Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
Directory of Open Access Journals (Sweden)
A Eslami
2012-12-01
Full Text Available Background: Due to the lack of a suitable and economic test for the analysis of the polymorphism at codon 167, we developed a new PCR-RFLP technique, based on a modified forward primer (UT-HC167 MF-primer, to identify simultaneously the SNPs at codons 167 and 200 of isotype 1 β-tubulin gene of Haemonchus contortus.Methods: There already are several safe and easy methods for identification of point mutations at codons 198 and 200. Due to the lack of a reliable and easy method for the detection of the single nucleotide polymorphism (SNP at codon 167, we developed an innovative PCR-RFLP technique based on a modified forward primer (UT-HC167 MF-primer, in which the nucleotide T at the position 443 was substituted through a nucleotide A creating a restriction site for restriction endonuclease SnaB I in the nucleotide sequences including codon 167. A total of 138 adult male H. contortus were collected from three different geo-climatic areas of Iran. The isolated genomic DNA of each single worm was amplified by PCR using primers flanking codon 167. The PCR product (527 bp was then amplified by semi-nested PCR using the UT-HC167 MF-primer and the reverse primer achieving a PCR product of 451 bp in length. This PCR product was subsequently digested with the restriction endonucleases SnaB I and TaaI for analysis of the mutations at codons 167 and 200, respectively.Results: All worms had two alleles encoding for phenylalanine (BZss homozygote for both codons.Conclusion: Using the UT-HC167 MF-primer and a suitable reverse primer designed upstream from codon 200, it is possible to amplify a PCR product which can be used for analysis of the SNPs at all three mentioned codons using RFLP.
Prognostic value of IDH1 mutations identified with PCR-RFLP assay in acute myeloid leukemia patients
International Nuclear Information System (INIS)
Elsayed, Gh.M.; Zaher, A.; Elnoshokaty, E.H.; Nassar, H.R.; Moneer, M.M.
2014-01-01
Background: Somatic mutations in isocitrate dehydrogenase 1 (1DH1) gene occur frequently in primary brain tumors. Recently theses mutations were demonstrated in acute myeloid leukemia (AML). So far, assessment of these mutations relied on the DNA sequencing technique. Aim of the work: The aim of this study was to detect somatic mutations in IDH1 gene using mismatched primers suitable for endonuclease based detection, without the need for DNA sequencing, and to estimate its prognostic value, on patients with de novo AML. Methods: Residual DNA extracted from pretreatment bone marrow (BM) samples of 100 patients with de novo AML was used. The polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) was adapted to IDHl gene, codon 132 mutations screening. Results: The frequency of IDH1 mutations was 13%. In the non-acute promyelocytic leukemia group (non-APL), IDH1 mutations were significantly associated with FLT3-ITD negative patients (p = 0.03). Patients with 1DH1 mutations did not achieve complete remission (CR). There was a trend for shorter overall survival (OS) in patients with IDH1 mutation compared to those with wild type (p = 0.08). Conclusion: IDH1 mutations are recurring genetic alterations in AML and they may have unfavorable impact on clinical outcome in adult AML. The PCR-RFLP method allows for a fast, inexpensive, and sensitive method for the detection of IDF11 mutations in AML.
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
International Nuclear Information System (INIS)
Li, Wan-Ming; Hu, Ting-Ting; Zhou, Lin-Lin; Feng, Yi-Ming; Wang, Yun-Yi; Fang, Jin
2016-01-01
The PIK3CA H1047R mutation is considered to be a potential predictive biomarker for EGFR-targeted therapies. In this study, we developed a novel PCR-PFLP approach to detect the PIK3CA H1047R mutation in high effectiveness. A 126-bp fragment of PIK3CA exon-20 was amplified by PCR, digested with FspI restriction endonuclease and separated by 3 % agarose gel electrophoresis for the PCR-RFLP analysis. The mutant sequence of the PIK3CA H1047R was spiked into the corresponding wild-type sequence in decreasing ratios for sensitivity analysis. Eight-six cases of formalin-fixed paraffin-embedded colorectal cancer (CRC) specimens were subjected to PCR-RFLP to evaluate the applicability of the method. The PCR-RFLP method had a capability to detect as litter as 0.4 % of mutation, and revealed 16.3 % of the PIK3CA H1047R mutation in 86 CRC tissues, which was significantly higher than that discovered by DNA sequencing (9.3 %). A positive association between the PIK3CA H1047R mutation and the patients’ age was first found, except for the negative relationship with the degree of tumor differentiation. In addition, the highly sensitive detection of a combinatorial mutation of PIK3CA, KRAS and BRAF was achieved using individual PCR-RFLP methods. We developed a sensitive, simple and rapid approach to detect the low-abundance PIK3CA H1047R mutation in real CRC specimens, providing an effective tool for guiding cancer targeted therapy
SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping
Directory of Open Access Journals (Sweden)
Chang Hsueh-Wei
2010-04-01
Full Text Available Abstract Background PCR-restriction fragment length polymorphism (RFLP assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. Results The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels, gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. Conclusions The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.
SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping.
Chang, Hsueh-Wei; Cheng, Yu-Huei; Chuang, Li-Yeh; Yang, Cheng-Hong
2010-04-08
PCR-restriction fragment length polymorphism (RFLP) assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels), gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.
Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P
2003-08-01
The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.
PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products
Directory of Open Access Journals (Sweden)
Y. Erwanto
2011-04-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.
Directory of Open Access Journals (Sweden)
Arefeh Abdi
2016-05-01
Full Text Available Background: Campylobacter species are responsible for the majority of cases of food-borne gastroenteritis. The sources of the disease outbreaks are often contaminated water or milk, and consumption of undercooked poultry product is the main cause of sporadic campylobacteriosis cases. Objectives: The aims of this study were to determine the prevalence of Campylobacter gastroenteritis in children and to differentiate the interfering species using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods at the Bahonar hospital in Karaj, Iran. Patients and Methods: A total of 150 stool samples were collected from children under 10 years old during the summer of 2014. PCR was performed using genus- and species-specific primers and RFLP was done using AluI and TasI enzymes. Results: The results showed the amplification of 400 and 491 bp segments and Campylobacter contamination in 30 (20% samples; 5 out of 30 Campylobacter positive samples (16.66% were identified as C. jejuni, 20 (66.66% as C. coli, 3 (10% as C. jejuni and C. coli (mixed infection, and 2 (6.66% were identified as non-jejuni, non-coli Campylobacter using the PCR method. Following the evaluation of RFLP results, 7 positive samples (23.33% showed the electrophoretic pattern of C. jejuni, 21 (70% showed the electrophoretic pattern of C. coli, and 2 (6.6% showed both of the patterns and mixed contamination with jejuni and coli species. The results of digestion with TasI did not show any C. lari or C. upsaliensis patterns. Conclusions: The results of this study showed high percentage of Campylobacter contamination in the tested stool samples. The other surprising finding was the high rate of Campylobacter coli positive samples; the difference between the results of PCR using species-specific primers (hipo and asp and the RFLP method (electrophoretic patterns in some of the positive samples confirms the hypothesis of variations in nucleotide sequences of the
PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates
Directory of Open Access Journals (Sweden)
Zohreh Ebrahimvandi
2014-07-01
Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.
Directory of Open Access Journals (Sweden)
Panca J. Santoso
2013-07-01
Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.
Kumar, Deepak; Singh, S P; Karabasanavar, Nagappa S; Singh, Rashmi; Umapathi, V
2014-11-01
Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168-776 bp) of mitochondrial cytochrome-b (cytb) gene for targeted species was designed which yielded a 609 bp PCR amplicon. Further, restriction enzyme digestion of the amplicons with Alu1 and Taq1 restriction enzymes resulted in a distinctive digestion pattern that was able to discriminate each species. The repeatability of the PCR-RFLP assay was validated ten times with consistent results observed. The developed assay can be used in routine diagnostic laboratories to differentiate the meats of closely related domestic livestock species namely cattle from buffalo and sheep from goat.
Şakalar, Çağrı; Kuk, Salih; Erensoy, Ahmet; Dağli, Adile Ferda; Özercan, İbrahim Hanifi; Çetınkaya, Ülfet; Yazar, Süleyman
2014-01-01
To develop a novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol using a new genomic marker sequence and a novel set of restriction enzymes in order to detect and discriminate 2 Echinococcus species, E. granulosus and E. multilocularis, found in formalin-fixed paraffin-embedded (FFPE) human tissues. DNA was isolated from 11 FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis. A mitochondrial genomic marker region was amplified and sequenced using a novel primer pair and a new PCR-RFLP protocol was developed for the detection and discrimination of E. granulosus and E. multilocularis using a set of restriction enzymes including AccI, MboI, MboII, and TsoI. The selected marker region was amplified using DNA isolated from FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis and the discrimination of E. granulosus and E. multilocularis was accomplished by use of the novel PCR-RFLP method. In this PCR-RFLP protocol, use of any single restriction enzyme is enough for the discrimination of E. granulosus and E. multilocularis. The PCR-RFLP protocol can be potentially used for the discrimination of 5 other Echinococcus species: E. oligarthus, E. shiquicus, E. ortleppi, E. canadensis, and E. vogeli.
Liu, Yun-Xi; Zhao, Zhong-Tang; Cao, Wu-Chun; Xu, Xiao-Qun; Suo, Ji-Jiang; Xing, Yu-Bin; Jia, Ning; Du, Ming-Mei; Liu, Bo-Wei; Yao, Yuan
2013-01-01
The aim of the present study was to evaluate the clinical usefulness of applying RT-nested PCR along with RFLP as a method for diagnosis and genotypic differentiation of Hantavirus in the acute-stage sera of HFRS patients as compared to the ELISA technique. A prospective study of patients with suspected HFRS patients was carried out. Sera were collected for serological evaluation by ELISA and RT-nested PCR testing. Primers were selected from the published sequence of the S segment of HTNV strain 76-118 and SEOV strain SR-11, which made it possible to obtain an amplicon of 403 bp by RT-nested PCR. The genotypic differentiations of the RT-nested PCR amplicons were carried out by RFLP. Sequence analyses of the amplicons were used to confirm the accuracy of the results obtained by RFLP. Of the 48 acute-stage sera from suspected HFRS patients, 35 were ELISA-positive while 41 were positive by RT-nested PCR. With Hind III and Hinf I, RFLP profiles of the RT-nested PCR amplicons of the 41 positive sera exhibited two patterns. 33 had RFLP profiles similar to the reference strain R22, and thus belonged to the SEOV type. The other 8 samples which were collected during October-December had RFLP profiles similar to the reference strain 76-118, and thus belonged to the HTNV type. Sequence phylogenetic analysis of RT-nested PCR amplicons revealed sdp1, sdp2 YXL-2008, and sdp3 as close relatives of HTNV strain 76-118, while sdp22 and sdp37 as close relatives of SEOV strain Z37 and strain R22 located in two separate clusters in the phylogenetic tree. These results were identical to those acquired by RFLP. RT-nested PCR integrated with RFLP was a rapid, simple, accurate method for detecting and differentiating the genotypes of Hantavirus in the acute-stage sera of suspected HFRS patients. In Shandong province, the main genotypes of Hantavirus belonged to the SEOV types, while the HTNV types were observed during the autumn-winter season.
Ayala-Valdovinos, Miguel Angel; Galindo-García, Jorge; Sánchez-Chiprés, David; Duifhuis-Rivera, Theodor
2017-04-01
Hydrocephalus in Friesian horses is an autosomal recessive hereditary disease that can result in an abortion, a stillbirth, or euthanization of a newborn foal. Here, the hydrocephalus-associated c.1423C > T mutation in B3GALNT2 gene was detected with PCR-RFLP and PCR-PIRA methods for horse genotyping. A preliminary genotyping survey was performed on 83 randomly selected Friesian stallion horses to determine the current allele frequency in Mexico. The frequency of the mutant T allele was 9.6%. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wagner Mark C
2005-05-01
Full Text Available Abstract Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As
Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba
2015-10-01
Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.
Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.
2012-01-01
Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...
Sensitive identification of mycobacterial species using PCR-RFLP on bronchial washings.
Hidaka, E; Honda, T; Ueno, I; Yamasaki, Y; Kubo, K; Katsuyama, T
2000-03-01
In 98 patients (24 with active pulmonary tuberculosis [TB] lesions, 28 with cured TB lesions, and 46 with nontuberculous opacities [control group] in chest CT scans), we examined whether washing the bronchus after brushing the lesion, then applying polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to the bronchial washings might be useful for diagnosing TB and nontuberculous mycobacteriosis (NTMosis). After biopsy and brushing with a bronchoscope, the bronchus connecting to the lesion was washed with 20 ml saline. The saline used for washing the brushes (5 ml; brushing sample), and 3 to 10 ml saline aspirated through the forceps channel (washing sample) were examined by PCR-RFLP, which proved able to identify Mycobacterium tuberculosis and seven species of nontuberculous mycobacteria (NTM). The values obtained for the sensitivity of the PCR-RFLP with respect to the brushing sample, the washing sample, and both samples mixed together were 70, 76, and 91%, respectively, when only patients who were culture-positive or radiologically improved after antituberculous therapy were considered as showing true infection. A mixture of brushing and washing samples provides useful material for PCR and culture, and the PCR-RFLP used here is a good method for the simultaneous identification of several species of mycobacterium (including M. tuberculosis).
DEFF Research Database (Denmark)
Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons
1998-01-01
New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...
Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu
2014-12-15
A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Directory of Open Access Journals (Sweden)
R. Mirnejad
2011-04-01
Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So
Identification of five sea cucumber species through PCR-RFLP analysis
Lv, Yingchun; Zheng, Rong; Zuo, Tao; Wang, Yuming; Li, Zhaojie; Xue, Yong; Xue, Changhu; Tang, Qingjuan
2014-10-01
Sea cucumbers are traditional marine food and Chinese medicine in Asia. The rapid expansion of sea cucumber market has resulted in various problems, such as commercial fraud and mislabeling. Conventionally, sea cucumber species could be distinguished by their morphological and anatomical characteristics; however, their identification becomes difficult when they are processed. The aim of this study was to develop a new convenient method of identifying and distinguishing sea cucumber species. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of mitochondrial cytochrome oxidase I gene ( COI) was used to identifing five sea cucumber species ( Apostichopus japonicus, Cucumaria frondosa, Thelenota ananas, Parastichopus californicus and Actinopyga lecanora). A 692 bp fragment of COI was searched for BamHI, KpnI, PstI, XbaI and Eco31I restriction sites with DNAMAN 6.0, which were then used to PCR-RFLP analysis. These five sea cucumber species can be discriminated from mixed sea cucumbers. The developed PCR-RFLP assay will facilitate the identification of sea cucumbers, making their source tracing and quality controlling feasible.
Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis
Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明
1997-01-01
For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
PCR-RFLP diagnostic method for identifying Globodera species in Slovenia
Directory of Open Access Journals (Sweden)
Sasa ŠIRCA
2011-01-01
Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.
COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS
Directory of Open Access Journals (Sweden)
Tülin GÜVEN GÖKMEN
Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.
Odongo, Steven; Delespaux, Vincent; Ngotho, Maina; Bekkele, Serkalem Mindaye; Magez, Stefan
2016-09-01
We compared the nested internal transcribed spacer (ITS) PCR and the 18S PCR-RFLP (restriction-fragment length polymorphism) pan-trypanosome assays in a cross-sectional survey of bovine trypanosomiasis in 358 cattle in Kwale County, Kenya. The prevalence of trypanosomiasis as determined by the nested ITS PCR was 19.6% (70/358) and by 18S PCR-RFLP was 16.8% (60/358). Of the pathogenic trypanosomes detected, the prevalence of Trypanosoma congolense and Trypanosoma vivax was greater than that of Trypanosoma simiae The nested ITS PCR detected 83 parasite events, whereas the 18S PCR-RFLP detected 64; however, overall frequencies of infections and the parasite events detected did not differ between the assays (χ(2) = 0.8, df = 1, p > 0.05 and χ(2) = 2.5, df = 1, p > 0.05, respectively). The kappa statistic (0.8) showed good agreement between the tests. The nested ITS PCR and the 18S PCR-RFLP had comparable sensitivity, although the nested ITS PCR was better at detecting mixed infections (χ(2) = 5.4, df = 1, p < 0.05). © 2016 The Author(s).
Bovine Papillomavirus in Brazil: Detection of Coinfection of Unusual Types by a PCR-RFLP Method
Directory of Open Access Journals (Sweden)
R. F. Carvalho
2013-01-01
Full Text Available Bovine papillomavirus (BPV is recognized as a causal agent of benign and malignant tumors in cattle. Thirteen types of BPV are currently characterized and classified into three distinct genera, associated with different pathological outcomes. The described BPV types as well as other putative ones have been demonstrated by molecular biology methods, mainly by the employment of degenerated PCR primers. Specifically, divergences in the nucleotide sequence of the L1 gene are useful for the identification and classification of new papillomavirus types. On the present work, a method based on the PCR-RFLP technique and DNA sequencing was evaluated as a screening tool, allowing for the detection of two relatively rare types of BPV in lesions samples from a six-year-old Holstein dairy cow, chronically affected with cutaneous papillomatosis. These findings point to the dissemination of BPVs with unclear pathogenic potential, since two relatively rare, new described BPV types, which were first characterized in Japan, were also detected in Brazil.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
DEFF Research Database (Denmark)
Kania, Per Walther; Jørgensen, Thomas Rohde; Buchmann, Kurt
2007-01-01
A new method based on PCR-RFLP is presented. It is able to differentiate between the Danish non-pathogenic form of Gyrodactylus salaris and the Norwegian pathogenic form.......A new method based on PCR-RFLP is presented. It is able to differentiate between the Danish non-pathogenic form of Gyrodactylus salaris and the Norwegian pathogenic form....
Directory of Open Access Journals (Sweden)
D. H. Sauka
2010-02-01
Full Text Available A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method for detection of cry11 genes from Bacillus thuringiensis was established. Based on the analysis of conserved regions of the cry11 genes, 2 oligonucleotide primers were designed to amplify a 1459-bp fragment of the cry11Aa gene, and a 1471-bp of the cry11Ba and cry11Bb genes. The amplification products were digested with restriction endonuclease HinfI. Exotic B. thuringiensis strains and native isolates collected from soils, leaves and stored product dust of Argentina were analyzed to study the distribution of cry11 genes. The PCR-RFLP patterns revealed the detection of cry11 genes in 3 of 64 exotic strains and in 10 of 107 native B. thuringiensis isolates tested. Just the cry11Aa gene subclass was detected among these bacteria. Since the methodology was also developed to detect cry11Ba and cry11Bb genes, an experimental future confirmation will be required. Based on the results obtained, the PCR-RFLP method presented may be a valuable tool for specific detection of the mosquitocidal toxin genes encoding Cry11 proteins from B. thuringiensis.En el presente estudio se estableció una estrategia basada en la amplificación génica (PCR y el posterior análisis de restricción (RFLP para detectar todos los genes cry11 de Bacillus thuringiensis informados hasta ahora. De acuerdo con el análisis de las regiones conservadas en los genes cry11, se diseñaron dos cebadores para amplificar un fragmento de 1459 pb de los genes cry11Aa y un fragmento de 1471 pb de los genes cry11Ba y cry11Bb. Los productos de la amplificación fueron digeridos con la enzima de restricción HinfI. Se analizaron cepas exóticas de B. thuringiensis y aislamientos nativos de Argentina obtenidos a partir de muestras de suelos, hojas y polvillo de silos, para estudiar la distribución de los genes cry11. Los patrones de PCR-RFLP revelaron la presencia de genes cry11 en 3 de las 64 cepas ex
International Nuclear Information System (INIS)
El Khoury, A.; Atoui, A.; Lebrihi, A.; Rizk, T.; Lteif, R.; Kallassy, M.
2011-01-01
Aflatoxins (AFs) represent the most important single mycotoxin-related food safety problem in developed and developing countries as they have adverse effects on human and animal health. They are produced mainly by Aspergillus flavus and A. parasiticus. Both species have different aflatoxinogenic profile. In order to distinguish between A. flavus and A. parasiticus, gene-specific primers were designed to target the intergenic spacer (IGS) for the AF biosynthesis genes, aflJ and aflR. Polymerase chain reaction (PCR) products were subjected to restriction endonuclease analysis using BglII to look for restriction fragment length polymorphisms (RFLPs). Our result showed that both species displayed different PCR-based RFLP (PCR-RFLP) profile. PCR products from A. flavus cleaved into 3 fragments of 362, 210, and 102 bp. However, there is only one restriction site for this enzyme in the sequence of A. parasiticus that produced only 2 fragments of 363 and 311 bp. The method was successfully applied to contaminated grapes samples. This approach of differentiating these 2 species would be simpler, less costly, and quicker than conventional sequencing of PCR products and/or morphological identification. (author)
Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW
1998-01-01
Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest
Roche, P.; Arkel, van G.; Heusden, van A.W.
1997-01-01
This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this
Directory of Open Access Journals (Sweden)
Marize Quinhones Pires
2014-04-01
Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.
Directory of Open Access Journals (Sweden)
Loo Keat
2012-05-01
Full Text Available Abstract Background Hyperhomocysteinemia as a consequence of the MTHFR 677 C > T variant is associated with cardiovascular disease and stroke. Another factor that can potentially contribute to these disorders is a depleted nitric oxide level, which can be due to the presence of eNOS +894 G > T and eNOS −786 T > C variants that make an individual more susceptible to endothelial dysfunction. A number of genotyping methods have been developed to investigate these variants. However, simultaneous detection methods using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis are still lacking. In this study, a novel multiplex PCR-RFLP method for the simultaneous detection of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants was developed. A total of 114 healthy Malay subjects were recruited. The MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants were genotyped using the novel multiplex PCR-RFLP and confirmed by DNA sequencing as well as snpBLAST. Allele frequencies of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C were calculated using the Hardy Weinberg equation. Methods The 114 healthy volunteers were recruited for this study, and their DNA was extracted. Primer pair was designed using Primer 3 Software version 0.4.0 and validated against the BLAST database. The primer specificity, functionality and annealing temperature were tested using uniplex PCR methods that were later combined into a single multiplex PCR. Restriction Fragment Length Polymorphism (RFLP was performed in three separate tubes followed by agarose gel electrophoresis. PCR product residual was purified and sent for DNA sequencing. Results The allele frequencies for MTHFR 677 C > T were 0.89 (C allele and 0.11 (T allele; for eNOS +894 G > T, the allele frequencies were 0.58 (G allele and 0.43 (T allele; and for eNOS −786 T > C, the allele
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene
Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan
2009-01-01
Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…
Molecular identification of Indian crocodile species: PCR-RFLP method for forensic authentication*.
Meganathan, P R; Dubey, Bhawna; Haque, Ikramul
2009-09-01
South East Asian countries are known for illegal poaching and trade of crocodiles clandestinely, to be used in skin, medicinal, and cosmetic industries. Besides crocodiles being listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora, India has its Wildlife Protection Act, 1972 for conservation of crocodile species. Hitherto, lack of any rapid and reliable technique for examinations of crocodile-based crime exhibits such as skin, bones, etc. has been a major problem for an effective promulgation of law on illegal trade. DNA-based identification of species using PCR-RFLP technique for an apt identification of all the three Indian crocodile species namely, Crocodylus porosus, Crocodylus palustris and Gavialis gangeticus is presented here. A 628 bp segment of cytochrome b gene was amplified using novel primers followed by restriction digestion with three enzymes i.e., HaeIII, MboI, and MwoI, separately and in combination. The technique has produced a species-specific pattern for identifying the three crocodile species individually, which fulfills the requirement for its forensic application. It is expected that the technique will prove handy in identification of all the three Indian crocodile species and strengthen conservation efforts.
Molecular analysis of diverse elements mediating VanA glycopeptide resistance in enterococci
DEFF Research Database (Denmark)
Palepou, M.F.I.; Adebiyi, A.M.A.; Tremlett, C.H.
1998-01-01
Differences were examined among 24 distinct elements mediating VanA-type glycopeptide resistance in enterococci isolated from hospital patients and non-human sources in the UK. The methods used included long-PCR restriction fragment length polymorphism (L-PCR RFLP) analysis and DNA hybridization...... characterized by the presence of an IS1216V/IS3-like/orf1 complex and a point mutation in vanX, both of which were absent from the other 23 groups of VanA elements. This finding is consistent with the dissemination of a stable resistance element. We conclude that L-PCR RFLP analysis, combined with DNA...
Directory of Open Access Journals (Sweden)
Zhiyuan Wu
2014-01-01
Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura
2011-09-01
To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
Sekar, Nishu; Kulkarni, Rucha; Ozalkar, Sharvari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.
2017-11-01
Polycystic ovarian syndrome is the most common heterogenous endocrine disorder in women. Follicle stimulating hormone receptor is associated with normal development as well as maturation of follicles and triggers estrogen production in granulosa cells of the ovary. Inactivating mutation in FSHR gene correlated with reduction of ovarian function in women is due to damage to receptor function. This study aims to investigate whether inactivating mutations, in follicle stimulating hormone receptor gene is related to polycystic ovarian morphology in women with PCOS. Genomic DNA isolated from 15 subjects from Sandhya Hospital, Vellore (10 patients with PCOS and 5 healthy controls) was taken for this study. Patient data included a clinical report, hormonal levels, and ovarian morphological details. DNA isolation was followed by DNA amplification by polymerase chain reaction using Exon 10 A and Exon 10 B primers. The PCR-RFLP analysis was performed using Dde1 restriction enzyme. Here we discuss inactivating mutation found in Exon 10 of FSHR gene in patients with PCOS.The absence of inactivating mutation was observed through PCR-RFLP study on Exon 10A and Exon 10B.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
c-Ha-ras BamHI RFLP in human urothelial tumors and point mutations in hot codons
International Nuclear Information System (INIS)
Weismanova, E; Skovraga, M.; Kaluz, S.
1993-01-01
High-molecular weights DNAs from 30 bladder and renal cell carcinomas (RCC) were isolated and the c-Ha-ras the c-Ha-ras gene BamHI RFLP was examined. Amplification of c-Ha-ras with normal localization with regard to the size of alleles was found only in the case. One of the normally localized c-Ha-ras allele termed RCC c-H-ras of a length of about 6.6 kbp was cloned and an oncogene-activating point mutation was identified using two restriction enzymes. After comparison of CfrI and Cfr10I cleavage maps of RCC c-Ha-ras to complete nucleotide sequences of EJ/T24 c-Ha-ras oncogene and its normal counterpart, a point mutation was identified within codon 11 or 12. The use of CfrI and Cfr10I is of value for clinical practice in identification of point mutations in c-Ha-ras PCR product in neoplasia accompanied by somatic mutation of c-Ha-ras. The correlation among c-Ha-ras allele, amplification/loss, presence of point mutation and progression of neoplasia is discussed. (author)
Identification of Pit-1 Gen Using PCR-RFLP of Padjadjaran Sheep and Evaluate of Growth Rate
Prajoga, S. B. K.; Andriani, L.; Subhandiana, H.
2018-02-01
The objectives of this research were to evaluate variation of Pit-1 gen of Padjadjaran Sheep and evaluate of their growth rate. The data comprised of 15 lambs female and 15 lambs male records of 0 - 12 mouths old lambs. Variation of Padjadjaran Sheep PIT-1 gen was analyzed using PCR-RFLP and used primer by 5’-GAGGGATAATTACAAATGGTCC-3’ and 5’-TGTTAACAGCTGTGGGACACAC-3’, length fragment analyse using HinfI restriction enzyme. Presence or absence of deference bands in a PCR fragment of the result can be distinguished by differences in the electrophoretic migration of the fragment. The result showed that the variation Pit1 gene showed that there was in the position 345 bp, 137 bp and 115 bp. In this experiment the difference migration did occur in all samples (monomorphic), that was amplificated with reverse and forward primer. The average male birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.29 ±0.42kg 8.96 ±1,89 kg and 30.12 ±5,65 kg. The average female birth weight (BW), weaning weight (WN) and Yearling Weight (YW) was 2.33 ±0.49 kg; 8.23 ±1.99 kg and 26.11 ±5.50 kg. Correlation value between age and body weight was 0,99 for female and 0,97 for male. The highest body weight gain per month was 2.85 kg for female at the age of six months and 3.4 kg for male at the age of one year. The best equition of growth rate was Ŷ = 1,862 + 0,127X1 0,076X2
Montalvo, Ana M; Fraga, Jorge; Tirado, Dídier; Blandón, Gustavo; Alba, Annia; Van der Auwera, Gert; Vélez, Iván Darío; Muskus, Carlos
2017-07-01
Leishmaniasis is highly prevalent in New World countries, where several methods are available for detection and identification of Leishmania spp. Two hsp70-based PCR protocols (PCR-N and PCR-F) and their corresponding restriction fragment length polymorphisms (RFLP) were applied for detection and identification of Leishmania spp. in clinical samples recruited in Colombia, Guatemala, and Honduras. A total of 93 cases were studied. The samples were classified into positive or suspected of leishmaniasis according to parasitological criteria. Molecular amplification of two different hsp70 gene fragments and further RFLP analysis for identification of Leishmania species was done. The detection in parasitologically positive samples was higher using PCR-N than PCR-F. In the total of samples studied, the main species identified were Leishmania panamensis, Leishmania braziliensis, and Leishmania infantum (chagasi). Although RFLP-N was more efficient for the identification, RFLP-F is necessary for discrimination between L. panamensis and Leishmania guyanesis, of great importance in Colombia. Unexpectedly, one sample from this country revealed an RFLP pattern corresponding to Leishmania naiffi. Both molecular variants are applicable for the study of clinical samples originated in Colombia, Honduras, and Guatemala. Choosing the better tool for each setting depends on the species circulating. More studies are needed to confirm the presence of L. naiffi in Colombian territory.
Mikaeili, Fattaneh; Mathis, Alexander; Deplazes, Peter; Mirhendi, Hossein; Barazesh, Afshin; Ebrahimi, Sepideh; Kia, Eshrat Beigom
2017-09-26
The definitive genetic identification of Toxocara species is currently based on PCR/sequencing. The objectives of the present study were to design and conduct an in silico polymerase chain reaction-restriction fragment length polymorphism method for identification of Toxocara species. In silico analyses using the DNASIS and NEBcutter softwares were performed with rDNA internal transcribed spacers, and mitochondrial cox1 and nad1 sequences obtained in our previous studies along with relevant sequences deposited in GenBank. Consequently, RFLP profiles were designed and all isolates of T. canis and T. cati collected from dogs and cats in different geographical areas of Iran were investigated with the RFLP method using some of the identified suitable enzymes. The findings of in silico analyses predicted that on the cox1 gene only the MboII enzyme is appropriate for PCR-RFLP to reliably distinguish the two species. No suitable enzyme for PCR-RFLP on the nad1 gene was identified that yields the same pattern for all isolates of a species. DNASIS software showed that there are 241 suitable restriction enzymes for the differentiation of T. canis from T. cati based on ITS sequences. RsaI, MvaI and SalI enzymes were selected to evaluate the reliability of the in silico PCR-RFLP. The sizes of restriction fragments obtained by PCR-RFLP of all samples consistently matched the expected RFLP patterns. The ITS sequences are usually conserved and the PCR-RFLP approach targeting the ITS sequence is recommended for the molecular differentiation of Toxocara species and can provide a reliable tool for identification purposes particularly at the larval and egg stages.
Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette
2009-06-01
Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.
International Nuclear Information System (INIS)
Hooshyar, Hossein; Rezian, Mostafa; Kazemi, Bahram
2003-01-01
Entamoeba histolytica and Entamoeba dispar are two morphologically indistinguishable human protozoan parasites that are genetically distinct species. The potential invasive pathogenic Entamoeba histolytica and non-invasive parasites Entamoeba dispar can be differentiated by molecular and other methods. We used Polymer Chain Reaction (PCR) to determine the ratio of two species in a population in central Iran.Human stool samples(n=12 148) were randomly collected in Tehran and Karaj and examined for E.histolytica/E.dispar cysts with direct and formalin-ether methods.Eighty -seven (0.7%) cases were positive, of which 49 (62.8%) isolates were successfully cultured in Robison's medium. A pair of oligonucleotide primers designed from sequence data for genomic DNA coding the 30-KD surface antigen of E.histolytica/E.dipar was used to amplify a 374 base-pair (bp) fragment. The restriction fragment length polymorphism (RFLP) pattern obtained from a standard E.histolytica isolate had had two fragments (219 bp and 155bp), but the standard isolate of E. disparshowed three fragments (155, 152 and 67bp ). Differential diagonosis of 49 isolates of E. histolytica/ E. dispar from Tehran and Karaj using PCR-RFLP revealed that 46(93.9%) were E. were E. dispar while only 2(4.1%) were E. histolytica .One person (2%) had a mixed infection and showed both patterns The differential diagonosis of the potentially pathogenic parasite E.histolytica from the non-pathogenic E. dispar is of clinical and epidemiological importance. This study demonstrated E. dispar is much more prevalent than E.histolytica among the c yst passersin Tehran and Kraj in Central Iran. (author)
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
RFLP analysis of rice semi-dwarf mutation induced by high energy argon ion radiation
International Nuclear Information System (INIS)
Zhuang Chuxiong; Hu Weimin; Mei Mantong
1997-01-01
Two Indica rice varieties, Bianpizhan and Xiangzhan, and their semi-dwarf mutants induced by high energy argon ion radiation, Ar-10, and Xiang-Ar-1, were examined with restriction fragment length polymorphism (RFLP) analysis by using 97 rice single copy genomic clones mapped on 12 chromosomes of molecular genetic map, combined with 5 restriction enzymes. Among the markers screened, 9 detected polymorphism were between Bianpizhen and Ar-10, and 11 detected polymorphism were between Xiangzhan and Xiang-Ar-1. Moreover, two or more restriction enzymes could generate RFLP patterns when screened with a given marker for several polymorphic markers. Based on the polymorphic allelic loci, the mutation frequencies were estimated as 5.15% and 6.39% for Ar-10 and Xiang-Ar-1 respectively. These results suggested that the nature of mutation on the DNA level was probably large genetic changes rather than point mutation. Genetic analysis and gene tagging of semi-dwarf mutation in one of the mutant line, Ar-10, indicated that this mutation was controlled by a major recessive gene, which was preliminary located on chromosome 4
RFLP Analysis of rice semi dwarf mutation induced by high energy argon ion radiation
International Nuclear Information System (INIS)
Zhuang Chuxiong; Hu Weimin; Mei Mantong
1997-01-01
Two Indica rice varieties, Bianpizhan and Xiangzhan, and their semi dwarf mutants induced by high energy argon ion radiation, Ar 10, and Xiang Ar 1, were examined with restriction fragment length polymorphism(RFLP)analysis by using 97 rice single copy genomic clones mapped on 12 chromosomes of molecular genetic map, combined with 5 restriction enzymes.Among the markers screened, 9 detected polymorphism were between Bianpizhan and Ar 10, and 11 detected polymorphism were between Xiangzhan and Xiang Ar 1.Moreover, two or more restriction enzymes could generate RFLP patterns when screened with a given marker for several polymorphic markers. Based on the polymorphic allelic loci, the mutation frequencies were estimated as 5 15% and 6 39% for Ar 10 and Xiang Ar 1 respectively.These results suggested that the nature of mutation on the DNA level was probably large genetic changes rather than point mutation.Genetic analysis and gene tagging of semi dwarf mutation in one of the mutant line, Ar 10, indicated that this mutation was controlled by a major recessive gene, which was preliminary located on chromosome 4. (author)
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Tomasello, Salvatore; Heubl, Günther
2017-07-01
The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.
Directory of Open Access Journals (Sweden)
Golam Mahmudunnabi
2018-06-01
Full Text Available Klebsiella pneumoniae is the second leading causative agent of UTI. In this study, a rapid combined polymerase chain reaction and restriction fragment length polymorphism analysis was developed to identify K. pneumoniae in women, infected with urinary tract infection in the Sylhet city of Bangladesh. Analysis of 11 isolates from women at the age range of 20–55 from three different hospitals were done firstly by amplification with K. pneumoniae specific ITS primers. All of the 11 collected isolates were amplified in PCR and showed the expected 136 bp products. Then, restriction fragment length polymorphism analysis of 11 isolates were conducted after PCR amplification by 16s rRNA universal primers, followed by subsequent digestion and incubation with two restriction enzymes, Pst1 and Alu1. Seven out of 11 isolates were digested by Pst1 restriction enzymes, six isolates digested by Alu1, and while others were negative for both enzymes. Data results reveal that, women at age between 25 and 50 were digested by both enzymes. A woman aged over than 50 was negative while bellow 20 was digested by only Pst1. The results could pave the tactic for further research in the detection of K. pneumoniae from UTI infected women. Keywords: Klebsiella pneumoniae, ITS-primer, MDR isolates, PCR-RFLP analysis
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity
Mirhendi, H; Zarei, F; Motamedi, M; Nouripour-Sisakht, S
2016-03-01
This work aimed to identify the species distribution of common clinical and environmental isolates of black Aspergilli based on simple restriction fragment length polymorphism (RFLP) analysis of the β-tubulin gene. A total of 149 clinical and environmental strains of black Aspergilli were collected and subjected to preliminary morphological examination. Total genomic DNAs were extracted, and PCR was performed to amplify part of the β-tubulin gene. At first, 52 randomly selected samples were species-delineated by sequence analysis. In order to distinguish the most common species, PCR amplicons of 117 black Aspergillus strains were identified by simple PCR-RFLP analysis using the enzyme TasI. Among 52 sequenced isolates, 28 were Aspergillus tubingensis, 21 Aspergillus niger, and the three remaining isolates included Aspergillus uvarum, Aspergillus awamori, and Aspergillus acidus. All 100 environmental and 17 BAL samples subjected to TasI-RFLP analysis of the β-tubulin gene, fell into two groups, consisting of about 59% (n=69) A. tubingensis and 41% (n=48) A. niger. Therefore, the method successfully and rapidly distinguished A. tubingensis and A. niger as the most common species among the clinical and environmental isolates. Although tardy, the Ehrlich test was also able to differentiate A. tubingensis and A. niger according to the yellow color reaction specific to A. niger. A. tubingensis and A. niger are the most common black Aspergillus in both clinical and environmental isolates in Iran. PCR-RFLP using TasI digestion of β-tubulin DNA enables rapid screening for these common species. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Badolo Athanase
2012-07-01
Full Text Available Abstract Background Malaria control relies heavily on treated bed nets and indoor residual spraying with pyrethroid insecticides. Unfortunately, the resistance to pyrethroid insecticides, mainly due to the kdr mutation, is spreading in the main malaria vector Anopheles gambiae s.l., decreasing the insecticides’ efficacy. To manage the insecticide resistance rapidly and flexibly, simple and effective tools for the early detection of resistant mosquitoes are needed. This study aimed to develop an allele-specific, loop-mediated, isothermal amplification (AS-LAMP method to detect the West African-type kdr mutation (kdr-w; L1014F in field-collected mosquitoes. Methods DNA fragments of the wild-type and the mutated kdr gene were used to select the primers and develop the method. The primers were designed with the mutation at the 5’ end of the backward inner primer (BIP. The AS-LAMP method was compared to the AS-PCR method using the genomic DNA of 120 field-collected mosquitoes. Results The AS-LAMP method could discriminate between the wild-type homozygote, the heterozygote, and the kdr-w homozygote within 75 min. The AS-LAMP method has the advantage of being faster and at least as sensitive and specific as the AS-PCR method. Conclusions The AS-LAMP method can be used to detect the kdr mutation for quick decision-making, even in less well-equipped laboratories.
Soleiro, C A; Pena, G A; Cavaglieri, L R; Coelho, I; Keller, L M; Dalcero, A M; Rosa, C A R
2013-12-01
Aspergillus fumigatus, a well-known human and animal pathogen causing aspergillosis, has been historically identified by morphological and microscopic features. However, recent studies have shown that species identification on the basis of morphology alone is problematic. The aim of this work was to confirm the taxonomic state at specie level of a set of clinical (human and animal) and animal environment A. fumigatus strains identified by morphological criteria applying a PCR-RFLP assay by an in silico and in situ analysis with three restriction enzymes. The A. fumigatus gliotoxin-producing ability was also determined. Previous to the in situ PCR-RFLP analysis, an in silico assay with BccI, MspI and Sau3AI restriction enzymes was carried out. After that, these enzymes were used for in situ assay. All A. fumigatus strains isolated from corn silage, human aspergillosis and bovine mastitis and high per cent of the strains isolated from cereals, animal feedstuff and sorghum silage were able to produce high gliotoxin levels. Also, all these strains identified by morphological criteria as A. fumigatus, regardless of its isolation source, had band patterns according to A. fumigatus sensu stricto by PCR-RFLP markers. Aspergillus fumigatus is a well-known human and animal pathogen causing aspergillosis. In this study, clinical (human and animal) and animal environment strains were able to produce high gliotoxin levels and had band profiles according to A. fumigatus sensu stricto by PCR-RFLP markers. The results obtained here suggest that strains involved in human and animal aspergillosis could come from the animal environment in which A. fumigatus is frequently found. Its presence in animal environments could affect animal health and productivity; in addition, there are risks of contamination for rural workers during handling and storage of animal feedstuffs. © 2013 The Society for Applied Microbiology.
Cloning-free genome alterations in Saccharomyces cerevisiae using adaptamer-mediated PCR
DEFF Research Database (Denmark)
Reid, Robert J D; Lisby, Michael; Rothstein, Rodney
2002-01-01
. Furthermore, many of the techniques described here rely on preexisting and commercially available adaptamer sets that can be obtained inexpensively rather than designing new primers for every experiment. Although a cost is incurred when performing multiple PCR amplifications, the increase in recombination...... efficiency is dramatic. Finally, the adaptamer-mediated PCR fusion methodology is versatile and can be applied to varied genome manipulations....
Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu
2018-03-15
The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Directory of Open Access Journals (Sweden)
Mohammad Shafiul Alam
2012-01-01
Full Text Available Mymensingh is the most endemic district for kala-azar in Bangladesh. Phlebotomus argentipes remains the only known vector although a number of sand fly species are prevalent in this area. Genotyping of sand flies distributed in a VL endemic area was developed by a PCR and restriction-fragment-length polymorphism (RFLP of 18S rRNA gene of sand fly species. Using the RFLP-PCR analysis with AfaI and HinfI restriction enzymes, P. argentipes, P. papatasi, and Sergentomyia species could be identified. Among 1,055 female sand flies successfully analyzed for the species identification individually, 64.4% flies was classified as Sergentomyia species, whereas 35.6% was identified as P. argentipes and no P. papatasi was found. Although infection of Leishmania within the sand flies was individually examined targeting leishmanial minicircle DNA, none of the 1,055 sand flies examined were positive for Leishmania infection. The RFLP-PCR could be useful tools for taxonomic identification and Leishmania infection monitoring in endemic areas of Bangladesh.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Directory of Open Access Journals (Sweden)
D. Purwantini
2014-10-01
Full Text Available The aim of this study was to investigate the different of plumage colors on morphological diversityof Magelang duck and genetic diversity using PCR-RFLP mtDNA D-loop region analysis of Magelangduck and four others native duck population (Tegal, Mojosari, Bali and Alabio duck in Indonesia. Bloodsample was taken from 50 Magelang ducks and 20 of each native ducks. Morphological characteristicsof body measurement, production ability and egg quality of Magelang duck were analyzed usingCompletely Randomized Design with 11 plumage colors as treatments. PCR technique was administeredto amplify fragments in mtDNA D-loop region and PCR products were digested with endonucleaserestriction enzyme AluI and HaeIII. The result showed that morphology diversity of Magelang duck wasstatistically affected by different plumage colors. PCR-RFLP analysis using AluI and HaeIII restrictionenzyme resulted in six combinations of restriction fragment pattern shown in six haplotypes (A, B, C, D,E and F. Haplotype difference showed genetic diversity in the population of Magelang duck and theother native ducks. In conclusion, the different plumage colors affected morphology diversity ofMagelang duck. Genetic diversity of Indonesian native duck population could be identified by usingPCR-RFLP analysis on mtDNA D-loop region.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Investigation of FecB Mutation in Four Romanian Sheep Breeds
Directory of Open Access Journals (Sweden)
Sergiu-Emil Georgescu
2011-05-01
Full Text Available Hyperprolific phenotype of Booroola sheep was first discovered in the Australian Merino breed. This phenotype is due to the action of a single autosomal gene that influences the number of ovulations per estrogenic cycle. Recent discoveries have revealed that high prolificacy in Booroola Merino sheep is the result of a mutation (FecB in the bone morphogenetic protein receptor 1B (BMPR-1B gene. This mutation is located in the highly conserved kinase domain of the bone morphogenetic protein receptor IB, and is characterized by precocious differentiation of ovarian follicles, leading to the production of large numbers of ovulatory follicles. Our objective was to develop an easy method to identify the FecB mutation in order to screen sheep populations in terms of prolificacy. We designed primers to amplify a 190 bp fragment from the BMPR-1B gene containing or lacking the mutation. The PCR product was cut with AvaII endonuclease and the restriction products were analysed by agarose gel electrophoresis. Using the PCR-RFLP technique, we established an easy and efficient method that can be used to screen the FecB mutation. Therefore, these new methods increase the panel of molecular tools available for sheep breeders to choose the most prolific genotypes for improving artificial selection.
Directory of Open Access Journals (Sweden)
A. Ghanizadeh
2015-10-01
Full Text Available Pasteurella multocida (P. multocida, A Gram-negative facultative anaerobic bacterium, is a causative animal pathogen in porcine atrophic rhinitis and avian fowl cholera. The outer membrane of Gram-negative bacteria contains of many different protein in very high copy numbers. One of the major outer membrane, the H proteins have functional as high immunogenicity and antigenicity. In this study to increase information about epidemiology of ovine and bovine P. multocida, the 24 isolates from sheep and nine isolates from cattle were investigated by PCR-RFLP analysis of the ompH gene. In all 33 isolates, digestion of the amplified fragment of ompH gene by using EcoRI, cfoI and HindIII produced 3, 5 and 3 different restriction patterns respectively. Sixteen RFLP patterns were found among 33 investigated P.multocida isolates. This study showed that, the PCR RFLP based on ompH gene is potentially a useful method for typing of P. multocida isolates from sheep and cattle. The RFLP patterns of this gene exhibited extensive restriction site heterogeneity, which may be particularly suitable for fingerprinting of P. multocida isolates.Considering ompH protein as a protective immunogenic moiety of P.ultocida, the results of this study showed a heterogenic bacteria and this means the possibility to produce a multivalent vaccine to be protective against diseases caused by this organism in sheep and cattle in Iran.
Directory of Open Access Journals (Sweden)
Khosro Hazrati Tappeh
2014-12-01
Full Text Available Giardia lamblia is one of the most prevalent intestinal flagellate protozoa that infects a wide range of vertebrate hosts causing severe intestinal disorder in children.This study was performed to determine subspecies of G.lamblia by the PCR-RFLP method, targeting the glutamate dehydrogenase(gdhlocus, in hospitalized children at Urmia Mutahhari Hospital, West Azerbaijan Province,Iran and determining the infection transformational storages in this area.Overall, 720 stool specimens were collected from the hospitalized children, 34 samples were positive and Giardia cysts were detected under the microscope. Cysts were partially purified by the sucrose density gradient method and then washed with sterile distilled water to remove effectively the PCR inhibitors. Genomic DNA of G. lamblia isolates was extracted by freeze-thaw cycles followed by phenol/ chloroform/isoamyl alcohol method. The single step PCR-RFLP assay was used to differentiate the assemblages between A and B, which were found in humans. In this method, 432 bp expected size was amplified, and then for detection of subspecies, specific restriction RsaI and BspLI enzymes were used.Totally 34 samples were positive in terms of Giardia cyst out of 720 examined samples microscopically, so the parasite spread rate is reported 4.72%. Analysis PCR-RFLP on these samples revealed that 28 samples (93.3% have the genotype BIII and 2 samples (6.7% belong to the subgroup BIV.PCR-RFLP is a proper analytical method for determining the genotype among parasite types, using the glutamate dehydrogenizes zone's genes. Based on the results, an animal origin of infection cycle is suggested.
Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah
2017-08-01
Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.
PCR-RFLP Method to Identify Salmonid Species of Economic Importance
Directory of Open Access Journals (Sweden)
Andreea Dudu
2011-05-01
Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.
International Nuclear Information System (INIS)
Maria Lina R; Budiman Bela; Andi Yasmon
2009-01-01
Handling and controlling of tuberculosis, a disease caused by Mycobacterium tuberculosis (MTB), is now complicated since there are many MTBs that are resistant against anti-tuberculosis drugs such as isoniazid. The drug resistance could occurred due to the inadequate and un-regular drug utilization that cause gene mutation of the drug target such as katG gene for isoniazid. The molecular biology techniques such as the PCR- dot blot hybridization with radioisotope ( 32 P) labeled oligonucleotide probe, has been reported as a technique that is more sensitive and rapid for detection of gene mutations related with drug resistances. Hence, the aim of this study was to apply the PCR- dot blot hybridization technique using 32 P labeled oligonucleotide probe for detection of single mutation at codon 315 of katG gene of MTBs that rise the isoniazid resistance. In this study, we used 89 sputum specimens and a standard MTB (MTB H 37 RV) as a control. DNA extractions were performed by the BOOM method and the phenol chloroform for sputum samples and standard MTB, respectively. Primers used for PCR technique were Pt8 and Pt9 and RTB59 and RTB36 for detecting tuberculosis causing Mycobacterium and the existence of katG gene, respectively. Both of the primers are specific for IS6110 region and katG gene, respectively. PCR products were detected by an agarose gel electrophoresis technique. Dot blot hybridization with 32 P-oligonucleotide probe 315mu was performed to detect mutation at codon 315 of tested samples. Results of the PCR using primer Pt8 and Pt9 showed that all sputum specimens had positive results. Mutation detection by PCR- dot blot hybridization with 32 P-oligonucleotide probe 315mu, revealed that 11 of 89 tested samples had a mutation at their codon 315 of katG gene. Based upon these results, it is concluded that PCR-dot blot hybridization with 32 P-oligonucleotide probe is a technique that is rapid and highly specific and sensitive for detection of mutation at codon
Directory of Open Access Journals (Sweden)
Laura Clusa
2017-02-01
Full Text Available Background Salmonids are native from the North Hemisphere but have been introduced for aquaculture and sport fishing in the South Hemisphere and inhabit most rivers and lakes in temperate and cold regions worldwide. Five species are included in the Global Invasive Species Database: rainbow trout Oncorhynchus mykiss, Atlantic salmon Salmo salar, brown trout Salmo trutta, brook trout Salvelinus fontinalis, and lake trout Salvelinus namaycush. In contrast, other salmonids are endangered in their native settings. Methods Here we have developed a method to identify salmonid species directly from water samples, focusing on the Iberian Peninsula as a case study. We have designed nested Salmonidae-specific primers within the 16S rDNA region. From these primers and a PCR-RFLP procedure the target species can be unequivocally identified from DNA extracted from water samples. Results The method was validated in aquarium experiments and in the field with water from watersheds with known salmonid populations. Finally, the method was applied to obtain a global view of the Salmonidae community in Nalón River (north coast of Spain. Discussion This new powerful, very sensitive (identifying the species down to 10 pg DNA/ml water and economical tool can be applied for monitoring the presence of salmonids in a variety of situations, from checking upstream colonization after removal of river barriers to monitoring potential escapes from fish farms.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat
2018-01-01
The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.
Directory of Open Access Journals (Sweden)
Roberta Lima Caldeira
2016-01-01
Full Text Available The identification of snails of the genus Biomphalaria can be done using morphological characteristics which depends on the size of the snails and skill and knowledge of researcher. These methods sometimes are not adequate for identification of species. The PCR-RFLP, using the ITS region of the rDNA, has been used to identify Brazilian species of the genus Biomphalaria. Nevertheless, there is a lack of information about snails from other Latin American countries. In addition, some snails may be infected by Schistosoma mansoni and when submitted to PCR-RFLP they show molecular profiles different from those previously standardized for the other mollusc species. In this work the molecular profiles of 15 species and the subspecies were established by PCR-RFLP of ITS-rDNA with the enzyme DdeI. Moreover, the molecular profiles of host species, B. glabrata, B. straminea, B. tenagophila, and B. prona, infected by S. mansoni were also established. The molluscs were dissected to permit morphological identification. These results contribute to a correct identification of snails of the genus Biomphalaria and detection of these snails infected by S. mansoni.
Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique
Directory of Open Access Journals (Sweden)
Hyoung Rai Ko
2017-09-01
Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Directory of Open Access Journals (Sweden)
Haleh Hanifian
2013-09-01
Full Text Available Background: The aim of this study was DNA extraction from protoscolecses of Echinococcus granulosus and identification of these strains in West-Azerbaijan Province, north western Iran.Methods: Thirty one livestock isolates from sheep and cattle were collected from abattoirs of the province. To investigate the genetic variation of the isolates, after DNA extraction by Glass beads-phenol chloroform method; PCR-RLFP analysis of rDNA-ITS1 was performed using three different restriction enzymes of Taq 1, Rsa 1 and Alu 1.Result: Amplified PCR products for all isolates were 1000bp band which is expected band in sheep strains (G1-G3 complex. The results of RFLP analysis also were the same for all isolates. PCR-RFLP patterns restriction enzymes were identical as follows, Rsa1 bands under UV showed two bands approximately 655bp and 345bp. Alu1 bands were as follows: two approximately 800bp and 200bp and Taq1 did not cut any region and bands were approximately 1000 bp in all samples.Conclusions: Based on PCR-RFLP patterns of ITS1 fragment produced with endonucleases enzyme digestion in animal isolates, it can be concluded that a single strain of E. granulosus (sheep strain or G1-G3 complex is dominant genotype in this province
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
Genotyping of the Holstein-Friesian crossbred cattle for CD18 gene using PCR-RFLP
Directory of Open Access Journals (Sweden)
A. S. Khade
2014-05-01
Full Text Available Aim: The present study was undertaken in Holstein-Friesian (HF crossbred cattle with the objective to find out genotype of HF crossbred cattle for Bovine Leucocyte Adhesion Deficiency (BLAD by using PCR-RFLP. Materials and Methods: 50 blood samples were collected from HF crossbred cattle and subjected to PCR. The amplified PCR products were digested using Taq I restriction enzyme at 65 oC overnight. After restriction digestion, the final PCR products were electrophoresed on 2.5 % agarose gel. Results: All the 50 animals under present investigation were found to be normal as the amplified PCR product upon digestion with Taq I restriction enzyme, revealed two bands of 313 bp and 54 bp for normal animals. Conclusions: In the present investigation D128G carrier frequency was found to be 0 %. However, recent reports suggest that the mutant gene has already been observed in the HF crossbred cattle population of India, which makes it necessary to screen the animals to avoid the risk of spreading BLAD in the breeding cattle population.
Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya
2017-10-10
Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Chaâbane-Banaoues, Raja; Oudni-M'rad, Myriam; M'rad, Selim; Amani, Hizem; Mezhoud, Habib; Babba, Hamouda
2016-10-01
Cystic echinococcosis, due to Echinococcus granulosus sensu lato (s. l.), currently affects three million people, especially in low-income countries and results in high livestock production loss. DNA-based methods demonstrated genetic variability of E. granulosus s. l., and five species were recognized to belong to the complex, including E. granulosus sensu stricto (s.s) (genotypes G1-G3), Echinococcus equinus (genotype G4), Echinococcus ortleppi (genotype G5), Echinococcus canadensis (genotypes G6-G10), and the lion strain Echinococcus felidis. The characterization of Echinococcus species responsible for human and animal echinococcosis is crucial to adapt the preventive measures against this parasitic disease. The sequencing approach is the gold standard for genotyping assays. Unfortunately, developing countries do not often have access to these techniques. Based on in silico RFLP tools, we described an accurate PCR-RFLP method for Echinococcus spp. characterization. The double digestion with the HaeIII and HinfI restriction enzymes of the PCR product from nad1 gene (1071 bp) led to a clear discrimination between E. granulosus s. l. and most closely related species (Echinococcus shiquicus and Echinococcus multilocularis).Molecular procedures and phylogenetic analysis confirmed the efficiency and the reproducibility of this simple and fast PCR-RFLP method. This technique is proved useful for fresh/unfixed and FF-PET tissues and enables large-scale molecular epidemiological screening in developing countries.
Weinlander, Kenneth M.; Hall, David J.; De Stasio, Elizabeth A.
2010-01-01
We describe here two open-ended laboratory investigations for an undergraduate laboratory course that uses students' DNA as templates for quantitative real-time PCR and for traditional PCR followed by RFLP analysis. Students are captivated by the immediacy of the application and the relevance of the genotypes and traits, lactase persistence or…
Directory of Open Access Journals (Sweden)
Diego Rayan Teixeira de Sousa
2015-05-01
Conclusion: The results showed that PCR-RFLP is a valuable tool for the identification of invasive mycoses that can be implemented in hospital laboratories, allowing for a high number of clinical analyses per day.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Directory of Open Access Journals (Sweden)
Ágnes Ősz
2015-12-01
4 University of West Hungary, Mosonmagyaróvár Vár 2., 9200 Mosonmagyaróvár, Hungary Based on the analyses of the mitochondrial DNA of several European brown trout populations, five evolutionary lineages of brown trout were indentified (Atlantic, Danubian, Mediterranean, Adriatic, Marble. The species is bred primarily for stock enhancement of natural waters, however the most hatchery-maintained broodstocks originate from the Atlantic lineage. Due to the hydrogeography of Hungary our stocks should theoretically belong to the Danubian lineage; however, this has not been investigated earlier by genetic studies. For our genetic analysis, 702 fin clips were collected from two brown trout broodstocks (Lillafüred and Szilvásvárad as well as populations of natural streams (Bán, Jósva, Kemence, Apátkút, Bittva and Kölöntés in Hungary. Sequencing of the control region in mitochondrial DNA, three PCR-RFLP (mitochondrial DNA control region, lactate dehydrogenase and somatolactin genes and five microsatellite markers were used to distinguish between Danubian and Atlantic lineages of brown trout. The proportion of the mitochondrial haplotype of the Danubian lineage was low, with the exception of the Apátkúti, Kölöntés streams and Szilvásvárad broodstock. Analyses of nuclear PCR-RFLP and microsatellites markers showed various distributions of alleles characteristic of the Atlantic or Danubian lineages, although the Atlantic genotype has dominated in all population. In case of the analyses of microsatellites the polymorphism varied greatly at all locations. In addition we found several alleles that were not described earlier in other populations. Those alleles probably would be typical of Hungarian brown trout populations. Overall the populations were effectively in Hardy-Weinberg equilibrium for both PCR-RFLP and microsatellite markers. The remarkably high proportion of allochthonous Atlantic alleles in the analyzed sites is a clear indicator of the import
Laser desorption mass spectrometry for point mutation detection
Energy Technology Data Exchange (ETDEWEB)
Taranenko, N.I.; Chung, C.N.; Zhu, Y.F. [Oak Ridge National Lab., TN (United States)] [and others
1996-12-31
A point mutation can be associated with the pathogenesis of inherited or acquired diseases. Laser desorption mass spectrometry coupled with allele specific polymerase chain reaction (PCR) was first used for point mutation detection. G551D is one of several mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene present in 1-3% of the mutant CFTR alleles in most European populations. In this work, two different approaches were pursued to detect G551D point mutation in the cystic fibrosis gene. The strategy is to amplify the desired region of DNA template by PCR using two primers that overlap one base at the site of the point mutation and which vary in size. If the two primers based on the normal sequence match the target DNA sequence, a normal PCR product will be produced. However, if the alternately sized primers that match the mutant sequence recognize the target DNA, an abnormal PCR product will be produced. Thus, the mass spectrometer can be used to identify patients that are homozygous normal, heterozygous for a mutation or homozygous abnormal at a mutation site. Another approach to identify similar mutations is the use of sequence specific restriction enzymes which respond to changes in the DNA sequence. Mass spectrometry is used to detect the length of the restriction fragments by digestion of a PCR generated target fragment. 21 refs., 10 figs., 2 tabs.
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
DEFF Research Database (Denmark)
Harrington, Clare S.; Moran, L.; Ridley, A.M.
2003-01-01
Aims: To compare typeability, discriminatory ability, and inter-laboratory reproducibility of three flagellin PCR/RFLP(fla typing) methods previously described for Campylobacter. Methods and Results: The sample set(n = 100) was diverse, including both C. jejuni (n = 85) and C. coli (n = 15). Two ...
Comparison of PCR-RFLP pattern with sequencing analysis of the ITS region of Hyrcanain\\'s Tilia
Directory of Open Access Journals (Sweden)
Hamed Yousefzadeh
2014-01-01
T. hyrcana and T. rubra from Hyrcanian's origin, but it could not separate T. begonifloia from the other hyrcanian species. In this respect, derived results were similar to sequencing one. In conclusion, with regard to less expensive and less time consuming PCR-RFLP technique and high similarity between its result with sequencing, we recommend this method as a simple and economical method with relatively high efficiency studding plant phylogeny.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Laser desorption mass spectrometry for point mutation detection
Energy Technology Data Exchange (ETDEWEB)
Taranenko, N.I.; Chung, C.N.; Zhu, Y.F. [Oak Ridge National Lab., TN (United States)] [and others
1996-10-01
A point mutation can be associated with the pathogenesis of inherited or acquired diseases. Laser desorption mass spectrometry coupled with allele specific polymerase chain reaction (PCR) was first used for point mutation detection. G551D is one of several mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene present in 1-3% of the mutant CFTR alleles in most European populations. In this work, two different approaches were pursued to detect G551D point mutation in the cystic fibrosis gene. The strategy is to amplify the desired region of DNA template by PCR using two primers that overlap one base at the site of the point mutation and which vary in size. If the two primers based on the normal sequence match the target DNA sequence, a normal PCR product will be produced. However, if the alternately sized primers that match the mutant sequence recognize the target DNA, an abnormal PCR product will be produced. Thus, the mass spectrometer can be used to identify patients that are homozygous normal, heterozygous for a mutation or homozygous abnormal at a mutation site. Another approach to identify similar mutations is the use of sequence specific restriction enzymes which respond to changes in the DNA sequence. Mass spectrometry is used to detect the length of the restriction fragments generated by digestion of a PCR generated target fragment. 21 refs., 10 figs., 2 tabs.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi
2017-08-15
Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Xu, Gaolian; You, Qimin; Pickerill, Sam; Zhong, Huayan; Wang, Hongying; Shi, Jian; Luo, Ying; You, Paul; Kong, Huimin; Lu, Fengmin; Hu, Lin
2010-07-01
Chronic hepatitis B virus (CHBV) infection causes cirrhosis and hepatocellular carcinoma. Lamivudine (LAM) has been successfully used to treat CHBV infections but prolonged use leads to the emergence of drug-resistant variants. This is primarily linked to a mutation in the tyrosine-methionine-aspartate-aspartate (YMDD) motif of the HBV polymerase gene at position 204. Rapid diagnosis of drug-resistant HBV is necessary for a prompt treatment response. Common diagnostic methods such as sequencing and restriction fragment length polymorphism (RFLP) analysis lack sensitivity and require significant processing. The aim of this study was to demonstrate the usefulness of a novel diagnostic method that combines polymerase chain reaction (PCR), ligase detection reaction (LDR) and a nucleic acid detection strip (NADS) in detecting site-specific mutations related to HBV LAM resistance. We compared this method (PLNA) to direct sequencing and RFLP analysis in 50 clinical samples from HBV infected patients. There was 90% concordance between all three results. PLNA detected more samples containing mutant variants than both sequencing and RFLP analysis and was more sensitive in detecting mixed variant populations. Plasmid standards indicated that the sensitivity of PLNA is at or below 3,000 copies per ml and that it can detect a minor variant at 5% of the total viral population. This warrants its further development and suggests that the PLNA method could be a useful tool in detecting LAM resistance. (c) 2010 Wiley-Liss, Inc.
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
Le, D P; Smith, M K; Aitken, E A B
2017-10-01
Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.
Turner, Andrew; Sasse, Jurgen; Varadi, Aniko
2016-10-19
Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes
2009-01-01
Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Directory of Open Access Journals (Sweden)
Dash Aditya P
2009-07-01
Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method
Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise
Robertson, Amber L.; Phillips, Allison R.
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...
Directory of Open Access Journals (Sweden)
Ryan C. Garrick
2015-06-01
Full Text Available Reticulitermes termites play key roles in dead wood decomposition and nutrient cycling in forests. They also damage man-made structures, resulting in considerable economic loss. In the eastern United States, five species (R. flavipes, R. virginicus, R. nelsonae, R. hageni and R. malletei have overlapping ranges and are difficult to distinguish morphologically. Here we present a molecular tool for species identification. It is based on polymerase chain reaction (PCR amplification of a section of the mitochondrial cytochrome oxidase subunit II gene, followed by a three-enzyme restriction fragment length polymorphism (RFLP assay, with banding patterns resolved via agarose gel electrophoresis. The assay was designed using a large set of training data obtained from a public DNA sequence database, then evaluated using an independent test panel of Reticulitermes from the Southern Appalachian Mountains, for which species assignments were determined via phylogenetic comparison to reference sequences. After refining the interpretive framework, the PCR-RFLP assay was shown to provide accurate identification of four co-occurring species (the fifth species, R. hageni, was absent from the test panel, so accuracy cannot yet be extended to training data. The assay is cost- and time-efficient, and will help improve knowledge of Reticulitermes species distributions.
Roellig, Dawn M; Gomez-Puerta, Luis A; Mead, Daniel G; Pinto, Jesus; Ancca-Juarez, Jenny; Calderon, Maritza; Bern, Caryn; Gilman, Robert H; Cama, Vitaliano A
2013-01-01
Trypanosoma cruzi, the etiologic agent of Chagas disease, is transmitted by hematophagous reduviid bugs within the subfamily Triatominae. These vectors take blood meals from a wide range of hosts, and their feeding behaviors have been used to investigate the ecology and epidemiology of T. cruzi. In this study we describe two PCR-based methodologies that amplify a fragment of the 16S mitochondrial rDNA, aimed to improve the identification of blood meal sources for Triatoma infestans: a.--Sequence analyses of two heminested PCRs that allow the identification of mammalian and avian species, and b.--restriction fragment length polymorphism (RFLP) analysis from the mammalian PCR to identify and differentiate multi-host blood meals. Findings from both methodologies indicate that host DNA could be detected and the host species identified in samples from laboratory reared and field collected triatomines. The implications of this study are two-fold. First, these methods can be used in areas where the fauna diversity and feeding behavior of the triatomines are unknown. Secondly, the RFLP method led to the identification of multi-host DNA from T. infestans gut contents, enhancing the information provided by this assay. These tools are important contributions for ecological and epidemiological studies of vector-borne diseases.
Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food.
Ali, Md Eaqub; Al Amin, Md; Hamid, Sharifah Bee Abd; Hossain, M A Motalib; Mustafa, Shuhaimi
2015-01-01
Wider availability but lack of legal market trades has given feline meat a high potential for use as an adulterant in common meat and meat products. However, mixing of feline meat or its derivatives in food is a sensitive issue, since it is a taboo in most countries and prohibited in certain religions such as Islam and Judaism. Cat meat also has potential for contamination with of severe acute respiratory syndrome, anthrax and hepatitis, and its consumption might lead to an allergic reaction. We developed a very short-amplicon-length (69 bp) PCR assay, authenticated the amplified PCR products by AluI-restriction digestion followed by its separation and detection on a lab-on-a-chip-based automated electrophoretic system, and proved its superiority over the existing long-amplicon-based assays. Although it has been assumed that longer DNA targets are susceptible to breakdown under compromised states, scientific evidence for this hypothesis has been rarely documented. Strong evidence showed that shorter targets are more stable than the longer ones. We confirmed feline-specificity by cross-challenging the primers against 10 different species of terrestrial, aquatic and plant origins in the presence of a 141-bp site of an 18S rRNA gene as a universal eukaryotic control. RFLP analysis separated 43- and 26-bp fragments of AluI-digest in both the gel-image and electropherograms, confirming the original products. The tested detection limit was 0.01% (w/w) feline meat in binary and ternary admixed as well as meatball matrices. Shorter target, better stability and higher sensitivity mean such an assay would be valid for feline identification even in degraded specimens.
Directory of Open Access Journals (Sweden)
BK Jha
2013-09-01
Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8
Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing
DEFF Research Database (Denmark)
Liu, Yilan; Chen, Jinjin; Thygesen, Anders
2018-01-01
Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...
Consistent absence of BRAF mutations in salivary gland carcinomas
Directory of Open Access Journals (Sweden)
Nooshin Mohtasham
2017-06-01
Full Text Available Introduction: Malignant salivary gland tumors are rare entities. Despite advances in surgery, radiation therapy and chemotherapy, the rate of the mortality and five-year survival has not been improved markedly over the last few decades. The activation of EGFR- RAS-RAF signaling pathway contributes to the initiation and progression of many human cancers, promising a key pathway for therapeutic molecules. Thus, the objective of this study was to evaluate BRAF mutations in salivary gland carcinomas. Methods: We designed PCR- RFLP (Polymerase Chain Reaction -Restriction Fragment Length Polymorphism and screened 50 salivary gland carcinomas (SGCs including mucoepidermoid carcinoma (MEC, adenoid cystic carcinoma (AdCC and polymorphous low grade adenocarcinoma (PLGA for the BRAF V600E mutation. Results: PCR-RFLP analyses demonstrated no mutation in BRAF exon 15 for SGC samples at position V600, which is the most commonly mutated site for BRAF in human cancer. Conclusions: According to our results SGCs didn’t acquire BRAF mutations that result in a constitutive activation of the signaling cascade downstream of EGFR, hence SGCs can be a good candidate for anti EGFR therapies.
Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat
2017-05-12
Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.
Directory of Open Access Journals (Sweden)
Chi-Chun Ho
2017-10-01
Full Text Available Thiopurines are clinically useful in the management of diverse immunological and malignant conditions. Nevertheless, these purine analogues can cause lethal myelosuppression, which may be prevented by prospective testing for variants in the thiopurine S-methyltransferase (TPMT and, in East Asians, Nudix hydrolase 15 (NUDT15 genes. Two single-tube, tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR assays were developed to genotype the common loss-of-function variants NUDT15 c.415C>T (rs116855232 and TPMT*3C c.719A>G (rs1142345. In a group of 60 unselected patients, one and seven were found to be homozygous and heterozygous, respectively, for NUDT15 c.415C>T; one was found to be heterozygous for TPMT*3C c.719A>G. There was no non-specific amplification, and the genotypes were 100% concordant with Sanger sequencing. Limit-of-detection for both assays was below 1 ng of heterozygous template per reaction. Time- and cost-effective ARMS-PCR assays, suitable for genotyping East-Asian patients for thiopurine intolerance, were successfully developed and validated.
Directory of Open Access Journals (Sweden)
Arlem Nascimento de Oliveira
2009-12-01
Full Text Available Few are the details concerning the molecular characterization of native rhizobia isolates from Amazonas soils. The aim of the present study was the genetic characterization of rhizobia isolated from nodules of cowpea using the method PCR-RFLP of the ribosome genes 16S rRNA and the restriction enzymes HinfI, MspI, and MboI. The analysis included 20 native isolates and ten reference strains from different origins. The results indicated a great genetic variability with the formation of eight groups in one dendrogram with a varied level of similarity.Poucas são as informações referentes à caracterização molecular de rizóbios nativos isolados de solos no Amazonas. Assim, o objetivo deste trabalho foi a caracterização genética de rizóbios isolados de nódulos de caupi usando o método PCR-RFLP dos genes ribossomais 16S rRNA e as enzimas de restrição HinfI, MspI, e MboI. A análise incluiu 20 isolados nativos e dez estirpes-referência de diferentes origens. Os resultados indicaram uma grande variabilidade genética com a formação de oito grupos em um dendrograma com um nível de similaridade variado.
Directory of Open Access Journals (Sweden)
Dinka eMandakovic
2016-05-01
Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Directory of Open Access Journals (Sweden)
T.D. Nova
2016-02-01
Full Text Available Penelitian ini bertujuan untuk mengetahui keragaman gen hormon pertumbuhan (GH dengan enzim MboII pada itik Sikumbang Janti dengan menggunakan penciri PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism. Penelitian ini menggunakan sebanyak 50 sampel darah itik Sikumbang Janti. Sampel darah itik Sikumbang Janti diambil melalui vena achilaris sebanyak ± 1 ml. DNA sampel darah diisolasi menggunakan protocol Genomik DNA Purification Kit (Promega. DNA total diamplifikasi menggunakan sepasang primer F : 5’-CTG GAG CAG GCA GGA AAA TT-3’ dan R: 5’-TCC AGG GAC AGT GAC TCA AC-3’ yang menghasilkan fragmen exon 1 gen GH dengan panjang 801 bp. Produk amplifikasi direstriksi dengan menggunakan MboII yang mengenali situs pemotongan GAAGA (N/8↓ . Dari 46 sampel hasil restriksi diperoleh dua posisi. Pada posisi 618 bp dengan genotip yaitu genotip heterozigot (+/- yang terdiri dari 3 pita (266 bp, 535 bp dan 801 bp, genotip homozigot (+/+ yang terdiri dari 3 pita (109 bp, 266 bp, 426 bp dan genotip homozigot (-/- yang terdiri dari 1 pita ( 801 dan terdapat dua tipe alel, yaitu alel (+ dan all (-, all (+ sebesar 0,79 dan alel (- sebesar 0,21. Sedangkan pada posisi 727 bp memiliki genotip yaitu genotip heterozigot (+/- yang terdiri dari 3 pita (109 bp, 266 bp, 426 bp, dan genotip homozigot (-/- yang terdiri dari 3 pita dan terdapat dua tipe alel, yaitu frekuensi alel (+ sebesar 0,61 dan frekuensi alel (- sebesar 0,39. Dari hasil penelitian ini dapat disimpulkan bahwa gen GH-MboII memiliki keragamanan yang tinggi serta menunjukkan adanya keseimbangan atau tidak menyimpang dari keseimbangan Hardy Weinberg pada posisi keragaman 618 bp dan pada posisi 727 dalam ketidakseimbangan Hardy Weinberg.
DEFF Research Database (Denmark)
Hansen, Michael Møller; Mensberg, Karen-Lise Dons; Rasmussen, Gorm
1997-01-01
Eleven Danish brown trout hatchery strains were studied by PCR- RFLP analysis of the ND-I and ND-5/6 segments of the mitochondrial genome. For comparison, data from wild trout representing three Danish river systems also were included. Reduced variability in terms of nucleon diversity and number...
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.
Directory of Open Access Journals (Sweden)
Indhu Kanakaraj
Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.
Asing; Ali, Md. Eaqub; Abd Hamid, Sharifah Bee; Hossain, M. A. Motalib; Mustafa, Shuhaimi; Kader, Md. Abdul; Zaidul, I. S. M.
2016-01-01
The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition. PMID:27716792
Asing; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Hossain, M A Motalib; Mustafa, Shuhaimi; Kader, Md Abdul; Zaidul, I S M
2016-01-01
The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition.
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Directory of Open Access Journals (Sweden)
S. DÍEZ
1999-11-01
Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de
Anwar, R; Booth, A; Churchill, A J; Markham, A F
1996-01-01
The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096
A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.
Directory of Open Access Journals (Sweden)
Regassa Fikru
Full Text Available A study was conducted to develop a Trypanosoma vivax (T. vivax specific PCR based on the T. vivax proline racemase (TvPRAC gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.
Directory of Open Access Journals (Sweden)
Buczkowska Katarzyna
2015-06-01
Full Text Available Currently, two subspecies are formally recognized within Calypogeia fissa: C. fissa subsp. fissa occurring in Europe and C. fissa subsp. neogea known from North America. Genetic studies have revealed a complex structure of this species. Within the European part of distribution, three genetically distinct groups PS, PB and G are distinguished. The combination of the SCAR marker Cal04 and PCR-RFLP markers with three restriction enzymes (SmaI, TaqI and TspGWI allowed the recognition of all groups within the C. fissa complex. The TaqI enzyme recognizing the restriction sites in the PCR product of SCAR marker Ca104 turned out to be the best marker
International Nuclear Information System (INIS)
Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham
2007-01-01
The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
Lack of Mutation-histopathology Correlation in a Patient with Proteus Syndrome
Doucet, Meggie E.; Bloomhardt, Hadley M.; Moroz, Krzysztof; Lindhurst, Marjorie J.; Biesecker, Leslie G.
2016-01-01
Proteus syndrome (PS) is characterized by progressive, disproportionate, segmental overgrowth and tumor susceptibility caused by a somatic mosaic AKT1 activating mutation. Each individual has unique manifestations making this disorder extremely heterogeneous. We correlated three variables in 38 tissue samples from a patient who died with PS: the gross affection status, the microscopic affection status, and the mutation level. The AKT1 mutation was measured using a PCR-based RFLP assay. Thirte...
Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region
Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela
2008-01-01
The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Directory of Open Access Journals (Sweden)
Adriana Gibotti
2004-06-01
Full Text Available In this study, polymorphism in ipa genes was found in five out of nine EIEC serotypes studied. When SalI and HindII were used in RFLP-PCR assays many EIEC serotypes showed polymorphism in ipaB and ipaD. On the other hand, no polymorphism was observed in ipaA and ipaC in these strains. The polymorphism present in EIEC strains is serotype-dependent, since restriction patterns were conserved amongst strains belonging to the same serotype. When IpaB deduced amino acid sequences of S. flexneri M90T and FBC124-13 were compared, ten amino acids changes could be observed mainly in the amino-terminal region. The deduced EIEC IpaD amino-acid sequence presented 91% similarity with the Shigella strain. In this case, amino acid changes were spread out through the whole structure, except in the carboxyl-terminal region.No presente estudo, foi encontrado polimorfismo no gene ipa em cinco sorotipos de EIEC, de nove estudados. Quando enzimas de restrição SalI e HindII foram utilizadas no ensaio de PCR-RFLP, amostras de EIEC apresentaram polimorfismo em ipaB e ipaD. Por outro lado, não foram observados polimorfismos nos genes ipaA e ipaC nestas cepas, quando diversas enzimas de restrição foram utilizadas. O polimorfismo presente em cepas de EIEC é sorotipo-dependente, uma vez que os padrões de restrição foram conservados entre as cepas pertencentes ao mesmo sorotipo. Quando a seqüência deduzida de aminoácidos de IpaB de S. flexneri M90T e FBC124-13 foram comparadas, mudanças foram observadas em dez aminoácidos na região amino-terminal. A seqüência deduzida de aminoácidos de IpaD de EIEC apresentou similaridade de 91% com a cepa de Shigella. Neste caso, mudanças de aminoácidos ocorreram em toda a estrutura da molécula de IpaD, exceto na região carboxi-terminal.
Directory of Open Access Journals (Sweden)
Alline Didone
2016-04-01
Full Text Available Objectives: A mutation in the JAK2 gene, V617F, has been identified in several BCR-ABL1 negative myeloproliferative neoplasms (MPN: polycythemia vera (PV, essential thrombocythemia (ET, and primary myelofibrosis (PMF. Defining the presence or absence of this mutation is an essential part of clinical diagnostic algorithms and patient management. Here, we aimed to evaluate the performance of three PCR-based assays: Amplification Refractory Mutation System (ARMS, High-Resolution Melting analysis (HRM, and Sanger direct sequencing, and compare their results with those obtained by a PCR restriction fragment polymorphism assay (PCR-RFLP. Design and methods: We used blood samples from 136 patients (PV=20; PMF=20; ET=28, and other MPN suspected cases=68. Results: Comparable results were observed among the four assays in patients with PV, PMF, and MPN suspected cases. In patients with a diagnosis of ET, the JAK2 V617F mutation was detected in 67.8% of them by the PCR-ARMS and PCR-HRM assay and in 64% of them by the conventional Sanger sequence approach. The PCR-ARMS and PCR-HRM assays were 100% concordant. With these tests, only one of the 20 patients with ET and one of the three patients with clinically suspected MPN gave different results compared with those obtained by the PCR-RFLP. Conclusions: Our results have demonstrated that the PCR-ARMS and PCR-HRM assays could detect the JAK2 V617F mutation effectively in MPN patients, but PCR-HRM assays are rapid and the most cost-effective procedures. Keywords: Myeloproliferative, JAK2 V617F, Mutation, Wild type, Screening
Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.
Liu, Chao; Chang, Le; Jia, Tingting; Guo, Fei; Zhang, Lu; Ji, Huimin; Zhao, Junpeng; Wang, Lunan
2017-05-12
Quantification Hepatitis B virus (HBV) DNA plays a critical role in the management of chronic HBV infections. However, HBV is a DNA virus with high levels of genetic variation, and drug-resistant mutations have emerged with the use of antiviral drugs. If a mutation caused a sequence mismatched in the primer or probe of a commercial DNA quantification kit, this would lead to an underestimation of the viral load of the sample. The aim of this study was to determine whether commercial kits, which use only one pair of primers and a single probe, accurately quantify the HBV DNA levels and to develop an improved duplex real-time PCR assay. We developed a new duplex real-time PCR assay that used two pairs of primers and two probes based on the conserved S and C regions of the HBV genome. We performed HBV DNA quantitative detection of HBV samples and compared the results of our duplex real-time PCR assays with the COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. The target region of the discordant sample was amplified, sequenced, and validated using plasmid. The results of the duplex real-time PCR were in good accordance with the commercial COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. We showed that two samples from Chinese HBV infections underestimated viral loads when quantified by the Roche kit because of a mismatch between the viral sequence and the reverse primer of the Roche kit. The HBV DNA levels of six samples were undervalued by duplex real-time PCR assays of the C region because of mutations in the primer of C region. We developed a new duplex real-time PCR assay, and the results of this assay were similar to the results of commercial kits. The HBV DNA level could be undervalued when using the COBAS TaqMan HBV Test version 2 for Chinese HBV infections owing to a mismatch with the primer/probe. A duplex real-time PCR assay based on the S and C regions could solve this problem to some extent.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR.
Decraene, Charles; Silveira, Amanda B; Bidard, François-Clément; Vallée, Audrey; Michel, Marc; Melaabi, Samia; Vincent-Salomon, Anne; Saliou, Adrien; Houy, Alexandre; Milder, Maud; Lantz, Olivier; Ychou, Marc; Denis, Marc G; Pierga, Jean-Yves; Stern, Marc-Henri; Proudhon, Charlotte
2018-02-01
Progress in the liquid biopsy field, combined with the development of droplet digital PCR (ddPCR), has enabled noninvasive monitoring of mutations with high detection accuracy. However, current assays detect a restricted number of mutations per reaction. ddPCR is a recognized method for detecting alterations previously characterized in tumor tissues, but its use as a discovery tool when the mutation is unknown a priori remains limited. We established 2 ddPCR assays detecting all genomic alterations within KRAS exon 2 and EGFR exon 19 mutation hotspots, which are of clinical importance in colorectal and lung cancer, with use of a unique pair of TaqMan ® oligoprobes. The KRAS assay scanned for the 7 most common mutations in codons 12/13 but also all other mutations found in that region. The EGFR assay screened for all in-frame deletions of exon 19, which are frequent EGFR-activating events. The KRAS and EGFR assays were highly specific and both reached a limit of detection of <0.1% in mutant allele frequency. We further validated their performance on multiple plasma and formalin-fixed and paraffin-embedded tumor samples harboring a panel of different KRAS or EGFR mutations. This method presents the advantage of detecting a higher number of mutations with single-reaction ddPCRs while consuming a minimum of patient sample. This is particularly useful in the context of liquid biopsy because the amount of circulating tumor DNA is often low. This method should be useful as a discovery tool when the tumor tissue is unavailable or to monitor disease during therapy. © 2017 American Association for Clinical Chemistry.
Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B
1997-11-01
Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Directory of Open Access Journals (Sweden)
Assawamakin Anunchai
2007-08-01
Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene
Energy Technology Data Exchange (ETDEWEB)
Goltsov, A.A.; Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States)); Konecki, D.S.; Lichter-Konecki, U.
1992-09-01
The HindIII RFLP in the human phenylalanine hydroxylase (PAH) gene is caused by the presence of an AT-rich (70%) minisatellite region. This region contains various multiples of 30-bp tandem repeats and is located 3 kb downstream of the final exon of the gene. PCR-mediated amplification of this region from haplotyped PAH chromosomes indicates that the previously reported 4.0-kb HindIII allele contains three of these repeats, while the 4.4-kb HindIII allele contains 12 of these repeats. The 4.2-kb HindIII fragment can contain six, seven, eight, or nine copies of this repeat. These variations permit more detailed analysis of mutant haplotypes 1, 5, 6, and, possibly, others. Kindred analysis in phenylketonuria families demonstrates Mendelian segregation of these VNTR alleles, as well as associations between theses alleles and certain PAH mutations. The R261Q mutation, associated with haplotype 1, is associated almost exclusively with an allele containing eight repeats; the R408W mutation, when occurring on a haplotype 1 background, may also be associated with the eight-repeat VNTR allele. Other PAH mutations associated with haplotype 1, R252W and P281L, do not appear to segregate with specific VNTR alleles. The IVS-10 mutation, when associated with haplotype 6, is associated exclusively with an allele containing seven repeats. The combined use of this VNTR system and the existing RFLP haplotype system will increase the performance of prenatal diagnostic tests based on haplotype analysis. In addition, this VNTR may prove useful in studies concerning the origins and distributions of PAH mutations in different human populations. 32 refs., 3 figs., 3 tabs.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Directory of Open Access Journals (Sweden)
Baudoin JP.
1998-01-01
Full Text Available Phylogenetic relationships among 74 accessions belonging to six species of Phaseolus are investigated using variation in chloroplast DNA assessed according to a PCR-RFLP protocol. Three fragments of chloroplast DNA are amplified using universal primers, and then digested with 10 restriction enzymes. Thirty-six haplotypes are identified on the basis of the polymorphism in fragment number and size. Three main phylogenetic groups, strongly supported through bootstrap analysis, are identified: (1 accessions from Phaseolus lunatus and Phaseolus xolocotzii; (2 accessions from Phaseolus glabellus; (3 accessions from Phaseolus vulgaris, Phaseolus polyanthus and Phaseolus coccineus. Within the third group, accessions of Phaseolus coccineus are scattered along the phylogenetic tree, which provides some evidence that coccineus accessions are paraphyletic with respect to Phaseolus vulgaris and Phaseolus polyanthus. An analysis of molecular variance applied on four species show that they are significantly differentiated with 79% of molecular variance among species and 21% within species. The results agree with previous investigations on chloroplast DNA variation in the genus Phaseolus, and suggest that PCRRFLP methods, which are technically less labour-intensive than previous methods, are of great value for phylogenetic investigations at the generic level.
Directory of Open Access Journals (Sweden)
Good Michael F
2005-10-01
Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.
Genotyping of β-Lactoglobulin gene by PCR-RFLP in Sahiwal and Tharparkar cattle breeds
Directory of Open Access Journals (Sweden)
Gupta Neelam
2006-05-01
Full Text Available Abstract Background Improvement of efficiency and economic returns is an important goal in dairy farming, as in any agricultural enterprise. The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. Selection of animals with desirable genotypes and mating them to produce the next generation has been the basis of livestock improvement and this would continue to remain the same in the coming years. The use of polymorphic genes as detectable molecular markers is a promising alternative to the current methods of trait selection once these genes are proven to be associated with traits of interest in animals. The point mutations in exon IV of bovine β-Lactoglobulin gene determine two allelic variants A and B. These variants were distinguished by Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP analysis in two indigenous Bos indicus breeds viz. Sahiwal and Tharparkar cattle. DNA samples (228 in Sahiwal and 86 in Tharparkar were analyzed for allelic variants of β-Lactoglobulin gene. Polymorphism was detected by digestion of PCR amplified products with Hae III enzyme, and separation on 12% non-denaturing gels and resolved by silver staining. Results The allele B of β-Lactoglobulin occurred at a higher frequency than the allele A in both Sahiwal and Tharparkar breeds. The genotypic frequencies of AA, AB, and BB in Sahiwal and Tharparkar breeds were 0.031, 0.276, 0.693 and 0.023, 0.733, 0.244 respectively. Frequencies of A and B alleles were 0.17 and 0.83, and 0.39 and 0.61 in Sahiwal and Tharparkar breeds respectively. The Chi-square test results (at one degree of freedom at one per cent level revealed that the Tharparkar population was not in Hardy-Weinberg equilibrium as there was a continuous migration of animals in the herd studied, where as, the results are not significant for the Sahiwal
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Rostampour, N.; Tajaddini, M.H.; Hashemipour, M
2012-01-01
Objective: The prevalence of congenital hypothyroidism (CH) is high in Isfahan, Iran. In addition, it has different etiologies compared with other countries. The rate of parental consanguinity is also high in the city. Moreover, DUOX2 gene is effective in transient CH and permanent CH due to dyshormonogenesis. Therefore, the aim of this research was to investigate the mutations of DUOX2 gene in patients with transient CH and permanent CH due to dyshormonogenesis. Methodology: In this descriptive, prospective study, patients diagnosed with transient and permanent CH due to dyshormonogenesis during CH screening program were selected. Venous blood samples were obtained to determine the 3 mutations (Q36H, R376W, and D506N) of DUOX2 gene using polymerase chain reaction (PCR) method by specific primers and complementary methods such as restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism (SSCP). Results: In this study, 25 patients with transient CH and 33 subjects with permanent CH due to dyshormonogenesis were studied. In addition, 30 children were studied as the control group. We did not find any mutations of the 3 mentioned mutations of DUOX2 gene. Conclusion: Considering the findings of the current study, further studies with other methods are required to evaluate other gene mutations such as pendrin, sodium-iodide symporter (NIS) and thyroglobulin. (author)
Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-RFLP in Iran.
Momeni, Zohreh; Sadraei, Javid; Kazemi, Bahram; Dalimi, Abdolhossein
2015-12-01
Trichomonas vaginalis is a human urogenital pathogen that causes trichomoniasis, the most common nonviral, parasitic sexually transmitted infection in the world. At present, little is known regarding the degree of strain variability of T. vaginalis. A classification method for T. vaginalis strains would be a useful tool in the study of the epidemiology, drug resistance, pathogenesis and transmission of T. vaginalis. Eight different types of actin genes have been identified by PCR-RFLP in T. vaginalis; the purpose of this study is to determine the genotypes of this parasite in Karaj city, Iran. Forty-five clinical T. vaginalis isolates from vaginal secretions and urine sediment were collected from Karaj city from 2012 through 2014. DNA was extracted and the actin gene was amplified by nested-PCR; all samples were positive. To determine the genetic differences, sequencing on seven samples was conducted. Then, all PCR products were digested with HindII, MseI, and RsaI restriction enzymes. Of 45 isolates, 23 samples (51.1%) were of actin genotype G, 11 samples (24.4%) of genotype E, six samples (13.3%) of genotype H, three samples (6.6%) of genotype I, and two samples (4.4%) were mixed genotypes of G and E. Genetic diversity of T. vaginalis isolates is notable. The actin genotype G may be the dominant genotype in Karaj city, Iran. Copyright © 2015 Elsevier Inc. All rights reserved.
PCR and RFLP analyses based on the ribosomal protein operon
Differentiation and classification of phytoplasmas have been primarily based on the highly conserved 16Sr RNA gene. RFLP analysis of 16Sr RNA gene sequences has identified 31 16Sr RNA (16Sr) groups and more than 100 16Sr subgroups. Classification of phytoplasma strains can however, become more refin...
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
Collery, Mark M; Smyth, Cyril J
2007-02-01
The egc locus of Staphylococus aureus harbours two enterotoxin genes (seg and sei) and three enterotoxin-like genes (selm, seln and selo). Between the sei and seln genes are located two pseudogenes, psient1 and psient2, or the selu or seluv gene. While these two alternative sei-seln intergenic regions can be distinguished by PCR, to date, DNA sequencing has been the only confirmatory option because of the very high degree of sequence similarity between egc loci bearing the pseudogenes and the selu or seluv gene. In silico restriction enzyme digestion of genomic regions encompassing the egc locus from the 3' end of the sei gene through the 5' first quarter of the seln gene allowed pseudogene- and selu- or seluv-bearing egc loci to be distinguished by PCR-RFLP. Experimental application of these findings demonstrated that endonuclease HindIII cleaved PCR amplimers bearing pseudogenes but not those with a selu or seluv gene, while selu- or seluv-bearing amplimers were susceptible to cleavage by endonuclease HphI, but not by endonuclease HindIII. The restriction enzyme BccI cleaved selu- or seluv-harbouring amplimers at a unique restriction site created by their signature 15 bp insertion compared with pseudogene-bearing amplimers, thereby allowing distinction of these egc loci. PCR-RFLP analysis using these restriction enzymes provides a rapid, easy to interpret alternative to DNA sequencing for verification of PCR findings on the nature of an egc locus type, and can also be used for the primary identification of the intergenic sei-seln egc locus type.
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
Directory of Open Access Journals (Sweden)
Vahhab Piranfar
2015-09-01
Conclusion: The present study showed that this technique, which scans gene segments and creates an analysis pattern for detection of clinical samples, is useful and more dominant compared with PCR-RFLP. Thus, this method can be used for brucellosis detection, and clinical and epidemiological research.
Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers
Czech Academy of Sciences Publication Activity Database
Kotík, Michael; Faměrová, Veronika
2012-01-01
Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Directory of Open Access Journals (Sweden)
Hamidreza Monavari
2013-12-01
Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
[Differentiation of geographic biovariants of smallpox virus by PCR].
Babkin, I V; Babkina, I N
2010-01-01
Comparative analysis of amino acid and nucleotides sequences of ORFs located in extended segments of the terminal variable regions in variola virus genome detected a promising locus for viral genotyping according to the geographic origin. This is ORF O1L of VARV. The primers were calculated for synthesis of this ORF fragment by PCR, which makes it possible to distinguish South America-Western Africa genotype from other VARV strains. Subsequent RFLP analysis reliably differentiated Asian strains from African strains (except Western Africa isolates). This method has been tested using 16 VARV strains from various geographic regions. The developed approach is simple, fast and reliable.
PCR-RFLP analyses for studying the diversity of GH and Pit-1 genes in Slovak Simmental cattle
Directory of Open Access Journals (Sweden)
Anna Trakovická
2013-10-01
Full Text Available The aim of this study was evaluation of growth hormone (GH and specific pituitary transcription factor (Pit-1 genes diversity in population of 353 Slovak Simmental cows. The analyses were based on single nucleotide polymorphisms GH/AluI and Pit-1/HinfI detections. A polymorphic site of GH gene (AluI has been linked to differences in circulating metabolites, metabolic hormones and milk yield. Bovine Pit-1 is responsible for pituitary development and hormone secreting gene expression, including GH gene. The Pit-1/HinfI locus was associated with growth, milk production and reproduction performance in cattle. Samples of genomic DNA were analyzed by PCR-RFLP method. Digestion of GH gene PCR products with restriction enzyme AluI revealed allele L and V with frequency 0.695 and 0.305, respectively. The digested Pit-1 gene PCR products with enzyme HinfI revealed alleles A (0.249 and B (0.751. Dominant genotypes were for GH gene heterozygous LV (0.47 and for Pit-1 gene homozygous BB (0.56 animals. The observed heterozygosity, effective allele numbers and polymorphism information content of GH/AluI and Pit-1/HinfI bovine loci population were 0.42/0.37, 1.73/1.59 and 0.33/0.30, respectively. The median polymorphic information content of loci was also transferred to the higher observed homozygosity in population (0.58/0.63. Keywords: cattle, growth hormone, leptin, PCR, Pit-1, polymorphism.
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria
2017-07-01
Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.
Montalvo Alvarez, Ana Margarita; Nodarse, Jorge Fraga; Goodridge, Ivón Montano; Fidalgo, Lianet Monzote; Marin, Marcel; Van Der Auwera, Gert; Dujardin, Jean-Claude; Bernal, Iván Darío Velez; Muskus, Carlos
2010-05-01
Leishmania panamensis and Leishmania guyanensis are two species of the subgenus Viannia that are genetically very similar. Both parasites are usually associated with cutaneous leishmaniasis, but also have the potential to cause the mucocutaneous form of the disease. In addition, the study of foci and consequently the identification of vectors and probable reservoirs involved in transmission require a correct differentiation between both species, which is important at epidemiological level. We explored the possibility of identifying these species by using restriction fragment length polymorphisms (RFLP) in the gene coding for heat-shock protein 70 (hsp70). Previously, an hsp70 PCR-RFLP assay proved to be very effective in differentiating other Leishmania species when HaeIII is used as restriction enzyme. Based on hsp70 sequences analysis, BccI was found to generate species-specific fragments that can easily be recognized by agarose gel electrophoresis. Using the analysis of biopsies, scrapings, and parasite isolates previously grouped in a cluster comprising both L. panamensis and L. guyanensis, we showed that our approach allowed differentiation of both entities. This offers the possibility not only for identification of parasites in biological samples, but also to apply molecular epidemiology in certain countries of the New World, where several Leishmania species could coexist. Copyright 2009 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Directory of Open Access Journals (Sweden)
Siti Nur Azizah
2017-01-01
Full Text Available Gourami (Osprhronemus goramy Lac. is a freshwater fish that is widely cultivated in Indonesia, particularly by fish farmer in Java. Soang strain has a faster growth rate than other strains. However, the fry that derived from a single cohort (generated from a single spawning shows various sizes even in the same age because they have different growth rate. Differences in growth rate may occur due to differences in metabolic capabilities especially cellular respiration. Different rate of respiration can be assumed to be due to differences in the genetic component, especially on their cytochrome c oxidase 1 gene (CO1. Therefore this study aimed to determine whether there are differences in PCR-RFLP marker CO1 gene among different sizes of gourami soang strain from the same cohort so that can be used to analyze genetic diversity. This study used survey method by applying purposive random sampling. Four restriction enzymes were used during the research. Molecular characters were defined descriptively based on the appearance of restriction fragment on agarose gel. The result showed that soang strain which used in this study had monomorphics allele on their CO1-HindIII. PstI, BamHI, and EcoRI, could not cut the PCR products and results no RFLP markers. So that genetic variation in the used CO1 gene fragment could not be detected using HindIII, Pst1, BamH1 and EcoR1 enzymes. The three different sizes of soang strain had similar alleles or homozygous, meaning that heterozigocity value was 0 (zero. Therefore, the CO1 gene in this study could not be used as molecular character to differentiate different sizes of gourami soang strain from the same cohort.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Ben Ali, Sina-Elisabeth; Madi, Zita Erika; Hochegger, Rupert; Quist, David; Prewein, Bernhard; Haslberger, Alexander G.; Brandes, Christian
2014-01-01
Genetic mutations must be avoided during the production and use of seeds. In the European Union (EU), Directive 2001/18/EC requires any DNA construct introduced via transformation to be stable. Establishing genetic stability is critical for the approval of genetically modified organisms (GMOs). In this study, genetic stability of two GMOs was examined using high resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) employing Scorpion primers for amplification. The genetic variability of the transgenic insert and that of the flanking regions in a single oilseed rape variety (GT73) and a stacked maize (MON88017 × MON810) was studied. The GT73 and the 5' region of MON810 showed no instabilities in the examined regions. However; two out of 100 analyzed samples carried a heterozygous point mutation in the 3' region of MON810 in the stacked variety. These results were verified by direct sequencing of the amplified PCR products as well as by sequencing of cloned PCR fragments. The occurrence of the mutation suggests that the 5' region is more suitable than the 3' region for the quantification of MON810. The identification of the single nucleotide polymorphism (SNP) in a stacked event is in contrast to the results of earlier studies of the same MON810 region in a single event where no DNA polymorphism was found. PMID:25365178
Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A
2017-10-26
EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.
ŞAKALAR, Çağrı; KUK, Salih; ERENSOY, Ahmet; DAĞLI, Adile Ferda; ÖZERCAN, İbrahim Hanifi
2015-01-01
To develop a novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol using a new genomic marker sequence and a novel set of restriction enzymes in order to detect and discriminate 2 Echinococcus species, E. granulosus and E. multilocularis, found in formalin-fixed paraffin-embedded (FFPE) human tissues. Materials and methods: DNA was isolated from 11 FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis. A mitochondrial...
Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira
2016-01-01
Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.
Sefrioui, David; Mauger, Florence; Leclere, Laurence; Beaussire, Ludivine; Di Fiore, Frédéric; Deleuze, Jean-François; Sarafan-Vasseur, Nasrin; Tost, Jörg
2017-02-01
Circulating cell-free DNA (ccfDNA) bears great promise as biomarker for personalized medicine, but ccfDNA is present only at low levels in the plasma or serum of cancer patients. E-ice-COLD-PCR is a recently developed enrichment method to detect and identify mutations present at low-abundance in clinical samples. However, recent studies have shown the importance to accurately quantify low-abundance mutations as clinically important decisions will depend on certain mutation thresholds. The possibility for an enrichment method to accurately quantify the mutation levels remains a point of concern and might limit its clinical applicability. In the present study, we compared the quantification of KRAS mutations in ccfDNA from metastatic colorectal cancer patients by E-ice-COLD-PCR with two digital PCR approaches. For the quantification of mutations by E-ice-COLD-PCR, cell lines with known mutations diluted into WT genomic DNA were used for calibration. E-ice-COLD-PCR and the two digital PCR approaches showed the same range of the mutation level and were concordant for mutation levels below the clinical relevant threshold. E-ice-COLD-PCR can accurately detect and quantify low-abundant mutations in ccfDNA and has a shorter time to results making it compatible with the requirements of analyses in a clinical setting without the loss of quantitative accuracy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Trognitz Friederike
2007-02-01
Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR
Energy Technology Data Exchange (ETDEWEB)
Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others
1996-07-01
Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.
Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris
2017-08-01
The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.
Sangalli, Juliano Rodrigues; Rodrigues, Thiago Bittencourt; Smith, Lawrence Charles; Meirelles, Flávio Vieira; Chiaratti, Marcos Roberto
2015-01-01
Mouse models are widely employed to study mitochondrial inheritance, which have implications to several human diseases caused by mutations in the mitochondrial genome (mtDNA). These mouse models take advantage of polymorphisms between the mtDNA of the NZB/BINJ and the mtDNA of common inbred laboratory (i.e., C57BL/6) strains to generate mice with two mtDNA haplotypes (heteroplasmy). Based on PCR followed by restriction fragment length polymorphism (PCR-RFLP), these studies determine the level of heteroplasmy across generations and in different cell types aiming to understand the mechanisms underlying mitochondrial inheritance. However, PCR-RFLP is a time-consuming method of low sensitivity and accuracy that dependents on the use of restriction enzyme digestions. A more robust method to measure heteroplasmy has been provided by the use of real-time quantitative PCR (qPCR) based on allelic refractory mutation detection system (ARMS-qPCR). Herein, we report an ARMS-qPCR assay for quantification of heteroplasmy using heteroplasmic mice with mtDNA of NZB/BINJ and C57BL/6 origin. Heteroplasmy and mtDNA copy number were estimated in germline and somatic tissues, providing evidence of the reliability of the approach. Furthermore, it enabled single-step quantification of heteroplasmy, with sensitivity to detect as low as 0.1% of either NZB/BINJ or C57BL/6 mtDNA. These findings are relevant as the ARMS-qPCR assay reported here is fully compatible with similar heteroplasmic mouse models used to study mitochondrial inheritance in mammals. PMID:26274500
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Feng, Qin; Gai, Fei; Sang, Yaxiong; Zhang, Jie; Wang, Ping; Wang, Yue; Liu, Bing; Lin, Dongmei; Yu, Yang; Fang, Jian
2018-01-01
The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC) patients with EGFR T790M mutations in circulating tumor DNA (ctDNA) could benefit from osimertinib. The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR. A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS). In total, 52.94% (69/119) had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF) was 1.09% and three cases presented low concentration (AF Digital PCR) was identified as T790M- by ARMS-PCR. Four samples were identified as T790M+ by both NGS and 3D Digital PCR, and typically three samples (3/4) presented at a low ratio (AF Digital PCR is a novel method with high sensitivity and specificity to detect EGFR T790M mutation in plasma.
Directory of Open Access Journals (Sweden)
Araújo F.G. de
2005-01-01
Full Text Available Cystic fibrosis (CF is the most common genetic disease among Caucasians and is rare among sub-Saharan Africans. The Brazilian population is not ethnically homogeneous but it is the result of three-way ethnic admixture of Europeans, Africans and Amerindians in varying proportions, depending on the region. In the present study, we investigated 33 patients who had been diagnosed and are currently under treatment for CF at the University Hospital João de Barros Barreto, Belém, Pará State. The molecular analysis for G542X, G551D and R553X mutations was performed by PCR followed by RFLP using BstNI, HincII and MboI, respectively, in polyacrylamide gel eletrophoresis and stained with AgNO3. ThedeltaF508 mutation (a deletion of 3 bp was only analyzed by polyacrylamide gel electrophoresis and stained with AgNO3. Each sample was analyzed for regions of interest in the CFTR gene using amplified by PCR and specific primers. The deltaF508 and G551D mutations presented frequencies of 22.7 and 3%, respectively. In 74.3% of the remaining patients, none of the mutations investigated was found. The present study characterized in a sample of patients with an established clinical diagnosis of CF (asthma, repeated bronchopneumonia, disorders of nutritional status, etc. the most frequent mutation ( deltaF508 in the North region of Brazil and is also the first report of the G551D mutation. In spite of the wide spectrum of CF mutations and the heterogeneous ethnic origin of the Amazon population, the molecular diagnosis is a helpful additional tool for the diagnosis and treatment of CF patients.
Singh, O P; Dykes, C L; Sharma, G; Das, M K
2015-01-01
Leucine-to-phenylalanine substitution at residue L1014 in the voltage-gated sodium channel, target site of action for dichlorodiphenyltrichloroethane (DDT) and pyrethroids, is the most common knockdown resistance (kdr) mutation reported in several insects conferring resistance against DDT and pyrethroids. Here, we report presence of two coexisting alternative transversions, A>T and A>C, on the third codon position of L1014 residue in malaria vector Anopheles subpictus Grassi (species A) from Jamshedpur (India), both leading to the same amino acid substitution of Leu-to-Phe with allelic frequencies of 19 and 67%, respectively. A single primer-introduced restriction analysis-polymerase chain reaction (PIRA-PCR) was devised for the identification of L1014F-kdr mutation in An. subpictus resulting from either type of point mutation. Genotyping of samples with PIRA-PCR revealed high frequency (82%) of L1014F-kdr mutation in the study area. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].
Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli
2017-08-10
To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.
Taghadosi, Vahideh; Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Samiei, Azadeh
2016-12-01
Renal diseases in cattle are frequently not recognized due to the subclinical conditions. Some species of Leptospira are the main cause of infectious agents that damage the kidneys and lead to abortion and economic losses in cattle and are also of major concern in the public health. This study was aimed to assess the prevalence of renal lesions of slaughtered cattle in the Shiraz abattoir and to determine the correlation between rejected kidneys and infection with Leptospira using nested PCR-restriction fragment length polymorphism (RFLP) techniques. Out of 1000 inspected animals, 205 (20.5 %) revealed the renal lesions. Chronic nephritis (7.5 %), white-spotted kidney (7.3 %), and petechial hemorrhage (3.5 %) were the most prevalent forms of the lesions. A direct correlation between increasing the age and significant increase in the rate of lesions was also observed (P = 0.03). Using nested PCR-RFLP assay, 40.8 % of the tested kidneys were turned to be infected to the pathogenic species of Leptospira. The risk of infection of the kidneys with white spot to pathogenic species of Leptospira (53.8 %) was more than that of the kidneys with other lesions (25.0 %) (P = 0.014). The odd ratio indicates that the kidneys with white spot lesions are likely to be infected with pathogenic species of Leptospira, five times greater than other lesions. This study showed that renal lesions especially white-spotted kidney, which were considerably associated with Leptospira in slaughtered cattle in Shiraz, were very high. This is important in terms of public health and in particular, increases the risk of transmission of disease to human specially in the high-risk careers including farmers, veterinarians, and abattoir workers.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS
Directory of Open Access Journals (Sweden)
Amit Kumar Tiwari
2016-11-01
Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.
Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T
2016-09-01
Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Amalia Monroy-Ostria
2014-01-01
Full Text Available American cutaneous leishmaniasis includes a spectrum of clinical forms localized cutaneous, diffuse cutaneous, and mucocutaneous leishmaniasis which can be caused by different strains of Leishmania belonging to the L. mexicana or L. braziliensis complexes which may coexist in the same endemic area. We evaluated the PCR-RFLP assay of the ITS1 genes for direct identification of Leishmania species in 163 clinical samples and 21 Mexican isolates of Leishmania. In relation to the Mexican isolates of Leishmania 52% displayed a pattern similar to the L. (L. mexicana, 5% showed a mixed pattern compatible with L. (L. mexicana and L. (V. braziliensis, eight with L. (L. amazonensis and L. (L. mexicana, and one to L. (V. braziliensis. Most of the clinical samples, 109/116 (94%, gave a pattern similar to that of the L. mexicana, two clinical samples gave similar patterns to that of Leishmania braziliensis, and 5 samples gave patterns that suggest a coinfection of L. (L. mexicana and L. (V. braziliensis or L. (L. mexicana and L. (L. amazonensis. The ITS1 PCR-RFLP assay is a multipurpose tool for diagnosis of Leishmania from clinical samples and enables determination of the infecting species of New World Leishmania in the field in relatively short time and low cost.
Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers
International Nuclear Information System (INIS)
Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.
2007-01-01
Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Vela, J; Vitorica, J; Ruano, D
2001-12-01
We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.
Directory of Open Access Journals (Sweden)
Maryam Dehghani
2017-02-01
Full Text Available Background: AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods: 243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results: Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion: Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.
Rapid screening of β-Globin gene mutations by Real-Time PCR in ...
African Journals Online (AJOL)
Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.
Directory of Open Access Journals (Sweden)
Martina Miluchová
2012-05-01
Full Text Available Canine atopic dermatitis (cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs22114085 SNP genotypes by PCR-RFLP method. The PCR products were digested with DdeI restriction enzyme. The C allele was distributed in Czech Pointer, Chihuahua, German Wirehaired Pointer with an allele frequency ranging from 0.4545 to 1.00. In the population of Czech Pointer we detected all genotypes CC, CT and TT with frequency in male 0.25, 0.5833 and 0.1667, and in female 0.2728, 0.3636 and 0.3636, subsequently. In German Wirehaired Pointer was detected homozygote genotype CC in male and heterozygote genotype CT in female with frequency 1 and 1. In Chihuahua was observed homozygote genotype CC and heterozygote genotype CT with frequency 0.3333 and 0.6667, subsequently. In Golden retriever and Pincher we detected genotype TT with frequency 1.
Molecular characterization of UV-treated sugar beet somaclones using RFLP markers
International Nuclear Information System (INIS)
Levall, M.W.; Bengtsson, K.; Nilsson, N.-O.; Hjerdin, A.; Hallden, C.
1994-01-01
Sugar beet plants regenerated from UV-treated calluses were examined by restriction fragment length polymorphism (RFLP) analysis to determine the extent of somaclonal variation occurring at the DNA level. In total, 50 random sugar beet DNA sequences were used to screen 42 somaclones for genetic alterations. Three polymorphisms were detected among the 7 644 alleles analysed. From these data a mutation frequency of 0.03 ± 0.02% per allele was estimated. This frequency is in agreement with similar studies of somaclonal DNA variation using molecular markers and lies in the upper range of the spontaneous gene mutation frequencies found in plants. The two probegenotype combinations showing independent polymorphisms, were further analysed using the restriction enzymes Bam HI, Eco RI, Eco RV and Hind III. Both polymorphisms are likely to result from structural rearrangements rather than from point mutations. Differences in methylation among 10 of the investigated somaclones were tested for by comparing Hpa II and Msp I generated RFLP patterns. The somaclones showed extensive methylation, but no differences in their degree of methylation. Cytological analysis revealed 34 diploid, 8 tetraploid, but no aneuploid plants. (author)
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Energy Technology Data Exchange (ETDEWEB)
Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)
1994-09-01
Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.
Acardi, Soraya Alejandra; Liotta, Domingo Javier; Santini, María Soledad; Romagosa, Carlo Mariano; Salomón, Oscar Daniel
2010-09-01
In this study, a genotypification of Leishmania was performed using polimerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing techniques to identify species of Leishmania parasites in phlebotomine sand flies and dogs naturally infected. Between January-February of 2009, CDC light traps were used to collect insect samples from 13 capture sites in the municipality of Posadas, which is located in the province of Misiones of Argentina. Sand flies identified as Lutzomyia longipalpis were grouped into 28 separate pools for molecular biological analysis. Canine samples were taken from lymph node aspirates of two symptomatic stray animals that had been positively diagnosed with canine visceral leishmaniasis. One vector pool of 10 sand flies (1 out of the 28 pools tested) and both of the canine samples tested positively for Leishmania infantum by PCR and RFLP analysis. PCR products were confirmed by sequencing and showed a maximum identity with L. infantum. Given that infection was detected in one out of the 28 pools and that at least one infected insect was infected, it was possible to infer an infection rate at least of 0.47% for Lu. longipalpis among the analyzed samples. These results contribute to incriminate Lu. longipalpis as the vector of L. infantum in the municipality of Posadas, where cases of the disease in humans and dogs have been reported since 2005.
Wiriyakarun, Suchaya; Yodpetch, Woraluk; Komatsu, Katsuko; Zhu, Shu; Ruangrungsi, Nijsiri; Sukrong, Suchada
2013-07-01
The tuberous roots of Pueraria candollei (White Kwao Khruea), Butea superba (Red Kwao Khruea) and Mucuna collettii (Black Kwao Khruea), which belong to the family Leguminosae, are used as rejuvenating herbs in traditional Thai medicine. Although all of these species have an indication for rejuvenation, each differs in its medicinal properties. Two varieties of P. candollei, var. mirifica and var. candollei, affect females, whereas B. superba and M. collettii exhibit effects on males. However, the identification of these roots according to the name "Kwao Khruea" is confusing due to the similarity in their features. Polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) was utilised to identify plant origin. The partial matK gene was amplified and subjected to restriction enzyme digestion with DdeI and TaqI. The restriction fragments generated differed in number and size. To test the reliability of the method, an admixture of the different Kwao Khruea species containing equal amounts of DNA was tested. The results showed combined restriction patterns, and each species could be detected in the background of the others. The method was also used to authenticate eight different crude drugs sold as various types of Kwao Khruea in Thai markets. The results showed that the misidentification of commercial drugs remains a problem in crude drug markets. The PCR-RFLP analysis developed here provides a simple and accurate discrimination of these rejuvenating "Kwao Khruea" species.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Takei, Hiraku; Morishita, Soji; Araki, Marito; Edahiro, Yoko; Sunami, Yoshitaka; Hironaka, Yumi; Noda, Naohiro; Sekiguchi, Yuji; Tsuneda, Satoshi; Ohsaka, Akimichi; Komatsu, Norio
2014-01-01
A gain-of-function mutation in the myeloproliferative leukemia virus (MPL) gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs). The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system)-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5%) of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.
Directory of Open Access Journals (Sweden)
Hiraku Takei
Full Text Available A gain-of-function mutation in the myeloproliferative leukemia virus (MPL gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs. The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5% of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.
PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.
Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R
2017-10-01
High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.
Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu
2017-10-27
Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Danielli Barreto Maciel
2010-12-01
Full Text Available Studies were performed to analyze the genetic characterization using RFLP-ITS and Intron (primer EI1 markers and the amplification of the cap20 pathogenicity gene by PCR in Colletotrichum gloeosporioides isolates of different hosts plant. The genetic variability was accessed using RFLP-ITS and Intron markers and grouping by UPGMA method. Primers to cap20 gene were constructed using selected sequences of the GenBank (National Center of Biotechnology Information, http://www.ncbi.nlm.nih.gov with the Primer 3 program. The dendrograms analysis showed that the RFLP-ITS marker was more informative to separate the Colletotrichum sp, and that primer EI1 demonstrated greater genetic diversity. The amplification of the DNA of the Colletotrichum isolates to the cap20 gene with primers P1 and P2 indicated that this gene could present variations into C. gloeosporioides related with the host, and also that it was present in other Colletotrichum sp.Estudos foram realizados para analisar a caracterização genética usando marcadores de RFLP-ITS e ISSP e a amplicação do gene de patogenicidade cap20 por PCR em isolados de Colletotrichum gloeosporioides de diferentes hospedeiros. Primers para o gene cap20 foram construídos a partir de seqüências selecionadas do GenBank (National Center of Biotechnology Information, http://www.ncbi.nlm.nih.gov com o programa Primer 3. A análise dos dendrogramas revelou que o marcador RFLP-ITS foi mais informativo em separar as espécies de Colletotrichum, e que o primer EI1 evidenciou maior diversidade genética. A amplificação do DNA dos isolados de Colletotrichum para o gene cap20 com os primers P1 e P2 indicou que este gene pode apresentar variações dentro de C. gloeosporioides relacionada ao hospedeiro, e que também está presente em outras espécies de Colletotrichum.
DEFF Research Database (Denmark)
Mirhendi, Hossein; Bruun, Brita; Schønheyder, Henrik Carl
2010-01-01
. Isolates with RFLP patterns distinct from C. parapsilosis were characterized by sequence analysis of the ITS1-ITS2, 26S rRNA (D1/D2) and SADH regions. Restriction patterns for the 3 species with each of 610 restriction enzymes were predicted in silico using 12 available sequences. By PCR-RFLP of the SADH......, respectively. This was confirmed using the reference strains and 79 clinical isolates. In conclusion, reliable discrimination was obtained by PCR-RFLP profile analysis of the SADH gene after digestion with NlaIII but not with BanI. C. metapsilosis and C. orthopsilosis are involved in a small but significant...
International Nuclear Information System (INIS)
Liew Woan Ying Pauline; Jong Bor Chyan; Khairuddin Abdul Rahim
2006-01-01
The use of PCR-RFLP analysis as a useful microbial identification tool has been evaluated for years. This approach was verified effective worldwide, where differential DNA bands and sequence markers distinctive to specific microbes or microbial groups have been identified. In our study, PCR-RFLP technique has been adopted in the identification of our indigenous N 2 -fixing isolates obtained from several local environments. RFLP was carried out with suitable restriction enzymes and the patterns were documented. Representatives of the different patterns were selected and analysed with the 16S ribosomal DNA sequencing method. The results demonstrated correlation between the differential RFLP patterns and the 16S rDNA identities. (Author)
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
Biochemical Diagnosis of Common Gene Mutations in Galactosemia
Directory of Open Access Journals (Sweden)
Farzaneh Mirzajani
2005-04-01
Full Text Available Objective: Galactosemia is an inborn error of galactose metabolism that is inherited in an autosomal recessive trait. Classical galactosemia is caused by deficient activity of the galactose-1-phosphate uridyltransferase (GALT enzyme that can result in galactosemia complications. Materials & Methods: 135 unrelated families, clinically suspected to galactosemia, were screened by qualitative measurement of galactose-1-phosphate uridyl transferase (GALT activity in blood RBCs by using Beutler method. Results: Deficient enzyme activity (classical galactosemia were confirmed in 16 families. All of these 16 families were submitted to the diagnosis of six common mutations in GALT gene including Q188R, K285N, S135L, L195P, X380R and Q169K by using PCR-RFLP method which resulted in detection of 68% of the mutated alleles. Eight patients were homozygote for Q188R mutation, while one patient homozygote for S135L mutation and one heterozygote for K285N mutation. Conclusion: Biochemnical diagnosis of Galactosemia in Grand infant hospital is very important and necessary.
Directory of Open Access Journals (Sweden)
Ángela Castillo
2001-12-01
Full Text Available Con el objetivo de detemúnar el genotipo del parvovirus canino (CPV circulante en Bogotá, se analizaron 56 muestras tomadas a conveniencia, de materia fecal y sangre de perros menores a un año con gastroenteritis hemorrágica presuntiva de parvovirosis, por reacción en cadena de la polirnerasa - huella genórnica (PCR - RFLP. Se obtuvieron fragmentos amplificados de DNA de 2.2 Kb por PCR de la cepa vacunal de CPV-2 y de cuatro muestras de heces, no se obtuvieron amplificados de las muestras de sangre. Los productos amplificados fueron digeridos por la enzima de restricción Rsa I pemútiendo la identificación de los genotipos CPV-2a y CPV-2b así como su diferenciación con el parvovirus tipo - 2 (CPV-2.
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
PCR-SSCP analysis and its application to human genome study
International Nuclear Information System (INIS)
Hayashi, Kenshi
1994-01-01
A large amount of DNA sequence data are now available owing to the development of the human genome project. These data are deposited in public databases, e.g. DDBJ, GebBank and EMBL, and freely accessible to scientific community. One of the major advantages of having these databases is that we can now detect sequence differences between individuals in a large scale. Using the sequence informations, we can design primer sequences, amplify various target regions of the sample DNA's by PCR and detect abnormal sequence changes from reference, or normal sequences. Detecting sequence changes, or mutations, are essential part of searching genes responsible for hereditary diseases and also DNA diagnosis of hereditary diseases or cancer. We can also measure mutation frequency of the human genome by knowing its variability. Our group has developed and been improving a method, PCR-SSCP analysis, as an extremely rapid and easy technique for detection of sequence differences between sample DNA's. Knowing the sensitivity (percentage detection of mutations) of this technique is important in evaluating usefulness of it for the purposes stated above. Considerable number of experiences on PCR-SSCP analysis of fragments shorter than 300 b.p. are accumulating. We summarize here the sensitivity of PCR-SSCP analysis for various sequence context of this size range examined in various electrophoretic conditions conducted in many laboratories. Data on mutation detection by this technique for longer fragments are limited. We also present oue effort for defining electrophoretic conditions of PCR-SSCP analysis when examining longer (350 to 600 b.p.) fragments. (author)
Directory of Open Access Journals (Sweden)
Bárbara Angulo
Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.
Directory of Open Access Journals (Sweden)
Warenholt Janina
2011-01-01
Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck
Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR
International Nuclear Information System (INIS)
Ben salem, Issam
2007-01-01
Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)
Tymon, Anna M; Shah, Paresh A; Pell, Judith K
2004-04-01
Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.
Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.
Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei
2009-06-26
Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.
George, Santosh; Kaliappan, Saravanakumar Puthupalayam; Kattula, Deepthi; Roy, Sheela; Geldhof, Peter; Kang, Gagandeep; Vercruysse, Jozef; Levecke, Bruno
2015-04-01
It is generally assumed that hookworm infections in humans are caused by Necator americanus and Ancylostoma duodenale. However, previous studies have also reported the presence of the animal hookworm A. ceylanicum in human stools. We determined hookworm infections in children in a tribal community in Tamil Nadu, India, using a semi-nested PCR-RFLP approach. The results indicate that human species account for a majority of the hookworm infections (N. americanus 39/41 [95%]; A. duodenale 6/41 [15%]), whereas the animal hookworm A. ceylanicum only accounts for a minority of the infections (5%; 2/41). The results emphasize the need to consider zoonotic ancylostomiasis while developing strategies to control hookworm infections. © The Author 2015. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Directory of Open Access Journals (Sweden)
Rafael Herrera-Esparza
2013-01-01
Full Text Available Fibrodysplasia ossificans progressiva (FOP is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2. A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP signalling that causes FOP.
Comparison of the yeast microbiota of different varieties of cool-climate grapes by PCR-RAPD
Directory of Open Access Journals (Sweden)
Iwona Drożdż
2015-08-01
Full Text Available The yeast microbiota occurring on different varieties of grapes grown in cool-climate is not completely researched. Therefore, its identification is important to research. On the other hand, yeasts occurring in these fruits can be potentially used as starter cultures to obtain particularly demanded features in the production of wine. In addition, rapid methods for yeast identification allow to eliminate the contamination with pathogenic yeasts, which could cause the loss of wine production. The aim of the study was to isolate and identify the yeasts occurring on the surface of the different varieties of white and red grapes, grown in cool-climate of Poland. Also, the aim was to compare the qualitative and quantitative composition of yeasts on the tested grapes. The 84 cultures of yeasts were isolated, that were initially macroscopic and microscopic analyzed and the purity of cultures was rated on the WL medium. Identification of yeasts by PCR-RAPD was carried using the M13 primer. In the PCR-RFLP method ITS1 and ITS4 primers, as well as restriction enzymes HhaI, HinfI, HaeIII, were used. Preliminary identification of yeasts by standard methods produced results very different from the results obtained by molecular methods. Among the isolated microorganisms yeasts were dominating, but bacteria and molds were also present. Using the PCR-RAPD method most strains of yeasts were identified. Yeast microflora of different varieties of white and red grapes was very similar as the same species of yeasts were identified. Yeasts of the genus Saccharomyces were present in all varieties of grapes. The Rhodotorula mucilaginosa, Saccharomyces cerevisiae, Metschnikowia pulcherrima, Rhodotorula minuta, Pichia kluyveri, Hanseniaspora uvarum and Rhodotorula mucilaginosa were identified by PCR-RAPD. 4 of the 33 tested strains of yeasts were identified by PCR-RFLP. By PCR-RAPD only Hanseniaspora uvarum was identified. The quantity and quality of microorganisms living
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Study of Four Common Mutations of Familial Mediterranean Fever in North-West of Iran
Directory of Open Access Journals (Sweden)
Abbas Karimi
2012-09-01
Full Text Available Background and Objectives : Familial Mediterranean Fever, an autosomal recessive disorder, is the most common and well known periodical fevers syndrome. Disease is mainly prevalent among non-Ashkenazi Jews, Arabs, Turks and Armenia. According to the geographical location of North-West of Iran, neighboring with two high risk FMF population (Turkey and Armenia, the prevalence of FMF in this region of Iran is not unlikely. The aim of this study was to estimate the carriers rate of FMF common mutations in healthy control people. Results can be potentially useful to estimate prevalence of disease. Methods : Randomly 200 samples from healthy people [non-FMF] from North-West of Iran selected. After taking consent, DNA was extracted from blood samples of these groups. Then mutations were evaluated using ARMS-PCR and RFLP-PCR techniques. Results : from 400 studied alleles, 44 and 7 mutant alleles were found for E148Q and V726A respectively. For 2 other mutations, no mutant alleles were found. The total allelic frequency for these four common mutations was 0.132. The carriers rate was 23.4%. Conclusion : This study showed that E148Q has high mutation frequency relative to other mutations in North-West of Iran.
RPE65 gene: multiplex PCR and mutation screening in patients from ...
Indian Academy of Sciences (India)
Unknown
The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the ... PCR and mutation screening in patients from India with retinal degenerative diseases. ..... Bennett J. 2001 Gene therapy restores vision in a canine.
Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo
2013-12-01
Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Directory of Open Access Journals (Sweden)
Zama Messala Luna da Silveira
2011-01-01
Full Text Available 35 unrelated individuals were studied for characterization as either heterozygous or homozygous for beta-thalassemia. Molecular analysis was done by PCR/RFLP to detect the mutations most commonly associated with beta-thalassemia (β0IVS-I-1, β+IVS-I-6, and β039. In the patients who showed none of these mutations, the beta-globin genes were sequenced. Of the 31 heterozygous patients, 13 (41.9% had the β+IVS-I-6 mutation, 15 (48.4% the β0IVS-I-1 mutation, 2 (6.5% the β+IVS-I-110 mutation and 1 (3.2% the β+IVS-I-5 mutation. IVS-I-6 was detected in the four homozygotes. The mutation in codon 39, often found in previous studies in Brazil, was not detected in the present case. This is the first study aiming at identifying mutations that determine beta-thalassemia in the state of Rio Grande do Norte.
Directory of Open Access Journals (Sweden)
Przybylska Arnika
2016-01-01
Full Text Available Thrips from the genus Frankliniella (Thysanoptera, Thripidae are phytophagous on crops and wild plants. Some of them cause slight economic damage, however, others including F. occidentalis and F. intonsa are responsible for considerable losses in crop production. Moreover, they constitute a double threat for host plants by not only feeding on them but also vectoring viruses, some of which are on the quarantined list of the European Plant Protection Organization. The rapid detection and differentiation between more and less harmful Frankliniella species is, therefore, important in order to combat the pests at the time of their appearance. In this study, we have undertaken to develop a method of detecting F. occidentalis, F. intonsa, F. pallida, and F. tenuicornis. The protocol is based on PCR amplification of ITS1 rDNA fragments of these insects using universal primers pair giving products of slightly distinct length for studied insects. Restriction enzymes digestion which is easy to interpret, allows for visible differentiation of all these Frankliniella species. The method was shown to be species-specific and sensitive. Even single specimens in either the larvae or adult stage could be distinguished.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences; Volume 28; Issue 4. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts. Rajani Varghese Vineeta S Chauhan Arvind K Misra. Articles Volume 28 Issue 4 June 2003 pp 437-442 ...
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and
Directory of Open Access Journals (Sweden)
Feng Q
2018-01-01
Full Text Available Qin Feng,1,* Fei Gai,2,* Yaxiong Sang,2 Jie Zhang,3 Ping Wang,1 Yue Wang,1 Bing Liu,2 Dongmei Lin,1 Yang Yu,2 Jian Fang3 1Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Department of Pathology, Peking University Cancer Hospital & Institute, 2Oncology Business Division, Beijing Novogene Bioinformatics Technology Co., Ltd, 3Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Department of Thoracic Oncology II, Peking University Cancer Hospital & Institute, Beijing, China *These authors contributed equally to this work Background: The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC patients with EGFR T790M mutations in circulating tumor DNA (ctDNA could benefit from osimertinib.Purpose: The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR.Patients and methods: A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS.Results: In total, 52.94% (69/119 had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF was 1.09% and three cases presented low concentration (AF <0.1%. Limited by the amount of plasma DNA, 17 samples (AF <2.5% and eight samples (T790M- were selected for verification by ARMS-PCR. Four of those samples were verified by NGS as a third verification method. Among the selected 17 positive cases, ten samples presented mutant allele frequency <0.5%, and seven samples presented intermediate mutant allele frequency (0.5%<AF<2.5%. However, only three samples (3/17 were identified as positive by ARMS-PCR, namely, P6
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-07-08
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of DNA polymerase ζ and SNPs in this gene are associated with altered susceptibility to cancer. This newly designed experiment is composed of three parts, including genomic DNA extraction, gene amplification by PCR, and genotyping by RFLP. By combining these activities, the students are not only able to learn a series of biotechniques in molecular biology, but also acquire the ability to link the learned knowledge with practical applications. This comprehensive experiment will help the medical students improve the conceptual understanding of SNP and the technical understanding of SNP detection. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):299-304, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.
Screening for circulating RAS/RAF mutations by multiplex digital PCR
DEFF Research Database (Denmark)
Andersen, Rikke Fredslund; Jakobsen, Anders
2016-01-01
by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...
Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel
2012-10-01
A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ki Young Yoo
2010-03-01
Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.
2016-10-01
5-45, completed under Dr. Li’s supervision at FHCRC: a. Identification of controls, Months 5-45: General population controls with no prior history ...sequencing and analysis will be validated by SYBR Green based QPCR using Page 11 primers designed using Primer 3 to encompass the fusion junction on a...pools of multiplexed PCR products resequenced on Illumina next-generation sequencing equipment, we will screen any recurrently mutated gene appearing
A high-throughput protocol for mutation scanning of the BRCA1 and BRCA2 genes
International Nuclear Information System (INIS)
Hondow, Heather L; Fox, Stephen B; Mitchell, Gillian; Scott, Rodney J; Beshay, Victoria; Wong, Stephen Q; Dobrovic, Alexander
2011-01-01
Detection of mutations by DNA sequencing can be facilitated by scanning methods to identify amplicons which may have mutations. Current scanning methods used for the detection of germline sequence variants are laborious as they require post-PCR manipulation. High resolution melting (HRM) is a cost-effective rapid screening strategy, which readily detects heterozygous variants by melting curve analysis of PCR products. It is well suited to screening genes such as BRCA1 and BRCA2 as germline pathogenic mutations in these genes are always heterozygous. Assays for the analysis of all coding regions and intron-exon boundaries of BRCA1 and BRCA2 were designed, and optimised. A final set of 94 assays which ran under identical amplification conditions were chosen for BRCA1 (36) and BRCA2 (58). Significant attention was placed on primer design to enable reproducible detection of mutations within the amplicon while minimising unnecessary detection of polymorphisms. Deoxyinosine residues were incorporated into primers that overlay intronic polymorphisms. Multiple 384 well plates were used to facilitate high throughput. 169 BRCA1 and 239 BRCA2 known sequence variants were used to test the amplicons. We also performed an extensive blinded validation of the protocol with 384 separate patient DNAs. All heterozygous variants were detected with the optimised assays. This is the first HRM approach to screen the entire coding region of the BRCA1 and BRCA2 genes using one set of reaction conditions in a multi plate 384 well format using specifically designed primers. The parallel screening of a relatively large number of samples enables better detection of sequence variants. HRM has the advantages of decreasing the necessary sequencing by more than 90%. This markedly reduced cost of sequencing will result in BRCA1 and BRCA2 mutation testing becoming accessible to individuals who currently do not undergo mutation testing because of the significant costs involved
Directory of Open Access Journals (Sweden)
Samaneh ZIBADOOST
2016-04-01
Full Text Available During field surveys in 2013 and 2014, about 14 weed plants showing phytoplasma diseases symptoms including yellowing and witches’broom were collected and tested by polymerase chain reaction (PCR using universal primers for 16SrRNA starting by primer pairs P1/P7 in first round PCR followed by primer pair R16F2n/R16R2 in nested PCR. The detected phytoplasmas were characterized and differentiated through sequence analysis of PCR-amplified rDNA and virtual restriction fragment length polymorphism (RFLP. The phytoplasmas detected in symptomatic horseweed (Erigeron canadensis L., common madder (Rubia tinctorum L., Johnson grass (Sorghum halepense [L.] Pers. and Sophora root (Sophora alopecuroides L. were identified as members of the clover proliferation group (16SrVI group by construction of phylogenetic trees. Further analysis by virtual RFLP classified the phytoplasmas of Erigeron canadensis L. and Sorghum halepense L. in subgroup 16SrVI-A and phytoplasmas of Rubia tinctorum L. and Sophora alpecuriodes L. in subgroup 16SrVI-D. This is the first report on the occurrence of phytoplasma diseases of weeds in west Azarbaijan, Iran.
Kumagai, Takashi; Furushima-Shimogawara, Rieko; Ohmae, Hiroshi; Wang, Tian-Ping; Lu, Shaohong; Chen, Rui; Wen, Liyong; Ohta, Nobuo
2010-09-01
Polymerase chain reaction (PCR) with the specific primer set amplifying 28S ribosomal DNA (rDNA) of Schistosoma japonicum was able to detect genomic DNA of S. japonicum, but not S. mansoni, at 100 fg. This procedure enabled us to detect the DNA from a single miracidium and a snail infected with one miracidium at just 1 day after infection. We compared these results with those from loop-mediated isothermal amplification (LAMP) targeting 28S rDNA and found similar results. The LAMP could amplify the specific DNA from a group of 100 normal snails mixed with one infected snail A PCR screening of infected snails from endemic regions in Anhui Province revealed schistosomal DNA even in snails found negative by microscopy. PCR and LAMP show promise for monitoring the early infection rate in snails, and they may be useful for predicting the risk of infection in the endemic places.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Molecular diagnosis of rhino-orbito-cerebral mucormycosis from fresh tissue samples.
Zaman, Kamran; Rudramurthy, Shivaprakash Mandya; Das, Ashim; Panda, Naresh; Honnavar, Prasanna; Kaur, Harsimran; Chakrabarti, Arunaloke
2017-08-01
We aimed to evaluate a PCR-based technique for the diagnosis of mucormycosis and the identification of fungi from fresh tissue specimens in patients with rhino-orbito-cerebral-mucormycosis (ROCM). Fifty cases of ROCM were included in the study. Conventional identification was performed using microscopy and culture. Molecular diagnosis was performed by amplifying the ribosomal DNA using pan-fungal ITS primers and semi-nested Mucorales-specific primers of the 18S region. The amplified products were sequenced to identify the agents. The utility of PCR-RFLP of the 18S region of rDNA was evaluated to identify the Mucorales. The ROCM cases were diagnosed by the demonstration of aseptate ribbon-like hyphae in biopsy specimens collected from the patients. Isolation was possible in 24 (48 %) samples. The ITS2 PCR confirmed mucormycosis in 27 cases (54 %; CI 59.4-68.2). By comparison, Mucorales-specific PCR was able to amplify DNA and the sequence enabled the identification of Mucorales speciesin all the patients. PCR-RFLP of the 18S region of rDNA could only identify the agent to genus level. The molecular technique was able to identify Mucorales species in 26 (42 %) cases that were negative by culture. Mucorales-specific semi-nested PCR targeting the 18S region is a better technique than ITS2 PCR for diagnosis. PCR-RFLP of the 18S region helps in identification to genus level.
Directory of Open Access Journals (Sweden)
Akeela Fatima
2017-01-01
Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
Directory of Open Access Journals (Sweden)
Roy Deodutta
2004-01-01
Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental
Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Nakanishi, Kenta; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Lai, Poh San; Takeshima, Yasuhiro; Takeuchi, Atsuko; Bouike, Yoshihiro; Okamoto, Maya; Nishio, Hisahide; Shinohara, Masakazu
2017-10-01
Spinal muscular atrophy (SMA) is a common neuromuscular disorder caused by mutations in SMN1. More than 95% of SMA patients carry homozygous SMN1 deletion. SMA is the leading genetic cause of infant death, and has been considered an incurable disease. However, a recent clinical trial with an antisense oligonucleotide drug has shown encouraging clinical efficacy. Thus, early and accurate detection of SMN1 deletion may improve prognosis of many infantile SMA patients. A total of 88 DNA samples (37 SMA patients, 12 carriers and 39 controls) from dried blood spots (DBS) on filter paper were analyzed. All participants had previously been screened for SMN genes by PCR restriction fragment length polymorphism (PCR-RFLP) using DNA extracted from freshly collected blood. DNA was extracted from DBS that had been stored at room temperature (20-25°C) for 1week to 5years. To ensure sufficient quality and quantity of DNA samples, target sequences were pre-amplified by conventional PCR. Real-time modified competitive oligonucleotide priming-PCR (mCOP-PCR) with the pre-amplified PCR products was performed for the gene-specific amplification of SMN1 and SMN2 exon 7. Compared with PCR-RFLP using DNA from freshly collected blood, results from real-time mCOP-PCR using DBS-DNA for detection of SMN1 exon 7 deletion showed a sensitivity of 1.00 (CI [0.87, 1.00])] and specificity of 1.00 (CI [0.90, 1.00]), respectively. We combined DNA extraction from DBS on filter paper, pre-amplification of target DNA, and real-time mCOP-PCR to specifically detect SMN1 and SMN2 genes, thereby establishing a rapid, accurate, and high-throughput system for detecting SMN1-deletion with practical applications for newborn screening. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Mouron, Silvana Andrea; Grillo, Claudia Alejandra; Dulout, Fernando Noel; Golijow, Carlos Daniel
2004-01-01
Cadmium (Cd) is a toxic heavy metal of continuing occupational and environmental concern with a wide variety of adverse effects. Several studies have shown that cadmium produces DNA strand breaks, DNA-protein cross-links, oxidative DNA damage, chromosomal aberrations, dysregulation of gene expression resulting in enhanced proliferation, depressed apoptosis and/or altered DNA repair. This study was undertaken to investigate the ability of cadmium chloride (CdCl 2 ) and cadmium sulphate (CdSO 4 ) to induce point mutations in codon 12 of the K-ras protooncogene assessed by polymerase chain reaction-single strand conformation polymorphisms (PCR-SSCP) and RFLP-enriched PCR methods. Also their genotoxic effects were analyzed by the comet assay and sister chromatid exchanges test. The human lung fibroblast cell line MRC-5 was used for the experiments. Sister chromatid exchanges assay (SCEs) frequencies were significantly increased in cells exposed to cadmium salts in relation to controls (p < 0.001). Despite the slow increment observed in the three comet parameters considered when cells were treated with cadmium chloride, significant differences between groups were only found in the variable comet moment (CM) (p < 0.005). On the other hand, when cells were exposed to cadmium sulphate, the Kruskal-Wallis test showed highly significant differences between groups for migration, tail moment and comet moment parameters (p < 0.001). Nevertheless, a null or weak point mutation induction in K-ras protooncogene was detected using polymerase chain reaction-low ionic strength-single strand conformation polymorphisms (PCR-LIS-SSCP) and RFLP-enriched PCR methods when cells were treated with cadmium salts. Thus, inorganic cadmium produces genotoxicity in human lung fibroblast MRC-5 cells, in the absence of significant point mutation of the K-ras gene
Frequencies of VNTR and RFLP polymorphisms associated with factor VIII gene in Singapore
Energy Technology Data Exchange (ETDEWEB)
Fong, I.; Lai, P.S.; Ouah, T.C. [National Univ. of Singapore (Malaysia)] [and others
1994-09-01
The allelic frequency of any polymorphism within a population determines its usefulness for genetic counselling. This is important in populations of non-Caucasian origin as RFLPs may significantly differ among ethnic groups. We report a study of five intragenic polymorphisms in factor VIII gene carried out in Singapore. The three PCR-based RFLP markers studied were Intron 18/Bcl I, Intron 19/Hind III and Intron 22/Xba I. In an analysis of 148 unrelated normal X chromosomes, the allele frequencies were found to be A1 = 0.18, A2 = 0.82 (Bcl I RFLP), A1 = 0.80, A2 = 0.20 (Hind III RFLP) and A1 = 0.58, and A2 = 0.42 (Xba I RFLP). The heterozygosity rates of 74 females analyzed separately were 31%, 32% and 84.2%, respectively. Linkage disequilibrium was also observed to some degree between Bcl I and Hind III polymorphism in our population. We have also analyzed a sequence polymorphism in Intron 7 using hybridization with radioactive-labelled {sup 32}P allele-specific oligonucleotide probes. This polymorphism was not very polymorphic in our population with only 2% of 117 individuals analyzed being informative. However, the use of a hypervariable dinucleotide repeat sequence (VNTR) in Intron 13 showed that 25 of our of 27 (93%) females were heterozygous. Allele frequencies ranged from 1 to 55 %. We conclude that a viable strategy for molecular analysis of Hemophilia A families in our population should include the use of Intron 18/Bcl I and Intron 22/Xba I RFLP markers and the Intron 13 VNTR marker.
Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo
2007-04-01
Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).
A novel AAT-deletion mutation in the coding sequence of the BCO2 gene in yellow-fat rabbits.
Strychalski, Janusz; Brym, Paweł; Czarnik, Urszula; Gugołek, Andrzej
2015-11-01
The carcasses of yellow-fat rabbits may be attractive to modern consumers, because they have a relatively high content of biologically active compounds. One of the main candidate genes associated with the yellow-fat trait is β-carotene 9',10'-oxygenase (BCO2). This study is the first report of the novel AAT-deletion mutation at codon 248 of the BCO2 gene, which has been found in homozygous yellow-fat rabbits. The deletion mutation, located at the beginning of exon 6, results in the absence of asparagine in protein. We also developed a PCR-RFLP test that supports intravital genotyping of indel polymorphism based on genomic DNA.
DEFF Research Database (Denmark)
Tom-Petersen, Andreas; Leser, Thomas D.; Marsh, Terence L.
2003-01-01
The impact of copper amendment on the bacterial community in agricultural soil was investigated by a 2-year field experiment complemented by short-term microcosm studies. In the field, the amendments led to total copper contents that were close to the safety limits laid down by European authorities....... In parallel, bioavailable copper was determined with a copper-specific bioluminescent Pseudomonas reporter strain. The amounts of total Cu as well as of bioavailable Cu in the field declined throughout the experiment. Bacterial community structure was examined by terminal restriction fragment length...... polymorphism (T-RFLP) analysis of community DNA amplified with primers specific for 16S rDNA from the Bacteria domain, the Rhizobium-Agrobacterium group and the Cytophaga group. Similarity analysis of T-RFLP profiles from field samples demonstrated an impact of copper at the domain level and within...
Directory of Open Access Journals (Sweden)
Chang Chieh-Ting
2008-06-01
Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.
Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco
2016-12-27
In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.
Singh, Om P; Dykes, Cherry L; Lather, Manila; Agrawal, Om P; Adak, Tridibes
2011-03-14
Knockdown resistance (kdr) in insects, resulting from mutation(s) in the voltage-gated sodium channel (vgsc) gene is one of the mechanisms of resistance against DDT and pyrethroid-group of insecticides. The most common mutation(s) associated with knockdown resistance in insects, including anophelines, has been reported to be present at residue Leu1014 in the IIS6 transmembrane segment of the vgsc gene. This study reports the presence of two alternative kdr-like mutations, L1014S and L1014F, at this residue in a major malaria vector Anopheles stephensi and describes new PCR assays for their detection. Part of the vgsc (IIS4-S5 linker-to-IIS6 transmembrane segment) of An. stephensi collected from Alwar (Rajasthan, India) was PCR-amplified from genomic DNA, sequenced and analysed for the presence of deduced amino acid substitution(s). Analysis of DNA sequences revealed the presence of two alternative non-synonymous point mutations at L1014 residue in the IIS6 transmembrane segment of vgsc, i.e., T>C mutation on the second position and A>T mutation on the third position of the codon, leading to Leu (TTA)-to-Ser (TCA) and -Phe (TTT) amino acid substitutions, respectively. Polymerase chain reaction (PCR) assays were developed for identification of each of these two point mutations. Genotyping of An. stephensi mosquitoes from Alwar by PCR assays revealed the presence of both mutations, with a high frequency of L1014S. The PCR assays developed for detection of the kdr mutations were specific as confirmed by DNA sequencing of PCR-genotyped samples. Two alternative kdr-like mutations, L1014S and L1014F, were detected in An. stephensi with a high allelic frequency of L1014S. The occurrence of L1014S is being reported for the first time in An. stephensi. Two specific PCR assays were developed for detection of two kdr-like mutations in An. stephensi.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene.
Hosamani, Madhusudan; Mondal, Bimalendu; Tembhurne, Prabhakar A; Bandyopadhyay, Santanu Kumar; Singh, Raj Kumar; Rasool, Thaha Jamal
2004-08-01
Sheep pox and Goat pox are highly contagious viral diseases of small ruminants. These diseases were earlier thought to be caused by a single species of virus, as they are serologically indistinguishable. P32, one of the major immunogenic genes of Capripoxvirus, was isolated and Sequenced from two Indian isolates of goat poxvirus (GPV) and a vaccine strain of sheep poxvirus (SPV). The sequences were compared with other P32 sequences of capripoxviruses available in the database. Sequence analysis revealed that sheep pox and goat poxviruses share 97.5 and 94.7% homology at nucleotide and amino acid level, respectively. A major difference between them is the presence of an additional aspartic acid at 55th position of P32 of sheep poxvirus that is absent in both goat poxvirus and lumpy skin disease virus. Further, six unique neutral nucleotide substitutions were observed at positions 77, 275, 403, 552, 867 and 964 in the sequence of goat poxvirus, which can be taken as GPV signature residues. Similar unique nucleotide signatures could be identified in SPV and LSDV sequences also. Phylogenetic analysis showed that members of the Capripoxvirus could be delineated into three distinct clusters of GPV, SPV and LSDV based on the P32 genomic sequence. Using this information, a PCR-RFLP method has been developed for unequivocal genomic differentiation of SPV and GPV.
Directory of Open Access Journals (Sweden)
Abeer A. Al-Dakhil
2017-11-01
Full Text Available Studies on the distribution of sand flies are important for the control of leishmaniasis in endemic and neighboring areas. In the present study polymerase chain reaction (PCR–restriction fragment length polymorphism (RFLP was used to identify the distribution of sand flies in Al-Madinah and Asir Regions of Saudi Arabia using PCR–RFLP of 18S ribosomal RNA gene. Based on the morphological characteristics, the sand flies were differentiated into seven species viz., Phlebotomus papatasi, Phlebotomus sergenti, Phlebotomus bergeroti, Sergentomyia clydei, Sergentomyia antennata, Sergentomyia fallax and Sergentomyia schwetzi. PCR–RFLP of 18S ribosomal RNA (rRNA genes with eight different restriction enzymes resulted in species-specific agarose gel electrophoresis banding patterns. Of the eight restriction enzymes used, not a single restriction enzyme by itself could separate species belonging to the same genera (like P. papatasi and P. sergenti by AseI as well as those belonging to different genera (like P. papatasi and S. clydei by AseI. We therefore conclude that the genetic diversity within sand fly species based on PCR–RFLP technique was nonspecific. Studies are in progress to study the viability of alternate techniques like low-stringency single specific primer polymerase chain reaction which can be used for molecular typing.
Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
M Heiat
2010-07-01
Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.
Liu, Dong; Zhu, Guoli; Tang, Wenqiao; Yang, Jinquan; Guo, Hongyi
2012-01-01
Short interspersed nucleotide elements (SINEs), a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR). Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR). The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180-360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNA(Leu)-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.
Directory of Open Access Journals (Sweden)
Dong Liu
2012-02-01
Full Text Available Short interspersed nucleotide elements (SINEs, a type of retrotransposon, are widely distributed in various genomes with multiple copies arranged in different orientations, and cause changes to genes and genomes during evolutionary history. This can provide the basis for determining genome diversity, genetic variation and molecular phylogeny, etc. SINE DNA is transcribed into RNA by polymerase III from an internal promoter, which is composed of two conserved boxes, box A and box B. Here we present an approach to isolate novel SINEs based on these promoter elements. Box A of a SINE is obtained via PCR with only one primer identical to box B (B-PCR. Box B and its downstream sequence are acquired by PCR with one primer corresponding to box A (A-PCR. The SINE clone produced by A-PCR is selected as a template to label a probe with biotin. The full-length SINEs are isolated from the genomic pool through complex capture using the biotinylated probe bound to magnetic particles. Using this approach, a novel SINE family, Cn-SINE, from the genomes of Coilia nasus, was isolated. The members are 180–360 bp long. Sequence homology suggests that Cn-SINEs evolved from a leucine tRNA gene. This is the first report of a tRNALeu-related SINE obtained without the use of a genomic library or inverse PCR. These results provide new insights into the origin of SINEs.
Directory of Open Access Journals (Sweden)
Abhishek De
2015-01-01
Full Text Available Background: Genomic reduction helps obligate intracellular microbes to survive difficult host niches. Adaptation of Mycobacterium leprae in cases of pure neural leprosy (PNL in the intracellular niche of peripheral nerves can be associated with some gene loss. Recently, a stable but variable number of tandem repefzats (TTC have been reported in strains of M. leprae. FolP and rpoB genes are the two common mutation sites which deal with the susceptibility of the bacteria to drugs. Aim: We attempted to find if genomic reduction of M. leprae in context of these TTC repeats or mutations in folP1 and rpoB can be the reason for the restriction of M. leprae in the nerves in PNL. Materials and Methods: DNA extracts taken from fine needle aspiration of affected nerves of 24 PNL cases were studied for tandem repeats with 21TTC primer in multiplex-PCR. Mutations were also studied by PCR Amplification of SRDR (Sulphone Resistance Determining Region of the folP1 and multiple primer PCR amplification refractory mutation system (MARS of the rpoB. Results: Of the 24 PNL, only 1 patient showed mutation in the rpoB gene and none in the folp1 gene. Studying the mutation in TTC region of the M. leprae gene we found that all the cases have a loss of a few bases in the sequence. Conclusion: We can conclude that there is consistent loss in the bases in the TTC region in all cases of pure neural Hansen and we postulate that it may be an adaptive response of the bacteria to survive host niche resulting in its restriction to peripheral nerves.
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
International Nuclear Information System (INIS)
Gresshoff, P.
1998-01-01
To understand chemically-induced genomic differences in soybean mutants differing in their ability to enter the nitrogen-fixing symbiosis involving Bradyrhizobium japonicum, molecular techniques were developed to aid the map-based, or positional, cloning. DNA marker technology involving single arbitrary primers was used to enrich regional RFLP linkage data. Molecular techniques, including two-dimensional pulse field gel electrophoresis, were developed to ascertain the first physical mapping in soybean, leading to the conclusion that in the region of marker pA-36 on linkage group H, 1 cM equals about 500 cM. High molecular weight DNA was isolated and cloned into yeast or bacterial artificial chromosomes (YACs/ BACs). YACs were used to analyze soybean genome structure, revealing that over half of the genome contains repetitive DNA. Genetic and molecular tools are now available to facilitate the isolation of plant genes directly involved in symbiosis. The further characterization of these genes, along with the determination of the mechanisms that lead to the mutation, will be of value to other plants and induced mutation research. (author)
Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li
2010-08-01
Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.
Mutation frequencies of the cytochrome CYP2D6 gene in Parkinson disease patients and in families
Energy Technology Data Exchange (ETDEWEB)
Lucotte, G.; Turpin, J.C. [CHR, Reims (France); Gerard, N. [INSERM, Paris (France)] [and others
1996-07-26
The frequencies of five mutations of the debrisoquine 4-hydroxylase (CYP2D6) gene (mutations D6-A, B, C, D, and T), corresponding to poor metabolizer (PM) phenotypes, were determined by restriction fragment length polymorphism (RFLP) and polymerase chain reaction (PCR) in 47 patients with Parkinson disease, and compared with the findings in 47 healthy controls. These mutant alleles were about twice as frequent among patients as in controls, with an approximate relative risk ratio of 2.12 (95% confidence interval, 1.41-2.62). There seem to be no significant differences in frequencies of mutant genotypes in patients among gender and modalities of response with levodopa therapy; but frequency of the mutations was slightly enhanced after age-at-onset of 60 years. Mutations D6-B, D, and T were detected in 7 patients belonging to 10 Parkinson pedigrees. 25 refs., 1 fig., 2 tabs.
Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C
2007-03-01
Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.
Ozdemir, Ozturk; Kayatas, Mansur; Cetinkaya, Selma; Yildirim, Malik Ejder; Silan, Fatma; Kurtulgan, Hande Kucuk; Koksal, Binnur; Urfali, Mine; Candan, Ferhan
2015-03-01
There is an increased mortality risk in long-term hemodialysis patients of renal failure due to the chronic inflammation. The relationship between the chronic renal failure (CRF) and the role of familial genetic markers remains incompletely understood. In the current study, it was aimed to find out the prevalence of common MEFV gene mutations and BcII polymorphism in serum amyloid A1 (SAA1) gene in chronic renal patients (CRF) who require long-term hemodialysis. Current cohort includes 242 CRF patients and 245 healthy individuals from the same population. Total genomic DNA was isolated from peripheral blood-EDTA samples and genotyping of target MEFV gene was carried out by reverse hybridization Strip Assay and real-time techniques. The SAA1 gene was genotyped by the BclI-RFLP method. Increased mutated MEFV genotypes were found in current CRF patients when compared with the control group from the same ethnicity and the difference was statistically significant (Table 2) (OR: 4.9401, 95% CI: 3.0694-7.9509), pchronic inflammation.
Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB
Directory of Open Access Journals (Sweden)
Lenice Roteia Cardoso Jung
2015-06-01
Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.
Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).
Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini
2015-06-01
Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong
2017-02-01
There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.
1999-01-01
Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566
Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui
2018-01-01
Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Directory of Open Access Journals (Sweden)
Alex Galanis
2015-10-01
Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
2014-01-01
Background Brazil nut is a protein-rich extractivist tree crop in the Amazon region. Fungal contamination of shells and kernel material frequently includes the presence of aflatoxigenic Aspergillus species from the section Flavi. Aflatoxins are polyketide secondary metabolites, which are hepatotoxic carcinogens in mammals. The objectives of this study were to identify Aspergillus species occurring on Brazil nut grown in different states in the Brazilian Amazon region and develop a specific PCR method for collective identification of member species of the genus Aspergillus. Results Polyphasic identification of 137 Aspergillus strains isolated from Brazil nut shell material from cooperatives across the Brazilian Amazon states of Acre, Amapá and Amazonas revealed five species, with Aspergillus section Flavi species A. nomius and A. flavus the most abundant. PCR primers ASP_GEN_MTSSU_F1 and ASP_GEN_MTSSU_R1 were designed for the genus Aspergillus, targeting a portion of the mitochondrial small subunit ribosomal RNA gene. Primer specificity was validated through both electronic PCR against target gene sequences at Genbank and in PCR reactions against DNA from Aspergillus species and other fungal genera common on Brazil nut. Collective differentiation of the observed section Flavi species A. flavus, A. nomius and A. tamarii from other Aspergillus species was possible on the basis of RFLP polymorphism. Conclusions Given the abundance of Aspergillus section Flavi species A. nomius and A. flavus observed on Brazil nut, and associated risk of mycotoxin accumulation, simple identification methods for such mycotoxigenic species are of importance for Hazard Analysis Critical Control Point system implementation. The assay for the genus Aspergillus represents progress towards specific PCR identification and detection of mycotoxigenic species. PMID:24885088
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
DEFF Research Database (Denmark)
Koch, T.; Jacobsen, N.; Fensholdt, J.
2000-01-01
Ligand immobilization on solid surfaces is an essential step in fields such as diagnostics, bio sensor manufacturing, and new material sciences in general. In this paper a photochemical approach based on anthraquinone as the chromophore is presented. Photochemical procedures offer special...... advantages as they are able to generate highly reactive species in an orientation specific manner. As presented here, anthraquinone (AQ) mediated covalent DNA immobilization appears to be superior to currently known procedures. A synthetic procedure providing AQ-phosphoramidites is presented. These reagents...... facilitate AQ conjugation during routine DNA synthesis, thus enabling the AQ-oligonucleotides to be immobilized in a very convenient and efficient manner. AQ-conjugated PCR primers can be used directly in PCR. When the PCR is performed in solution, the amplicons can be immobilized after the PCR. Moreover...
Directory of Open Access Journals (Sweden)
Jeffrey A Johnson
Full Text Available BACKGROUND: The success of antiretroviral therapy is known to be compromised by drug-resistant HIV-1 at frequencies detectable by conventional bulk sequencing. Currently, there is a need to assess the clinical consequences of low-frequency drug resistant variants occurring below the detection limit of conventional genotyping. Sensitive detection of drug-resistant subpopulations, however, requires simple and practical methods for routine testing. METHODOLOGY: We developed highly-sensitive and simple real-time PCR assays for nine key drug resistance mutations and show that these tests overcome substantial sequence heterogeneity in HIV-1 clinical specimens. We specifically used early wildtype virus samples from the pre-antiretroviral drug era to measure background reactivity and were able to define highly-specific screening cut-offs that are up to 67-fold more sensitive than conventional genotyping. We also demonstrate that sequencing the mutation-specific PCR products provided a direct and novel strategy to further detect and link associated resistance mutations, allowing easy identification of multi-drug-resistant variants. Resistance mutation associations revealed in mutation-specific amplicon sequences were verified by clonal sequencing. SIGNIFICANCE: Combined, sensitive real-time PCR testing and mutation-specific amplicon sequencing provides a powerful and simple approach that allows for improved detection and evaluation of HIV-1 drug resistance mutations.
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
BELDÜZ, Ali Osman; DEMİRBAĞ, Zihni; DÜLGER, Sabriye
2014-01-01
Polymerase chain reaction (PCR) was employed to detect the presence of cyclic AMP receptor protein (CPR) in a number of diverse organisms. In PCR, two primers specific to the crp gene of Escherichia coli were used. Staphylococcus aureus, Staphylococcus epidermidis, Lactobacillus delbrueckii and Corynebacterium veraSuş all showed the same size of PCR frağments (708 bp) and same restriction frağment length polymorphizm (RFLP).
JAK2V617F mutation is associated with special alleles in essential thrombocythemia.
Hsiao, Hui-Hua; Liu, Yi-Chang; Tsai, Hui-Jen; Lee, Ching-Ping; Hsu, Jui-Feng; Lin, Sheng-Fung
2011-03-01
Janus kinase 2 mutation (JAK2V617F) has been identified in myeloproliferative neoplasms. Furthermore, special single nucleoside polymorphisms (SNPs) have been found to be associated with the JAK2V617F mutation. Therefore, the associations among JAK2V617F and special SNPs and the allelic location between them were investigated in patients with essential thrombocythemia (ET). A total of 61 patients with ET and 106 healthy individuals were enrolled. The PCR-RFLP method was applied to investigate the pattern of three SNPs, rs10974944, rs12343867, and rs12340895. Allele-specific PCR was used to examine the allelic location between rs10974944 and JAK2V617F. Among the patients with ET, 34 (55.7%, 34/61) were JAK2V617F positive (heterozygous) while the other 27 (44.3%, 27/61) were negative, and there were no MPLW515L/K mutations noted. The pattern of special SNPs in JAK2V617F(+) was significantly different from that in normal individuals (p <0.05), while there was no difference between JAK2V617F(-) patients and normal individuals. Allele-specific PCR showed high association of a cis-location between the special G-allele of rs10974944 and JAK2V617F(+). Based on this small numbered study, the results show the association between special SNPs and JAK2V617F mutation and a cis-location between the special G-allelic form of rs10974944 and the JAK2V617F mutation. These data highlight a close relationship between them in patients with ET.
Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline
2018-01-01
In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Kopecká, J; Němec, M; Matoulková, D
2016-06-01
Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The
Detection of MPL mutations by a novel allele-specific PCR-based strategy.
Furtado, Larissa V; Weigelin, Helmut C; Elenitoba-Johnson, Kojo S J; Betz, Bryan L
2013-11-01
MPL mutation testing is recommended in patients with suspected primary myelofibrosis or essential thrombocythemia who lack the JAK2 V617F mutation. MPL mutations can occur at allelic levels below 15%, which may escape detection by commonly used mutation screening methods such as Sanger sequencing. We developed a novel multiplexed allele-specific PCR assay capable of detecting most recurrent MPL exon 10 mutations associated with primary myelofibrosis and essential thrombocythemia (W515L, W515K, W515A, and S505N) down to a sensitivity of 2.5% mutant allele. Test results were reviewed from 15 reference cases and 1380 consecutive specimens referred to our laboratory for testing. Assay performance was compared to Sanger sequencing across a series of 58 specimens with MPL mutations. Positive cases consisted of 45 with W515L, 6 with S505N, 5 with W515K, 1 with W515A, and 1 with both W515L and S505N. Seven cases had mutations below 5% that were undetected by Sanger sequencing. Ten additional cases had mutation levels between 5% and 15% that were not consistently detected by sequencing. All results were easily interpreted in the allele-specific test. This assay offers a sensitive and reliable solution for MPL mutation testing. Sanger sequencing appears insufficiently sensitive for robust MPL mutation detection. Our data also suggest the relative frequency of S505N mutations may be underestimated, highlighting the necessity for inclusion of this mutation in MPL test platforms. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Aquino, Ruth; Protzel, Ana; Rivera, Juan; Abarca, Hugo; Dueñas, Milagros; Nestarez, Cecilia; Purizaga, Nestor; Diringer, Benoit
2017-01-01
To determine the frequency of the ten most common mutations of the CFTR gene reported in Latin Americausing amplification-refractory mutation system-polymerase chain reaction (ARMS-PCR) in patients with cystic fibrosis (CF) in two referral hospitals in Peru during the year 2014. The frequency of the ten most common mutations of the CFTR gene was assessed in patients of the Hospital Nacional Edgardo Rebagliati Martins and the Instituto Nacional de Salud del Niño, both located in Lima, Peru. Blood samples were collected from 36 patients with CF, and the ARMS-PCR technique was used to determine the presence of these mutations. The study group included 73.5% of patients with a known diagnosis of CF in the country when the study was carried out. ARMS-PCR allowed three of the mutations to be identified in a combined 30.6% of the alleles from patients with CF, and 64.9% of the mutated alleles were not identified. The mutations found were p.Phe508del (22,2%), p.Gly542* (6,9%), and p.Arg1162* (1,4%). There is significant variability in both the frequency and type of mutations present in our study population and in what has been reported in other Latin American countries. It is necessary to perform studies that use complete sequencing technology for the CFTR gene to identify other mutations present in our population.
Directory of Open Access Journals (Sweden)
Lucia Micale
2009-01-01
Full Text Available There are many well-studied examples of human phenotypes resulting from nonsense or frameshift mutations that are modulated by Nonsense-Mediated mRNA Decay (NMD, a process that typically degrades transcripts containing premature termination codons (PTCs in order to prevent translation of unnecessary or aberrant transcripts. Different types of germline mutations in the VHL gene cause the von Hippel-Lindau disease, a dominantly inherited familial cancer syndrome with a marked phenotypic variability and age-dependent penetrance. By generating the Drosophila UAS:Upf1D45B line we showed the possible involvement of NMD mechanism in the modulation of the c.172delG frameshift mutation located in the exon 1 of Vhl gene. Further, by Quantitative Real-time PCR (QPCR we demonstrated that the corresponding c.163delG human mutation is targeted by NMD in human HEK 293 cells. The UAS:Upf1D45B line represents a useful system to identify novel substrates of NMD pathway in Drosophila melanogaster. Finally, we suggest the possible role of NMD on the regulation of VHL mutations.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)
1995-08-01
The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R
1999-12-01
A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.
de Almeida, Jonatas Campos; de Melo, Renata Pimentel Bandeira; de Morais Pedrosa, Camila; da Silva Santos, Marcelo; de Barros, Luiz Daniel; Garcia, João Luis; Porto, Wagnner José Nascimento; Mota, Rinaldo Aparecido
2017-05-01
Wild animals may play an important role in the transmission and maintenance of Toxoplasma gondii in the environment. The purpose of the present study was to isolate and genotype T. gondii from a free-ranging crab-eating fox (Cerdocyon thous-Linnaeus, 1766). A crab-eating fox in critical health condition was attended in a veterinary hospital in Recife, Pernambuco State, Brazil. The animal died despite emergency treatment. The brain was collected aseptically and destined for mouse bioassay. One isolate of T. gondii was obtained, and Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) was used to assess genetic variability at 11 markers (SAG1, SAG2, altSAG2, SAG3, BTUB, GRA6, c228, c292, L358, PK1 and APICO). A murine model was used to assess the virulence of the isolate. Using the PCR-RFLP, genotype ToxoDB #13 was identified, which is considered an atypical strain. The isolate was classified as avirulent in the murine model. This is the first study to report T. gondii infection in the crab-eating fox. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Long-range PCR facilitates the identification of PMS2-specific mutations.
Clendenning, Mark; Hampel, Heather; LaJeunesse, Jennifer; Lindblom, Annika; Lockman, Jan; Nilbert, Mef; Senter, Leigha; Sotamaa, Kaisa; de la Chapelle, Albert
2006-05-01
Mutations within the DNA mismatch repair gene, "postmeiotic segregation increased 2" (PMS2), have been associated with a predisposition to hereditary nonpolyposis colorectal cancer (HNPCC; Lynch syndrome). The presence of a large family of highly homologous PMS2 pseudogenes has made previous attempts to sequence PMS2 very difficult. Here, we describe a novel method that utilizes long-range PCR as a way to preferentially amplify PMS2 and not the pseudogenes. A second, exon-specific, amplification from diluted long-range products enables us to obtain a clean sequence that shows no evidence of pseudogene contamination. This method has been used to screen a cohort of patients whose tumors were negative for the PMS2 protein by immunohistochemistry and had not shown any mutations within the MLH1 gene. Sequencing of the PMS2 gene from 30 colorectal and 11 endometrial cancer patients identified 10 novel sequence changes as well as 17 sequence changes that had previously been identified. In total, putative pathologic mutations were detected in 11 of the 41 families. Among these were five novel mutations, c.705+1G>T, c.736_741del6ins11, c.862_863del, c.1688G>T, and c.2007-1G>A. We conclude that PMS2 mutation detection in selected Lynch syndrome and Lynch syndrome-like patients is both feasible and desirable. Published 2006 Wiley-Liss, Inc.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Directory of Open Access Journals (Sweden)
Yongbin Zeng
Full Text Available BACKGROUND: Long-term use of nucleos(tide analogues can increase risk of HBV drug-resistance mutations. The rtM204I (ATT coding for isoleucine is one of the most important resistance mutation sites. Establishing a simple, rapid, reliable and highly sensitive assay to detect the resistant mutants as early as possible is of great clinical significance. METHODS: Recombinant plasmids for HBV YMDD (tyrosine-methionine-aspartate-aspartate and YIDD (tyrosine-isoleucine-aspartate-aspartate were constructed by TA cloning. Real time allele specific locked nucleic acid quantitative PCR (RT-AS-LNA-qPCR with SYBR Green I was established by LNA-modified primers and evaluated with standard recombinant plasmids, clinical templates (the clinical wild type and mutant HBV DNA mixture and 102 serum samples from nucleos(tide analogues-experienced patients. The serum samples from a chronic hepatitis B (CHB patient firstly received LMV mono therapy and then switched to LMV + ADV combined therapy were also dynamically analyzed for 10 times. RESULTS: The linear range of the assay was between 1×10(9 copies/μl and 1 × 10(2 copies/μl. The low detection limit was 1 × 10(1 copies/μl. Sensitivity of the assay were 10(-6, 10(-4 and 10(-2 in the wild-type background of 1 × 10(9 copies/μl, 1 × 10(7 copies/μl and 1 × 10(5 copies/μl, respectively. The sensitivity of the assay in detection of clinical samples was 0.03%. The complete coincidence rate between RT-AS-LNA-qPCR and direct sequencing was 91.2% (93/102, partial coincidence rate was 8.8% (9/102, and no complete discordance was observed. The two assays showed a high concordance (Kappa = 0.676, P = 0.000. Minor variants can be detected 18 weeks earlier than the rebound of HBV DNA load and alanine aminotransferase level. CONCLUSIONS: A rapid, cost-effective, high sensitive, specific and reliable method of RT-AS-LNA-qPCR with SYBR Green I for early and absolute quantification of HBV YIDD (ATT coding for isoleucine
International Nuclear Information System (INIS)
I Ishak
2016-01-01
The BADH2 gene acts as suppressor of 2-acetyl-1-pyrolline (2AP) biosynthesis in plants. 2AP is the volatile compound which provides fragrance in rice. Biosynthesis of 2AP occurs when BADH2 loses its function as suppressor gene. Aromatic rice cultivars naturally incur mutation of BADH2 gene at 8 bp. In this experiment, aromatic mutant rice lines derived from irradiation of Sintanur cultivar by gamma rays with dose of 100 Gy were studied in molecular level. These mutant lines were characterized at the M10 plantgeneration under the assumption that genetically these aromatic mutant rice lines were homozygotic. Several primers related to aroma in rice have been used for polymerase chain reaction (PCR) in a thermal cycler instrument. Gel electrophoreses were carried out using 1.5% agarose in TAE buffer. DNA fragments at 254 bp and 355 bp (base pair) were taken and amplified by primer for nucleotide sequencing of these fragments. Molecular identification and characterization after electrophoresis showed that the mutant line from AR1020 can be differentiated from AR.1080 at 254 bp. Nucleotide sequence data from of these DNA fragments showed that point mutations (deletions and substitutions) occurred at the BADH2 gene in exon 7; those are called second mutation and were caused by gamma rays effects. The Sintanur variety was used as check cultivar and its DNA sequence was compared to that of the AR.1020 mutant line. The results from both DNA sequences (from cv. Sintanur and AR.1020) derived from fragments at 254 bp show that point mutations occurred within exon 7 and earlier stop codon occurred in the AR.1020 mutant rice line. Further, the use of EA primer in PCR resulted in detection of deletion and substitution of nucleotides in the AR.1020 mutant line. (author)
Tsubahara, Mayuko; Hayashi, Yoshitaka; Niijima, Shin-ichi; Yamamoto, Michiyo; Kamijo, Takashi; Murata, Yoshiharu; Haruna, Hidenori; Okumura, Akihisa; Shimizu, Toshiaki
2012-03-01
Mutations in the GH1 gene have been identified in patients with isolated growth hormone deficiency (IGHD). Mutations causing aberrant splicing of exon 3 of GH1 that have been identified in IGHD are inherited in an autosomal dominant manner, whereas other mutations in GH1 that have been identified in IGHD are inherited in an autosomal recessive manner. Two siblings born from nonconsanguineous healthy parents exhibited IGHD. To elucidate the cause, GH1 in all family members was analysed. Two novel mutations in GH1, a point mutation in intron 3 and a 16-bp deletion in exon 3, were identified by sequence analyses. The intronic mutation was present in both siblings and was predicted to cause aberrant splicing. The deletion was present in one of the siblings as well as the mother with normal stature and was predicted to cause rapid degradation of mRNA through nonsense-mediated mRNA decay. The point mutation was not identified in the parents' peripheral blood DNA; however, it was detected in the DNA extracted from the father's sperms. As a trace of the mutant allele was detected in the peripheral blood of the father using PCR-RFLP, the mutation is likely to have occurred de novo at an early developmental stage before differentiation of somatic cells and germline cells. This is the first report of mosaicism for a mutation in GH1 in a family with IGHD. It is clear that the intronic mutation plays a dominant role in the pathogenesis of IGHD in this family, as one of the siblings who had only the point mutation was affected. On the other hand, the other sibling was a compound heterozygote for the point mutation and the 16-bp deletion and it may be arguable whether IGHD in this patient should be regarded as autosomal dominant or recessive. © 2012 Blackwell Publishing Ltd.
Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes.
Vaughn, Cecily P; Robles, Jorge; Swensen, Jeffrey J; Miller, Christine E; Lyon, Elaine; Mao, Rong; Bayrak-Toydemir, Pinar; Samowitz, Wade S
2010-05-01
Germline mutation detection in PMS2, one of four mismatch repair genes associated with Lynch syndrome, is greatly complicated by the presence of numerous pseudogenes. We used a modification of a long-range PCR method to evaluate PMS2 in 145 clinical samples. This modification avoids potential interference from the pseudogene PMS2CL by utilizing a long-range product spanning exons 11-15, with the forward primer anchored in exon 10, an exon not shared by PMS2CL. Large deletions were identified by MLPA. Pathogenic PMS2 mutations were identified in 22 of 59 patients whose tumors showed isolated loss of PMS2 by immunohistochemistry (IHC), the IHC profile most commonly associated with a germline PMS2 mutation. Three additional patients with pathogenic mutations were identified from 53 samples without IHC data. Thirty-seven percent of the identified mutations were large deletions encompassing one or more exons. In 27 patients whose tumors showed absence of either another protein or combination of proteins, no pathogenic mutations were identified. We conclude that modified long-range PCR can be used to preferentially amplify the PMS2 gene and avoid pseudogene interference, thus providing a clinically useful germline analysis of PMS2. Our data also support the use of IHC screening to direct germline testing of PMS2. (c) 2010 Wiley-Liss, Inc.
Detection of Bacillus spores using PCR and FTA filters.
Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A
2004-05-01
Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.
Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.
2017-11-01
Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
PCR approach for rapid detection of Escherichia coli in tempe using a specific primer
Directory of Open Access Journals (Sweden)
Siti Harnina Bintari
2014-12-01
Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.
Konstantinova, P.S.; Yli-Mattila, T.
2004-01-01
The intergenic spacer (IGS) regions of the rDNA of several Fusarium spp. strains obtained from the collaborative researchers (Int. J. Food Microbiol. (2003)) were amplified by polymerase chain reaction (PCR), and an IGS¿RFLP analysis was performed. Restriction digestion with AluI, MspI and PstI
Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping
2015-11-01
Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.
Kazemi Nezhad, Seyed Reza; Fahmi, Fatemeh; Khatami, Saeid Reza; Musaviun, Mohsen
2011-01-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is one of the most common hereditary enzymatic disorders in human, increases the vulnerability of erythrocytes to oxidative stress. It is also characterized by remarkable molecular and biochemical heterogeneity. According to previous investigations, G6PD Cosenza (G1376C) is a common G6PD mutation in some parts of . Therefore in the present study we have characterized mutation among G6PD deficient individuals in Khuzestan province. In order to identify G6PD Cosenza, we analyzed the G6PD gene in 64 samples out of 231 deficient individuals who had not G6PD Mediterranean mutation, using PCR- restriction fragment length polymorphism (RFLP) method. G6PD Cosenza mutation was found in 6 males of 231 samples, resulting in the relative rate of 2.6% and allele frequency of 0.023 among Khuzestanian G6PD deficient subjects. A comparison of these results with previous findings in some parts of suggests that G6PD Cosenza is a common mutation in Khuzestanian G6PD deficient individuals. PMID:23365477
Directory of Open Access Journals (Sweden)
Nathalie Pallares-Ruiz
2010-11-01
Full Text Available The recent identification of genes implicated in hereditary recurrent fevers has allowed their specific diagnosis. So far however, only punctual mutations have been identified and a significant number of patients remain with no genetic confirmation of their disease after routine molecular approaches such as sequencing. The possible involvement of sequence rearrangements in these patients has only been examined in familial Mediterranean fever and was found to be unlikely. To assess the existence of larger genetic alterations in 3 other concerned genes, MVK (Mevalonate kinase, NLRP3 (Nod like receptor family, pyrin domain containing 3 and TNFRSF1A (TNF receptor superfamily 1A, we adapted the qPCR-HRM method to study possible intragenic deletions and duplications. This single-tube approach, combining both qualitative (mutations and quantitative (rearrangement screening, has proven effective in Lynch syndrome diagnosis. Using this approach, we studied 113 unselected (prospective group and 88 selected (retrospective group patients and identified no intragenic rearrangements in the 3 genes. Only qualitative alterations were found with a sensitivity similar to that obtained using classical molecular techniques for screening punctual mutations. Our results support that deleterious copy number alterations in MVK, NLRP3 and TNFRSF1A are rare or absent from the mutational spectrum of hereditary recurrent fevers, and demonstrate that a routine combined method such as qPCR-HRM provides no further help in genetic diagnosis. However, quantitative approaches such as qPCR or SQF-PCR did prove to be quick and effective and could still be useful after non contributory punctual mutation screening in the presence of clinically evocative signs.
The occurrence and frequency of genomic mutations that mediate ...
African Journals Online (AJOL)
The occurrence and frequency of genomic mutations that mediate Isoniazid and Rifampicin resistance in Mycobacterium tuberculosis isolates from untreated pulmonary Tuberculosis cases in urban Blantyre, Malawi.
Ajmal, Muhammad; Mir, Asif; Shoaib, Muhammad; Malik, Salman Akbar; Nasir, Muhammad
2017-07-05
The dimerization efficiency of FGFR3 transmembrane domain plays a critical role in the formation of a normal skeleton through the negative regulation of bone development. Recently, gain-of-function mutations in the transmembrane domain of FGFR3 has been described associated with an aberrant negative regulation, leading to the development of achondroplasia-group disorders, including achondroplasia (ACH), hypochondroplasia (HCH) and thanatophoric dysplasia (TD). Here, we describe a non-consanguineous Pakistani family with achondroplasia to explain hereditary basis of the disease. PCR-based linkage analysis using microsatellite markers was employed to localize the disease gene. Gene specific intronic primers were used to amplify the genomic DNA from all affected as well as phenotypically healthy individuals. Amplified PCR products were then subjected to Sanger sequencing and RFLP analysis to identify a potentially pathogenic mutation. The impact of identified mutation on FGFR3 protein's structure and stability was highlighted through different bioinformatics tools. Genetic screening of the family revealed a previously reported heterozygous c.1138 G > A (p.G380R) mutation in the coding exon 8 of FGFR3 gene. Identified genetic variation was confirmed in all affected individuals while healthy individuals and controls were found genotypically normal. The results were further validated by RFLP analysis as c.1138 G > A substitution generates a unique recognition site for SfcI endonuclease. Following SfcI digestion, the electrophoretic pattern of three bands/DNA fragments for each patient is indicative of heterozygous status of the disease allele. In silico studies of the mutant FGFR3 protein predicted to adversely affect the stability of FGFR3 protein. Mutation in the transmembrane domain may adversely affect the dimerization efficiency and overall stability of the FGFR3, leading to a constitutively active protein. As a result, an uncontrolled intracellular signaling
Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing
2013-02-01
The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.
Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira
2013-05-27
Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.
Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P
2012-06-01
Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR
Directory of Open Access Journals (Sweden)
Neng Chen
2014-07-01
Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.
International Nuclear Information System (INIS)
Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander
2013-01-01
The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a
Directory of Open Access Journals (Sweden)
Bahador Hajimohammadi
2014-11-01
Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Directory of Open Access Journals (Sweden)
Paula Rogério Fernandes
2008-09-01
Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the
Mutation Detection with Next-Generation Resequencing through a Mediator Genome
Energy Technology Data Exchange (ETDEWEB)
Wurtzel, Omri; Dori-Bachash, Mally; Pietrokovski, Shmuel; Jurkevitch, Edouard; Sorek, Rotem; Ben-Jacob, Eshel
2010-12-31
The affordability of next generation sequencing (NGS) is transforming the field of mutation analysis in bacteria. The genetic basis for phenotype alteration can be identified directly by sequencing the entire genome of the mutant and comparing it to the wild-type (WT) genome, thus identifying acquired mutations. A major limitation for this approach is the need for an a-priori sequenced reference genome for the WT organism, as the short reads of most current NGS approaches usually prohibit de-novo genome assembly. To overcome this limitation we propose a general framework that utilizes the genome of relative organisms as mediators for comparing WT and mutant bacteria. Under this framework, both mutant and WT genomes are sequenced with NGS, and the short sequencing reads are mapped to the mediator genome. Variations between the mutant and the mediator that recur in the WT are ignored, thus pinpointing the differences between the mutant and the WT. To validate this approach we sequenced the genome of Bdellovibrio bacteriovorus 109J, an obligatory bacterial predator, and its prey-independent mutant, and compared both to the mediator species Bdellovibrio bacteriovorus HD100. Although the mutant and the mediator sequences differed in more than 28,000 nucleotide positions, our approach enabled pinpointing the single causative mutation. Experimental validation in 53 additional mutants further established the implicated gene. Our approach extends the applicability of NGS-based mutant analyses beyond the domain of available reference genomes.
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Leng, Yinglin; Liu, Yuhe; Fang, Xiaojing; Li, Yao; Yu, Lei; Yuan, Yun; Wang, Zhaoxia
2015-04-01
Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes/Leigh (MELAS/LS) overlap syndrome is a mitochondrial disorder subtype with clinical and magnetic resonance imaging (MRI) features that are characteristic of both MELAS and Leigh syndrome (LS). Here, we report an MELAS/LS case presenting with cortical deafness and seizures. Cranial MRI revealed multiple lesions involving bilateral temporal lobes, the basal ganglia and the brainstem, which conformed to neuroimaging features of both MELAS and LS. Whole mitochondrial DNA (mtDNA) sequencing and PCR-RFLP revealed a de novo heteroplasmic m.10197 G > A mutation in the NADH dehydrogenase subunit 3 gene (ND3), which was predicted to cause an alanine to threonine substitution at amino acid 47. Although the mtDNA m.10197 G > A mutation has been reported in association with LS, Leber hereditary optic neuropathy and dystonia, it has never been linked with MELAS/LS overlap syndrome. Our patient therefore expands the phenotypic spectrum of the mtDNA m.10197 G > A mutation.
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...
Directory of Open Access Journals (Sweden)
Anna Lyberopoulou
Full Text Available Circulating tumor cells (CTCs provide a non-invasive accessible source of tumor material from patients with cancer. The cellular heterogeneity within CTC populations is of great clinical importance regarding the increasing number of adjuvant treatment options for patients with metastatic carcinomas, in order to eliminate residual disease. Moreover, the molecular profiling of these rare cells might lead to insight on disease progression and therapeutic strategies than simple CTCs counting. In the present study we investigated the feasibility to detect KRAS, BRAF, CD133 and Plastin3 (PLS3 mutations in an enriched CTCs cell suspension from patients with colorectal cancer, with the hypothesis that these genes` mutations are of great importance regarding the generation of CTCs subpopulations. Subsequently, we compared CTCs mutational status with that of the corresponding primary tumor, in order to access the possibility of tumor cells characterization without biopsy. CTCs were detected and isolated from blood drawn from 52 colorectal cancer (CRC patients using a quantum-dot-labelled magnetic immunoassay method. Mutations were detected by PCR-RFLP or allele-specific PCR and confirmed by direct sequencing. In 52 patients, discordance between primary tumor and CTCs was 5.77% for KRAS, 3.85% for BRAF, 11.54% for CD133 rs3130, 7.69% for CD133 rs2286455 and 11.54% for PLS3 rs6643869 mutations. Our results support that DNA mutational analysis of CTCs may enable non-invasive, specific biomarker diagnostics and expand the scope of personalized medicine for cancer patients.
Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.
Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua
2016-10-11
The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.
Kim, Sung-Su; Choi, Hyun-Jeung; Kim, Jin Ju; Kim, M Sun; Lee, In-Seon; Byun, Bohyun; Jia, Lina; Oh, Myung Ryurl; Moon, Youngho; Park, Sarah; Choi, Joon-Seok; Chae, Seoung Wan; Nam, Byung-Ho; Kim, Jin-Soo; Kim, Jihun; Min, Byung Soh; Lee, Jae Seok; Won, Jae-Kyung; Cho, Soo Youn; Choi, Yoon-La; Shin, Young Kee
2018-01-11
In clinical translational research and molecular in vitro diagnostics, a major challenge in the detection of genetic mutations is overcoming artefactual results caused by the low-quality of formalin-fixed paraffin-embedded tissue (FFPET)-derived DNA (FFPET-DNA). Here, we propose the use of an 'internal quality control (iQC) index' as a criterion for judging the minimum quality of DNA for PCR-based analyses. In a pre-clinical study comparing the results from droplet digital PCR-based EGFR mutation test (ddEGFR test) and qPCR-based EGFR mutation test (cobas EGFR test), iQC index ≥ 0.5 (iQC copies ≥ 500, using 3.3 ng of FFPET-DNA [1,000 genome equivalents]) was established, indicating that more than half of the input DNA was amplifiable. Using this criterion, we conducted a retrospective comparative clinical study of the ddEGFR and cobas EGFR tests for the detection of EGFR mutations in non-small cell lung cancer (NSCLC) FFPET-DNA samples. Compared with the cobas EGFR test, the ddEGFR test exhibited superior analytical performance and equivalent or higher clinical performance. Furthermore, iQC index is a reliable indicator of the quality of FFPET-DNA and could be used to prevent incorrect diagnoses arising from low-quality samples.
Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.
Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z
2016-10-31
To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient
Energy Technology Data Exchange (ETDEWEB)
Choy, F.Y.M.; Humphries, M.L. [Univ. of Victoria, British Columbia (Canada); Ferreira, P. [Univ. of Alberta, Edmonton (Canada)
1997-01-20
Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed while the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.
International Nuclear Information System (INIS)
Lina, M.; Dadang, S.; Suhadi, F.
2002-01-01
Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer
DEFF Research Database (Denmark)
Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl
2002-01-01
sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....
Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S
2002-04-01
The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.
Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy
2007-01-01
PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele
2009-11-01
A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.
The p. N103K mutation of leptin (LEP gene and severe early onset obesity in Pakistan
Directory of Open Access Journals (Sweden)
Shabana
Full Text Available BACKGROUND: Obesity is a complex disorder and has been increasing globally at alarming rates including Pakistan. However, there is scarce research on understanding obesity genetics in Pakistan. Leptin is a hormone secreted by adipocytes in response to satiety and correlates with body weight. Any mutations in the LEP gene have an adverse effect on energy regulation pathway and lead to severe, early onset obesity. To date, only eight mutations have been described in the LEP gene of which p. N103K is one. METHODS: We aimed to analyze the prevalence of this mutation in Pakistani subjects. A total of 475 subjects were genotyped by PCR-RFLP analysis and their serum profiling was done. RESULTS: Results showed that this mutation was present only in one male child with early onset obesity (10 year. He had very low serum leptin levels suggestive of functional impact of the mutation. The prevalence of such mutations is, however, low due to the drastic effects on the energy regulation. CONCLUSION: In conclusion, LEP gene mutations contribute significantly to the monogenic forms of obesity and are important due to the availability of treatment options. Such mutations may exert their effect by directly affecting energy regulation pathway and are more prominent in the early stages of life only.
International Nuclear Information System (INIS)
Ruijter, Jan M.; Hoff, Maurice J. B. van den; Lorenz, Peter; Tuomi, Jari M.; Hecker, Michael
2014-01-01
The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)
Tai, Chang-Long; Liu, Mei-Ying; Yu, Hsiao-Chi; Chiang, Chiang-Chuan; Chiang, Hung; Suen, Jeng-Hung; Kao, Shu-Min; Huang, Yu-Hsiu; Wu, Tina Jui-Ting; Yang, Chia-Feng; Tsai, Fang-Chih; Lin, Ching-Yuang; Chang, Jan-Gowth; Chen, Hong-Duo; Niu, Dau-Ming
2012-02-18
As an X-linked genetic disorder, Fabry disease was first thought to affect males only, and females were generally considered to be asymptomatic carriers. However, recent research suggests that female carriers of Fabry disease may still develop vital organ damage causing severe morbidity and mortality. In the previous newborn screening, from 299,007 newborns, we identified a total of 20 different Fabry mutations and 121 newborns with Fabry mutations. However, we found that most female carriers are not detected by enzyme assays. A streamlined method for high resolution melting (HRM) analysis was designed to screen for GLA gene mutations using a same PCR and melting program. Primer sets were designed to cover the 7 exons and the Chinese common intronic mutation, IVS4+919G>A of GLA gene. The HRM analysis was successful in identifying heterozygous and hemizygous patients with the 20 surveyed mutations. We were also successful in using this method to test dry blood spots of newborns afflicted with Fabry mutations without having to determine DNA concentration before PCR amplification. The results of this study show that HRM could be a reliable and sensitive method for use in the rapid screening of females for GLA mutations. Copyright © 2011 Elsevier B.V. All rights reserved.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.
2011-01-01
Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746
PCR artifact in testing for homologous recombination in genomic editing in zebrafish.
Directory of Open Access Journals (Sweden)
Minho Won
Full Text Available We report a PCR-induced artifact in testing for homologous recombination in zebrafish. We attempted to replace the lnx2a gene with a donor cassette, mediated by a TALEN induced double stranded cut. The donor construct was flanked with homology arms of about 1 kb at the 5' and 3' ends. Injected embryos (G0 were raised and outcrossed to wild type fish. A fraction of the progeny appeared to have undergone the desired homologous recombination, as tested by PCR using primer pairs extending from genomic DNA outside the homology region to a site within the donor cassette. However, Southern blots revealed that no recombination had taken place. We conclude that recombination happened during PCR in vitro between the donor integrated elsewhere in the genome and the lnx2a locus. We conclude that PCR alone may be insufficient to verify homologous recombination in genome editing experiments in zebrafish.
DEFF Research Database (Denmark)
Balint, Adam; Tenk, Miklós; Deim, Zoltán
2009-01-01
A real-time PCR assay, based on Primer-Probe Energy Transfer (PriProET), was developed to improve the detection and quantification of porcine circovirus type 2 (PVC2). PCV2 is recognised as the essential infectious agent in post-weaning multisystemic wasting syndrome (PMWS) and has been associated...... in different organs. The data obtained in this study correlate with those described earlier; namely, the viral load in 1 ml plasma and in 500 ng tissue DNA exceeds 10(7) copies in the case of PMWS. The results indicate that the new assay provides a specific, sensitive and robust tool for the improved detection...... and quantification of PCV2....
Woo, Hye In; Joo, Eun Yeon; Lee, Kyung Wha
2012-01-01
Background Narcolepsy is a neurologic disorder characterized by excessive daytime sleepiness, symptoms of abnormal rapid eye movement (REM) sleep, and a strong association with HLA-DRB1*1501, -DQA1*0102, and -DQB1*0602. Here, we investigated the clinico-physical characteristics of Korean patients with narcolepsy, their HLA types, and the clinical utility of high-resolution PCR with sequence-specific primers (PCR-SSP) as a simple typing method for identifying DRB1*15/16, DQA1, and DQB1 alleles. Methods The study population consisted of 67 consecutively enrolled patients having unexplained daytime sleepiness and diagnosed narcolepsy based on clinical and neurological findings. Clinical data and the results of the multiple sleep latency test and polysomnography were reviewed, and HLA typing was performed using both high-resolution PCR-SSP and sequence-based typing (SBT). Results The 44 narcolepsy patients with cataplexy displayed significantly higher frequencies of DRB1*1501 (Pc= 0.003), DQA1*0102 (Pc=0.001), and DQB1*0602 (Pc=0.014) than the patients without cataplexy. Among patients carrying DRB1*1501-DQB1*0602 or DQA1*0102, the frequencies of a mean REM sleep latency of less than 20 min in nocturnal polysomnography and clinical findings, including sleep paralysis and hypnagogic hallucination were significantly higher. SBT and PCR-SSP showed 100% concordance for high-resolution typing of DRB1*15/16 alleles and DQA1 and DQB1 loci. Conclusions The clinical characteristics and somnographic findings of narcolepsy patients were associated with specific HLA alleles, including DRB1*1501, DQA1*0102, and DQB1*0602. Application of high-resolution PCR-SSP, a reliable and simple method, for both allele- and locus-specific HLA typing of DRB1*15/16, DQA1, and DQB1 would be useful for characterizing clinical status among subjects with narcolepsy. PMID:22259780
Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.
Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim
2016-03-01
Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.
Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco
2008-01-01
A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.
A novel homozygous stop-codon mutation in human HFE responsible for nonsense-mediated mRNA decay.
Padula, Maria Carmela; Martelli, Giuseppe; Larocca, Marilena; Rossano, Rocco; Olivieri, Attilio
2014-09-01
HFE-hemochromatosis (HH) is an autosomal disease characterized by excessive iron absorption. Homozygotes for H63D variant, and still less H63D heterozygotes, generally do not express HH phenotype. The data collected in our previous study in the province of Matera (Basilicata, Italy) underlined that some H63D carriers showed altered iron metabolism, without additional factors. In this study, we selected a cohort of 10/22 H63D carriers with severe biochemical iron overload (BIO). Additional analysis was performed for studying HFE exons, exon-intron boundaries, and untranslated regions (UTRs) by performing DNA extraction, PCR amplification and sequencing. The results showed a novel substitution (NM_000410.3:c.847C>T) in a patient exon 4 (GenBankJQ478433); it introduces a premature stop-codon (PTC). RNA extraction and reverse-transcription were also performed. Quantitative real-time PCR was carried out for verifying if our aberrant mRNA is targeted for nonsense-mediated mRNA decay (NMD); we observed that patient HFE mRNA was expressed much less than calibrator, suggesting that the mutated HFE protein cannot play its role in iron metabolism regulation, resulting in proband BIO. Our finding is the first evidence of a variation responsible for a PTC in iron cycle genes. The genotype-phenotype correlation observed in our cases could be related to the additional mutation. Copyright © 2014 Elsevier Inc. All rights reserved.
Tuomi, Jari Michael; Voorbraak, Frans; Jones, Douglas L.; Ruijter, Jan M.
2010-01-01
For real-time monitoring of PCR amplification of DNA, quantitative PCR (qPCR) assays use various fluorescent reporters. DNA binding molecules and hybridization reporters (primers and probes) only fluoresce when bound to DNA and result in the non-cumulative increase in observed fluorescence.
International Nuclear Information System (INIS)
Madania, A.; Ghouri, I.; Abou-Alshamat, Gh.; Issa, M.; Al-Halabi, M.
2012-01-01
14 known point mutations in the androgen receptor gene (AR) causing male infertility were screened by real time PCR and by DNA sequencing, in order to identify point mutations in the AR gene causing infertility in azoospermic men. We screened 110 Syrian patients suffering from non-obstructive azoospermia with no chromosomal aberrations or AZF micro deletions. We discovered a new AR mutation, del 57Leu, described for the first time as a possible cause of male infertility. Furthermore, we found two patients with the Ala474Val mutation and one patient bearing the Pro390Ser mutation. Our results indicate that these mutations are significant markers for idiopathic male infertility in the Syrian society and in Mediterranean populations in general. (author)
THE EFFECT OF HAEMOCHROMATOSIS MUTATION ON IRON OVERLOAD IN THALASSAEMIA MAJOR PATIENTS
Directory of Open Access Journals (Sweden)
Tapas Ranjan Behera
2016-11-01
Full Text Available BACKGROUND Haemochromatosis is a genetic form of iron overload due to a defective HFE gene. Secondary iron overload is the main complication in transfusion-dependent thalassaemia major patients. This study aims at evaluating the degree of iron overload in β-thalassaemia major patients with and without HFE mutations (C282Y, H63D and S65C. MATERIALS AND METHODS A descriptive observational study was conducted including fifty diagnosed -thalassaemia major cases. Detailed clinical history and iron profile was estimated. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS After DNA analysis of all the thalassaemia major cases, two groups were identified, one with HFE gene mutation and other without HFE gene mutation. Iron profile of both the groups (with and without HFE gene mutation was estimated and compared. Only H63D mutation (out of three HFE gene mutations was detected in 16% cases (8 out of 50 cases, which comprised the group with mutation. Comparison of iron parameters between two groups (with and without HFE gene mutation showed significant difference in percent transferrin saturation (p=0.02, while other iron parameters (serum iron and serum ferritin did not show significant difference. CONCLUSION No significant difference between serum ferritin values (a marker of iron overload of groups with and without mutation (mean ferritin level 4641±2166 ng/mL and 4170±2461 ng/mL, respectively was found (p=0.61, in a patient population in whom transfusion protocol and proper chelation regimen was followed.
Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2018-05-01
As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.
Genotypic characterization of psittacid herpesvirus isolates from Brazil.
Luppi, Marcela Miranda; Luiz, Ana Paula Moreira Franco; Coelho, Fabiana Magalhães; Ecco, Roselene; da Fonseca, Flávio Guimarães; Resende, Mauricio
2016-01-01
Thirty-six isolates of psittacid herpesvirus (PsHV), obtained from 12 different species of psittacids in Brazil, were genotypically characterized by restriction fragment length polymorphism (RFLP) analysis and PCR amplification. RFLP analysis with the PstI enzyme revealed four distinct restriction patterns (A1, X, W and Y), of which only A1 (corresponding to PsHV-1) had previously been described. To study PCR amplification patterns, six pairs of primers were used. Using this method, six variants were identified, of which, variants 10, 8, and 9 (in this order) were most prevalent, followed by variants 1, 4, and 5. It was not possible to correlate the PCR and RFLP patterns. Twenty-nine of the 36 isolates were shown to contain a 419bp fragment of the UL16 gene, displaying high similarity to the PsHV-1 sequences available in GenBank. Comparison of the results with the literature data suggests that the 36 Brazilian isolates from this study belong to genotype 1 and serotype 1. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Directory of Open Access Journals (Sweden)
Sucik Maylinda
2015-04-01
Full Text Available Research with aim to estimate genetic polymorphism at ACACA (Acetyl-coenzyme A carboxylase locus in Ettawa Crossbred goat wan its relationship with production traits was done at goat population in Batu, Lawang and Ampel Gading. 46 female goats were taken it’s blood sample to isolate the DNA and continue with PCR (Polymerase Chain Reaction and RFLP (Restricted Fragment Length Polymorphism. PCR was used to amplify ACACA gene fragment in intron 3’ about 200 bp with primer F : 5’ – AGT GTA GAA GGG ACA GCC CAG C – 3’ and R : 5’ – GTG GAA TGA CAC ATG GAG AGG G – 3’; RFLP was used to test mutation of that fragment in particular place (point using restriction enzyme RSA1. Variables were alelles and genotypes composition in population, milk and fat content, and birth weight of kid. Result showed that (a genetic polymorphism at locus ACACA in three location was high that is 44,22 %, with allele frequency of G (p = 33 % and allele T (q = 67 %; (b no relationship between the high polymorphism with productive performance of goat in fat and protein content, and birth weight of kid. It was concluded that in goat population there was a high polymorphism at ACACA gene, and that polymorphism was not related to production.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-11-01
Full Text Available In the framework of the supervision and enforcement of the regulation regarding the content of soybean transgenic in food and processed foods such as tempeh, a reliable testing method is indispensable. Performance specific primer PCR amplification with promoter of CaMV 35S tested to detect the presence of GMOs. The parameters tested were specificity, precision and cut off detection using CRM transgenic soybean. The method is reliable to detect transgenic soybean specifically and has the annealing temperature at 59 °C during the 30 cycle standard PCR condition. The method did not show any false positive and false negative results meaning good precision. The cut off the methods is up to 2 copies total DNA of soybean or less than 104 copies of the CaMV 35S promoter. Observation to the commercial soybeans and tempeh found that most of the commercially available soybean in Indonesia are transgenic (8 of 10 sample while all tested tempeh sample were detected have been fermented from transgenic soybeans.
Directory of Open Access Journals (Sweden)
Seyed Reza Kazemi Nezhad
2011-03-01
Full Text Available Glucose-6-phosphate dehydrogenase (G6PD deficiency is one of the most common hereditary enzymatic disorders in human, increases the vulnerability of erythrocytes to oxidative stress. It is also characterized by remarkable molecular and biochemical heterogeneity. According to previous investigations, G6PD Cosenza (G1376C is a common G6PD mutation in some parts of Iran. Therefore in the present study we have characterized Cosenza mutation among G6PD deficient individuals in Khuzestan province. In order to identify G6PD Cosenza, we analyzed the G6PD gene in 64 samples out of 231 deficient individuals who had not G6PD Mediterranean mutation, using PCR- restriction fragment length polymorphism (RFLP method. G6PD Cosenza mutation was found in 6 males of 231 samples, resulting in the relative rate of 2.6% and allele frequency of 0.023 among Khuzestanian G6PD deficient subjects. A comparison of these results with previous findings in some parts of Iran suggests that G6PD Cosenza is a common mutation in Khuzestanian G6PD deficient individuals
Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal
2016-06-15
This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.
Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR
Directory of Open Access Journals (Sweden)
Hoseong Choi
2013-03-01
Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.
Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo
2012-01-01
To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.
Directory of Open Access Journals (Sweden)
Mohamed S. Hassanane
2018-06-01
Full Text Available Egyptian chickens, representing 2 breeds and 7 strains, were genotyped using the PCR-RFLP and sequencing techniques for detection of a non-synonymous dimorphism (G/A in exon 14 of chicken Myxovirus resistance (Mx gene. This dimorphic position is responsible for altering Mx protein’s antiviral activity. Polymerase Chain reactions were performed using Egyptian chickens DNA and specific primer set to amplify Mx DNA fragments of 299 or 301 bp, containing the dimorphic position. Amplicons were cut with restriction enzyme Hpy81. Genotype and allele frequencies for the resistant allele A and sensitive allele G were calculated in all the tested chickens. Results of PCR-RFLP were confirmed by sequencing. The three genotypes AA, AG, GG at the target nucleotide position in Mx gene were represented in all the studied Egyptian chicken breeds and strains except Baladi strain which showed only one genotype AA. The average allele frequency of the resistant A allele in the tested birds (0.67 was higher than the sensitive G allele average frequency in the same birds (0.33. Appling PCR-RFLP technique in the breeding program can be used to select chickens carrying the A allele with high frequencies. This will help in improving poultry breeding in Egypt by producing infectious disease-resistant chickens. Keywords: Egyptian chickens, Antiviral activity, Mx gene, Genotyping, PCR-RFLP
Hsieh, Ming-Kun; Shih, Pei-Yin; Wei, Chia-Fong; Vickroy, Thomas W; Chou, Chi-Chung
2016-03-30
The potential presence of undeclared animal by-products in pet foods is not subject to routine examination. Previously published methods for species-based identification of animal by-products have not been used routinely owing to inconsistent results. The present study evaluated the utility of several approaches for accurate identification of animal by-products in 11 commercial brands of canine canned foods. Canine canned foods from several countries were analysed by ELISA, PCR-RFLP coupled with slab-gel electrophoresis (SGE) and capillary gel electrophoresis (CGE) to test for evidence of by-products derived from cattle, chicken, sheep or pig. While CGE-based analysis detected all (24) animal-derived by-products that were reported for the 11 test samples, SGE and ELISA detected only 22/24 (92%) and 14/24 (58%) of labelled by-products, respectively. In addition, undeclared animal by-products were found using all three analytical approaches with CGE detecting more positives (19) than SGE (17) or ELISA (5). Significant disparities were evident between the labelled contents and the detected content of animal by-products. CGE-based testing for PCR products appears to provide greater sensitivity and accuracy than either SGE or ELISA-based methods. As testing of commercial products becomes more reliable and mainstream, manufacturers will need to develop more thorough and accurate labelling protocols. © 2015 Society of Chemical Industry.
de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena
2016-06-01
Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing
Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N
2018-06-01
Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.
Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri
2012-01-01
The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Influence of X-ray on the P53 gene in human peripheral blood lymphocytes
International Nuclear Information System (INIS)
Jin Wenwei; Cai Ting
2002-01-01
Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation
Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.
Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A
2009-07-01
Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.
Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿
Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.
2009-01-01
Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Directory of Open Access Journals (Sweden)
Serbulent Yigit
2012-01-01
Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.
RAPD, RFLP, T-RFLP, AFLP, RISA
International Nuclear Information System (INIS)
Denman, S.E.; McSweeney, C.S.; Makoto Mitsumori
2005-01-01
Traditional methods of identifying microorganisms through culturing and microscopy techniques can be somewhat tedious and time consuming. A faster and more accurate method for identifying microorganisms is through the sequencing of its ribosomal gene. Classification of microorganisms by ribosomal gene sequencing has become widely accepted within the scientific community. Although this method is quite definitive in its ability to identify the microorganism being studied, it usually involves a pure culture and then the cloning and sequencing of its ribosomal gene. In order to look at complex communities and uncultured microorganisms, many researches have removed the culturing step and moved towards the generation of 16S clone libraries. Data generated from numerous 16S clone libraries from countless environments have produced databases full of ribosomal sequences that may have never been gathered if culturing of the microorganism had been a prerequisite. Ribosomal clone libraries are still quite time consuming, especially if one is interested in detecting differences between complex community structures under varying conditions, such as the effect, diet can impose on the rumen microbial community. Rapid screening methods that allow for the presentation of phylogenetic ribosomal diversity patterns from complex communities in an easy-to-interpret and reproducible manner have all benefited from the knowledge gained from ribosomal clone libraries. Restriction fragment length polymorphism (RFLP) and terminal restriction fragment length polymorphism (T-RFLP) are two such techniques that will be described in this chapter. Other methods such as ribosomal intergenic spacer analysis (RISA), which determines diversity through differences, found in the transcribed spacer region between the highly conserved ribosomal genes can also be employed. RISA is a particularly powerful tool for attempting to discriminate between closely related species and strains. Two methods that do not
Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Sattarifard, Hedieh; Hashemi, Seyed Mehdi; Bahari, Gholamreza
2018-04-25
It has been shown that a 4-bp insertion/deletion (ins/del) polymorphism of EGLN2 influences the risk of several cancers. However, to date, no study has inspected the impact of the 4-bp ins/del polymorphism on breast cancer (BC) risk. A case-control study, including 134 breast cancer patients and 154 healthy women, was here conducted to examine the possible association between EGLN2 4-bp ins/del polymorphism and BC risk in a southeast Iranian population. A mismatched polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was designed for genotyping of the variant. Our findings did not support any association between the 4-bp ins/del polymorphism and the risk of BC in the codominant, dominant, recessive and allele inheritance models tested. When links between the EGLN2 4-bp ins/del polymorphism and clinicopathological characteristics of the patients were evaluate the variant was only associated with HER2 status. More studies with larger sample sizes and diverse ethnicities are warranted to verify our finding. Creative Commons Attribution License
Comparison of agglutination test, microscopy and nPCR for ...
African Journals Online (AJOL)
action (nPCR) for the detection of T. gondii infection in mice (n=399) inoculated with heart .... Direct Agglutination Test (DAT) (Toxo screen DA, Biomerieux®, France) fol- ... 0.3 µl external forward Primer (50 µM), 0.3 µl external reverse Primer.
Moti, Y; De Deken, R; Thys, E; Van Den Abbeele, J; Duchateau, L; Delespaux, V
2015-06-01
African Animal Trypanosomosis is threatening the agricultural production and cattle breeding more severely than any other livestock disease in the continent, even more since the advent of drug resistance. A longitudinal study was conducted from November 2012 to May 2013 in the Ghibe valley to evaluate diminazene aceturate (DA) resistance and assess livestock owner's perception of trypanocidal drug use. Four Peasant Associations (PAs) were purposively selected and the cattle randomly sampled in each PAs. At the beginning of the study (t0), 106 bovines positive for trypanosomes by the haematocrit centrifugation technique (HCT) and 119 negative control animals were recruited for six months follow-up using HCT, 18S-PCR-RFLP, DpnII-PCR-RFLP and microsatellite analysis. Prevalence of trypanosomosis was 18.1% based on the HCT technique and the mean PCV value was 23.6±5.1% for the 587 sampled cattle. Out of the 106 HCT positive, 64 (60.4%) were positive for the presence of trypanosomes using the 18S-PCR-RFLP. Species detection showed 38 (59.4%) Trypanosoma congolense savannah, 18 (28.1%) Trypanosoma vivax, 5 (7.8%) Trypanosoma theileri and 3 (4.7%) T. congolense Kilifi. Among the T. congolense savannah samples, 31 (81.6%) showed a DA resistant RFLP profile, 2 (5.3%) a mixed profile and 5 did not amplify using the DpnII-PCR-RFLP. A positive HCT had a significant effect on PCV (pmessages should be delivered to promote a rational drug use, improved livestock management and the application of strategic vector control methods. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Energy Technology Data Exchange (ETDEWEB)
Lapade, A.G.; Nazarea, T.Y.; Veluz, A.M.S.; Marbella, L.J.; Nato, A.Q.; Coloma, C.B. Jr.; Asencion, A.B. [Philippine Nuclear Research Institute, Commonwealth Avenue, Quezon (Philippines)
2002-02-01
This paper summarizes the status of biotechnology with emphasis on molecular techniques for plant breeding in the Philippines. Several molecular and in-vitro culture techniques are integrated in plant breeding for crop improvement at PNRI, UPLB, IRRI and PhilRice. At IRRI, PCR techniques, RFLP and RAPD, PCR techniques, RFLP and RAPD were developed to establish high density molecular maps, determine breadth and diversity of germplasm and characterize alien introgression. The molecular maps have identified DNA sequence of resistance genes of HYVs and NPTs to abiotic and biotic stresses, the major achievement is the development of high density molecular maps in rice with at least 2000 markers. The biotechnology program at PhilRice for varietal improvement includes: (1) utilization of molecular marker technology such gene mapping of desired traits in rice, analysis of genetic relationships of germplasm materials and breeding lines through DNA fingerprinting and genetic diversity studies and development and application of marker aided selection for disease resistance (RTD and BLB); (2) application of in-vitro techniques in the development of lines with tolerance to adverse conditions; (3) molecular cloning of important genes for RTD resistance; (4) genetic transformation for male sterility and resistance to sheath blight and stem borers; and (5) transfer of disease resistance from wild species to cultivated varieties. In IPB, molecular markers:microsatellites or SSR, AFLP and RGA are being used for mapping and diversity studies in coconut, mango, banana, mungbean, corn and tomato. Mutation breeding at PNRI using gamma radiation has resulted in the development of crop varieties with desirable traits. The use of AFLP coupled to PCR is being used to study polymorphism in plant variants of radiation-induced mutants of rice, pineapple and ornamentals. (author)
SCREENING OF COMMON FLAX FAD GENES BY PCR
Directory of Open Access Journals (Sweden)
Veronika Štefúnová
2013-02-01
Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.
Alpha-synuclein A53T mutation is not frequent on a sample of Brazilian Parkinson’s disease patients
Directory of Open Access Journals (Sweden)
Gabriela S. Longo
2015-06-01
Full Text Available Introduction The pathogenesis of Parkinson’s disease (PD involves both genetic susceptibility and environmental factors, with focus on the mutation in the alpha-synuclein gene (SNCA.Objective To analyse the polymorphism SNCA-A53T in patients with familial PD (FPD and sporadic PD (SPD.Method A total of 294 individuals were studied, regardless of sex and with mixed ethnicity. The study group with 154 patients with PD, and the control group included 140 individuals without PD. The genotyping of SNCA-A53T was performed by PCR/RFLP. Significance level was p < 0.05.Results Among all patients, 37 (24% had FPD and 117 (75.9% had SPD. The absence of SNCA-A53T mutation was observed in all individuals.Conclusion SPD is notably observed in patients. However, the SNCA-A53T mutation was absent in all individuals, which does not differ controls from patients. This fact should be confirmed in a Brazilian study case with a more numerous and older population.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.
International Nuclear Information System (INIS)
Mesquita, Bárbara; Veiga, Isabel; Pereira, Deolinda; Tavares, Ana; Pinto, Isabel M; Pinto, Carla; Teixeira, Manuel R; Castedo, Sérgio
2005-01-01
The mechanisms of chemoresistance in ovarian cancer patients remain largely to be elucidated. Paclitaxel/cisplatin combination is the standard chemotherapeutic treatment for this disease, although some patients do not respond to therapy. Our goals were to investigate whether TUBB mutations and mismatch repair defects underlie paclitaxel and cisplatin resistance. Thirty-four patients with primary ovarian carcinomas (26 serous and eight clear cell carcinomas) treated with paclitaxel/cisplatin were analysed. TUBB exon 4 was analysed by nested PCR after a first round PCR using intronic primers. Microsatellite analysis was performed with the quasimonomorphic markers BAT 26 and BAT 34. Twenty-two of the 34 ovarian cancers (64.7%) presented residual tumour after surgery, seven of which (7/22; 31.8%) were shown to be chemoresistant (five serous and two clear cell tumours). Sequence analysis did not find any mutation in TUBB exon 4. Microsatellite instability was not detected in any of the ovarian carcinomas. We conclude that TUBB exon 4 mutations and mismatch repair defects do not play a significant role in paclitaxel/cisplatin resistance
Directory of Open Access Journals (Sweden)
Gonzalo Rincón
2006-01-01
Full Text Available The ancestors of Uruguayan Creole cattle were introduced by the Spanish conquerors in the XVII century, following which the population grew extensively and became semi-feral before the introduction of selected breeds. Today the Uruguayan Creole cattle genetic reserve consists of 575 animals. We used the tetra primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR to analyze the kappa-casein, beta-casein, alphaS1-casein and alpha-lactoalbumin gene polymorphisms and restriction fragment length polymorphism PCR (RFLP-PCR for the beta-lactoglobulin and the acylCoA:diacyl glycerol acyltransferase 1 (DGAT1 genes. The kappa-casein and beta-lactoglobulin genes presented very similar A and B allele frequencies, while the alphas1-casein and alpha-lactoalbumin gene B alleles showed much higher frequencies than the corresponding A alleles. The beta-casein B allele was not found in the population sampled. There was a very high frequency of the DGAT1 gene A allele which is associated with low milk fat content and high milk yield. All loci were in Hardy-Weinberg equilibrium and the level of heterozygosity agreed with the high genetic diversity observed in a previous analysis of this population. Preservation of the allelic richness observed in the Uruguayan Creole cattle should be considered for future dairy management and livestock genetic improvement. The results also emphasize the value of the tetra primers ARMS-PCR technique as a rapid, easy and economical way of genotyping cattle breeds for milk gene single nucleotide polymorphisms.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
Frawley, Thomas; O'Brien, Cathal P; Conneally, Eibhlin; Vandenberghe, Elisabeth; Percy, Melanie; Langabeer, Stephen E; Haslam, Karl
2018-02-01
The classical Philadelphia chromosome-negative myeloproliferative neoplasms (MPNs), consisting of polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a heterogeneous group of neoplasms that harbor driver mutations in the JAK2, CALR, and MPL genes. The detection of mutations in these genes has been incorporated into the recent World Health Organization (WHO) diagnostic criteria for MPN. Given a pressing clinical need to screen for mutations in these genes in a routine diagnostic setting, a targeted next-generation sequencing (NGS) assay for the detection of MPN-associated mutations located in JAK2 exon 14, JAK2 exon 12, CALR exon 9, and MPL exon 10 was developed to provide a single platform alternative to reflexive, stepwise diagnostic algorithms. Polymerase chain reaction (PCR) primers were designed to target mutation hotspots in JAK2 exon 14, JAK2 exon 12, MPL exon 10, and CALR exon 9. Multiplexed PCR conditions were optimized by using qualitative PCR followed by NGS. Diagnostic genomic DNA from 35 MPN patients, known to harbor driver mutations in one of the target genes, was used to validate the assay. One hundred percent concordance was observed between the previously-identified mutations and those detected by NGS, with no false positives, nor any known mutations missed (specificity = 100%, CI = 0.96, sensitivity = 100%, CI = 0.89). Improved resolution of mutation sequences was also revealed by NGS analysis. Detection of diagnostically relevant driver mutations of MPN is enhanced by employing a targeted multiplex NGS approach. This assay presents a robust solution to classical MPN mutation screening, providing an alternative to time-consuming sequential analyses.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
KMeyeDB: a graphical database of mutations in genes that cause eye diseases.
Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei
2010-06-01
KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.
Directory of Open Access Journals (Sweden)
Bhatt Rajendra M
2010-05-01
Full Text Available Abstract Background Knockdown resistance in insects resulting from mutation(s in the voltage gated Na+ channel (VGSC is one of the mechanisms of resistance against DDT and pyrethroids. Recently a point mutation leading to Leu-to-Phe substitution in the VGSC at residue 1014, a most common kdr mutation in insects, was reported in Anopheles culicifacies-a major malaria vector in the Indian subcontinent. This study reports the presence of two additional amino acid substitutions in the VGSC of an An. culicifacies population from Malkangiri district of Orissa, India. Methods Anopheles culicifacies sensu lato (s.l. samples, collected from a population of Malkangiri district of Orissa (India, were sequenced for part of the second transmembrane segment of VGSC and analyzed for the presence of non-synonymous mutations. A new primer introduced restriction analysis-PCR (PIRA-PCR was developed for the detection of the new mutation L1014S. The An. culicifacies population was genotyped for the presence of L1014F substitution by an amplification refractory mutation system (ARMS and for L1014S substitutions by using a new PIRA-PCR developed in this study. The results were validated through DNA sequencing. Results DNA sequencing of An. culicifacies individuals collected from district Malkangiri revealed the presence of three amino acid substitutions in the IIS6 transmembrane segments of VGSC, each one resulting from a single point mutation. Two alternative point mutations, 3042A>T transversion or 3041T>C transition, were found at residue L1014 leading to Leu (TTA-to-Phe (TTT or -Ser (TCA changes, respectively. A third and novel substitution, Val (GTG-to-Leu (TTG or CTG, was identified at residue V1010 resulting from either of the two transversions–3028G>T or 3028G>C. The L1014S substitution co-existed with V1010L in all the samples analyzed irrespective of the type of point mutation associated with the latter. The PIRA-PCR strategy developed for the
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M
2005-02-01
Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.
Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu
2017-12-18
Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first
Directory of Open Access Journals (Sweden)
Kyusik Jeong
2011-04-01
Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.
Haider, M Z; Devarajan, L V; Al-Essa, M; Srivastva, B S; Kumar, H; Azad, R; Rashwan, N
2001-04-01
Retinopathy of prematurity (ROP) is a retinal vascular disease that occurs in infants with short gestational age and low birth weight and may lead to retinal detachment and blindness. Missense mutations in the Norrie disease (ND) gene have been associated with the risk of progression to advanced stages in cases of ROP from the US and also in clinically similar ND and familial exudative vitreoretinopathy. We have screened two ND gene mutations, namely A105T and Val60Glu, by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific PCR methods, respectively, in 210 Kuwaiti premature newborns to replicate these findings in a different ethnic group. In the Kuwaiti premature newborn cohort, 115 of 210 babies had no eye problems and served as controls, while 95 were cases of ROP. In 71 of 95 ROP cases, the disease regressed spontaneously on or before stage 3, while in 24 of 95 ROP cases the disease progressed to advanced stages 4 and 5. In case of missense mutation (A105T), the AA genotype was detected in 96% of controls compared with 87% of ROP cases (NS); similarly no significant difference was found between spontaneously regressed ROP cases and those who progressed to advanced stages. For the Val60Glu mutation, no significant association was detected between the genotype and progression of ROP to advanced stages. Unlike data from the US, our findings from a Kuwaiti cohort of ROP cases and controls suggest a lack of association between the two ND gene mutations (A105T and Val60Glu) and ROP and the risk of progression of the disease to advanced stages.
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
[Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].
Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu
2008-12-16
To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.
Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi
2018-01-01
Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Directory of Open Access Journals (Sweden)
Espinola Emilio E
2006-05-01
Full Text Available Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures in the correct genotyping of G1, G2, G8, G9 and G10 rotavirus strains were reported in the most commonly used reverse transcription (RT-PCR strategies. Collecting VP7 gene sequences of G1 rotavirus strains from databases we found that 74 (61.2 % out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure of G1-typing. Thus, a great percentage of the G1 strains from lineage I worldwide reported could not have been typed if the Das's RT-PCR strategy were used. This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages. Therefore, the use of different RT-PCR strategies with different primer binding locations on the VP7 gene or new typing methodologies -like microarrays procedures- could be a better option to avoid the failure of the G-typing of rotavirus strains detected during surveillance programs.
Bamaga, Omar A A; Mahdy, Mohammed A K; Lim, Yvonne A L
2015-09-01
Malaria is still a major public health problem in Yemen. More than 95% of the malaria cases are due to Plasmodium falciparum. Recently in Yemen, the antimalarial treatment policy was changed from chloroquine (CQ) to artemisinin combination therapy (ACTs). However, CQ is still available and prescribed in the Yemeni market. The persistence of CQ resistance will be prolonged if the shift to ACT and the simultaneous withdrawal of CQ are not rigorously implemented. The aim of the current survey is to detect chloroquine-resistant mutations in P. falciparum chloroquine-resistance transporter (pfcrt) and P. falciparum multi-drug resistance-1 (pfmdr1) genes. These data will be important for future monitoring and assessment of antimalarial drug policy in Yemen. Blood specimens were collected from 735 individuals from different districts of the Hadhramout province, Yemen by house-to-house visit. Mutation-specific nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (PCR-RFLP) methods were used to investigate the mutations in the pfmdr1(codons 86 and 1246) and pfcrt (codons 76, 271, 326, 356 and 371) genes. The overall prevalence of pfcrt mutations at codons 76, 271, 326 and 371 were 50.4%, 58.7%, 54.3% and 44.9%, respectively. All isolates had wild-type pfcrt 356 allele. The majority of pfmdr1 86 alleles (83.3%) and all pfmdr1 1246 alleles were wild type. There was no association between pfcrt mutations and symptomatology, gender and age groups. In conclusion, point mutations in codons 76, 271, 326 and 371 of pfcrt of P. falciparum are high suggesting a sustained high CQ resistance even after 4 years of shifting to ACTs. These findings warrant complete withdrawal of CQ use from the Yemeni market for P. falciparum and careful usage of CQ for treating Plasmodium vivax. Copyright © 2015 Elsevier B.V. All rights reserved.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.
Barker, Emily N; Stranieri, Angelica; Helps, Chris R; Porter, Emily L; Davidson, Andrew D; Day, Michael J; Knowles, Toby; Kipar, Anja; Tasker, Séverine
2017-10-05
Feline infectious peritonitis (FIP) is a fatal disease of cats, and a sequela of systemic feline coronavirus (FCoV) infection. Mutations in the viral spike (S) gene have been associated with FCoVs found in tissues from cats with FIP, but not FCoVs found in faeces from healthy cats, and are implicated in monocyte/macrophage tropism and systemic spread. This study was designed to determine whether S gene mutation analysis can reliably diagnose FIP. Cats were categorised as with FIP (n = 57) or without FIP (n = 45) based on gross post-mortem and histopathological examination including immunohistochemistry for FCoV antigen. RNA was purified from available tissue, fluid and faeces. Reverse-transcriptase quantitative-PCR (RT-qPCR) was performed on all samples using FCoV-specific primers, followed by sequencing of a section of the S gene on RT-qPCR positive samples. Samples were available from a total of 102 cats. Tissue, fluid, and faecal samples from cats with FIP were more likely to be FCoV RT-qPCR-positive (90.4, 78.4 and 64.6% respectively) than those from cats without FIP (7.8, 2.1 and 20% respectively). Identification of S gene mutated FCoVs as an additional step to the detection of FCoV alone, only moderately increased specificity for tissue samples (from 92.6 to 94.6%) but specificity was unchanged for fluid samples (97.9%) for FIP diagnosis; however, sensitivity was markedly decreased for tissue (from 89.8 to 80.9%) and fluid samples (from 78.4 to 60%) for FIP diagnosis. These findings demonstrate that S gene mutation analysis in FCoVs does not substantially improve the ability to diagnose FIP as compared to detection of FCoV alone.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Directory of Open Access Journals (Sweden)
Miyazawa Takayuki
2010-12-01
Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.
Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.
Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung
2008-01-01
The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.
Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.
West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D
1995-01-01
A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625
A simple RT-PCR-based strategy for screening connexin identity
Directory of Open Access Journals (Sweden)
M. Urban
1999-08-01
Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.
A Point-of-Need infrared mediated PCR platform with compatible lateral flow strip for HPV detection.
Liu, Wenjia; Zhang, Mingfang; Liu, Xiaoyan; Sharma, Alok; Ding, Xianting
2017-10-15
With the increasing need of monitoring the epidemiology of serious infectious diseases, food hygiene, food additives and pesticide residues, it is urgent to develop portable, easy-to-use, inexpensive and rapid molecular diagnostic tools. Herein, we demonstrate a prototype of IR mediated Conducting Oil and CarbOn Nanotube circUlaTing PCR (IR-COCONUT PCR) platform for nucleic acid amplification. The presented platform offers a new solution for miniaturized PCR instruments with non-contact heaters by using conducting oil and carbon nanotube as a medium in IR mediated PCR. This novel platform offers accurate and flexible control of temperature through the integration of PID (proportional-integral-derivative) algorithms to manipulate the duty cycle of the voltage signals of IR LED and a peristaltic pump. The ramping rate of the introduced platform in current study is 1.5°C/s for heating speed and -2.0°C/s for cooling speed. This platform fulfills 30 thermal cycles within 50min which is a match to the conventional bench-top PCR thermo cyclers. For demonstration purpose, human papillomavirus (HPV) patient cervical swab specimens were examined. Downstream lateral flow strip (LFS) was also developed to quantity the PCR products from the IR-COCONUT PCR device within 25min. This PCR platform together with the compatible LFS shows great potential for in-field and Point-of-Need (PoN) testing of genetic or contagious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Detection of polymorphism in booroola gene and growth ...
African Journals Online (AJOL)
[12] and Davis et al [17], forced PCR–RFLP DNA test was used to detect the mutations of FecB and GDF9 in Lori breed sheep. The primer sequences used for the FecB AvaII site and. GDF9 HhaI site are presented in Table 1. Polymerase chain reactions were performed in a. 25 μL reaction mixture containing approximately.
Directory of Open Access Journals (Sweden)
Weiyi Ni
Full Text Available Sensitive and specific tests for detecting exogenous DNA molecules are useful for infectious disease diagnosis, gene therapy clinical trial safety, and gene doping surveillance. Taqman real-time PCR using specific sequence probes provides an effective approach to accurately and quantitatively detect exogenous DNA. However, one of the major challenges in these analyses is to eliminate false positive signals caused by either non-targeted exogenous or endogenous DNA sequences, or false negative signals caused by impurities that inhibit PCR. Although multiplex Taqman PCR assays have been applied to address these problems by adding extra primer-probe sets targeted to endogenous DNA sequences, the differences between targets can lead to different detection efficiencies. To avoid these complications, a Taqman PCR-based approach that incorporates an internal threshold control (ITC has been developed. In this single reaction format, the target sequence and ITC template are co-amplified by the same primers, but are detected by different probes each with a unique fluorescent dye. Sample DNA, a prescribed number of ITC template molecules set near the limit of sensitivity, a single pair of primers, target probe and ITC probe are added to one reaction. Fluorescence emission signals are obtained simultaneously to determine the cycle thresholds (Ct for amplification of the target and ITC sequences. The comparison of the target Ct with the ITC Ct indicates if a sample is a true positive for the target (i.e. Ct less than or equal to the ITC Ct or negative (i.e. Ct greater than the ITC Ct. The utility of this approach was demonstrated in a nonhuman primate model of rAAV vector mediated gene doping in vivo and in human genomic DNA spiked with plasmid DNA.
Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.
Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen
2013-01-01
To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.
Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu
2015-03-01
Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.
Directory of Open Access Journals (Sweden)
Camara Mark D
2008-05-01
Full Text Available Abstract Background Since it was first described in the mid-1990s, quantitative real time PCR (Q-PCR has been widely used in many fields of biomedical research and molecular diagnostics. This method is routinely used to validate whole transcriptome analyses such as DNA microarrays, suppressive subtractive hybridization (SSH or differential display techniques such as cDNA-AFLP (Amplification Fragment Length Polymorphism. Despite efforts to optimize the methodology, misleading results are still possible, even when standard optimization approaches are followed. Results As part of a larger project aimed at elucidating transcriptome-level responses of Pacific oysters (Crassostrea gigas to various environmental stressors, we used microarrays and cDNA-AFLP to identify Expressed Sequence Tag (EST fragments that are differentially expressed in response to bacterial challenge in two heat shock tolerant and two heat shock sensitive full-sib oyster families. We then designed primers for these differentially expressed ESTs in order to validate the results using Q-PCR. For two of these ESTs we tested fourteen primer pairs each and using standard optimization methods (i.e. melt-curve analysis to ensure amplification of a single product, determined that of the fourteen primer pairs tested, six and nine pairs respectively amplified a single product and were thus acceptable for further testing. However, when we used these primers, we obtained different statistical outcomes among primer pairs, raising unexpected but serious questions about their reliability. We hypothesize that as a consequence of high levels of sequence polymorphism in Pacific oysters, Q-PCR amplification is sub-optimal in some individuals because sequence variants in priming sites results in poor primer binding and amplification in some individuals. This issue is similar to the high frequency of null alleles observed for microsatellite markers in Pacific oysters. Conclusion This study highlights
Directory of Open Access Journals (Sweden)
Rupreht Ruth
2007-11-01
Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for
Lack of mutational hot spots during decitabine-mediated HIV-1 mutagenesis.
Rawson, Jonathan M O; Landman, Sean R; Reilly, Cavan S; Bonnac, Laurent; Patterson, Steven E; Mansky, Louis M
2015-11-01
Decitabine has previously been shown to induce lethal mutagenesis of human immunodeficiency virus type 1 (HIV-1). However, the factors that determine the susceptibilities of individual sequence positions in HIV-1 to decitabine have not yet been defined. To investigate this, we performed Illumina high-throughput sequencing of multiple amplicons prepared from proviral DNA that was recovered from decitabine-treated cells infected with HIV-1. We found that decitabine induced an ≈4.1-fold increase in the total mutation frequency of HIV-1, primarily due to a striking ≈155-fold increase in the G-to-C transversion frequency. Intriguingly, decitabine also led to an ≈29-fold increase in the C-to-G transversion frequency. G-to-C frequencies varied substantially (up to ≈80-fold) depending upon sequence position, but surprisingly, mutational hot spots (defined as upper outliers within the mutation frequency distribution) were not observed. We further found that every single guanine position examined was significantly susceptible to the mutagenic effects of decitabine. Taken together, these observations demonstrate for the first time that decitabine-mediated HIV-1 mutagenesis is promiscuous and occurs in the absence of a clear bias for mutational hot spots. These data imply that decitabine-mediated G-to-C mutagenesis is a highly effective antiviral mechanism for extinguishing HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Demkin, V V; Korneva, I N; Riazanova, Iu A; Muminov, T A; Beĭsembaeva, Sh A; Zhakipbaeva, B T; Shopaeva, G A; Dauletbakova, A M
2008-01-01
A three-primer PCR assay was designed for detection of possible deletions in the RD7 region of the Mycobacterium tuberculosis complex chromosome. The assay produced amplicons of different size depending on the presence or absence of the deletions. The PCR assay was applied to 176 isolates from patients with lung tuberculosis collected in different areas of Kazakhstan in summer 2004. The isolates were initially characterized by culture and biochemical tests. The RD7 genotyping results demonstrated no polymorphism and the absence of deletions in the RD7 genome region. Some strains were additionally characterized using PCR-RFLP analysis of gyrB and hsp64 genes. The RFLP-patterns obtained corresponded to the M. tuberculosis genotypes. The results of this work are consistent with certain previous studies, indicating population stability of the RD7 region in M. tuberculosis strains. Species characterization of the isolates shows that M. tuberculosis sensu stricto is the principal causative agent of human lung tuberculosis in Kazakhstan.
High resolution melting for mutation scanning of TP53 exons 5–8
International Nuclear Information System (INIS)
Krypuy, Michael; Dobrovic, Alexander; Ahmed, Ahmed Ashour; Etemadmoghadam, Dariush; Hyland, Sarah J; Australian Ovarian Cancer Study Group; Fazio, Anna de; Fox, Stephen B; Brenton, James D; Bowtell, David D
2007-01-01
p53 is commonly inactivated by mutations in the DNA-binding domain in a wide range of cancers. As mutant p53 often influences response to therapy, effective and rapid methods to scan for mutations in TP53 are likely to be of clinical value. We therefore evaluated the use of high resolution melting (HRM) as a rapid mutation scanning tool for TP53 in tumour samples. We designed PCR amplicons for HRM mutation scanning of TP53 exons 5 to 8 and tested them with DNA from cell lines hemizygous or homozygous for known mutations. We assessed the sensitivity of each PCR amplicon using dilutions of cell line DNA in normal wild-type DNA. We then performed a blinded assessment on ovarian tumour DNA samples that had been previously sequenced for mutations in TP53 to assess the sensitivity and positive predictive value of the HRM technique. We also performed HRM analysis on breast tumour DNA samples with unknown TP53 mutation status. One cell line mutation was not readily observed when exon 5 was amplified. As exon 5 contained multiple melting domains, we divided the exon into two amplicons for further screening. Sequence changes were also introduced into some of the primers to improve the melting characteristics of the amplicon. Aberrant HRM curves indicative of TP53 mutations were observed for each of the samples in the ovarian tumour DNA panel. Comparison of the HRM results with the sequencing results revealed that each mutation was detected by HRM in the correct exon. For the breast tumour panel, we detected seven aberrant melt profiles by HRM and subsequent sequencing confirmed the presence of these and no other mutations in the predicted exons. HRM is an effective technique for simple and rapid scanning of TP53 mutations that can markedly reduce the amount of sequencing required in mutational studies of TP53
Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S
2017-12-30
Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Gomes, K B; Carvalho, M G; Coelho, F F; Rodrigues, I F; Soares, A L; Guimarães, D A; Fernandes, A P
2009-10-27
Hereditary hemochromatosis is one of the most common autosomal recessive diseases; it is characterized by excess absorption of iron. Clinically, the major challenge is to diagnose increased iron deposition before irreversible tissue damage has occurred. C282Y and H63D are the main mutations related to hereditary hemochromatosis; these mutations have been reported to be associated with increased risk of developing diabetes mellitus type 2 (DM2). We investigated whether these mutations are associated with increased risk for the development of DM2 in women in Brazil. Seventy-two women with clinical diagnosis of DM2 under treatment with hypoglycemic agents and a control group composed of 72 women with no clinical history of diabetes were studied. The C282Y and H63D mutations were determined by PCR-RFLP. Significant differences were not observed for C282Y and H63D, when we compared diabetic and non-diabetic women. We suggest that mutations C282Y and H63D in the HFE gene are not significant risk factors for the development of DM2 in Brazilian women.
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.
Prevost, S; Andre, S; Remize, F
2010-12-01
Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.
Svitek, N; Nzau, B; Steinaa, L; Nene, V
2015-04-01
We have developed a polymerase chain reaction-sequence-specific primers-restriction fragment length polymorphism (PCR-SSP-RFLP) method to rapidly differentiate between the A18 and A18 variant (v) BoLA haplotypes and between A14 and A15/A15v BoLA haplotypes in Holstein/Friesian cattle. We used published SSP to PCR amplify BoLA alleles expressed in animals of known haplotype and exposed the amplicons to the restriction enzyme PvuII that was predicted to cut at a unique site in the middle of BoLA-6*01302 (A18v) and BoLA-1*00901 (A15) but not in BoLA-6*01301 (A18) or BoLA-1*02301 (A14) alleles. Whereas the method does not discriminate between the A15 and A15v haplotypes, as the BoLA-1*00902 allele associated with A15v also contains a PvuII site, we are interested in cattle of A18 and A14 haplotype for vaccine related studies. Our results also indicated that the BoLA-6*01302 (A18v) allele is much more abundant than BoLA-6*01301 (A18) in the cattle that we sampled. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Arinsburg, Suzanne A; Shaz, Beth H; Westhoff, Connie; Cushing, Melissa M
2012-05-01
Neonatal alloimmune thrombocytopenia (NAIT) is the most common cause of severe thrombocytopenia and intracranial hemorrhage in the perinatal period. While the gold standard for making a diagnosis of NAIT is detection of a human platelet antigen (HPA)-specific antibody in maternal serum, together with identifying an incompatibility between the parents for the cognate HPA antigen, platelet genotyping is the gold standard method for HPA typing. Platelet genotyping is critical in screening at-risk fetuses for the presence ofthe HPA corresponding to the maternal antibody. In addition, platelet genotyping may play a role in population screening to identify women at risk for sensitization, and thus, fetuses at risk for NAIT. The most commonly used methods of platelet genotyping are sequence-specific primer-polymerase chain reaction (PCR-SSP), restriction fragment length polymorphism-PCR (PCR-RFLP), and TaqMan real-time PCR. PCR-SSP and PCR-RFLP are relatively inexpensive and technically simple methods, but they are not easily automated and require expertise for reliable interpretation of results. Newer methods that allow for multiplexing, automation, and easily interpretable results, such as bead arrays, are currently in development and available for research purposes. Copyright © 2012 Wiley Periodicals, Inc.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Novakovic, S.; Stegel, V.
2005-01-01
Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)
Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab
2016-07-01
The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.
Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.
Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D
2002-12-20
A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kankan Wang
2016-01-01
Full Text Available Precise genome editing in livestock is of great value for the fundamental investigation of disease modeling. However, genetically modified pigs carrying subtle point mutations were still seldom reported despite the rapid development of programmable endonucleases. Here, we attempt to investigate single-stranded oligonucleotides (ssODN mediated knockin by introducing two orthologous pathogenic mutations, p.E693G for Alzheimer's disease and p.G2019S for Parkinson's disease, into porcine APP and LRRK2 loci, respectively. Desirable homology-directed repair (HDR efficiency was achieved in porcine fetal fibroblasts (PFFs by optimizing the dosage and length of ssODN templates. Interestingly, incomplete HDR alleles harboring partial point mutations were observed in single-cell colonies, which indicate the complex mechanism of ssODN-mediated HDR. The effect of mutation-to-cut distance on incorporation rate was further analyzed by deep sequencing. We demonstrated that a mutation-to-cut distance of 11 bp resulted in a remarkable difference in HDR efficiency between two point mutations. Finally, we successfully obtained one cloned piglet harboring the orthologous p.C313Y mutation at the MSTN locus via somatic cell nuclear transfer (SCNT. Our proof-of-concept study demonstrated efficient ssODN-mediated incorporation of pathogenic point mutations in porcine somatic cells, thus facilitating further development of disease modeling and genetic breeding in pigs.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A
2004-10-01
The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.
Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.
Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin
2017-08-01
Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.
Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei
2014-09-15
Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Souza Manoel T
2008-01-01
Full Text Available Abstract Background Many commercial banana varieties lack sources of resistance to pests and diseases, as a consequence of sterility and narrow genetic background. Fertile wild relatives, by contrast, possess greater variability and represent potential sources of disease resistance genes (R-genes. The largest known family of plant R-genes encode proteins with nucleotide-binding site (NBS and C-terminal leucine-rich repeat (LRR domains. Conserved motifs in such genes in diverse plant species offer a means for isolation of candidate genes in banana which may be involved in plant defence. Results A computational strategy was developed for unbiased conserved motif discovery in NBS and LRR domains in R-genes and homologues in monocotyledonous plant species. Degenerate PCR primers targeting conserved motifs were tested on the wild cultivar Musa acuminata subsp. burmannicoides, var. Calcutta 4, which is resistant to a number of fungal pathogens and nematodes. One hundred and seventy four resistance gene analogs (RGAs were amplified and assembled into 52 contiguous sequences. Motifs present were typical of the non-TIR NBS-LRR RGA subfamily. A phylogenetic analysis of deduced amino-acid sequences for 33 RGAs with contiguous open reading frames (ORFs, together with RGAs from Arabidopsis thaliana and Oryza sativa, grouped most Musa RGAs within monocotyledon-specific clades. RFLP-RGA markers were developed, with 12 displaying distinct polymorphisms in parentals and F1 progeny of a diploid M. acuminata mapping population. Eighty eight BAC clones were identified in M. acuminata Calcutta 4, M. acuminata Grande Naine, and M. balbisiana Pisang Klutuk Wulung BAC libraries when hybridized to two RGA probes. Multiple copy RGAs were common within BAC clones, potentially representing variation reservoirs for evolution of new R-gene specificities. Conclusion This is the first large scale analysis of NBS-LRR RGAs in M. acuminata Calcutta 4. Contig sequences were
Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G
2018-03-30
Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.
Use of species-specific PCR for the identification of 10 sea cucumber species
Wen, Jing; Zeng, Ling
2014-11-01
We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.
van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T
2010-05-01
Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.
A novel method for detection of dioxins. Exonuclease protection mediated PCR assay
Energy Technology Data Exchange (ETDEWEB)
Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College
2004-09-15
The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
DEFF Research Database (Denmark)
Priemé, Anders; Wolsing, Martin
2004-01-01
Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...
Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki
2010-11-01
Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.
DEFF Research Database (Denmark)
Colding, H; Hartzen, S H; Mohammadi, M
2003-01-01
Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
International Nuclear Information System (INIS)
Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr
2006-01-01
Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB
Novel mutations of CYP3A4 in Chinese.
Hsieh, K P; Lin, Y Y; Cheng, C L; Lai, M L; Lin, M S; Siest, J P; Huang, J D
2001-03-01
Human cytochrome P450 3A4 is a major P450 enzyme in the liver and gastrointestinal tract. It plays important roles in the metabolism of a wide variety of drugs, some endogenous steroids, and harmful environmental contaminants. CYP3A4 exhibits a remarkable interindividual activity variation as high as 20-fold. To investigate whether the interindividual variation in CYP3A4 levels can be partly explained by genetic polymorphism, we analyzed DNA samples from 102 Chinese subjects by polymerase chain reaction (PCR)-single-strand conformation polymorphism analysis for novel point mutation in the CYP3A4 coding sequence and promoter region. Using PCR and directed sequencing method to establish the complete intron sequence of CYP3A4 from leukocytes, the complete genomic sequence from exon 1 through 13 of CYP3A4 was determined and published in the GenBank database (accession no. AF209389). CYP3A4-specific primers were designed accordingly. After PCR-single-strand conformation polymorphism and restriction fragment length polymorphism screening, we found three novel mutations; two are point mutations and one is insertion. The first variant allele (CYP3A4*4), an Ile118Val change, was found in 3 of 102 Chinese subjects. The next allele (CYP3A4*5), which causes a Pro218Arg amino acid change, was found in 2 of 102 subjects. We found an insertion in A(17776), designated as CYP3A4*6, which causes frame shift and an early stop codon in exon 9, in one heterozygous subject. We also investigated the CYP3A4 activity in these mutant subjects by measuring the morning spot urinary 6beta-hydroxycortisol to free cortisol ratio with the enzyme-linked immunosorbent assay method. When compared with healthy Chinese population data, the 6beta-hydroxycortisol to free cortisol ratio data suggested that these alleles (CYP3A4*4, CYP3A4*5, and CYP3A4*6) may decrease the CYP3A4 activity. Incidences of these mutations in Chinese subjects are rare. The prevalence of these point mutations in other ethnic
Directory of Open Access Journals (Sweden)
Jorge S.B.
2003-01-01
Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.
Energy Technology Data Exchange (ETDEWEB)
Rozen, R.; Mascisch, A.; Scriver, C.R. (McGill Univ., Montreal (Canada)); Lambert, M. (Hopital Ste-Justine, Montreal (Canada)); Laframboise, R. (Centre Hospitalier Universite Laval, Quebec (Canada))
1994-08-01
Independent phenylketonuria (PKU) chromosomes (n=109) representing 80% of a proband cohort in Quebec province carry 18 different identified mutations in 20 different mutation/haplotype combinations. The study reported here, the third in a series on Quebec populations, was done in the Montreal region and predominantly on French Canadians. It has identified three novel mutations (A309D, D338Y, and 1054/1055delG [352fs]) and one unusual mutation/RFLP haplotype combination (E280K on Hp 2). The relative frequencies and distribution of PKU mutations were then compared in three regions and population subsets (eastern Quebec, French Canadian; western Quebec, French Canadian; and Montreal, non-French Canadian). The distributions of the prevalent and rare mutations are nonrandom and provide evidence for genetic stratification. The latter and the presence of eight unusual mutation/haplotype combinations in Quebec families with European ancestries (the aforementioned four and M1V, 165T, S349P, and R408W on Hp 1) corroborate demographic and anthropologic evidence, from elsewhere, for different origins of French Canadians in eastern and western Quebec. 29 refs., 1 fig., 1 tab.
International Nuclear Information System (INIS)
2010-01-01
Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)