110. OBJECTIVE: To describe in detail nCHH patients with biallelic KISS1R mutations belonging to 2 unrelated families, and to functionally characterize a novel KISS1R mutation. RESULTS: An original mutant, p.Tyr313His, was found in the homozygous state in 3 affected kindred (2 females and 1 male from a consanguineous Portuguese family. This mutation, located in the seventh transmembrane domain, affects a highly conserved amino acid, perturbs the conformation of the transmembrane segment, and impairs MAP kinase signaling and intracellular calcium release. In the second family, a French Caucasian male patient with nCHH was found to carry two recurrent mutations in the compound heterozygous state (p.Leu102Pro/Stop399Arg. In this man, pulsatile GnRH (Gonadotropin Releasing Hormone administration restored pulsatile LH (Luteinizing Hormone secretion and testicular hormone secretion. Later, long-term combined gonadotropin therapy induced spermatogenesis, enabling 3 successive pregnancies that resulted in 2 miscarriages and the birth of a healthy boy. CONCLUSION: We show that a novel loss-of-function mutation (p.Tyr313His in the KISS1R gene can cause familial nCHH, revealing the crucial role of this amino acid in KISS1R function. The observed restoration of gonadotropin secretion by exogenous GnRH administration further supports, in humans, the hypothalamic origin of the gonadotropin deficiency in this genetic form of nCHH.
Mutations in the catalytic loop HRD motif alter the activity and function of Drosophila Src64.
Directory of Open Access Journals (Sweden)
Taylor C Strong
Full Text Available The catalytic loop HRD motif is found in most protein kinases and these amino acids are predicted to perform functions in catalysis, transition to, and stabilization of the active conformation of the kinase domain. We have identified mutations in a Drosophila src gene, src64, that alter the three HRD amino acids. We have analyzed the mutants for both biochemical activity and biological function during development. Mutation of the aspartate to asparagine eliminates biological function in cytoskeletal processes and severely reduces fertility, supporting the amino acid's critical role in enzymatic activity. The arginine to cysteine mutation has little to no effect on kinase activity or cytoskeletal reorganization, suggesting that the HRD arginine may not be critical for coordinating phosphotyrosine in the active conformation. The histidine to leucine mutant retains some kinase activity and biological function, suggesting that this amino acid may have a biochemical function in the active kinase that is independent of its side chain hydrogen bonding interactions in the active site. We also describe the phenotypic effects of other mutations in the SH2 and tyrosine kinase domains of src64, and we compare them to the phenotypic effects of the src64 null allele.
Lin, Yu-Fen; Nagasawa, Hatsumi; Little, John B; Kato, Takamitsu A; Shih, Hung-Ying; Xie, Xian-Jin; Wilson, Paul F; Brogan, John R; Kurimasa, Akihiro; Chen, David J; Bedford, Joel S; Chen, Benjamin P C
2014-01-01
We have examined cell-cycle dependence of chromosomal aberration induction and cell killing after high or low dose-rate γ irradiation in cells bearing DNA-PKcs mutations in the S2056 cluster, the T2609 cluster, or the kinase domain. We also compared sister chromatid exchanges (SCE) production by very low fluences of α-particles in DNA-PKcs mutant cells, and in homologous recombination repair (HRR) mutant cells including Rad51C, Rad51D, and Fancg/xrcc9. Generally, chromosomal aberrations and cell killing by γ-rays were similarly affected by mutations in DNA-PKcs, and these mutant cells were more sensitive in G1 than in S/G2 phase. In G1-irradiated DNA-PKcs mutant cells, both chromosome- and chromatid-type breaks and exchanges were in excess than wild-type cells. For cells irradiated in late S/G2 phase, mutant cells showed very high yields of chromatid breaks compared to wild-type cells. Few exchanges were seen in DNA-PKcs-null, Ku80-null, or DNA-PKcs kinase dead mutants, but exchanges in excess were detected in the S2506 or T2609 cluster mutants. SCE induction by very low doses of α-particles is resulted from bystander effects in cells not traversed by α-particles. SCE seen in wild-type cells was completely abolished in Rad51C- or Rad51D-deficient cells, but near normal in Fancg/xrcc9 cells. In marked contrast, very high levels of SCEs were observed in DNA-PKcs-null, DNA-PKcs kinase-dead and Ku80-null mutants. SCE induction was also abolished in T2609 cluster mutant cells, but was only slightly reduced in the S2056 cluster mutant cells. Since both non-homologous end-joining (NHEJ) and HRR systems utilize initial DNA lesions as a substrate, these results suggest the possibility of a competitive interference phenomenon operating between NHEJ and at least the Rad51C/D components of HRR; the level of interaction between damaged DNA and a particular DNA-PK component may determine the level of interaction of such DNA with a relevant HRR component.
[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].
Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen
2018-02-10
OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.
Zhao, Qi; Guan, Menglong; Wang, Ling; Liao, Yong; Li-Ling, Jesse; Wan, Huajing
2017-04-10
To detect mutation of GPR143 gene in a Chinese patient affected with ocular albinism. Peripheral blood samples were collected from the proband and his parents. The coding regions of the GPR143 gene were subjected to PCR amplification and Sanger sequencing. A previously unreported mutation (c.758T>A) was found in exon 6 of the GPR143 gene in the proband and his mother. The same mutation was not found in his father. As predicted, the mutation has resulted in a stop codon, causing premature termination of protein translation. A novel mutation of the GPR143 gene related to X-linked ocular albinism has been identified.
Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Hérault, Frédéric; Damon, Marie; Le Roy, Pascale
2011-08-29
Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08), with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the influence of major-effect mutations on the least affected
Directory of Open Access Journals (Sweden)
Iannuccelli Nathalie
2011-08-01
Full Text Available Abstract Background Detection of quantitative trait loci (QTLs affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effects. We report on a microsatellite-based QTL detection scan including all autosomes for pig meat quality and carcass composition traits in an F2 population of 1,000 females and barrows resulting from an intercross between a Pietrain and a Large White-Hampshire-Duroc synthetic sire line. Our QTL detection design allowed side-by-side comparison of the RYR1 and PRKAG3 mutation effects seen as QTLs when segregating at low frequencies (0.03-0.08, with independent QTL effects detected from most of the same population, excluding any carrier of these mutations. Results Large QTL effects were detected in the absence of the RYR1 and PRKGA3 mutations, accounting for 12.7% of phenotypic variation in loin colour redness CIE-a* on SSC6 and 15% of phenotypic variation in glycolytic potential on SSC1. We detected 8 significant QTLs with effects on meat quality traits and 20 significant QTLs for carcass composition and growth traits under these conditions. In control analyses including mutation carriers, RYR1 and PRKAG3 mutations were detected as QTLs, from highly significant to suggestive, and explained 53% to 5% of the phenotypic variance according to the trait. Conclusions Our results suggest that part of muscle development and backfat thickness effects commonly attributed to the RYR1 mutation may be a consequence of linkage with independent QTLs affecting those traits. The proportion of variation explained by the most significant QTLs detected in this work is close to the
Di Dalmazi, Guido; Kisker, Caroline; Calebiro, Davide; Mannelli, Massimo; Canu, Letizia; Arnaldi, Giorgio; Quinkler, Marcus; Rayes, Nada; Tabarin, Antoine; Laure Jullié, Marie; Mantero, Franco; Rubin, Beatrice; Waldmann, Jens; Bartsch, Detlef K; Pasquali, Renato; Lohse, Martin; Allolio, Bruno; Fassnacht, Martin; Beuschlein, Felix; Reincke, Martin
2014-10-01
Somatic mutations in PRKACA gene, encoding the catalytic subunit of protein kinase A (PKA), have been recently found in a high proportion of sporadic adenomas associated with Cushing's syndrome. The aim was to analyze the PRKACA mutation in a large cohort of patients with adrenocortical masses. Samples from nine European centers were included (Germany, n = 4; Italy, n = 4; France, n = 1). Samples were drawn from 149 patients with nonsecreting adenomas (n = 32 + 2 peritumoral), subclinical hypercortisolism (n = 36), Cushing's syndrome (n = 64 + 2 peritumoral), androgen-producing tumors (n = 4), adrenocortical carcinomas (n = 5 + 2 peritumoral), and primary bilateral macronodular adrenal hyperplasias (n = 8). Blood samples were available from patients with nonsecreting adenomas (n = 15), subclinical hypercortisolism (n = 10), and Cushing's syndrome (n = 35). Clinical and hormonal data were collected. DNA amplification by PCR of exons 6 and 7 of the PRKACA gene and direct sequencing were performed. PRKACA heterozygous mutations were found in 22/64 samples of Cushing's syndrome patients (34%). No mutations were found in peritumoral tissue and blood samples or in other tumors examined. The c.617A>C (p.Leu206Arg) occurred in 18/22 patients. Furthermore, two novel mutations were identified: c.600_601insGTG/p.Cys200_Gly201insVal in three patients and c.639C>G+c.638_640insATTATCCTGAGG/p.Ser213Arg+p.Leu212_Lys214insIle-Ile-Leu-Arg) in one. All the mutations involved a region implicated in interaction between PKA regulatory and catalytic subunits. Patients with somatic PRKACA mutations showed higher levels of cortisol after dexamethasone test and a smaller adenoma size, compared with nonmutated subjects. These data confirm and extend previous observations that somatic PRKACA mutations are specific for adrenocortical adenomas causing Cushing's syndrome.
Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast
International Nuclear Information System (INIS)
Lin, Y.H.; Keil, R.L.
1991-01-01
HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination
Directory of Open Access Journals (Sweden)
Cavender Druie
2009-05-01
Full Text Available Abstract Background The mammalian target of rapamycin protein (mTOR is an evolutionarily conserved kinase that regulates protein synthesis, cell cycle progression and proliferation in response to various environmental cues. As a critical downstream mediator of PI3K signaling, mTOR is important for lymphocyte development and function of mature T and B-cells. Most studies of mTOR in immune responses have relied on the use of pharmacological inhibitors, such as rapamycin. Rapamycin-FKBP12 complex exerts its immunosuppressive and anti-proliferative effect by binding outside the kinase domain of mTOR, and subsequently inhibiting downstream mTOR signaling. Results To determine the requirement for mTOR kinase activity in the immune system function, we generated knock-in mice carrying a mutation (D2338 in the catalytic domain of mTOR. While homozygous mTOR kd/kd embryos died before embryonic day 6.5, heterozygous mTOR+/kd mice appeared entirely normal and are fertile. mTOR +/kd mice exhibited normal T and B cell development and unaltered proliferative responses of splenocytes to IL-2 and TCR/CD28. In addition, heterozygousity for the mTOR kinase-dead allele did not sensitize T cells to rapamycin in a CD3-mediated proliferation assay. Unexpectedly, mTOR kinase activity towards its substrate 4E-BP1 was not decreased in hearts and livers from heterozygous animals. Conclusion Altogether, our findings indicate that mTOR kinase activity is indispensable for the early development of mouse embryos. Moreover, a single wild type mTOR allele is sufficient to maintain normal postnatal growth and lymphocyte development and proliferation.
Lu, Kai; Liang, Shan; Wu, Zhen; Bi, Chao; Yu, Yong-Tao; Wang, Xiao-Fang; Zhang, Da-Peng
2016-01-01
Receptor-like kinases (RLKs) have been reported to regulate many developmental and defense process, but only a few members have been functionally characterized. In the present study, our observations suggest that one of the RLKs, a membrane-localized cysteine-rich receptor-like protein kinase, CRK5, is involved in abscisic acid (ABA) signaling in Arabidopsis thaliana. Overexpression of CRK5 increases ABA sensitivity in ABA-induced early seedling growth arrest and promotion of stomatal closure and inhibition of stomatal opening. Interestingly, and importantly, overexpression of CRK5 enhances plant drought tolerance without affecting plant growth at the mature stages and plant productivity. Transgenic lines overexpressing a mutated form of CRK5, CRK5 K372E with the change of the 372nd conserved amino acid residue from lysine to glutamic acid in its kinase domain, result in wild-type ABA and drought responses, supporting the role of CRK5 in ABA signaling. The loss-of-function mutation of the CRK5 gene does not affect the ABA response, while overexpression of two homologs of CRK5, CRK4 and CRK19, confers ABA responses, suggesting that these CRK members function redundantly. We further showed that WRKY18, WRKY40 and WRKY60 transcription factors repress the expression of CRK5, and that CRK5 likely functions upstream of ABI2 in ABA signaling. These findings help in understanding the complex ABA signaling network. PMID:27406784
C. elegans serine-threonine kinase KIN-29 modulates TGFβ signaling and regulates body size formation
Directory of Open Access Journals (Sweden)
Cohen Stephen
2005-04-01
Full Text Available Background In C. elegans there are two well-defined TGFβ-like signaling pathways. The Sma/Mab pathway affects body size morphogenesis, male tail development and spicule formation while the Daf pathway regulates entry into and exit out of the dauer state. To identify additional factors that modulate TGFβ signaling in the Sma/Mab pathway, we have undertaken a genetic screen for small animals and have identified kin-29. Results kin-29 encodes a protein with a cytoplasmic serine-threonine kinase and a novel C-terminal domain. The kinase domain is a distantly related member of the EMK (ELKL motif kinase family, which interacts with microtubules. We show that the serine-threonine kinase domain has in vitro activity. kin-29 mutations result in small animals, but do not affect male tail morphology as do several of the Sma/Mab signal transducers. Adult worms are smaller than the wild-type, but also develop more slowly. Rescue by kin-29 is achieved by expression in neurons or in the hypodermis. Interaction with the dauer pathway is observed in double mutant combinations, which have been seen with Sma/Mab pathway mutants. We show that kin-29 is epistatic to the ligand dbl-1, and lies upstream of the Sma/Mab pathway target gene, lon-1. Conclusion kin-29 is a new modulator of the Sma/Mab pathway. It functions in neurons and in the hypodermis to regulate body size, but does not affect all TGFβ outputs, such as tail morphogenesis.
Directory of Open Access Journals (Sweden)
Martin Neumann
Full Text Available Early T-cell precursor acute lymphoblastic leukemia (ETP-ALL has been identified as high-risk subgroup of acute T-lymphoblastic leukemia (T-ALL with a high rate of FLT3-mutations in adults. To unravel the underlying pathomechanisms and the clinical course we assessed molecular alterations and clinical characteristics in a large cohort of ETP-ALL (n = 68 in comparison to non-ETP T-ALL adult patients. Interestingly, we found a high rate of FLT3-mutations in ETP-ALL samples (n = 24, 35%. Furthermore, FLT3 mutated ETP-ALL was characterized by a specific immunophenotype (CD2+/CD5-/CD13+/CD33-, a distinct gene expression pattern (aberrant expression of IGFBP7, WT1, GATA3 and mutational status (absence of NOTCH1 mutations and a low frequency, 21%, of clonal TCR rearrangements. The observed low GATA3 expression and high WT1 expression in combination with lack of NOTCH1 mutations and a low rate of TCR rearrangements point to a leukemic transformation at the pluripotent prothymocyte stage in FLT3 mutated ETP-ALL. The clinical outcome in ETP-ALL patients was poor, but encouraging in those patients with allogeneic stem cell transplantation (3-year OS: 74%. To further explore the efficacy of targeted therapies, we demonstrate that T-ALL cell lines transfected with FLT3 expression constructs were particularly sensitive to tyrosine kinase inhibitors. In conclusion, FLT3 mutated ETP-ALL defines a molecular distinct stem cell like leukemic subtype. These data warrant clinical studies with the implementation of FLT3 inhibitors in addition to early allogeneic stem cell transplantation for this high risk subgroup.
HRR25, a putative protein kinase from budding yeast: Association with repair of damaged DNA
International Nuclear Information System (INIS)
Hoekstra, M.F.; Ou, A.C.; DeMaggio, A.J.; Burbee, D.G.; Liskay, R.M.; Heffron, F.
1991-01-01
In simple eukaryotes, protein kinases regulate mitotic and meiotic cell cycles, the response to polypeptide pheromones, and the initiation of nuclear DNA synthesis. The protein HRR25 from the budding yeast Saccharomyces cerevisiae was defined by the mutation hrr25-1. This mutation resulted in sensitivity to continuous expression of the HO double-strand endonuclease, to methyl methanesulfonate, and to x-irradiation. Homozygotes of hrr25-1 were unable to sporulate and disruption and deletion of HRR25 interfered with mitotic and meiotic cell division. Sequence analysis revealed two distinctive regions in the protein. The NH 2 -terminus of HRR25 contains the hallmark features of protein kinases, whereas the COOH-terminus is rich in proline and glutamine. Mutations in HRR25 at conserved residues found in all protein kinases inactivated the gene, and these mutants exhibited the hrr25 null phenotypes. Taken together, the hrr25 mutant phenotypes and the features of the gene product indicate that HRR25 is a distinctive member of the protein kinase superfamily
Profiling bacterial kinase activity using a genetic circuit
DEFF Research Database (Denmark)
van der Helm, Eric; Bech, Rasmus; Lehning, Christina Eva
Phosphorylation is a post-translational modification that regulates the activity of several key proteins in bacteria and eukaryotes. Accordingly, a variety of tools has been developed to measure kinase activity. To couple phosphorylation to an in vivo fluorescent readout we used the Bacillus...... subtilis kinase PtkA, transmembrane activator TkmA and the repressor FatR to construct a genetic circuit in E. coli. By tuning the repressor and kinase expression level at the same time, we were able to show a 4.2-fold increase in signal upon kinase induction. We furthermore validated that the previously...... reported FatR Y45E mutation1 attenuates operator repression. This genetic circuit provides a starting point for computational protein design and a metagenomic library-screening tool....
Yamaguchi, Fumihiro; Fukuchi, Kunihiko; Yamazaki, Yohei; Takayasu, Hiromi; Tazawa, Sakiko; Tateno, Hidetsugu; Kato, Eisuke; Wakabayashi, Aya; Fujimori, Mami; Iwasaki, Takuya; Hayashi, Makoto; Tsuchiya, Yutaka; Yamashita, Jun; Takeda, Norikazu; Kokubu, Fumio
2014-02-01
The purpose of the present study was to report cases of epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI)-naïve patients carrying a mutation associated with acquired resistance to the drug. Gene alterations in 77 lung carcinoma patients were analyzed by collecting and studying curette lavage fluid at the time of diagnosis. PCRs were performed to amplify mutation hotspot regions in EGFR genes. The PCR products were direct-sequenced and the mutations confirmed by resequencing using different primers. Case 1 was a 78-year-old Japanese male diagnosed with stage IB lung adenocarcinoma who was found to have two EGFR mutations, G719S and L747S. Case 2 was a 73-year-old Japanese male diagnosed with stage IV squamous cell lung carcinoma and bone metastasis who had the EGFR mutation, L747S. Case 3 was an 82-year-old Japanese male diagnosed with hyponatremia due to inappropriate secretion of antidiuretic hormone and stage IIIB small cell lung carcinoma (SCLC) who had the EGFR mutation, L747S. Thus, the EGFR mutation L747S associated with acquired EGFR-TKI resistance was detected in two non-small cell lung carcinoma (NSCLC) patients and one SCLC patient, none of whom had ever received EGFR-TKI. The patients were current smokers with stages at diagnosis ranging from IB to IV, and their initial tumors contained resistant clones carrying L747S. L747S may be associated with primary resistance. To the best of our knowledge, this study is the first report of an EGFR mutation associated with resistance to EGFR-TKI in SCLC patients. The early detection of EGFR-TKI resistance mutations may be beneficial in making treatment decisions for lung carcinoma patients, including those with SCLC.
STAT3 mutations correlated with hyper-IgE syndrome lead to ...
Indian Academy of Sciences (India)
Of all the causes identified for the disease hyper-immunoglobulinemia E syndrome (HIES), a homozygous mutation in tyrosine kinase2 (TYK2) and heterozygous mutations in STAT3 are implicated the defects in Jak/STAT signalling pathway in the pathogenesis of HIES. Mutations of STAT3 have been frequently clinically ...
Arjumand, Wani; Merry, Cole D.; Wang, Chen; Saba, Elias; McIntyre, John B.; Fang, Shujuan; Kornaga, Elizabeth; Ghatage, Prafull; Doll, Corinne M.; Lees, Susan P.
2016-01-01
The phosphatidylinositol-3 kinase (PI3K)/Akt/mTOR signaling pathway is activated in many human cancers. Previously, we reported that patients with early stage cervical cancer whose tumours harbour PIK3CA exon 9 or 20 mutations have worse overall survival in response to treatment with radiation and cisplatin than patients with wild-type PIK3CA. The purpose of this study was to determine whether PIK3CA-E545K mutation renders cervical cancer cells more resistant to cisplatin and/or radiation, and whether PI3K inhibition reverses the phenotype. We found that CaSki cells that are heterozygous for the PIK3CA-E545K mutation are more resistant to cisplatin or cisplatin plus radiation than either HeLa or SiHa cells that express only wild-type PIK3CA. Similarly, HeLa cells engineered to stably express PIK3CA-E545K were more resistant to cisplatin or cisplatin plus radiation than cells expressing only wild-type PIK3CA or with PIK3CA depleted. Cells expressing the PIK3CA-E545K mutation also had constitutive PI3K pathway activation and increased cellular migration and each of these phenotypes was reversed by treatment with the PI3K inhibitor GDC-0941/Pictilisib. Our results suggests that cervical cancer patients whose tumours are positive for the PIK3CA-E545K mutation may benefit from PI3K inhibitor therapy in concert with standard cisplatin and radiation therapy. PMID:27489350
Impaired intracortical transmission in G2019S leucine rich-repeat kinase Parkinson patients.
Ponzo, Viviana; Di Lorenzo, Francesco; Brusa, Livia; Schirinzi, Tommaso; Battistini, Stefania; Ricci, Claudia; Sambucci, Manolo; Caltagirone, Carlo; Koch, Giacomo
2017-05-01
A mutation in leucine-rich repeat kinase 2 is the most common cause of hereditary Parkinson's disease (PD), yet the neural mechanisms and the circuitry potentially involved are poorly understood. We used different transcranial magnetic stimulation protocols to explore in the primary motor cortex the activity of intracortical circuits and cortical plasticity (long-term potentiation) in patients with the G2019S leucine-rich repeat kinase 2 gene mutation when compared with idiopathic PD patients and age-matched healthy subjects. Paired pulse transcranial magnetic stimulation was used to investigate short intracortical inhibition and facilitation and short afferent inhibition. Intermittent theta burst stimulation, a form of repetitive transcranial magnetic stimulation, was used to test long-term potentiation-like cortical plasticity. Leucine-rich repeat kinase 2 and idiopathic PD were tested both in ON and in OFF l-dopa therapy. When compared with idiopathic PD and healthy subjects, leucine-rich repeat kinase 2 PD patients showed a remarkable reduction of short intracortical inhibition in both ON and in OFF l-dopa therapy. This reduction was paralleled by an increase of intracortical facilitation in OFF l-dopa therapy. Leucine-rich repeat kinase 2 PD showed abnormal long-term potentiation-like cortical plasticity in ON l-dopa therapy. The motor cortex in leucine-rich repeat kinase 2 mutated PD patients is strongly disinhibited and hyperexcitable. These abnormalities could be a result of an impairment of inhibitory (gamma-Aminobutyric acid) transmission eventually related to altered neurotransmitter release. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.
Resistance of Akt kinases to dephosphorylation through ATP-dependent conformational plasticity.
Chan, Tung O; Zhang, Jin; Rodeck, Ulrich; Pascal, John M; Armen, Roger S; Spring, Maureen; Dumitru, Calin D; Myers, Valerie; Li, Xue; Cheung, Joseph Y; Feldman, Arthur M
2011-11-15
Phosphorylation of a threonine residue (T308 in Akt1) in the activation loop of Akt kinases is a prerequisite for deregulated Akt activity frequently observed in neoplasia. Akt phosphorylation in vivo is balanced by the opposite activities of kinases and phosphatases. Here we describe that targeting Akt kinase to the cell membrane markedly reduced sensitivity of phosphorylated Akt to dephosphorylation by protein phosphatase 2A. This effect was amplified by occupancy of the ATP binding pocket by either ATP or ATP-competitive inhibitors. Mutational analysis revealed that R273 in Akt1 and the corresponding R274 in Akt2 are essential for shielding T308 in the activation loop against dephosphorylation. Thus, occupancy of the nucleotide binding pocket of Akt kinases enables intramolecular interactions that restrict phosphatase access and sustain Akt phosphorylation. This mechanism provides an explanation for the "paradoxical" Akt hyperphosphorylation induced by ATP-competitive inhibitor, A-443654. The lack of phosphatase resistance further contributes insight into the mechanism by which the human Akt2 R274H missense mutation may cause autosomal-dominant diabetes mellitus.
Hyun, H-K; Lee, S-K; Lee, K-E; Kang, H-Y; Kim, E-J; Choung, P-H; Kim, J-W
2009-11-01
To determine the underlying molecular genetic aetiology of a family with the hypocalcified form of amelogenesis imperfecta and to investigate the hardness of the enamel and dentine of a known FAM83H mutation. Mutational screening of the FAM83H on the basis of candidate gene approach was performed. All exons and exon-intron boundaries was amplified and sequenced. A microhardness test was performed to measure the Vickers microhardness value. A novel nonsense mutation (c.1354C>T, p.Q452X) was identified in the last exon of FAM83H, which resulted in soft, uncalcified enamel. The affected enamel was extremely soft (about 17% of the normal control), but the underlying dentine was as hard as the normal control. Mutational analysis revealed a novel mutation in FAM83H gene. Hardness of dentine was not affected by the mutation, whilst the enamel was extremely soft.
International Nuclear Information System (INIS)
Khateb, Mamduh; Ruimi, Nili; Khamisie, Hazem; Najajreh, Yousef; Mian, Afsar; Metodieva, Anna; Ruthardt, Martin; Mahajna, Jamal
2012-01-01
Philadelphia positive leukemias are characterized by the presence of Bcr-Abl fusion protein which exhibits an abnormal kinase activity. Selective Abl kinase inhibitors have been successfully established for the treatment of Ph (+) leukemias. Despite high rates of clinical response, Ph (+) patients can develop resistance against these kinase inhibitors mainly due to point mutations within the Abl protein. Of special interest is the ‘gatekeeper’ T315I mutation, which confers complete resistance to Abl kinase inhibitors. Recently, GNF-2, Abl allosteric kinase inhibitor, was demonstrated to possess cellular activity against Bcr-Abl transformed cells. Similarly to Abl kinase inhibitors (AKIs), GNF-2 failed to inhibit activity of mutated Bcr-Abl carrying the T315I mutation. Ba/F3 cells harboring native or T315I mutated Bcr-Abl constructs were treated with GNF-2 and AKIs. We monitored the effect of GNF-2 with AKIs on the proliferation and clonigenicity of the different Ba/F3 cells. In addition, we monitored the auto-phosphorylation activity of Bcr-Abl and JAK2 in cells treated with GNF-2 and AKIs. In this study, we report a cooperation between AKIs and GNF-2 in inhibiting proliferation and clonigenicity of Ba/F3 cells carrying T315I mutated Bcr-Abl. Interestingly, cooperation was most evident between Dasatinib and GNF-2. Furthermore, we showed that GNF-2 was moderately active in inhibiting the activity of JAK2 kinase, and presence of AKIs augmented GNF-2 activity. Our data illustrated the ability of allosteric inhibitors such as GNF-2 to cooperate with AKIs to overcome T315I mutation by Bcr-Abl-independent mechanisms, providing a possibility of enhancing AKIs efficacy and overcoming resistance in Ph+ leukemia cells
Hopper, Rachel K; Feinstein, Jeffrey A; Manning, Melanie A; Benitz, William; Hudgins, Louanne
2015-04-01
Mutations in RAF1 are associated with Noonan syndrome and hypertrophic cardiomyopathy. We present two infants with Noonan syndrome and an identical RAF1 mutation, p.Ser257Leu (c.770C>T), who developed severe pulmonary arterial hypertension (PAH) that proved to be fatal. The RAF1 gene encodes Raf-1 kinase, part of the Ras/mitogen-activated kinase (MAPK) signaling pathway, which has been linked to the development of PAH. This specific mutation has been associated with dephosphorylation of a critical serine residue and constitutive activation of the Raf-1 kinase. These two cases suggest that abnormal activation of the Ras/MAPK pathway may play a significant role in the development of pulmonary vascular disease in the subset of patients with Noonan syndrome and a specific RAF1 mutation. © 2015 Wiley Periodicals, Inc.
Phenotypic and molecular genetic analysis of Pyruvate Kinase ...
African Journals Online (AJOL)
Jaouani Mouna
2015-09-26
Sep 26, 2015 ... to several mutations at the Pyruvate Kinase gene (PKLR) located on chromosome .... Tunisians (Fig. 2) [21]. The screening of whole PKLR gene revealed the presence of ..... newborns: the pitfalls of diagnosis. J Pediatr 2007 ...
Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey
2017-01-01
Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.
Signaling network of the Btk family kinases.
Qiu, Y; Kung, H J
2000-11-20
The Btk family kinases represent new members of non-receptor tyrosine kinases, which include Btk/Atk, Itk/Emt/Tsk, Bmx/Etk, and Tec. They are characterized by having four structural modules: PH (pleckstrin homology) domain, SH3 (Src homology 3) domain, SH2 (Src homology 2) domain and kinase (Src homology 1) domain. Increasing evidence suggests that, like Src-family kinases, Btk family kinases play central but diverse modulatory roles in various cellular processes. They participate in signal transduction in response to virtually all types of extracellular stimuli which are transmitted by growth factor receptors, cytokine receptors, G-protein coupled receptors, antigen-receptors and integrins. They are regulated by many non-receptor tyrosine kinases such as Src, Jak, Syk and FAK family kinases. In turn, they regulate many of major signaling pathways including those of PI3K, PLCgamma and PKC. Both genetic and biochemical approaches have been used to dissect the signaling pathways and elucidate their roles in growth, differentiation and apoptosis. An emerging new role of this family of kinases is cytoskeletal reorganization and cell motility. The physiological importance of these kinases was amply demonstrated by their link to the development of immunodeficiency diseases, due to germ-line mutations. The present article attempts to review the structure and functions of Btk family kinases by summarizing our current knowledge on the interacting partners associated with the different modules of the kinases and the diverse signaling pathways in which they are involved.
Directory of Open Access Journals (Sweden)
Chang-Hyun Lee
2016-10-01
Full Text Available Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the Atm and Xrp1 genes identified in this screen.
DEFF Research Database (Denmark)
Holck, Susanne; Bonde, Jesper; Pedersen, Helle
2016-01-01
Colorectal cancers (CRC) often show activating mutations of the KRAS or BRAF genes, which stimulate the extracellular signal-regulated kinase (ERK) pathway, thus increasing cell proliferation and inhibiting apoptosis. However, immunohistochemical results on ERK activation in such tumors differ...... detectable increases in phosphorylation of ERK (pERK), we stained biopsies from 36 CRC patients with activating mutations in the BRAF gene (BRAFV600E: BRAF(m)), the KRAS gene (KRAS(m)) or in neither (BRAF/KRAS(n)) with this optimized method. Staining was scored in blind-coded specimens by two observers....... Staining of stromal cells was used as a positive control. BRAF(m) or KRAS(m) tumors did not show higher staining scores than BRAF/KRAS(n) tumors. Although BRAFV600E staining occurred in over 90% of cancer cells in all 9 BRAF(m) tumors, 3 only showed staining for pERK in less than 10% of cancer cell nuclei...
Directory of Open Access Journals (Sweden)
Naomi Coulton
2017-12-01
Full Text Available While mammalian Chk1 kinase regulates replication origins, safeguards fork integrity and promotes fork progression, yeast Chk1 acts only in G1 and G2. We report here that the mutation of serine 173 (S173A in the kinase domain of fission yeast Chk1 abolishes the G1-M and S-M checkpoints with little impact on the G2-M arrest. This separation-of-function mutation strongly reduces the Rad3-dependent phosphorylation of Chk1 at serine 345 during logarithmic growth, but not when cells experience exogenous DNA damage. Loss of S173 lowers the restrictive temperature of a catalytic DNA polymerase epsilon mutant (cdc20.M10 and is epistatic with a mutation in DNA polymerase delta (cdc6.23 when DNA is alkylated by methyl-methanesulfate (MMS. The chk1-S173A allele is uniquely sensitive to high MMS concentrations where it displays a partial checkpoint defect. A complete checkpoint defect occurs only when DNA replication forks break in cells without the intra-S phase checkpoint kinase Cds1. Chk1-S173A is also unable to block mitosis when the G1 transcription factor Cdc10 (cdc10.V50 is impaired. We conclude that serine 173, which is equivalent to lysine 166 in the activation loop of human Chk1, is only critical in DNA polymerase mutants or when forks collapse in the absence of Cds1.
Azam, Mohammad; Nardi, Valentina; Shakespeare, William C.; Metcalf, Chester A.; Bohacek, Regine S.; Wang, Yihan; Sundaramoorthi, Raji; Sliz, Piotr; Veach, Darren R.; Bornmann, William G.; Clarkson, Bayard; Dalgarno, David C.; Sawyer, Tomi K.; Daley, George Q.
2006-01-01
Mutation in the ABL kinase domain is the principal mechanism of imatinib resistance in patients with chronic myelogenous leukemia. Many mutations favor active kinase conformations that preclude imatinib binding. Because the active forms of ABL and SRC resemble one another, we tested two dual SRC-ABL kinase inhibitors, AP23464 and PD166326, against 58 imatinib-resistant (IMR) BCR/ABL kinase variants. Both compounds potently inhibit most IMR variants, and in vitro drug selection demonstrates that active (AP23464) and open (PD166326) conformation-specific compounds are less susceptible to resistance than imatinib. Combinations of inhibitors suppressed essentially all resistance mutations, with the notable exception of T315I. Guided by mutagenesis studies and molecular modeling, we designed a series of AP23464 analogues to target T315I. The analogue AP23846 inhibited both native and T315I variants of BCR/ABL with submicromolar potency but showed nonspecific cellular toxicity. Our data illustrate how conformational dynamics of the ABL kinase accounts for the activity of dual SRC-ABL inhibitors against IMR-mutants and provides a rationale for combining conformation specific inhibitors to suppress resistance. PMID:16754879
Sholl, Lynette M; Xiao, Yun; Joshi, Victoria; Yeap, Beow Y; Cioffredi, Leigh-Anne; Jackman, David M; Lee, Charles; Jänne, Pasi A; Lindeman, Neal I
2010-06-01
About 10% of patients with non-small cell lung carcinoma (NSCLC) respond to epidermal growth factor receptor (EGFR)-targeted tyrosine kinase inhibitors (TKIs). More than 75% of "responders" have activating mutations in EGFR. However, mutation analysis is not widely available, and proposed alternatives (in situ hybridization and immunohistochemical analysis) have shown inconsistent associations with outcome. Fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), immunohistochemical analysis, and DNA sequencing were compared in this study of 40 NSCLC samples from TKI-treated patients. Response rates were 12 of 19 in EGFR-mutant vs 1 of 20 EGFR wild-type tumors (P = .0001), 7 of 19 FISH+ vs 4 of 17 FISH- tumors (not significant [NS]), 5 of 16 CISH+ vs 6 of 21 CISH- tumors (NS), and 3 of 9 immunohistochemically positive vs 7 of 22 immunohistochemically negative tumors (NS). EGFR mutation was associated with improved progression-free survival (P = .0004). Increased copy number (FISH or CISH) and protein expression (immunohistochemical) did not independently predict outcome. Thus, EGFR sequence analysis was the only method useful for predicting response and progression-free survival following TKI therapy in NSCLC.
Directory of Open Access Journals (Sweden)
Olaf Karl Klinke
Full Text Available The aim of this study was to determine the minimal set of genetic alterations required for the development of a very low risk clinically symptomatic gastro-intestinal stromal tumour within the stomach wall. We studied the genome of a very low-risk gastric gastro-intestinal stromal tumour by whole-genome sequencing, comparative genomic hybridisation and methylation profiling. The studied tumour harboured two typical genomic lesions: loss of the long arm of chromosome 14 and an activating mutation in exon 11 of KIT. Besides these genetic lesions, only two point mutations that may affect tumour progression were identified: A frame-shift deletion in RNF146 and a missense mutation in a zinc finger of ZNF407. Whilst the frameshift deletion in RNF146 seemed to be restricted to this particular tumour, a similar yet germline mutation in ZNF407 was found in a panel of 52 gastro-intestinal stromal tumours from different anatomical sites and different categories. Germline polymorphisms in the mitotic checkpoint proteins Aurora kinase A and BUB1 kinase B may have furthered tumour growth. The epigenetic profile of the tumour matches that of other KIT-mutant tumours. We have identified mutations in three genes and loss of the long arm of chromosome 14 as the so far minimal set of genetic abnormalities sufficient for the development of a very low risk clinically symptomatic gastric stromal tumour.
Weidensee, Sabine; Goettig, Peter; Bertone, Marko; Haas, Dorothea; Magdolen, Viktor; Kiechle, Marion; Meindl, Alfons; van Kuilenburg, André B. P.; Gross, Eva
2011-01-01
Evaluation of a non-synonymous mutation associated with dihydropyrimidine dehydrogenase (DPD) deficiency. DPD enzyme analysis, mutation analysis and molecular dynamics simulations based on the 3D-model of DPD. The substitution Lys63Glu is likely to affect the FAD binding pocket within the DPD
MED and PSACH COMP mutations affect chondrogenesis in chicken limb bud micromass cultures.
Roman-Blas, J; Dion, A S; Seghatoleslami, M R; Giunta, K; Oca, P; Jimenez, S A; Williams, C J
2010-09-01
Mutations in cartilage oligomeric matrix protein (COMP) cause pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). We studied the effects of over-expression of wild type and mutant COMP on early stages of chondrogenesis in chicken limb bud micromass cultures. Cells were transduced with RCAS virus harboring wild type or mutant (C328R, PSACH; T585R, MED) COMP cDNAs and cultured for 3, 4, and 5 days. The effect of COMP constructs on chondrogenesis was assessed by analyzing mRNA and protein expression of several COMP binding partners. Cell viability was assayed, and evaluation of apoptosis was performed by monitoring caspase 3 processing. Over-expression of COMP, and especially expression of COMP mutants, had a profound affect on the expression of syndecan 3 and tenascin C, early markers of chondrogenesis. Over-expression of COMP did not affect levels of type II collagen or matrilin-3; however, there were increases in type IX collagen expression and sulfated proteoglycan synthesis, particularly at day 5 of harvest. In contrast to cells over-expressing COMP, cells with mutant COMP showed reduction in type IX collagen expression and increased matrilin 3 expression. Finally, reduction in cell viability, and increased activity of caspase 3, at days 4 and 5, were observed in cultures expressing either wild type or mutant COMP. MED, and PSACH mutations, despite displaying phenotypic differences, demonstrated only subtle differences in their cellular viability and mRNA and protein expression of components of the extracellular matrix, including those that interact with COMP. These results suggest that COMP mutations, by disrupting normal interactions between COMP and its binding partners, significantly affect chondrogenesis. (c) 2010 Wiley-Liss, Inc.
Kram, Karin E; Finkel, Steven E
2015-07-01
Bacteria such as Escherichia coli are frequently grown to high density to produce biomolecules for study in the laboratory. To achieve this, cells can be incubated in extremely rich media that increase overall cell yield. In these various media, bacteria may have different metabolic profiles, leading to changes in the amounts of toxic metabolites produced. We have previously shown that stresses experienced during short-term growth can affect the survival of cells during the long-term stationary phase (LTSP). Here, we incubated cells in LB, 2× yeast extract-tryptone (YT), Terrific Broth, or Super Broth medium and monitored survival during the LTSP, as well as other reporters of genetic and physiological change. We observe differential cell yield and survival in all media studied. We propose that differences in long-term survival are the result of changes in the metabolism of components of the media that may lead to increased levels of protein and/or DNA damage. We also show that culture pH and levels of protein glycation, a covalent modification that causes protein damage, affect long-term survival. Further, we measured mutation frequency after overnight incubation and observed a correlation between high mutation frequencies at the end of the log phase and loss of viability after 4 days of LTSP incubation, indicating that mutation frequency is potentially predictive of long-term survival. Since glycation and mutation can be caused by oxidative stress, we measured expression of the oxyR oxidative stress regulator during log-phase growth and found that higher levels of oxyR expression during the log phase are consistent with high mutation frequency and lower cell density during the LTSP. Since these complex rich media are often used when producing large quantities of biomolecules in the laboratory, the observed increase in damage resulting in glycation or mutation may lead to production of a heterogeneous population of plasmids or proteins, which could affect the
A genetic screen for mutations affecting embryonic development in medaka fish (Oryzias latipes).
Loosli, F; Köster, R W; Carl, M; Kühnlein, R; Henrich, T; Mücke, M; Krone, A; Wittbrodt, J
2000-10-01
In a pilot screen, we assayed the efficiency of ethylnitrosourea (ENU) as a chemical mutagen to induce mutations that lead to early embryonic and larval lethal phenotypes in the Japanese medaka fish, Oryzias latipes. ENU acts as a very efficient mutagen inducing mutations at high rates in germ cells. Three repeated treatments of male fish in 3 mM ENU for 1 h results in locus specific mutation rates of 1.1-1.95 x10(-3). Mutagenized males were outcrossed to wild type females and the F1 offspring was used to establish F2 families. F2 siblings were intercrossed and the F3 progeny was scored 24, 48 and 72 h after fertilization for morphological alterations affecting eye development. The presented mutant phenotypes were identified using morphological criteria and occur during early developmental stages of medaka. They are stably inherited in a Mendelian fashion. The high efficiency of ENU to induce mutations in this pilot screen indicates that chemical mutagenesis and screening for morphologically visible phenotypes in medaka fish allows the genetic analysis of specific aspects of vertebrate development complementing the screens performed in other vertebrate model systems.
Regales, Lucia; Balak, Marissa N; Gong, Yixuan; Politi, Katerina; Sawai, Ayana; Le, Carl; Koutcher, Jason A; Solit, David B; Rosen, Neal; Zakowski, Maureen F; Pao, William
2007-08-29
The EGFR T790M mutation confers acquired resistance to kinase inhibitors in human EGFR mutant lung adenocarcinoma, is occasionally detected before treatment, and may confer genetic susceptibility to lung cancer. To study further its role in lung tumorigenesis, we developed mice with inducible expression in type II pneumocytes of EGFR(T790M) alone or together with a drug-sensitive L858R mutation. Both transgenic lines develop lung adenocarcinomas that require mutant EGFR for tumor maintenance but are resistant to an EGFR kinase inhibitor. EGFR(L858R+T790M)-driven tumors are transiently targeted by hsp90 inhibition. Notably, EGFR(T790M)-expressing animals develop tumors with longer latency than EGFR(L858R+T790M)-bearing mice and in the absence of additional kinase domain mutations. These new mouse models of mutant EGFR-dependent lung adenocarcinomas provide insight into clinical observations. The models should also be useful for developing improved therapies for patients with lung cancers harboring EGFR(T790M) alone or in conjunction with drug-sensitive EGFR kinase domain mutations.
Directory of Open Access Journals (Sweden)
Lucia Regales
2007-08-01
Full Text Available The EGFR T790M mutation confers acquired resistance to kinase inhibitors in human EGFR mutant lung adenocarcinoma, is occasionally detected before treatment, and may confer genetic susceptibility to lung cancer.To study further its role in lung tumorigenesis, we developed mice with inducible expression in type II pneumocytes of EGFR(T790M alone or together with a drug-sensitive L858R mutation. Both transgenic lines develop lung adenocarcinomas that require mutant EGFR for tumor maintenance but are resistant to an EGFR kinase inhibitor. EGFR(L858R+T790M-driven tumors are transiently targeted by hsp90 inhibition. Notably, EGFR(T790M-expressing animals develop tumors with longer latency than EGFR(L858R+T790M-bearing mice and in the absence of additional kinase domain mutations.These new mouse models of mutant EGFR-dependent lung adenocarcinomas provide insight into clinical observations. The models should also be useful for developing improved therapies for patients with lung cancers harboring EGFR(T790M alone or in conjunction with drug-sensitive EGFR kinase domain mutations.
Vulto-van Silfhout, Anneke T; Rajamanickam, Shivakumar; Jensik, Philip J; Vergult, Sarah; de Rocker, Nina; Newhall, Kathryn J; Raghavan, Ramya; Reardon, Sara N; Jarrett, Kelsey; McIntyre, Tara; Bulinski, Joseph; Ownby, Stacy L; Huggenvik, Jodi I; McKnight, G Stanley; Rose, Gregory M; Cai, Xiang; Willaert, Andy; Zweier, Christiane; Endele, Sabine; de Ligt, Joep; van Bon, Bregje W M; Lugtenberg, Dorien; de Vries, Petra F; Veltman, Joris A; van Bokhoven, Hans; Brunner, Han G; Rauch, Anita; de Brouwer, Arjan P M; Carvill, Gemma L; Hoischen, Alexander; Mefford, Heather C; Eichler, Evan E; Vissers, Lisenka E L M; Menten, Björn; Collard, Michael W; de Vries, Bert B A
2014-05-01
Recently, we identified in two individuals with intellectual disability (ID) different de novo mutations in DEAF1, which encodes a transcription factor with an important role in embryonic development. To ascertain whether these mutations in DEAF1 are causative for the ID phenotype, we performed targeted resequencing of DEAF1 in an additional cohort of over 2,300 individuals with unexplained ID and identified two additional individuals with de novo mutations in this gene. All four individuals had severe ID with severely affected speech development, and three showed severe behavioral problems. DEAF1 is highly expressed in the CNS, especially during early embryonic development. All four mutations were missense mutations affecting the SAND domain of DEAF1. Altered DEAF1 harboring any of the four amino acid changes showed impaired transcriptional regulation of the DEAF1 promoter. Moreover, behavioral studies in mice with a conditional knockout of Deaf1 in the brain showed memory deficits and increased anxiety-like behavior. Our results demonstrate that mutations in DEAF1 cause ID and behavioral problems, most likely as a result of impaired transcriptional regulation by DEAF1. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Autosomal mutations affecting Y chromosome loops in Drosophila melanogaster
Directory of Open Access Journals (Sweden)
Petrucci Romano
2008-04-01
Full Text Available Abstract Background The Y chromosome of Drosophila melanogaster harbors several genes required for male fertility. The genes for these fertility factors are very large in size and contain conspicuous amounts of repetitive DNA and transposons. Three of these loci (ks-1, kl-3 and kl-5 have the ability to develop giant lampbrush-like loops in primary spermatocytes, a cytological manifestation of their active state in these cells. Y-loops bind a number of non-Y encoded proteins, but the mechanisms regulating their development and their specific functions are still to be elucidated. Results Here we report the results of a screen of 726 male sterile lines to identify novel autosomal genes controlling Y-loop function. We analyzed mutant testis preparations both in vivo and by immunofluorescence using antibodies directed against Y-loop-associated proteins. This screen enabled us to isolate 17 mutations at 15 loci whose wild-type function is required for proper Y-loop morphogenesis. Six of these loci are likely to specifically control loop development, while the others display pleiotropic effects on both loops and meiotic processes such as spermiogenesis, sperm development and maturation. We also determined the map position of the mutations affecting exclusively Y-loop morphology. Conclusion Our cytological screening permitted us to identify novel genetic functions required for male spermatogenesis, some of which show pleiotropic effects. Analysis of these mutations also shows that loop development can be uncoupled from meiosis progression. These data represent a useful framework for the characterization of Y-loop development at a molecular level and for the study of the genetic control of heterochromatin.
Rimm, David L.; Caca, Karel; Hu, Gang; Harrison, Frank B.; Fearon, Eric R.
1999-01-01
β-Catenin has a critical role in E-cadherin-mediated cell-cell adhesion, and it also functions as a downstream signaling molecule in the wnt pathway. Mutations in the putative glycogen synthase kinase 3β phosphorylation sites near the β-catenin amino terminus have been found in some cancers and cancer cell lines. The mutations render β-catenin resistant to regulation by a complex containing the glycogen synthase kinase 3β, adenomatous polyposis coli, and axin proteins. As a result, β-catenin accumulates in the cytosol and nucleus and activates T-cell factor/lymphoid enhancing factor transcription factors. Previously, 6 of 27 melanoma cell lines were found to have β-catenin exon 3 mutations affecting the N-terminal phosphorylation sites (Rubinfeld B, Robbins P, Elgamil M, Albert I, Porfiri E, Polakis P: Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 1997, 275:1790–1792). To assess the role of β-catenin defects in primary melanomas, we undertook immunohistochemical and DNA sequencing studies in 65 melanoma specimens. Nuclear and/or cytoplasmic localization of β-catenin, a potential indicator of wnt pathway activation, was seen focally within roughly one third of the tumors, though a clonal somatic mutation in β-catenin was found in only one case (codon 45 Ser→Pro). Our findings demonstrate that β-catenin mutations are rare in primary melanoma, in contrast to the situation in melanoma cell lines. Nonetheless, activation of β-catenin, as indicated by its nuclear and/or cytoplasmic localization, appears to be frequent in melanoma, and in some cases, it may reflect focal and transient activation of the wnt pathway within the tumor. PMID:10027390
New contribution on the LRRK2 G2019S mutation associated to ...
African Journals Online (AJOL)
... generations ago. Conclusion: Our conclusion is that the G2019S mutation of the LRRK2 gene originates 3,840 (95% CI 3,210-5,400) years ago in parkinsonian Moroccan Berbers patients. Key words: Parkinson's disease (PD), Leucine-rich repeat kinase 2 (LRRK2) gene, G2019S mutation, Haplotype, Founding mutation.
Functional characterization of a constitutively active kinase variant of Arabidopsis phototropin 1.
Petersen, Jan; Inoue, Shin-Ichiro; Kelly, Sharon M; Sullivan, Stuart; Kinoshita, Toshinori; Christie, John M
2017-08-18
Phototropins (phots) are plasma membrane-associated serine/threonine kinases that coordinate a range of processes linked to optimizing photosynthetic efficiency in plants. These photoreceptors contain two light-, oxygen-, or voltage-sensing (LOV) domains within their N terminus, with each binding one molecule of flavin mononucleotide as a UV/blue light-absorbing chromophore. Although phots contain two LOV domains, light-induced activation of the C-terminal kinase domain and subsequent receptor autophosphorylation is controlled primarily by the A'α-LOV2-Jα photosensory module. Mutations that disrupt interactions between the LOV2 core and its flanking helical segments can uncouple this mode of light regulation. However, the impact of these mutations on phot function in Arabidopsis has not been explored. Here we report that histidine substitution of Arg-472 located within the A'α-helix of Arabidopsis phot1 constitutively activates phot1 kinase activity in vitro without affecting LOV2 photochemistry. Expression analysis of phot1 R472H in the phot-deficient mutant confirmed that it is autophosphorylated in darkness in vivo but unable to initiate phot1 signaling in the absence of light. Instead, we found that phot1 R472H is poorly functional under low-light conditions but can restore phototropism, chloroplast accumulation, stomatal opening, and leaf positioning and expansion at higher light intensities. Our findings suggest that Arabidopsis can adapt to the elevated phosphorylation status of the phot1 R472H mutant in part by reducing its stability, whereas the activity of the mutant under high-light conditions can be attributed to additional increases in LOV2-mediated photoreceptor autophosphorylation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Lu, Kai; Liang, Shan; Wu, Zhen; Bi, Chao; Yu, Yong-Tao; Wang, Xiao-Fang; Zhang, Da-Peng
2016-09-01
Receptor-like kinases (RLKs) have been reported to regulate many developmental and defense process, but only a few members have been functionally characterized. In the present study, our observations suggest that one of the RLKs, a membrane-localized cysteine-rich receptor-like protein kinase, CRK5, is involved in abscisic acid (ABA) signaling in Arabidopsis thaliana Overexpression of CRK5 increases ABA sensitivity in ABA-induced early seedling growth arrest and promotion of stomatal closure and inhibition of stomatal opening. Interestingly, and importantly, overexpression of CRK5 enhances plant drought tolerance without affecting plant growth at the mature stages and plant productivity. Transgenic lines overexpressing a mutated form of CRK5, CRK5 (K372E) with the change of the 372nd conserved amino acid residue from lysine to glutamic acid in its kinase domain, result in wild-type ABA and drought responses, supporting the role of CRK5 in ABA signaling. The loss-of-function mutation of the CRK5 gene does not affect the ABA response, while overexpression of two homologs of CRK5, CRK4 and CRK19, confers ABA responses, suggesting that these CRK members function redundantly. We further showed that WRKY18, WRKY40 and WRKY60 transcription factors repress the expression of CRK5, and that CRK5 likely functions upstream of ABI2 in ABA signaling. These findings help in understanding the complex ABA signaling network. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data
Energy Technology Data Exchange (ETDEWEB)
Jorge, S.E.D.C.; Kobayashi, S.S.; Costa, D.B. [Harvard Medical School, Beth Israel Deaconess Medical Center, Department of Medicine, Division of Hematology/Oncology, Boston, MA (United States)
2014-09-05
Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC.
Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data
International Nuclear Information System (INIS)
Jorge, S.E.D.C.; Kobayashi, S.S.; Costa, D.B.
2014-01-01
Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC
Su, Y C; Maurel-Zaffran, C; Treisman, J E; Skolnik, E Y
2000-07-01
We have previously shown that the Ste20 kinase encoded by misshapen (msn) functions upstream of the c-Jun N-terminal kinase (JNK) mitogen-activated protein kinase module in Drosophila. msn is required to activate the Drosophila JNK, Basket (Bsk), to promote dorsal closure of the embryo. A mammalian homolog of Msn, Nck interacting kinase, interacts with the SH3 domains of the SH2-SH3 adapter protein Nck. We now show that Msn likewise interacts with Dreadlocks (Dock), the Drosophila homolog of Nck. dock is required for the correct targeting of photoreceptor axons. We have performed a structure-function analysis of Msn in vivo in Drosophila in order to elucidate the mechanism whereby Msn regulates JNK and to determine whether msn, like dock, is required for the correct targeting of photoreceptor axons. We show that Msn requires both a functional kinase and a C-terminal regulatory domain to activate JNK in vivo in Drosophila. A mutation in a PXXP motif on Msn that prevents it from binding to the SH3 domains of Dock does not affect its ability to rescue the dorsal closure defect in msn embryos, suggesting that Dock is not an upstream regulator of msn in dorsal closure. Larvae with only this mutated form of Msn show a marked disruption in photoreceptor axon targeting, implicating an SH3 domain protein in this process; however, an activated form of Msn is not sufficient to rescue the dock mutant phenotype. Mosaic analysis reveals that msn expression is required in photoreceptors in order for their axons to project correctly. The data presented here genetically link msn to two distinct biological events, dorsal closure and photoreceptor axon pathfinding, and thus provide the first evidence that Ste20 kinases of the germinal center kinase family play a role in axonal pathfinding. The ability of Msn to interact with distinct classes of adapter molecules in dorsal closure and photoreceptor axon pathfinding may provide the flexibility that allows it to link to distinct
Screening for calreticulin mutations in a cohort of patients suspected ...
African Journals Online (AJOL)
Background. The discovery of calreticulin (CALR) has shown it to be the second most frequent mutation after the Janus Kinase 2 (JAK2) mutation in myeloproliferative neoplasms (MPNs). Its structure indicates various functions, of which two are to ensure calcium homeostasis and proper folding of other target proteins.
Somatic mutations in histiocytic sarcoma identified by next generation sequencing.
Liu, Qingqing; Tomaszewicz, Keith; Hutchinson, Lloyd; Hornick, Jason L; Woda, Bruce; Yu, Hongbo
2016-08-01
Histiocytic sarcoma is a rare malignant neoplasm of presumed hematopoietic origin showing morphologic and immunophenotypic evidence of histiocytic differentiation. Somatic mutation importance in the pathogenesis or disease progression of histiocytic sarcoma was largely unknown. To identify somatic mutations in histiocytic sarcoma, we studied 5 histiocytic sarcomas [3 female and 2 male patients; mean age 54.8 (20-72), anatomic sites include lymph node, uterus, and pleura] and matched normal tissues from each patient as germ line controls. Somatic mutations in 50 "Hotspot" oncogenes and tumor suppressor genes were examined using next generation sequencing. Three (out of five) histiocytic sarcoma cases carried somatic mutations in BRAF. Among them, G464V [variant frequency (VF) of 43.6 %] and G466R (VF of 29.6 %) located at the P loop potentially interfere with the hydrophobic interaction between P and activating loops and ultimately activation of BRAF. Also detected was BRAF somatic mutation N581S (VF of 7.4 %), which was located at the catalytic loop of BRAF kinase domain: its role in modifying kinase activity was unclear. A similar mutational analysis was also performed on nine acute monocytic/monoblastic leukemia cases, which did not identify any BRAF somatic mutations. Our study detected several BRAF mutations in histiocytic sarcomas, which may be important in understanding the tumorigenesis of this rare neoplasm and providing mechanisms for potential therapeutical opportunities.
Structural Requirements for Yersinia YopJ Inhibition of MAP Kinase Pathways
Burdette, Dara; Mukherjee, Sohini; Keitany, Gladys; Goldsmith, Elizabeth; Orth, Kim
2008-01-01
MAPK signaling cascades are evolutionally conserved. The bacterial effector, YopJ, uses the unique activity of Ser/Thr acetylation to inhibit the activation of the MAPK kinase (MKK) and prevent activation by phosphorylation. YopJ is also able to block yeast MAPK signaling pathways using this mechanism. Based on these observations, we performed a genetic screen to isolate mutants in the yeast MKK, Pbs2, that suppress YopJ inhibition. One suppressor contains a mutation in a conserved tyrosine residue and bypasses YopJ inhibition by increasing the basal activity of Pbs2. Mutations on the hydrophobic face of the conserved G α-helix in the kinase domain prevent both binding and acetylation by YopJ. Corresponding mutants in human MKKs showed that they are conserved not only structurally, but also functionally. These studies reveal a conserved binding site found on the superfamily of MAPK kinases while providing insight into the molecular interactions required for YopJ inhibition. PMID:18167536
Structural requirements for Yersinia YopJ inhibition of MAP kinase pathways.
Directory of Open Access Journals (Sweden)
Yi-Heng Hao
2008-01-01
Full Text Available MAPK signaling cascades are evolutionally conserved. The bacterial effector, YopJ, uses the unique activity of Ser/Thr acetylation to inhibit the activation of the MAPK kinase (MKK and prevent activation by phosphorylation. YopJ is also able to block yeast MAPK signaling pathways using this mechanism. Based on these observations, we performed a genetic screen to isolate mutants in the yeast MKK, Pbs2, that suppress YopJ inhibition. One suppressor contains a mutation in a conserved tyrosine residue and bypasses YopJ inhibition by increasing the basal activity of Pbs2. Mutations on the hydrophobic face of the conserved G alpha-helix in the kinase domain prevent both binding and acetylation by YopJ. Corresponding mutants in human MKKs showed that they are conserved not only structurally, but also functionally. These studies reveal a conserved binding site found on the superfamily of MAPK kinases while providing insight into the molecular interactions required for YopJ inhibition.
Disruption of the LOV-Jalpha helix interaction activates phototropin kinase activity.
Harper, Shannon M; Christie, John M; Gardner, Kevin H
2004-12-28
Light plays a crucial role in activating phototropins, a class of plant photoreceptors that are sensitive to blue and UV-A wavelengths. Previous studies indicated that phototropin uses a bound flavin mononucleotide (FMN) within its light-oxygen-voltage (LOV) domain to generate a protein-flavin covalent bond under illumination. In the C-terminal LOV2 domain of Avena sativa phototropin 1, formation of this bond triggers a conformational change that results in unfolding of a helix external to this domain called Jalpha [Harper, S. M., et al. (2003) Science 301, 1541-1545]. Though the structural effects of illumination were characterized, it was unknown how these changes are coupled to kinase activation. To examine this, we made a series of point mutations along the Jalpha helix to disrupt its interaction with the LOV domain in a manner analogous to light activation. Using NMR spectroscopy and limited proteolysis, we demonstrate that several of these mutations displace the Jalpha helix from the LOV domain independently of illumination. When placed into the full-length phototropin protein, these point mutations display constitutive kinase activation, without illumination of the sample. These results indicate that unfolding of the Jalpha helix is the critical event in regulation of kinase signaling for the phototropin proteins.
Musi, Elgilda; Ambrosini, Grazia; de Stanchina, Elisa; Schwartz, Gary K
2014-05-01
G-protein mutations are one of the most common mutations occurring in uveal melanoma activating the protein kinase C (PKC)/mitogen-activated protein kinase and phosphoinositide 3-kinase (PI3K)/AKT pathways. In this study, we described the effect of dual pathway inhibition in uveal melanoma harboring GNAQ and GNA11 mutations via PKC inhibition with AEB071 (sotrastaurin) and PI3K/AKT inhibition with BYL719, a selective PI3Kα inhibitor. Growth inhibition was observed in GNAQ/GNA11-mutant cells with AEB071 versus no activity in wild-type cells. In the GNAQ-mutant cells, AEB071 decreased phosphorylation of myristoylated alanine-rich C-kinase substrate, a substrate of PKC, along with ERK1/2 and ribosomal S6, but persistent AKT activation was present. BYL719 had minimal antiproliferative activity in all uveal melanoma cell lines, and inhibited phosphorylation of AKT in most cell lines. In the GNA11-mutant cell line, similar effects were observed with ERK1/2 inhibition, mostly inhibited by BYL719. With the combination treatment, both GNAQ- and GNA11-mutant cell lines showed synergistic inhibition of cell proliferation and apoptotic cell death. In vivo studies correlated with in vitro findings showing reduced xenograft tumor growth with the combination therapy in a GNAQ-mutant model. These findings suggest a new therapy treatment option for G-protein-mutant uveal melanoma with a focus on specific targeting of multiple downstream pathways as part of combination therapy.
Nuclear localization of Lyn tyrosine kinase mediated by inhibition of its kinase activity
International Nuclear Information System (INIS)
Ikeda, Kikuko; Nakayama, Yuji; Togashi, Yuuki; Obata, Yuuki; Kuga, Takahisa; Kasahara, Kousuke; Fukumoto, Yasunori; Yamaguchi, Naoto
2008-01-01
Src-family kinases, cytoplasmic enzymes that participate in various signaling events, are found at not only the plasma membrane but also subcellular compartments, such as the nucleus, the Golgi apparatus and late endosomes/lysosomes. Lyn, a member of the Src-family kinases, is known to play a role in DNA damage response and cell cycle control in the nucleus. However, it is still unclear how the localization of Lyn to the nucleus is regulated. Here, we investigated the mechanism of the distribution of Lyn between the cytoplasm and the nucleus in epitheloid HeLa cells and hematopoietic THP-1 cells. Lyn was definitely detected in purified nuclei by immunofluorescence and immunoblotting analyses. Nuclear accumulation of Lyn was enhanced upon treatment of cells with leptomycin B (LMB), an inhibitor of Crm1-mediated nuclear export. Moreover, Lyn mutants lacking the sites for lipid modification were highly accumulated in the nucleus upon LMB treatment. Intriguingly, inhibition of the kinase activity of Lyn by SU6656, Csk overexpression, or point mutation in the ATP-binding site induced an increase in nuclear Lyn levels. These results suggest that Lyn being imported into and rapidly exported from the nucleus preferentially accumulates in the nucleus by inhibition of the kinase activity and lipid modification
Joachims, Michelle L; Marble, Patrick A; Laurent, Aletha B; Pastuszko, Peter; Paliotta, Marco; Blackburn, Michael R; Thompson, Linda F
2008-12-01
Mutations in the gene encoding adenosine deaminase (ADA), a purine salvage enzyme, lead to immunodeficiency in humans. Although ADA deficiency has been analyzed in cell culture and murine models, information is lacking concerning its impact on the development of human thymocytes. We have used chimeric human/mouse fetal thymic organ culture to study ADA-deficient human thymocyte development in an "in vivo-like" environment where toxic metabolites accumulate in situ. Inhibition of ADA during human thymocyte development resulted in a severe reduction in cellular expansion as well as impaired differentiation, largely affecting mature thymocyte populations. Thymocyte differentiation was not blocked at a discrete stage; rather, the paucity of mature thymocytes was due to the induction of apoptosis as evidenced by activation of caspases and was accompanied by the accumulation of intracellular dATP. Inhibition of adenosine kinase and deoxycytidine kinase prevented the accumulation of dATP and restored thymocyte differentiation and proliferation. Our work reveals that multiple deoxynucleoside kinases are involved in the phosphorylation of deoxyadenosine when ADA is absent, and suggests an alternate therapeutic strategy for treatment of ADA-deficient patients.
Germline mutations in MAP3K6 are associated with familial gastric cancer.
Directory of Open Access Journals (Sweden)
Daniel Gaston
2014-10-01
Full Text Available Gastric cancer is among the leading causes of cancer-related deaths worldwide. While heritable forms of gastric cancer are relatively rare, identifying the genes responsible for such cases can inform diagnosis and treatment for both hereditary and sporadic cases of gastric cancer. Mutations in the E-cadherin gene, CDH1, account for 40% of the most common form of familial gastric cancer (FGC, hereditary diffuse gastric cancer (HDGC. The genes responsible for the remaining forms of FGC are currently unknown. Here we examined a large family from Maritime Canada with FGC without CDH1 mutations, and identified a germline coding variant (p.P946L in mitogen-activated protein kinase kinase kinase 6 (MAP3K6. Based on conservation, predicted pathogenicity and a known role of the gene in cancer predisposition, MAP3K6 was considered a strong candidate and was investigated further. Screening of an additional 115 unrelated individuals with non-CDH1 FGC identified the p.P946L MAP3K6 variant, as well as four additional coding variants in MAP3K6 (p.F849Sfs*142, p.P958T, p.D200Y and p.V207G. A somatic second-hit variant (p.H506Y was present in DNA obtained from one of the tumor specimens, and evidence of DNA hypermethylation within the MAP3K6 gene was observed in DNA from the tumor of another affected individual. These findings, together with previous evidence from mouse models that MAP3K6 acts as a tumor suppressor, and studies showing the presence of somatic mutations in MAP3K6 in non-hereditary gastric cancers and gastric cancer cell lines, point towards MAP3K6 variants as a predisposing factor for FGC.
Recurrent occurrences of CDKL5 mutations in patients with epileptic encephalopathy.
Yamamoto, Toshiyuki; Shimojima, Keiko; Kimura, Nobusuke; Mogami, Yukiko; Usui, Daisuke; Takayama, Rumiko; Ikeda, Hiroko; Imai, Katsumi
2015-01-01
The cyclin-dependent kinase-like 5 gene (CDKL5) is recognized as one of the genes responsible for epileptic encephalopathy. We identified CDKL5 mutations in five Japanese patients (one male and four female) with epileptic encephalopathy. Although all mutations were of de novo origin, they were located in the same positions as previously reported pathogenic mutations. These recurrent occurrences of de novo mutations in the same loci may indicate hot spots of nucleotide alteration.
Lee, Chang-Hyun; Rimesso, Gerard; Reynolds, David M; Cai, Jinlu; Baker, Nicholas E
2016-10-13
Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the Atm and Xrp1 genes identified in this screen. Copyright © 2016 Lee et al.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Livide, Gabriella; Patriarchi, Tommaso; Amenduni, Mariangela; Amabile, Sonia; Yasui, Dag; Calcagno, Eleonora; Lo Rizzo, Caterina; De Falco, Giulia; Ulivieri, Cristina; Ariani, Francesca; Mari, Francesca; Mencarelli, Maria Antonietta; Hell, Johannes Wilhelm; Renieri, Alessandra; Meloni, Ilaria
2015-02-01
Rett syndrome is a monogenic disease due to de novo mutations in either MECP2 or CDKL5 genes. In spite of their involvement in the same disease, a functional interaction between the two genes has not been proven. MeCP2 is a transcriptional regulator; CDKL5 encodes for a kinase protein that might be involved in the regulation of gene expression. Therefore, we hypothesized that mutations affecting the two genes may lead to similar phenotypes by dysregulating the expression of common genes. To test this hypothesis we used induced pluripotent stem (iPS) cells derived from fibroblasts of one Rett patient with a MECP2 mutation (p.Arg306Cys) and two patients with mutations in CDKL5 (p.Gln347Ter and p.Thr288Ile). Expression profiling was performed in CDKL5-mutated cells and genes of interest were confirmed by real-time RT-PCR in both CDKL5- and MECP2-mutated cells. The only major change in gene expression common to MECP2- and CDKL5-mutated cells was for GRID1, encoding for glutamate D1 receptor (GluD1), a member of the δ-family of ionotropic glutamate receptors. GluD1 does not form AMPA or NMDA glutamate receptors. It acts like an adhesion molecule by linking the postsynaptic and presynaptic compartments, preferentially inducing the inhibitory presynaptic differentiation of cortical neurons. Our results demonstrate that GRID1 expression is downregulated in both MECP2- and CDKL5-mutated iPS cells and upregulated in neuronal precursors and mature neurons. These data provide novel insights into disease pathophysiology and identify possible new targets for therapeutic treatment of Rett syndrome.
Directory of Open Access Journals (Sweden)
Soudeh Ghafouri-Fard
2016-02-01
Full Text Available Background The X-linked cyclin-dependent kinase like 5 (CDKL5/STK9 gene has been shown to be responsible for a severe encephalopathy condition characterized by early onset of epilepsy and severe developmental delay. CDKL5 mutations have been shown to be more frequent among female patients. Results Here we report a 6- month male patient, second child of a healthy non consanguineous in the Iranian population. He has been affected by early onset epileptic refractory seizures and developmental delay. Whole-exome sequencing (WES has revealed a base substitution c.173T>A in CDKL5 gene, resulting in the formation of stop codon p.L58X. This mutation resides in the catalytic domain of the corresponding protein and is expected to result in premature RNA break down with no CDKL5 resulting protein. Conclusion The present report highlights the importance of CDKL5 mutation analysis in male patients affected with early onset refractory epilepsy.
HER2 activating mutations are targets for colorectal cancer treatment.
Kavuri, Shyam M; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M; Migliardi, Giorgia; Searleman, Adam C; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A; Bertotti, Andrea; Bose, Ron
2015-08-01
The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of patients with colorectal cancer. Introduction of the HER2 mutations S310F, L755S, V777L, V842I, and L866M into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutants are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors neratinib and afatinib. HER2 gene sequencing of 48 cetuximab-resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) wild-type (WT) colorectal cancer patient-derived xenografts (PDX) identified 4 PDXs with HER2 mutations. HER2-targeted therapies were tested on two PDXs. Treatment with a single HER2-targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2-targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2-mutated PDXs. HER2 activating mutations cause EGFR antibody resistance in colorectal cell lines, and PDXs with HER2 mutations show durable tumor regression when treated with dual HER2-targeted therapy. These data provide a strong preclinical rationale for clinical trials targeting HER2 activating mutations in metastatic colorectal cancer. ©2015 American Association for Cancer Research.
Takahashi, Yuji; Fukuda, Yoko; Yoshimura, Jun; Toyoda, Atsushi; Kurppa, Kari; Moritoyo, Hiroyoko; Belzil, Veronique V.; Dion, Patrick A.; Higasa, Koichiro; Doi, Koichiro; Ishiura, Hiroyuki; Mitsui, Jun; Date, Hidetoshi; Ahsan, Budrul; Matsukawa, Takashi; Ichikawa, Yaeko; Moritoyo, Takashi; Ikoma, Mayumi; Hashimoto, Tsukasa; Kimura, Fumiharu; Murayama, Shigeo; Onodera, Osamu; Nishizawa, Masatoyo; Yoshida, Mari; Atsuta, Naoki; Sobue, Gen; Fifita, Jennifer A.; Williams, Kelly L.; Blair, Ian P.; Nicholson, Garth A.; Gonzalez-Perez, Paloma; Brown, Robert H.; Nomoto, Masahiro; Elenius, Klaus; Rouleau, Guy A.; Fujiyama, Asao; Morishita, Shinichi; Goto, Jun; Tsuji, Shoji
2013-01-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurological disorder characterized by the degeneration of motor neurons and typically results in death within 3–5 years from onset. Familial ALS (FALS) comprises 5%–10% of ALS cases, and the identification of genes associated with FALS is indispensable to elucidating the molecular pathogenesis. We identified a Japanese family affected by late-onset, autosomal-dominant ALS in which mutations in genes known to be associated with FALS were excluded. A whole- genome sequencing and parametric linkage analysis under the assumption of an autosomal-dominant mode of inheritance with incomplete penetrance revealed the mutation c.2780G>A (p. Arg927Gln) in ERBB4. An extensive mutational analysis revealed the same mutation in a Canadian individual with familial ALS and a de novo mutation, c.3823C>T (p. Arg1275Trp), in a Japanese simplex case. These amino acid substitutions involve amino acids highly conserved among species, are predicted as probably damaging, and are located within a tyrosine kinase domain (p. Arg927Gln) or a C-terminal domain (p. Arg1275Trp), both of which mediate essential functions of ErbB4 as a receptor tyrosine kinase. Functional analysis revealed that these mutations led to a reduced autophosphorylation of ErbB4 upon neuregulin-1 (NRG-1) stimulation. Clinical presentations of the individuals with mutations were characterized by the involvement of both upper and lower motor neurons, a lack of obvious cognitive dysfunction, and relatively slow progression. This study indicates that disruption of the neuregulin-ErbB4 pathway is involved in the pathogenesis of ALS and potentially paves the way for the development of innovative therapeutic strategies such using NRGs or their agonists to upregulate ErbB4 functions. PMID:24119685
Efficacy of ponatinib against ABL tyrosine kinase inhibitor-resistant leukemia cells
International Nuclear Information System (INIS)
Okabe, Seiichi; Tauchi, Tetsuzo; Tanaka, Yuko; Ohyashiki, Kazuma
2013-01-01
Highlights: •Efficacy of ponatinib against ABL tyrosine kinase inhibitor-resistant leukemia cells okabe et al. •Imatinib or nilotinib resistance was involved Src family kinase. •The BCR-ABL point mutation (E334V) was highly resistant to imatinib or nilotinib. •Ponatinib was a powerful strategy against imatinib or nilotinib resistant Ph-positive cells. -- Abstract: Because a substantial number of patients with chronic myeloid leukemia acquire resistance to ABL tyrosine kinase inhibitors (TKIs), their management remains a challenge. Ponatinib, also known as AP24534, is an oral multi-targeted TKI. Ponatinib is currently being investigated in a pivotal phase 2 clinical trial. In the present study, we analyzed the molecular and functional consequences of ponatinib against imatinib- or nilotinib-resistant (R) K562 and Ba/F3 cells. The proliferation of imatinib- or nilotinib-resistant K562 cells did not decrease after treatment with imatinib or nilotinib. Src family kinase Lyn was activated. Point mutation Ba/F3 cells (E334 V) were also highly resistant to imatinib and nilotinib. Treatment with ponatinib for 72 h inhibited the growth of imatinib- and nilotinib-resistant cells. The phosphorylation of BCR-ABL, Lyn, and Crk-L was reduced. This study demonstrates that ponatinib has an anti-leukemia effect by reducing ABL and Lyn kinase activity and this information may be of therapeutic relevance
Efficacy of ponatinib against ABL tyrosine kinase inhibitor-resistant leukemia cells
Energy Technology Data Exchange (ETDEWEB)
Okabe, Seiichi, E-mail: okabe@tokyo-med.ac.jp; Tauchi, Tetsuzo; Tanaka, Yuko; Ohyashiki, Kazuma
2013-06-07
Highlights: •Efficacy of ponatinib against ABL tyrosine kinase inhibitor-resistant leukemia cells okabe et al. •Imatinib or nilotinib resistance was involved Src family kinase. •The BCR-ABL point mutation (E334V) was highly resistant to imatinib or nilotinib. •Ponatinib was a powerful strategy against imatinib or nilotinib resistant Ph-positive cells. -- Abstract: Because a substantial number of patients with chronic myeloid leukemia acquire resistance to ABL tyrosine kinase inhibitors (TKIs), their management remains a challenge. Ponatinib, also known as AP24534, is an oral multi-targeted TKI. Ponatinib is currently being investigated in a pivotal phase 2 clinical trial. In the present study, we analyzed the molecular and functional consequences of ponatinib against imatinib- or nilotinib-resistant (R) K562 and Ba/F3 cells. The proliferation of imatinib- or nilotinib-resistant K562 cells did not decrease after treatment with imatinib or nilotinib. Src family kinase Lyn was activated. Point mutation Ba/F3 cells (E334 V) were also highly resistant to imatinib and nilotinib. Treatment with ponatinib for 72 h inhibited the growth of imatinib- and nilotinib-resistant cells. The phosphorylation of BCR-ABL, Lyn, and Crk-L was reduced. This study demonstrates that ponatinib has an anti-leukemia effect by reducing ABL and Lyn kinase activity and this information may be of therapeutic relevance.
Yoo, Da Hye; Choi, Young-Chul; Nam, Da Eun; Choi, Sun Seong; Kim, Ji Won; Choi, Byung-Ok; Chung, Ki Wha
2017-07-01
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is a condition that affects many parts of the body, particularly the brain and muscles. This study examined a Korean MELAS-like syndrome patient with seizure, stroke-like episode, and optic atrophy. Target sequencing of whole mtDNA and 73 nuclear genes identified compound heterozygous mutations p.R205X and p.L255P in the FASTKD2. Each of his unaffected parents has one of the two mutations, and both mutations were not found in 302 controls. FASTKD2 encodes a FAS-activated serine-threonine (FAST) kinase domain 2 which locates in the mitochondrial inner compartment. A FASTKD2 nonsense mutation was once reported as the cause of a recessive infantile mitochondrial encephalomyopathy. The present case showed relatively mild symptoms with a late onset age, compared to a previous patient with FASTKD2 mutation, implicating an inter-allelic clinical heterogeneity. Because this study is the second report of an autosomal recessive mitochondrial encephalomyopathy patient with a FASTKD2 mutation, it will extend the phenotypic spectrum of the FASTKD2 mutation. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Andersson, E I; Rajala, H L M; Eldfors, S; Ellonen, P; Olson, T; Jerez, A; Clemente, M J; Kallioniemi, O; Porkka, K; Heckman, C; Loughran, T P Jr; Maciejewski, J P; Mustjoki, S
2013-01-01
T-cell large granular lymphocytic (T-LGL) leukemia is a clonal disease characterized by the expansion of mature CD3+CD8+ cytotoxic T cells. It is often associated with autoimmune disorders and immune-mediated cytopenias. Our recent findings suggest that up to 40% of T-LGL patients harbor mutations in the STAT3 gene, whereas STAT5 mutations are present in 2% of patients. In order to identify putative disease-causing genetic alterations in the remaining T-LGL patients, we performed exome sequencing from three STAT mutation-negative patients and validated the findings in 113 large granular lymphocytic (LGL) leukemia patients. On average, 11 CD8+ LGL leukemia cell-specific high-confidence nonsynonymous somatic mutations were discovered in each patient. Interestingly, all patients had at least one mutation that affects either directly the STAT3-pathway (such as PTPRT) or T-cell activation (BCL11B, SLIT2 and NRP1). In all three patients, the STAT3 pathway was activated when studied by RNA expression or pSTAT3 analysis. Screening of the remaining 113 LGL leukemia patients did not reveal additional patients with same mutations. These novel mutations are potentially biologically relevant and represent rare genetic triggers for T-LGL leukemia, and are associated with similar disease phenotype as observed in patients with mutations in the STAT3 gene
LENUS (Irish Health Repository)
Toomey, Sinead
2017-07-27
The Cancer Genome Atlas analysis revealed that somatic EGFR, receptor tyrosine-protein kinase erbB-2 (ERBB2), Erb-B2 receptor tyrosine kinase 3 (ERBB3) and Erb-B2 receptor tyrosine kinase 4 (ERBB4) gene mutations (ERBB family mutations) occur alone or co-occur with somatic mutations in the gene encoding the phosphatidylinositol 3-kinase (PI3K) catalytic subunit (PIK3CA) in 19% of human epidermal growth factor receptor 2 (HER2)-positive breast cancers. Because ERBB family mutations can activate the PI3K\\/AKT pathway and likely have similar canonical signalling effects to PI3K pathway mutations, we investigated their combined impact on response to neoadjuvant HER2-targeted therapies.
Activating HER2 mutations in HER2 gene amplification negative breast cancer.
Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J
2013-02-01
Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.
Dynamic Allostery Mediated by a Conserved Tryptophan in the Tec Family Kinases.
Directory of Open Access Journals (Sweden)
Nikita Chopra
2016-03-01
Full Text Available Bruton's tyrosine kinase (Btk is a Tec family non-receptor tyrosine kinase that plays a critical role in immune signaling and is associated with the immunological disorder X-linked agammaglobulinemia (XLA. Our previous findings showed that the Tec kinases are allosterically activated by the adjacent N-terminal linker. A single tryptophan residue in the N-terminal 17-residue linker mediates allosteric activation, and its mutation to alanine leads to the complete loss of activity. Guided by hydrogen/deuterium exchange mass spectrometry results, we have employed Molecular Dynamics simulations, Principal Component Analysis, Community Analysis and measures of node centrality to understand the details of how a single tryptophan mediates allostery in Btk. A specific tryptophan side chain rotamer promotes the functional dynamic allostery by inducing coordinated motions that spread across the kinase domain. Either a shift in the rotamer population, or a loss of the tryptophan side chain by mutation, drastically changes the coordinated motions and dynamically isolates catalytically important regions of the kinase domain. This work also identifies a new set of residues in the Btk kinase domain with high node centrality values indicating their importance in transmission of dynamics essential for kinase activation. Structurally, these node residues appear in both lobes of the kinase domain. In the N-lobe, high centrality residues wrap around the ATP binding pocket connecting previously described Catalytic-spine residues. In the C-lobe, two high centrality node residues connect the base of the R- and C-spines on the αF-helix. We suggest that the bridging residues that connect the catalytic and regulatory architecture within the kinase domain may be a crucial element in transmitting information about regulatory spine assembly to the catalytic machinery of the catalytic spine and active site.
Identification of a novel mutation in WFS1 in a family affected by low-frequency hearing impairment
Energy Technology Data Exchange (ETDEWEB)
Kunz, Juergen; Marquez-Klaka, Ben; Uebe, Steffen; Volz-Peters, Anja; Berger, Roswitha; Rausch, Peter
2003-04-09
Previously we confirmed linkage of autosomal dominantly inherited low-frequency sensorineural hearing impairment (LFSNHI) in a German family to the genetic locus DFNA6/DFNA14 on chromosome 4p16.3 close to the markers D4S432 and D4S431. Analysis of data from the Human Genome Project, showed that WFS1 is located in this region. Mutations in WFS1 are known to be responsible for Wolfram syndrome (DIDMOAD, MIM no. 606201), which follows an autosomal recessive trait. Studies in low-frequency hearing loss families showed that mutations in WFS1 were responsible for the phenotype. In all affected family members analysed, we detected a missense mutation in WFS1 (K705N) and therefore confirm the finding that the majority of mutations responsible for LFSNHI are missense mutations which localise to the C-terminal domain of the protein.
Identification of a novel mutation in WFS1 in a family affected by low-frequency hearing impairment
International Nuclear Information System (INIS)
Kunz, Juergen; Marquez-Klaka, Ben; Uebe, Steffen; Volz-Peters, Anja; Berger, Roswitha; Rausch, Peter
2003-01-01
Previously we confirmed linkage of autosomal dominantly inherited low-frequency sensorineural hearing impairment (LFSNHI) in a German family to the genetic locus DFNA6/DFNA14 on chromosome 4p16.3 close to the markers D4S432 and D4S431. Analysis of data from the Human Genome Project, showed that WFS1 is located in this region. Mutations in WFS1 are known to be responsible for Wolfram syndrome (DIDMOAD, MIM no. 606201), which follows an autosomal recessive trait. Studies in low-frequency hearing loss families showed that mutations in WFS1 were responsible for the phenotype. In all affected family members analysed, we detected a missense mutation in WFS1 (K705N) and therefore confirm the finding that the majority of mutations responsible for LFSNHI are missense mutations which localise to the C-terminal domain of the protein
Hsiao, Hui-Hua; Yang, Ming-Yu; Liu, Yi-Chang; Lee, Ching-Ping; Yang, Wen-Chi; Liu, Ta-Chih; Chang, Chao-Sung; Lin, Sheng-Fung
2007-11-01
The Janus kinase 2 mutation, JAK2 (V617F), and megakaryocytic mutations, MPL (W515L/K), have been identified and correlated with a subtype of essential thrombocythemia (ET) patients. We investigated the frequency of mutations in ET patients and analyzed the relationship with their clinical features. Fifty-three ET patients were enrolled in the study. The amplification refractory mutation system was applied for the mutation survey of the JAK2V617F, while the polymerase chain reaction with sequencing was used for the mutation survey of MPLW515L/K. Thirty-five (66%) patients harboring the JAK2 (V617F) mutation, including 3 homozygous and 32 heterozygous changes, but no MPLW515L/K mutation, were found. During follow-up, 17 (32.1%) patients suffered from documented thrombotic events, with 15 having JAK2V617F mutations. Statistical analysis showed that patients with the JAK2 mutation had significantly higher leukocytes, hemoglobin level, and thrombotic event (p = 0.043, p = 0.001, and p = 0.029, respectively). Thrombotic events were also significantly correlated with leukocytosis and older age. The JAK2V617F mutation was noted in a certain population of ET patients and correlated with leukocytosis, high hemoglobin level, and thrombosis. Therefore, detection of the JAK2V617F mutation can affect not only the diagnosis, but also the management of ET patients.
Directory of Open Access Journals (Sweden)
Sabine Fillinger
Full Text Available Dicarboximides and phenylpyrroles are commonly used fungicides against plant pathogenic ascomycetes. Although their effect on fungal osmosensing systems has been shown in many studies, their modes-of-action still remain unclear. Laboratory- or field-mutants of fungi resistant to either or both fungicide categories generally harbour point mutations in the sensor histidine kinase of the osmotic signal transduction cascade.In the present study we compared the mechanisms of resistance to the dicarboximide iprodione and to pyrrolnitrin, a structural analogue of phenylpyrrole fungicides, in Botrytis cinerea. Pyrrolnitrin-induced mutants and iprodione-induced mutants of B. cinerea were produced in vitro. For the pyrrolnitrin-induced mutants, a high level of resistance to pyrrolnitrin was associated with a high level of resistance to iprodione. For the iprodione-induced mutants, the high level of resistance to iprodione generated variable levels of resistance to pyrrolnitrin and phenylpyrroles. All selected mutants showed hypersensitivity to high osmolarity and regardless of their resistance levels to phenylpyrroles, they showed strongly reduced fitness parameters (sporulation, mycelial growth, aggressiveness on plants compared to the parental phenotypes. Most of the mutants presented modifications in the osmosensing class III histidine kinase affecting the HAMP domains. Site directed mutagenesis of the bos1 gene was applied to validate eight of the identified mutations. Structure modelling of the HAMP domains revealed that the replacements of hydrophobic residues within the HAMP domains generally affected their helical structure, probably abolishing signal transduction. Comparing mutant phenotypes to the HAMP structures, our study suggests that mutations perturbing helical structures of HAMP2-4 abolish signal-transduction leading to loss-of-function phenotype. The mutation of residues E529, M427, and T581, without consequences on HAMP structure
Cassol, Clarissa A; Guo, Miao; Ezzat, Shereen; Asa, Sylvia L
2010-12-01
Activating mutations of GNAq protein in a hotspot at codon 209 have been recently described in uveal melanomas. Since these neoplasms share with thyroid carcinomas a high frequency of MAP kinase pathway-activating mutations, we hypothesized whether GNAq mutations could also play a role in the development of thyroid carcinomas. Additionally, activating mutations of another subtype of G protein (GNAS1) are frequently found in hyperfunctioning thyroid adenomas, making it plausible that GNAq-activating mutations could also be found in some of these nodules. To investigate thyroid papillary carcinomas and thyroid hyperfunctioning nodules for GNAq mutations in exon 5, codon 209, a total of 32 RET/PTC, BRAF, and RAS negative thyroid papillary carcinomas and 13 hyperfunctioning thyroid nodules were evaluated. No mutations were identified. Although plausible, GNAq mutations seem not to play an important role in the development of thyroid follicular neoplasms, either benign hyperfunctioning nodules or malignant papillary carcinomas. Our results are in accordance with the literature, in which no GNAq hotspot mutations were found in thyroid papillary carcinomas, as well as in an extensive panel of other tumors. The molecular basis for MAP-kinase pathway activation in RET-PTC/BRAF/RAS negative thyroid carcinomas remains to be determined.
Allogeneic stem cell transplantation for patients harboring T315I BCR-ABL mutated leukemias
DEFF Research Database (Denmark)
Nicolini, Franck Emmanuel; Basak, Grzegorz W; Soverini, Simona
2011-01-01
T315I(+) Philadelphia chromosome-positive leukemias are inherently resistant to all licensed tyrosine kinase inhibitors, and therapeutic options remain limited. We report the outcome of allogeneic stem cell transplantation in 64 patients with documented BCR-ABL(T315I) mutations. Median follow......) as unfavorable factors. We conclude that allogeneic stem cell transplantation represents a valuable therapeutic tool for eligible patients with BCR-ABL(T315I) mutation, a tool that may or may not be replaced by third-generation tyrosine kinase inhibitors....
Sprovieri, T; Conforti, F L; Fiumara, A; Mazzei, R; Ungaro, C; Citrigno, L; Muglia, M; Arena, A; Quattrone, A
2009-02-15
Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have recently been reported in patients with severe neurodevelopmental disorder characterized by early-onset seizures, infantile spasms, severe psychomotor impairment and very recently, in patients with Rett syndrome (RTT)-like phenotype. Although the involvement of CDKL5 in specific biological pathways and its neurodevelopmental role have not been completely elucidated, the CDKL5 appears to be physiologically related to the MECP2 gene. Here we report on the clinical and CDKL5 molecular investigation in a very unusual RTT case, with severe, early-neurological involvement in which we have shown in a previous report, a novel P388S MECP2 mutation [Conforti et al. (2003); Am J Med Genet A 117A: 184-187]. The patient has had severe psychomotor delay since the first month of life and infantile spasms since age 5 months. Moreover, at age 5 years the patient suddenly presented with renal failure. The severe pattern of symptoms in our patient, similar to a CDKL5 phenotype, prompted us to perform an analysis of the CDKL5, which revealed a novel missense mutation never previously described. The X-inactivation assay was non-informative. In conclusion, this report reinforces the observation that the CDKL5 phenotype overlaps with RTT and that CDKL5 analysis is recommended in patients with a seizure disorder commencing during the first months of life.
Recurrent mutations in the CDKL5 gene: genotype-phenotype relationships.
Bahi-Buisson, Nadia; Villeneuve, Nathalie; Caietta, Emilie; Jacquette, Aurélia; Maurey, Helene; Matthijs, Gert; Van Esch, Hilde; Delahaye, Andrée; Moncla, Anne; Milh, Mathieu; Zufferey, Flore; Diebold, Bertrand; Bienvenu, Thierry
2012-07-01
Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been described in epileptic encephalopathies in females with infantile spasms with features that overlap with Rett syndrome. With more than 80 reported patients, the phenotype of CDKL5-related encephalopathy is well-defined. The main features consist of seizures starting before 6 months of age, severe intellectual disability with absent speech and hand stereotypies and deceleration of head growth, which resembles Rett syndrome. However, some clinical discrepancies suggested the influence of genetics and/or environmental factors. No genotype-phenotype correlation has been defined and thus there is a need to examine individual mutations. In this study, we analyzed eight recurrent CDKL5 mutations to test whether the clinical phenotype of patients with the same mutation is similar and whether patients with specific CDKL5 mutations have a milder phenotype than those with other CDKL5 mutations. Patients bearing missense mutations in the ATP binding site such as the p.Ala40Val mutation typically walked unaided, had normocephaly, better hand use ability, and less frequent refractory epilepsy when compared to girls with other CDKL5 mutations. In contrast, patients with mutations in the kinase domain (such as p.Arg59X, p.Arg134X, p.Arg178Trp/Pro/Gln, or c.145 + 2T > C) and frameshift mutations in the C-terminal region (such as c.2635_2636delCT) had a more severe phenotype with infantile spasms, refractory epileptic encephalopathy, absolute microcephaly, and inability to walk. It is important for clinicians to have this information when such patients are diagnosed. Copyright © 2012 Wiley Periodicals, Inc.
SOCS proteins in regulation of receptor tyrosine kinase signaling
DEFF Research Database (Denmark)
Kazi, Julhash U.; Kabir, Nuzhat N.; Flores Morales, Amilcar
2014-01-01
Receptor tyrosine kinases (RTKs) are a family of cell surface receptors that play critical roles in signal transduction from extracellular stimuli. Many in this family of kinases are overexpressed or mutated in human malignancies and thus became an attractive drug target for cancer treatment....... The signaling mediated by RTKs must be tightly regulated by interacting proteins including protein-tyrosine phosphatases and ubiquitin ligases. The suppressors of cytokine signaling (SOCS) family proteins are well-known negative regulators of cytokine receptors signaling consisting of eight structurally similar...
Directory of Open Access Journals (Sweden)
Emily M. Mace
2018-03-01
Full Text Available Human natural killer (NK cells play a critical role in the control of viral infections and malignancy. Their importance in human health and disease is illustrated by severe viral infections in patients with primary immunodeficiencies that affect NK cell function and/or development. The recent identification of patients with phosphoinositide-3-kinase (PI3K-signaling pathway mutations that can cause primary immunodeficiency provides valuable insight into the role that PI3K signaling plays in human NK cell maturation and lytic function. There is a rich literature that demonstrates a requirement for PI3K in multiple key aspects of NK cell biology, including development/maturation, homing, priming, and function. Here, I briefly review these previous studies and place them in context with recent findings from the study of primary immunodeficiency patients, particularly those with hyperactivating mutations in PI3Kδ signaling.
Warren, G; McKown, R; Marin, A L; Teutonico, R
1996-08-01
We screened for mutations deleterious to the freezing tolerance of Arabidopsis thaliana (L.) Heynh. ecotype Columbia. Tolerance was assayed by the vigor and regrowth of intact plants after cold acclimation and freezing. From a chemically mutagenized population, we obtained 13 lines of mutants with highly penetrant phenotypes. In 5 of these, freezing sensitivity was attributable to chilling injury sustained during cold acclimation, but in the remaining 8 lines, the absence of injury prior to freezing suggested that they were affected specifically in the development of freezing tolerance. In backcrosses, freezing sensitivity from each line segregated as a single nuclear mutation. Complementation tests indicated that the 8 lines contained mutations in 7 different genes. The mutants' freezing sensitivity was also detectable in the leakage of electrolytes from frozen leaves. However, 1 mutant line that displayed a strong phenotype at the whole-plant level showed a relatively weak phenotype by the electrolyte leakage assay.
Energy Technology Data Exchange (ETDEWEB)
Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.; Parcels, Leslie A.; Parcels, Joshua; Karnak, David; Ryan, Caila; Liu, Na; Maybaum, Jonathan; Lawrence, Theodore S.
2016-06-01
Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3 antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.
Epigenetic Mechanisms Regulating Adaptive Responses to Targeted Kinase Inhibitors in Cancer.
Angus, Steven P; Zawistowski, Jon S; Johnson, Gary L
2018-01-06
Although targeted inhibition of oncogenic kinase drivers has achieved remarkable patient responses in many cancers, the development of resistance has remained a significant challenge. Numerous mechanisms have been identified, including the acquisition of gatekeeper mutations, activating pathway mutations, and copy number loss or gain of the driver or alternate nodes. These changes have prompted the development of kinase inhibitors with increased selectivity, use of second-line therapeutics to overcome primary resistance, and combination treatment to forestall resistance. In addition to genomic resistance mechanisms, adaptive transcriptional and signaling responses seen in tumors are gaining appreciation as alterations that lead to a phenotypic state change-often observed as an epithelial-to-mesenchymal shift or reversion to a cancer stem cell-like phenotype underpinned by remodeling of the epigenetic landscape. This epigenomic modulation driving cell state change is multifaceted and includes modulation of repressive and activating histone modifications, DNA methylation, enhancer remodeling, and noncoding RNA species. Consequently, the combination of kinase inhibitors with drugs targeting components of the transcriptional machinery and histone-modifying enzymes has shown promise in preclinical and clinical studies. Here, we review mechanisms of resistance to kinase inhibition in cancer, with special emphasis on the rewired kinome and transcriptional signaling networks and the potential vulnerabilities that may be exploited to overcome these adaptive signaling changes.
Key Clinical Features to Identify Girls with "CDKL5" Mutations
Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydee; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothee; Afenjar, Alexandra; Rio, Marlene; Heron, Delphine; Morel, Marie Ange N'Guyen; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry
2008-01-01
Mutations in the human X-linked cyclin-dependent kinase-like 5 ("CDKL5") gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of…
Directory of Open Access Journals (Sweden)
Christel Depienne
2009-02-01
Full Text Available Dravet syndrome (DS is a genetically determined epileptic encephalopathy mainly caused by de novo mutations in the SCN1A gene. Since 2003, we have performed molecular analyses in a large series of patients with DS, 27% of whom were negative for mutations or rearrangements in SCN1A. In order to identify new genes responsible for the disorder in the SCN1A-negative patients, 41 probands were screened for micro-rearrangements with Illumina high-density SNP microarrays. A hemizygous deletion on chromosome Xq22.1, encompassing the PCDH19 gene, was found in one male patient. To confirm that PCDH19 is responsible for a Dravet-like syndrome, we sequenced its coding region in 73 additional SCN1A-negative patients. Nine different point mutations (four missense and five truncating mutations were identified in 11 unrelated female patients. In addition, we demonstrated that the fibroblasts of our male patient were mosaic for the PCDH19 deletion. Patients with PCDH19 and SCN1A mutations had very similar clinical features including the association of early febrile and afebrile seizures, seizures occurring in clusters, developmental and language delays, behavioural disturbances, and cognitive regression. There were, however, slight but constant differences in the evolution of the patients, including fewer polymorphic seizures (in particular rare myoclonic jerks and atypical absences in those with PCDH19 mutations. These results suggest that PCDH19 plays a major role in epileptic encephalopathies, with a clinical spectrum overlapping that of DS. This disorder mainly affects females. The identification of an affected mosaic male strongly supports the hypothesis that cellular interference is the pathogenic mechanism.
Directory of Open Access Journals (Sweden)
Tammy M K Cheng
Full Text Available Gauging the systemic effects of non-synonymous single nucleotide polymorphisms (nsSNPs is an important topic in the pursuit of personalized medicine. However, it is a non-trivial task to understand how a change at the protein structure level eventually affects a cell's behavior. This is because complex information at both the protein and pathway level has to be integrated. Given that the idea of integrating both protein and pathway dynamics to estimate the systemic impact of missense mutations in proteins remains predominantly unexplored, we investigate the practicality of such an approach by formulating mathematical models and comparing them with experimental data to study missense mutations. We present two case studies: (1 interpreting systemic perturbation for mutations within the cell cycle control mechanisms (G2 to mitosis transition for yeast; (2 phenotypic classification of neuron-related human diseases associated with mutations within the mitogen-activated protein kinase (MAPK pathway. We show that the application of simplified mathematical models is feasible for understanding the effects of small sequence changes on cellular behavior. Furthermore, we show that the systemic impact of missense mutations can be effectively quantified as a combination of protein stability change and pathway perturbation.
Directory of Open Access Journals (Sweden)
Tadej Pajič
2012-12-01
Conclusions: It seems that the BCR-ABl1 mutations are rare in patients who do not achieve a MMR by 18 months or more or who have lost MMR. The T315I mutation detected in one patient in our cohort of CML patients indicates that the BCR-ABL1 mutation analysis could be recommended in these cases. The silent mutation detected did not lead to amino acid change, however, it is listed in major single nucleotide polymorphisms databases (SNP, rs2227985. The role of the SNP in the resistance to TKIs is not clear.
Affect of Presenilin Mutations on APP Cleavage; Insights into the Pathogenesis of FAD
Directory of Open Access Journals (Sweden)
Nuomin eLi
2016-03-01
Full Text Available Alzheimer disease (AD is characterized by progressive memory loss, reduction in cognitive functions, and damage to the brain. The β-amyloid precursor protein can be sequentially cleaved by β- secretase and γ-secretase. Mutations in the presenilin1(PS1) are the most common cause of Familial Alzheimer’s disease ( FAD. PS1 mutations can alter the activity of γ-secretase on the cleavage of the β-amyloid precursor protein, causing increased Aβ production. Previous studies show that the βAPP-C-terminal fragment is first cleaved by β-scretase, primarily generating long fragments of Aβ48 and Aβ49, followed by the stepwise cleavage of every three amino acid residues at the C terminus, resulting in Aβ48-, 45-, 42 line and Aβ49-, 46-, 43-, 40 line. Here, we used LC-MS/MS to analyze unique peptides IAT, VVIA, ITL,TVI,IVI through sequential cleavage, combined with ELISA to test the level of Aβ42 and Aβ40 for validation. The results show that most FAD mutant PS1 can alter the level of Aβ42 and Aβ40 monitored by the Aβ42/Aβ40 ratio. Among them, 6 mutants (I143T, H163P, S170F, Q223R, M233V and G384A affect the Aβ42/40 ratio through both Aβ49-40 and Aβ48-38 lines; L166P through decreasing the Aβ49-40 line, 6 mutants (I143V, M146V, G217A, E280A, L381V and L392V through increasing the Aβ48-42 line. More importantly, we found some mutations can affect the γ-secretase cleavage preference of α-CTF and β-CTF. In conclusion, we found that the FAD PS1 mutations mainly increase the generation of Aβ42 by decreasing the cleavage of Aβ42-Aβ38 and Aβ43-Aβ40.
Loss of ATM kinase activity leads to embryonic lethality in mice
DEFF Research Database (Denmark)
Daniel, J.A.; Pellegrini, M.; Filsuf, D.
2012-01-01
whether the functions of ATM are mediated solely by its kinase activity, we generated two mouse models containing single, catalytically inactivating point mutations in Atm. In this paper, we show that, in contrast to Atm-null mice, both D2899A and Q2740P mutations cause early embryonic lethality in mice......, without displaying dominant-negative interfering activity. Using conditional deletion, we find that the D2899A mutation in adult mice behaves largely similar to Atm-null cells but shows greater deficiency in homologous recombination (HR) as measured by hypersensitivity to poly (adenosine diphosphate...
Mediator kinase module and human tumorigenesis.
Clark, Alison D; Oldenbroek, Marieke; Boyer, Thomas G
2015-01-01
Mediator is a conserved multi-subunit signal processor through which regulatory informatiosn conveyed by gene-specific transcription factors is transduced to RNA Polymerase II (Pol II). In humans, MED13, MED12, CDK8 and Cyclin C (CycC) comprise a four-subunit "kinase" module that exists in variable association with a 26-subunit Mediator core. Genetic and biochemical studies have established the Mediator kinase module as a major ingress of developmental and oncogenic signaling through Mediator, and much of its function in signal-dependent gene regulation derives from its resident CDK8 kinase activity. For example, CDK8-targeted substrate phosphorylation impacts transcription factor half-life, Pol II activity and chromatin chemistry and functional status. Recent structural and biochemical studies have revealed a precise network of physical and functional subunit interactions required for proper kinase module activity. Accordingly, pathologic change in this activity through altered expression or mutation of constituent kinase module subunits can have profound consequences for altered signaling and tumor formation. Herein, we review the structural organization, biological function and oncogenic potential of the Mediator kinase module. We focus principally on tumor-associated alterations in kinase module subunits for which mechanistic relationships as opposed to strictly correlative associations are established. These considerations point to an emerging picture of the Mediator kinase module as an oncogenic unit, one in which pathogenic activation/deactivation through component change drives tumor formation through perturbation of signal-dependent gene regulation. It follows that therapeutic strategies to combat CDK8-driven tumors will involve targeted modulation of CDK8 activity or pharmacologic manipulation of dysregulated CDK8-dependent signaling pathways.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Tianjun; Commodore, Lois; Huang, Wei-Sheng; Wang, Yihan; Thomas, Mathew; Keats, Jeff; Xu, Qihong; Rivera, Victor M.; Shakespeare, William C.; Clackson, Tim; Dalgarno, David C.; Zhu, Xiaotian (ARIAD)
2012-01-20
The BCR-ABL inhibitor imatinib has revolutionized the treatment of chronic myeloid leukemia. However, drug resistance caused by kinase domain mutations has necessitated the development of new mutation-resistant inhibitors, most recently against the T315I gatekeeper residue mutation. Ponatinib (AP24534) inhibits both native and mutant BCR-ABL, including T315I, acting as a pan-BCR-ABL inhibitor. Here, we undertook a combined crystallographic and structure-activity relationship analysis on ponatinib to understand this unique profile. While the ethynyl linker is a key inhibitor functionality that interacts with the gatekeeper, virtually all other components of ponatinib play an essential role in its T315I inhibitory activity. The extensive network of optimized molecular contacts found in the DFG-out binding mode leads to high potency and renders binding less susceptible to disruption by single point mutations. The inhibitory mechanism exemplified by ponatinib may have broad relevance to designing inhibitors against other kinases with mutated gatekeeper residues.
Verkhivker, Gennady M
2016-01-01
The human protein kinome presents one of the largest protein families that orchestrate functional processes in complex cellular networks, and when perturbed, can cause various cancers. The abundance and diversity of genetic, structural, and biochemical data underlies the complexity of mechanisms by which targeted and personalized drugs can combat mutational profiles in protein kinases. Coupled with the evolution of system biology approaches, genomic and proteomic technologies are rapidly identifying and charactering novel resistance mechanisms with the goal to inform rationale design of personalized kinase drugs. Integration of experimental and computational approaches can help to bring these data into a unified conceptual framework and develop robust models for predicting the clinical drug resistance. In the current study, we employ a battery of synergistic computational approaches that integrate genetic, evolutionary, biochemical, and structural data to characterize the effect of cancer mutations in protein kinases. We provide a detailed structural classification and analysis of genetic signatures associated with oncogenic mutations. By integrating genetic and structural data, we employ network modeling to dissect mechanisms of kinase drug sensitivities to oncogenic EGFR mutations. Using biophysical simulations and analysis of protein structure networks, we show that conformational-specific drug binding of Lapatinib may elicit resistant mutations in the EGFR kinase that are linked with the ligand-mediated changes in the residue interaction networks and global network properties of key residues that are responsible for structural stability of specific functional states. A strong network dependency on high centrality residues in the conformation-specific Lapatinib-EGFR complex may explain vulnerability of drug binding to a broad spectrum of mutations and the emergence of drug resistance. Our study offers a systems-based perspective on drug design by unravelling
Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing
International Nuclear Information System (INIS)
Akeson, A.L.; Wiginton, D.A.; States, C.J.; Perme, C.M.; Dusing, M.R.; Hutton, J.J.
1987-01-01
Adenosine deaminase deficiency is one cause of the genetic disease severe combined immunodeficiency. To identify mutations responsible for ADA deficiency, the authors synthesized cDNAs to ADA mRNAs from two cell lines, GM2756 and GM2825A, derived from ADA-deficient immunodeficient patients. Sequence analysis of GM2756 cDNA clones revealed a different point mutation in each allele that causes amino acid changes of alanine to valine and arginine to histidine. One allele of GM2825A also has a point mutation that causes an alanine to valine substitution. The other allele of GM2825A was found to produce an mRNA in which exon 4 had been spliced out but had no other detrimental mutations. S1 nuclease mapping of GM2825A mRNA showed equal abundance of the full-length ADA mRNA and the ADA mRNA that was missing exon 4. Several of the ADA cDNA clones extended 5' of the major initiation start site, indicating multiple start sites for ADA transcription. The point mutations in GM2756 and GM2825A and the absence of exon 4 in GM2825A appear to be directly responsible for the ADA deficiency. Comparison of a number of normal and mutant ADA cDNA sequences showed a number of changes in the third base of codons. These change do not affect the amino acid sequence. Analyses of ADA cDNAs from different cell lines detected aberrant RNA species that either included intron 7 or excluded exon 7. Their presence is a result of aberrant splicing of pre-mRNAs and is not related to mutations that cause ADA deficiency
The Development of Ataxia Telangiectasia Mutated Kinase Inhibitors
Czech Academy of Sciences Publication Activity Database
Andrs, M.; Kobarecny, J.; Nepovimova, E.; Jun, D.; Hodný, Zdeněk; Moravcová, Simona; Hanzlíková, Hana; Kuca, K.
2014-01-01
Roč. 14, č. 10 (2014), s. 805-811 ISSN 1389-5575 R&D Projects: GA MŠk(CZ) CZ.1.07/2.3.00/30.0044 Grant - others:MH CZ - DRO (University Hospital Hradec Kralove(CZ) 00179906 Institutional support: RVO:68378050 Keywords : Ataxia telangiectasia mutated * cancer * chemosensitization * DNA damage response Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.903, year: 2014
Directory of Open Access Journals (Sweden)
Yu S
2017-09-01
Full Text Available Su Yu,1,2 Yang Zhang,1 Yunjian Pan,1 Chao Cheng,1,3 Yihua Sun,1,3 Haiquan Chen1–4 1Department of Thoracic Surgery, Fudan University Shanghai Cancer Center, Shanghai, China; 2Cancer Research Center, Fudan University Shanghai Cancer Center, Shanghai, China; 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, China; 4Institutes of Biomedical Sciences, Fudan University, Shanghai, China Purpose: To identify novel oncogenic mutations in non-small cell lung cancer patient specimens that lack mutations in known targetable genes (“pan-negative” patients.Methods: Comprehensive mutational analyses were performed on 1,356 lung adenocarcinoma specimens. In this cohort of patients, common lung cancer oncogenic driver mutations were detected in the epidermal growth factor receptor (EGFR kinase domain, the human epidermal growth factor receptor 2 kinase domain, as well as the KRAS, BRAF, ALK, ROS1 and RET genes. A sub-cohort of pan-negative patient specimens was assayed for mutations in the EGFR extracellular domain (ECD. Additionally, EGFR mutant NIH-3T3 stable cell lines were constructed and assessed for protein content, anchorage-independent growth, and tumor formation in xenograft models to identify oncogenic mutations. BaF3 lymphocytes were also used to test sensitivities of the mutations to tyrosine kinase inhibitors.Results: In pan-negative lung adenocarcinoma cases, a novel oncogenic EGFR ECD mutation was identified (M277E. EGFR M277E mutations encoded oncoproteins that transformed NIH-3T3 cells to grow in the absence of exogenous epidermal growth factor. Transformation was further evidenced by anchorage-independent growth and tumor formation in immunocompromised xenograft mouse models. Finally, as seen in the canonical EGFR L858R mutation, the M277E mutation conferred sensitivity to both erlotinib and cetuximab in BaF3 cell lines and to erlotinib in xenograft models.Conclusion: Here, a new EGFR driver mutation, M277E
A New Generalizable Test for Detection of Mutations Affecting Tn10 Transposition
Huisman, Olivier; Kleckner, Nancy
1987-01-01
We describe here a new rapid screen that allows easy detection of transposon or host mutations that affect Tn10 transposition in Escherichia coli. This test involves a new Tn10 derivative called the "mini-lacZ-kanR fusion hopper" or mini-Tn10-LK for short. This element does not direct expression of β-galactosidase when present at its original starting location on a suitably engineered plasmid or phage genome because it lacks appropriate transcription and translation start signals. However, t...
Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J
2014-07-01
Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts
Janus kinase inhibitors: jackpot or potluck?
Directory of Open Access Journals (Sweden)
Pavithran Keechilat
2012-06-01
Full Text Available The reports of a unique mutation in the Janus kinase-2 gene (JAK2 in polycythemia vera by several independent groups in 2005 quickly spurred the development of the Janus kinase inhibitors. In one of the great victories of translational research in recent times, the first smallmolecule Janus kinase inhibitor ruxolitinib entered a phase I trial in 2007. With the approval of ruxolitinib by the US Federal Drug Administration in November 2011 for high-risk and intermediate-2 risk myelofibrosis, a change in paradigm has occurred in the management of a subset of myeloproliferative neoplasms (MPN: primary myelofibrosis, post-polycythemia vera myelofibrosis, and post-essential thrombocythemia myelofibrosis. Whereas the current evidence for ruxolitinib only covers high-risk and intermediate-2 risk myelofibrosis, inhibitors with greater potency are likely to offer better disease control and survival advantage in patients belonging to these categories, and possibly to the low-risk and intermediate-1 risk categories of MPN as well. But use of the Janus kinase inhibitors also probably has certain disadvantages, such as toxicity, resistance, withdrawal phenomenon, non-reversal of histology, and an implausible goal of disease clone eradication, some of which could offset the gains. In spite of this, Janus kinase inhibitors are here to stay, and for use in more than just myeloproliferative neoplasms.
Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree
2018-03-09
The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.
Directory of Open Access Journals (Sweden)
Marina Kemmerer
Full Text Available AMP-activated protein kinase (AMPK maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO. The transcription factor peroxisome proliferator-activated receptor δ (PPARδ also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload.
Directory of Open Access Journals (Sweden)
Debora Bogani
2009-09-01
Full Text Available Sex determination in mammals is controlled by the presence or absence of the Y-linked gene SRY. In the developing male (XY gonad, sex-determining region of the Y (SRY protein acts to up-regulate expression of the related gene, SOX9, a transcriptional regulator that in turn initiates a downstream pathway of testis development, whilst also suppressing ovary development. Despite the requirement for a number of transcription factors and secreted signalling molecules in sex determination, intracellular signalling components functioning in this process have not been defined. Here we report a role for the phylogenetically ancient mitogen-activated protein kinase (MAPK signalling pathway in mouse sex determination. Using a forward genetic screen, we identified the recessive boygirl (byg mutation. On the C57BL/6J background, embryos homozygous for byg exhibit consistent XY gonadal sex reversal. The byg mutation is an A to T transversion causing a premature stop codon in the gene encoding MAP3K4 (also known as MEKK4, a mitogen-activated protein kinase kinase kinase. Analysis of XY byg/byg gonads at 11.5 d post coitum reveals a growth deficit and a failure to support mesonephric cell migration, both early cellular processes normally associated with testis development. Expression analysis of mutant XY gonads at the same stage also reveals a dramatic reduction in Sox9 and, crucially, Sry at the transcript and protein levels. Moreover, we describe experiments showing the presence of activated MKK4, a direct target of MAP3K4, and activated p38 in the coelomic region of the XY gonad at 11.5 d post coitum, establishing a link between MAPK signalling in proliferating gonadal somatic cells and regulation of Sry expression. Finally, we provide evidence that haploinsufficiency for Map3k4 accounts for T-associated sex reversal (Tas. These data demonstrate that MAP3K4-dependent signalling events are required for normal expression of Sry during testis development, and
Bogani, Debora; Siggers, Pam; Brixey, Rachel; Warr, Nick; Beddow, Sarah; Edwards, Jessica; Williams, Debbie; Wilhelm, Dagmar; Koopman, Peter; Flavell, Richard A.; Chi, Hongbo; Ostrer, Harry; Wells, Sara; Cheeseman, Michael; Greenfield, Andy
2009-01-01
Sex determination in mammals is controlled by the presence or absence of the Y-linked gene SRY. In the developing male (XY) gonad, sex-determining region of the Y (SRY) protein acts to up-regulate expression of the related gene, SOX9, a transcriptional regulator that in turn initiates a downstream pathway of testis development, whilst also suppressing ovary development. Despite the requirement for a number of transcription factors and secreted signalling molecules in sex determination, intracellular signalling components functioning in this process have not been defined. Here we report a role for the phylogenetically ancient mitogen-activated protein kinase (MAPK) signalling pathway in mouse sex determination. Using a forward genetic screen, we identified the recessive boygirl (byg) mutation. On the C57BL/6J background, embryos homozygous for byg exhibit consistent XY gonadal sex reversal. The byg mutation is an A to T transversion causing a premature stop codon in the gene encoding MAP3K4 (also known as MEKK4), a mitogen-activated protein kinase kinase kinase. Analysis of XY byg/byg gonads at 11.5 d post coitum reveals a growth deficit and a failure to support mesonephric cell migration, both early cellular processes normally associated with testis development. Expression analysis of mutant XY gonads at the same stage also reveals a dramatic reduction in Sox9 and, crucially, Sry at the transcript and protein levels. Moreover, we describe experiments showing the presence of activated MKK4, a direct target of MAP3K4, and activated p38 in the coelomic region of the XY gonad at 11.5 d post coitum, establishing a link between MAPK signalling in proliferating gonadal somatic cells and regulation of Sry expression. Finally, we provide evidence that haploinsufficiency for Map3k4 accounts for T-associated sex reversal (Tas). These data demonstrate that MAP3K4-dependent signalling events are required for normal expression of Sry during testis development, and create a novel
Loss of thymidine kinase 2 alters neuronal bioenergetics and leads to neurodegeneration.
Bartesaghi, Stefano; Betts-Henderson, Joanne; Cain, Kelvin; Dinsdale, David; Zhou, Xiaoshan; Karlsson, Anna; Salomoni, Paolo; Nicotera, Pierluigi
2010-05-01
Mutations of thymidine kinase 2 (TK2), an essential component of the mitochondrial nucleotide salvage pathway, can give rise to mitochondrial DNA (mtDNA) depletion syndromes (MDS). These clinically heterogeneous disorders are characterized by severe reduction in mtDNA copy number in affected tissues and are associated with progressive myopathy, hepatopathy and/or encephalopathy, depending in part on the underlying nuclear genetic defect. Mutations of TK2 have previously been associated with an isolated myopathic form of MDS (OMIM 609560). However, more recently, neurological phenotypes have been demonstrated in patients carrying TK2 mutations, thus suggesting that loss of TK2 results in neuronal dysfunction. Here, we directly address the role of TK2 in neuronal homeostasis using a knockout mouse model. We demonstrate that in vivo loss of TK2 activity leads to a severe ataxic phenotype, accompanied by reduced mtDNA copy number and decreased steady-state levels of electron transport chain proteins in the brain. In TK2-deficient cerebellar neurons, these abnormalities are associated with impaired mitochondrial bioenergetic function, aberrant mitochondrial ultrastructure and degeneration of selected neuronal types. Overall, our findings demonstrate that TK2 deficiency leads to neuronal dysfunction in vivo, and have important implications for understanding the mechanisms of neurological impairment in MDS.
Zuidervaart, W; van Nieuwpoort, F; Stark, M; Dijkman, R; Packer, L; Borgstein, A-M; Pavey, S; van der Velden, P; Out, C; Jager, M J; Hayward, N K; Gruis, N A
2005-06-06
In contrast to cutaneous melanoma, there is no evidence that BRAF mutations are involved in the activation of the mitogen-activated protein kinase (MAPK) pathway in uveal melanoma, although there is increasing evidence that this pathway is activated frequently in the latter tumours. In this study, we performed mutation analysis of the RAS and BRAF genes in a panel of 11 uveal melanoma cell lines and 19 primary uveal melanoma tumours. In addition, Western blot and immunohistochemical analyses were performed on downstream members of the MAPK pathway in order to assess the contribution of each of these components. No mutations were found in any of the three RAS gene family members and only one cell line carried a BRAF mutation (V599E). Despite this, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK), ERK and ELK were constitutively activated in all samples. These data suggest that activation of the MAPK pathway is commonly involved in the development of uveal melanoma, but occurs through a mechanism different to that of cutaneous melanoma.
Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.
Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca
2012-10-01
The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.
Somatic activating ARAF mutations in Langerhans cell histiocytosis
Nelson, David S.; Quispel, Willemijn; Badalian-Very, Gayane; van Halteren, Astrid G. S.; van den Bos, Cor; Bovée, Judith V. M. G.; Tian, Sara Y.; van Hummelen, Paul; Ducar, Matthew; MacConaill, Laura E.; Egeler, R. Maarten; Rollins, Barrett J.
2014-01-01
The extracellular signal-regulated kinase (ERK) signaling pathway is activated in Langerhans cell histiocytosis (LCH) histiocytes, but only 60% of cases carry somatic activating mutations of BRAF. To identify other genetic causes of ERK pathway activation, we performed whole exome sequencing on
ATM (ataxia-telangiectasia mutated) abnormality and diseases
International Nuclear Information System (INIS)
Takagi, Masatoshi; Nakata, Shinichiro; Mizutani, Shuki
2007-01-01
Ataxia-Telangiectasia (A-T) is an autosomal recessive inherited disease due to mutation of ATM gene on chromosome 11q22.3, with major symptoms of ataxia, telangiectasia, immunodeficiency and frequent complication of cancer, and the cells have characters of chromosomal break, high sensitivity to radiation and inappropriate continuation of DNA synthesis after radiation. This review describes past and present studies of ATM functions with clinical features in the following order: Clinical symptoms and epidemiology; ATM gene mutation in A-T patients, mainly by frame-shift (80-90%); ATM, whose gene consisted from 66 exons (150 kb), functions in phosphoinositide-3-kinase related kinase family which protecting cells from stress and integrating their system, at response to DNA double strand break, and in the cell cycle checkpoints at G1/S, S and G2/M phases; ATM nonsense/missense mutations in embryonic cells leading to carcinogenesis and role of ATM in the suppression of carcinogenesis in somatic cells; Chromosomal translocation which relating to carcinogenesis, by functional defect of ATM; and Other functions of ATM in neuronal growth, immunodeficiency, carbohydrate and lipid metabolism, early senescence, and virus infection. ATM is thus an essential molecule to maintain growth and homeostasis. (T.I.)
Ezquerra-Inchausti, Maitane; Barandika, Olatz; Anasagasti, Ander; Irigoyen, Cristina; López de Munain, Adolfo; Ruiz-Ederra, Javier
2017-01-01
Retinitis pigmentosa is the most frequent group of inherited retinal dystrophies. It is highly heterogeneous, with more than 80 disease-causing genes 27 of which are known to cause autosomal dominant RP (adRP), having been identified. In this study a total of 29 index cases were ascertained based on a family tree compatible with adRP. A custom panel of 31 adRP genes was analysed by targeted next-generation sequencing using the Ion PGM platform in combination with Sanger sequencing. This allowed us to detect putative disease-causing mutations in 14 out of the 29 (48.28%) families analysed. Remarkably, around 38% of all adRP cases analysed showed mutations affecting the splicing process, mainly due to mutations in genes coding for spliceosome factors (SNRNP200 and PRPF8) but also due to splice-site mutations in RHO. Twelve of the 14 mutations found had been reported previously and two were novel mutations found in PRPF8 in two unrelated patients. In conclusion, our results will lead to more accurate genetic counselling and will contribute to a better characterisation of the disease. In addition, they may have a therapeutic impact in the future given the large number of studies currently underway based on targeted RNA splicing for therapeutic purposes. PMID:28045043
Unconventional functions of mitotic kinases in kidney tumourigenesis
Directory of Open Access Journals (Sweden)
Pauline eHascoet
2015-10-01
Full Text Available Human tumours exhibit a variety of genetic alterations, including point mutations, translocations, gene amplifications and deletions, as well as aneuploid chromosome numbers. For carcinomas, aneuploidy is associated with poor patient outcome for a large variety of tumour types, including breast, colon and renal cell carcinoma. The Renal cell cancer (RCC is a heterogeneous carcinoma consisting of different histologic types. The clear renal cell carcinoma (ccRCC is the most common subtype and represents 85 % of the RCC. Central to the biology of the ccRCC is the loss of function of the Von Hippel Lindau gene but is also associated with genetic instability that could be caused by abrogation of the cell cycle mitotic spindle checkpoint and may involve the Aurora kinases, which regulate centrosome maturation. Aneuploidy can also result from the loss of cell-cell adhesion and apical-basal cell polarity that also may be regulated by the mitotic kinases (Plk1, CK2, DLCK1 and Aurora kinases. In this review, we describe the non mitotic unconventional functions of these kinases in renal tumourigenesis.
Directory of Open Access Journals (Sweden)
Sakiho Ueda
2015-03-01
Full Text Available Hereditary diffuse leukoencephalopathy with spheroids (HDLS is an autosomal dominant white matter disease that causes adult-onset cognitive impairment. The clinical manifestations are a variable combination of personality and behavioral changes, cognitive decline, parkinsonism, spasticity, and epilepsy. In 2012, mutations in the gene encoding colony stimulating factor 1 receptor (CSF1R were identified as the cause of HDLS. As the numbers of reported mutations are limited, the understanding of whole pathogenesis needs accumulation of disease-causing mutations with detailed clinical descriptions. We describe a Japanese family with autosomal dominant adult-onset cognitive impairment and characteristic white matter lesions. Genetic testing revealed a novel p.A792D mutation in the tyrosine kinase domain of CSF1R in two affected family members. The symptom profile of the present cases mostly matched the previously reported cases, with the notable exceptions of late-onset and long disease duration.
Musi, Elgilda; Ambrosini, Grazia; de Stanchina, Elisa; Schwartz, Gary K.
2014-01-01
G-protein mutations are one of the most common mutations occurring in uveal melanoma activating the protein kinase C (PKC)/mitogen-activated protein kinase (MAPK) and phosphoinositide 3-Kinase (PI3K)/AKT pathways. In this study, we described the effect of dual pathway inhibition in uveal melanoma harboring GNAQ and GNA11 mutations via PKC inhibition with AEB071 (Sotrastaurin) and PI3k/AKT inhibition with BYL719, a selective PI3Kα inhibitor. Growth inhibition was observed in GNAQ/GNA11 mutant cells with AEB071 versus no activity in WT cells. In the GNAQ-mutant cells, AEB071 decreased phosphorylation of MARCKS, a substrate of PKC, along with ERK1/2 and ribosomal S6, but persistent AKT activation was present. BYL719 had minimal anti-proliferative activity in all uveal melanoma cell lines, and inhibited phosphorylation of AKT in most cell lines. In the GNA11 mutant cell line, similar effects were observed with ERK1/2 inhibition, mostly inhibited by BYL719. With the combination treatment, both GNAQ and GNA11 mutant cell lines showed synergistic inhibition of cell proliferation and apoptotic cell death. In vivo studies correlated with in vitro findings showing reduced xenograft tumor growth with the combination therapy in a GNAQ mutant model. These findings suggest a new therapy treatment option for G-protein mutant uveal melanoma with a focus on specific targeting of multiple downstream pathways as part of combination therapy. PMID:24563540
GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation
Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip
2016-01-01
Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745
de Brouwer, Sara; de Preter, Katleen; Kumps, Candy; Zabrocki, Piotr; Porcu, Michaël; Westerhout, Ellen M.; Lakeman, Arjan; Vandesompele, Jo; Hoebeeck, Jasmien; van Maerken, Tom; de Paepe, Anne; Laureys, Geneviève; Schulte, Johannes H.; Schramm, Alexander; van den Broecke, Caroline; Vermeulen, Joëlle; van Roy, Nadine; Beiske, Klaus; Renard, Marleen; Noguera, Rosa; Delattre, Olivier; Janoueix-Lerosey, Isabelle; Kogner, Per; Martinsson, Tommy; Nakagawara, Akira; Ohira, Miki; Caron, Huib N.; Eggert, Angelika; Cools, Jan; Versteeg, Rogier; Speleman, Frank
2010-01-01
Purpose: Activating mutations of the anaplastic lymphoma kinase (ALK) were recently described in neuroblastoma. We carried out a meta-analysis of 709 neuroblastoma tumors to determine their frequency and mutation spectrum in relation to genomic and clinical parameters, and studied the prognostic
A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.
Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio
2012-09-01
Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.
Akten, Bikem; Tangredi, Michelle M.; Jauch, Eike; Roberts, Mary A.; Ng, Fanny; Raabe, Thomas; Jackson, F. Rob
2009-01-01
There is a universal requirement for post-translational regulatory mechanisms in circadian clock systems. Previous work in Drosophila has identified several kinases, phosphatases and an E3 ligase that are critical for determining the nuclear translocation and/or stability of clock proteins. The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. In mammals, RSK1 is a light- and clock-regulated kinase known to be activated by the MAPK pathway, but there is no direct evidence that it functions as a component of the circadian system. Here, we show that Drosophila S6KII RNA displays rhythms in abundance, indicative of circadian control. Importantly, an S6KII null mutant exhibits a short-period circadian phenotype that can be rescued by expression of the wild-type gene in clock neurons, indicating a role for S6KII in the molecular oscillator. Peak PER clock protein expression is elevated in the mutant, indicative of enhanced stability, whereas per mRNA level is decreased, consistent with enhanced feedback repression. Gene reporter assays show that decreased S6KII is associated with increased PER repression. Surprisingly, we demonstrate a physical interaction between S6KII and the Casein Kinase 2 regulatory subunit (CK2β), suggesting a functional relationship between the two kinases. In support of such a relationship, there are genetic interactions between S6KII and CK2 mutations, in vivo, which indicate that CK2 activity is required for S6KII action. We propose that the two kinases cooperate within clock neurons to fine-tune circadian period, improving the precision of the clock mechanism. PMID:19144847
Biancalana, V.; Scheidecker, S.; Miguet, M.; Laquerriere, A.; Romero, N.B.; Stojkovic, T.; Neto, O. Abath; Mercier, S.; Voermans, N.C.; Tanner, L.; Rogers, C.; Ollagnon-Roman, E.; Roper, H.; Boutte, C.; Ben-Shachar, S.; Lornage, X.; Vasli, N.; Schaefer, E.; Laforet, P.; Pouget, J.; Moerman, A.; Pasquier, L.; Marcorelle, P.; Magot, A.; Kusters, B.; Streichenberger, N.; Tranchant, C.; Dondaine, N.; Schneider, R.; Gasnier, C.; Calmels, N.; Kremer, V.; Nguyen, K. Van; Perrier, J.; Kamsteeg, E.J.; Carlier, P.; Carlier, R.Y.; Thompson, J.; Boland, A.; Deleuze, J.F.; Fardeau, M.; Zanoteli, E.; Eymard, B.; Laporte, J.
2017-01-01
X-linked myotubular myopathy (XLMTM), a severe congenital myopathy, is caused by mutations in the MTM1 gene located on the X chromosome. A majority of affected males die in the early postnatal period, whereas female carriers are believed to be usually asymptomatic. Nevertheless, several affected
Directory of Open Access Journals (Sweden)
Cristian Miere
2016-03-01
Full Text Available The KCL018 human embryonic stem cell line was derived from an embryo donated for research that carried an autosomal dominant mutation affecting one allele of the DMPK gene encoding the dystrophia myotonica protein kinase (2200 trinucleotide repeats; 14 for the normal allele. The ICM was isolated using laser microsurgery and plated on γ-irradiated human foreskin fibroblasts. Both the derivation and cell line propagation were performed in an animal product-free environment. Pluripotent state and differentiation potential were confirmed by in vitro assays.
Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat
2008-05-01
Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.
Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions.
Groveman, Bradley R; Xue, Sheng; Marin, Vedrana; Xu, Jindong; Ali, Mohammad K; Bienkiewicz, Ewa A; Yu, Xian-Min
2011-02-01
Previous studies demonstrated that intra-domain interactions between Src family kinases (SFKs), stabilized by binding of the phosphorylated C-terminus to the SH2 domain and/or binding of the SH2 kinase linker to the SH3 domain, lock the molecules in a closed conformation, disrupt the kinase active site, and inactivate SFKs. Here we report that the up-regulation of N-methyl-D-aspartate receptors (NMDARs) induced by expression of constitutively active neuronal Src (n-Src), in which the C-terminus tyrosine is mutated to phenylalanine (n-Src/Y535F), is significantly reduced by dysfunctions of the SH2 and/or SH3 domains of the protein. Furthermore, we found that dysfunctions of SH2 and/or SH3 domains reduce auto-phosphorylation of the kinase activation loop, depress kinase activity, and decrease NMDAR phosphorylation. The SH2 domain plays a greater regulatory role than the SH3 domain. Our data also show that n-Src binds directly to the C-terminus of the NMDAR NR2A subunit in vitro, with a K(D) of 108.2 ± 13.3 nM. This binding is not Src kinase activity-dependent, and dysfunctions of the SH2 and/or SH3 domains do not significantly affect the binding. These data indicate that the SH2 and SH3 domains may function to promote the catalytic activity of active n-Src, which is important in the regulation of NMDAR functions. © 2010 The Authors Journal compilation © 2010 FEBS.
Quantitative and Dynamic Imaging of ATM Kinase Activity.
Nyati, Shyam; Young, Grant; Ross, Brian Dale; Rehemtulla, Alnawaz
2017-01-01
Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including DNA double-strand breaks (DSBs). ATM activation results in the initiation of a complex cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally, protein kinases have been analyzed in vitro using biochemical methods (kinase assays using purified proteins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosensors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to enable interrogation of kinase activities in live cells with a high signal to background. We have genetically engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphorylation of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing complementation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.
SH2-dependent autophosphorylation within the Tec family kinase Itk.
Joseph, Raji E; Severin, Andrew; Min, Lie; Fulton, D Bruce; Andreotti, Amy H
2009-08-07
The Tec family kinase, Itk (interleukin-2 tyrosine kinase), undergoes an in cis autophosphorylation on Y180 within its Src homology 3 (SH3) domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening Src homology 2 (SH2) domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full-length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the betaD strand. These results are extended into Btk (Bruton's tyrosine kinase), a Tec family kinase linked to the B-cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA-causing mutations might impair Btk phosphorylation.
A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.
Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya
2016-08-01
Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rocío eRuiz
2016-04-01
Full Text Available The spontaneous mutation tambaleante is caused by the Gly483Glu substitution in the highly conserved N terminal RCC1-like domain of the HERC1 protein, which leads to the increase of mutated protein levels responsible for cerebellar Purkinje cell death by autophagy. Until now, Purkinje cells have been the only central nervous neurons reported as being targeted by the mutation, and their degeneration elicits an ataxic syndrome in adult mutant mice. However, the ultrastructural analysis performed here demonstrates that signs of autophagy, such as autophagosomes, lysosomes, and altered mitochondria, are present in neocortical pyramidal, CA3 hippocampal pyramidal, and spinal cord motor neurons. The main difference is that the reduction in the number of neurons affected in the tambaleante mutation in the neocortex, the hippocampus, and the spinal cord is not so evident as the dramatic loss of cerebellar Purkinje cells. Interestingly, signs of autophagy are absent in both interneurons and neuroglia cells. Affected neurons have in common that they are projection neurons which receive strong and varied synaptic inputs, and possess the highest degree of neuronal activity. Therefore, because the integrity of the ubiquitin-proteasome system is essential for protein degradation and, hence, for normal protein turnover, it could be hypothesized that the deleterious effects of the misrouting of these pathways would depend directly on the neuronal activity.
Directory of Open Access Journals (Sweden)
Chiara Sartor
2013-07-01
Full Text Available We report a case of a patient affected by juvenile polyposis and hereditary hemorrhagic telangiectasia linked to a SMAD4 mutation who developed acute lymphoblastic leukemia positive for the Philadelphia chromosome translocation and with a complex karyotype. During the treatment with the tyrosine kinase inhibitor dasatinib the patient presented recurrent severe gastrointestinal hemorrhages linked to the genetic background and aggravated by thrombocytopenia.
Protein kinase C (PKC) isoforms in cancer, tumor promotion and tumor suppression.
Isakov, Noah
2018-02-01
The AGC family of serine/threonine kinases (PKA, PKG, PKC) includes more than 60 members that are critical regulators of numerous cellular functions, including cell cycle and differentiation, morphogenesis, and cell survival and death. Mutation and/or dysregulation of AGC kinases can lead to malignant cell transformation and contribute to the pathogenesis of many human diseases. Members of one subgroup of AGC kinases, the protein kinase C (PKC), have been singled out as critical players in carcinogenesis, following their identification as the intracellular receptors of phorbol esters, which exhibit tumor-promoting activities. This observation attracted the attention of researchers worldwide and led to intense investigations on the role of PKC in cell transformation and the potential use of PKC as therapeutic drug targets in cancer diseases. Studies demonstrated that many cancers had altered expression and/or mutation of specific PKC genes. However, the causal relationships between the changes in PKC gene expression and/or mutation and the direct cause of cancer remain elusive. Independent studies in normal cells demonstrated that activation of PKC is essential for the induction of cell activation and proliferation, differentiation, motility, and survival. Based on these observations and the general assumption that PKC isoforms play a positive role in cell transformation and/or cancer progression, many PKC inhibitors have entered clinical trials but the numerous attempts to target PKC in cancer has so far yielded only very limited success. More recent studies demonstrated that PKC function as tumor suppressors, and suggested that future clinical efforts should focus on restoring, rather than inhibiting, PKC activity. The present manuscript provides some historical perspectives on the tumor promoting function of PKC, reviewing some of the observations linking PKC to cancer progression, and discusses the role of PKC in the pathogenesis of cancer diseases and its
Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta
2017-03-15
Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.
Gene mutations in hepatocellular adenomas
DEFF Research Database (Denmark)
Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben
2015-01-01
is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....
International Nuclear Information System (INIS)
Yu, Dong; Watanabe, Hiroshi; Shibuya, Hitoshi; Miura, Masahiko
2002-01-01
The insulin-like growth factor I receptor (IGF-IR) is known to induce clonogenic radioresistance in cells following ionizing irradiation. To explore the downstream signaling pathways, we focused on the phosphatidylinositol-3 kinase (PI3-K) pathway, which is thought to be the primary cell survival signal originating from the receptor. For this purpose, R- cells deficient in the endogenous IGF-IR were used as a recipient of the human IGF-IR with or without mutations at potential PI3-K activation sites: NPXY 950 and Y 1316 XXM. Mutats with double mutation at Y950/Y1316 exhibited not abrogated, but reduced activation of insulin receptor substance-1 (IRS-1), PI3-K, and Akt upon IGF-I stimulation. However, the mutants had the same clonogenic radioresistance as cells with wild type (WT) receptors. Neither wortmannin nor LY294002, specific inhibitors of PI3-K, affected the radioresistance of cells with WT receptors at concentrations specific for PI3-K. Collectively, these results indicate that the PI3-K pathway is not essential for IGF-IR-mediated clonogenic radioresistance. (author)
Brunetti, Dario; Dusi, Sabrina; Giordano, Carla; Lamperti, Costanza; Morbin, Michela; Fugnanesi, Valeria; Marchet, Silvia; Fagiolari, Gigliola; Sibon, Ody; Moggio, Maurizio; d'Amati, Giulia; Tiranti, Valeria
Pantothenate kinase-associated neurodegeneration, caused by mutations in the PANK2 gene, is an autosomal recessive disorder characterized by dystonia, dysarthria, rigidity, pigmentary retinal degeneration and brain iron accumulation. PANK2 encodes the mitochondrial enzyme pantothenate kinase type 2,
Comprehensive mutational profiling of core binding factor acute myeloid leukemia.
Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude
2016-05-19
Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. © 2016 by The American Society of Hematology.
Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J
2016-12-01
Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.
Ben-Shachar, S.; Khajavi, M.; Withers, M.A.; Shaw, C.A.; Bokhoven, J.H.L.M. van; Brunner, H.G.; Lupski, J.R.
2009-01-01
Mutations in ROR2, encoding a receptor tyrosine kinase, can cause autosomal recessive Robinow syndrome (RRS), a severe skeletal dysplasia with limb shortening, brachydactyly, and a dysmorphic facial appearance. Other mutations in ROR2 result in the autosomal dominant disease, brachydactyly type B
Chung, Aeri; Jin, Bora; Han, Kwang-Hyub; Ahn, Sang Hoon; Kim, Seungtaek
2017-01-01
Most of HCV RNAs require cell culture-adaptive mutations for efficient replication in cell culture and a number of such mutations have been described including a well-known S2204I substitution mutation in NS5A protein. In contrast, the replication of genotype 2a JFH1 RNA in cell culture does not require any cell culture-adaptive mutation. Rather, the presence of S2204I mutation impaired the JFH1 RNA replication. In this study, we examined the effect of reversions and substitutions of NS5A cell culture-adaptive mutations on virus replication in different genotypic backgrounds after either placing genotype 1a NS5A in the genotype 2a JFH1 or vice versa. The results from this investigation suggest that the S2204I mutation affects HCV RNA replication differentially depending on the viral genotypes but that the effect was not simply explained by the genotypic background. Perhaps, the effect of the S2204I mutation on HCV replication reflects both intra- and intergenic interactions of NS5A protein. J. Med. Virol. 89:146-152, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Key clinical features to identify girls with CDKL5 mutations.
Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydeé; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothée; Afenjar, Alexandra; Rio, Marlène; Héron, Delphine; N'guyen Morel, Marie Ange; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry
2008-10-01
Mutations in the human X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of CDKL5-associated encephalopathy. We screened the entire coding region of CDKL5 for mutations in 183 females with encephalopathy with early seizures by denaturing high liquid performance chromatography and direct sequencing, and we identified in 20 unrelated girls, 18 different mutations including 7 novel mutations. These mutations were identified in eight patients with encephalopathy with RTT-like features, five with infantile spasms and seven with encephalopathy with refractory epilepsy. Early epilepsy with normal interictal EEG and severe hypotonia are the key clinical features in identifying patients likely to have CDKL5 mutations. Our study also indicates that these patients clearly exhibit some RTT features such as deceleration of head growth, stereotypies and hand apraxia and that these RTT features become more evident in older and ambulatory patients. However, some RTT signs are clearly absent such as the so called RTT disease profile (period of nearly normal development followed by regression with loss of acquired fine finger skill in early childhood and characteristic intensive eye communication) and the characteristic evolution of the RTT electroencephalogram. Interestingly, in addition to the overall stereotypical symptomatology (age of onset and evolution of the disease) resulting from CDKL5 mutations, atypical forms of CDKL5-related conditions have also been observed. Our data suggest that phenotypic heterogeneity does not correlate with the nature or the position of the mutations or with the pattern of X-chromosome inactivation, but most probably with the functional transcriptional and/or translational consequences of CDKL5
A PLK4 mutation causing azoospermia in a man with Sertoli cell-only syndrome.
Miyamoto, T; Bando, Y; Koh, E; Tsujimura, A; Miyagawa, Y; Iijima, M; Namiki, M; Shiina, M; Ogata, K; Matsumoto, N; Sengoku, K
2016-01-01
About 15% of couples wishing to have children are infertile; approximately half these cases involve a male factor. Polo-like kinase 4 (PLK-4) is a member of the polo protein family and a key regulator of centriole duplication. Male mice with a point mutation in the Plk4 gene show azoospermia associated with germ cell loss. Mutational analysis of 81 patients with azoospermia and Sertoli cell-only syndrome (SCOS) identified one man with a heterozygous 13-bp deletion in the Ser/Thr kinase domain of PLK4. Division of centrioles occurred in wild-type PLK4-transfected cells, but was hampered in PLK-4-mutant transfectants, which also showed abnormal nuclei. Thus, this PLK4 mutation might be a cause of human SCOS and nonobstructive azoospermia. © 2015 American Society of Andrology and European Academy of Andrology.
Identification of ATM Protein Kinase Phosphorylation Sites by Mass Spectrometry.
Graham, Mark E; Lavin, Martin F; Kozlov, Sergei V
2017-01-01
ATM (ataxia-telangiectasia mutated) protein kinase is a key regulator of cellular responses to DNA damage and oxidative stress. DNA damage triggers complex cascade of signaling events leading to numerous posttranslational modification on multitude of proteins. Understanding the regulation of ATM kinase is therefore critical not only for understanding the human genetic disorder ataxia-telangiectasia and potential treatment strategies, but essential for deciphering physiological responses of cells to stress. These responses play an important role in carcinogenesis, neurodegeneration, and aging. We focus here on the identification of DNA damage inducible ATM phosphorylation sites to understand the importance of autophosphorylation in the mechanism of ATM kinase activation. We demonstrate the utility of using immunoprecipitated ATM in quantitative LC-MS/MS workflow with stable isotope dimethyl labeling of ATM peptides for identification of phosphorylation sites.
Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.
Directory of Open Access Journals (Sweden)
Elizabeth A. Robb
Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.
Rix, U; Remsing Rix, L L; Terker, A S; Fernbach, N V; Hantschel, O; Planyavsky, M; Breitwieser, F P; Herrmann, H; Colinge, J; Bennett, K L; Augustin, M; Till, J H; Heinrich, M C; Valent, P; Superti-Furga, G
2010-01-01
Resistance to the BCR-ABL tyrosine kinase inhibitor imatinib poses a pressing challenge in treating chronic myeloid leukemia (CML). This resistance is often caused by point mutations in the ABL kinase domain or by overexpression of LYN. The second-generation BCR-ABL inhibitor INNO-406 is known to inhibit most BCR-ABL mutants and LYN efficiently. Knowledge of its full target spectrum would provide the molecular basis for potential side effects or suggest novel therapeutic applications and possible combination therapies. We have performed an unbiased chemical proteomics native target profile of INNO-406 in CML cells combined with functional assays using 272 recombinant kinases thereby identifying several new INNO-406 targets. These include the kinases ZAK, DDR1/2 and various ephrin receptors. The oxidoreductase NQO2, inhibited by both imatinib and nilotinib, is not a relevant target of INNO-406. Overall, INNO-406 has an improved activity over imatinib but a slightly broader target profile than both imatinib and nilotinib. In contrast to dasatinib and bosutinib, INNO-406 does not inhibit all SRC kinases and most TEC family kinases and is therefore expected to elicit fewer side effects. Altogether, these properties may make INNO-406 a valuable component in the drug arsenal against CML.
Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia
Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.
2013-01-01
BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein
Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco
2010-01-01
RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386
Epidermal growth factor receptor mutation in gastric cancer.
Liu, Zhimin; Liu, Lina; Li, Mei; Wang, Zhaohui; Feng, Lu; Zhang, Qiuping; Cheng, Shihua; Lu, Shen
2011-04-01
Epidermal growth factor receptor (EGFR) and Kirsten-RAS (KRAS) mutations have been identified as predictors of response to EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer. We aimed to screen the mutations of both genes in gastric carcinoma to detect the suitability of EGFR TKIs for patients with gastric carcinoma. We screened EGFR mutation in exons 19-21 and KRAS mutation in exon 2 in 58 gastric adenocarcinomas from China using high resolution melting analysis (HRMA). Positive samples were confirmed by DNA sequencing. Three EGFR missense mutations (5.2%) and 22 single nucleotide polymorphisms (SNP, Q787Q, 37.9%) were identified. To our knowledge, we report for the first time three mutation patterns of EGFR, Y801C, L858R and G863D, in gastric carcinoma. Two samples with EGFR mutation were mucinous adenocarcinoma. These three samples were collected from male patients aged over 75 years old. The frequency of KRAS mutation was 10.3% (6/58). The exclusiveness of EGFR and KRAS mutations was proven for the first time in gastric cancer. Gastric carcinoma of the mucinous adenocarcinoma type collected from older male patients may harbour EGFR mutations. The small subset of gastric adenocarcinoma patients may respond to EGFR TKIs.
SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.
Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S
2017-04-01
A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through
Consensus for EGFR mutation testing in non-small cell lung cancer: results from a European workshop
DEFF Research Database (Denmark)
Pirker, Robert; Herth, Felix J F; Kerr, Keith M
2010-01-01
Activating somatic mutations of the tyrosine kinase domain of epidermal growth factor receptor (EGFR) have recently been characterized in a subset of patients with advanced non-small cell lung cancer (NSCLC). Patients harboring these mutations in their tumors show excellent response to EGFR tyros...
Directory of Open Access Journals (Sweden)
Jeroen Paardekooper Overman
Full Text Available Noonan syndrome (NS and LEOPARD syndrome (LS cause congenital afflictions such as short stature, hypertelorism and heart defects. More than 50% of NS and almost all of LS cases are caused by activating and inactivating mutations of the phosphatase Shp2, respectively. How these biochemically opposing mutations lead to similar clinical outcomes is not clear. Using zebrafish models of NS and LS and mass spectrometry-based phosphotyrosine proteomics, we identified a down-regulated peptide of Fer kinase in both NS and LS. Further investigation showed a role for Fer during development, where morpholino-based knockdown caused craniofacial defects, heart edema and short stature. During gastrulation, loss of Fer caused convergence and extension defects without affecting cell fate. Moreover, Fer knockdown cooperated with NS and LS, but not wild type Shp2 to induce developmental defects, suggesting a role for Fer in the pathogenesis of both NS and LS.
Cossu-Rocca, Paolo; Contini, Marcella; Uras, Maria Gabriela; Muroni, Maria Rosaria; Pili, Francesca; Carru, Ciriaco; Bosincu, Luisanna; Massarelli, Giovannino; Nogales, Francisco F; De Miglio, Maria Rosaria
2012-11-01
Endometrial stromal sarcomas (ESS) are rare uterine malignant mesenchymal neoplasms, which are currently treated by surgery, as effective adjuvant therapies have not yet been established. Tyrosine kinase inhibitors have rarely been applied in ESS therapy, with few reports describing imatinib responsivity. The aim of this study was to analyze the status of different tyrosine kinase receptors in an ESS series, in order to evaluate their potential role as molecular targets. Immunohistochemistry was performed for EGFR, c-KIT, PDGFR-α, PDGFR-β, and ABL on 28 ESS. EGFR, PDGFR-α, and PDGFR-β gene expression was investigated by real-time polymerase chain reaction (qRT-PCR) on selected cases. "Hot-spot" mutations were screened for on EGFR, c-KIT, PDGFR-α, and PDGFR-β genes, by sequencing. All analysis was executed from formalin-fixed, paraffin-embedded specimens. Immunohistochemical overexpression of 2 or more tyrosine kinase receptors was observed in 18 of 28 tumors (64%), whereas only 5 tumors were consistently negative. Gene expression profiles were concordant with immunohistochemical overexpression in only 1 tumor, which displayed both high mRNA levels and specific immunoreactivity for PDGFR-α, and PDGFR-β. No activating mutations were found on the tumors included in the study. This study confirms that TKRs expression is frequently observed in ESS. Considering that the responsiveness to tyrosine kinase inhibitors is known to be related to the presence of specific activating mutations or gene over-expression, which are not detectable in ESS, TKRs immunohistochemical over-expression alone should not be considered as a reliable marker for targeted therapies in ESS. Specific post-translational abnormalities, responsible for activation of TKRs, should be further investigated.
Disruption of PH–kinase domain interactions leads to oncogenic activation of AKT in human cancers
Parikh, Chaitali; Janakiraman, Vasantharajan; Wu, Wen-I; Foo, Catherine K.; Kljavin, Noelyn M.; Chaudhuri, Subhra; Stawiski, Eric; Lee, Brian; Lin, Jie; Li, Hong; Lorenzo, Maria N.; Yuan, Wenlin; Guillory, Joseph; Jackson, Marlena; Rondon, Jesus; Franke, Yvonne; Bowman, Krista K.; Sagolla, Meredith; Stinson, Jeremy; Wu, Thomas D.; Wu, Jiansheng; Stokoe, David; Stern, Howard M.; Brandhuber, Barbara J.; Lin, Kui; Skelton, Nicholas J.; Seshagiri, Somasekar
2012-01-01
The protein kinase v-akt murine thymoma viral oncogene homolog (AKT), a key regulator of cell survival and proliferation, is frequently hyperactivated in human cancers. Intramolecular pleckstrin homology (PH) domain–kinase domain (KD) interactions are important in maintaining AKT in an inactive state. AKT activation proceeds after a conformational change that dislodges the PH from the KD. To understand these autoinhibitory interactions, we generated mutations at the PH–KD interface and found that most of them lead to constitutive activation of AKT. Such mutations are likely another mechanism by which activation may occur in human cancers and other diseases. In support of this likelihood, we found somatic mutations in AKT1 at the PH–KD interface that have not been previously described in human cancers. Furthermore, we show that the AKT1 somatic mutants are constitutively active, leading to oncogenic signaling. Additionally, our studies show that the AKT1 mutants are not effectively inhibited by allosteric AKT inhibitors, consistent with the requirement for an intact PH–KD interface for allosteric inhibition. These results have important implications for therapeutic intervention in patients with AKT mutations at the PH–KD interface. PMID:23134728
A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.
López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José
2017-07-27
In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.
CDKL Family Kinases Have Evolved Distinct Structural Features and Ciliary Function
Directory of Open Access Journals (Sweden)
Peter Canning
2018-01-01
Full Text Available Various kinases, including a cyclin-dependent kinase (CDK family member, regulate the growth and functions of primary cilia, which perform essential roles in signaling and development. Neurological disorders linked to CDK-Like (CDKL proteins suggest that these underexplored kinases may have similar functions. Here, we present the crystal structures of human CDKL1, CDKL2, CDKL3, and CDKL5, revealing their evolutionary divergence from CDK and mitogen-activated protein kinases (MAPKs, including an unusual αJ helix important for CDKL2 and CDKL3 activity. C. elegans CDKL-1, most closely related to CDKL1–4 and localized to neuronal cilia transition zones, modulates cilium length; this depends on its kinase activity and αJ helix-containing C terminus. Human CDKL5, linked to Rett syndrome, also localizes to cilia, and it impairs ciliogenesis when overexpressed. CDKL5 patient mutations modeled in CDKL-1 cause localization and/or cilium length defects. Together, our studies establish a disease model system suggesting cilium length defects as a pathomechanism for neurological disorders, including epilepsy.
Directory of Open Access Journals (Sweden)
Sarah L. McCarron
2013-01-01
Full Text Available A minority of chronic myeloid leukaemia (CML patients express variant transcripts of which the e19a2 BCR-ABL1 fusion is the most common. Instances of tyrosine kinase inhibitor (TKI resistance in e19a2 BCR-ABL1 CML patients have rarely been reported. A case of e19a2 BCR-ABL1 CML is described in whom imatinib resistance, associated with a Q252H ABL1 kinase domain mutation, became apparent soon after initiation of TKI therapy. The patient rapidly transformed to myeloid blast crisis (BC with considerable bone marrow fibrosis and no significant molecular response to a second generation TKI. The clinical course was complicated by comorbidities with the patient rapidly succumbing to advanced disease. This scenario of Q252H-associated TKI resistance with rapid BC transformation has not been previously documented in e19a2 BCR-ABL1 CML. This case highlights the considerable challenges remaining in the management of TKI-resistant BC CML, particularly in the elderly patient.
DEFF Research Database (Denmark)
Proschowsky, Helle Friis; Flagstad, Annette; Cirera, Susanna
2007-01-01
The presence of a recessive inherited muscle disease in Old Danish Pointing Dogs has been well known for years. Comparisons of this disease with myasthenic diseases of other dog breeds and humans have pointed toward a defect in the synthesis of the neurotransmitter acetylcholine possibly due...... to decreased activity of the enzyme choline acetyltransferase. We sequenced exons 5-18 of the gene encoding choline acetyltransferase (CHAT) in 2 affected and 2 unaffected dogs and identified a G to A missense mutation in exon 6. The mutation causes a valine to methionine substitution and segregates...... in agreement with the inheritance of the disease. The mutation was not detected in 50 dogs representing 25 other dog breeds. A DNA test has been developed and is now available to the breeders of Old Danish Pointing Dogs....
Ret receptor tyrosine kinase sustains proliferation and tissue maturation in intestinal epithelia
DEFF Research Database (Denmark)
Perea, Daniel; Guiu, Jordi; Hudry, Bruno
2017-01-01
Expression of the Ret receptor tyrosine kinase is a defining feature of enteric neurons. Its importance is underscored by the effects of its mutation in Hirschsprung disease, leading to absence of gut innervation and severe gastrointestinal symptoms. We report a new and physiologically significant...
Strategies for Overcoming Resistance in Tumours Harboring BRAF Mutations
Directory of Open Access Journals (Sweden)
Nourah Mohammad Obaid
2017-03-01
Full Text Available The development of resistance to previously effective treatments has been a challenge for health care providers and a fear for patients undergoing cancer therapy. This is an unfortunately frequent occurrence for patients undergoing targeted therapy for tumours harboring the activating V600E mutation of the BRAF gene. Since the initial identification of the BRAF mutation in 2002, a series of small molecular inhibitors that target the BRAFV600E have been developed, but intrinsic and acquired resistance to these drugs has presented an ongoing challenge. More recently, improvements in therapy have been achieved by combining the use of BRAF inhibitors with other drugs, such as inhibitors of the downstream effector mitogen activated protein kinase (MAPK/extracellular-signal regulated kinase (ERK kinase (MEK. Despite improved success in response rates and in delaying resistance using combination therapy, ultimately, the acquisition of resistance remains a concern. Recent research articles have shed light on some of the underlying mechanisms of this resistance and have proposed numerous strategies that might be employed to overcome or avoid resistance to targeted therapies. This review will explore some of the resistance mechanisms, compare what is known in melanoma cancer to colorectal cancer, and discuss strategies under development to manage the development of resistance.
Directory of Open Access Journals (Sweden)
Ren-You Gan
2014-09-01
Full Text Available Liver kinase B1 (LKB1, known as a serine/threonine kinase, has been identified as a critical cancer suppressor in many cancer cells. It is a master upstream kinase of 13 AMP-activated protein kinase (AMPK-related protein kinases, and possesses versatile biological functions. LKB1 gene is mutated in many cancers, and its protein can form different protein complexes with different cellular localizations in various cell types. The expression of LKB1 can be regulated through epigenetic modification, transcriptional regulation and post-translational modification. LKB1 dowcnstream pathways mainly include AMPK, microtubule affinity regulating kinase (MARK, salt-inducible kinase (SIK, sucrose non-fermenting protein-related kinase (SNRK and brain selective kinase (BRSK signalings, etc. This review, therefore, mainly discusses recent studies about the expression, regulation, downstream signaling and cancer suppressive function of LKB1, which can be helpful for better understanding of this molecular and its significance in cancers.
Mutations induced by ultraviolet radiation affecting virulence in Puccinia striiformis
International Nuclear Information System (INIS)
Shang Hongsheng; Jing Jinxue; Li Zhenqi
1994-01-01
Uredospores of parent culture, cy 29-1, were treated by ultraviolet radiation and mutations to virulent were tested on resistant wheat cultivars inoculated with treated spores. 7 mutant cultures virulent to the test cultivars were developed with estimated mutation rate 10~6~10~4. The virulence of mutant cultures was different from the all known races of stripe rust. Resistance segregation to mutant cultures was detected in two test cultivars. The results suggested that mutation was important mechanism of virulence variation operative in asexual population of rust fungi
Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2
Nangalia, J.; Massie, C.E.; Baxter, E.J.; Nice, F.L.; Gundem, G.; Wedge, D.C.; Avezov, E.; Li, J.; Kollmann, K.; Kent, D.G.; Aziz, A.; Godfrey, A.L.; Hinton, J.; Martincorena, I.; Loo, P. Van; Jones, A.V.; Guglielmelli, P.; Tarpey, P.; Harding, H.P.; Fitzpatrick, J.D.; Goudie, C.T.; Ortmann, C.A.; Loughran, S.J.; Raine, K.; Jones, D.R.; Butler, A.P.; Teague, J.W.; O'Meara, S.; McLaren, S.; Bianchi, M.; Silber, Y.; Dimitropoulou, D.; Bloxham, D.; Mudie, L.; Maddison, M.; Robinson, B.; Keohane, C.; Maclean, C.; Hill, K.; Orchard, K.; Tauro, S.; Du, M.Q.; Greaves, M.; Bowen, D.; Huntly, B.J.; Harrison, C.N.; Cross, N.C.; Ron, D.; Vannucchi, A.M.; Papaemmanuil, E.; Campbell, P.J.; Green, A.R.
2013-01-01
BACKGROUND: Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. METHODS: We performed exome sequencing
Clinical phenotype of 5 females with a CDKL5 mutation
Stalpers, X.L.; Spruijt, L.; Yntema, H.G.; Verrips, A.
2012-01-01
Mutations in the X-linked cyclin dependent kinase like 5 (CDKL5) gene have been reported in approximately 80 patients since the first description in 2003. The clinical presentation partly corresponds with Rett syndrome, considering clinical features as intellectual disability, hypotonia, and poor
Directory of Open Access Journals (Sweden)
Yong Tang
Full Text Available Mertk belongs to the Tyro3, Axl and Mertk (TAM family of receptor tyrosine kinases, and plays a pivotal role in regulation of cytoskeletal rearrangement during phagocytosis. Phagocytosis by either professional or non-professional phagocytes is impaired in the Mertk deficient individual. In the present study, we further investigated the effects of Mertk mutation on peritoneal macrophage morphology, attachment, spreading and movement. Mertk-mutated macrophages exhibited decreased attachment, weak spreading, loss of spindle-like body shape and lack of clear leading and trailing edges within the first few hours of culture, as observed by environmental scanning electron microscopy. Time-lapse video photography recording showed that macrophage without Mertk conducted mainly random movement with oscillating swing around the cell body, and lost the directional migration action seen on the WT cells. Western blotting showed a decreased phosphorylation of focal adhesion kinase (FAK. Immunocytochemistry revealed that actin filaments and dynamic protein myosin II failed to concentrate in the leading edge of migrating cells. Microtubules were localized mainly in one side of mutant cell body, with no clear MTOC and associated radially-distributed microtubule bundles, which were clearly evident in the WT cells. Our results suggest that Mertk deficiency affects not only phagocytosis but also cell shape and migration, likely through a common regulatory mechanism on cytoskeletons.
Briquet-Laugier, V; Ben-Zeev, O; White, A; Doolittle, M H
1999-11-01
The mutations cld (combined lipase deficiency) and lec23 disrupt in a similar manner the expression of lipoprotein lipase (LPL). Whereas cld affects an unknown gene, lec23 abolishes the activity of alpha-glucosidase I, an enzyme essential for proper folding and assembly of nascent glycoproteins. The hypothesis that cld, like lec23, affects the folding/assembly of nascent LPL was confirmed by showing that in cell lines homozygous for these mutations (Cld and Lec23, respectively), the majority of LPL was inactive, displayed heterogeneous aggregation, and had a decreased affinity for heparin. While inactive LPL was retained in the ER, a small amount of LPL that had attained a native conformation was transported through the Golgi and secreted. Thus, Cld and Lec23 cells recognized and retained the majority of LPL as misfolded, maintaining the standard of quality control. Examination of candidate factors affecting protein maturation, such as glucose addition and trimming, proteins involved in lectin chaperone cycling, and other abundant ER chaperones, revealed that calnexin levels were dramatically reduced in livers from cld/cld mice; this finding was also confirmed in Cld cells. We conclude that cld may affect components in the ER, such as calnexin, that play a role in protein maturation. Whether the reduced calnexin levels per se contribute to the LPL deficiency awaits confirmation.
Kicka, Sébastien; Silar, Philippe
2004-03-01
MAPKKK are kinases involved in cell signaling. In fungi, these kinases are known to regulate development, pathogenicity, and the sensing of external conditions. We show here that Podospora anserina strains mutated in PaASK1, a MAPKKK of the MEK family, are impaired in the development of crippled growth, a cell degeneration process caused by C, a nonconventional infectious element. They also display defects in mycelium pigmentation, differentiation of aerial hyphae, and making of fruiting bodies, three hallmarks of cell differentiation during stationary phase in P. anserina. Overexpression of PaASK1 results in exacerbation of crippled growth. PaASK1 is a large protein of 1832 amino acids with several domains, including a region rich in proline and a 60-amino-acid-long polyglutamine stretch. Deletion analysis reveals that the polyglutamine stretch is dispensable for PaASK1 activity, whereas the region that contains the prolines is essential but insufficient to promote full activity. We discuss a model based on the hysteresis of a signal transduction cascade to account for the role of PaASK1 in both cell degeneration and stationary-phase cell differentiation.
Protein kinase C mediates platelet secretion and thrombus formation through protein kinase D2.
Konopatskaya, Olga; Matthews, Sharon A; Harper, Matthew T; Gilio, Karen; Cosemans, Judith M E M; Williams, Christopher M; Navarro, Maria N; Carter, Deborah A; Heemskerk, Johan W M; Leitges, Michael; Cantrell, Doreen; Poole, Alastair W
2011-07-14
Platelets are highly specialized blood cells critically involved in hemostasis and thrombosis. Members of the protein kinase C (PKC) family have established roles in regulating platelet function and thrombosis, but the molecular mechanisms are not clearly understood. In particular, the conventional PKC isoform, PKCα, is a major regulator of platelet granule secretion, but the molecular pathway from PKCα to secretion is not defined. Protein kinase D (PKD) is a family of 3 kinases activated by PKC, which may represent a step in the PKC signaling pathway to secretion. In the present study, we show that PKD2 is the sole PKD member regulated downstream of PKC in platelets, and that the conventional, but not novel, PKC isoforms provide the upstream signal. Platelets from a gene knock-in mouse in which 2 key phosphorylation sites in PKD2 have been mutated (Ser707Ala/Ser711Ala) show a significant reduction in agonist-induced dense granule secretion, but not in α-granule secretion. This deficiency in dense granule release was responsible for a reduced platelet aggregation and a marked reduction in thrombus formation. Our results show that in the molecular pathway to secretion, PKD2 is a key component of the PKC-mediated pathway to platelet activation and thrombus formation through its selective regulation of dense granule secretion.
Carrion, Maria Dolores Perez; Marsicano, Silvia; Daniele, Federica; Marte, Antonella; Pischedda, Francesca; Di Cairano, Eliana; Piovesana, Ester; von Zweydorf, Felix; Kremmer, Elisabeth; Gloeckner, Christian Johannes; Onofri, Franco; Perego, Carla; Piccoli, Giovanni
2017-07-14
Mutations in the Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial Parkinson's disease (PD). LRRK2 protein contains several functional domains, including protein-protein interaction domains at its N- and C-termini. In this study, we analyzed the functional features attributed to LRRK2 by its N- and C-terminal domains. We combined TIRF microscopy and synaptopHluorin assay to visualize synaptic vesicle trafficking. We found that N- and C-terminal domains have opposite impact on synaptic vesicle dynamics. Biochemical analysis demonstrated that different proteins are bound at the two extremities, namely β3-Cav2.1 at N-terminus part and β-Actin and Synapsin I at C-terminus domain. A sequence variant (G2385R) harboured within the C-terminal WD40 domain increases the risk for PD. Complementary biochemical and imaging approaches revealed that the G2385R variant alters strength and quality of LRRK2 interactions and increases fusion of synaptic vesicles. Our data suggest that the G2385R variant behaves like a loss-of-function mutation that mimics activity-driven events. Impaired scaffolding capabilities of mutant LRRK2 resulting in perturbed vesicular trafficking may arise as a common pathophysiological denominator through which different LRRK2 pathological mutations cause disease.
Prevalence of Janus kinase 2 mutations in patients with unusual site venous thrombosis
Directory of Open Access Journals (Sweden)
Ana Lisa Basquiera
2011-08-01
Full Text Available We aimed to study patients with splanchnic vein thrombosis (SVT and cerebral vein thrombosis (CVT searching for JAK2 mutations. We evaluated 14 patients (median age: 41.5 years with portal vein thrombosis (PVT = 7; mesenteric vein thrombosis (MVT = 3; and CVT = 4. JAK2 V617F was assessed by allele specific PCR of peripheral blood DNA. In addition, DNA was sequenced for other JAK2 mutations. Other inherited and acquired thrombophilia risk factors were evaluated. JAK2 V617F was positive in four out of seven patients with PVT and in one CVT patient. These five patients had a diagnosis of myeloproliferative disorder (MPD at the moment of the occurrence of thrombosis (n = 2 or later (n = 2. Patients with MVT and CVT were negative for JAK2 V617F, except one patient with CVT and a diagnosis of essential thrombocythemia. No other JAK2 mutations were found in this cohort. Besides MPD, other thrombophilia risk factors were identified in five patients. One patient had MPD as well as thrombophilia risk factor. In this group, 4 out of 7 of the patients with PVT carried the JAK2 V617F mutation with or without overt MPD. However, the investigation of other JAK2 mutations may not be necessary in patients with thrombosis at unusual sites.
The slaty mutation affects the morphology and maturation of melanosomes in the mouse melanocytes.
Hirobe, Tomohisa; Abe, Hiroyuki
2006-10-01
The slaty (Dct(slt)) mutation is known to reduce the activity of dopachrome tautomerase in melanocytes and to reduce the melanin content in skin, hairs and eyes. Although the melanosomes in slaty melanocytes are reported to be eumelanosome-like, detailed melanosome biogenesis is not well studied. To address this point, melanosomes in neonatal epidermal melanocytes from wild-type (Dct+/Dct+) mice at the slaty locus as well as its congenic mouse mutant (Dct(slt)/Dct(slt)) in serum-free primary culture were observed under the electron microscope. Wild-type melanocytes possessed exclusively elliptical melanosomes with internal longitudinal structures, whereas in mutant melanocytes, numerous spherical melanosomes with globular depositions of pigment and elliptical melanosomes as well as mixed type of the two melanosomes were observed. Mature stage IV melanosomes were greatly decreased in mutant melanocytes, whereas immature stage III melanosomes were more numerous than in wild-type melanocytes. These results suggest that the slaty mutation affects the morphology and maturation of melanosomes in mouse melanocytes.
EGFR and KRAS mutation coexistence in lung adenocarcinomas
Directory of Open Access Journals (Sweden)
Vitor Manuel Leitão de Sousa
2015-04-01
Full Text Available Lung cancer is one of the most common causes of cancer deaths. The development of EGFR targeted therapies, including monoclonal antibodies and tyrosine kinase inhibitors have generated an interest in the molecular characterization of these tumours. KRAS mutations are associated with resistance to EGFR TKIs. EGFR and KRAS mutations have been considered as mutually exclusive. This paper presents three bronchial-pulmonary carcinomas, two adenocarcinomas and one pleomorphic sarcomatoid carcinoma, harboring EGFR and KRAS mutations. Case 1 corresponded to an adenocarcinoma with EGFR exon 21 mutation (L858R and KRAS codon 12 point mutation (G12V; case 2, a mucinous adenocarcinoma expressed coexistence of EGFR exon 21 mutation (L858R and KRAS codon 12 point mutation (G12V; and case 3 a sarcomatoid carcinoma with EGFR exon 19 deletion – del 9bp and KRAS codon 12 point mutation (G12C - cysteine. Based on our experience and on the literature, we conclude that EGFR and KRAS mutations can indeed coexist in the same bronchial-pulmonary carcinoma, either in the same histological type or in different patterns. The biological implications of this coexistence are still poorly understood mainly because these cases are not frequent or currently searched. It is therefore necessary to study larger series of cases with the two mutations to better understand the biological, clinical and therapeutic implications.
Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela
2011-03-01
Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.
Lesage, Suzanne; Patin, Etienne; Condroyer, Christel; Leutenegger, Anne-Louise; Lohmann, Ebba; Giladi, Nir; Bar-Shira, Anat; Belarbi, Soraya; Hecham, Nassima; Pollak, Pierre; Ouvrard-Hernandez, Anne-Marie; Bardien, Soraya; Carr, Jonathan; Benhassine, Traki; Tomiyama, Hiroyuki; Pirkevi, Caroline; Hamadouche, Tarik; Cazeneuve, Cécile; Basak, A Nazli; Hattori, Nobutaka; Dürr, Alexandra; Tazir, Meriem; Orr-Urtreger, Avi; Quintana-Murci, Lluis; Brice, Alexis
2010-05-15
Mutations in the leucine-rich-repeat kinase 2 (LRRK2) gene have been identified in families with autosomal dominant Parkinson's disease (PD) and in sporadic cases; the G2019S mutation is the single most frequent. Intriguingly, the frequency of this mutation in PD patients varies greatly among ethnic groups and geographic origins: it is present at <0.1% in East Asia, approximately 2% in European-descent patients and can reach frequencies of up to 15-40% in PD Ashkenazi Jews and North African Arabs. To ascertain the evolutionary dynamics of the G2019S mutation in different populations, we genotyped 74 markers spanning a 16 Mb genomic region around G2019S, in 191 individuals carrying the mutation from 126 families of different origins. Sixty-seven families were of North-African Arab origin, 18 were of North/Western European descent, 37 were of Jewish origin, mostly from Eastern Europe, one was from Japan, one from Turkey and two were of mixed origins. We found the G2019S mutation on three different haplotypes. Network analyses of the three carrier haplotypes showed that G2019S arose independently at least twice in humans. In addition, the population distribution of the intra-allelic diversity of the most widespread carrier haplotype, together with estimations of the age of G2019S determined by two different methods, suggests that one of the founding G2019S mutational events occurred in the Near East at least 4000 years ago.
SH2 dependent autophosphorylation within the Tec family kinase Itk
Joseph, Raji E.; Severin, Andrew; Min, Lie; Fulton, D. Bruce; Andreotti, Amy H.
2009-01-01
The Tec family kinase, Itk, undergoes an in cis autophosphorylation on Y180 within its SH3 domain. Autophosphorylation of the Itk SH3 domain by the Itk kinase domain is strictly dependent on the presence of the intervening SH2 domain. A direct docking interaction between the Itk kinase and SH2 domains brings the Itk SH3 domain into the active site where Y180 is then phosphorylated. We now identify the residues on the surface of the Itk SH2 domain responsible for substrate docking and show that this SH2 surface mediates autophosphorylation in the full length Itk molecule. The canonical phospholigand binding site on the SH2 domain is not involved in substrate docking, instead the docking site consists of side chains from three loop regions (AB, EF and BG) and part of the βD strand. These results are extended into Btk, a Tec family kinase linked to the B cell deficiency X-linked agammaglobulinemia (XLA). Our results suggest that some XLA causing mutations might impair Btk phosphorylation. PMID:19523959
Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry
2013-01-01
Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.
Chapman, Carolyn Riley; Evans, Sarah Tyler; Carr, Antony M.; Enoch, Tamar
1999-01-01
The fission yeast Rad3p checkpoint protein is a member of the phosphatidylinositol 3-kinase-related family of protein kinases, which includes human ATMp. Mutation of the ATM gene is responsible for the disease ataxia-telangiectasia. The kinase domain of Rad3p has previously been shown to be essential for function. Here, we show that although this domain is necessary, it is not sufficient, because the isolated kinase domain does not have kinase activity in vitro and cannot complement a rad3 deletion strain. Using dominant negative alleles of rad3, we have identified two sites N-terminal to the conserved kinase domain that are essential for Rad3p function. One of these sites is the putative leucine zipper, which is conserved in other phosphatidylinositol 3-kinase-related family members. The other is a novel motif, which may also mediate Rad3p protein–protein interactions. PMID:10512862
Sjölund, Katarina; Andersson, Anna; Nilsson, Erik; Nilsson, Ola; Ahlman, Håkan
2010-01-01
Background Gastrointestinal stromal tumors (GISTs) express the receptor tyrosine kinase KIT. Most GISTs have mutations in the KIT or PDGFRA gene, causing activation of tyrosine kinase. Imatinib, a tyrosine kinase inhibitor (TKI), is the first-line palliative treatment for advanced GISTs. Sunitinib was introduced for patients with mutations not responsive to imatinib. The aim was to compare the survival of patients with high-risk resected GISTs treated with TKI prior to surgery with historical controls and to determine if organ-preserving surgery was facilitated. Methods Ten high-risk GIST-patients had downsizing/adjuvant TKI treatment: nine with imatinib and one with sunitinib. The patients were matched with historical controls (n = 89) treated with surgery alone, from our population-based series (n = 259). Mutational analysis of KIT and PDGFRA was performed in all cases. The progression-free survival was calculated. Results The primary tumors decreased in mean diameter from 20.4 cm to 10.5 cm on downsizing imatinib. Four patients with R0 resection and a period of adjuvant imatinib had no recurrences versus 67% in the historical control group. Four patients with residual liver metastases have stable disease on continuous imatinib treatment after surgery. One patient has undergone reoperation with liver resection. The downsizing treatment led to organ-preserving surgery in nine patients and improved preoperative nutritional status in one patient. Conclusions Downsizing TKI is recommended for patients with bulky tumors with invasion of adjacent organs. Sunitinib can be used for patients in case of imatinib resistance (e.g., wild-type GISTs), underlining the importance of mutational analysis for optimal surgical planning. PMID:20512492
International Nuclear Information System (INIS)
Hashim, R.; Ahmad, S.; Sattar, A.; Khan, F.A.
2011-01-01
Background: Duchenne Muscular Dystrophy (DMD) is an X-linked recessive lethal, genetic disorder characterised by progressive weakness of skeletal muscles which is untreatable and transmitted to males by carrier females. Advances in laboratory techniques now focus direct mutational analysis as the most reliable and indirect analysis based on Short Tandem Repeats (STR) based linkage analysis as feasible, inexpensive, and efficient method for carrier detection and prenatal diagnosis. The objective of this study was to compare the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and diagnostic efficiency of Serum Creatine Kinase (SCK) with Short Tandem Repeats (STR based linkage analysis in carriers and affected children of Duchenne Muscular Dystrophy. Methods: The study was carried out from Dec 2006 to Dec 2007 in families having index clinical cases of DMD who were referred from different hospitals for evaluation/workup of DMD. SCK was done as a preliminary investigation in all index cases. The PCR assay with STR based linkage analysis with Intron 44, 45, 49 and 50 of DMD gene were performed in all families. Six families were informative with Intron 44 of DMD gene and one family was non-informative with all four intronic markers of DMD. SCK analyses were done in all the family members and compared with PCR analysis in informative families. SCK was not performed on Chorionic villous sample (CVS) done for prenatal diagnosis of DMD, and CVS and non-informative family members were excluded from the study. Results: In carriers of DMD, the sensitivity and negative predictive value of SCK were 33.3%, and specificity and positive predictive were 100% with diagnostic efficiency of 50%. In affected cases of DMD the sensitivity and negative predictive value of SCK were 100%, and specificity and positive predictive were 91% and 88.8% respectively and diagnostic efficiency of 94.1%. Conclusion: The SCK is an excellent screening test for
Ziemska, Joanna; Solecka, Jolanta
Cancers are the leading cause of deaths all over the world. Available anticancer agents used in clinics exhibit low therapeutic index and usually high toxicity. Wide spreading drug resistance of cancer cells induce a demanding need to search for new drug targets. Currently, many on-going studies on novel compounds with potent anticancer activity, high selectivity as well as new modes of action are conducted. In this work, we describe in details three enzyme groups, which are at present of extensive interest to medical researchers and pharmaceutical companies. These include receptor tyrosine kinases (e.g. EGFR enzymes) and non-receptor tyrosine kinases (Src enzymes), type A, B and C Aurora kinases and aminopeptidases, especially leucine aminopeptidase. We discuss classification of these enzymes, biochemistry as well as their role in the cell cycle under normal conditions and during cancerogenesis. Further on, the work describes enzyme inhibitors that are under in vitro, preclinical, clinical studies as well as drugs available on the market. Both, chemical structures of discovered inhibitors and the role of chemical moieties in novel drug design are discussed. Described enzymes play essential role in cell cycle, especially in mitosis (Aurora kinases), cell differentiation, growth and apoptosis (tyrosine kinases) as well as G1/S transition (leucine aminopeptidase). In cancer cells, they are overexpressed and only their inhibition may stop tumor progression. This review presents the clinical outcomes of selected inhibitors and argues the safety of drug usage in human volunteers. Clinical studies of EGFR and Src kinase inhibitors in different tumors clearly show the need for molecular selection of patients (to those with mutations in genes coding EGFR and Src) to achieve positive clinical response. Current data indicates the great necessity for new anticancer treatment and actions to limit off-target activity.
Directory of Open Access Journals (Sweden)
Tassin Anne-Marie
2008-04-01
Full Text Available Abstract Background The t(6;8 translocation found in rare and agressive myeloproliferative disorders results in a chimeric gene encoding the FOP-FGFR1 fusion protein. This protein comprises the N-terminal region of the centrosomal protein FOP and the tyrosine kinase of the FGFR1 receptor. FOP-FGFR1 is localized at the centrosome where it exerts a constitutive kinase activity. Results We show that FOP-FGFR1 interacts with the large centrosomal protein CAP350 and that CAP350 is necessary for FOP-FGFR1 localisation at centrosome. FOP-FGFR1 activates the phosphoinositide-3 kinase (PI3K pathway. We show that p85 interacts with tyrosine 475 of FOP-FGFR1, which is located in a YXXM consensus binding sequence for an SH2 domain of p85. This interaction is in part responsible for PI3K activation. Ba/F3 cells that express FOP-FGFR1 mutated at tyrosine 475 have reduced proliferative ability. Treatment with PI3K pathway inhibitors induces death of FOP-FGFR1 expressing cells. FOP-FGFR1 also recruits phospholipase Cγ1 (PLCγ1 at the centrosome. We show that this enzyme is recruited by FOP-FGFR1 at the centrosome during interphase. Conclusion These results delineate a particular type of oncogenic mechanism by which an ectopic kinase recruits its substrates at the centrosome whence unappropriate signaling induces continuous cell growth and MPD.
Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung
2008-08-15
The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.
van Oosterwijk, J G; van Ruler, M A J H; Briaire-de Bruijn, I H; Herpers, B; Gelderblom, H; van de Water, B; Bovée, J V M G
2013-01-01
Background: Chondrosarcomas are malignant cartilage-forming tumours of bone. Because of their resistance to conventional chemotherapy and radiotherapy, currently no treatment strategies exist for unresectable and metastatic chondrosarcoma. Previously, PI3K/AKT/GSK3β and Src kinase pathways were shown to be activated in chondrosarcoma cell lines. Our aim was to investigate the role of these kinases in chemoresistance and migration in chondrosarcoma in relation to TP53 mutation status. Methods: We used five conventional and three dedifferentiated chondrosarcoma cell lines and investigated the effect of PI3K/AKT/GSK3β pathway inhibition (enzastaurin) and Src pathway inhibition (dasatinib) in chemoresistance using WST assay and live cell imaging with AnnexinV staining. Immunohistochemistry on tissue microarrays (TMAs) containing 157 cartilaginous tumours was performed for Src family members. Migration assays were performed with the RTCA xCelligence System. Results: Src inhibition was found to overcome chemoresistance, to induce apoptosis and to inhibit migration. Cell lines with TP53 mutations responded better to combination therapy than wild-type cell lines (P=0.002). Tissue microarray immunohistochemistry confirmed active Src (pSrc) signalling, with Fyn being most abundantly expressed (76.1%). Conclusion: These results strongly indicate Src family kinases, in particular Fyn, as a potential target for the treatment of inoperable and metastatic chondrosarcomas, and to sensitise for doxorubicin especially in the presence of TP53 mutations. PMID:23922104
Presence of calreticulin mutations in JAK2-negative polycythemia vera.
Broséus, Julien; Park, Ji-Hye; Carillo, Serge; Hermouet, Sylvie; Girodon, François
2014-12-18
Calreticulin (CALR) mutations have been reported in Janus kinase 2 (JAK2)- and myeloproliferative leukemia (MPL)-negative essential thrombocythemia and primary myelofibrosis. In contrast, no CALR mutations have ever been reported in the context of polycythemia vera (PV). Here, we describe 2 JAK2(V617F)-JAK2(exon12)-negative PV patients who presented with a CALR mutation in peripheral granulocytes at the time of diagnosis. In both cases, the CALR mutation was a 52-bp deletion. Single burst-forming units-erythroid (BFU-E) from 1 patient were grown in vitro and genotyped: the same CALR del 52-bp mutation was noted in 31 of the 37 colonies examined; 30 of 31 BFU-E were heterozygous for CALR del 52 bp, and 1 of 31 BFU-E was homozygous for CALR del 52 bp. In summary, although unknown mutations leading to PV cannot be ruled out, our results suggest that CALR mutations can be associated with JAK2-negative PV. © 2014 by The American Society of Hematology.
Lee, Dae-Won; Han, Sae-Won; Cha, Yongjun; Bae, Jeong Mo; Kim, Hwang-Phill; Lyu, Jaemyun; Han, Hyojun; Kim, Hyoki; Jang, Hoon; Bang, Duhee; Huh, Iksoo; Park, Taesung; Won, Jae-Kyung; Jeong, Seung-Yong; Park, Kyu Joo; Kang, Gyeong Hoon; Kim, Tae-You
2017-09-15
Colorectal cancer (CRC) develops through the alteration of several critical pathways. This study was aimed at evaluating the influence of critical pathways on survival outcomes for patients with CRC. Targeted next-generation sequencing of 40 genes included in the 5 critical pathways of CRC (WNT, P53, RTK-RAS, phosphatidylinositol-4,5-bisphosphate 3-kinase [PI3K], and transforming growth factor β [TGF-β]) was performed for 516 patients with stage III or high-risk stage II CRC treated with surgery followed by adjuvant fluoropyrimidine and oxaliplatin chemotherapy. The associations between critical pathway mutations and relapse-free survival (RFS) and overall survival were analyzed. The associations were further analyzed according to the tumor location. The mutation rates for the WNT, P53, RTK-RAS, PI3K, and TGF-β pathways were 84.5%, 69.0%, 60.7%, 30.0%, and 28.9%, respectively. A mutation in the PI3K pathway was associated with longer RFS (adjusted hazard ratio [HR], 0.59; 95% confidence interval [CI], 0.36-0.99), whereas a mutation in the RTK-RAS pathway was associated with shorter RFS (adjusted HR, 1.60; 95% CI, 1.01-2.52). Proximal tumors showed a higher mutation rate than distal tumors, and the mutation profile was different according to the tumor location. The mutation rates of Kirsten rat sarcoma viral oncogene homolog (KRAS), phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α (PIK3CA), and B-Raf proto-oncogene serine/threonine kinase (BRAF) were higher in proximal tumors, and the mutation rates of adenomatous polyposis coli (APC), tumor protein 53 (TP53), and neuroblastoma RAS viral oncogene homolog (NRAS) were higher in distal tumors. The better RFS with the PI3K pathway mutation was significant only for proximal tumors, and the worse RFS with the RTK-RAS pathway mutation was significant only for distal tumors. A PI3K pathway mutation was associated with better RFS for CRC patients treated with adjuvant chemotherapy, and an RTK
Systematic reconstruction of autism biology from massive genetic mutation profiles.
Luo, Weijun; Zhang, Chaolin; Jiang, Yong-Hui; Brouwer, Cory R
2018-04-01
Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3',5'-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein-coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity.
A case of lung adenocarcinoma harboring EGFR mutation and EML4-ALK fusion gene
International Nuclear Information System (INIS)
Tanaka, Hisashi; Hayashi, Akihito; Morimoto, Takeshi; Taima, Kageaki; Tanaka, Yoshihito; Shimada, Michiko; Kurose, Akira; Takanashi, Shingo; Okumura, Ken
2012-01-01
Lung cancer is the leading cause of cancer-related death worldwide. Epidermal growth factor receptor (EGFR) - tyrosine kinase inhibitor (TKI) is used for the patients with EGFR-mutant lung cancer. Recently, phase III studies in the patients with EGFR-mutant demonstrated that EGFR-TKI monotherapy improved progression-free survival compared with platinum-doublet chemotherapy. The echinoderm microtubule-associated protein-like 4 (EML4) - anaplastic lymphoma kinase (ALK) fusion oncogene represents one of the newest molecular targets in non-small cell lung cancer (NSCLC). Patients who harbor EML4-ALK fusions have been associated with a lack of EGFR or KRAS mutations. We report a 39-year-old patient diagnosed as adenocarcinoma harboring EGFR mutation and EML4-ALK fusion gene. We treated this patient with erlotinib as the third line therapy, but no clinical benefit was obtained. We experienced a rare case with EGFR mutation and EML4-ALK. Any clinical benefit using EGFR-TKI was not obtained in our case. The therapeutic choice for the patients with more than one driver mutations is unclear. We needs further understanding of the lung cancer molecular biology and the biomarker infomation
Directory of Open Access Journals (Sweden)
Celine Hebras
Full Text Available Aurora kinases are key proteins found throughout the eukaryotes that control mitotic progression. Vertebrate Aurora-A and B kinases are thought to have evolved from a single Aurora-kinase isoform closest to that found in present day urochordates. In urochordate ascidians Aurora binds both TPX2 (a vertebrate AURKA partner and INCENP (a vertebrate AURKB partner and localizes to centrosomes and spindle microtubules as well as chromosomes and midbody during both meiosis and mitosis. Ascidian Aurora also displays this localization pattern during mitosis in echinoderms, strengthening the idea that non-vertebrate deuterostomes such as the urochordates and echinoderms possess a single form of Aurora kinase that has properties of vertebrate Aurora-kinase A and B. In the ascidian, TPX2 localizes to the centrosome and the spindle poles also as in vertebrates. However, we were surprised to find that TPX2 also localized strongly to the midbody in ascidian eggs and embryos. We thus examined more closely Aurora localization to the midbody by creating two separate point mutations of ascidian Aurora predicted to perturb binding to TPX2. Both forms of mutated Aurora behaved as predicted: neither localized to spindle poles where TPX2 is enriched. Interestingly, neither form of mutated Aurora localized to the midbody where TPX2 is also enriched, suggesting that ascidian Aurora midbody localization required TPX2 binding in ascidians. Functional analysis revealed that inhibition of Aurora kinase with a pharmacological inhibitor or with a dominant negative kinase dead form of Aurora caused cytokinesis failure and perturbed midbody formation during polar body extrusion. Our data support the view that vertebrate Aurora-A and B kinases evolved from a single non-vertebrate deuterostome ancestor. Moreover, since TPX2 localizes to the midbody in ascidian eggs and cleavage stage embryos it may be worthwhile re-assessing whether Aurora A kinase or TPX2 localize to the midbody
Induced plasmon mutations affecting the growth habit of peanuts, A. hypogaea L
International Nuclear Information System (INIS)
Levy, A.; Ashri, A.
1978-01-01
The effectiveness of the acridines ethidium bromide (EB) and acriflavine in inducing plasmon mutations was compared with the alkylating agents ethyl methanesulphonate (EMS) and diethyl sulphate and to γ-rays. The growth habit (trailing versus bunch) of peanuts (A. hypogaea), controlled by genic-cytoplasmic interactions, was utilized. Breeding tests distinguishing nuclear from plasmon mutations were developed and are described in detail. Plasmon mutations were induced, but there were differences in mutation yields between the cultivars and the mutagens. (Auth.)
Manickam, Kandamurugu; Donoghue, Daniel J; Meyer, April N; Snyder, Pamela J; Prior, Thomas W
2014-01-01
Severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN) is an extremely rare severe skeletal dysplasia characterized by significant developmental delay, brain structural abnormalities, hearing loss, and acanthosis nigricans. The disorder is the result of a single missense mutation at codon 650 (p.Lys650Met) in the fibroblast growth factor receptor 3 gene (FGFR3). We describe a child who initially presented with a mild achondroplasia or hypochondroplasia like phenotype. Molecular analysis of the FGFR3 gene showed the common SADDAN mutation and a second novel mutation at codon 651 (p.Thr651Pro). Both mutations were shown to occur on the same allele (cis) and de novo. Transient transfection studies with FGFR3 double mutant constructs show that the p.Thr651Pro mutation causes a dramatic decrease in constitutive receptor kinase activity than that observed by the p.Lys650Met mutation. Our data suggest that the molecular effect by the p.Thr651Pro is to elicit a conformational change that decreases the FGFR3 tyrosine kinase activity, which is constitutively activated by the SADDAN mutation. Due to the inheritance of both a gain-of-function and a loss-of-function mutation, we conclude that a reduction of constitutive activation caused the milder skeletal phenotype. Although the occurrence of double mutations are expected to be rare, the presence of other FGFR3 modifiers may be responsible for some of the clinically discrepant skeletal dysplasia cases. © 2013 Wiley Periodicals, Inc.
Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A; Kuiper, Raoul V; Curbo, Sophie; Karlsson, Anna
2013-02-15
A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK(+/-) transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK(+/-)TK2(-/-) mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK(+/-)TK2(-/-) mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency.
Lorenz, Sonja; Deng, Patricia; Hantschel, Oliver; Superti-Furga, Giulio; Kuriyan, John
2015-06-01
Constitutive activation of the non-receptor tyrosine kinase c-Abl (cellular Abelson tyrosine protein kinase 1, Abl1) in the Bcr (breakpoint cluster region)-Abl1 fusion oncoprotein is the molecular cause of chronic myeloid leukaemia (CML). Recent studies have indicated that an interaction between the SH2 (Src-homology 2) domain and the N-lobe (N-terminal lobe) of the c-Abl kinase domain (KD) has a critical role in leukaemogenesis [Grebien et al. (2011) Cell 147, 306-319; Sherbenou et al. (2010) Blood 116, 3278-3285]. To dissect the structural basis of this phenomenon, we studied c-Abl constructs comprising the SH2 and KDs in vitro. We present a crystal structure of an SH2-KD construct bound to dasatinib, which contains the relevant interface between the SH2 domain and the N-lobe of the KD. We show that the presence of the SH2 domain enhances kinase activity moderately and that this effect depends on contacts in the SH2/N-lobe interface and is abrogated by specific mutations. Consistently, formation of the interface decreases slightly the association rate of imatinib with the KD. That the effects are small compared with the dramatic in vivo consequences suggests an important function of the SH2-N-lobe interaction might be to help disassemble the auto-inhibited conformation of c-Abl and promote processive phosphorylation, rather than substantially stimulate kinase activity.
TZORTZATOS, GERASIMOS; ARAVIDIS, CHRISTOS; LINDBLOM, ANNIKA; MINTS, MIRIAM; THAM, EMMA
2015-01-01
Cowden syndrome (CS) is an autosomal dominant disorder characterized by multiple hamartomas in the breast, thyroid and endometrium, with a prevalence of 1 per 250,000. Females with CS have a 21–28% lifetime risk of developing uterine cancer. Germline mutations in the phosphatase and tensin homolog (PTEN) gene, a tumor suppressor gene, are responsible for 30–80% of CS cases. PTEN is a nine-exon gene, located on chromosome 10q23.3, which encodes the 403 amino acid PTEN protein. It negatively regulates the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin pathway, affecting various cellular processes and signaling pathways. The present study examined whether PTEN mutations are present in CS-like families with uterine cancer (UC). UC patients underwent surgery at Karolinska University Hospital, Stockholm, Sweden (2008–2012). Pedigrees were analyzed and 54 unrelated CS-like families were identified. CS-like families were defined as having at least one occurrence of uterine cancer and one of breast cancer, as well as at least one additional Cowden-associated tumor (uterine, breast, thyroid, colon or kidney cancer) in the same individual or in first-degree relatives. Genomic DNA was amplified using polymerase chain reaction, and DNA sequencing analysis of all nine exons of the PTEN gene was conducted. No germline PTEN mutations or polymorphisms were identified. Germline PTEN mutations are rare in CS-like families with uterine cancer, therefore, genetic screening must be restricted to patients that meet the strict National Comprehensive Cancer Network criteria. Gynecologists must be aware of the CS criteria and identify potential cases of CS in females where uterine cancer is the sentinel cancer. PMID:25789042
Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.
1994-01-01
The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...
A Novel Method to Screen for Dominant Negative ATM Mutations in Familial Breast Cancer
National Research Council Canada - National Science Library
Khanna, Kum K; Chenevix-Trench, Georgia; Grimmond, Sean
2005-01-01
The aim of this proposal is to identify families carrying potentially pathogenic A TM mutations by assaying for ATM kinase activity in cell lines derived from individuals with multiple cases of breast...
Directory of Open Access Journals (Sweden)
Eijiro Yamada
Full Text Available Fyn-deficient mice display increased AMP-activated Protein Kinase (AMPK activity as a result of Fyn-dependent regulation of Liver Kinase B1 (LKB1 in skeletal muscle. Mutation of Fyn-specific tyrosine sites in LKB1 results in LKB1 export into the cytoplasm and increased AMPK activation site phosphorylation. This study characterizes the structural elements responsible for the physical interaction between Fyn and LKB1. Effects of point mutations in the Fyn SH2/SH3 domains and in the LKB1 proline-rich motif on 1 Fyn and LKB1 binding, 2 LKB1 subcellular localization and 3 AMPK phosphorylation were investigated in C2C12 muscle cells. Additionally, novel LKB1 proline-rich motif mimicking cell permeable peptides were generated to disrupt Fyn/LKB1 binding and investigate the consequences on AMPK activity in both C2C12 cells and mouse skeletal muscle. Mutation of either Fyn SH3 domain or the proline-rich motif of LKB1 resulted in the disruption of Fyn/LKB1 binding, re-localization of 70% of LKB1 signal in the cytoplasm and a 2-fold increase in AMPK phosphorylation. In vivo disruption of the Fyn/LKB1 interaction using LKB1 proline-rich motif mimicking cell permeable peptides recapitulated Fyn pharmacological inhibition. We have pinpointed the structural elements within Fyn and LKB1 that are responsible for their binding, demonstrating the functionality of this interaction in regulating AMPK activity.
Signaling by Kit protein-tyrosine kinase--the stem cell factor receptor.
Roskoski, Robert
2005-11-11
Signaling by stem cell factor and Kit, its receptor, plays important roles in gametogenesis, hematopoiesis, mast cell development and function, and melanogenesis. Moreover, human and mouse embryonic stem cells express Kit transcripts. Stem cell factor exists as both a soluble and a membrane-bound glycoprotein while Kit is a receptor protein-tyrosine kinase. The complete absence of stem cell factor or Kit is lethal. Deficiencies of either produce defects in red and white blood cell production, hypopigmentation, and sterility. Gain-of-function mutations of Kit are associated with several human neoplasms including acute myelogenous leukemia, gastrointestinal stromal tumors, and mastocytomas. Kit consists of an extracellular domain, a transmembrane segment, a juxtamembrane segment, and a protein kinase domain that contains an insert of about 80 amino acid residues. Binding of stem cell factor to Kit results in receptor dimerization and activation of protein kinase activity. The activated receptor becomes autophosphorylated at tyrosine residues that serve as docking sites for signal transduction molecules containing SH2 domains. The adaptor protein APS, Src family kinases, and Shp2 tyrosyl phosphatase bind to phosphotyrosine 568. Shp1 tyrosyl phosphatase and the adaptor protein Shc bind to phosphotyrosine 570. C-terminal Src kinase homologous kinase and the adaptor Shc bind to both phosphotyrosines 568 and 570. These residues occur in the juxtamembrane segment of Kit. Three residues in the kinase insert domain are phosphorylated and attract the adaptor protein Grb2 (Tyr703), phosphatidylinositol 3-kinase (Tyr721), and phospholipase Cgamma (Tyr730). Phosphotyrosine 900 in the distal kinase domain binds phosphatidylinositol 3-kinase which in turn binds the adaptor protein Crk. Phosphotyrosine 936, also in the distal kinase domain, binds the adaptor proteins APS, Grb2, and Grb7. Kit has the potential to participate in multiple signal transduction pathways as a result of
A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.
Johnson, E M; Schnabelrauch, L S; Sears, B B
1991-01-01
Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.
Directory of Open Access Journals (Sweden)
Wang H
2018-05-01
Full Text Available Han Wang,1–3 Yao Wang,1–3 Wentao Guo,4 Bin Du,1–3 Xiaobing Huang,1–3 Riping Wu,1–3 Baoyu Yang,1–3 Xiaoyan Lin,1–3,5 Yilan Wu6 1Department of Medical Oncology, Fujian Medical University Union Hospital, Fuzhou, People’s Republic of China; 2Stem Cell Research Institute, Fujian Medical University, Fuzhou, People’s Republic of China; 3Fujian Key Laboratory of Translational Cancer Medicine, Fuzhou, People’s Republic of China; 4School of Pharmacy, Wenzhou Medical University, Wenzhou, People’s Republic of China; 5Graduate School of Education, Fujian Medical University, Fuzhou, People’s Republic of China; 6School of Nursing, Fujian University of Traditional Chinese Medicine, Fuzhou, People’s Republic of China Background: Mutated anaplastic lymphoma kinase (ALK drives the development of advanced non-small cell lung cancer (NSCLC. Most reported small-molecule inhibitors targeting the ALK domain do not display good inhibition of the G1202R solvent front mutation. The solvent front mutation was assumed to hinder drug binding. However, a different fact could be uncovered by the simulations reported in this study through a structural analog of alectinib (JH-VIII-157-02, which demonstrated potent effects against the G1202R mutation. Methods: Molecular docking, conventional molecular dynamics (MD simulations, free energy calculations, and umbrella sampling (US simulations were carried out to make clear the principles of the binding preferences of alectinib and JH-VIII-157-02 toward ALKWT and the ALK G1202R (ALKG1202R mutation. Results: JH-VIII-157-02 has similar binding affinities to both ALKWT and ALKG1202R whereas it has has a much lower binding affinity for alectinib to ALKG1202R. Analysis of individual energy terms indicate the major variation involves the van der Waals and entropy terms. Structural analysis reveals that the conformational change of the ATP-binding glycine-rich loop was primarily responsible for the alectinib
Mutation in GNE Downregulates Peroxiredoxin IV Altering ER Redox Homeostasis.
Chanana, Pratibha; Padhy, Gayatri; Bhargava, Kalpana; Arya, Ranjana
2017-12-01
GNE myopathy is a rare neuromuscular genetic disorder characterized by early adult onset and muscle weakness due to mutation in sialic acid biosynthetic enzyme, UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE). More than 180 different GNE mutations are known all over the world with unclear pathomechanism. Although hyposialylation of glycoproteins is speculated to be the major cause, but cellular mechanism leading to loss of muscle mass has not yet been deciphered. Besides sialic acid biosynthesis, GNE affects other cellular functions such as cell adhesion and apoptosis. In order to understand the effect of mutant GNE protein on cellular functions, differential proteome profile of HEK293 cells overexpressing pathologically relevant recombinant mutant GNE protein (D207V and V603L) was analyzed. These cells, along with vector control and wild-type GNE-overexpressing cells, were subjected to two-dimensional gel electrophoresis coupled with mass spectrometry (MALDI-TOF/TOF MS/MS). In the study, 10 differentially expressed proteins were identified. Progenesis same spots software revealed downregulation of peroxiredoxin IV (PrdxIV), an ER-resident H 2 O 2 sensor that regulates neurogenesis. Significant reduction in mRNA and protein levels of PrdxIV was observed in GNE mutant cell lines compared with vector control. However, neither total reactive oxygen species was altered nor H 2 O 2 accumulation was observed in GNE mutant cell lines. Interestingly, ER redox state was significantly affected due to reduced normal GNE enzyme activity. Our study indicates that downregulation of PrdxIV affects ER redox state that may contribute to misfolding and aggregation of proteins in GNE myopathy.
Cherel, Pierre; Pires, José; Glénisson, Jérôme; Milan, Denis; Iannuccelli, Nathalie; Herault, Frédéric; Damon, Marie; Le Roy, Pascale
2011-01-01
Abstract Background Detection of quantitative trait loci (QTLs) affecting meat quality traits in pigs is crucial for the design of efficient marker-assisted selection programs and to initiate efforts toward the identification of underlying polymorphisms. The RYR1 and PRKAG3 causative mutations, originally identified from major effects on meat characteristics, can be used both as controls for an overall QTL detection strategy for diversely affected traits and as a scale for detected QTL effect...
Watanabe, Daisuke; Araki, Yuya; Zhou, Yan; Maeya, Naoki; Akao, Takeshi; Shimoi, Hitoshi
2012-06-01
Sake yeast cells have defective entry into the quiescent state, allowing them to sustain high fermentation rates. To reveal the underlying mechanism, we investigated the PAS kinase Rim15p, which orchestrates initiation of the quiescence program in Saccharomyces cerevisiae. We found that Rim15p is truncated at the carboxyl terminus in modern sake yeast strains as a result of a frameshift mutation. Introduction of this mutation or deletion of the full-length RIM15 gene in a laboratory strain led to a defective stress response, decreased synthesis of the storage carbohydrates trehalose and glycogen, and impaired G(1) arrest, which together closely resemble the characteristic phenotypes of sake yeast. Notably, expression of a functional RIM15 gene in a modern sake strain suppressed all of these phenotypes, demonstrating that dysfunction of Rim15p prevents sake yeast cells from entering quiescence. Moreover, loss of Rim15p or its downstream targets Igo1p and Igo2p remarkably improved the fermentation rate in a laboratory strain. This finding verified that Rim15p-mediated entry into quiescence plays pivotal roles in the inhibition of ethanol fermentation. Taken together, our results suggest that the loss-of-function mutation in the RIM15 gene may be the key genetic determinant of the increased ethanol production rates in modern sake yeast strains.
Peng, Xiao-Nu; Wang, Jing; Zhang, Wei
2017-08-01
Non-small cell lung cancer etiology and its treatment failure are due to epidermal growth factor receptor (EGFR) kinase domain mutations at amino acid position 790. The mutational change from threonine to methionine at position 790 (T790M) is responsible for tyrosine kinase inhibition failure. Using molecular dynamic simulation, the present study investigated the architectural changes occurring at the atomic scale. The 50-nsec runs using a GROMOS force field for wild-type and mutant EGFR's kinase domains were investigated for contrasting variations using Gromacs inbuilt tools. The adenosine triphosphate binding domain and the active site of EGFR were studied extensively in order to understand the structural changes. All the parameters investigated in the present study revealed considerable changes in the studied structures, and the knowledge gained from this may be used to develop novel kinase inhibitors that will be effective irrespective of the structural alterations in kinase domain.
Three-Dimentional Structures of Autophosphorylation Complexes in Crystals of Protein Kinases
Dumbrack, Roland
2016-01-26
Protein kinase autophosphorylation is a common regulatory mechanism in cell signaling pathways. Several autophosphorylation complexes have been identified in crystals of protein kinases, with a known serine, threonine, or tyrosine autophosphorylation site of one kinase monomer sitting in the active site of another monomer of the same protein in the crystal. We utilized a structural bioinformatics method to identify all such autophosphorylation complexes in X-ray crystallographic structures in the Protein Data Bank (PDB) by generating all unique kinase/kinase interfaces within and between asymmetric units of each crystal and measuring the distance between the hydroxyl oxygen of potential autophosphorylation sites and the oxygen atoms of the active site aspartic acid residue side chain. We have identified 15 unique autophosphorylation complexes in the PDB, of which 5 complexes have not previously been described in the relevant publications on the crystal structures (N-terminal juxtamembrane regions of CSF1R and EPHA2, activation loop tyrosines of LCK and IGF1R, and a serine in a nuclear localization signal region of CLK2. Mutation of residues in the autophosphorylation complex interface of LCK either severely impaired autophosphorylation or increased it. Taking the autophosphorylation complexes as a whole and comparing them with peptide-substrate/kinase complexes, we observe a number of important features among them. The novel and previously observed autophosphorylation sites are conserved in many kinases, indicating that by homology we can extend the relevance of these complexes to many other clinically relevant drug targets.
Fedyna, Alison; Drayna, Dennis; Kang, Changsoo
2010-01-01
Stuttering is a disorder which affects the fluency of speech. It has been shown to have high heritability, and has recently been linked to mutations in the GNPTAB gene. One such mutation, Glu1200Lys, has been repeatedly observed in unrelated families and individual cases. Eight unrelated individuals carrying this mutation were analyzed in an effort to distinguish whether these arise from repeated mutation at the same site, or whether they represent a founder mutation with a single origin. Results show that all 12 chromosomes carrying this mutation share a common haplotype in this region, indicating it is a founder mutation. Further analysis estimated the age of this allele to be ~572 generations. Construction of a cladogram tracing the mutation through our study sample also supports the founder mutation hypothesis. PMID:20944643
Venkitachalam, Srividya; Chueh, Fu-Yu; Leong, King-Fu; Pabich, Samantha; Yu, Chao-Lan
2011-03-01
Lymphocyte-specific protein tyrosine kinase (Lck) plays a key role in T cell signal transduction and is tightly regulated by phosphorylation and dephosphorylation. Lck can function as an oncoprotein when overexpressed or constantly activated by mutations. Our previous studies showed that Lck-induced cellular transformation could be suppressed by enforced expression of suppressor of cytokine signaling 1 (SOCS1), a SOCS family member involved in the negative feedback control of cytokine signaling. We observed attenuated Lck kinase activity in SOCS1-expressing cells, suggesting an important role of SOCS in regulating Lck functions. It remains largely unknown whether and how SOCS proteins interact with the oncogenic Lck kinase. Here, we report that among four SOCS family proteins, SOCS1, SOCS2, SOCS3 and CIS (cytokine-inducible SH2 domain containing protein), SOCS1 has the highest affinity in binding to the oncogenic Lck kinase. We identified the positive regulatory phosphotyrosine 394 residue in the kinase domain as the key interacting determinant in Lck. Additionally, the Lck kinase domain alone is sufficient to bind SOCS1. While the SH2 domain in SOCS1 is important in its association with the oncogenic Lck kinase, other functional domains may also contribute to overall binding affinity. These findings provide important mechanistic insights into the role of SOCS proteins as tumor suppressors in cells transformed by oncogenic protein tyrosine kinases.
Directory of Open Access Journals (Sweden)
Chi Hoon Maeng
Full Text Available Given the high incidence of metastatic esophageal squamous cell carcinoma, especially in Asia, we screened for the presence of somatic mutations using OncoMap platform with the aim of defining subsets of patients who may be potential candidate for targeted therapy.We analyzed 87 tissue specimens obtained from 80 patients who were pathologically confirmed with esophageal squamous cell carcinoma and received 5-fluoropyrimidine/platinum-based chemotherapy. OncoMap 4.0, a mass-spectrometry based assay, was used to interrogate 471 oncogenic mutations in 41 commonly mutated genes. Tumor specimens were prepared from primary cancer sites in 70 patients and from metastatic sites in 17 patients. In order to test the concordance between primary and metastatic sites from the patient for mutations, we analyzed 7 paired (primary-metastatic specimens. All specimens were formalin-fixed paraffin embedded tissues and tumor content was >70%.In total, we have detected 20 hotspot mutations out of 80 patients screened. The most frequent mutation was PIK3CA mutation (four E545K, five H1047R and one H1047L (N = 10, 11.5% followed by MLH1 V384D (N = 7, 8.0%, TP53 (R306, R175H and R273C (N = 3, 3.5%, BRAF V600E (N = 1, 1.2%, CTNNB1 D32N (N = 1, 1.2%, and EGFR P733L (N = 1, 1.2%. Distributions of somatic mutations were not different according to anatomic sites of esophageal cancer (cervical/upper, mid, lower. In addition, there was no difference in frequency of mutations between primary-metastasis paired samples.Our study led to the detection of potentially druggable mutations in esophageal SCC which may guide novel therapies in small subsets of esophageal cancer patients.
Huang, Yuanyuan; Zhang, Hao; Tian, Hongming; Li, Cheng; Han, Shuangyan; Lin, Ying; Zheng, Suiping
2015-09-01
N-acetyl glutamate kinase (NAGK) is a key enzyme in the synthesis of L-arginine that is inhibited by its end product L-arginine in Corynebacterium glutamicum (C. glutamicum). In this study, the potential binding sites of arginine and the residues essential for its inhibition were identified by homology modeling, inhibitor docking, and site-directed mutagenesis. The allosteric inhibition of NAGK was successfully alleviated by a mutation, as determined through analysis of mutant enzymes, which were overexpressed in vivo in C. glutamicum ATCC14067. Analysis of the mutant enzymes and docking analysis demonstrated that residue W23 positions an arginine molecule, and the interaction between arginine and residues L282, L283, and T284 may play an important role in the remote inhibitory process. Based on the results of the docking analysis of the effective mutants, we propose a linkage mechanism for the remote allosteric regulation of NAGK activity, in which residue R209 may play an essential role. In this study, the structure of the arginine-binding site of C. glutamicum NAGK (CgNAGK) was successfully predicted and the roles of the relevant residues were identified, providing new insight into the allosteric regulation of CgNAGK activity and a solid platform for the future construction of an optimized L-arginine producing strain.
Myosin light chain kinase phosphorylation in tracheal smooth muscle
International Nuclear Information System (INIS)
Stull, J.T.; Hsu, L.C.; Tansey, M.G.; Kamm, K.E.
1990-01-01
Purified myosin light chain kinase from smooth muscle is phosphorylated by cyclic AMP-dependent protein kinase, protein kinase C, and the multifunctional calmodulin-dependent protein kinase II. Because phosphorylation in a specific site (site A) by any one of these kinases desensitizes myosin light chain kinase to activation by Ca2+/calmodulin, kinase phosphorylation could play an important role in regulating smooth muscle contractility. This possibility was investigated in 32 P-labeled bovine tracheal smooth muscle. Treatment of tissues with carbachol, KCl, isoproterenol, or phorbol 12,13-dibutyrate increased the extent of kinase phosphorylation. Six primary phosphopeptides (A-F) of myosin light chain kinase were identified. Site A was phosphorylated to an appreciable extent only with carbachol or KCl, agents which contract tracheal smooth muscle. The extent of site A phosphorylation correlated to increases in the concentration of Ca2+/calmodulin required for activation. These results show that cyclic AMP-dependent protein kinase and protein kinase C do not affect smooth muscle contractility by phosphorylating site A in myosin light chain kinase. It is proposed that phosphorylation of myosin light chain kinase in site A in contracting tracheal smooth muscle may play a role in the reported desensitization of contractile elements to activation by Ca2+
Mutations in PIK3CA are infrequent in neuroblastoma
International Nuclear Information System (INIS)
Dam, Vincent; Morgan, Brian T; Mazanek, Pavel; Hogarty, Michael D
2006-01-01
Neuroblastoma is a frequently lethal pediatric cancer in which MYCN genomic amplification is highly correlated with aggressive disease. Deregulated MYC genes require co-operative lesions to foster tumourigenesis and both direct and indirect evidence support activated Ras signaling for this purpose in many cancers. Yet Ras genes and Braf, while often activated in cancer cells, are infrequent targets for activation in neuroblastoma. Recently, the Ras effector PIK3CA was shown to be activated in diverse human cancers. We therefore assessed PIK3CA for mutation in human neuroblastomas, as well as in neuroblastomas arising in transgenic mice with MYCN overexpressed in neural-crest tissues. In this murine model we additionally surveyed for Ras family and Braf mutations as these have not been previously reported. Sixty-nine human neuroblastomas (42 primary tumors and 27 cell lines) were sequenced for PIK3CA activating mutations within the C2, helical and kinase domain 'hot spots' where 80% of mutations cluster. Constitutional DNA was sequenced in cases with confirmed alterations to assess for germline or somatic acquisition. Additionally, Ras family members (Hras1, Kras2 and Nras) and the downstream effectors Pik3ca and Braf, were sequenced from twenty-five neuroblastomas arising in neuroblastoma-prone transgenic mice. We identified mutations in the PIK3CA gene in 2 of 69 human neuroblastomas (2.9%). Neither mutation (R524M and E982D) has been studied to date for effects on lipid kinase activity. Though both occurred in tumors with MYCN amplification the overall rate of PIK3CA mutations in MYCN amplified and single-copy tumors did not differ appreciably (2 of 31 versus 0 of 38, respectively). Further, no activating mutations were identified in a survey of Ras signal transduction genes (including Hras1, Kras2, Nras, Pik3ca, or Braf genes) in twenty-five neuroblastic tumors arising in the MYCN-initiated transgenic mouse model. These data suggest that activating
The role of the C8 proton of ATP in the catalysis of shikimate kinase and adenylate kinase
Directory of Open Access Journals (Sweden)
Kenyon Colin P
2012-08-01
Full Text Available Abstract Background It has been demonstrated that the adenyl moiety of ATP plays a direct role in the regulation of ATP binding and/or phosphoryl transfer within a range of kinase and synthetase enzymes. The role of the C8-H of ATP in the binding and/or phosphoryl transfer on the enzyme activity of a number of kinase and synthetase enzymes has been elucidated. The intrinsic catalysis rate mediated by each kinase enzyme is complex, yielding apparent KM values ranging from less than 0.4 μM to more than 1 mM for ATP in the various kinases. Using a combination of ATP deuterated at the C8 position (C8D-ATP as a molecular probe with site directed mutagenesis (SDM of conserved amino acid residues in shikimate kinase and adenylate kinase active sites, we have elucidated a mechanism by which the ATP C8-H is induced to be labile in the broader kinase family. We have demonstrated the direct role of the C8-H in the rate of ATP consumption, and the direct role played by conserved Thr residues interacting with the C8-H. The mechanism by which the vast range in KM might be achieved is also suggested by these findings. Results We have demonstrated the mechanism by which the enzyme activities of Group 2 kinases, shikimate kinase (SK and adenylate kinase 1 (AK1, are controlled by the C8-H of ATP. Mutations of the conserved threonine residues associated with the labile C8-H cause the enzymes to lose their saturation kinetics over the concentration range tested. The relationship between the role C8-H of ATP in the reaction mechanism and the ATP concentration as they influence the saturation kinetics of the enzyme activity is also shown. The SDM clearly identified the amino acid residues involved in both the catalysis and regulation of phosphoryl transfer in SK and AK1 as mediated by C8H-ATP. Conclusions The data outlined serves to demonstrate the “push” mechanism associated with the control of the saturation kinetics of Group 2 kinases mediated by ATP C8-H. It
Noonan syndrome gain-of-function mutations in NRAS cause zebrafish gastrulation defects
Runtuwene, V.J.; van Eekelen, M.J.L.; Overvoorde, J.; Rehmann, H.; Yntema, H.G.; Nillesen, W.M.; van Haeringen, A.; van der Burgt, I.; Burgering, B.; den Hertog, J.
2011-01-01
Noonan syndrome is a relatively common developmental disorder that is characterized by reduced growth, wide-set eyes and congenital heart defects. Noonan syndrome is associated with dysregulation of the Ras-mitogen-activated-protein-kinase (MAPK) signaling pathway. Recently, two mutations in NRAS
Directory of Open Access Journals (Sweden)
Yusuke Echigoya
Full Text Available Duchenne muscular dystrophy (DMD, one of the most common and lethal genetic disorders, and the mdx mouse myopathies are caused by a lack of dystrophin protein. These dystrophic muscles contain sporadic clusters of dystrophin-expressing revertant fibers (RFs, as detected by immunohistochemistry. RFs are known to arise from muscle precursor cells with spontaneous exon skipping (alternative splicing and clonally expand in size with increasing age through the process of muscle degeneration/regeneration. The expansion of revertant clusters is thought to represent the cumulative history of muscle regeneration and proliferation of such precursor cells. However, the precise mechanisms by which RFs arise and expand are poorly understood. Here, to test the effects of mutation types and aging on RF expansion and muscle regeneration, we examined the number of RFs in mdx mice (containing a nonsense mutation in exon 23 and mdx52 mice (containing deletion mutation of exon 52 with the same C57BL/6 background at 2, 6, 12, and 18months of age. Mdx mice displayed a significantly higher number of RFs compared to mdx52 mice in all age groups, suggesting that revertant fiber expansion largely depends on the type of mutation and/or location in the gene. A significant increase in the expression and clustering levels of RFs was found beginning at 6months of age in mdx mice compared with mdx52 mice. In contrast to the significant expansion of RFs with increasing age, the number of centrally nucleated fibers and embryonic myosin heavy chain-positive fibers (indicative of cumulative and current muscle regeneration, respectively decreased with age in both mouse strains. These results suggest that mutation types and aging differently affect revertant fiber expansion in mdx and mdx52 mice.
Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.
Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco
2017-01-01
Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.
JAK2 mutations and clinical practice in myeloproliferative neoplasms.
Tefferi, Ayalew
2007-01-01
With the discovery in the last 3 years of novel Janus kinase 2 (JAK2) and thrombopoietin receptor (MPL) mutations, the pathogenetic understanding of and clinical practice for myeloproliferative neoplasms (MPNs) have entered a new era. Each one of these newly discovered mutations, including JAK2V617F, MPLW515L, and a JAK2 exon 12 mutation, has been shown to result in constitutive activation of JAK-STAT signaling and also induce a MPN phenotype in mice. Thus, JAK2 is now considered to be a legitimate target for drug development in MPNs, and small molecule JAK2 inhibitors have already gone through successful preclinical testing, and early-phase human trials in primary myelofibrosis have already begun. Furthermore, JAK2 mutation screening has now become a front-line diagnostic test in the evaluation of both "erythrocytosis" and thrombocytosis and the 2001 World Health Organization diagnostic criteria for polycythemia vera, essential thrombocythemia, and primary myelofibrosis have now been revised to incorporate JAK2V617F mutation screening.
Granovsky, Alexey E; Clark, Matthew C; McElheny, Dan; Heil, Gary; Hong, Jia; Liu, Xuedong; Kim, Youngchang; Joachimiak, Grazyna; Joachimiak, Andrzej; Koide, Shohei; Rosner, Marsha Rich
2009-03-01
Raf kinase inhibitory protein (RKIP/PEBP1), a member of the phosphatidylethanolamine binding protein family that possesses a conserved ligand-binding pocket, negatively regulates the mammalian mitogen-activated protein kinase (MAPK) signaling cascade. Mutation of a conserved site (P74L) within the pocket leads to a loss or switch in the function of yeast or plant RKIP homologues. However, the mechanism by which the pocket influences RKIP function is unknown. Here we show that the pocket integrates two regulatory signals, phosphorylation and ligand binding, to control RKIP inhibition of Raf-1. RKIP association with Raf-1 is prevented by RKIP phosphorylation at S153. The P74L mutation increases kinase interaction and RKIP phosphorylation, enhancing Raf-1/MAPK signaling. Conversely, ligand binding to the RKIP pocket inhibits kinase interaction and RKIP phosphorylation by a noncompetitive mechanism. Additionally, ligand binding blocks RKIP association with Raf-1. Nuclear magnetic resonance studies reveal that the pocket is highly dynamic, rationalizing its capacity to interact with distinct partners and be involved in allosteric regulation. Our results show that RKIP uses a flexible pocket to integrate ligand binding- and phosphorylation-dependent interactions and to modulate the MAPK signaling pathway. This mechanism is an example of an emerging theme involving the regulation of signaling proteins and their interaction with effectors at the level of protein dynamics.
Metts, J; West, J; Doares, S H; Matthysse, A G
1991-01-01
Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was d...
Vancraenenbroeck, Renée; Lobbestael, Evy; Weeks, Stephen D; Strelkov, Sergei V; Baekelandt, Veerle; Taymans, Jean-Marc; De Maeyer, Marc
2012-03-01
Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of familial Parkinson's disease. Much research effort has been directed towards the catalytic core region of LRRK2 composed of GTPase (ROC, Ras of complex proteins) and kinase domains and a connecting COR (C-terminus of ROC) domain. In contrast, the precise functions of the protein-protein interaction domains, such as the leucine-rich repeat (LRR) domain, are not known. In the present study, we modeled the LRRK2 LRR domain (LRR(LRRK2)) using a template assembly approach, revealing the presence of 14 LRRs. Next, we focused on the expression and purification of LRR(LRRK2) in Escherichia coli. Buffer optimization revealed that the protein requires the presence of a zwitterionic detergent, namely Empigen BB, during solubilization and the subsequent purification and characterization steps. This indicates that the detergent captures the hydrophobic surface patches of LRR(LRRK2) thereby suppressing its aggregation. Circular dichroism (CD) spectroscopy measured 18% α-helices and 21% β-sheets, consistent with predictions from the homology model. Size exclusion chromatography (SEC) and dynamic light scattering measurements showed the presence of a single species, with a Stokes radius corresponding to the model dimensions of a protein monomer. Furthermore, no obvious LRR(LRRK2) multimerization was detected via cross-linking studies. Finally, the LRR(LRRK2) clinical mutations did not influence LRR(LRRK2) secondary, tertiary or quaternary structure as determined via SEC and CD spectroscopy. We therefore conclude that these mutations are likely to affect putative LRR(LRRK2) inter- and intramolecular interactions. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Katherine A. McCulloch
2017-07-01
Full Text Available Acetylcholine (ACh receptors (AChR regulate neural circuit activity in multiple contexts. In humans, mutations in ionotropic acetylcholine receptor (iAChR genes can cause neurological disorders, including myasthenia gravis and epilepsy. In Caenorhabditis elegans, iAChRs play multiple roles in the locomotor circuit. The cholinergic motor neurons express an ACR-2-containing pentameric AChR (ACR-2R comprised of ACR-2, ACR-3, ACR-12, UNC-38, and UNC-63 subunits. A gain-of-function mutation in the non-α subunit gene acr-2 [acr-2(gf] causes defective locomotion as well as spontaneous convulsions. Previous studies of genetic suppressors of acr-2(gf have provided insights into ACR-2R composition and assembly. Here, to further understand how the ACR-2R regulates neuronal activity, we expanded the suppressor screen for acr-2(gf-induced convulsions. The majority of these suppressor mutations affect genes that play critical roles in synaptic transmission, including two novel mutations in the vesicular ACh transporter unc-17. In addition, we identified a role for a conserved major facilitator superfamily domain (MFSD protein, mfsd-6, in regulating neural circuit activity. We further defined a role for the sphingosine (SPH kinase (Sphk sphk-1 in cholinergic neuron activity, independent of previously known signaling pathways. Overall, the genes identified in our study suggest that optimal modulation of synaptic activity is balanced by the differential activities of multiple pathways, and the novel alleles provide valuable reagents to further dissect neuronal mechanisms regulating the locomotor circuit.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Directory of Open Access Journals (Sweden)
Zhitao Niu
2017-11-01
Full Text Available The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1 consistent GC content evolution trends and mutational biases in single-copy (SC and inverted repeats (IRs regions; and (2 that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus.
Niu, Zhitao; Xue, Qingyun; Wang, Hui; Xie, Xuezhu; Zhu, Shuying; Liu, Wei; Ding, Xiaoyu
2017-01-01
The variation of GC content is a key genome feature because it is associated with fundamental elements of genome organization. However, the reason for this variation is still an open question. Different kinds of hypotheses have been proposed to explain the variation of GC content during genome evolution. However, these hypotheses have not been explicitly investigated in whole plastome sequences. Dendrobium is one of the largest genera in the orchid species. Evolutionary studies of the plastomic organization and base composition are limited in this genus. In this study, we obtained the high-quality plastome sequences of D. loddigesii and D. devonianum. The comparison results showed a nearly identical organization in Dendrobium plastomes, indicating that the plastomic organization is highly conserved in Dendrobium genus. Furthermore, the impact of three evolutionary forces—selection, mutational biases, and GC-biased gene conversion (gBGC)—on the variation of GC content in Dendrobium plastomes was evaluated. Our results revealed: (1) consistent GC content evolution trends and mutational biases in single-copy (SC) and inverted repeats (IRs) regions; and (2) that gBGC has influenced the plastome-wide GC content evolution. These results suggest that both mutational biases and gBGC affect GC content in the plastomes of Dendrobium genus. PMID:29099062
Koltovaya, N A; Kholmurodov, Kh T; Kretov, D A
2005-01-01
The central role that cyclin-dependent kinases play in the timing of cell division and the high incidence of genetic alteration of CDKs or deregulation of CDK inhibitors in a number of cancers make CDC28 of the yeast \\textit{Saccharomyces cerevisiae }very attractive model for studies of mechanisms of CDK regulation. Earlier it was found that certain gene mutations including \\textit{cdc28-srm} affect cell cycle progression, maintenance of different genetic structures and increase cell sensitivity to ionizing radiation. A~\\textit{cdc28-srm} mutation is not temperature-sensitive mutation and differs from the known \\textit{cdc28-ts }mutations because it has the evident phenotypic manifestations at 30 $^{\\circ}$C. Sequencing analysis of \\textit{cdc28-srm} revealed a single nucleotide substitution G20S. This is a third glycine in a conserved sequence GxGxxG in the G-rich loop positioned opposite the activation T-loop. Despite its demonstrated importance, the role of the G-loop has remained unclear. The crystal stru...
SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.
Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T
1997-10-31
Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Nygaard, Per
1989-01-01
Using purine auxotrophic strains of Escherichia coli with additional genetic lesions in the pathways of interconversion and salvage of purine compounds, we demonstrated the in vivo function of guanosine kinase and inosine kinase. Mutants with increased ability to utilize guanosine were isolated b...... a purF, a purL or a purM mutation. A revised map location of the gsk gene is presented and the gene order established as proC-acrA-apt-adk-gsk-purE....
Tumor-specific mutations in low-frequency genes affect their functional properties
L. Erdem-Eraslan (Lale); D. Heijsman (Daphne); M. De Wit (Maurice); A.E. Kremer (Andreas); A. Sacchetti (Andrea); P.J. van der Spek (Peter); P.A.E. Sillevis Smitt (Peter); P.J. French (Pim)
2015-01-01
textabstractCausal genetic changes in oligodendrogliomas (OD) with 1p/19q co-deletion include mutations in IDH1, IDH2, CIC, FUBP1, TERT promoter and NOTCH1. However, it is generally assumed that more somatic mutations are required for tumorigenesis. This study aimed to establish whether genes
Inhibition of Axl improves the targeted therapy against ALK-mutated neuroblastoma
Energy Technology Data Exchange (ETDEWEB)
Xu, Fei [Department of Neurology, Sichuan Medical Science Institute and Sichuan Provincial Hospital, Chengdu 610072 (China); Li, Hongling [Department of Radiotherapy, Shanghai First People’s Hospital, Shanghai Jiao Tong University, Shanghai 201620 (China); Sun, Yong, E-mail: sunfanqi2010@163.com [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China)
2014-11-28
Highlights: • First reported Axl is co-expressed with ALK in neuroblastoma tissues and cell lines. • Axl activation promotes cell growth and impairs the efficiency of ALK inhibitor. • Further found silence of Axl leads to increased sensitivity to ALK inhibitors. • Axl inhibitor promotes the efficiency of targeted therapy in vitro and in vivo. • Axl activation should be considered in the clinical application of ALK inhibitors. - Abstract: Neuroblastoma (NB) patients harboring mutated ALK can be expected to potentially benefit from targeted therapy based on ALK tyrosine kinase inhibitor (TKI), such as crizotinib and ceritinib. However, the effect of the treatment varies with different individuals, although with the same genic changes. Axl receptor tyrosine kinase is expressed in a variety of human cancers, but little data are reported in NB, particularly in which carrying mutated ALK. In this study, we focus on the roles of Axl in ALK-mutated NB for investigating rational therapeutic strategy. We found that Axl is expressed in ALK-positive NB tissues and cell lines, and could be effectively activated by its ligand GAS6. Ligand-dependent Axl activation obviously rescued crizotinib-mediated suppression of cell proliferation in ALK-mutated NB cells. Genetic inhibition of Axl with specific small interfering RNA markedly increased the sensitivity of cells to ALK-TKIs. Furthermore, a small-molecule inhibitor of Axl significantly enhanced ALK-targeted therapy, as an increased frequency of apoptosis was observed in NB cells co-expressing ALK and Axl. Taken together, our results demonstrated that activation of Axl could lead to insensitivity to ALK inhibitors, and dual inhibition of ALK and Axl might be a potential therapeutic strategy against ALK-mutated NB.
Mutational analysis of the cell cycle inhibitor Kip1/p27 in childhood leukemia.
Markaki, E-A; Stiakaki, E; Zafiropoulos, A; Arvanitis, D A; Katzilakis, N; Dimitriou, H; Spandidos, D A; Kalmanti, M
2006-07-01
Cyclin-dependent kinases (CDKs) and cyclins, their regulatory subunits, govern cell-cycle progression in eukaryotic cells. Kip1/p27 is the main cyclin-dependent kinase inhibitor, which arrests cell division inhibiting G1-S transition. Kip1/p27 seems to play a critical role in the pathogenesis of several human malignancies and its lower expression has been shown to correlate with a poor prognosis in adult solid tumors. Bone marrow blasts from 49 children with leukemia, 37 acute lymphoblastic leukemia (ALL), and 12 acute myeloid leukemia (AML) were studied. Exon 3 of Kip1/p27 was amplified using the polymerase chain reaction technique (PCR). Single strand conformational polymorphism and heterodouplex analysis were performed to detect DNA sequence with altered conformations and were subsequently sequenced to document mutations. Mutations in Kip1/p27 gene were detected in 2 out of 3 T-ALL, 6 out of 12 AML patients, and only 1 out of 34 B lineage ALL cases. Although the patient groups are small, a highly significant relation of the mutation status with the type of leukemia (P = 0.0037) and the risk group according to treatment protocols (P = 0.00021) was estimated. A statistically significant difference in the white blood count was observed (P = 0.019) between the mutated and non-mutated patient groups although no statistically significant association of the mutation status with the hemoglobin and platelets values, karyotype, age, sex, disease progression, and outcome was determined. Based upon these results, the Kip1/p27 mutations should be considered for further prospective testing as an additional parameter for risk stratification and treatment of childhood leukemia. Copyright 2006 Wiley-Liss, Inc.
Mutational status of EGFR and KIT in thymoma and thymic carcinoma.
Yoh, Kiyotaka; Nishiwaki, Yutaka; Ishii, Genichiro; Goto, Koichi; Kubota, Kaoru; Ohmatsu, Hironobu; Niho, Seiji; Nagai, Kanji; Saijo, Nagahiro
2008-12-01
This study was conducted to evaluate the prevalence of EGFR and KIT mutations in thymomas and thymic carcinomas as a means of exploring the potential for molecularly targeted therapy with tyrosine kinase inhibitors. Genomic DNA was isolated from 41 paraffin-embedded tumor samples obtained from 24 thymomas and 17 thymic carcinomas. EGFR exons 18, 19, and 21, and KIT exons 9, 11, 13, and 17, were analyzed for mutations by PCR and direct sequencing. Protein expression of EGFR and KIT was evaluated immunohistochemically. EGFR mutations were detected in 2 of 20 thymomas, but not in any of the thymic carcinomas. All of the EGFR mutations detected were missense mutations (L858R and G863D) in exon 21. EGFR protein was expressed in 71% of the thymomas and 53% of the thymic carcinomas. The mutational analysis of KIT revealed only a missense mutation (L576P) in exon 11 of one thymic carcinoma. KIT protein was expressed in 88% of the thymic carcinomas and 0% of the thymomas. The results of this study indicate that EGFR and KIT mutations in thymomas and thymic carcinomas are rare, but that many of the tumors express EGFR or KIT protein.
Voigt, Carsten; Holzapfel, Hans-Peter; Meyer, Silke; Paschke, Ralf
2004-07-01
G-protein-coupled receptor kinases (GRKs) are implicated in the pathophysiology of human diseases such as arterial hypertension, heart failure and rheumatoid arthritis. While G-protein-coupled receptor kinases 2 and 5 have been shown to be involved in the desensitization of the rat thyrotropin receptor (TSHR), their role in the pathophysiology of hyperfunctioning thyroid nodules (HTNs) is unknown. Therefore, we analyzed the expression pattern of the known GRKs in human thyroid tissue and investigated their function in the pathology of HTNs. The expression of different GRKs in human thyroid and HTNs was measured by Western blotting. The influence of GRK expression on TSHR function was analyzed by coexpression experiments in HEK 293 cells. We demonstrate that in addition to GRKs 2, 5 and 6, GRKs 3 and 4 are also expressed in the human thyroid. GRKs 2, 3, 5 and 6 are able to desensitize the TSHR in vitro. This GRK-induced desensitization is amplified by the additional over-expression of beta-arrestin 1 or 2. We did not find any mutations in the GRKs 2, 3 and 5 from 14 HTNs without TSHR mutations and Gsalpha mutations. The expression of GRKs 3 and 4 was increased in HTNs independently from the existence of TSHR mutations or Gsalpha mutations. In conclusion, the increased expression of GRK 3 in HTNs and the ability of GRK 3 to desensitize the TSHR in vitro, suggest a potential role for GRK 3 as a negative feedback regulator for the constitutively activated cAMP pathway in HTNs.
A novel ICK mutation causes ciliary disruption and lethal endocrine-cerebro-osteodysplasia syndrome.
Oud, Machteld M; Bonnard, Carine; Mans, Dorus A; Altunoglu, Umut; Tohari, Sumanty; Ng, Alvin Yu Jin; Eskin, Ascia; Lee, Hane; Rupar, C Anthony; de Wagenaar, Nathalie P; Wu, Ka Man; Lahiry, Piya; Pazour, Gregory J; Nelson, Stanley F; Hegele, Robert A; Roepman, Ronald; Kayserili, Hülya; Venkatesh, Byrappa; Siu, Victoria M; Reversade, Bruno; Arts, Heleen H
2016-01-01
Endocrine-cerebro-osteodysplasia (ECO) syndrome [MIM:612651] caused by a recessive mutation (p.R272Q) in Intestinal cell kinase (ICK) shows significant clinical overlap with ciliary disorders. Similarities are strongest between ECO syndrome, the Majewski and Mohr-Majewski short-rib thoracic dysplasia (SRTD) with polydactyly syndromes, and hydrolethalus syndrome. In this study, we present a novel homozygous ICK mutation in a fetus with ECO syndrome and compare the effect of this mutation with the previously reported ICK variant on ciliogenesis and cilium morphology. Through homozygosity mapping and whole-exome sequencing, we identified a second variant (c.358G > T; p.G120C) in ICK in a Turkish fetus presenting with ECO syndrome. In vitro studies of wild-type and mutant mRFP-ICK (p.G120C and p.R272Q) revealed that, in contrast to the wild-type protein that localizes along the ciliary axoneme and/or is present in the ciliary base, mutant proteins rather enrich in the ciliary tip. In addition, immunocytochemistry revealed a decreased number of cilia in ICK p.R272Q-affected cells. Through identification of a novel ICK mutation, we confirm that disruption of ICK causes ECO syndrome, which clinically overlaps with the spectrum of ciliopathies. Expression of ICK-mutated proteins result in an abnormal ciliary localization compared to wild-type protein. Primary fibroblasts derived from an individual with ECO syndrome display ciliogenesis defects. In aggregate, our findings are consistent with recent reports that show that ICK regulates ciliary biology in vitro and in mice, confirming that ECO syndrome is a severe ciliopathy.
Chebib, Jobran; Guillaume, Frédéric
2017-10-01
Phenotypic traits do not always respond to selection independently from each other and often show correlated responses to selection. The structure of a genotype-phenotype map (GP map) determines trait covariation, which involves variation in the degree and strength of the pleiotropic effects of the underlying genes. It is still unclear, and debated, how much of that structure can be deduced from variational properties of quantitative traits that are inferred from their genetic (co) variance matrix (G-matrix). Here we aim to clarify how the extent of pleiotropy and the correlation among the pleiotropic effects of mutations differentially affect the structure of a G-matrix and our ability to detect genetic constraints from its eigen decomposition. We show that the eigenvectors of a G-matrix can be predictive of evolutionary constraints when they map to underlying pleiotropic modules with correlated mutational effects. Without mutational correlation, evolutionary constraints caused by the fitness costs associated with increased pleiotropy are harder to infer from evolutionary metrics based on a G-matrix's geometric properties because uncorrelated pleiotropic effects do not affect traits' genetic correlations. Correlational selection induces much weaker modular partitioning of traits' genetic correlations in absence then in presence of underlying modular pleiotropy. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Systems Analysis of Adaptive Responses to MAP Kinase Pathway Blockade in BRAF Mutant Melanoma.
Directory of Open Access Journals (Sweden)
Brian J Capaldo
Full Text Available Fifty percent of cutaneous melanomas are driven by activated BRAFV600E, but tumors treated with RAF inhibitors, even when they respond dramatically, rapidly adapt and develop resistance. Thus, there is a pressing need to identify the major mechanisms of intrinsic and adaptive resistance and develop drug combinations that target these resistance mechanisms. In a combinatorial drug screen on a panel of 12 treatment-naïve BRAFV600E mutant melanoma cell lines of varying levels of resistance to mitogen-activated protein kinase (MAPK pathway inhibition, we identified the combination of PLX4720, a targeted inhibitor of mutated BRaf, and lapatinib, an inhibitor of the ErbB family of receptor tyrosine kinases, as synergistically cytotoxic in the subset of cell lines that displayed the most resistance to PLX4720. To identify potential mechanisms of resistance to PLX4720 treatment and synergy with lapatinib treatment, we performed a multi-platform functional genomics analysis to profile the genome as well as the transcriptional and proteomic responses of these cell lines to treatment with PLX4720. We found modest levels of resistance correlated with the zygosity of the BRAF V600E allele and receptor tyrosine kinase (RTK mutational status. Layered over base-line resistance was substantial upregulation of many ErbB pathway genes in response to BRaf inhibition, thus generating the vulnerability to combination with lapatinib. The transcriptional responses of ErbB pathway genes are associated with a number of transcription factors, including ETS2 and its associated cofactors that represent a convergent regulatory mechanism conferring synergistic drug susceptibility in the context of diverse mutational landscapes.
Directory of Open Access Journals (Sweden)
Gabriella Braun
Full Text Available TRESK (TWIK-related spinal cord K(+ channel, KCNK18 is a major background K(+ channel of sensory neurons. Dominant-negative mutation of TRESK is linked to familial migraine. This important two-pore domain K(+ channel is uniquely activated by calcineurin. The calcium/calmodulin-dependent protein phosphatase directly binds to the channel and activates TRESK current several-fold in Xenopus oocytes and HEK293 cells. We have recently shown that the kinase, which is responsible for the basal inhibition of the K(+ current, is sensitive to the adaptor protein 14-3-3. Therefore we have examined the effect of the 14-3-3-inhibited PAR-1/MARK, microtubule-associated-protein/microtubule affinity-regulating kinase on TRESK in the Xenopus oocyte expression system. MARK1, MARK2 and MARK3 accelerated the return of TRESK current to the resting state after the calcium-dependent activation. Several other serine-threonine kinase types, generally involved in the modulation of other ion channels, failed to influence TRESK current recovery. MARK2 phosphorylated the primary determinant of regulation, the cluster of three adjacent serine residues (S274, 276 and 279 in the intracellular loop of mouse TRESK. In contrast, serine 264, the 14-3-3-binding site of TRESK, was not phosphorylated by the kinase. Thus MARK2 selectively inhibits TRESK activity via the S274/276/279 cluster, but does not affect the direct recruitment of 14-3-3 to the channel. TRESK is the first example of an ion channel phosphorylated by the dynamically membrane-localized MARK kinases, also known as general determinants of cellular polarity. These results raise the possibility that microtubule dynamics is coupled to the regulation of excitability in the neurons, which express TRESK background potassium channel.
Neuron membrane trafficking and protein kinases involved in autism and ADHD.
Kitagishi, Yasuko; Minami, Akari; Nakanishi, Atsuko; Ogura, Yasunori; Matsuda, Satoru
2015-01-30
A brain-enriched multi-domain scaffolding protein, neurobeachin has been identified as a candidate gene for autism patients. Mutations in the synaptic adhesion protein cell adhesion molecule 1 (CADM1) are also associated with autism spectrum disorder, a neurodevelopmental disorder of uncertain molecular origin. Potential roles of neurobeachin and CADM1 have been suggested to a function of vesicle transport in endosomal trafficking. It seems that protein kinase B (AKT) and cyclic adenosine monophosphate (cAMP)-dependent protein kinase A (PKA) have key roles in the neuron membrane trafficking involved in the pathogenesis of autism. Attention deficit hyperactivity disorder (ADHD) is documented to dopaminergic insufficiencies, which is attributed to synaptic dysfunction of dopamine transporter (DAT). AKT is also essential for the DAT cell-surface redistribution. In the present paper, we summarize and discuss the importance of several protein kinases that regulate the membrane trafficking involved in autism and ADHD, suggesting new targets for therapeutic intervention.
Neuron Membrane Trafficking and Protein Kinases Involved in Autism and ADHD
Directory of Open Access Journals (Sweden)
Yasuko Kitagishi
2015-01-01
Full Text Available A brain-enriched multi-domain scaffolding protein, neurobeachin has been identified as a candidate gene for autism patients. Mutations in the synaptic adhesion protein cell adhesion molecule 1 (CADM1 are also associated with autism spectrum disorder, a neurodevelopmental disorder of uncertain molecular origin. Potential roles of neurobeachin and CADM1 have been suggested to a function of vesicle transport in endosomal trafficking. It seems that protein kinase B (AKT and cyclic adenosine monophosphate (cAMP-dependent protein kinase A (PKA have key roles in the neuron membrane trafficking involved in the pathogenesis of autism. Attention deficit hyperactivity disorder (ADHD is documented to dopaminergic insufficiencies, which is attributed to synaptic dysfunction of dopamine transporter (DAT. AKT is also essential for the DAT cell-surface redistribution. In the present paper, we summarize and discuss the importance of several protein kinases that regulate the membrane trafficking involved in autism and ADHD, suggesting new targets for therapeutic intervention.
Prevalence and clinical correlates of JAK2 mutations in Down syndrome acute lymphoblastic leukemia
Gaikwad, Amos; Rye, Cassia L.; Devidas, Meenakshi; Heerema, Nyla A.; Carroll, Andrew J.; Izraeli, Shai; Plon, Sharon E.; Basso, Giuseppe; Pession, Andrea; Rabin, Karen R.
2009-01-01
Summary Recurrent, prognostically significant chromosomal abnormalities occur in approximately 75% of pediatric acute lymphoblastic leukemia (ALL), but only infrequently in children with Down syndrome (DS) and ALL. Recently, novel somatic activating mutations in Janus kinase 2 (JAK2) were reported in 18% of DS ALL. Here we report identification and clinical correlates of JAK2 mutations in an independent cohort. JAK2 activating mutations occurred in 10 of 53 DS ALL cases (18.9%). Mutations were overrepresented in males (p<0.03), occurred once in association with high hyperdiploidy, and were not significantly correlated with age, initial white blood count, or event-free survival. Our results confirm significance of JAK-STAT pathway activation in DS ALL. PMID:19120350
Coexistance of JAK2V617F mutation and BCR/ABL translocation in one patient
Directory of Open Access Journals (Sweden)
Murat Albayrak
2010-09-01
Full Text Available Dear Editor,The myeloproliferative disorders (MPDs constitute a subcategory of chronic myeloid disorders and include chronic myeloid leukemia (CML, essential thrombocytemia (ET, polycythemia vera (PV and myelofibrosis (MF. In 1960, the discovery of the Philadelphia chromosome (Ph became a cornerstone in CML treatment and led to the development of moleculary targeted therapy. Recently, an acquired mutation in the Janus kinase 2 (JAK2 gene has been discovered in nearly all patents with PV and approximately half of the patients with primary MF and ET. Subsequently, the mutation has been demonstrated in atypical MPDs (chronic neutrophilic leukemia, unclassified, de novo myelodysplastic syndrome or acute myeloid leukemia.1 It has been hoped that targeted inhibition of JAK2V617F should achieve similar disease control as thyrosine kinases has produced in CML.
Directory of Open Access Journals (Sweden)
Jian Li
2017-02-01
Full Text Available The efficacy of anaplastic lymphoma kinase (ALK positive non-small-cell lung cancer (NSCLC treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer.
Granovsky, Alexey E.; Clark, Matthew C.; McElheny, Dan; Heil, Gary; Hong, Jia; Liu, Xuedong; Kim, Youngchang; Joachimiak, Grazyna; Joachimiak, Andrzej; Koide, Shohei; Rosner, Marsha Rich
2009-01-01
Raf kinase inhibitory protein (RKIP/PEBP1), a member of the phosphatidylethanolamine binding protein family that possesses a conserved ligand-binding pocket, negatively regulates the mammalian mitogen-activated protein kinase (MAPK) signaling cascade. Mutation of a conserved site (P74L) within the pocket leads to a loss or switch in the function of yeast or plant RKIP homologues. However, the mechanism by which the pocket influences RKIP function is unknown. Here we show that the pocket integrates two regulatory signals, phosphorylation and ligand binding, to control RKIP inhibition of Raf-1. RKIP association with Raf-1 is prevented by RKIP phosphorylation at S153. The P74L mutation increases kinase interaction and RKIP phosphorylation, enhancing Raf-1/MAPK signaling. Conversely, ligand binding to the RKIP pocket inhibits kinase interaction and RKIP phosphorylation by a noncompetitive mechanism. Additionally, ligand binding blocks RKIP association with Raf-1. Nuclear magnetic resonance studies reveal that the pocket is highly dynamic, rationalizing its capacity to interact with distinct partners and be involved in allosteric regulation. Our results show that RKIP uses a flexible pocket to integrate ligand binding- and phosphorylation-dependent interactions and to modulate the MAPK signaling pathway. This mechanism is an example of an emerging theme involving the regulation of signaling proteins and their interaction with effectors at the level of protein dynamics. PMID:19103740
DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.
Directory of Open Access Journals (Sweden)
Adam J L Cook
2007-04-01
Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.
STK33 kinase inhibitor BRD-8899 has no effect on KRAS-dependent cancer cell viability.
Luo, Tuoping; Masson, Kristina; Jaffe, Jacob D; Silkworth, Whitney; Ross, Nathan T; Scherer, Christina A; Scholl, Claudia; Fröhling, Stefan; Carr, Steven A; Stern, Andrew M; Schreiber, Stuart L; Golub, Todd R
2012-02-21
Approximately 30% of human cancers harbor oncogenic gain-of-function mutations in KRAS. Despite interest in KRAS as a therapeutic target, direct blockade of KRAS function with small molecules has yet to be demonstrated. Based on experiments that lower mRNA levels of protein kinases, KRAS-dependent cancer cells were proposed to have a unique requirement for the serine/threonine kinase STK33. Thus, it was suggested that small-molecule inhibitors of STK33 might have therapeutic benefit in these cancers. Here, we describe the development of selective, low nanomolar inhibitors of STK33's kinase activity. The most potent and selective of these, BRD8899, failed to kill KRAS-dependent cells. While several explanations for this result exist, our data are most consistent with the view that inhibition of STK33's kinase activity does not represent a promising anti-KRAS therapeutic strategy.
Zampieri, Stefania; Montalvo, Annalisa; Blanco, Mariana; Zanin, Irene; Amartino, Hernan; Vlahovicek, Kristian; Szlago, Marina; Schenone, Andrea; Pittis, Gabriela; Bembi, Bruno; Dardis, Andrea
2012-05-15
Tay-Sachs disease (TSD) is a recessively inherited disorder caused by the deficient activity of hexosaminidase A due to mutations in the HEXA gene. Up to date there is no information regarding the molecular genetics of TSD in Argentinean patients. In the present study we have studied 17 Argentinean families affected by TSD, including 20 patients with the acute infantile form and 3 with the sub-acute form. Overall, we identified 14 different mutations accounting for 100% of the studied alleles. Eight mutations were novel: 5 were single base changes leading to drastic residue changes or truncated proteins, 2 were small deletions and one was an intronic mutation that may cause a splicing defect. Although the spectrum of mutations was highly heterogeneous, a high frequency of the c.459+5G>A mutation, previously described in different populations was found among the studied cohort. Haplotype analysis suggested that in these families the c.459+5G>A mutation might have arisen by a single mutational event. Copyright © 2012 Elsevier B.V. All rights reserved.
Luzzi, Simona; Colleoni, Lara; Corbetta, Paola; Baldinelli, Sara; Fiori, Chiara; Girelli, Francesca; Silvestrini, Mauro; Caroppo, Paola; Giaccone, Giorgio; Tagliavini, Fabrizio; Rossi, Giacomina
2017-06-01
Gene coding for progranulin, GRN, is a major gene linked to frontotemporal lobar degeneration. While most of pathogenic GRN mutations are null mutations leading to haploinsufficiency, GRN missense mutations do not have an obvious pathogenicity, and only a few have been revealed to act through different pathogenetic mechanisms, such as cytoplasmic missorting, protein degradation, and abnormal cleavage by elastase. The aim of this study was to disclose the pathogenetic mechanisms of the GRN A199V missense mutation, which was previously reported not to alter physiological progranulin features but was associated with a reduced plasma progranulin level. After investigating the family pedigree, we performed genetic and biochemical analysis on its members and performed RNA expression studies. We found that the mutation segregates with the disease and discovered that its pathogenic feature is the alteration of GRN mRNA splicing, actually leading to haploinsufficiency. Thus, when facing with a missense GRN mutation, its pathogenetic effects should be investigated, especially if associated with low plasma progranulin levels, to determine its nature of either benign polymorphism or pathogenic mutation. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Corbett Alastair
2008-11-01
Full Text Available Abstract Background We report age-dependent penetrance estimates for leucine-rich repeat kinase 2 (LRRK2-related Parkinson's disease (PD in a large sample of familial PD. The most frequently seen LRRK2 mutation, Gly2019Ser (G2019S, is associated with approximately 5 to 6% of familial PD cases and 1 to 2% of idiopathic cases, making it the most common known genetic cause of PD. Studies of the penetrance of LRRK2 mutations have produced a wide range of estimates, possibly due to differences in study design and recruitment, including in particular differences between samples of familial PD versus sporadic PD. Methods A sample, including 903 affected and 58 unaffected members from 509 families ascertained for having two or more PD-affected members, 126 randomly ascertained PD patients and 197 controls, was screened for five different LRRK2 mutations. Penetrance was estimated in families of LRRK2 carriers with consideration of the inherent bias towards increased penetrance in a familial sample. Results Thirty-one out of 509 families with multiple cases of PD (6.1% were found to have 58 LRRK2 mutation carriers (6.4%. Twenty-nine of the 31 families had G2019S mutations while two had R1441C mutations. No mutations were identified among controls or unaffected relatives of PD cases. Nine PD-affected relatives of G2019S carriers did not carry the LRRK2 mutation themselves. At the maximum observed age range of 90 to 94 years, the unbiased estimated penetrance was 67% for G2019S families, compared with a baseline PD risk of 17% seen in the non-LRRK2-related PD families. Conclusion Lifetime penetrance of LRRK2 estimated in the unascertained relatives of multiplex PD families is greater than that reported in studies of sporadically ascertained LRRK2 cases, suggesting that inherited susceptibility factors may modify the penetrance of LRRK2 mutations. In addition, the presence of nine PD phenocopies in the LRRK2 families suggests that these susceptibility
Ogi, Kazuhiro; Nakashima, Kenji; Chihara, Kazuyasu; Takeuchi, Kenji; Horiguchi, Tomoko; Fujieda, Shigeharu; Sada, Kiyonao
2011-09-01
Tyrosine phosphorylation of adaptor protein c-Abl-Src homology 3 (SH3) domain-binding protein-2 (3BP2, also referred to SH3BP2) positively regulates the B-cell antigen receptor (BCR)-mediated signal transduction, leading to the activation of nuclear factor of activated T cells (NFAT). Here we showed the effect of the proline to arginine substitution of 3BP2 in which is the most common mutation in patients with cherubism (P418R) on B-cell receptor signaling. Comparing to the wild type, overexpression of the mutant form of 3BP2 (3BP2-P416R, corresponding to P418R in human protein) enhanced BCR-mediated activation of NFAT. 3BP2-P416R increased the signaling complex formation with Syk, phospholipase C-γ2 (PLC-γ2), and Vav1. In contrast, 3BP2-P416R could not change the association with the negative regulator 14-3-3. Loss of the association mutant that was incapable to associate with 14-3-3 could not mimic BCR-mediated NFAT activation in Syk-deficient cells. Moreover, BCR-mediated phosphorylation of extracellular signal regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) was not affected by P416R mutation. These results showed that P416R mutation of 3BP2 causes the gain of function in B cells by increasing the interaction with specific signaling molecules. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
JAK2, MPL, and CALR mutations in Chinese Han patients with essential thrombocythemia.
Wang, Jing; Zhang, Biao; Chen, Bing; Zhou, Rong-Fu; Zhang, Qi-Guo; Li, Juan; Yang, Yong-Gong; Zhou, Min; Shao, Xiao-Yan; Xu, Yong; Xu, Xi-Hui; Ouyang, Jian; Xu, Jingyan; Ye, Qing
2017-04-01
Mutations in Janus kinase 2 (JAK2), myeloproliferative leukemia (MPL), and CALR are highly relevant to Philadelphia chromosome (Ph)-negative myeloproliferative neoplasms. Assessing the prevalence of molecular mutations in Chinese Han patients with essential thrombocythemia (ET), and correlating their mutational profile with disease characteristics/phenotype. Of the 110 subjects studied, 62 carried the JAK2 V617F mutation, 21 had CALR mutations, one carried an MPL (W515) mutation, and 28 had non-mutated JAK2, CALR, and MPL (so-called triple-negative ET). Mutations in JAK2 exon 12 were not detected in any patient. Two ET patients had both CALR and JAK2 V617F mutations. Comparing the hematological parameters of the patients with JAK2 mutations with those of the patients with CALR mutations showed that the ET patients with CALR mutations were younger (p = 0.045) and had higher platelet counts (p = 0.043). Genotyping for CALR could be a useful diagnostic tool for JAK2/MPL-negative ET, since the data suggest that CALR is much more prevalent than MPL, therefore testing for CALR should be considered in patients who are JAK2 negative as its frequency is almost 20 times that of MPL mutation.
ERK mutations confer resistance to mitogen-activated protein kinase pathway inhibitors.
Goetz, Eva M; Ghandi, Mahmoud; Treacy, Daniel J; Wagle, Nikhil; Garraway, Levi A
2014-12-01
The use of targeted therapeutics directed against BRAF(V600)-mutant metastatic melanoma improves progression-free survival in many patients; however, acquired drug resistance remains a major medical challenge. By far, the most common clinical resistance mechanism involves reactivation of the MAPK (RAF/MEK/ERK) pathway by a variety of mechanisms. Thus, targeting ERK itself has emerged as an attractive therapeutic concept, and several ERK inhibitors have entered clinical trials. We sought to preemptively determine mutations in ERK1/2 that confer resistance to either ERK inhibitors or combined RAF/MEK inhibition in BRAF(V600)-mutant melanoma. Using a random mutagenesis screen, we identified multiple point mutations in ERK1 (MAPK3) and ERK2 (MAPK1) that could confer resistance to ERK or RAF/MEK inhibitors. ERK inhibitor-resistant alleles were sensitive to RAF/MEK inhibitors and vice versa, suggesting that the future development of alternating RAF/MEK and ERK inhibitor regimens might help circumvent resistance to these agents. ©2014 American Association for Cancer Research.
Factors affecting the spontaneous mutational spectra in somatic mammalian cells
Directory of Open Access Journals (Sweden)
О.А. Ковальова
2006-04-01
Full Text Available In our survey of references we are discussed the influence of factors biological origin on the spontaneous mutation specters in mammalian. Seasonal and age components influence on the frequence of cytogenetic anomalies. The immune and endocrinous systems are take part in control of the alteration of the spontaneous mutation specters. Genetical difference of sensibility in animal and human at the alteration of factors enviroment as and genetical differences of repair systems activity are may influence on individual variation of spontaneous destabilization characters of chromosomal apparatus.
The target landscape of clinical kinase drugs.
Klaeger, Susan; Heinzlmeir, Stephanie; Wilhelm, Mathias; Polzer, Harald; Vick, Binje; Koenig, Paul-Albert; Reinecke, Maria; Ruprecht, Benjamin; Petzoldt, Svenja; Meng, Chen; Zecha, Jana; Reiter, Katrin; Qiao, Huichao; Helm, Dominic; Koch, Heiner; Schoof, Melanie; Canevari, Giulia; Casale, Elena; Depaolini, Stefania Re; Feuchtinger, Annette; Wu, Zhixiang; Schmidt, Tobias; Rueckert, Lars; Becker, Wilhelm; Huenges, Jan; Garz, Anne-Kathrin; Gohlke, Bjoern-Oliver; Zolg, Daniel Paul; Kayser, Gian; Vooder, Tonu; Preissner, Robert; Hahne, Hannes; Tõnisson, Neeme; Kramer, Karl; Götze, Katharina; Bassermann, Florian; Schlegl, Judith; Ehrlich, Hans-Christian; Aiche, Stephan; Walch, Axel; Greif, Philipp A; Schneider, Sabine; Felder, Eduard Rudolf; Ruland, Juergen; Médard, Guillaume; Jeremias, Irmela; Spiekermann, Karsten; Kuster, Bernhard
2017-12-01
Kinase inhibitors are important cancer therapeutics. Polypharmacology is commonly observed, requiring thorough target deconvolution to understand drug mechanism of action. Using chemical proteomics, we analyzed the target spectrum of 243 clinically evaluated kinase drugs. The data revealed previously unknown targets for established drugs, offered a perspective on the "druggable" kinome, highlighted (non)kinase off-targets, and suggested potential therapeutic applications. Integration of phosphoproteomic data refined drug-affected pathways, identified response markers, and strengthened rationale for combination treatments. We exemplify translational value by discovering SIK2 (salt-inducible kinase 2) inhibitors that modulate cytokine production in primary cells, by identifying drugs against the lung cancer survival marker MELK (maternal embryonic leucine zipper kinase), and by repurposing cabozantinib to treat FLT3-ITD-positive acute myeloid leukemia. This resource, available via the ProteomicsDB database, should facilitate basic, clinical, and drug discovery research and aid clinical decision-making. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Energy Technology Data Exchange (ETDEWEB)
Richter, K.; Huwe, A.; Boldt, H.; Dresel, S. [Nuklearmedizinische Klinik, HELIOS-Klinikum Berlin-Buch (Germany); Geipel, D. [St.-Hedwig-Krankenhaus, Bereich Endokrine Chirurgie (Germany); Mairinger, T. [Inst. fuer Pathologie, HELIOS-Klinikum Emil von Behring (Germany); Schwabe, M. [Inst. fuer Pathologie, Charite Berlin Campus Mitte (Germany)
2008-07-01
Medullary thyroid carcinoma (MTC) arises from parafollicular C-cells of the thyroid and accounts for 1% to 10% of all thyroid cancers (1). MTC can be sporadic or hereditary. Hereditary MTC represents 20% to 30% of all MTC with an autosomal dominant pattern of transmission and a high degree of penetrance (>90%). It can be transmitted as a single entity (sporadic), familial MTC (FMTC), or it can arise as part of a multiple endocrine neoplasia (MEN) syndrome type 2A or 2B. Both genders are equally affected. (1, 9) The identification of hereditary MTC has been facilitated in recent years by the direct analysis of germline point mutations of the RET(rearranged during transfection)-protooncogene, a 21 exon gene that encodes a plasma membrane-bound tyrosine kinase receptor, localised on chromosome 10q11.2, which is expressed in tissues derived from the neural crest. To date codon mutations in nine different exons were identified (7, 8, 16, 22, 29) causing MEN 2A (MTC in combination with pheochromocytoma and hyperparathyroidism, including rare variants with Hirschsprung's disease and cutaneous lichen amyloidosis), FMTC (MTC as a sole disease phenotype) and MEN 2B (MTC in combination with pheochromocytoma, multiple mucosa neuromas, and marfanoid habitus). The most common mutation, accounting for over 80% of all mutations associated with MEN 2A (or Sipple's) syndrome affects codon 634 in exon 11 of the RET-protooncogene. Other mutations affect codon 630 in exon 11, and codons 609, 611, 618, 620 in exon 10 - they also cause FMTC, although some have a classic MEN 2A syndrome. 5% to 10% of families with FMTC have mutations that affect codons 768, 790, 791 in exon 13: codons 804, 844 in exon 14, and codon 891 in exon 15 (3, 4, 10). The much more aggressive MEN 2B is caused by a single mutation converting a methionine into a threonine at codon 918 in exon 16, and has been identified in approximately 95% of patients with MEN 2B. Other rare mutations associated with MEN 2
Growth Hormone Receptor Mutations Related to Individual Dwarfism
Li, Charles; Zhang, Xiquan
2018-01-01
Growth hormone (GH) promotes body growth by binding with two GH receptors (GHRs) at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin-like growth factor (IGF) synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature), including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development. PMID:29748515
Growth Hormone Receptor Mutations Related to Individual Dwarfism
Directory of Open Access Journals (Sweden)
Shudai Lin
2018-05-01
Full Text Available Growth hormone (GH promotes body growth by binding with two GH receptors (GHRs at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin‐like growth factor (IGF synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature, including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development.
Protein kinase CK2 structure-function relationship
DEFF Research Database (Denmark)
Boldyreff, B; Meggio, F; Pinna, L A
1994-01-01
Protein kinase CK2 subunits alpha and beta were expressed either separately or together in a bacterial expression system (pT7-7/BL21(DE3)) and purified to homogeneity. After mixing the subunits, a CK2 holoenzyme (alpha 2 beta 2) was spontaneously reconstituted, which displays identical features...... subunit have been prepared and assayed for their ability to assemble with the catalytic alpha subunit to give a fully competent CK2 holoenzyme. The beta subunit contains an acidic stretch (amino acid 55-64), which is obviously responsible for a negative control of enzyme activity since mutations...
Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A.; Kuiper, Raoul V.; Curbo, Sophie; Karlsson, Anna
2013-01-01
A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK+/− transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK+/−TK2−/− mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK+/−TK2−/− mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency. PMID:23288848
Sekiguchi, Mari; Katayama, Syouichi; Hatano, Naoya; Shigeri, Yasushi; Sueyoshi, Noriyuki; Kameshita, Isamu
2013-07-15
Cyclin-dependent kinase-like 5 (CDKL5) is a Ser/Thr protein kinase predominantly expressed in brain and mutations of its gene are known to be associated with neurodevelopmental disorders such as X-linked West syndrome and Rett syndrome. However, the physiological substrates of CDKL5 that are directly linked to these neurodevelopmental disorders are currently unknown. In this study, we explored endogenous substrates for CDKL5 in mouse brain extracts fractionated by a liquid-phase isoelectric focusing. In conjunction with CDKL5 phosphorylation assay, this approach detected a protein band with an apparent molecular mass of 120kDa that is remarkably phosphorylated by CDKL5. This 120-kDa protein was identified as amphiphysin 1 (Amph1) by LC-MS/MS analysis, and the site of phosphorylation by CDKL5 was determined to be Ser-293. The phosphorylation mimic mutants, Amph1(S293E) and Amph1(S293D), showed significantly reduced affinity for endophilin, a protein involved in synaptic vesicle endocytosis. Introduction of point mutations in the catalytic domain of CDKL5, which are disease-causing missense mutations found in Rett patients, resulted in the impairment of kinase activity toward Amph1. These results suggest that Amph1 is the cytoplasmic substrate for CDKL5 and that its phosphorylation may play crucial roles in the neuronal development. Copyright © 2013 Elsevier Inc. All rights reserved.
Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.
Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle
2016-10-01
Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.
Hofstra, R M; Osinga, J; Tan-Sindhunata, G; Wu, Y; Kamsteeg, E J; Stulp, R P; van Ravenswaaij-Arts, C; Majoor-Krakauer, D; Angrist, M; Chakravarti, A; Meijers, C; Buys, C H
1996-04-01
Hirschsprung disease (HSCR) or colonic aganglionosis is a congenital disorder characterized by an absence of intramural ganglia along variable lengths of the colon resulting in intestinal obstruction. The incidence of HSCR is 1 in 5,000 live births. Mutations in the RET gene, which codes for a receptor tyrosine kinase, and in EDNRB which codes for the endothelin-B receptor, have been shown to be associated with HSCR in humans. The lethal-spotted mouse which has pigment abnormalities, but also colonic aganglionosis, carries a mutation in the gene coding for endothelin 3 (Edn3), the ligand for the receptor protein encoded by EDNRB. Here, we describe a mutation of the human gene for endothelin 3 (EDN3), homozygously present in a patient with a combined Waardenburg syndrome type 2 (WS2) and HSCR phenotype (Shah-Waardenburg syndrome). The mutation, Cys159Phe, in exon 3 in the ET-3 like domain of EDN3, presumably affects the proteolytic processing of the preproendothelin to the mature peptide EDN3. The patient's parents were first cousins. A previous child in this family had been diagnosed with a similar combination of HSCR, depigmentation and deafness. Depigmentation and deafness were present in other relatives. Moreover, we present a further indication for the involvement of EDNRB in HSCR by reporting a novel mutation detected in one of 40 unselected HSCR patients.
Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene
Directory of Open Access Journals (Sweden)
Udhaya H Kotecha
2014-01-01
Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.
DEFF Research Database (Denmark)
Kjærulff, Søren; Lautrup-Larsen, I.; Truelsen, S.
2005-01-01
In the fission yeast Schizosaccharomyces pombe, meiosis normally takes place in diploid zygotes resulting from conjugation of haploid cells. In the present study, we report that the expression of a constitutively activated version of the pheromone-responsive mitogen-activated protein kinase kinase...... found that haploid meiosis was dramatically reduced when Ste11 was mutated to mimic phosphorylation by Pat1. The mutation of two putative MAPK sites in Ste11 also dramatically reduced the level of haploid meiosis, suggesting that Ste11 is a direct target of Spk1. Supporting this, we show that Spk1 can...... interact physically with Ste11 and also phosphorylate the transcription factor in vitro. Finally, we demonstrate that ste11 is required for pheromone-induced G1 arrest. Interestingly, when we mutated Ste11 in the sites for Pat1 and Spk1 phosphorylation simultaneously, the cells could still arrest in G1...
International Nuclear Information System (INIS)
Favreau, Catherine; Delbarre, Erwan; Courvalin, Jean-Claude; Buendia, Brigitte
2008-01-01
Mutation R453W in A-type lamins, that are major nuclear envelope proteins, generates Emery-Dreifuss muscular dystrophy. We previously showed that mouse myoblasts expressing R453W-lamin A incompletely exit the cell cycle and differentiate into myocytes with a low level of multinucleation. Here we attempted to improve differentiation by treating these cells with a mixture of PD98059, an extracellular-regulated kinase (ERK) kinase (also known as mitogen-activated kinase, MEK) inhibitor, and insulin-like growth factor-II, an activator of phosphoinositide 3-kinase. We show that mouse myoblasts expressing R453W-lamin A were sensitive to the drug treatment as shown by (i) an increase in multinucleation, (ii) downregulation of proliferation markers (cyclin D1, hyperphosphorylated Rb), (iii) upregulation of myogenin, and (iv) sustained activation of p21 and cyclin D3. However, nuclear matrix anchorage of p21 and cyclin D3 in a complex with hypophosphorylated Rb that is critical to trigger cell cycle arrest and myogenin induction was deficient and incompletely restored by drug treatment. As the turn-over of R453W-lamin A at the nuclear envelope was greatly enhanced, we propose that R453W-lamin A impairs the capacity of the nuclear lamina to serve as scaffold for substrates of the MEK-ERK pathway and for MyoD-induced proteins that play a role in the differentiation process
DEFF Research Database (Denmark)
Ungureanu, Daniela; Wu, Jinhua; Pekkala, Tuija
2011-01-01
Human JAK2 tyrosine kinase mediates signaling through numerous cytokine receptors. The JAK2 JH2 domain functions as a negative regulator and is presumed to be a catalytically inactive pseudokinase, but the mechanism(s) for its inhibition of JAK2 remains unknown. Mutations in JH2 lead to increased...... JAK2 activity, contributing to myeloproliferative neoplasms (MPNs). Here we show that JH2 is a dual-specificity protein kinase that phosphorylates two negative regulatory sites in JAK2: Ser523 and Tyr570. Inactivation of JH2 catalytic activity increased JAK2 basal activity and downstream signaling....... Notably, different MPN mutations abrogated JH2 activity in cells, and in MPN (V617F) patient cells phosphorylation of Tyr570 was reduced, suggesting that loss of JH2 activity contributes to the pathogenesis of MPNs. These results identify the catalytic activity of JH2 as a previously unrecognized...
Bhargava, Ragini; Carson, Caree R; Lee, Gabriella; Stark, Jeremy M
2017-01-24
A likely mechanism of chromosomal rearrangement formation involves joining the ends from two different chromosomal double-strand breaks (DSBs). These events could potentially be mediated by either of two end-joining (EJ) repair pathways [canonical nonhomologous end joining (C-NHEJ) or alternative end joining (ALT-EJ)], which cause distinct rearrangement junction patterns. The relative role of these EJ pathways during rearrangement formation has remained controversial. Along these lines, we have tested whether the DNA damage response mediated by the Ataxia Telangiectasia Mutated (ATM) kinase may affect the relative influence of C-NHEJ vs. ALT-EJ on rearrangement formation. We developed a reporter in mouse cells for a 0.4-Mbp deletion rearrangement that is formed by EJ between two DSBs induced by the Cas9 endonuclease. We found that disruption of the ATM kinase causes an increase in the frequency of the rearrangement as well as a shift toward rearrangement junctions that show hallmarks of C-NHEJ. Furthermore, ATM suppresses rearrangement formation in an experimental condition, in which C-NHEJ is the predominant EJ repair event (i.e., expression of the 3' exonuclease Trex2). Finally, several C-NHEJ factors are required for the increase in rearrangement frequency caused by inhibition of the ATM kinase. We also examined ATM effectors and found that H2AX shows a similar influence as ATM, whereas the influence of ATM on this rearrangement seems independent of 53BP1. We suggest that the contribution of the C-NHEJ pathway to the formation of a 0.4-Mbp deletion rearrangement is enhanced in ATM-deficient cells.
DEFF Research Database (Denmark)
VanderKuur, J A; Wang, X; Zhang, L
1994-01-01
Growth hormone (GH) has recently been shown to activate the GH receptor (GHR)-associated tyrosine kinase JAK2. In the present study, regions of the GHR required for JAK2 association with GHR were identified. GH-dependent JAK2 association with GHR was detected in Chinese hamster ovary (CHO) cells...... and RIN-5AH cells, the ability of JAK2 to associate with the mutated GHR was found to correlate with GH-dependent activation of JAK2, tyrosyl phosphorylation of GHR (in the case of GHR1-638 and GHR1-454), and the ability of the GHR to copurify with tyrosine kinase activity. In CHO cells expressing mutated......, and that tyrosines in the N-terminal half of the cytoplasmic domain of the GHR are phosphorylated by JAK2. The finding that a specific interaction with the C-terminal half of GHR appears to be necessary for p97 phosphorylation indicates that while JAK2 activation may be necessary for a full biological response to GH...
DEFF Research Database (Denmark)
Steenhof, Maria; Kibæk, Maria; Larsen, Martin J.
2018-01-01
with mutations affecting the GR5P domain. We present a 19-year old male patient with autosomal recessive spastic paraplegia and compound heterozygosity for two ALDH18A1 mutations, one in each of the P5CS domains. This young man has spastic paraplegia with onset in childhood and temporal lobe epilepsy, but normal...
Directory of Open Access Journals (Sweden)
Jason P. Chan
2017-09-01
Full Text Available Sphingolipid metabolism is important to balance the abundance of bioactive lipid molecules involved in cell signaling, neuronal function, and survival. Specifically, the sphingolipid sphingosine mediates cell death signaling, whereas its phosphorylated form, sphingosine-1-phosphate (S1P, mediates cell survival signaling. The enzyme sphingosine kinase produces S1P, and the activity of sphingosine kinase impacts the ability of cells to survive under stress and challenges. To examine the influence of sphingolipid metabolism, particularly enzymes regulating sphingosine and S1P, in mediating aging, neuronal function and stress response, we examined life history traits, locomotor capacities and heat stress responses of young and old animals using the model organism Caenorhabditis elegans. We found that C. elegans sphk-1 mutants, which lack sphingosine kinase, had shorter lifespans, reduced brood sizes, and smaller body sizes compared to wild type animals. By analyzing a panel of young and old animals with genetic mutations in the sphingolipid signaling pathway, we showed that aged sphk-1 mutants exhibited a greater decline in neuromuscular function and locomotor behavior. In addition, aged animals lacking sphk-1 were more susceptible to death induced by acute and prolonged heat exposure. On the other hand, older animals with loss of function mutations in ceramide synthase (hyl-1, which converts sphingosine to ceramide, showed improved neuromuscular function and stress response with age. This phenotype was dependent on sphk-1. Together, our data show that loss of sphingosine kinase contributes to poor animal health span, suggesting that sphingolipid signaling may be important for healthy neuronal function and animal stress response during aging.
Energy Technology Data Exchange (ETDEWEB)
Bonaventure, J.; Rousseau, F.; Legeai-Mallet, L.; LeMerrer, M.; Munnich, A.; Maroteaux, P. [INSERM, Paris (France)
1996-05-03
The mapping of the achondroplasia locus to the short arm of chromosome 4 and the subsequent identification of a recurrent missense mutation (G380R) in the fibroblast growth factor receptor 3 (FGFR-3) gene has been followed by the detection of common FGFR-3 mutations in two clinically related disorders: thanatophoric dwarfism (types I and II) and hypochondroplasia. The relative clinical homogeneity of achondroplasia was substantiated by demonstration of its genetic homogeneity as more than 98% of all patients hitherto reported exhibit mutations in the transmembrane receptor domain. Although most hypochondroplasia cases were accounted for by a recurrent missense substitution (N540K) in the first tyrosine kinase (TK 1) domain of the receptor, a significant proportion (40%) of our patients did not harbor the N540K mutation and three hypochondroplasia families were not linked to the FGFR-3 locus, thus supporting clinical heterogeneity of this condition. In thanatophoric dwarfism (TD), a recurrent FGFR-3 mutation located in the second tyrosine kinase (TK 2) domain of the receptor was originally detected in 100% of TD II cases; in our series, seven distinct mutations in three different protein domains were identified in 25 of 26 TD I patients, suggesting that TD, like achondroplasia, is a genetically homogenous skeletal disorder. 31 refs., 4 figs., 2 tabs.
Protein Kinase C δ: a Gatekeeper of Immune Homeostasis.
Salzer, Elisabeth; Santos-Valente, Elisangela; Keller, Bärbel; Warnatz, Klaus; Boztug, Kaan
2016-10-01
Human autoimmune disorders present in various forms and are associated with a life-long burden of high morbidity and mortality. Many different circumstances lead to the loss of immune tolerance and often the origin is suspected to be multifactorial. Recently, patients with autosomal recessive mutations in PRKCD encoding protein kinase c delta (PKCδ) have been identified, representing a monogenic prototype for one of the most prominent forms of humoral systemic autoimmune diseases, systemic lupus erythematosus (SLE). PKCδ is a signaling kinase with multiple downstream target proteins and with functions in various signaling pathways. Interestingly, mouse models have indicated a special role of the ubiquitously expressed protein in the control of B-cell tolerance revealed by the severe autoimmunity in Prkcd (-/-) knockout mice as the major phenotype. As such, the study of PKCδ deficiency in humans has tremendous potential in enhancing our knowledge on the mechanisms of B-cell tolerance.
Microcephalic primordial dwarfism in an Emirati patient with PNKP mutation.
Nair, Pratibha; Hamzeh, Abdul Rezzak; Mohamed, Madiha; Saif, Fatima; Tawfiq, Nafisa; El Halik, Majdi; Al-Ali, Mahmoud Taleb; Bastaki, Fatma
2016-08-01
Microcephaly is a rare neurological condition, both in isolation and when it occurs as part of a syndrome. One of the syndromic forms of microcephaly is microcephaly, seizures and developmental delay (MCSZ) (OMIM #613402), a rare autosomal recessive neurodevelopmental disorder with a range of phenotypic severity, and known to be caused by mutations in the polynucleotide kinase 3' phosphatase (PNKP) gene. The PNK protein is a key enzyme involved in the repair of single and double stranded DNA breaks, a process which is particularly important in the nervous system. We describe an Emirati patient who presented with microcephaly, short stature, uncontrollable tonic-clonic seizures, facial dysmorphism, and developmental delay, while at the same time showing evidence of brain atrophy and agenesis of the corpus callosum. We used whole exome sequencing to identify homozygosity for a missense c.1385G > C (p.Arg462Pro) mutation in PNKP in the patient and heterozygosity for this mutation in her consanguineous parents. The Arg 462 residue forms a part of the lid subdomain helix of the P-loop Kinase domain. Although our patient's phenotype resembled that of MCSZ, the short stature and evidence of brain atrophy distinguished it from other classic cases of the condition. The report raises the question of whether to consider this case as an atypical variant of MCSZ or as a novel form of microcephalic primordial dwarfism. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
FAM20A mutations can cause enamel-renal syndrome (ERS.
Directory of Open Access Journals (Sweden)
Shih-Kai Wang
Full Text Available Enamel-renal syndrome (ERS is an autosomal recessive disorder characterized by severe enamel hypoplasia, failed tooth eruption, intrapulpal calcifications, enlarged gingiva, and nephrocalcinosis. Recently, mutations in FAM20A were reported to cause amelogenesis imperfecta and gingival fibromatosis syndrome (AIGFS, which closely resembles ERS except for the renal calcifications. We characterized three families with AIGFS and identified, in each case, recessive FAM20A mutations: family 1 (c.992G>A; g.63853G>A; p.Gly331Asp, family 2 (c.720-2A>G; g.62232A>G; p.Gln241_Arg271del, and family 3 (c.406C>T; g.50213C>T; p.Arg136* and c.1432C>T; g.68284C>T; p.Arg478*. Significantly, a kidney ultrasound of the family 2 proband revealed nephrocalcinosis, revising the diagnosis from AIGFS to ERS. By characterizing teeth extracted from the family 3 proband, we demonstrated that FAM20A(-/- molars lacked true enamel, showed extensive crown and root resorption, hypercementosis, and partial replacement of resorbed mineral with bone or coalesced mineral spheres. Supported by the observation of severe ectopic calcifications in the kidneys of Fam20a null mice, we conclude that FAM20A, which has a kinase homology domain and localizes to the Golgi, is a putative Golgi kinase that plays a significant role in the regulation of biomineralization processes, and that mutations in FAM20A cause both AIGFS and ERS.
Kirschner, Doris B; vom Baur, Elmar; Thibault, Christelle; Sanders, Steven L; Gangloff, Yann-Gaël; Davidson, Irwin; Weil, P Anthony; Tora, Làszlò
2002-05-01
The RNA polymerase II transcription factor TFIID, composed of the TATA-binding protein (TBP) and TBP-associated factors (TAF(II)s), nucleates preinitiation complex formation at protein-coding gene promoters. SAGA, a second TAF(II)-containing multiprotein complex, is involved in transcription regulation in Saccharomyces cerevisiae. One of the essential protein components common to SAGA and TFIID is yTAF(II)25. We define a minimal evolutionarily conserved 91-amino-acid region of TAF(II)25 containing a histone fold domain that is necessary and sufficient for growth in vivo. Different temperature-sensitive mutations of yTAF(II)25 or chimeras with the human homologue TAF(II)30 arrested cell growth at either the G(1) or G(2)/M cell cycle phase and displayed distinct phenotypic changes and gene expression patterns. Immunoprecipitation studies revealed that TAF(II)25 mutation-dependent gene expression and phenotypic changes correlated at least partially with the integrity of SAGA and TFIID. Genome-wide expression analysis revealed that the five TAF(II)25 temperature-sensitive mutant alleles individually affect the expression of between 18 and 33% of genes, whereas taken together they affect 64% of all class II genes. Thus, different yTAF(II)25 mutations induce distinct phenotypes and affect the regulation of different subsets of genes, demonstrating that no individual TAF(II) mutant allele reflects the full range of its normal functions.
Akman, Hasan O; Dorado, Beatriz; López, Luis C; García-Cazorla, Angeles; Vilà, Maya R; Tanabe, Lauren M; Dauer, William T; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio
2008-08-15
Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous Tk2 mutant (Tk2(-/-)) mice developed rapidly progressive weakness after age 10 days and died between ages 2 and 3 weeks. Tk2(-/-) animals showed Tk2 deficiency, unbalanced dNTP pools, mtDNA depletion and defects of respiratory chain enzymes containing mtDNA-encoded subunits that were most prominent in the central nervous system. Histopathology revealed an encephalomyelopathy with prominent vacuolar changes in the anterior horn of the spinal cord. The H126N TK2 mouse is the first knock-in animal model of human MDS and demonstrates that the severity of TK2 deficiency in tissues may determine the organ-specific phenotype.
Syahruddin, Elisna; Wulandari, Laksmi; Sri Muktiati, Nunuk; Rima, Ana; Soeroso, Noni; Ermayanti, Sabrina; Levi, Michael; Hidajat, Heriawaty; Widjajahakim, Grace; Utomo, Ahmad Rusdan Handoyo
2018-01-01
Purpose We aimed to evaluate the distribution of individual epidermal growth factor receptor (EGFR) mutation subtypes found in routine cytological specimens. Patients and methods A retrospective audit was performed on EGFR testing results of 1,874 consecutive cytological samples of newly diagnosed or treatment-naïve Indonesian lung cancer patients (years 2015–2016). Testing was performed by ISO15189 accredited central laboratory. Results Overall test failure rate was 5.1%, with the highest failure (7.1%) observed in pleural effusion and lowest (1.6%) in needle aspiration samples. EGFR mutation frequency was 44.4%. Tyrosine kinase inhibitor (TKI)-sensitive common EGFR mutations (ins/dels exon 19, L858R) and uncommon mutations (G719X, T790M, L861Q) contributed 57.1% and 29%, respectively. Approximately 13.9% of mutation-positive patients carried a mixture of common and uncommon mutations. Women had higher EGFR mutation rate (52.9%) vs men (39.1%; pcytological techniques yielded similar success rate to detect EGFR mutations. Uncommon EGFR mutations were frequent events in Indonesian lung cancer patients. PMID:29615847
Phenotypic Analysis of ATM Protein Kinase in DNA Double-Strand Break Formation and Repair.
Mian, Elisabeth; Wiesmüller, Lisa
2017-01-01
Ataxia telangiectasia mutated (ATM) encodes a serine/threonine protein kinase, which is involved in various regulatory processes in mammalian cells. Its best-known role is apical activation of the DNA damage response following generation of DNA double-strand breaks (DSBs). When DSBs appear, sensor and mediator proteins are recruited, activating transducers such as ATM, which in turn relay a widespread signal to a multitude of downstream effectors. ATM mutation causes Ataxia telangiectasia (AT), whereby the disease phenotype shows differing characteristics depending on the underlying ATM mutation. However, all phenotypes share progressive neurodegeneration and marked predisposition to malignancies at the organismal level and sensitivity to ionizing radiation and chromosome aberrations at the cellular level. Expression and localization of the ATM protein can be determined via western blotting and immunofluorescence microscopy; however, detection of subtle alterations such as resulting from amino acid exchanges rather than truncating mutations requires functional testing. Previous studies on the role of ATM in DSB repair, which connects with radiosensitivity and chromosomal stability, gave at first sight contradictory results. To systematically explore the effects of clinically relevant ATM mutations on DSB repair, we engaged a series of lymphoblastoid cell lines (LCLs) derived from AT patients and controls. To examine DSB repair both in a quantitative and qualitative manners, we used an EGFP-based assay comprising different substrates for distinct DSB repair mechanisms. In this way, we demonstrated that particular signaling defects caused by individual ATM mutations led to specific DSB repair phenotypes. To explore the impact of ATM on carcinogenic chromosomal aberrations, we monitored chromosomal breakage at a breakpoint cluster region hotspot within the MLL gene that has been associated with therapy-related leukemia. PCR-based MLL-breakage analysis of HeLa cells
Directory of Open Access Journals (Sweden)
Elodie Laine
2011-06-01
Full Text Available The type III receptor tyrosine kinase (RTK KIT plays a crucial role in the transmission of cellular signals through phosphorylation events that are associated with a switching of the protein conformation between inactive and active states. D816V KIT mutation is associated with various pathologies including mastocytosis and cancers. D816V-mutated KIT is constitutively active, and resistant to treatment with the anti-cancer drug Imatinib. To elucidate the activating molecular mechanism of this mutation, we applied a multi-approach procedure combining molecular dynamics (MD simulations, normal modes analysis (NMA and binding site prediction. Multiple 50-ns MD simulations of wild-type KIT and its mutant D816V were recorded using the inactive auto-inhibited structure of the protein, characteristic of type III RTKs. Computed free energy differences enabled us to quantify the impact of D816V on protein stability in the inactive state. We evidenced a local structural alteration of the activation loop (A-loop upon mutation, and a long-range structural re-organization of the juxta-membrane region (JMR followed by a weakening of the interaction network with the kinase domain. A thorough normal mode analysis of several MD conformations led to a plausible molecular rationale to propose that JMR is able to depart its auto-inhibitory position more easily in the mutant than in wild-type KIT and is thus able to promote kinase mutant dimerization without the need for extra-cellular ligand binding. Pocket detection at the surface of NMA-displaced conformations finally revealed that detachment of JMR from the kinase domain in the mutant was sufficient to open an access to the catalytic and substrate binding sites.
Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.
Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques
2013-09-01
Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.
DEFF Research Database (Denmark)
Lindahl, Kim Hein; Sørensen, Flemming Brandt; Jonstrup, Søren Peter
2015-01-01
The identification of EGFR mutations in non-small-cell lung cancer is important for selecting patients, who may benefit from treatment with EGFR tyrosine kinase inhibitors. The analysis is usually performed on cytological aspirates and/or histological needle biopsies, representing a small fraction....... Moreover, several inconclusive results in the diagnostic biopsies reveal that attention must be paid on the suitability of pre-operative biopsies for EGFR mutation analysis....
Receptor tyrosine kinase structure and function in health and disease
Directory of Open Access Journals (Sweden)
Oleg A. Karpov
2015-09-01
Full Text Available Receptor tyrosine kinases (RTKs are membrane proteins that control the flow of information through signal transduction pathways, impacting on different aspects of cell function. RTKs are characterized by a ligand-binding ectodomain, a single transmembrane α-helix, a cytosolic region comprising juxtamembrane and kinase domains followed by a flexible C-terminal tail. Somatic and germline RTK mutations can induce aberrant signal transduction to give rise to cardiovascular, developmental and oncogenic abnormalities. RTK overexpression occurs in certain cancers, correlating signal strength and disease incidence. Diverse RTK activation and signal transduction mechanisms are employed by cells during commitment to health or disease. Small molecule inhibitors are one means to target RTK function in disease initiation and progression. This review considers RTK structure, activation, and signal transduction and evaluates biological relevance to therapeutics and clinical outcomes.
Ishikawa, Yoshihiro; Vranka, Janice A; Boudko, Sergei P; Pokidysheva, Elena; Mizuno, Kazunori; Zientek, Keith; Keene, Douglas R; Rashmir-Raven, Ann M; Nagata, Kazuhiro; Winand, Nena J; Bächinger, Hans Peter
2012-06-22
The rate-limiting step of folding of the collagen triple helix is catalyzed by cyclophilin B (CypB). The G6R mutation in cyclophilin B found in the American Quarter Horse leads to autosomal recessive hyperelastosis cutis, also known as hereditary equine regional dermal asthenia. The mutant protein shows small structural changes in the region of the mutation at the side opposite the catalytic domain of CypB. The peptidylprolyl cis-trans isomerase activity of the mutant CypB is normal when analyzed in vitro. However, the biosynthesis of type I collagen in affected horse fibroblasts shows a delay in folding and secretion and a decrease in hydroxylysine and glucosyl-galactosyl hydroxylysine. This leads to changes in the structure of collagen fibrils in tendon, similar to those observed in P3H1 null mice. In contrast to cyclophilin B null mice, where little 3-hydroxylation was found in type I collagen, 3-hydroxylation of type I collagen in affected horses is normal. The mutation disrupts the interaction of cyclophilin B with the P-domain of calreticulin, with lysyl hydroxylase 1, and probably other proteins, such as the formation of the P3H1·CypB·cartilage-associated protein complex, resulting in less effective catalysis of the rate-limiting step in collagen folding in the rough endoplasmic reticulum.
Ishikawa, Yoshihiro; Vranka, Janice A.; Boudko, Sergei P.; Pokidysheva, Elena; Mizuno, Kazunori; Zientek, Keith; Keene, Douglas R.; Rashmir-Raven, Ann M.; Nagata, Kazuhiro; Winand, Nena J.; Bächinger, Hans Peter
2012-01-01
The rate-limiting step of folding of the collagen triple helix is catalyzed by cyclophilin B (CypB). The G6R mutation in cyclophilin B found in the American Quarter Horse leads to autosomal recessive hyperelastosis cutis, also known as hereditary equine regional dermal asthenia. The mutant protein shows small structural changes in the region of the mutation at the side opposite the catalytic domain of CypB. The peptidylprolyl cis-trans isomerase activity of the mutant CypB is normal when analyzed in vitro. However, the biosynthesis of type I collagen in affected horse fibroblasts shows a delay in folding and secretion and a decrease in hydroxylysine and glucosyl-galactosyl hydroxylysine. This leads to changes in the structure of collagen fibrils in tendon, similar to those observed in P3H1 null mice. In contrast to cyclophilin B null mice, where little 3-hydroxylation was found in type I collagen, 3-hydroxylation of type I collagen in affected horses is normal. The mutation disrupts the interaction of cyclophilin B with the P-domain of calreticulin, with lysyl hydroxylase 1, and probably other proteins, such as the formation of the P3H1·CypB·cartilage-associated protein complex, resulting in less effective catalysis of the rate-limiting step in collagen folding in the rough endoplasmic reticulum. PMID:22556420
Duan, Penggen; Rao, Yuchun; Zeng, Dali; Yang, Yaolong; Xu, Ran; Zhang, Baolan; Dong, Guojun; Qian, Qian; Li, Yunhai
2014-02-01
Although grain size is one of the most important components of grain yield, little information is known about the mechanisms that determine final grain size in crops. Here we characterize rice small grain1 (smg1) mutants, which exhibit small and light grains, dense and erect panicles and comparatively slightly shorter plants. The short grain and panicle phenotypes of smg1 mutants are caused by a defect in cell proliferation. The smg1 mutations were identified, using a map-based cloning approach, in mitogen-activated protein kinase kinase 4 (OsMKK4). Relatively higher expression of OsMKK4/SMG1 was detected in younger organs than in older ones, consistent with its role in cell proliferation. Green fluorescent protein (GFP)-OsMKK4/SMG1 fusion proteins appear to be distributed ubiquitously in plant cells. Further results revealed that OsMKK4 influenced brassinosteroid (BR) responses and the expression of BR-related genes. Thus, our findings have identified OsMKK4 as a factor for grain size, and suggest a possible link between the MAPK pathways and BRs in grain growth. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2017-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Schlaepfer, D D; Hunter, T
1996-10-01
Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.
Directory of Open Access Journals (Sweden)
Yin eLiu
2014-09-01
Full Text Available Background: Molecular genetic alterations with prognostic significance have been described in childhood acute myeloid leukemia (AML. The aim of this study was to establish cost-effective techniques to detect mutations of FMS-like tyrosine kinase 3 (FLT3, Nucleophosmin 1 (NPM1, and a partial tandem duplication within the mixed lineage leukemia (MLL-PTD genes in childhood AML. Procedure: Ninety-nine children with newly diagnosed AML were included in this study. We developed a fluoresent dye SYTO-82 based high resolution melting curve (HRM anaylsis to detect FLT3 internal tandem duplication (FLT3-ITD, FLT3 tyrosine kinase domain (FLT3-TKD and NPM1 mutations. MLL-PTD was screened by real-time quantitative PCR. Results: The HRM methodology correlated well with gold standard Sanger sequencing with less cost. Among the 99 patients studied, the FLT3-ITD mutation was associated with significantly worse event free survival (EFS. Patients with the NPM1 mutation had significantly better EFS and overall survival. However, HRM was not sensitive enough for minimal residual disease monitoring. Conclusions: HRM was a rapid and efficient method for screening of FLT3 and NPM1 gene mutations. It was both affordable and accurate, especially in resource underprivileged regions. Our results indicated that HRM could be a useful clinical tool for rapid and cost effective screening of the FLT3 and NPM1 mutations in AML patients.
Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency.
Garone, Caterina; Garcia-Diaz, Beatriz; Emmanuele, Valentina; Lopez, Luis C; Tadesse, Saba; Akman, Hasan O; Tanji, Kurenai; Quinzii, Catarina M; Hirano, Michio
2014-08-01
Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2(-/-)) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-old Tk2(-/-) mice treated with dCMP+dTMP 200 mg/kg/day each (Tk2(-/-200dCMP/) (dTMP)) demonstrated that in mutant animals, the compounds raise dTTP concentrations, increase levels of mtDNA, ameliorate defects of mitochondrial respiratory chain enzymes, and significantly prolong their lifespan (34 days with treatment versus 13 days untreated). A second trial of dCMP+dTMP each at 400 mg/kg/day showed even greater phenotypic and biochemical improvements. In conclusion, dCMP/dTMP supplementation is the first effective pharmacologic treatment for Tk2 deficiency. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.
Review papers The role of KIT gene mutations in pathogenesis of pediatric mastocytosis
Directory of Open Access Journals (Sweden)
Joanna Dawicka
2015-03-01
Full Text Available Mastocytosis is characterized by excessive proliferation and accumulation of mast cells in skin and/or other organs. Two forms of the disease, cutaneous and systemic mastocytosis, differ significantly in symptomatology and clinical course. KIT mutations play an important role in the pathogenesis of the disease. The presence of p.D816V KIT mutation was detected in the vast majority of adults with systemic mastocytosis. The role of KIT mutations in childhood-onset mastocytosis remains a matter of discussion. More recent studies have shown that cutaneous mastocytosis, which is the most common clinical manifestation of the disease in children, has a genetic background. In contrast to adults, different types of KIT mutations have been described in pediatric and familial mastocytosis. The understanding of the molecular mechanisms in mastocytosis enables targeted therapy using tyrosine kinase inhibitors.
Mohammadi, M; Dionne, C A; Li, W; Li, N; Spivak, T; Honegger, A M; Jaye, M; Schlessinger, J
1992-08-20
Stimulation of growth factor receptors with tyrosine kinase activity is followed by rapid receptor dimerization, tyrosine autophosphorylation and phosphorylation of signalling molecules such as phospholipase C gamma (PLC gamma) and the ras GTPase-activating protein. PLC gamma and GTPase-activating protein bind to specific tyrosine-phosphorylated regions in growth factor receptors through their src-homologous SH2 domains. Growth factor-induced tyrosine phosphorylation of PLC gamma is essential for stimulation of phosphatidylinositol hydrolysis in vitro and in vivo. We have shown that a short phosphorylated peptide containing tyrosine at position 766 from a conserved region of the fibroblast growth factor (FGF) receptor is a binding site for the SH2 domain of PLC gamma (ref. 8). Here we show that an FGF receptor point mutant in which Tyr 766 is replaced by a phenylalanine residue (Y766F) is unable to associate with and tyrosine-phosphorylate PLC gamma or to stimulate hydrolysis of phosphatidylinositol. Nevertheless, the Y766F FGF receptor mutant can be autophosphorylated, and can phosphorylate several cellular proteins and stimulate DNA synthesis. Our data show that phosphorylation of the conserved Tyr 766 of the FGF receptor is essential for phosphorylation of PLC gamma and for hydrolysis of phosphatidylinositol, but that elimination of this hydrolysis does not affect FGF-induced mitogenesis.
Ste20-like kinase SLK, at the crossroads
Al-Zahrani, Khalid N.; Baron, Kyla D.; Sabourin, Luc A.
2013-01-01
Reorganization of the cytoskeleton is necessary for apoptosis, proliferation, migration, development and tissue repair. However, it is well established that mutations or overexpression of key regulators contribute to the phenotype and progression of several pathologies such as cancer. For instance, c-src mutations and the overexpression of FAK have been implicated in the invasive and metastatic process, suggesting that components of the motility system may represent a new class of therapeutic targets. Over the last several years, we and others have established distinct roles for the Ste20-like kinase SLK, encompassing apoptosis, growth, motility and development. Here, we review the SLK field from its initial cloning to the most recent findings from our laboratory. We summarize the various roles of SLK and the biochemical mechanisms that regulate its activity. These various findings reveal very complex functions and pattern of regulation for SLK in development and cancer, making it a potential therapeutic target. PMID:23154402
Rooting, growth, and color mutation of poinsettias affected by gamma radiation
International Nuclear Information System (INIS)
Lee, Eun Kyung; Kim, Won Hee; Kim, Seung Tae; Kang, Si Yong
2010-01-01
This experiment was carried out to investigate the effects of gamma-radiation on the rooting, growth, and color mutation in poinsettia. Using 10 poinsettia varieties ('Lollipop', 'Little Peace', 'Happy Day', 'Early Bird', 'Pixy Red', 'Happy Time', 'Heidi', 'Red Bell', 'Clara', and 'Scarlet') bred by National Institute of Horticultural and Herbal Science, 100 Gy of gamma ray was irradiated at the stage of callused cuttings. Four weeks after sticking cuttings in the rooting media, 8 cultivars showed 100% of root formation, but 'Early Bird' rooted 24.4% and even died off during the cutting propagation. After planting rooted cuttings, survival rate until flowering time varied among irradiated cultivars. While 'Pixy Red' and 'Heidi' survived about 98%, 'Clara', 'Happy Day', and 'Early Bird' survived lesser than 30%. All irradiated plants showed remarkably shorter plant height, lesser branch numbers than non-irradiated control plants. Thirty color mutants were obtained among 281 plants survived until flowering time. Nine were complete color mutated branches, whereas 21 mutants were partially color mutated bracts and transitional leaves. Color patterns mutated by 100 Gy of gamma ray were divided into pink, hot pink, light red and spotted (pink spots with red main color). Pink mutants were commonly obtained. Complete color mutants were discovered from 4 plants of 'Pixy Red', 2 plants of 'Red Bell' and 3 plants of Lollipop
Masselli, E; Carubbi, C; Gobbi, G; Mirandola, P; Galli, D; Martini, S; Bonomini, S; Crugnola, M; Craviotto, L; Aversa, F; Vitale, M
2015-11-01
Among the three classic Philadelphia chromosome-negative myeloproliferative neoplasms, primary myelofibrosis (PMF) is the most severe in terms of disease biology, survival and quality of life. Abnormalities in the process of differentiation of PMF megakaryocytes (MKs) are a hallmark of the disease. Nevertheless, the molecular events that lead to aberrant megakaryocytopoiesis have yet to be clarified. Protein kinase Cɛ (PKCɛ) is a novel serine/threonine kinase that is overexpressed in a variety of cancers, promoting aggressive phenotype, invasiveness and drug resistance. Our previous findings on the role of PKCɛ in normal (erythroid and megakaryocytic commitment) and malignant (acute myeloid leukemia) hematopoiesis prompted us to investigate whether it could be involved in the pathogenesis of PMF MK-impaired differentiation. We demonstrate that PMF megakaryocytic cultures express higher levels of PKCɛ than healthy donors, which correlate with higher disease burden but not with JAK2V617F mutation. Inhibition of PKCɛ function (by a negative regulator of PKCɛ translocation) or translation (by target small hairpin RNA) leads to reduction in PMF cell growth, restoration of PMF MK differentiation and inhibition of PKCɛ-related anti-apoptotic signaling (Bcl-xL). Our data suggest that targeting PKCɛ directly affects the PMF neoplastic clone and represent a proof-of-concept for PKCɛ inhibition as a novel therapeutic strategy in PMF.
International Nuclear Information System (INIS)
Ji, Wonjun; Lee, Dae Ho; Lee, Jae Cheol; Choi, Chang-Min; Rho, Jin Kyung; Jang, Se Jin; Park, Young Soo; Chun, Sung-Min; Kim, Woo Sung; Lee, Jung-Shin; Kim, Sang-We
2013-01-01
Despite an initial good response to epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor (TKI), resistance to treatment eventually develops. Although several resistance mechanisms have been discovered, little data exist regarding Asian patient populations. Among patients at a tertiary referral hospital in Korea who initially responded well to gefitinib and later acquired resistance to treatment, we selected those with enough tissues obtained before EGFR-TKI treatment and after the onset of resistance to examine mutations by mass spectrometric genotyping technology (Asan-Panel), MET amplification by fluorescence in situ hybridization (FISH), and analysis of AXL status, epithelial-to-mesenchymal transition (EMT) and neuroendocrine markers by immunohistochemistry. Twenty-six patients were enrolled, all of whom were diagnosed with adenocarcinoma with EGFR mutations (19del: 16, L858R: 10) except one (squamous cell carcinoma with 19del). Secondary T790M mutation was detected in 11 subjects (42.3%) and four of these patients had other co-existing resistance mechanisms; increased AXL expression was observed in 5/26 patients (19.2%), MET gene amplification was noted in 3/26 (11.5%), and one patient acquired a mutation in the phosphatidylinositol-4, 5-bisphosphate 3-kinase catalytic subunit alpha isoform (PIK3CA) gene. None of the patients exhibited EMT; however, increased CD56 expression suggesting neuroendocrine differentiation was observed in two patients. Interestingly, conversion from L858R-mutant to wild-type EGFR occurred in one patient. Seven patients (26.9%) did not exhibit any known resistance mechanisms. Patients with a T790M mutation showed a more favorable prognosis. The mechanisms and frequency of acquired EGFR-TKI resistance in Koreans are comparable to those observed in Western populations; however, more data regarding the mechanisms that drive EGFR-TKI resistance are necessary
HECTD3 Mediates an HSP90-Dependent Degradation Pathway for Protein Kinase Clients
Directory of Open Access Journals (Sweden)
Zhaobo Li
2017-06-01
Full Text Available Inhibition of the ATPase cycle of the HSP90 chaperone promotes ubiquitylation and proteasomal degradation of its client proteins, which include many oncogenic protein kinases. This provides the rationale for HSP90 inhibitors as cancer therapeutics. However, the mechanism by which HSP90 ATPase inhibition triggers ubiquitylation is not understood, and the E3 ubiquitin ligases involved are largely unknown. Using a siRNA screen, we have identified components of two independent degradation pathways for the HSP90 client kinase CRAF. The first requires CUL5, Elongin B, and Elongin C, while the second requires the E3 ligase HECTD3, which is also involved in the degradation of MASTL and LKB1. HECTD3 associates with HSP90 and CRAF in cells via its N-terminal DOC domain, which is mutationally disrupted in tumor cells with activated MAP kinase signaling. Our data implicate HECTD3 as a tumor suppressor modulating the activity of this important oncogenic signaling pathway.
Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth
Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, J?rn
2017-01-01
Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell...
Torielli, Lucia; Tivodar, Simona; Montella, Rosa Chiara; Iacone, Roberto; Padoani, Gloria; Tarsini, Paolo; Russo, Ornella; Sarnataro, Daniela; Strazzullo, Pasquale; Ferrari, Patrizia; Bianchi, Giuseppe; Zurzolo, Chiara
2008-08-01
Genetic variation in alpha-adducin cytoskeletal protein is implicated in the polymerization and bundling of actin and alteration of the Na/K pump, resulting in abnormal renal sodium transport and hypertension in Milan hypertensive rats and humans. To investigate the molecular involvement of alpha-adducin in controlling Na/K pump activity, wild-type or mutated rat and human alpha-adducin forms were, respectively, transfected into several renal cell lines. Through multiple experimental approaches (microscopy, enzymatic assays, coimmunoprecipitation), we showed that rat and human mutated forms increased Na/K pump activity and the number of pump units; moreover, both variants coimmunoprecipitate with Na/K pump. The increased Na/K pump activity was not due to changes in its basolateral localization, but to an alteration of Na/K pump residential time on the plasma membrane. Indeed, both rat and human mutated variants reduced constitutive Na/K pump endocytosis and similarly affected transferrin receptor trafficking and fluid-phase endocytosis. In fact, alpha-adducin was detected in clathrin-coated vesicles and coimmunoprecipitated with clathrin. These results indicate that adducin, besides its modulatory effects on actin cytoskeleton dynamics, might play a direct role in clathrin-dependent endocytosis. The constitutive reduction of the Na/K pump endocytic rate induced by mutated adducin variants may be relevant in Na-dependent hypertension.
Erdogan, Bulent; Kodaz, Hilmi; Karabulut, Senem; Cinkaya, Ahmet; Tozkir, Hilmi; Tanriverdi, Ozgur; Cabuk, Devrim; Hacioglu, Muhammed Bekir; Turkmen, Esma; Hacibekiroglu, Ilhan; Uzunoglu, Sernaz; Cicin, Irfan
2016-11-10
Lung cancer in smokers and non-smokers demonstrates distinct genetic profiles, and cigarette smoking affects epidermal growth factor receptor (EGFR) function and causes secondary EGFR tyrosine kinase resistance. We evaluated the effect of active smoking in patients with metastatic lung adenocarcinoma. A total of 132 metastatic lung adenocarcinoma patients, diagnosed between 2008 and 2013, with known EGFR mutation status, were evaluated retrospectively. Among these patients, 40 had an activating EGFR mutation. Patients who continued smoking during the treatment were defined as active smokers. Former smokers and never smokers were together defined as non-smokers. The outcomes of the treatment in relation to the EGFR mutation and smoking status were evaluated. The median follow-up time was 10.5 months. The overall response rate for the first-line therapy was significantly higher among the EGFR-mutant patients (p = 0.01), however, smoking status had no impact on the response rate (p = 0.1). The EGFR-mutant active smokers progressed earlier than the non-smokers (p non-smokers and patients treated with erlotinib was significantly longer (p = 0.02 and p = 0.01, respectively). Smoking status did not affect the OS in EGFR wild type tumors (p = 0.49) but EGFR-mutant non-smokers had a longer OS than the active smokers (p = 0.01).The active smokers treated with erlotinib had poorer survival than the non-smokers (p = 0.03). Multivariate analysis of EGFR-mutant patients showed that erlotinib treatment at any line and non-smoking were independent prognostic factors for the OS (p = 0.04 and p = 0.01, respectively). Smoking during treatment is a negative prognostic factor in metastatic lung adenocarcinoma with an EGFR mutation.
DEFF Research Database (Denmark)
Raaf, J; Bischoff, N; Kloppfleisch, K
2011-01-01
that Leu41 or Phe54 single mutations were most disruptive to binding of CK2β. Additionally, these CK2α mutants retained their kinase activity. Furthermore, the substitution of Leu41 in combination with Phe54 showed that the individual mutations were not additive, suggesting that the cooperative action...
Namiki, Takeshi; Tanemura, Atsushi; Valencia, Julio C; Coelho, Sergio G; Passeron, Thierry; Kawaguchi, Masakazu; Vieira, Wilfred D; Ishikawa, Masashi; Nishijima, Wataru; Izumo, Toshiyuki; Kaneko, Yasuhiko; Katayama, Ichiro; Yamaguchi, Yuji; Yin, Lanlan; Polley, Eric C; Liu, Hongfang; Kawakami, Yutaka; Eishi, Yoshinobu; Takahashi, Eishi; Yokozeki, Hiroo; Hearing, Vincent J
2011-04-19
The identification of genes that participate in melanomagenesis should suggest strategies for developing therapeutic modalities. We used a public array comparative genomic hybridization (CGH) database and real-time quantitative PCR (qPCR) analyses to identify the AMP kinase (AMPK)-related kinase NUAK2 as a candidate gene for melanomagenesis, and we analyzed its functions in melanoma cells. Our analyses had identified a locus at 1q32 where genomic gain is strongly associated with tumor thickness, and we used real-time qPCR analyses and regression analyses to identify NUAK2 as a candidate gene at that locus. Associations of relapse-free survival and overall survival of 92 primary melanoma patients with NUAK2 expression measured using immunohistochemistry were investigated using Kaplan-Meier curves, log rank tests, and Cox regression models. Knockdown of NUAK2 induces senescence and reduces S-phase, decreases migration, and down-regulates expression of mammalian target of rapamycin (mTOR). In vivo analysis demonstrated that knockdown of NUAK2 suppresses melanoma tumor growth in mice. Survival analysis showed that the risk of relapse is greater in acral melanoma patients with high levels of NUAK2 expression than in acral melanoma patients with low levels of NUAK2 expression (hazard ratio = 3.88; 95% confidence interval = 1.44-10.50; P = 0.0075). These data demonstrate that NUAK2 expression is significantly associated with the oncogenic features of melanoma cells and with the survival of acral melanoma patients. NUAK2 may provide a drug target to suppress melanoma progression. This study further supports the importance of NUAK2 in cancer development and tumor progression, while AMPK has antioncogenic properties.
Directory of Open Access Journals (Sweden)
Zhang H
2016-11-01
Full Text Available Haijun Zhang Department of Oncology, Zhongda Hospital, Medical School, Southeast University, Nanjing, People’s Republic of China Abstract: Lung cancer, ~80%–85% of which is non-small-cell lung cancer (NSCLC, is the leading cause of cancer-related mortality worldwide. Sensitizing mutations in epidermal growth factor receptor (EGFR gene (EGFRm+, such as exon 19 deletions and exon 21 L858R point mutations, are the most important drivers in NSCLC patients. In this respect, small-molecule EGFR tyrosine kinase inhibitors (TKIs have been designed and developed, which launched the era of targeted, personalized and precise medicine for lung cancer. Patients with EGFRm+ could achieve good responses to the treatment with the first-generation EGFR TKIs, such as erlotinib and gefitinib. However, most patients develop acquired drug resistance mostly driven by the T790M mutation occurring within exon 20. Although the second-generation EGFR TKIs, such as afatinib, dacomitinib and neratinib, demonstrated promising activity against T790M in preclinical models, they have failed to overcome resistance in patients due to dose-limiting toxicity. Recently, the third-generation EGFR TKIs have shown to be effective against cell lines and murine models harboring T790M mutations while sparing wild-type EGFR, which represents a promising breakthrough approach in overcoming T790M-mediated resistance in NSCLC patients. This article provides a comprehensive review of the therapy revolution for NSCLC with three generations of EGFR TKIs. Keywords: lung cancer, epidermal growth factor receptor, tyrosine kinase inhibitors, T790M mutation
Yamaguchi, Hiroshi; Kuboki, Yuko; Hatori, Takashi; Yamamoto, Masakazu; Shiratori, Keiko; Kawamura, Shunji; Kobayashi, Makio; Shimizu, Michio; Ban, Shinichi; Koyama, Isamu; Higashi, Morihiro; Shin, Nobuhiro; Ishida, Kazuyuki; Morikawa, Takanori; Motoi, Fuyuhiko; Unno, Michiaki; Kanno, Atsushi; Satoh, Kennichi; Shimosegawa, Tooru; Orikasa, Hideki; Watanabe, Tomoo; Nishimura, Kazuhiko; Harada, Youji; Furukawa, Toru
2011-12-01
Intraductal tubulopapillary neoplasm (ITPN) is a recently recognized rare variant of intraductal neoplasms of the pancreas. Molecular aberrations underlying the neoplasm remain unknown. We investigated somatic mutations in PIK3CA, PTEN, AKT1, KRAS, and BRAF. We also investigated aberrant expressions of phosphorylated AKT, phosphatase and tensin homolog (PTEN), tumor protein 53 (TP53), SMAD4, and CTNNB1 in 11 cases of ITPNs and compared these data with those of 50 cases of intraductal papillary mucinous neoplasm (IPMN), another distinct variant of pancreatic intraductal neoplasms. Mutations in PIK3CA were found in 3 of 11 ITPNs but not in IPMNs (P = 0.005; Fisher exact test). In contrast, mutations in KRAS were found in none of the ITPNs but were found in 26 of the 50 IPMNs (P = 0.001; Fisher exact test). PIK3CA mutations were associated with strong expression of phosphorylated AKT (P AKT was apparent in most ITPNs but only in a few IPMNs (P SMAD4, and CTNNB1 were not statistically different between these neoplasms. Mutations in PIK3CA and the expression of phosphorylated AKT were not associated with age, sex, tissue invasion, and patients' prognosis in ITPNs. These results indicate that activation of the phosphatidylinositol 3-kinase pathway may play a crucial role in ITPNs but not in IPMNs. In contrast, the mutation in KRAS seems to play a major role in IPMNs but not in ITPNs. The activated phosphatidylinositol 3-kinase pathway may be a potential target for molecular diagnosis and therapy of ITPNs.
Rho-associated kinase is a therapeutic target in neuroblastoma.
Dyberg, Cecilia; Fransson, Susanne; Andonova, Teodora; Sveinbjörnsson, Baldur; Lännerholm-Palm, Jessika; Olsen, Thale K; Forsberg, David; Herlenius, Eric; Martinsson, Tommy; Brodin, Bertha; Kogner, Per; Johnsen, John Inge; Wickström, Malin
2017-08-08
Neuroblastoma is a peripheral neural system tumor that originates from the neural crest and is the most common and deadly tumor of infancy. Here we show that neuroblastoma harbors frequent mutations of genes controlling the Rac/Rho signaling cascade important for proper migration and differentiation of neural crest cells during neuritogenesis. RhoA is activated in tumors from neuroblastoma patients, and elevated expression of Rho-associated kinase (ROCK)2 is associated with poor patient survival. Pharmacological or genetic inhibition of ROCK1 and 2, key molecules in Rho signaling, resulted in neuroblastoma cell differentiation and inhibition of neuroblastoma cell growth, migration, and invasion. Molecularly, ROCK inhibition induced glycogen synthase kinase 3β-dependent phosphorylation and degradation of MYCN protein. Small-molecule inhibition of ROCK suppressed MYCN -driven neuroblastoma growth in TH- MYCN homozygous transgenic mice and MYCN gene-amplified neuroblastoma xenograft growth in nude mice. Interference with Rho/Rac signaling might offer therapeutic perspectives for high-risk neuroblastoma.
TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.
Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf
2017-06-01
Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Kim, Hong-Il; Noh, Tae-Hwan; Lee, Chang-Soo; Park, Young-Jin
2015-01-01
Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight (BB) in rice. To study its function, a random insertion mutation library of Xoo was constructed using the Tn5 transposon. A mutant strain with decreased virulence against the susceptible rice cultivar IR24 was isolated from the library (aroE mutant), which also had extremely low pigment production. Thermal asymmetric interlaced-polymerase chain reaction (TAIL-PCR) and sequence analysis of the mutant revealed that the transposon was inserted into the aroE gene (encoding shikimate dehydrogenase). To investigate gene expression changes in the pigment- and virulence-deficient mutant, DNA microarray analysis was performed, which showed downregulation of 20 genes involved in the chemotaxis of Xoo. Our findings reveal that mutation of the aroE gene affects virulence and pigment production, as well as expression of genes involved in Xoo chemotaxis. Copyright © 2014 Elsevier GmbH. All rights reserved.
Mirzaa, Ghayda M; Conti, Valerio; Timms, Andrew E; Smyser, Christopher D; Ahmed, Sarah; Carter, Melissa; Barnett, Sarah; Hufnagel, Robert B; Goldstein, Amy; Narumi-Kishimoto, Yoko; Olds, Carissa; Collins, Sarah; Johnston, Kathreen; Deleuze, Jean-François; Nitschké, Patrick; Friend, Kathryn; Harris, Catharine; Goetsch, Allison; Martin, Beth; Boyle, Evan August; Parrini, Elena; Mei, Davide; Tattini, Lorenzo; Slavotinek, Anne; Blair, Ed; Barnett, Christopher; Shendure, Jay; Chelly, Jamel; Dobyns, William B; Guerrini, Renzo
2015-12-01
Bilateral perisylvian polymicrogyria (BPP), the most common form of regional polymicrogyria, causes the congenital bilateral perisylvian syndrome, featuring oromotor dysfunction, cognitive impairment, and epilepsy. The causes of BPP are heterogeneous, but only a few genetic causes have been reported. The aim of this study was to identify additional genetic causes of BPP and characterise their frequency in this population. Children (aged ≤18 years) with polymicrogyria were enrolled into our research programme from July, 1980, to October, 2015, at two centres (Florence, Italy, and Seattle, WA, USA). We obtained samples (blood and saliva) throughout this period at both centres and did whole-exome sequencing on DNA from eight trios (two parents and one affected child) with BPP in 2014. After the identification of mosaic PIK3R2 mutations in two of these eight children, we performed targeted screening of PIK3R2 by two methods in a cohort of 118 children with BPP. First, we performed targeted sequencing of the entire PIK3R2 gene by single molecule molecular inversion probes (smMIPs) on 38 patients with BPP with normal to large head size. Second, we did amplicon sequencing of the recurrent PIK3R2 mutation (Gly373Arg) in 80 children with various types of polymicrogyria including BPP. One additional patient had clinical whole-exome sequencing done independently, and was included in this study because of the phenotypic similarity to our cohort. We identified a mosaic mutation (Gly373Arg) in a regulatory subunit of the PI3K-AKT-mTOR pathway, PIK3R2, in two children with BPP. Of the 38 patients with BPP and normal to large head size who underwent targeted next-generation sequencing by smMIPs, we identified constitutional and mosaic PIK3R2 mutations in 17 additional children. In parallel, one patient had the recurrent PIK3R2 mutation identified by clinical whole-exome sequencing. Seven of these 20 patients had BPP alone, and 13 had BPP in association with features of the
The prevalence of ABCB1:c.227_230delATAG mutation in affected dog breeds from European countries.
Firdova, Zuzana; Turnova, Evelina; Bielikova, Marcela; Turna, Jan; Dudas, Andrej
2016-06-01
Deletion of 4-base pairs in the canine ABCB1 (MDR1) gene, responsible for encoding P-glycoprotein, leads to nonsense frame-shift mutation, which causes hypersensitivity to macrocyclic lactones drugs (e.g. ivermectin). To date, at least 12 purebred dog breeds have been found to be affected by this mutation. The aim of this study was to update information about the prevalence of ABCB1 mutation (c.227_230delATAG) in predisposed breeds in multiple European countries. This large scale survey also includes countries which were not involved in previous studies. The samples were collected in the period from 2012 to 2014. The overview is based on genotyping data of 4729 individuals. The observed mutant allele frequencies were 58.5% (Smooth Collie), 48.3% (Rough Collie), 35% (Australian Shepherd), 30.3% (Shetland Sheepdog), 28.1% (Silken Windhound), 26.1% (Miniature Australian Shepherd), 24.3% (Longhaired Whippet), 16.2% (White Swiss Shepherd) and 0% (Border Collie). The possible presence of an ABCB1 mutant allele in Akita-Inu breed has been investigated with negative results. This information could be helpful for breeders in optimization of their breeding strategy and for veterinarians when prescribing drug therapy for dogs of predisposed breeds. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kaiyue Sun
Full Text Available Mutated mouse lipoprotein lipase (LPL containing a leucine (L to histidine (H substitution at position 452 was transferred into mouse liver by hydrodynamics-based gene delivery (HD. Mutated-LPL (MLPL gene transfer significantly increased the concentrations of plasma MLPL and triglyceride (TG but significantly decreased the activity of plasma LPL. Moreover, the gene transfer caused adiposis hepatica and significantly increased TG content in mouse liver. To understand the effects of MLPL gene transfer on energy metabolism, we investigated the expression of key functional genes related to energy metabolism in the liver, epididymal fat, and leg muscles. The mRNA contents of hormone-sensitive lipase (HSL, adipose triglyceride lipase (ATGL, fatty acid-binding protein (FABP, and uncoupling protein (UCP were found to be significantly reduced. Furthermore, we investigated the mechanism by which MLPL gene transfer affected fat deposition in the liver, fat tissue, and muscle. The gene expression and protein levels of forkhead Box O3 (FOXO3, AMP-activated protein kinase (AMPK, and peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α were found to be remarkably decreased in the liver, fat and muscle. These results suggest that the Leu452His mutation caused LPL dysfunction and gene transfer of MLPL in vivo produced resistance to the AMPK/PGC-1α signaling pathway in mice.
KRAS mutation: should we test for it, and does it matter?
Roberts, Patrick J; Stinchcombe, Thomas E
2013-03-10
Lung cancer is the leading cause of cancer mortality in the United States and worldwide. Previously, lung cancer was simplistically divided into non-small-cell lung cancer (NSCLC) and small-cell lung cancer. However, in the last decade, we have gone from a simplistic binary system of classifying lung cancer to defining NSCLC on the basis of molecular subsets. KRAS mutations represent the most common molecular change in NSCLC. The presence of KRAS mutation has been shown to be associated with a poor prognosis in NSCLC, but this is of little clinical utility. More important is determining the clinical utility of KRAS mutational analysis for predicting benefit of chemotherapy, epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), anti-EGFR monoclonal antibodies, or other novel therapeutics. Current data does not support the routine use of KRAS mutational analysis for predicting chemotherapy benefit. Additionally, there was significant interest in using KRAS status to select patients for EGFR TKI and anti-EGFR monoclonal antibodies. However, the EGFR mutational status has demonstrated significant predictive value in the selection of patients for EGFR TKI therapy and is now the preferred test. An association between KRAS mutational status and benefit of anti-EGFR monoclonal antibodies has not been demonstrated in NSCLC. Here we review, in the context of NSCLC, the underlying biology of KRAS mutations, the predictive value of KRAS mutations for therapeutic intervention, and the integration of KRAS mutational testing into our current clinical paradigms.
Song, Xiaoyun; Liu, Xingcai; Ding, Xi
2017-04-01
The human epidermal growth factor receptor (EGFR) has been established as an attractive target for lung cancer therapy. However, an acquired EGFR T790M gatekeeper mutation is frequently observed in patients treated with first-line anticancer agents such as gefitinib and erlotinib to cause drug resistance, largely limiting the application of small-molecule kinase inhibitors in EGFR-targeted chemotherapy. Previously, the reversible pan-kinase inhibitor staurosporine and its several analogs such as Gö6976 and K252a have been reported to selectively inhibit the EGFR T790M mutant (EGFR T790M ) over wild-type kinase (EGFR WT ), suggesting that the staurosporine scaffold is potentially to develop the wild-type sparing reversible inhibitors of EGFR T790M . Here, we systematically evaluated the inhibitor response of 28 staurosporine scaffold-based compounds to EGFR T790M mutation at structural, energetic, and molecular levels by using an integrated in silico-in vitro analog-sensitive (AS) kinase technology. With the strategy, we were able to identify 4 novel wild-type sparing inhibitors UCN-01, UCN-02, AFN941, and SB-218078 with high or moderate selectivity of 30-, 45-, 5-, and 8-fold for EGFR T790M over EGFR WT , respectively, which are comparable with or even better than that of the parent compound staurosporine (24-fold). Molecular modeling and structural analysis revealed that van der Waals contacts and hydrophobic forces can form between the side chain of mutated residue Met790 and the pyrrolidinone moiety of inhibitor ligand UCN-02, which may simultaneously improve the favorable interaction energy between the kinase and inhibitor, and reduce the unfavorable desolvation penalty upon the kinase-inhibitor binding. A hydroxyl group of UCN-02 additional to staurosporine locates at the pyrrolidinone moiety, which can largely alter the electronic distribution of pyrrolidinone moiety and thus promote the intermolecular interaction with Met790 residue. This can well explain
Molecular Imaging of the ATM Kinase Activity
Energy Technology Data Exchange (ETDEWEB)
Williams, Terence M. [Department of Radiation Oncology, Ohio State University, Columbus, Ohio (United States); Nyati, Shyam [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Center for Molecular Imaging, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Ross, Brian D. [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Department of Radiology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Rehemtulla, Alnawaz, E-mail: alnawaz@umich.edu [Department of Radiation Oncology, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Center for Molecular Imaging, University of Michigan Medical Center, Ann Arbor, Michigan (United States); Department of Radiology, University of Michigan Medical Center, Ann Arbor, Michigan (United States)
2013-08-01
Purpose: Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including from DNA double-strand breaks. ATM activation results in the initiation of a complex cascade of events including DNA damage repair, cell cycle checkpoint control, and survival. We sought to create a bioluminescent reporter that dynamically and noninvasively measures ATM kinase activity in living cells and subjects. Methods and Materials: Using the split luciferase technology, we constructed a hybrid cDNA, ATM-reporter (ATMR), coding for a protein that quantitatively reports on changes in ATM kinase activity through changes in bioluminescence. Results: Treatment of ATMR-expressing cells with ATM inhibitors resulted in a dose-dependent increase in bioluminescence activity. In contrast, induction of ATM kinase activity upon irradiation resulted in a decrease in reporter activity that correlated with ATM and Chk2 activation by immunoblotting in a time-dependent fashion. Nuclear targeting improved ATMR sensitivity to both ATM inhibitors and radiation, whereas a mutant ATMR (lacking the target phosphorylation site) displayed a muted response. Treatment with ATM inhibitors and small interfering (si)RNA-targeted knockdown of ATM confirm the specificity of the reporter. Using reporter expressing xenografted tumors demonstrated the ability of ATMR to report in ATM activity in mouse models that correlated in a time-dependent fashion with changes in Chk2 activity. Conclusions: We describe the development and validation of a novel, specific, noninvasive bioluminescent reporter that enables monitoring of ATM activity in real time, in vitro and in vivo. Potential applications of this reporter include the identification and development of novel ATM inhibitors or ATM-interacting partners through high-throughput screens and in vivo pharmacokinetic/pharmacodynamic studies of ATM inhibitors in preclinical models.
Bjursell, Magnus K; Blom, Henk J; Cayuela, Jordi Asin; Engvall, Martin L; Lesko, Nicole; Balasubramaniam, Shanti; Brandberg, Göran; Halldin, Maria; Falkenberg, Maria; Jakobs, Cornelis; Smith, Desiree; Struys, Eduard; von Döbeln, Ulrika; Gustafsson, Claes M; Lundeberg, Joakim; Wedell, Anna
2011-10-07
Four inborn errors of metabolism (IEMs) are known to cause hypermethioninemia by directly interfering with the methionine cycle. Hypermethioninemia is occasionally discovered incidentally, but it is often disregarded as an unspecific finding, particularly if liver disease is involved. In many individuals the hypermethioninemia resolves without further deterioration, but it can also represent an early sign of a severe, progressive neurodevelopmental disorder. Further investigation of unclear hypermethioninemia is therefore important. We studied two siblings affected by severe developmental delay and liver dysfunction. Biochemical analysis revealed increased plasma levels of methionine, S-adenosylmethionine (AdoMet), and S-adenosylhomocysteine (AdoHcy) but normal or mildly elevated homocysteine (Hcy) levels, indicating a block in the methionine cycle. We excluded S-adenosylhomocysteine hydrolase (SAHH) deficiency, which causes a similar biochemical phenotype, by using genetic and biochemical techniques and hypothesized that there was a functional block in the SAHH enzyme as a result of a recessive mutation in a different gene. Using exome sequencing, we identified a homozygous c.902C>A (p.Ala301Glu) missense mutation in the adenosine kinase gene (ADK), the function of which fits perfectly with this hypothesis. Increased urinary adenosine excretion confirmed ADK deficiency in the siblings. Four additional individuals from two unrelated families with a similar presentation were identified and shown to have a homozygous c.653A>C (p.Asp218Ala) and c.38G>A (p.Gly13Glu) mutation, respectively, in the same gene. All three missense mutations were deleterious, as shown by activity measurements on recombinant enzymes. ADK deficiency is a previously undescribed, severe IEM shedding light on a functional link between the methionine cycle and adenosine metabolism. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Zlobina, M V; Steblyanko, Yu Yu; Shklyaeva, M A; Kharchenko, V V; Salova, A V; Kornilova, E S
2015-01-01
To confirm the hypothesis about the involvement of EGF-stimulated MAP-kinase ERK1/2 in the regulation of microtubule (MT) system, the influence of two widely used ERK1/2 inhibitors, U0126 and PD98059, on the organization of tubulin cytoskeleton in interphase HeLa cells during EGF receptor endocytosis has been investigated. We have found that addition of U0126 or PD98059 to not-stimulated with EGF ells for 30 min has no effect on radially organized MT system. However, in the case of U0126 addition before EGF endocytosis stimulation, the number of MT per cell decreased within 15 min after such stimulation and was followed by complete MT depolymerization by 60-90 min. Stimulation of EGF endocytosis in the presence of PD98059 resulted only in insignificant depolymerization of MT and it could be detected mainly from their minus-ends. At the same time, MT regions close to plasma membrane became stabilized, which was proved by increase in tubulin acetylation level. This situation was characteristic for all period of the experiment. It has been also found that the inhibitors affect endocytosis dynamics of EGF-receptor complexes. Quantitative analysis demonstrated that the stimulation of endocytosis in the presence of U0126 generated a greater number of endosomes compared to control cells, and their number did not change significantly during the experiment. All these endosomes were localized peripherally. Effect of PD98059 resulted in the formation of lower number of endosomes that in control, but they demonstrated very slow clusterization despite the presence of some intact MT. Both inhibitors decreased EGFR colocolization with early endosomal marker EEA1, which indicated a delay in endosome fusions and maturation. The inhibitors were also shown to affect differently phospho-ERK 1 and 2 forms: U0126 completely inhibited phospho-ERK1 and 2, white, in the presence of PD98059, the two ERK forms demonstrated sharp transient activation in 15 min after stimulation, but only
Effect of starvation, diabetes and insulin on the casein kinase 2 from rat liver cytosol.
Martos, C; Plana, M; Guasch, M D; Itarte, E
1985-01-01
Starvation, diabetes and insulin did not alter the concentration of casein kinases in rat liver cytosol. However, the Km for casein of casein kinase 2 from diabetic rats was about 2-fold lower than that from control animals. Administration of insulin to control rats did not alter this parameter, but increased the Km for casein of casein kinase 2 in diabetic rats. Starvation did not affect the kinetic constants of casein kinases. The effect of diabetes on casein kinase 2 persisted after partia...
Patnaik, M M; Lasho, T L; Finke, C M; Gangat, N; Caramazza, D; Holtan, S G; Pardanani, A; Knudson, R A; Ketterling, R P; Chen, D; Hoyer, J D; Hanson, C A; Tefferi, A
2010-07-01
The 2008 World Health Organization (WHO) criteria were used to identify 88 consecutive Mayo Clinic patients with 'myelodysplastic syndrome with isolated del(5q)' (median age 74 years; 60 females). In all, 60 (68%) patients were followed up to the time of their death. Overall median survival was 66 months; leukemic transformation was documented in five (5.7%) cases. Multivariable analysis identified age >or=70 years (P=0.01), transfusion need at diagnosis (P=0.04) and dysgranulopoiesis (P=0.02) as independent predictors of shortened survival; the presence of zero (low risk), one (intermediate risk) or >or=2 (high risk) risk factors corresponded to median survivals of 102, 52 and 27 months, respectively. Janus kinase 2 (JAK2), thrombopoietin receptor (MPL), isocitrate dehydrogenase 1 (IDH1) and IDH2 mutational analysis was performed on archived bone marrows in 78 patients; JAK2V617F and MPLW515L mutations were shown in five (6.4%) and three (3.8%) patients, respectively, and did not seem to affect phenotype or prognosis. IDH mutations were not detected. Survival was not affected by serum ferritin and there were no instances of death directly related to iron overload. The current study is unique in its strict adherence to WHO criteria for selecting study patients and providing information on long-term survival, practical prognostic factors, baseline risk of leukemic transformation and the prevalence of JAK2, MPL and IDH mutations.
Directory of Open Access Journals (Sweden)
Calzavara-Pinton Pier
2009-11-01
Full Text Available Abstract Background Loeys-Dietz syndrome (LDS is a rare autosomal dominant disorder showing the involvement of cutaneous, cardiovascular, craniofacial, and skeletal systems. In particular, LDS patients show arterial tortuosity with widespread vascular aneurysm and dissection, and have a high risk of aortic dissection or rupture at an early age and at aortic diameters that ordinarily are not predictive of these events. Recently, LDS has been subdivided in LDS type I (LDSI and type II (LDSII on the basis of the presence or the absence of cranio-facial involvement, respectively. Furthermore, LDSII patients display at least two of the major signs of vascular Ehlers-Danlos syndrome. LDS is caused by mutations in the transforming growth factor (TGF beta-receptor I (TGFBR1 and II (TGFBR2 genes. The aim of this study was the clinical and molecular characterization of two LDS patients. Methods The exons and intronic flanking regions of TGFBR1 and TGFBR2 genes were amplified and sequence analysis was performed. Results Patient 1 was a boy showing dysmorphic signs, blue sclerae, high-arched palate, bifid uvula; skeletal system involvement, joint hypermobility, velvety and translucent skin, aortic root dilatation, tortuosity and elongation of the carotid arteries. These signs are consistent with an LDSI phenotype. The sequencing analysis disclosed the novel TGFBR1 p.Asp351Gly de novo mutation falling in the kinase domain of the receptor. Patient 2 was an adult woman showing ascending aorta aneurysm, with vascular complications following surgery intervention. Velvety and translucent skin, venous varicosities and wrist dislocation were present. These signs are consistent with an LDSII phenotype. In this patient and in her daughter, TGFBR2 genotyping disclosed in the kinase domain of the protein the novel p.Ile510Ser missense mutation. Conclusion We report two novel mutations in the TGFBR1 and TGFBR2 genes in two patients affected with LDS and showing marked
Parkinson's Disease: Leucine-Rich Repeat Kinase 2 and Autophagy, Intimate Enemies
Directory of Open Access Journals (Sweden)
José M. Bravo-San Pedro
2012-01-01
Full Text Available Parkinson's disease is the second common neurodegenerative disorder, after Alzheimer's disease. It is a clinical syndrome characterized by loss of dopamine-generating cells in the substancia nigra, a region of the midbrain. The etiology of Parkinson's disease has long been through to involve both genetic and environmental factors. Mutations in the leucine-rich repeat kinase 2 gene cause late-onset Parkinson's disease with a clinical appearance indistinguishable from Parkinson's disease idiopathic. Autophagy is an intracellular catabolic mechanism whereby a cell recycles or degrades damage proteins and cytoplasmic organelles. This degradative process has been associated with cellular dysfunction in neurodegenerative processes including Parkinson's disease. We discuss the role of leucine-rich repeat kinase 2 in autophagy, and how the deregulations of this degradative mechanism in cells can be implicated in the Parkinson's disease etiology.
Bowles, Kristen; Cukras, Catherine; Turriff, Amy; Sergeev, Yuri; Vitale, Susan; Bush, Ronald A; Sieving, Paul A
2011-11-29
To assess the effect of age and RS1 mutation on the phenotype of X-linked retinoschisis (XLRS) subjects using the clinical electroretinogram (ERG) in a cross-sectional analysis. Sixty-eight XLRS males 4.5 to 55 years of age underwent genotyping, and the retinoschisis (RS1) mutations were classified as less severe (27 subjects) or more severe (41 subjects) based on the putative impact on the protein. ERG parameters of retinal function were analyzed by putative mutation severity with age as a continuous variable. The a-wave amplitude remained greater than the lower limit of normal (mean, -2 SD) for 72% of XLRS males and correlated with neither age nor mutation class. However, b-wave and b/a-ratio amplitudes were significantly lower in the more severe than in the less severe mutation groups and in older than in younger subjects. Subjects up to 10 years of age with more severe RS1 mutations had significantly greater b-wave amplitudes and faster a-wave trough implicit times than older subjects in this group. RS1 mutation putative severity and age both had significant effects on retinal function in XLRS only in the severe mutation group, as judged by ERG analysis of the b-wave amplitude and the b/a-ratio, whereas the a-wave amplitude remained normal in most. A new observation was that increasing age (limited to those aged 55 and younger) caused a significant delay in XLRS b-wave onset (i.e., a-wave implicit time), even for those who retained considerable b-wave amplitudes. The delayed b-wave onset suggested that dysfunction of the photoreceptor synapse or of bipolar cells increases with age of XLRS subjects.
Hashimoto, Yuichi; Toyama, Yuka; Kusakari, Shinya; Nawa, Mikiro; Matsuoka, Masaaki
2016-06-03
A missense mutation (T835M) in the uncoordinated-5C (UNC5C) netrin receptor gene increases the risk of late-onset Alzheimer disease (AD) and also the vulnerability of neurons harboring the mutation to various insults. The molecular mechanisms underlying T835M-UNC5C-induced death remain to be elucidated. In this study, we show that overexpression of wild-type UNC5C causes low-grade death, which is intensified by an AD-linked mutation T835M. An AD-linked survival factor, calmodulin-like skin protein (CLSP), and a natural ligand of UNC5C, netrin1, inhibit this death. T835M-UNC5C-induced neuronal cell death is mediated by an intracellular death-signaling cascade, consisting of death-associated protein kinase 1/protein kinase D/apoptosis signal-regulating kinase 1 (ASK1)/JNK/NADPH oxidase/caspases, which merges at ASK1 with a death-signaling cascade, mediated by amyloid β precursor protein (APP). Notably, netrin1 also binds to APP and partially inhibits the death-signaling cascade, induced by APP. These results may provide new insight into the amyloid β-independent pathomechanism of AD. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Roth Flach, Rachel J; Danai, Laura V; DiStefano, Marina T; Kelly, Mark; Menendez, Lorena Garcia; Jurczyk, Agata; Sharma, Rohit B; Jung, Dae Young; Kim, Jong Hun; Kim, Jason K; Bortell, Rita; Alonso, Laura C; Czech, Michael P
2016-07-29
Previous studies revealed a paradox whereby mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) acted as a negative regulator of insulin sensitivity in chronically obese mice, yet systemic deletion of Map4k4 did not improve glucose tolerance. Here, we report markedly reduced glucose-responsive plasma insulin and C-peptide levels in whole body Map4k4-depleted mice (M4K4 iKO) as well as an impaired first phase of insulin secretion from islets derived from M4K4 iKO mice ex vivo After long-term high fat diet (HFD), M4K4 iKO mice pancreata also displayed reduced β cell mass, fewer proliferating β cells and reduced islet-specific gene mRNA expression compared with controls, although insulin content was normal. Interestingly, the reduced plasma insulin in M4K4 iKO mice exposed to chronic (16 weeks) HFD was not observed in response to acute HFD challenge or short term treatment with the insulin receptor antagonist S961. Furthermore, the improved insulin sensitivity in obese M4K4 iKO mice was abrogated by high exogenous insulin over the course of a euglycemic clamp study, indicating that hypoinsulinemia promotes insulin sensitivity in chronically obese M4K4 iKO mice. These results demonstrate that protein kinase Map4k4 drives obesity-induced hyperinsulinemia and insulin resistance in part by promoting insulin secretion from β cells in mice. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Mazurova, Stella; Magner, Martin; Kucerova-Vidrova, Vendula; Vondrackova, Alzbeta; Stranecky, Viktor; Pristoupilova, Anna; Zamecnik, Josef; Hansikova, Hana; Zeman, Jiri; Tesarova, Marketa; Honzik, Tomas
2017-07-01
Cardiomyopathy is a common manifestation in neonates and infants with mitochondrial disorders. In this study, we report two cases manifesting with fatal mitochondrial hypertrophic cardiomyopathy, which include the third known patient with thymidine kinase 2 deficiency and the ninth patient with alanyl-tRNA synthetase 2 deficiency. The girl with thymidine kinase 2 deficiency had hypertrophic cardiomyopathy together with regression of gross motor development at the age of 13 months. Neurological symptoms and cardiac involvement progressed into severe myopathy, psychomotor arrest, and cardiorespiratory failure at the age of 22 months. The imaging methods and autoptic studies proved that she suffered from unique findings of leucoencephalopathy, severe, mainly cerebellar neuronal degeneration, and hepatic steatosis. The girl with alanyl-tRNA synthetase 2 deficiency presented with cardiac failure and underlying hypertrophic cardiomyopathy within 12 hours of life and subsequently died at 9 weeks of age. Muscle biopsy analyses demonstrated respiratory chain complex I and IV deficiencies, and histological evaluation revealed massive mitochondrial accumulation and cytochrome c oxidase-negative fibres in both cases. Exome sequencing in the first case revealed compound heterozygozity for one novel c.209T>C and one previously published c.416C>T mutation in the TK2 gene, whereas in the second case homozygozity for the previously described mutation c.1774C>T in the AARS2 gene was determined. The thymidine kinase 2 mutations resulted in severe mitochondrial DNA depletion (to 12% of controls) in the muscle. We present, for the first time, severe leucoencephalopathy and hepatic steatosis in a patient with thymidine kinase 2 deficiency and the finding of a ragged red fibre-like image in the muscle biopsy in a patient with alanyl-tRNA synthetase 2 deficiency.
Mutations and binding sites of human transcription factors
Kamanu, Frederick Kinyua
2012-06-01
Mutations in any genome may lead to phenotype characteristics that determine ability of an individual to cope with adaptation to environmental challenges. In studies of human biology, among the most interesting ones are phenotype characteristics that determine responses to drug treatments, response to infections, or predisposition to specific inherited diseases. Most of the research in this field has been focused on the studies of mutation effects on the final gene products, peptides, and their alterations. Considerably less attention was given to the mutations that may affect regulatory mechanism(s) of gene expression, although these may also affect the phenotype characteristics. In this study we make a pilot analysis of mutations observed in the regulatory regions of 24,667 human RefSeq genes. Our study reveals that out of eight studied mutation types, insertions are the only one that in a statistically significant manner alters predicted transcription factor binding sites (TFBSs). We also find that 25 families of TFBSs have been altered by mutations in a statistically significant manner in the promoter regions we considered. Moreover, we find that the related transcription factors are, for example, prominent in processes related to intracellular signaling; cell fate; morphogenesis of organs and epithelium; development of urogenital system, epithelium, and tube; neuron fate commitment. Our study highlights the significance of studying mutations within the genes regulatory regions and opens way for further detailed investigations on this topic, particularly on the downstream affected pathways. 2012 Kamanu, Medvedeva, Schaefer, Jankovic, Archer and Bajic.
Rooting, growth, and color mutation of poinsettias affected by gamma radiation
Energy Technology Data Exchange (ETDEWEB)
Lee, Eun Kyung; Kim, Won Hee; Kim, Seung Tae [National Institute of Horticultural and Herbal Science, RDA, Suwon (Korea, Republic of); Kang, Si Yong [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)
2010-09-15
This experiment was carried out to investigate the effects of gamma-radiation on the rooting, growth, and color mutation in poinsettia. Using 10 poinsettia varieties ('Lollipop', 'Little Peace', 'Happy Day', 'Early Bird', 'Pixy Red', 'Happy Time', 'Heidi', 'Red Bell', 'Clara', and 'Scarlet') bred by National Institute of Horticultural and Herbal Science, 100 Gy of gamma ray was irradiated at the stage of callused cuttings. Four weeks after sticking cuttings in the rooting media, 8 cultivars showed 100% of root formation, but 'Early Bird' rooted 24.4% and even died off during the cutting propagation. After planting rooted cuttings, survival rate until flowering time varied among irradiated cultivars. While 'Pixy Red' and 'Heidi' survived about 98%, 'Clara', 'Happy Day', and 'Early Bird' survived lesser than 30%. All irradiated plants showed remarkably shorter plant height, lesser branch numbers than non-irradiated control plants. Thirty color mutants were obtained among 281 plants survived until flowering time. Nine were complete color mutated branches, whereas 21 mutants were partially color mutated bracts and transitional leaves. Color patterns mutated by 100 Gy of gamma ray were divided into pink, hot pink, light red and spotted (pink spots with red main color). Pink mutants were commonly obtained. Complete color mutants were discovered from 4 plants of 'Pixy Red', 2 plants of 'Red Bell' and 3 plants of Lollipop.
Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia
Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.
2017-01-01
Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077
Frenoy, Antoine; Bonhoeffer, Sebastian
2018-05-01
The stress-induced mutagenesis hypothesis postulates that in response to stress, bacteria increase their genome-wide mutation rate, in turn increasing the chances that a descendant is able to better withstand the stress. This has implications for antibiotic treatment: exposure to subinhibitory doses of antibiotics has been reported to increase bacterial mutation rates and thus probably the rate at which resistance mutations appear and lead to treatment failure. More generally, the hypothesis posits that stress increases evolvability (the ability of a population to generate adaptive genetic diversity) and thus accelerates evolution. Measuring mutation rates under stress, however, is problematic, because existing methods assume there is no death. Yet subinhibitory stress levels may induce a substantial death rate. Death events need to be compensated by extra replication to reach a given population size, thus providing more opportunities to acquire mutations. We show that ignoring death leads to a systematic overestimation of mutation rates under stress. We developed a system based on plasmid segregation that allows us to measure death and division rates simultaneously in bacterial populations. Using this system, we found that a substantial death rate occurs at the tested subinhibitory concentrations previously reported to increase mutation rate. Taking this death rate into account lowers and sometimes removes the signal for stress-induced mutagenesis. Moreover, even when antibiotics increase mutation rate, we show that subinhibitory treatments do not increase genetic diversity and evolvability, again because of effects of the antibiotics on population dynamics. We conclude that antibiotic-induced mutagenesis is overestimated because of death and that understanding evolvability under stress requires accounting for the effects of stress on population dynamics as much as on mutation rate. Our goal here is dual: we show that population dynamics and, in particular, the
Structural basis for activation of ZAP-70 by phosphorylation of the SH2-kinase linker.
Yan, Qingrong; Barros, Tiago; Visperas, Patrick R; Deindl, Sebastian; Kadlecek, Theresa A; Weiss, Arthur; Kuriyan, John
2013-06-01
Serial activation of the tyrosine kinases Lck and ZAP-70 initiates signaling downstream of the T cell receptor. We previously reported the structure of an autoinhibited ZAP-70 variant in which two regulatory tyrosine residues (315 and 319) in the SH2-kinase linker were replaced by phenylalanine. We now present a crystal structure of ZAP-70 in which Tyr 315 and Tyr 319 are not mutated, leading to the recognition of a five-residue sequence register error in the SH2-kinase linker of the original crystallographic model. The revised model identifies distinct roles for these two tyrosines. As seen in a recently reported structure of the related tyrosine kinase Syk, Tyr 315 of ZAP-70 is part of a hydrophobic interface between the regulatory apparatus and the kinase domain, and the integrity of this interface would be lost upon engagement of doubly phosphorylated peptides by the SH2 domains. Tyr 319 is not necessarily dislodged by SH2 engagement, which activates ZAP-70 only ∼5-fold in vitro. In contrast, phosphorylation by Lck activates ZAP-70 ∼100-fold. This difference is due to the ability of Tyr 319 to suppress ZAP-70 activity even when the SH2 domains are dislodged from the kinase domain, providing stringent control of ZAP-70 activity downstream of Lck.
Directory of Open Access Journals (Sweden)
Chen D
2016-07-01
Full Text Available Dan Chen,1 Zhengbo Song,2 Guoping Cheng3 1Department of Cardiothoracic Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing, 2Department of Chemotherapy, 3Department of Pathology, Zhejiang Cancer Hospital, Hangzhou, People’s Republic of China Purpose: Subsets of non-small-cell lung cancer patients with epidermal growth factor receptor (EGFR mutations carry uncommon subtypes. We evaluated the efficacy of first-generation EGFR-tyrosine kinase inhibitors (TKIs; erlotinib, gefitinib, and icotinib in patients with non-small-cell lung cancer carrying insertions and T790M and S768I mutations in EGFR exon 20. Patients and methods: Patients carrying EGFR exon 20 insertion/T790M/S768I mutations and treated with EGFR-TKIs were evaluated from 2005 to 2014 in Zhejiang Cancer Hospital. The efficacy was evaluated using the Kaplan–Meier method and compared with the log-rank test. Results: Sixty-two patients with exon 20 insertion/T790M/S768I mutations were enrolled. Mutations including exon 20 insertions and T790M and S768I mutations were observed in 29, 23, and ten patients, respectively. In total, the response rate and median progression-free survival (PFS were 8.1% and 2.1 months, respectively. Patients with S768I mutation manifested the longest median PFS (2.7 months, followed by those with T790M (2.4 months and exon 20 insertions (1.9 months; P=0.022. Patients with complex mutations show a better PFS than those with single mutations (2.7 months vs 1.9 months; P=0.034. Conclusion: First-generation EGFR-TKIs are less effective in patients with exon 20 uncommon mutations than in those with common mutations. Patients with complex mutations benefited more from first-generation EGFR-TKIs than those with single mutations. Keywords: non-small cell lung cancer, epidermal growth factor receptor, EGFR mutations, exon 20, tyrosine kinase inhibitor
Patnaik, M M; Lasho, T L; Finke, C M; Gangat, N; Caramazza, D; Holtan, S G; Pardanani, A; Knudson, R A; Ketterling, R P; Chen, D; Hoyer, J D; Hanson, C A; Tefferi, A
2010-01-01
The 2008 World Health Organization (WHO) criteria were used to identify 88 consecutive Mayo Clinic patients with ‘myelodysplastic syndrome with isolated del(5q)' (median age 74 years; 60 females). In all, 60 (68%) patients were followed up to the time of their death. Overall median survival was 66 months; leukemic transformation was documented in five (5.7%) cases. Multivariable analysis identified age ⩾70 years (P=0.01), transfusion need at diagnosis (P=0.04) and dysgranulopoiesis (P=0.02) as independent predictors of shortened survival; the presence of zero (low risk), one (intermediate risk) or ⩾2 (high risk) risk factors corresponded to median survivals of 102, 52 and 27 months, respectively. Janus kinase 2 (JAK2), thrombopoietin receptor (MPL), isocitrate dehydrogenase 1 (IDH1) and IDH2 mutational analysis was performed on archived bone marrows in 78 patients; JAK2V617F and MPLW515L mutations were shown in five (6.4%) and three (3.8%) patients, respectively, and did not seem to affect phenotype or prognosis. IDH mutations were not detected. Survival was not affected by serum ferritin and there were no instances of death directly related to iron overload. The current study is unique in its strict adherence to WHO criteria for selecting study patients and providing information on long-term survival, practical prognostic factors, baseline risk of leukemic transformation and the prevalence of JAK2, MPL and IDH mutations. PMID:20485371
Mevalonate kinase deficiencies: from mevalonic aciduria to hyperimmunoglobulinemia D syndrome
Directory of Open Access Journals (Sweden)
Hoffmann Georg F
2006-04-01
Full Text Available Abstract Mevalonic aciduria (MVA and hyperimmunoglobulinemia D syndrome (HIDS represent the two ends of a clinical spectrum of disease caused by deficiency of mevalonate kinase (MVK, the first committed enzyme of cholesterol biosynthesis. At least 30 patients with MVA and 180 patients with HIDS have been reported worldwide. MVA is characterized by psychomotor retardation, failure to thrive, progressive cerebellar ataxia, dysmorphic features, progressive visual impairment and recurrent febrile crises. The febrile episodes are commonly accompanied by hepatosplenomegaly, lymphadenopathy, abdominal symptoms, arthralgia and skin rashes. Life expectancy is often compromised. In HIDS, only febrile attacks are present, but a subgroup of patients may also develop neurological abnormalities of varying degree such as mental retardation, ataxia, ocular symptoms and epilepsy. A reduced activity of MVK and pathogenic mutations in the MVK gene have been demonstrated as the common genetic basis in both disorders. In MVA, the diagnosis is established by detection of highly elevated levels of mevalonic acid excreted in urine. Increased levels of immunoglobulin D (IgD and, in most patients of immunoglobulin A (IgA, in combination with enhanced excretion of mevalonic acid provide strong evidence for HIDS. The diagnosis is confirmed by low activity of mevalonate kinase or by demonstration of disease-causing mutations. Genetic counseling should be offered to families at risk. There is no established successful treatment for MVA. Simvastatin, an inhibitor of HMG-CoA reductase, and anakinra have been shown to have beneficial effect in HIDS.
Infantile Alexander Disease: Spectrum of GFAP Mutations and Genotype-Phenotype Correlation
Rodriguez, Diana; Gauthier, Fernande; Bertini, Enrico; Bugiani, Marianna; Brenner, Michael; N'guyen, Sylvie; Goizet, Cyril; Gelot, Antoinette; Surtees, Robert; Pedespan, Jean-Michel; Hernandorena, Xavier; Troncoso, Monica; Uziel, Graziela; Messing, Albee; Ponsot, Gérard; Pham-Dinh, Danielle; Dautigny, André; Boespflug-Tanguy, Odile
2001-01-01
Heterozygous, de novo mutations in the glial fibrillary acidic protein (GFAP) gene have recently been reported in 12 patients affected by neuropathologically proved Alexander disease. We searched for GFAP mutations in a series of patients who had heterogeneous clinical symptoms but were candidates for Alexander disease on the basis of suggestive neuroimaging abnormalities. Missense, heterozygous, de novo GFAP mutations were found in exons 1 or 4 for 14 of the 15 patients analyzed, including patients without macrocephaly. Nine patients carried arginine mutations (four had R79H; four had R239C; and one had R239H) that have been described elsewhere, whereas the other five had one of four novel mutations, of which two affect arginine (2R88C and 1R88S) and two affect nonarginine residues (1L76F and 1N77Y). All mutations were located in the rod domain of GFAP, and there is a correlation between clinical severity and the affected amino acid. These results confirm that GFAP mutations are a reliable molecular marker for the diagnosis of infantile Alexander disease, and they also form a basis for the recommendation of GFAP analysis for prenatal diagnosis to detect potential cases of germinal mosaicism. PMID:11567214
Oncoprotein protein kinase antibody kit
Karin, Michael [San Diego, CA; Hibi, Masahiko [San Diego, CA; Lin, Anning [La Jolla, CA
2008-12-23
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Domino, Steven E.; Karnak, David M.; Hurd, Elizabeth A.
2006-01-01
Background/Aims: Neoplasia-related alterations in cell surface α(1,2)fucosylated glycans have been reported in multiple tumors including colon, pancreas, endometrium, cervix, bladder, lung, and choriocarcinoma. Spontaneous colorectal tumors from mice with a germline null mutation of transforming growth factor-β signaling gene Smad3 (Madh3) were tested for α(1,2)fucosylated glycan expression. Methods: Ulex Europaeus Agglutinin-I lectin staining, fucosyltransferase gene northern blot analysis, and a cross of mutant mice with Fut2 and Smad3 germline mutations were performed. Results: Spontaneous colorectal tumors from Smad3 (-/-) homozygous null mice were found to express α(1,2)fucosylated glycans in an abnormal pattern compared to adjacent nonneoplastic colon. Northern blot analysis of α(1,2)fucosyltransferase genes Fut1 and Fut2 revealed that Fut2, but not Fut1, steady-state mRNA levels were significantly increased in tumors relative to adjacent normal colonic mucosa. Mutant mice with a Fut2-inactivating germline mutation were crossed with Smad3 targeted mice. In Smad3 (-/-)/Fut2 (-/-) double knock-out mice, UEA-I lectin staining was eliminated from colon and colon tumors, however, the number and size of tumors present by 24 weeks of age did not vary regardless of the Fut2 genotype. Conclusions: In this model of colorectal cancer, cell surface α(1,2)fucosylation does not affect development of colon tumors. PMID:17264540
Jonas Cicenas; Egle Zalyte; Amos Bairoch; Pascale Gaudet
2018-01-01
Protein kinases are a large family of enzymes catalyzing protein phosphorylation. The human genome contains 518 protein kinase genes, 478 of which belong to the classical protein kinase family and 40 are atypical protein kinases [...
Investigation of FecB Mutation in Four Romanian Sheep Breeds
Directory of Open Access Journals (Sweden)
Sergiu-Emil Georgescu
2011-05-01
Full Text Available Hyperprolific phenotype of Booroola sheep was first discovered in the Australian Merino breed. This phenotype is due to the action of a single autosomal gene that influences the number of ovulations per estrogenic cycle. Recent discoveries have revealed that high prolificacy in Booroola Merino sheep is the result of a mutation (FecB in the bone morphogenetic protein receptor 1B (BMPR-1B gene. This mutation is located in the highly conserved kinase domain of the bone morphogenetic protein receptor IB, and is characterized by precocious differentiation of ovarian follicles, leading to the production of large numbers of ovulatory follicles. Our objective was to develop an easy method to identify the FecB mutation in order to screen sheep populations in terms of prolificacy. We designed primers to amplify a 190 bp fragment from the BMPR-1B gene containing or lacking the mutation. The PCR product was cut with AvaII endonuclease and the restriction products were analysed by agarose gel electrophoresis. Using the PCR-RFLP technique, we established an easy and efficient method that can be used to screen the FecB mutation. Therefore, these new methods increase the panel of molecular tools available for sheep breeders to choose the most prolific genotypes for improving artificial selection.
STK33 kinase activity is nonessential in KRAS-dependent cancer cells.
Babij, Carol; Zhang, Yihong; Kurzeja, Robert J; Munzli, Anke; Shehabeldin, Amro; Fernando, Manory; Quon, Kim; Kassner, Paul D; Ruefli-Brasse, Astrid A; Watson, Vivienne J; Fajardo, Flordeliza; Jackson, Angela; Zondlo, James; Sun, Yu; Ellison, Aaron R; Plewa, Cherylene A; San, Miguel Tisha; Robinson, John; McCarter, John; Schwandner, Ralf; Judd, Ted; Carnahan, Josette; Dussault, Isabelle
2011-09-01
Despite the prevalence of KRAS mutations in human cancers, there remain no targeted therapies for treatment. The serine-threonine kinase STK33 has been proposed to be required for the survival of mutant KRAS-dependent cell lines, suggesting that small molecule kinase inhibitors of STK33 may be useful to treat KRAS-dependent tumors. In this study, we investigated the role of STK33 in mutant KRAS human cancer cells using RNA interference, dominant mutant overexpression, and small molecule inhibitors. As expected, KRAS downregulation decreased the survival of KRAS-dependent cells. In contrast, STK33 downregulation or dominant mutant overexpression had no effect on KRAS signaling or survival of these cells. Similarly, a synthetic lethal siRNA screen conducted in a broad panel of KRAS wild-type or mutant cells identified KRAS but not STK33 as essential for survival. We also obtained similar negative results using small molecule inhibitors of the STK33 kinase identified by high-throughput screening. Taken together, our findings refute earlier proposals that STK33 inhibition may be a useful therapeutic approach to target human KRAS mutant tumors. ©2011 AACR.
[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].
Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong
2014-10-18
To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in
Congenital Hypopituitarism due to POU1F1 Gene Mutation
Directory of Open Access Journals (Sweden)
Ni-Chung Lee
2011-01-01
Full Text Available POU1F1 (Pit-1; Gene ID 5449 is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome, elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S mutation. The rarity of the disease can result in delayed diagnosis and treatment.
Mutational profile of GNAQQ209 in human tumors.
Directory of Open Access Journals (Sweden)
Simona Lamba
Full Text Available BACKGROUND: Frequent somatic mutations have recently been identified in the ras-like domain of the heterotrimeric G protein alpha-subunit (GNAQ in blue naevi 83%, malignant blue naevi (50% and ocular melanoma of the uvea (46%. The mutations exclusively affect codon 209 and result in GNAQ constitutive activation which, in turn, acts as a dominant oncogene. METHODOLOGY: To assess if the mutations are present in other tumor types we performed a systematic mutational profile of the GNAQ exon 5 in a panel of 922 neoplasms, including glioblastoma, gastrointestinal stromal tumors (GIST, acute myeloid leukemia (AML, blue naevi, skin melanoma, bladder, breast, colorectal, lung, ovarian, pancreas, and thyroid carcinomas. PRINCIPAL FINDINGS: We detected the previously reported mutations in 6/13 (46% blue naevi. Changes affecting Q209 were not found in any of the other tumors. Our data indicate that the occurrence of GNAQ mutations display a unique pattern being present in a subset of melanocytic tumors but not in malignancies of glial, epithelial and stromal origin analyzed in this study.
Use of human tissue to assess the oncogenic activity of melanoma-associated mutations.
Chudnovsky, Yakov; Adams, Amy E; Robbins, Paul B; Lin, Qun; Khavari, Paul A
2005-07-01
Multiple genetic alterations occur in melanoma, a lethal skin malignancy of increasing incidence. These include mutations that activate Ras and two of its effector cascades, Raf and phosphoinositide 3-kinase (PI3K). Induction of Ras and Raf can be caused by active N-Ras and B-Raf mutants as well as by gene amplification. Activation of PI3K pathway components occurs by PTEN loss and by AKT3 amplification. Melanomas also commonly show impairment of the p16(INK4A)-CDK4-Rb and ARF-HDM2-p53 tumor suppressor pathways. CDKN2A mutations can produce p16(INK4A) and ARF protein loss. Rb bypass can also occur through activating CDK4 mutations as well as by CDK4 amplification. In addition to ARF deletion, p53 pathway disruption can result from dominant negative TP53 mutations. TERT amplification also occurs in melanoma. The extent to which these mutations can induce human melanocytic neoplasia is unknown. Here we characterize pathways sufficient to generate human melanocytic neoplasia and show that genetically altered human tissue facilitates functional analysis of mutations observed in human tumors.
The Structural Basis for Activation and Inhibition of ZAP-70 Kinase Domain.
Huber, Roland G; Fan, Hao; Bond, Peter J
2015-10-01
ZAP-70 (Zeta-chain-associated protein kinase 70) is a tyrosine kinase that interacts directly with the activated T-cell receptor to transduce downstream signals, and is hence a major player in the regulation of the adaptive immune response. Dysfunction of ZAP-70 causes selective T cell deficiency that in turn results in persistent infections. ZAP-70 is activated by a variety of signals including phosphorylation of the kinase domain (KD), and binding of its regulatory tandem Src homology 2 (SH2) domains to the T cell receptor. The present study investigates molecular mechanisms of activation and inhibition of ZAP-70 via atomically detailed molecular dynamics simulation approaches. We report microsecond timescale simulations of five distinct states of the ZAP-70 KD, comprising apo, inhibited and three phosphorylated variants. Extensive analysis of local flexibility and correlated motions reveal crucial transitions between the states, thus elucidating crucial steps in the activation mechanism of the ZAP-70 KD. Furthermore, we rationalize previously observed staurosporine-bound crystal structures, suggesting that whilst the KD superficially resembles an "active-like" conformation, the inhibitor modulates the underlying protein dynamics and restricts it in a compact, rigid state inaccessible to ligands or cofactors. Finally, our analysis reveals a novel, potentially druggable pocket in close proximity to the activation loop of the kinase, and we subsequently use its structure in fragment-based virtual screening to develop a pharmacophore model. The pocket is distinct from classical type I or type II kinase pockets, and its discovery offers promise in future design of specific kinase inhibitors, whilst mutations in residues associated with this pocket are implicated in immunodeficiency in humans.
The Structural Basis for Activation and Inhibition of ZAP-70 Kinase Domain.
Directory of Open Access Journals (Sweden)
Roland G Huber
2015-10-01
Full Text Available ZAP-70 (Zeta-chain-associated protein kinase 70 is a tyrosine kinase that interacts directly with the activated T-cell receptor to transduce downstream signals, and is hence a major player in the regulation of the adaptive immune response. Dysfunction of ZAP-70 causes selective T cell deficiency that in turn results in persistent infections. ZAP-70 is activated by a variety of signals including phosphorylation of the kinase domain (KD, and binding of its regulatory tandem Src homology 2 (SH2 domains to the T cell receptor. The present study investigates molecular mechanisms of activation and inhibition of ZAP-70 via atomically detailed molecular dynamics simulation approaches. We report microsecond timescale simulations of five distinct states of the ZAP-70 KD, comprising apo, inhibited and three phosphorylated variants. Extensive analysis of local flexibility and correlated motions reveal crucial transitions between the states, thus elucidating crucial steps in the activation mechanism of the ZAP-70 KD. Furthermore, we rationalize previously observed staurosporine-bound crystal structures, suggesting that whilst the KD superficially resembles an "active-like" conformation, the inhibitor modulates the underlying protein dynamics and restricts it in a compact, rigid state inaccessible to ligands or cofactors. Finally, our analysis reveals a novel, potentially druggable pocket in close proximity to the activation loop of the kinase, and we subsequently use its structure in fragment-based virtual screening to develop a pharmacophore model. The pocket is distinct from classical type I or type II kinase pockets, and its discovery offers promise in future design of specific kinase inhibitors, whilst mutations in residues associated with this pocket are implicated in immunodeficiency in humans.
Hall, Bradford E.; Prochazkova, Michaela; Sapio, Matthew R.; Minetos, Paul; Kurochkina, Natalya; Binukumar, B. K.; Amin, Niranjana D.; Terse, Anita; Joseph, John; Raithel, Stephen J.; Mannes, Andrew J.; Pant, Harish C.; Chung, Man-Kyo; Iadarola, Michael J.; Kulkarni, Ashok B.
2018-01-01
Cyclin-dependent kinase 5 (Cdk5) is a key neuronal kinase that is upregulated during inflammation, and can subsequently modulate sensitivity to nociceptive stimuli. We conducted an in silico screen for Cdk5 phosphorylation sites within proteins whose expression was enriched in nociceptors and identified the chemo-responsive ion channel Transient Receptor Potential Ankyrin 1 (TRPA1) as a possible Cdk5 substrate. Immunoprecipitated full length TRPA1 was shown to be phosphorylated by Cdk5 and th...
Soverini, Simona; De Benedittis, Caterina; Castagnetti, Fausto; Gugliotta, Gabriele; Mancini, Manuela; Bavaro, Luana; Machova Polakova, Katerina; Linhartova, Jana; Iurlo, Alessandra; Russo, Domenico; Pane, Fabrizio; Saglio, Giuseppe; Rosti, Gianantonio; Cavo, Michele; Baccarani, Michele; Martinelli, Giovanni
2016-08-02
Imatinib-resistant chronic myeloid leukemia (CML) patients receiving second-line tyrosine kinase inhibitor (TKI) therapy with dasatinib or nilotinib have a higher risk of disease relapse and progression and not infrequently BCR-ABL1 kinase domain (KD) mutations are implicated in therapeutic failure. In this setting, earlier detection of emerging BCR-ABL1 KD mutations would offer greater chances of efficacy for subsequent salvage therapy and limit the biological consequences of full BCR-ABL1 kinase reactivation. Taking advantage of an already set up and validated next-generation deep amplicon sequencing (DS) assay, we aimed to assess whether DS may allow a larger window of detection of emerging BCR-ABL1 KD mutants predicting for an impending relapse. a total of 125 longitudinal samples from 51 CML patients who had acquired dasatinib- or nilotinib-resistant mutations during second-line therapy were analyzed by DS from the time of failure and mutation detection by conventional sequencing backwards. BCR-ABL1/ABL1%(IS) transcript levels were used to define whether the patient had 'optimal response', 'warning' or 'failure' at the time of first mutation detection by DS. DS was able to backtrack dasatinib- or nilotinib-resistant mutations to the previous sample(s) in 23/51 (45 %) pts. Median mutation burden at the time of first detection by DS was 5.5 % (range, 1.5-17.5 %); median interval between detection by DS and detection by conventional sequencing was 3 months (range, 1-9 months). In 5 cases, the mutations were detectable at baseline. In the remaining cases, response level at the time mutations were first detected by DS could be defined as 'Warning' (according to the 2013 ELN definitions of response to 2nd-line therapy) in 13 cases, as 'Optimal response' in one case, as 'Failure' in 4 cases. No dasatinib- or nilotinib-resistant mutations were detected by DS in 15 randomly selected patients with 'warning' at various timepoints, that later turned into optimal
Directory of Open Access Journals (Sweden)
Bulent Erdogan
2016-11-01
Full Text Available Lung cancer in smokers and non-smokers demonstrates distinct genetic profiles, and cigarette smoking affects epidermal growth factor receptor (EGFR function and causes secondary EGFR tyrosine kinase resistance. We evaluated the effect of active smoking in patients with metastatic lung adenocarcinoma. A total of 132 metastatic lung adenocarcinoma patients, diagnosed between 2008 and 2013, with known EGFR mutation status, were evaluated retrospectively. Among these patients, 40 had an activating EGFR mutation. Patients who continued smoking during the treatment were defined as active smokers. Former smokers and never smokers were together defined as non-smokers. The outcomes of the treatment in relation to the EGFR mutation and smoking status were evaluated. The median follow-up time was 10.5 months. The overall response rate for the first-line therapy was significantly higher among the EGFR-mutant patients (p = 0.01, however, smoking status had no impact on the response rate (p = 0.1. The EGFR-mutant active smokers progressed earlier than the non-smokers (p < 0.01. The overall survival (OS of the non-smokers and patients treated with erlotinib was significantly longer (p = 0.02 and p = 0.01, respectively. Smoking status did not affect the OS in EGFR wild type tumors (p = 0.49 but EGFR-mutant non-smokers had a longer OS than the active smokers (p = 0.01.The active smokers treated with erlotinib had poorer survival than the non-smokers (p = 0.03. Multivariate analysis of EGFR-mutant patients showed that erlotinib treatment at any line and non-smoking were independent prognostic factors for the OS (p = 0.04 and p = 0.01, respectively. Smoking during treatment is a negative prognostic factor in metastatic lung adenocarcinoma with an EGFR mutation.