WorldWideScience

Sample records for mutated primer binding

  1. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  2. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  3. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  5. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    Science.gov (United States)

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  6. Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

    Science.gov (United States)

    Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

    2015-01-01

    The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

  7. Functional impact of HIV coreceptor-binding site mutations

    International Nuclear Information System (INIS)

    Biscone, Mark J.; Miamidian, John L.; Muchiri, John M.; Baik, Sarah S.W.; Lee, Fang-Hua; Doms, Robert W.; Reeves, Jacqueline D.

    2006-01-01

    The bridging sheet region of the gp120 subunit of the HIV-1 Env protein interacts with the major virus coreceptors, CCR5 and CXCR4. We examined the impact of mutations in and adjacent to the bridging sheet region of an X4 tropic HIV-1 on membrane fusion and entry inhibitor susceptibility. When the V3-loop of this Env was changed so that CCR5 was used, the effects of these same mutations on CCR5 use were assayed as well. We found that coreceptor-binding site mutations had greater effects on CXCR4-mediated fusion and infection than when CCR5 was used as a coreceptor, perhaps related to differences in coreceptor affinity. The mutations also reduced use of the alternative coreceptors CCR3 and CCR8 to varying degrees, indicating that the bridging sheet region is important for the efficient utilization of both major and minor HIV coreceptors. As seen before with a primary R5 virus strain, bridging sheet mutations increased susceptibility to the CCR5 inhibitor TAK-779, which correlated with CCR5 binding efficiency. Bridging sheet mutations also conferred increased susceptibility to the CXCR4 ligand AMD-3100 in the context of the X4 tropic Env. However, these mutations had little effect on the rate of membrane fusion and little effect on susceptibility to enfuvirtide, a membrane fusion inhibitor whose activity is dependent in part on the rate of Env-mediated membrane fusion. Thus, mutations that reduce coreceptor binding and enhance susceptibility to coreceptor inhibitors can affect fusion and enfuvirtide susceptibility in an Env context-dependent manner

  8. Supplementary data: Novel mutation in ATP-binding domain of ...

    Indian Academy of Sciences (India)

    Novel mutation in ATP-binding domain of ABCD1 gene in adrenoleucodystrophy. Neeraj Kumar, Krishna K. Taneja, Atul Kumar, Deepti Nayar, Bhupesh Taneja, Satindra Aneja,. Madhuri Behari, Veena Kalra and Surendra K. Bansal. J. Genet. 89, 473–477. Figure 1. Rmsd plot of native and Arg617Ser substituted models.

  9. Comprehensive mutational profiling of core binding factor acute myeloid leukemia.

    Science.gov (United States)

    Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude

    2016-05-19

    Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. © 2016 by The American Society of Hematology.

  10. Mutations and binding sites of human transcription factors

    KAUST Repository

    Kamanu, Frederick Kinyua

    2012-06-01

    Mutations in any genome may lead to phenotype characteristics that determine ability of an individual to cope with adaptation to environmental challenges. In studies of human biology, among the most interesting ones are phenotype characteristics that determine responses to drug treatments, response to infections, or predisposition to specific inherited diseases. Most of the research in this field has been focused on the studies of mutation effects on the final gene products, peptides, and their alterations. Considerably less attention was given to the mutations that may affect regulatory mechanism(s) of gene expression, although these may also affect the phenotype characteristics. In this study we make a pilot analysis of mutations observed in the regulatory regions of 24,667 human RefSeq genes. Our study reveals that out of eight studied mutation types, insertions are the only one that in a statistically significant manner alters predicted transcription factor binding sites (TFBSs). We also find that 25 families of TFBSs have been altered by mutations in a statistically significant manner in the promoter regions we considered. Moreover, we find that the related transcription factors are, for example, prominent in processes related to intracellular signaling; cell fate; morphogenesis of organs and epithelium; development of urogenital system, epithelium, and tube; neuron fate commitment. Our study highlights the significance of studying mutations within the genes regulatory regions and opens way for further detailed investigations on this topic, particularly on the downstream affected pathways. 2012 Kamanu, Medvedeva, Schaefer, Jankovic, Archer and Bajic.

  11. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.

    Science.gov (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José

    2018-04-01

    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  12. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  13. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  14. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  15. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  16. SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

    Science.gov (United States)

    Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

    2016-04-12

    Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/.

  17. Mutations and binding sites of human transcription factors

    KAUST Repository

    Kamanu, Frederick Kinyua; Medvedeva, Yulia A.; Schaefer, Ulf; Jankovic, Boris R.; Archer, John A.C.; Bajic, Vladimir B.

    2012-01-01

    signaling; cell fate; morphogenesis of organs and epithelium; development of urogenital system, epithelium, and tube; neuron fate commitment. Our study highlights the significance of studying mutations within the genes regulatory regions and opens way

  18. Potential ligand-binding residues in rat olfactory receptors identified by correlated mutation analysis

    Science.gov (United States)

    Singer, M. S.; Oliveira, L.; Vriend, G.; Shepherd, G. M.

    1995-01-01

    A family of G-protein-coupled receptors is believed to mediate the recognition of odor molecules. In order to identify potential ligand-binding residues, we have applied correlated mutation analysis to receptor sequences from the rat. This method identifies pairs of sequence positions where residues remain conserved or mutate in tandem, thereby suggesting structural or functional importance. The analysis supported molecular modeling studies in suggesting several residues in positions that were consistent with ligand-binding function. Two of these positions, dominated by histidine residues, may play important roles in ligand binding and could confer broad specificity to mammalian odor receptors. The presence of positive (overdominant) selection at some of the identified positions provides additional evidence for roles in ligand binding. Higher-order groups of correlated residues were also observed. Each group may interact with an individual ligand determinant, and combinations of these groups may provide a multi-dimensional mechanism for receptor diversity.

  19. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

    1996-01-01

    , suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...... site to allow correct second-strand transfer in reverse transcription. The system thereby selects for a reverse transcriptase-mediated recombination event in the 5' untranslated region. A panel of sequence differences between the recombination partners in this region has allowed mapping of the site...

  20. The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

    Science.gov (United States)

    Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

    1998-08-17

    Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.

  1. Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis.

    Science.gov (United States)

    Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M

    2015-11-01

    Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.

  2. Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Kylie L. Gorringe

    2008-11-01

    Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.

  3. Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy.

    Science.gov (United States)

    Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc

    2006-01-01

    Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNA(Lys,2) to two distinct primer binding sites (PBS) at the genome 5' and 3' ends. Only the 5' PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells.

  4. Mutation analysis and molecular modeling for the investigation of ligand-binding modes of GPR84.

    Science.gov (United States)

    Nikaido, Yoshiaki; Koyama, Yuuta; Yoshikawa, Yasushi; Furuya, Toshio; Takeda, Shigeki

    2015-05-01

    GPR84 is a G protein-coupled receptor for medium-chain fatty acids. Capric acid and 3,3'-diindolylmethane are specific agonists for GPR84. We built a homology model of a GPR84-capric acid complex to investigate the ligand-binding mode using the crystal structure of human active-state β2-adrenergic receptor. We performed site-directed mutagenesis to subject ligand-binding sites to our model using GPR84-Giα fusion proteins and a [(35)S]GTPγS-binding assay. We compared the activity of the wild type and mutated forms of GPR84 by [(35)S]GTPγS binding to capric acid and diindolylmethane. The mutations L100D `Ballesteros-Weinstein numbering: 3.32), F101Y (3.33) and N104Q (3.36) in the transmembrane helix III and N357D (7.39) in the transmembrane helix VII resulted in reduced capric acid activity but maintained the diindolylmethane responses. Y186F (5.46) and Y186H (5.46) mutations had no characteristic effect on capric acid but with diindolylmethane they significantly affected the G protein activation efficiency. The L100D (3.32) mutant responded to decylamine, a fatty amine, instead of a natural agonist, the fatty acid capric acid, suggesting that we have identified a mutated G protein-coupled receptor-artificial ligand pairing. Our molecular model provides an explanation for these results and interactions between GPR84 and capric acid. Further, from the results of a double stimulation assay, we concluded that diindolylmethane was a positive allosteric modulator for GPR84. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  5. Structural and energetic effects of A2A adenosine receptor mutations on agonist and antagonist binding.

    Directory of Open Access Journals (Sweden)

    Henrik Keränen

    Full Text Available To predict structural and energetic effects of point mutations on ligand binding is of considerable interest in biochemistry and pharmacology. This is not only useful in connection with site-directed mutagenesis experiments, but could also allow interpretation and prediction of individual responses to drug treatment. For G-protein coupled receptors systematic mutagenesis has provided the major part of functional data as structural information until recently has been very limited. For the pharmacologically important A(2A adenosine receptor, extensive site-directed mutagenesis data on agonist and antagonist binding is available and crystal structures of both types of complexes have been determined. Here, we employ a computational strategy, based on molecular dynamics free energy simulations, to rationalize and interpret available alanine-scanning experiments for both agonist and antagonist binding to this receptor. These computer simulations show excellent agreement with the experimental data and, most importantly, reveal the molecular details behind the observed effects which are often not immediately evident from the crystal structures. The work further provides a distinct validation of the computational strategy used to assess effects of point-mutations on ligand binding. It also highlights the importance of considering not only protein-ligand interactions but also those mediated by solvent water molecules, in ligand design projects.

  6. A novel D458V mutation in the SANS PDZ binding motif causes atypical Usher syndrome.

    Science.gov (United States)

    Kalay, E; de Brouwer, A P M; Caylan, R; Nabuurs, S B; Wollnik, B; Karaguzel, A; Heister, J G A M; Erdol, H; Cremers, F P M; Cremers, C W R J; Brunner, H G; Kremer, H

    2005-12-01

    Homozygosity mapping and linkage analysis in a Turkish family with autosomal recessive prelingual sensorineural hearing loss revealed a 15-cM critical region at 17q25.1-25.3 flanked by the polymorphic markers D17S1807 and D17S1806. The maximum two-point lod score was 4.07 at theta=0.0 for the marker D17S801. The linkage interval contains the Usher syndrome 1G gene (USH1G) that is mutated in patients with Usher syndrome (USH) type 1g and encodes the SANS protein. Mutation analysis of USH1G led to the identification of a homozygous missense mutation D458V at the -3 position of the PDZ binding motif of SANS. This mutation was also present homozygously in one out of 64 additional families from Turkey with autosomal recessive nonsyndromic hearing loss and heterozygously in one out of 498 control chromosomes. By molecular modeling, we provide evidence that this mutation impairs the interaction of SANS with harmonin. Ophthalmologic examination and vestibular evaluation of patients from both families revealed mild retinitis pigmentosa and normal vestibular function. These results suggest that these patients suffer from atypical USH.

  7. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Zhiyuan Wu

    2014-01-01

    Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

  8. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Science.gov (United States)

    Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

    2014-01-01

    A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

  9. Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Leder, Verena [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Lummer, Martina [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Tegeler, Kathrin [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Humpert, Fabian [Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Lewinski, Martin [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany); Schüttpelz, Mark [Biomolecular Photonics, Faculty of Physics, Bielefeld University (Germany); Staiger, Dorothee, E-mail: dorothee.staiger@uni-bielefeld.de [Molecular Cell Physiology, Faculty of Biology, Bielefeld University (Germany)

    2014-10-10

    Highlights: • We use FCS to investigate binding site requirements for the hnRNP-like protein AtGRP7. • We identify three nucleotides critical for AtGRP7 binding to its own intron. • Mutation of the conserved R{sup 49} abolishes binding altogether. • The paralogue AtGRP8 binds to an overlapping motif with different sequence requirement. • The glycine-rich stretch of a plant hnRNP-like protein contributes to binding. - Abstract: Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased K{sub d} value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R{sup 49} that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding.

  10. Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy

    International Nuclear Information System (INIS)

    Leder, Verena; Lummer, Martina; Tegeler, Kathrin; Humpert, Fabian; Lewinski, Martin; Schüttpelz, Mark; Staiger, Dorothee

    2014-01-01

    Highlights: • We use FCS to investigate binding site requirements for the hnRNP-like protein AtGRP7. • We identify three nucleotides critical for AtGRP7 binding to its own intron. • Mutation of the conserved R 49 abolishes binding altogether. • The paralogue AtGRP8 binds to an overlapping motif with different sequence requirement. • The glycine-rich stretch of a plant hnRNP-like protein contributes to binding. - Abstract: Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased K d value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R 49 that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding

  11. A hotspot in the glucocorticoid receptor DNA-binding domain susceptible to loss of function mutation

    Science.gov (United States)

    Banuelos, Jesus; Shin, Soon Cheon; Lu, Nick Z.

    2015-01-01

    Glucocorticoids (GCs) are used to treat a variety of inflammatory disorders and certain cancers. However, GC resistance occurs in subsets of patients. We found that EL4 cells, a GC-resistant mouse thymoma cell line, harbored a point mutation in their GC receptor (GR) gene, resulting in the substitution of arginine 493 by a cysteine in the second zinc finger of the DNA-binding domain. Allelic discrimination analyses revealed that the R493C mutation occurred on both alleles. In the absence of GCs, the GR in EL4 cells localized predominantly in the cytoplasm and upon dexamethasone treatment underwent nuclear translocation, suggesting the ligand binding ability of the GR in EL4 cells was intact. In transient transfection assays, the R493C mutant could not transactivate the MMTV-luciferase reporter. Site-directed mutagenesis to revert the R493C mutation restored the transactivation activity. Cotransfection experiments showed that the R493C mutant did not inhibit the transcriptional activities of the wild-type GR. In addition, the R493C mutant did not repress either the AP-1 or NF-κB reporters as effectively as WT GR. Furthermore, stable expression of the WT GR in the EL4 cells enabled GC-mediated gene regulation, specifically upregulation of IκBα and downregulation of interferon γ and interleukin 17A. Arginine 493 is conserved among multiple species and all human nuclear receptors and its mutation has also been found in the human GR, androgen receptor, and mineralocorticoid receptor. Thus, R493 is necessary for the transcriptional activity of the GR and a hotspot for mutations that result in GC resistance. PMID:25676786

  12. A mild phenotype of dihydropyrimidine dehydrogenase deficiency and developmental retardation associated with a missense mutation affecting cofactor binding

    NARCIS (Netherlands)

    Weidensee, Sabine; Goettig, Peter; Bertone, Marko; Haas, Dorothea; Magdolen, Viktor; Kiechle, Marion; Meindl, Alfons; van Kuilenburg, André B. P.; Gross, Eva

    2011-01-01

    Evaluation of a non-synonymous mutation associated with dihydropyrimidine dehydrogenase (DPD) deficiency. DPD enzyme analysis, mutation analysis and molecular dynamics simulations based on the 3D-model of DPD. The substitution Lys63Glu is likely to affect the FAD binding pocket within the DPD

  13. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    International Nuclear Information System (INIS)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung; Park, Sun; Shin, Ho-Joon; Kim, Kyongmin

    2008-01-01

    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate 32 P-ribonucleotides, but not HBV core particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems

  14. Mutations in the RNA-binding domains of tombusvirus replicase proteins affect RNA recombination in vivo

    International Nuclear Information System (INIS)

    Panaviene, Zivile; Nagy, Peter D.

    2003-01-01

    RNA recombination, which is thought to occur due to replicase errors during viral replication, is one of the major driving forces of virus evolution. In this article, we show evidence that the replicase proteins of Cucumber necrosis virus, a tombusvirus, are directly involved in RNA recombination in vivo. Mutations within the RNA-binding domains of the replicase proteins affected the frequency of recombination observed with a prototypical defective-interfering (DI) RNA, a model template for recombination studies. Five of the 17 replicase mutants tested showed delay in the formation of recombinants when compared to the wild-type helper virus. Interestingly, two replicase mutants accelerated recombinant formation and, in addition, these mutants also increased the level of subgenomic RNA synthesis (Virology 308 (2003), 191-205). A trans-complementation system was used to demonstrate that mutation in the p33 replicase protein resulted in altered recombination rate. Isolated recombinants were mostly imprecise (nonhomologous), with the recombination sites clustered around a replication enhancer region and a putative cis-acting element, respectively. These RNA elements might facilitate the proposed template switching events by the tombusvirus replicase. Together with data in the article cited above, results presented here firmly establish that the conserved RNA-binding motif of the replicase proteins is involved in RNA replication, subgenomic RNA synthesis, and RNA recombination

  15. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  16. Canine chondrodysplasia caused by a truncating mutation in collagen-binding integrin alpha subunit 10.

    Directory of Open Access Journals (Sweden)

    Kaisa Kyöstilä

    Full Text Available The skeletal dysplasias are disorders of the bone and cartilage tissues. Similarly to humans, several dog breeds have been reported to suffer from different types of genetic skeletal disorders. We have studied the molecular genetic background of an autosomal recessive chondrodysplasia that affects the Norwegian Elkhound and Karelian Bear Dog breeds. The affected dogs suffer from disproportionate short stature dwarfism of varying severity. Through a genome-wide approach, we mapped the chondrodysplasia locus to a 2-Mb region on canine chromosome 17 in nine affected and nine healthy Elkhounds (praw = 7.42×10(-6, pgenome-wide = 0.013. The associated locus contained a promising candidate gene, cartilage specific integrin alpha 10 (ITGA10, and mutation screening of its 30 exons revealed a nonsense mutation in exon 16 (c.2083C>T; p.Arg695* that segregated fully with the disease in both breeds (p = 2.5×10(-23. A 24% mutation carrier frequency was indicated in NEs and an 8% frequency in KBDs. The ITGA10 gene product, integrin receptor α10-subunit combines into a collagen-binding α10β1 integrin receptor, which is expressed in cartilage chondrocytes and mediates chondrocyte-matrix interactions during endochondral ossification. As a consequence of the nonsense mutation, the α10-protein was not detected in the affected cartilage tissue. The canine phenotype highlights the importance of the α10β1 integrin in bone growth, and the large animal model could be utilized to further delineate its specific functions. Finally, this study revealed a candidate gene for human chondrodysplasias and enabled the development of a genetic test for breeding purposes to eradicate the disease from the two dog breeds.

  17. N1421K mutation in the glycoprotein Ib binding domain impairs ristocetin- and botrocetin-mediated binding of von Willebrand factor to platelets

    DEFF Research Database (Denmark)

    Lanke, E.; Kristoffersson, A.C.; Isaksson, C.

    2008-01-01

    , moderately decreased plasma factor VIII (FVIII) and VWF levels, and disproportionately low-plasma VWF:RCo levels. The patients were found to be heterozygous for the novel N1421K mutation, caused by a 4263C > G transversion in exon 28 of the VWF gene coding for the A1 domain. Botrocetin- and ristocetin-mediated...... binding of plasma VWF to GPIb were reduced in the patients. In vitro mutagenesis and expression in COS-7 cells confirmed the impairment of the mutant in botrocetin- and ristocetin-mediated VWF binding to GPIb. VWF collagen binding capacity was unaffected in plasma from the heterozygous individuals as well...

  18. Systemic mastocytosis uncommon in KIT D816V mutation positive core-binding factor acute myeloid leukemia

    DEFF Research Database (Denmark)

    Kristensen, Thomas; Preiss, Birgitte; Broesby-Olsen, Sigurd

    2012-01-01

    Abstract The KIT D816V mutation is detected in the vast majority of adult cases of systemic mastocytosis (SM). The mutation is also frequently detected in core-binding factor acute myeloid leukemia (CBF-AML) defined by the presence of t(8;21)(q22;q22); RUNX1-RUNX1T1 or inv(16)(p13.1;q22)/t(16;16)(p...

  19. Enhanced Human-Type Receptor Binding by Ferret-Transmissible H5N1 with a K193T Mutation.

    Science.gov (United States)

    Peng, Wenjie; Bouwman, Kim M; McBride, Ryan; Grant, Oliver C; Woods, Robert J; Verheije, Monique H; Paulson, James C; de Vries, Robert P

    2018-05-15

    All human influenza pandemics have originated from avian influenza viruses. Although multiple changes are needed for an avian virus to be able to transmit between humans, binding to human-type receptors is essential. Several research groups have reported mutations in H5N1 viruses that exhibit specificity for human-type receptors and promote respiratory droplet transmission between ferrets. Upon detailed analysis, we have found that these mutants exhibit significant differences in fine receptor specificity compared to human H1N1 and H3N2 and retain avian-type receptor binding. We have recently shown that human influenza viruses preferentially bind to α2-6-sialylated branched N-linked glycans, where the sialic acids on each branch can bind to receptor sites on two protomers of the same hemagglutinin (HA) trimer. In this binding mode, the glycan projects over the 190 helix at the top of the receptor-binding pocket, which in H5N1 would create a stearic clash with lysine at position 193. Thus, we hypothesized that a K193T mutation would improve binding to branched N-linked receptors. Indeed, the addition of the K193T mutation to the H5 HA of a respiratory-droplet-transmissible virus dramatically improves both binding to human trachea epithelial cells and specificity for extended α2-6-sialylated N-linked glycans recognized by human influenza viruses. IMPORTANCE Infections by avian H5N1 viruses are associated with a high mortality rate in several species, including humans. Fortunately, H5N1 viruses do not transmit between humans because they do not bind to human-type receptors. In 2012, three seminal papers have shown how these viruses can be engineered to transmit between ferrets, the human model for influenza virus infection. Receptor binding, among others, was changed, and the viruses now bind to human-type receptors. Receptor specificity was still markedly different compared to that of human influenza viruses. Here we report an additional mutation in ferret

  20. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    OpenAIRE

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A

    1997-01-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...

  1. Hb taradale [beta82(EF6)Lys-->Arg]: a novel mutation at a 2,3-diphosphoglycerate binding site.

    Science.gov (United States)

    Brennan, Stephen O; Sheen, Campbell; Chan, Tim; George, Peter M

    2005-01-01

    Hb Taradale [beta82(EF6)Lys-->Arg] was initially detected as a split Hb A0 peak on Hb A1c, monitoring. Red cell parameters, hemoglobin (Hb) electrophoresis and stability tests were normal. Mass spectrometry (ms) clearly identified a variant beta chain with a mass increase of 28 Da and peptide mapping located the mutation site to peptide betaT-9. DNA sequencing confirmed the presence of a novel beta82(EF6)Lys-->Arg mutation. This conservative substitution at a 2,3-diphosphoglycerate (2,3-DPG) binding site did not, however, appear to affect the P50 for oxygen binding.

  2. Predicting Binding Free Energy Change Caused by Point Mutations with Knowledge-Modified MM/PBSA Method.

    Directory of Open Access Journals (Sweden)

    Marharyta Petukh

    2015-07-01

    Full Text Available A new methodology termed Single Amino Acid Mutation based change in Binding free Energy (SAAMBE was developed to predict the changes of the binding free energy caused by mutations. The method utilizes 3D structures of the corresponding protein-protein complexes and takes advantage of both approaches: sequence- and structure-based methods. The method has two components: a MM/PBSA-based component, and an additional set of statistical terms delivered from statistical investigation of physico-chemical properties of protein complexes. While the approach is rigid body approach and does not explicitly consider plausible conformational changes caused by the binding, the effect of conformational changes, including changes away from binding interface, on electrostatics are mimicked with amino acid specific dielectric constants. This provides significant improvement of SAAMBE predictions as indicated by better match against experimentally determined binding free energy changes over 1300 mutations in 43 proteins. The final benchmarking resulted in a very good agreement with experimental data (correlation coefficient 0.624 while the algorithm being fast enough to allow for large-scale calculations (the average time is less than a minute per mutation.

  3. In silico analysis of conformational changes induced by mutation of aromatic binding residues: consequences for drug binding in the hERG K+ channel.

    Directory of Open Access Journals (Sweden)

    Kirsten Knape

    Full Text Available Pharmacological inhibition of cardiac hERG K(+ channels is associated with increased risk of lethal arrhythmias. Many drugs reduce hERG current by directly binding to the channel, thereby blocking ion conduction. Mutation of two aromatic residues (F656 and Y652 substantially decreases the potency of numerous structurally diverse compounds. Nevertheless, some drugs are only weakly affected by mutation Y652A. In this study we utilize molecular dynamics simulations and docking studies to analyze the different effects of mutation Y652A on a selected number of hERG blockers. MD simulations reveal conformational changes in the binding site induced by mutation Y652A. Loss of π-π-stacking between the two aromatic residues induces a conformational change of the F656 side chain from a cavity facing to cavity lining orientation. Docking studies and MD simulations qualitatively reproduce the diverse experimentally observed modulatory effects of mutation Y652A and provide a new structural interpretation for the sensitivity differences.

  4. Rescue of Na+ and H+ binding in Na+,K+-ATPase M8 aspartate mutants by secondary mutation

    DEFF Research Database (Denmark)

    Holm, Rikke; Einholm, Anja P.; Andersen, Jens Peter

    A mutation replacing the aspartate in transmembrane segment M8 in the a3-isoform of Na,K-ATPase with asparagine has been found in patients with rapid-onset dystonia parkinsonism or alternating hemiplegia of childhood. This aspartate may be a critical Na+ coordinating residue, but the crystal......-isoforms of Na,K-ATPase, and much smaller effects were seen for other mutations to the M8 aspartate, which were less disruptive of Na+ binding than mutations to other residues related to Na+ site III. The D928 (rat a1 numbering) mutations strongly diminished the cooperativity of Na+ binding. Moreover the p......H optimum of Na,K-ATPase activity was left-shifted, again with D928N being most disruptive. The reduced affinity for activating Na+ and for inhibitory protons, caused by D928N and D928A mutations, could be rescued by introduction of an additional mutation of a glutamate located far away from D928....

  5. GTP Binding and Oncogenic Mutations May Attenuate Hypervariable Region (HVR)-Catalytic Domain Interactions in Small GTPase K-Ras4B, Exposing the Effector Binding Site*

    Science.gov (United States)

    Lu, Shaoyong; Banerjee, Avik; Jang, Hyunbum; Zhang, Jian; Gaponenko, Vadim; Nussinov, Ruth

    2015-01-01

    K-Ras4B, a frequently mutated oncogene in cancer, plays an essential role in cell growth, differentiation, and survival. Its C-terminal membrane-associated hypervariable region (HVR) is required for full biological activity. In the active GTP-bound state, the HVR interacts with acidic plasma membrane (PM) headgroups, whereas the farnesyl anchors in the membrane; in the inactive GDP-bound state, the HVR may interact with both the PM and the catalytic domain at the effector binding region, obstructing signaling and nucleotide exchange. Here, using molecular dynamics simulations and NMR, we aim to figure out the effects of nucleotides (GTP and GDP) and frequent (G12C, G12D, G12V, G13D, and Q61H) and infrequent (E37K and R164Q) oncogenic mutations on full-length K-Ras4B. The mutations are away from or directly at the HVR switch I/effector binding site. Our results suggest that full-length wild-type GDP-bound K-Ras4B (K-Ras4BWT-GDP) is in an intrinsically autoinhibited state via tight HVR-catalytic domain interactions. The looser association in K-Ras4BWT-GTP may release the HVR. Some of the oncogenic mutations weaken the HVR-catalytic domain association in the K-Ras4B-GDP/-GTP bound states, which may facilitate the HVR disassociation in a nucleotide-independent manner, thereby up-regulating oncogenic Ras signaling. Thus, our results suggest that mutations can exert their effects in more than one way, abolishing GTP hydrolysis and facilitating effector binding. PMID:26453300

  6. GTP Binding and Oncogenic Mutations May Attenuate Hypervariable Region (HVR)-Catalytic Domain Interactions in Small GTPase K-Ras4B, Exposing the Effector Binding Site.

    Science.gov (United States)

    Lu, Shaoyong; Banerjee, Avik; Jang, Hyunbum; Zhang, Jian; Gaponenko, Vadim; Nussinov, Ruth

    2015-11-27

    K-Ras4B, a frequently mutated oncogene in cancer, plays an essential role in cell growth, differentiation, and survival. Its C-terminal membrane-associated hypervariable region (HVR) is required for full biological activity. In the active GTP-bound state, the HVR interacts with acidic plasma membrane (PM) headgroups, whereas the farnesyl anchors in the membrane; in the inactive GDP-bound state, the HVR may interact with both the PM and the catalytic domain at the effector binding region, obstructing signaling and nucleotide exchange. Here, using molecular dynamics simulations and NMR, we aim to figure out the effects of nucleotides (GTP and GDP) and frequent (G12C, G12D, G12V, G13D, and Q61H) and infrequent (E37K and R164Q) oncogenic mutations on full-length K-Ras4B. The mutations are away from or directly at the HVR switch I/effector binding site. Our results suggest that full-length wild-type GDP-bound K-Ras4B (K-Ras4B(WT)-GDP) is in an intrinsically autoinhibited state via tight HVR-catalytic domain interactions. The looser association in K-Ras4B(WT)-GTP may release the HVR. Some of the oncogenic mutations weaken the HVR-catalytic domain association in the K-Ras4B-GDP/-GTP bound states, which may facilitate the HVR disassociation in a nucleotide-independent manner, thereby up-regulating oncogenic Ras signaling. Thus, our results suggest that mutations can exert their effects in more than one way, abolishing GTP hydrolysis and facilitating effector binding. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Mutational analysis of the antagonist-binding site of the histamine H(1) receptor.

    Science.gov (United States)

    Wieland, K; Laak, A M; Smit, M J; Kühne, R; Timmerman, H; Leurs, R

    1999-10-15

    We combined in a previously derived three-dimensional model of the histamine H(1) receptor (Ter Laak, A. M., Timmerman, H., Leurs, H., Nederkoorn, P. H. J., Smit, M. J., and Donne-Op den Kelder, G. M. (1995) J. Comp. Aid. Mol. Design. 9, 319-330) a pharmacophore for the H(1) antagonist binding site (Ter Laak, A. M., Venhorst, J., Timmerman, H., and Donné-Op de Kelder, G. M. (1994) J. Med. Chem. 38, 3351-3360) with the known interacting amino acid residue Asp(116) (in transmembrane domain III) of the H(1) receptor and verified the predicted receptor-ligand interactions by site-directed mutagenesis. This resulted in the identification of the aromatic amino acids Trp(167), Phe(433), and Phe(436) in transmembrane domains IV and VI of the H(1) receptor as probable interaction points for the trans-aromatic ring of the H(1) antagonists. Subsequently, a specific interaction of carboxylate moieties of two therapeutically important, zwitterionic H(1) antagonists with Lys(200) in transmembrane domain V was predicted. A Lys(200) --> Ala mutation results in a 50- (acrivastine) to 8-fold (d-cetirizine) loss of affinity of these zwitterionic antagonists. In contrast, the affinities of structural analogs of acrivastine and cetirizine lacking the carboxylate group, triprolidine and meclozine, respectively, are unaffected by the Lys(200) --> Ala mutation. These data strongly suggest that Lys(200), unique for the H(1) receptor, acts as a specific anchor point for these "second generation" H(1) antagonists.

  8. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

    Science.gov (United States)

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  9. Combining structural modeling with ensemble machine learning to accurately predict protein fold stability and binding affinity effects upon mutation.

    Directory of Open Access Journals (Sweden)

    Niklas Berliner

    Full Text Available Advances in sequencing have led to a rapid accumulation of mutations, some of which are associated with diseases. However, to draw mechanistic conclusions, a biochemical understanding of these mutations is necessary. For coding mutations, accurate prediction of significant changes in either the stability of proteins or their affinity to their binding partners is required. Traditional methods have used semi-empirical force fields, while newer methods employ machine learning of sequence and structural features. Here, we show how combining both of these approaches leads to a marked boost in accuracy. We introduce ELASPIC, a novel ensemble machine learning approach that is able to predict stability effects upon mutation in both, domain cores and domain-domain interfaces. We combine semi-empirical energy terms, sequence conservation, and a wide variety of molecular details with a Stochastic Gradient Boosting of Decision Trees (SGB-DT algorithm. The accuracy of our predictions surpasses existing methods by a considerable margin, achieving correlation coefficients of 0.77 for stability, and 0.75 for affinity predictions. Notably, we integrated homology modeling to enable proteome-wide prediction and show that accurate prediction on modeled structures is possible. Lastly, ELASPIC showed significant differences between various types of disease-associated mutations, as well as between disease and common neutral mutations. Unlike pure sequence-based prediction methods that try to predict phenotypic effects of mutations, our predictions unravel the molecular details governing the protein instability, and help us better understand the molecular causes of diseases.

  10. Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

    Science.gov (United States)

    Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

    2014-01-01

    Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are

  11. One-step isothermal detection of multiple KRAS mutations by forming SNP specific hairpins on a gold nanoshell.

    Science.gov (United States)

    Chung, Chan Ho; Kim, Joong Hyun

    2018-04-24

    We developed a one-step isothermal method for typing multiple KRAS mutations using a designed set of primers to form a hairpin on a gold nanoshell upon being ligated by a SNP specific DNA ligase after binding of targets. As a result, we could detect as low as 20 attomoles of KRAS mutations within 1 h.

  12. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    Science.gov (United States)

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Insights into the binding specificity of wild type and mutated wheat germ agglutinin towards Neu5Acα(2-3)Gal: a study by in silico mutations and molecular dynamics simulations.

    Science.gov (United States)

    Parasuraman, Ponnusamy; Murugan, Veeramani; Selvin, Jeyasigamani F A; Gromiha, M Michael; Fukui, Kazuhiko; Veluraja, Kasinadar

    2014-08-01

    Wheat germ agglutinin (WGA) is a plant lectin, which specifically recognizes the sugars NeuNAc and GlcNAc. Mutated WGA with enhanced binding specificity can be used as biomarkers for cancer. In silico mutations are performed at the active site of WGA to enhance the binding specificity towards sialylglycans, and molecular dynamics simulations of 20 ns are carried out for wild type and mutated WGAs (WGA1, WGA2, and WGA3) in complex with sialylgalactose to examine the change in binding specificity. MD simulations reveal the change in binding specificity of wild type and mutated WGAs towards sialylgalactose and bound conformational flexibility of sialylgalactose. The mutated polar amino acid residues Asn114 (S114N), Lys118 (G118K), and Arg118 (G118R) make direct and water mediated hydrogen bonds and hydrophobic interactions with sialylgalactose. An analysis of possible hydrogen bonds, hydrophobic interactions, total pair wise interaction energy between active site residues and sialylgalactose and MM-PBSA free energy calculation reveals the plausible binding modes and the role of water in stabilizing different binding modes. An interesting observation is that the binding specificity of mutated WGAs (cyborg lectin) towards sialylgalactose is found to be higher in double point mutation (WGA3). One of the substituted residues Arg118 plays a crucial role in sugar binding. Based on the interactions and energy calculations, it is concluded that the order of binding specificity of WGAs towards sialylgalactose is WGA3 > WGA1 > WGA2 > WGA. On comparing with the wild type, double point mutated WGA (WGA3) exhibits increased specificity towards sialylgalactose, and thus, it can be effectively used in targeted drug delivery and as biological cell marker in cancer therapeutics. Copyright © 2014 John Wiley & Sons, Ltd.

  14. Lack of hormone binding in COS-7 cells expressing a mutated growth hormone receptor found in Laron dwarfism.

    Science.gov (United States)

    Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A

    1993-01-01

    A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064

  15. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    Directory of Open Access Journals (Sweden)

    Jian Li

    2017-02-01

    Full Text Available The efficacy of anaplastic lymphoma kinase (ALK positive non-small-cell lung cancer (NSCLC treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer.

  16. Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

    Science.gov (United States)

    Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

    2018-01-01

    "Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  17. Mutational analysis of the pumpkin (Cucurbita maxima) phloem exudate lectin, PP2 reveals Ser-104 is crucial for carbohydrate binding.

    Science.gov (United States)

    Bobbili, Kishore Babu; Bandari, Shyam; Grobe, Kay; Swamy, Musti J

    2014-07-18

    The pumpkin phloem lectin (PP2) is an RNA-binding, defense-related, chitooligosaccharide-specific, homodimeric lectin of Mr 48 kDa expressed at high concentrations in the sieve elements and companion cells of pumpkin (Cucurbita maxima). In the present study, PP2 was expressed in the methylotrophic yeast Pichia pastoris with the Saccharomyces α-factor sequence to direct the recombinant protein into the secretory pathway as a prerequisite for unimpaired folding and posttranslational glycosylation of recombinant PP2. Previous computational modeling and ligand docking studies predicted a putative chitooligosaccharide-binding site on the PP2 surface, which was divided into three subsites, with two amino acid residues in each subsite identified as possible candidates for interaction with chitooligosaccharides (CHOs). In this work, mutational analysis and hemagglutination assays were employed to verify the role of the predicted residues in the carbohydrate binding activity of the protein. The results obtained revealed that mutation of Ser-104 to Ala (S104A) at subsite-2 resulted in about 90% loss of agglutination activity of the protein, indicating that Ser-104 is crucial for the binding of CHOs to PP2. Also, L100A (at subsite-1) and K200A (at subsite-3) independently decreased the lectin activity by about 40%, indicating that these two residues also contribute significantly to sugar binding by PP2. Together, these findings confirm that all the three subsites contribute to varying degrees toward PP2-carbohydrate interaction, and confirm the validity of the computational model, as proposed earlier. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. New Mutations of Penicillin-Binding Proteins in Streptococcus agalactiae Isolates from Cattle with Decreased Susceptibility to Penicillin.

    Science.gov (United States)

    Hu, Yun; Kan, Yunchao; Zhang, Zhengtian; Lu, Zhanning; Li, Yanqiu; Leng, Chaoliang; Ji, Jun; Song, Shiyang; Shi, Hongfei

    2018-02-23

    Streptococcus agalactiae is a causal agent of bovine mastitis and is treated by β-lactam antibiotics (BLAs). Compared to penicillin-resistant S. agalactiae from humans, resistant strains in bovine are rarely reported. In this study, we aimed to investigate BLA resistance and mutations in penicillin-binding proteins (PBPs) of S. agalactiae in central and northeast China. The minimum inhibitory concentrations (MICs) of 129 penicillin-resistant S. agalactiae isolates from cows with mastitis were determined, and the related PBP genes were detected and sequenced. All strains were unsusceptible to penicillin G and mostly resistant to ampicillin, cefalexin, and ceftiofur sodium. One hundred twenty-nine strains were divided into 4 clonal groups and 8 sequence types by multilocus sequence typing analysis. We found a set of new substitutions in PBP1B, PBP2B, and PBP2X from most strains isolated from three provinces. The strains with high PBP mutations showed a broader unsusceptible spectrum and higher MICs than those with few or single mutation. Our research indicates unpredicted mutations in the PBP genes of S. agalactiae isolated from cows with mastitis treated by BLAs. This screening is the first of S. agalactiae from cattle.

  19. Genetic and epigenetic mutations affect the DNA binding capability of human ZFP57 in transient neonatal diabetes type 1.

    Science.gov (United States)

    Baglivo, Ilaria; Esposito, Sabrina; De Cesare, Lucia; Sparago, Angela; Anvar, Zahra; Riso, Vincenzo; Cammisa, Marco; Fattorusso, Roberto; Grimaldi, Giovanna; Riccio, Andrea; Pedone, Paolo V

    2013-05-21

    In the mouse, ZFP57 contains three classical Cys2His2 zinc finger domains (ZF) and recognizes the methylated TGC(met)CGC target sequence using the first and the second ZFs. In this study, we demonstrate that the human ZFP57 (hZFP57) containing six Cys2His2 ZFs, binds the same methylated sequence through the third and the fourth ZFs, and identify the aminoacids critical for DNA interaction. In addition, we present evidences indicating that hZFP57 mutations and hypomethylation of the TNDM1 ICR both associated with Transient Neonatal Diabetes Mellitus type 1 result in loss of hZFP57 binding to the TNDM1 locus, likely causing PLAGL1 activation. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. Mutations that silence constitutive signaling activity in the allosteric ligand-binding site of the thyrotropin receptor.

    Science.gov (United States)

    Haas, Ann-Karin; Kleinau, Gunnar; Hoyer, Inna; Neumann, Susanne; Furkert, Jens; Rutz, Claudia; Schülein, Ralf; Gershengorn, Marvin C; Krause, Gerd

    2011-01-01

    The thyrotropin receptor (TSHR) exhibits elevated cAMP signaling in the basal state and becomes fully activated by thyrotropin. Previously we presented evidence that small-molecule ligands act allosterically within the transmembrane region in contrast to the orthosteric extracellular hormone-binding sites. Our goal in this study was to identify positions that surround the allosteric pocket and that are sensitive for inactivation of TSHR. Homology modeling combined with site-directed mutagenesis and functional characterization revealed seven mutants located in the allosteric binding site that led to a decrease of basal cAMP signaling activity. The majority of these silencing mutations, which constrain the TSHR in an inactive conformation, are found in two clusters when mapped onto the 3D structural model. We suggest that the amino acid positions identified herein are indicating locations where small-molecule antagonists, both neutral antagonists and inverse agonists, might interfere with active TSHR conformations.

  1. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  2. A mutation in a functional Sp1 binding site of the telomerase RNA gene (hTERC promoter in a patient with Paroxysmal Nocturnal Haemoglobinuria

    Directory of Open Access Journals (Sweden)

    Mason Philip J

    2004-06-01

    Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.

  3. A single mutation in Taiwanese H6N1 influenza hemagglutinin switches binding to human-type receptors

    Energy Technology Data Exchange (ETDEWEB)

    de Vries, Robert P.; Tzarum, Netanel; Peng, Wenjie; Thompson, Andrew J.; Ambepitiya Wickramasinghe, Iresha N.; de la Pena, Alba T. Torrents; van Breemen, Marielle J.; Bouwman, Kim M.; Zhu, Xueyong; McBride, Ryan; Yu, Wenli; Sanders, Rogier W.; Verheije, Monique H.; Wilson, Ian A.; Paulson, James C.

    2017-07-10

    In June 2013, the first case of human infection with an avian H6N1 virus was reported in a Taiwanese woman. Although this was a single non-fatal case, the virus continues to circulate in Taiwanese poultry. As with any emerging avian virus that infects humans, there is concern that acquisition of human-type receptor specificity could enable transmission in the human population. Despite mutations in the receptor-binding pocket of the human H6N1 isolate, it has retained avian-type (NeuAcα2-3Gal) receptor specificity. However, we show here that a single nucleotide substitution, resulting in a change from Gly to Asp at position 225 (G225D), completely switches specificity to human-type (NeuAcα2-6Gal) receptors. Significantly, G225D H6 loses binding to chicken trachea epithelium and is now able to bind to human tracheal tissue. Structural analysis reveals that Asp225 directly interacts with the penultimate Gal of the human-type receptor, stabilizing human receptor binding.

  4. Improved detection of genetic markers of antimicrobial resistance by hybridization probe-based melting curve analysis using primers to mask proximal mutations: examples include the influenza H275Y substitution.

    Science.gov (United States)

    Whiley, David M; Jacob, Kevin; Nakos, Jennifer; Bletchly, Cheryl; Nimmo, Graeme R; Nissen, Michael D; Sloots, Theo P

    2012-06-01

    Numerous real-time PCR assays have been described for detection of the influenza A H275Y alteration. However, the performance of these methods can be undermined by sequence variation in the regions flanking the codon of interest. This is a problem encountered more broadly in microbial diagnostics. In this study, we developed a modification of hybridization probe-based melting curve analysis, whereby primers are used to mask proximal mutations in the sequence targets of hybridization probes, so as to limit the potential for sequence variation to interfere with typing. The approach was applied to the H275Y alteration of the influenza A (H1N1) 2009 strain, as well as a Neisseria gonorrhoeae mutation associated with antimicrobial resistance. Assay performances were assessed using influenza A and N. gonorrhoeae strains characterized by DNA sequencing. The modified hybridization probe-based approach proved successful in limiting the effects of proximal mutations, with the results of melting curve analyses being 100% consistent with the results of DNA sequencing for all influenza A and N. gonorrhoeae strains tested. Notably, these included influenza A and N. gonorrhoeae strains exhibiting additional mutations in hybridization probe targets. Of particular interest was that the H275Y assay correctly typed influenza A strains harbouring a T822C nucleotide substitution, previously shown to interfere with H275Y typing methods. Overall our modified hybridization probe-based approach provides a simple means of circumventing problems caused by sequence variation, and offers improved detection of the influenza A H275Y alteration and potentially other resistance mechanisms.

  5. Mechanism of DNA–binding loss upon single-point mutation in p53

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    loss in protein−DNA binding affinity and specificity upon single point ..... we computed the root–mean–square–deviations (RMSDs) of each residue's ...... Petsko G and Ringe D 1984 Fluctuations in protein structure from. X-ray diffraction; Annu.

  6. Ubiquinone accumulates in the mitochondria of yeast mutated in the ubiquinone binding protein, Qcr8p

    International Nuclear Information System (INIS)

    Hagerman, Ruth A.; Waring, Natashya J.; Willis, Richard A.; Hagerman, Ann E.

    2006-01-01

    In Saccharomyces cerevisiae, the trans-membrane helix of Qcr8p, the ubiquinone binding protein of complex III, contributes to the Q binding site. In wild-type cells, residue 62 of the helix is non-polar (proline). Substitution of proline 62 with a polar, uncharged residue does not impair the ability of the cells to respire, complex III assembly is unaffected, ubiquinone occupancy of the Q binding site is unchanged, and mitochondrial ubiquinone levels are in the wild-type range. Substitution with a +1 charged residue is associated with partial respiratory competence, impaired complex III assembly, and loss of cytochrome b. Although ubiquinone occupancy of the Q binding site is similar to wild-type, total mitochondrial ubiquinone doubled in these mutants. Mutants with a +2 charged substitution at position 62 are unable to respire. These results suggest that the accumulation of ubiquinone in the mitochondria may be a compensatory mechanism for impaired electron transport at cytochrome b

  7. Electrophysiological analysis of the mutated Na,K-ATPase cation binding pocket.

    NARCIS (Netherlands)

    Koenderink, J.B.; Geibel, S.; Grabsch, E.; Pont, J.J.H.H.M. de; Bamberg, E.; Friedrich, T.

    2003-01-01

    Na,K-ATPase mediates net electrogenic transport by extruding three Na+ ions and importing two K+ ions across the plasma membrane during each reaction cycle. We mutated putative cation coordinating amino acids in transmembrane hairpin M5-M6 of rat Na,K-ATPase: Asp776 (Gln, Asp, Ala), Glu779 (Asp,

  8. Mutations in the polyglutamine binding protein 1 gene cause X-linked mental retardation.

    NARCIS (Netherlands)

    Kalscheuer, V.M.M.; Freude, K.; Musante, L.; Jensen, L.R.; Yntema, H.G.; Gecz, J.; Sefiani, A.; Hoffmann, K.; Moser, B.; Haas, S.; Gurok, U.; Haesler, S.; Aranda, B.; Nshedjan, A.; Tzschach, A.; Hartmann, N.; Roloff, T.C.; Shoichet, S.; Hagens, O.; Tao, J.; Bokhoven, J.H.L.M. van; Turner, G.; Chelly, J.; Moraine, C.; Fryns, J.P.; Nuber, U.; Hoeltzenbein, M.; Scharff, C.; Scherthan, H.; Lenzner, S.; Hamel, B.C.J.; Schweiger, S.; Ropers, H.H.

    2003-01-01

    We found mutations in the gene PQBP1 in 5 of 29 families with nonsyndromic (MRX) and syndromic (MRXS) forms of X-linked mental retardation (XLMR). Clinical features in affected males include mental retardation, microcephaly, short stature, spastic paraplegia and midline defects. PQBP1 has previously

  9. Mutations in the polyglutamine binding protein 1 gene cause X-linked mental retardation

    DEFF Research Database (Denmark)

    Kalscheuer, Vera M; Freude, Kristine; Musante, Luciana

    2003-01-01

    We found mutations in the gene PQBP1 in 5 of 29 families with nonsyndromic (MRX) and syndromic (MRXS) forms of X-linked mental retardation (XLMR). Clinical features in affected males include mental retardation, microcephaly, short stature, spastic paraplegia and midline defects. PQBP1 has previou...

  10. Mutations in the polyglutamine binding protein 1 gene cause X-linked mental retardation

    NARCIS (Netherlands)

    Kalscheuer, VM; Freude, K; Musante, L; Jensen, LR; Yntema, HG; Gecz, J; Sefiani, A; Hoffmann, K; Moser, B; Haas, S; Gurok, U; Haesler, S; Aranda, B; Nshedjan, A; Tzschach, A; Hartmann, N; Roloff, TC; Shoichet, S; Hagens, O; Tao, J; van Bokhoven, H; Turner, G; Chelly, J; Moraine, C; Fryns, JP; Nuber, U; Hoeltzenbein, M; Scharff, C; Scherthan, H; Lenzner, S; Hamel, BCJ; Schweiger, S; Ropers, Hans-Hilger

    2003-01-01

    We found mutations in the gene PQBP1 in 5 of 29 families with nonsyndromic (MRX) and syndromic (MRXS) forms of X-linked mental retardation (XLMR). Clinical features in affected males include mental retardation, microcephaly, short stature, spastic paraplegia and midline defects. PQBP1 has previously

  11. Tyr120Asp mutation alters domain flexibility and dynamics of MeCP2 DNA binding domain leading to impaired DNA interaction: Atomistic characterization of a Rett syndrome causing mutation.

    Science.gov (United States)

    D'Annessa, Ilda; Gandaglia, Anna; Brivio, Elena; Stefanelli, Gilda; Frasca, Angelisa; Landsberger, Nicoletta; Di Marino, Daniele

    2018-05-01

    Mutations in the X-linked MECP2 gene represent the main origin of Rett syndrome, causing a profound intellectual disability in females. MeCP2 is an epigenetic transcriptional regulator containing two main functional domains: a methyl-CpG binding domain (MBD) and a transcription repression domain (TRD). Over 600 pathogenic mutations were reported to affect the whole protein; almost half of missense mutations affect the MBD. Understanding the impact of these mutations on the MBD structure and interaction with DNA will foster the comprehension of their pathogenicity and possibly genotype/phenotype correlation studies. Herein, we use molecular dynamics simulations to obtain a detailed view of the dynamics of WT and mutated MBD in the presence and absence of DNA. The pathogenic mutation Y120D is used as paradigm for our studies. Further, since the Y120 residue was previously found to be a phosphorylation site, we characterize the dynamic profile of the MBD also in the presence of Y120 phosphorylation (pY120). We found that addition of a phosphate group to Y120 or mutation in aspartic acid affect domain mobility that samples an alternative conformational space with respect to the WT, leading to impaired ability to interact with DNA. Experimental assays showing a significant reduction in the binding affinity between the mutated MBD and the DNA confirmed our predictions. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  13. Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis

    Science.gov (United States)

    Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.

    2016-01-01

    SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499

  14. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    Directory of Open Access Journals (Sweden)

    Chang Jan-Gowth

    2011-10-01

    Full Text Available Abstract Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser and the hotspot mutation (p.Ala84Thr from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD simulations and normal mode analysis (NMA, we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

  15. Ancestral mutations as a tool for solubilizing proteins: The case of a hydrophobic phosphate-binding protein

    Directory of Open Access Journals (Sweden)

    Daniel Gonzalez

    2014-01-01

    Full Text Available Stable and soluble proteins are ideal candidates for functional and structural studies. Unfortunately, some proteins or enzymes can be difficult to isolate, being sometimes poorly expressed in heterologous systems, insoluble and/or unstable. Numerous methods have been developed to address these issues, from the screening of various expression systems to the modification of the target protein itself. Here we use a hydrophobic, aggregation-prone, phosphate-binding protein (HPBP as a case study. We describe a simple and fast method that selectively uses ancestral mutations to generate a soluble, stable and functional variant of the target protein, here named sHPBP. This variant is highly expressed in Escherichia coli, is easily purified and its structure was solved at much higher resolution than its wild-type progenitor (1.3 versus 1.9 Å, respectively.

  16. A mutation in the glutamate-rich region of RNA-binding motif protein 20 causes dilated cardiomyopathy through missplicing of titin and impaired Frank-Starling mechanism

    DEFF Research Database (Denmark)

    Beqqali, Abdelaziz; Bollen, I. A. E.; Rasmussen, T. B.

    2016-01-01

    Mutations in the RS-domain of RNA-binding motif protein 20 (RBM20) have recently been identified to segregate with aggressive forms of familial dilated cardiomyopathy (DCM). Loss of RBM20 in rats results in missplicing of the sarcomeric gene titin (TTN). The functional and physiological consequen......Mutations in the RS-domain of RNA-binding motif protein 20 (RBM20) have recently been identified to segregate with aggressive forms of familial dilated cardiomyopathy (DCM). Loss of RBM20 in rats results in missplicing of the sarcomeric gene titin (TTN). The functional and physiological...... consequences of RBM20 mutations outside the mutational hotspot of RBM20 have not been explored to date. In this study, we investigated the pathomechanism of DCM caused by a novel RBM20 mutation in human cardiomyocytes. We identified a family with DCM carrying a mutation (RBM20(E913K/+)) in a glutamate...... to the early onset, and malignant course of DCM caused by RBM20 mutations. Altogether, our results demonstrate that heterozygous loss of RBM20 suffices to profoundly impair myocyte biomechanics by its disturbance of TTN splicing....

  17. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Mutations in the nucleotide binding pocket of MreB can alter cell curvature and polar morphology in Caulobacter.

    Science.gov (United States)

    Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A

    2011-07-01

    The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.

  19. Transforming activity and therapeutic targeting of C-terminal-binding protein 2 in Apc-mutated neoplasia.

    Science.gov (United States)

    Sumner, E T; Chawla, A T; Cororaton, A D; Koblinski, J E; Kovi, R C; Love, I M; Szomju, B B; Korwar, S; Ellis, K C; Grossman, S R

    2017-08-17

    Overexpression of the transcriptional coregulators C-terminal binding proteins 1 and 2 (CtBP1 and 2) occurs in many human solid tumors and is associated with poor prognosis. CtBP modulates oncogenic gene expression programs and is an emerging drug target, but its oncogenic role is unclear. Consistent with this oncogenic potential, exogenous CtBP2 transformed primary mouse and human cells to anchorage independence similarly to mutant H-Ras. To investigate CtBP's contribution to in vivo tumorigenesis, Apc min/+ mice, which succumb to massive intestinal polyposis, were bred to Ctbp2 +/- mice. CtBP interacts with adenomatous polyposis coli (APC) protein, and is stabilized in both APC-mutated human colon cancers and Apc min/+ intestinal polyps. Ctbp2 heterozygosity increased the median survival of Apc min/+ mice from 21 to 48 weeks, and reduced polyp formation by 90%, with Ctbp2 +/- polyps exhibiting reduced levels of β-catenin and its oncogenic transcriptional target, cyclin D1. CtBP's potential as a therapeutic target was studied by treating Apc min/+ mice with the CtBP small-molecule inhibitors 4-methylthio-2-oxobutyric acid and 2-hydroxy-imino phenylpyruvic acid, both of which reduced polyposis by more than half compared with vehicle treatment. Phenocopying Ctbp2 deletion, both Ctbp inhibitors caused substantial decreases in the protein level of Ctbp2, as well its oncogenic partner β-catenin, and the effects of the inhibitors on CtBP and β-catenin levels could be modeled in an APC-mutated human colon cancer cell line. CtBP2 is thus a druggable transforming oncoprotein critical for the evolution of neoplasia driven by Apc mutation.

  20. A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

    Directory of Open Access Journals (Sweden)

    Gao Chen

    2012-02-01

    Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.

  1. A mutation in the heparin-binding site of noggin as a novel mechanism of proximal symphalangism and conductive hearing loss.

    Science.gov (United States)

    Masuda, Sawako; Namba, Kazunori; Mutai, Hideki; Usui, Satoko; Miyanaga, Yuko; Kaneko, Hiroki; Matsunaga, Tatsuo

    2014-05-09

    The access of bone morphogenetic protein (BMP) to the BMP receptors on the cell surface is regulated by its antagonist noggin, which binds to heparan-sulfate proteoglycans on the cell surface. Noggin is encoded by NOG and mutations in the gene are associated with aberrant skeletal formation, such as in the autosomal dominant disorders proximal symphalangism (SYM1), multiple synostoses syndrome, Teunissen-Cremers syndrome, and tarsal-carpal coalition syndrome. NOG mutations affecting a specific function may produce a distinct phenotype. In this study, we investigated a Japanese pedigree with SYM1 and conductive hearing loss and found that it carried a novel heterozygous missense mutation of NOG (c.406C>T; p.R136C) affecting the heparin-binding site of noggin. As no mutations of the heparin-binding site of noggin have previously been reported, we investigated the crystal structure of wild-type noggin to investigate molecular mechanism of the p.R136C mutation. We found that the positively charged arginine at position 136 was predicted to be important for binding to the negatively charged heparan-sulfate proteoglycan (HSPG). An in silico docking analysis showed that one of the salt bridges between noggin and heparin disappeared following the replacement of the arginine with a non-charged cysteine. We propose that the decreased binding affinity of NOG with the p.R136C mutation to HSPG leads to an excess of BMP signaling and underlies the SYM1 and conductive hearing loss phenotype of carriers. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Estimation of the Binding Free Energy of AC1NX476 to HIV-1 Protease Wild Type and Mutations Using Free Energy Perturbation Method.

    Science.gov (United States)

    Ngo, Son Tung; Mai, Binh Khanh; Hiep, Dinh Minh; Li, Mai Suan

    2015-10-01

    The binding mechanism of AC1NX476 to HIV-1 protease wild type and mutations was studied by the docking and molecular dynamics simulations. The binding free energy was calculated using the double-annihilation binding free energy method. It is shown that the binding affinity of AC1NX476 to wild type is higher than not only ritonavir but also darunavir, making AC1NX476 become attractive candidate for HIV treatment. Our theoretical results are in excellent agreement with the experimental data as the correlation coefficient between calculated and experimentally measured binding free energies R = 0.993. Residues Asp25-A, Asp29-A, Asp30-A, Ile47-A, Gly48-A, and Val50-A from chain A, and Asp25-B from chain B play a crucial role in the ligand binding. The mutations were found to reduce the receptor-ligand interaction by widening the binding cavity, and the binding propensity is mainly driven by the van der Waals interaction. Our finding may be useful for designing potential drugs to combat with HIV. © 2015 John Wiley & Sons A/S.

  3. Cross-Neutralising Nanobodies Bind to a Conserved Pocket in the Hemagglutinin Stem Region Identified Using Yeast Display and Deep Mutational Scanning.

    Directory of Open Access Journals (Sweden)

    Tiziano Gaiotto

    Full Text Available Cross-neutralising monoclonal antibodies against influenza hemagglutinin (HA are of considerable interest as both therapeutics and diagnostic tools. We have recently described five different single domain antibodies (nanobodies which share this cross-neutralising activity and suggest their small size, high stability, and cleft binding properties may present distinct advantages over equivalent conventional antibodies. We have used yeast display in combination with deep mutational scanning to give residue level resolution of positions in the antibody-HA interface which are crucial for binding. In addition, we have mapped positions within HA predicted to have minimal effect on antibody binding when mutated. Our cross-neutralising nanobodies were shown to bind to a highly conserved pocket in the HA2 domain of A(H1N1pdm09 influenza virus overlapping with the fusion peptide suggesting their mechanism of action is through the inhibition of viral membrane fusion. We also note that the epitope overlaps with that of CR6261 and F10 which are human monoclonal antibodies in clinical development as immunotherapeutics. Although all five nanobodies mapped to the same highly conserved binding pocket we observed differences in the size of the epitope footprint which has implications in comparing the relative genetic barrier each nanobody presents to a rapidly evolving influenza virus. To further refine our epitope map, we have re-created naturally occurring mutations within this HA stem epitope and tested their effect on binding using yeast display. We have shown that a D46N mutation in the HA2 stem domain uniquely interferes with binding of R2b-E8. Further testing of this substitution in the context of full length purified HA from 1918 H1N1 pandemic (Spanish flu, 2009 H1N1 pandemic (swine flu and highly pathogenic avian influenza H5N1 demonstrated binding which correlated with D46 whereas binding to seasonal H1N1 strains carrying N46 was absent. In addition, our

  4. Structural Effects of Some Relevant Missense Mutations on the MECP2-DNA Binding: A MD Study Analyzed by Rescore+, a Versatile Rescoring Tool of the VEGA ZZ Program.

    Science.gov (United States)

    Pedretti, Alessandro; Granito, Cinzia; Mazzolari, Angelica; Vistoli, Giulio

    2016-09-01

    DNA methylation plays key roles in mammalian cells and is modulated by a set of proteins which recognize symmetrically methylated nucleotides. Among them, the protein MECP2 shows multifunctional roles repressing and/or activating genes by binding to both methylated and unmethylated regions of the genome. The interest for this protein markedly increased from the observation that its mutations are the primary cause of Rett syndrome, a neurodevelopmental disorder which causes mental retardation in young females. Thus, the present study is aimed to investigate the effects of some of these known pathogenic missense mutations (i.e. R106Q, R106W, R111G, R133C and R133H) on the MECP2 folding and DNA binding by molecular dynamics simulations. The effects of the simulated mutations are also parameterized by using a here proposed new tool, named Rescore+, implemented in the VEGA ZZ suite of programs, which calculates a set of scoring functions on all frames of a trajectory or on all complexes contained in a database thus allowing an easy rescoring of results coming from MD or docking simulations. The obtained results revealed that the reported loss of the MECP2 function induced by the simulated mutations can be ascribed to both stabilizing and destabilizing effect on DNA binding. The study confirms that MD simulations are particularly useful to rationalize and predict the mutation effects offering insightful information for diagnostics and drug design. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia.

    Science.gov (United States)

    Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri

    2011-07-01

    There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.

  6. A novel RUNX2 missense mutation predicted to disrupt DNA binding causes cleidocranial dysplasia in a large Chinese family with hyperplastic nails

    Directory of Open Access Journals (Sweden)

    Wang Xiaoqin

    2007-12-01

    Full Text Available Abstract Background Cleidocranial dysplasia (CCD is a dominantly inherited disease characterized by hypoplastic or absent clavicles, large fontanels, dental dysplasia, and delayed skeletal development. The purpose of this study is to investigate the genetic basis of Chinese family with CCD. Methods Here, a large Chinese family with CCD and hyperplastic nails was recruited. The clinical features displayed a significant intrafamilial variation. We sequenced the coding region of the RUNX2 gene for the mutation and phenotype analysis. Results The family carries a c.T407C (p.L136P mutation in the DNA- and CBFβ-binding Runt domain of RUNX2. Based on the crystal structure, we predict this novel missense mutation is likely to disrupt DNA binding by RUNX2, and at least locally affect the Runt domain structure. Conclusion A novel missense mutation was identified in a large Chinese family with CCD with hyperplastic nails. This report further extends the mutation spectrum and clinical features of CCD. The identification of this mutation will facilitate prenatal diagnosis and preimplantation genetic diagnosis.

  7. Novel Tetra-Primer ARMS-PCR Assays for Thiopurine Intolerance Susceptibility Mutations NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C in East Asians

    Directory of Open Access Journals (Sweden)

    Chi-Chun Ho

    2017-10-01

    Full Text Available Thiopurines are clinically useful in the management of diverse immunological and malignant conditions. Nevertheless, these purine analogues can cause lethal myelosuppression, which may be prevented by prospective testing for variants in the thiopurine S-methyltransferase (TPMT and, in East Asians, Nudix hydrolase 15 (NUDT15 genes. Two single-tube, tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR assays were developed to genotype the common loss-of-function variants NUDT15 c.415C>T (rs116855232 and TPMT*3C c.719A>G (rs1142345. In a group of 60 unselected patients, one and seven were found to be homozygous and heterozygous, respectively, for NUDT15 c.415C>T; one was found to be heterozygous for TPMT*3C c.719A>G. There was no non-specific amplification, and the genotypes were 100% concordant with Sanger sequencing. Limit-of-detection for both assays was below 1 ng of heterozygous template per reaction. Time- and cost-effective ARMS-PCR assays, suitable for genotyping East-Asian patients for thiopurine intolerance, were successfully developed and validated.

  8. Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

    Science.gov (United States)

    Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

    2015-09-01

    Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Hereditary 1,25-dihydroxyvitamin D-resistant rickets with alopecia resulting from a novel missense mutation in the DNA-binding domain of the vitamin D receptor

    Science.gov (United States)

    Malloy, Peter J.; Wang, Jining; Srivastava, Tarak; Feldman, David

    2009-01-01

    The rare genetic recessive disease, hereditary vitamin D resistant rickets (HVDRR), is caused by mutations in the vitamin D receptor (VDR) that result in resistance to the active hormone 1,25-dihydroxyvitamin D3 (1,25-(OH)2D3 or calcitriol). In this study, we examined the VDR from a young boy with clinical features of HVDRR including severe rickets, hypocalcemia, hypophosphatemia and partial alopecia. The pattern of alopecia was very unusual with areas of total baldness, adjacent to normal hair and regions of scant hair. The child failed to improve on oral calcium and vitamin D therapy but his abnormal chemistries and his bone x-rays normalized with intravenous calcium therapy. We found that the child was homozygous for a unique missense mutation in the VDR gene that converted valine to methionine at amino acid 26 (V26M) in the VDR DNA-binding domain (DBD). The mutant VDR was studied in the patient’s cultured skin fibroblasts and found to exhibit normal [3H]1,25-(OH)2D3 binding and protein expression. However, the fibroblasts were unresponsive to treatment with high concentrations of 1,25(OH)2D3 as demonstrated by their failure to induce CYP24A1 gene expression, a marker of 1,25(OH)2D3 responsiveness. We recreated the V26M mutation in the WT VDR and showed that in transfected COS-7 cells the mutation abolished 1,25(OH)2D3-mediated transactivation. The mutant VDR exhibited normal ligand-induced binding to RXRα and to the coactivator DRIP205. However, the V26M mutation inhibited VDR binding to a consensus vitamin D response element (VDRE). In summary, we have identified a novel V26M mutation in the VDR DBD as the molecular defect in a patient with HVDRR and an unusual pattern of alopecia. PMID:19815438

  10. Mutations at the flavin binding site of ETF:QO yield a MADD-like severe phenotype in Drosophila.

    Science.gov (United States)

    Alves, Ema; Henriques, Bárbara J; Rodrigues, João V; Prudêncio, Pedro; Rocha, Hugo; Vilarinho, Laura; Martinho, Rui G; Gomes, Cláudio M

    2012-08-01

    Following a screening on EMS-induced Drosophila mutants defective for formation and morphogenesis of epithelial cells, we have identified three lethal mutants defective for the production of embryonic cuticle. The mutants are allelic to the CG12140 gene, the fly homologue of electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO). In humans, inherited defects in this inner membrane protein account for multiple acyl-CoA dehydrogenase deficiency (MADD), a metabolic disease of β-oxidation, with a broad range of clinical phenotypes, varying from embryonic lethal to mild forms. The three mutant alleles carried distinct missense mutations in ETF:QO (G65E, A68V and S104F) and maternal mutant embryos for ETF:QO showed lethal morphogenetic defects and a significant induction of apoptosis following germ-band elongation. This phenotype is accompanied by an embryonic accumulation of short- and medium-chain acylcarnitines (C4, C8 and C12) as well as long-chain acylcarnitines (C14 and C16:1), whose elevation is also found in severe MADD forms in humans under intense metabolic decompensation. In agreement the ETF:QO activity in the mutant embryos is markedly decreased in relation to wild type activity. Amino acid sequence analysis and structural mapping into a molecular model of ETF:QO show that all mutations map at FAD interacting residues, two of which at the nucleotide-binding Rossmann fold. This structural domain is composed by a β-strand connected by a short loop to an α-helix, and its perturbation results in impaired cofactor association via structural destabilisation and consequently enzymatic inactivation. This work thus pinpoints the molecular origins of a severe MADD-like phenotype in the fruit fly and establishes the proof of concept concerning the suitability of this organism as a potential model organism for MADD. © 2012 Elsevier B.V. All rights reserved.

  11. Development of techniques using DNA analysis method for detection/analysis of radiation-induced mutation. Development of an useful probe/primer and improvement of detection efficacy

    International Nuclear Information System (INIS)

    Maekawa, Hideaki; Tsuchida, Kozo; Hashido, Kazuo; Takada, Naoko; Kameoka, Yosuke; Hirata, Makoto

    1999-01-01

    Previously, it was demonstrated that detection of centromere became easy and reliable through fluorescent staining by FISH method using a probe of the sequence preserved in α-satelite DNA. Since it was, however, found inappropriate to detect dicentrics based on the relative amount of DNA probe on each chromosome. A prove which allows homogeneous detection of α-satelite DNA for each chromosome was constructed. A presumed sequence specific to kinetochore, CENP-B box was amplified by PCR method and the product DNA was used as a probe. However, the variation in amounts of probe DNA among chromosomes was decreased by only about 20%. Then, a program for image processing of the results obtained from FISH using α-satelite DNA was constructed to use as a marker for centromere. When compared with detection of abnormal chromosomes stained by the conventional method, calculation efficacy for only detection of centromere was improved by the use of this program. Calculation to discriminate the normal or not was still complicated and the detection efficacy was little improved. Chromosomal abnormalities in lymphocytes were used to detect the effects of radiation. In this method, it is needed to shift the phase of cells into metaphase. The mutation induced by radiation might be often repaired during shifting. To exclude this possibility, DNA extraction was conducted at a low temperature and immediately after exposure to 137 Cs, and a rapid genome detection method was established using the genome DNA. As the model genomes, the following three were used: 1) long chain repeated sequences widely dispersed over chromosome, 2) cluster genes, 3) single copy genes. The effects of radiation were detectable at 1-2 Gy for the long repeated sequences and at 7 Gy for the cluster genes, respectively, whereas no significant effects were observed at any Gy tested for the single copy genes. Amplification was marked in the cells exposed at 1-10 Gy (peak at 4 Gy), suggesting that these regions had

  12. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  13. Stabilization of a nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator yields insight into disease-causing mutations.

    Science.gov (United States)

    Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D

    2017-08-25

    Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Mutations in the DNA-binding domain of NR2E3 affect in vivo dimerization and interaction with CRX.

    Directory of Open Access Journals (Sweden)

    Raphael Roduit

    Full Text Available BACKGROUND: NR2E3 (PNR is an orphan nuclear receptor essential for proper photoreceptor determination and differentiation. In humans, mutations in NR2E3 have been associated with the recessively inherited enhanced short wavelength sensitive (S- cone syndrome (ESCS and, more recently, with autosomal dominant retinitis pigmentosa (adRP. NR2E3 acts as a suppressor of the cone generation program in late mitotic retinal progenitor cells. In adult rod photoreceptors, NR2E3 represses cone-specific gene expression and acts in concert with the transcription factors CRX and NRL to activate rod-specific genes. NR2E3 and CRX have been shown to physically interact in vitro through their respective DNA-binding domains (DBD. The DBD also contributes to homo- and heterodimerization of nuclear receptors. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed NR2E3 homodimerization and NR2E3/CRX complex formation in an in vivo situation by Bioluminescence Resonance Energy Transfer (BRET(2. NR2E3 wild-type protein formed homodimers in transiently transfected HEK293T cells. NR2E3 homodimerization was impaired in presence of disease-causing mutations in the DBD, except for the p.R76Q and p.R104W mutant proteins. Strikingly, the adRP-linked p.G56R mutant protein interacted with CRX with a similar efficiency to that of NR2E3 wild-type and p.R311Q proteins. In contrast, all other NR2E3 DBD-mutant proteins did not interact with CRX. The p.G56R mutant protein was also more effective in abolishing the potentiation of rhodospin gene transactivation by the NR2E3 wild-type protein. In addition, the p.G56R mutant enhanced the transrepression of the M- and S-opsin promoter, while all other NR2E3 DBD-mutants did not. CONCLUSIONS/SIGNIFICANCE: These results suggest different disease mechanisms in adRP- and ESCS-patients carrying NR2E3 mutations. Titration of CRX by the p.G56R mutant protein acting as a repressor in trans may account for the severe clinical phenotype in adRP patients.

  15. Mutations increasing exposure of a receptor binding site epitope in the soluble and oligomeric forms of the caprine arthritis-encephalitis lentivirus envelope glycoprotein

    International Nuclear Information System (INIS)

    Hoetzel, Isidro; Cheevers, William P.

    2005-01-01

    The caprine arthritis-encephalitis (CAEV) and ovine maedi-visna (MVV) viruses are resistant to antibody neutralization, a feature shared with all other lentiviruses. Whether the CAEV gp135 receptor binding site(s) (RBS) in the functional surface envelope glycoprotein (Env) is protected from antibody binding, allowing the virus to resist neutralization, is not known. Two CAEV gp135 regions were identified by extrapolating a gp135 structural model that could affect binding of antibodies to the RBS: the V1 region and a short sequence analogous in position to the human immunodeficiency virus type 1 gp120 loop B postulated to be located between two major domains of CAEV gp135. Mutation of isoleucine-166 to alanine in the putative loop B of gp135 increased the affinity of soluble gp135 for the CAEV receptor(s) and goat monoclonal antibody (Mab) F7-299 which recognizes an epitope overlapping the gp135 RBS. The I166A mutation also stabilized or exposed the F7-299 epitope in anionic detergent buffers, indicating that the I166A mutation induces conformational changes and stabilizes the RBS of soluble gp135 and enhances Mab F7-299 binding. In contrast, the affinity of a V1 deletion mutant of gp135 for the receptor and Mab F7-299 and its structural stability did not differ from that of the wild-type gp135. However, both the I166A mutation and the V1 deletion of gp135 increased cell-to-cell fusion activity and binding of Mab F7-299 to the oligomeric Env. Therefore, the CAEV gp135 RBS is protected from antibody binding by mechanisms both dependent and independent of Env oligomerization which are disrupted by the V1 deletion and the I166A mutation, respectively. In addition, we found a correlation between side-chain β-branching at amino acid position 166 and binding of Mab F7-299 to oligomeric Env and cell-to-cell fusion, suggesting local secondary structure constraints in the region around isoleucine-166 as one determinant of gp135 RBS exposure and antibody binding

  16. Mutations in a Novel Isoform of TRIOBP That Encodes a Filamentous-Actin Binding Protein Are Responsible for DFNB28 Recessive Nonsyndromic Hearing Loss

    Science.gov (United States)

    Shahin, Hashem; Walsh, Tom; Sobe, Tama; Abu Sa’ed, Judeh; Abu Rayan, Amal; Lynch, Eric D.; Lee, Ming K.; Avraham, Karen B.; King, Mary-Claire; Kanaan, Moein

    2006-01-01

    In a large consanguineous Palestinian kindred, we previously mapped DFNB28—a locus associated with recessively inherited, prelingual, profound sensorineural hearing impairment—to chromosome 22q13.1. We report here that mutations in a novel 218-kDa isoform of TRIOBP (TRIO and filamentous actin [F-actin] binding protein) are associated with DFNB28 hearing loss in a total of nine Palestinian families. Two nonsense mutations (R347X and Q581X) truncate the protein, and a potentially deleterious missense mutation (G1019R) occurs in a conserved motif in a putative SH3-binding domain. In seven families, 27 deaf individuals are homozygous for one of the nonsense mutations; in two other families, 3 deaf individuals are compound heterozygous for the two nonsense mutations or for Q581X and G1019R. The novel long isoform of TRIOBP has a restricted expression profile, including cochlea, retina, and fetal brain, whereas the original short isoform is widely expressed. Antibodies to TRIOBP reveal expression in sensory cells of the inner ear and colocalization with F-actin along the length of the stereocilia. PMID:16385458

  17. Mutations in Human Tubulin Proximal to the Kinesin-Binding Site Alter Dynamic Instability at Microtubule Plus- and Minus-Ends

    Energy Technology Data Exchange (ETDEWEB)

    Ti, Shih-Chieh; Pamula, Melissa C.; Howes, Stuart C.; Duellberg, Christian; Cade, Nicholas I.; Kleiner, Ralph E.; Forth, Scott; Surrey, Thomas; Nogales, Eva; Kapoor, Tarun M.

    2016-04-01

    The assembly of microtubule-based cellular structures depends on regulated tubulin polymerization and directional transport. In this research, we have purified and characterized tubulin heterodimers that have human β-tubulin isotype III (TUBB3), as well as heterodimers with one of two β-tubulin mutations (D417H or R262H). Both point mutations are proximal to the kinesin-binding site and have been linked to an ocular motility disorder in humans. Compared to wild-type, microtubules with these mutations have decreased catastrophe frequencies and increased average lifetimes of plus- and minus-end-stabilizing caps. Importantly, the D417H mutation does not alter microtubule lattice structure or Mal3 binding to growing filaments. Instead, this mutation reduces the affinity of tubulin for TOG domains and colchicine, suggesting that the distribution of tubulin heterodimer conformations is changed. Together, our findings reveal how residues on the surface of microtubules, distal from the GTP-hydrolysis site and inter-subunit contacts, can alter polymerization dynamics at the plus- and minus-ends of microtubules.

  18. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    Science.gov (United States)

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  19. Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

    Science.gov (United States)

    Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

    2016-08-02

    MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Mutations in a Novel Isoform of TRIOBP That Encodes a Filamentous-Actin Binding Protein Are Responsible for DFNB28 Recessive Nonsyndromic Hearing Loss

    OpenAIRE

    Shahin, Hashem; Walsh, Tom; Sobe, Tama; Abu Sa’ed, Judeh; Abu Rayan, Amal; Lynch, Eric D.; Lee, Ming K.; Avraham, Karen B.; King, Mary-Claire; Kanaan, Moein

    2005-01-01

    In a large consanguineous Palestinian kindred, we previously mapped DFNB28—a locus associated with recessively inherited, prelingual, profound sensorineural hearing impairment—to chromosome 22q13.1. We report here that mutations in a novel 218-kDa isoform of TRIOBP (TRIO and filamentous actin [F-actin] binding protein) are associated with DFNB28 hearing loss in a total of nine Palestinian families. Two nonsense mutations (R347X and Q581X) truncate the protein, and a potentially deleterious mi...

  1. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  2. Novel Mutation in the ATP-Binding Cassette Transporter A3 (ABCA3) Encoding Gene Causes Respiratory Distress Syndrome in A Term Newborn in Southwest Iran

    Science.gov (United States)

    Rezaei, Farideh; Shafiei, Mohammad; Shariati, Gholamreza; Dehdashtian, Ali; Mohebbi, Maryam; Galehdari, Hamid

    2016-01-01

    Introduction ABCA3 glycoprotein belongs to the ATP-binding cassette (ABC) superfamily of transporters, which utilize the energy derived from hydrolysis of ATP for the translocation of a wide variety of substrates across the plasma membrane. Mutations in the ABCA3 gene are knowingly causative for fatal surfactant deficiency, particularly respiratory distress syndrome (RDS) in term babies. Case Presentation In this study, Sanger sequencing of the whole ABCA3 gene (NCBI NM_001089) was performed in a neonatal boy with severe RDS. A homozygous mutation has been identified in the patient. Parents were heterozygous for the same missense mutation GGA > AGA at position 202 in exon 6 of the ABCA3 gene (c.604G > A; p.G202R). Furthermore, 70 normal individuals have been analyzed for the mentioned change with negative results. Conclusions Regarding Human Genome Mutation Database (HGMD) and other literature recherche, the detected change is a novel mutation and has not been reported before. Bioinformatics mutation predicting tools prefer it as pathogenic. PMID:27437095

  3. Effect of Multiple Mutations in the Hemoglobin- and Hemoglobin-Haptoglobin-Binding Proteins, HgpA, HgpB, and HgpC, of Haemophilus influenzae Type b

    OpenAIRE

    Morton, Daniel J.; Whitby, Paul W.; Jin, Hongfan; Ren, Zhen; Stull, Terrence L.

    1999-01-01

    Haemophilus influenzae requires heme for growth and can utilize hemoglobin and hemoglobin-haptoglobin as heme sources. We previously identified two hemoglobin- and hemoglobin-haptoglobin-binding proteins, HgpA and HgpB, in H. influenzae HI689. Insertional mutation of hgpA and hgpB, either singly or together, did not abrogate the ability to utilize or bind either hemoglobin or the hemoglobin-haptoglobin complex. A hemoglobin affinity purification method was used to isolate a protein of approxi...

  4. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

    OpenAIRE

    Herranz, M. Carmen; Sánchez Navarro, Jesús A.; Saurí Peris, Ana; Mingarro Muñoz, Ismael; Pallás Benet, Vicente

    2005-01-01

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive c...

  5. The ability of AIF-1 to activate human vascular smooth muscle cells is lost by mutations in the EF-hand calcium-binding region

    International Nuclear Information System (INIS)

    Autieri, Michael V.; Chen Xing

    2005-01-01

    Allograft Inflammatory Factor-1 (AIF-1) is a cytoplasmic calcium-binding protein expressed in vascular smooth muscle cells (VSMC) in response to injury or cytokine stimulation. AIF-1 contains a partially conserved EF-hand calcium-binding domain, and participates in VSMC activation by activation of Rac1 and induction of Granulocyte-Colony Stimulating Factor (G-CSF) expression; however, the mechanism whereby AIF-1 mediates these effects is presently uncharacterized. To determine if calcium binding plays a functional role in AIF-1 activity, a single site-specific mutation was made in the EF-hand calcium-binding domain to abrogate binding of calcium (AIF-1ΔA), which was confirmed by calcium overlay. Functionally, similar to wild-type AIF-1, AIF-1ΔA was able to polymerize F-actin in vitro. However, in contrast to wild-type AIF-1, over-expression of AIF-1ΔA was unable to increase migration or proliferation of primary human VSMC. Further, it was unable to activate Rac1, or induce G-CSF expression to the degree as wild-type AIF-1. Taken together, modification of the wild-type EF-hand domain and native calcium-binding activity results in a loss of AIF-1 function. We conclude that appropriate calcium-binding potential is critical in AIF-1-mediated effects on VSMC pathophysiology, and that AIF-1 activity is mediated by Rac1 activation and G-CSF expression

  6. Determining the role of missense mutations in the POU domain of HNF1A that reduce the DNA-binding affinity: A computational approach.

    Directory of Open Access Journals (Sweden)

    Sneha P

    Full Text Available Maturity-onset diabetes of the young type 3 (MODY3 is a non-ketotic form of diabetes associated with poor insulin secretion. Over the past years, several studies have reported the association of missense mutations in the Hepatocyte Nuclear Factor 1 Alpha (HNF1A with MODY3. Missense mutations in the POU homeodomain (POUH of HNF1A hinder binding to the DNA, thereby leading to a dysfunctional protein. Missense mutations of the HNF1A were retrieved from public databases and subjected to a three-step computational mutational analysis to identify the underlying mechanism. First, the pathogenicity and stability of the mutations were analyzed to determine whether they alter protein structure and function. Second, the sequence conservation and DNA-binding sites of the mutant positions were assessed; as HNF1A protein is a transcription factor. Finally, the biochemical properties of the biological system were validated using molecular dynamic simulations in Gromacs 4.6.3 package. Two arginine residues (131 and 203 in the HNF1A protein are highly conserved residues and contribute to the function of the protein. Furthermore, the R131W, R131Q, and R203C mutations were predicted to be highly deleterious by in silico tools and showed lower binding affinity with DNA when compared to the native protein using the molecular docking analysis. Triplicate runs of molecular dynamic (MD simulations (50ns revealed smaller changes in patterns of deviation, fluctuation, and compactness, in complexes containing the R131Q and R131W mutations, compared to complexes containing the R203C mutant complex. We observed reduction in the number of intermolecular hydrogen bonds, compactness, and electrostatic potential, as well as the loss of salt bridges, in the R203C mutant complex. Substitution of arginine with cysteine at position 203 decreases the affinity of the protein for DNA, thereby destabilizing the protein. Based on our current findings, the MD approach is an important

  7. Computational Studies of a Mechanism for Binding and Drug Resistance in the Wild Type and Four Mutations of HIV-1 Protease with a GRL-0519 Inhibitor

    Directory of Open Access Journals (Sweden)

    Guodong Hu

    2016-05-01

    Full Text Available Drug resistance of mutations in HIV-1 protease (PR is the most severe challenge to the long-term efficacy of HIV-1 PR inhibitor in highly active antiretroviral therapy. To elucidate the molecular mechanism of drug resistance associated with mutations (D30N, I50V, I54M, and V82A and inhibitor (GRL-0519 complexes, we have performed five molecular dynamics (MD simulations and calculated the binding free energies using the molecular mechanics Poisson–Boltzmann surface area (MM-PBSA method. The ranking of calculated binding free energies is in accordance with the experimental data. The free energy spectra of each residue and inhibitor interaction for all complexes show a similar binding model. Analysis based on the MD trajectories and contribution of each residues show that groups R2 and R3 mainly contribute van der Waals energies, while groups R1 and R4 contribute electrostatic interaction by hydrogen bonds. The drug resistance of D30N can be attributed to the decline in binding affinity of residues 28 and 29. The size of Val50 is smaller than Ile50 causes the residue to move, especially in chain A. The stable hydrophobic core, including the side chain of Ile54 in the wild type (WT complex, became unstable in I54M because the side chain of Met54 is flexible with two alternative conformations. The binding affinity of Ala82 in V82A decreases relative to Val82 in WT. The present study could provide important guidance for the design of a potent new drug resisting the mutation inhibitors.

  8. The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.

    Science.gov (United States)

    Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter

    2018-06-01

    Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of

  9. Recurrent De Novo Mutations Disturbing the GTP/GDP Binding Pocket of RAB11B Cause Intellectual Disability and a Distinctive Brain Phenotype.

    Science.gov (United States)

    Lamers, Ideke J C; Reijnders, Margot R F; Venselaar, Hanka; Kraus, Alison; Jansen, Sandra; de Vries, Bert B A; Houge, Gunnar; Gradek, Gyri Aasland; Seo, Jieun; Choi, Murim; Chae, Jong-Hee; van der Burgt, Ineke; Pfundt, Rolph; Letteboer, Stef J F; van Beersum, Sylvia E C; Dusseljee, Simone; Brunner, Han G; Doherty, Dan; Kleefstra, Tjitske; Roepman, Ronald

    2017-11-02

    The Rab GTPase family comprises ∼70 GTP-binding proteins, functioning in vesicle formation, transport and fusion. They are activated by a conformational change induced by GTP-binding, allowing interactions with downstream effectors. Here, we report five individuals with two recurrent de novo missense mutations in RAB11B; c.64G>A; p.Val22Met in three individuals and c.202G>A; p.Ala68Thr in two individuals. An overlapping neurodevelopmental phenotype, including severe intellectual disability with absent speech, epilepsy, and hypotonia was observed in all affected individuals. Additionally, visual problems, musculoskeletal abnormalities, and microcephaly were present in the majority of cases. Re-evaluation of brain MRI images of four individuals showed a shared distinct brain phenotype, consisting of abnormal white matter (severely decreased volume and abnormal signal), thin corpus callosum, cerebellar vermis hypoplasia, optic nerve hypoplasia and mild ventriculomegaly. To compare the effects of both variants with known inactive GDP- and active GTP-bound RAB11B mutants, we modeled the variants on the three-dimensional protein structure and performed subcellular localization studies. We predicted that both variants alter the GTP/GDP binding pocket and show that they both have localization patterns similar to inactive RAB11B. Evaluation of their influence on the affinity of RAB11B to a series of binary interactors, both effectors and guanine nucleotide exchange factors (GEFs), showed induction of RAB11B binding to the GEF SH3BP5, again similar to inactive RAB11B. In conclusion, we report two recurrent dominant mutations in RAB11B leading to a neurodevelopmental syndrome, likely caused by altered GDP/GTP binding that inactivate the protein and induce GEF binding and protein mislocalization. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  10. Site-directed mutational analysis of structural interactions of low molecule compounds binding to the N-terminal 8 kDa domain of DNA polymerase β

    International Nuclear Information System (INIS)

    Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo

    2006-01-01

    We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA

  11. GPIHBP1 Missense Mutations Often Cause Multimerization of GPIHBP1 and Thereby Prevent Lipoprotein Lipase Binding

    DEFF Research Database (Denmark)

    Beigneux, Anne P; Fong, Loren G; Bensadoun, Andre

    2015-01-01

    lacked the ability to bind LPL but had a reduced propensity for forming dimers or multimers, suggesting that W109 might play a more direct role in binding LPL. In support of that idea, replacing W109 with any of 8 other amino acids abolished LPL binding-and often did so without promoting the formation...

  12. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Nuemket, Nipawan [Graduate School of Life Sciences, Hokkaido University, Sapporo 060-0810 (Japan); Tanaka, Yoshikazu [Creative Research Institution ' Sousei,' Hokkaido University, Sapporo 001-0021 (Japan); Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810 (Japan); Tsukamoto, Kentaro; Tsuji, Takao [Department of Microbiology, Fujita Health University School of Medicine, Toyoake, Aichi 470-1192 (Japan); Nakamura, Keiji; Kozaki, Shunji [Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Osaka 598-8531 (Japan); Yao, Min [Graduate School of Life Sciences, Hokkaido University, Sapporo 060-0810 (Japan); Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810 (Japan); Tanaka, Isao, E-mail: tanaka@castor.sci.hokudai.ac.jp [Graduate School of Life Sciences, Hokkaido University, Sapporo 060-0810 (Japan); Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810 (Japan)

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinum neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.

  13. Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus

    Directory of Open Access Journals (Sweden)

    Margit Mutso

    2018-04-01

    Full Text Available Infection by Chikungunya virus (CHIKV of the Old World alphaviruses (family Togaviridae in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP (nsP1, nsp2, nsP3 and nsP4 that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

  14. Mutation of CD2AP and SH3KBP1 Binding Motif in Alphavirus nsP3 Hypervariable Domain Results in Attenuated Virus.

    Science.gov (United States)

    Mutso, Margit; Morro, Ainhoa Moliner; Smedberg, Cecilia; Kasvandik, Sergo; Aquilimeba, Muriel; Teppor, Mona; Tarve, Liisi; Lulla, Aleksei; Lulla, Valeria; Saul, Sirle; Thaa, Bastian; McInerney, Gerald M; Merits, Andres; Varjak, Margus

    2018-04-27

    Infection by Chikungunya virus (CHIKV) of the Old World alphaviruses (family Togaviridae) in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP) (nsP1, nsp2, nsP3 and nsP4) that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD) of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV) harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.

  15. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  16. Accurate calculation of mutational effects on the thermodynamics of inhibitor binding to p38α MAP kinase: a combined computational and experimental study.

    Science.gov (United States)

    Zhu, Shun; Travis, Sue M; Elcock, Adrian H

    2013-07-09

    A major current challenge for drug design efforts focused on protein kinases is the development of drug resistance caused by spontaneous mutations in the kinase catalytic domain. The ubiquity of this problem means that it would be advantageous to develop fast, effective computational methods that could be used to determine the effects of potential resistance-causing mutations before they arise in a clinical setting. With this long-term goal in mind, we have conducted a combined experimental and computational study of the thermodynamic effects of active-site mutations on a well-characterized and high-affinity interaction between a protein kinase and a small-molecule inhibitor. Specifically, we developed a fluorescence-based assay to measure the binding free energy of the small-molecule inhibitor, SB203580, to the p38α MAP kinase and used it measure the inhibitor's affinity for five different kinase mutants involving two residues (Val38 and Ala51) that contact the inhibitor in the crystal structure of the inhibitor-kinase complex. We then conducted long, explicit-solvent thermodynamic integration (TI) simulations in an attempt to reproduce the experimental relative binding affinities of the inhibitor for the five mutants; in total, a combined simulation time of 18.5 μs was obtained. Two widely used force fields - OPLS-AA/L and Amber ff99SB-ILDN - were tested in the TI simulations. Both force fields produced excellent agreement with experiment for three of the five mutants; simulations performed with the OPLS-AA/L force field, however, produced qualitatively incorrect results for the constructs that contained an A51V mutation. Interestingly, the discrepancies with the OPLS-AA/L force field could be rectified by the imposition of position restraints on the atoms of the protein backbone and the inhibitor without destroying the agreement for other mutations; the ability to reproduce experiment depended, however, upon the strength of the restraints' force constant

  17. Four novel FBN1 mutations: Significance for mutant transcript level and EGF-like domain calcium binding in the pathogenesis of Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Dietz, H.C.; McIntosh, I.; Pyeritz, R.E.; Francomano, C.A. (Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)); Sakai, L.Y.; Corson, G.M.; Chalberg, S.C. (Oregon Health Sciences Univ., Portland (United States))

    1993-08-01

    Defects of fibrillin (FBN1), a glycoprotein component of the extracellular microfibril, cause Marfan syndrome. This disorder is characterized by marked inter- and intrafamilial variation in phenotypic severity. To understand the molecular basis for this clinical observation, the authors have screened the fibrillin gene (FBN1) on chromosome 15, including the newly cloned 5[prime] coding sequence, for disease-producing alterations in a panel of patients with a wide range of manifestations and clinical severity. All the missense mutations identified to date, including two novel mutations discussed here, are associated with classic and moderate to severe disease and occur at residues with putative significance for calcium binding to epidermal growth factor (EGF)-like domains. In contrast, two new mutations that create premature signals for termination of translation of mRNA and are associated with reduction in the amount of mutant allele transcript produce a range of phenotypic severity. The patient with the lowest amount of mutant transcript has the mildest disease. These data support a role for altered calcium binding to EGF-like domains in the pathogenesis of Marfan syndrome and suggest a dominant negative mechanism for the pathogenesis of this disorder. 26 refs., 6 figs., 1 tab.

  18. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  19. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  20. Alzheimer neuropathology without frontotemporal lobar degeneration hallmarks (TAR DNA-binding protein 43 inclusions) in missense progranulin mutation Cys139Arg.

    Science.gov (United States)

    Redaelli, Veronica; Rossi, Giacomina; Maderna, Emanuela; Kovacs, Gabor G; Piccoli, Elena; Caroppo, Paola; Cacciatore, Francesca; Spinello, Sonia; Grisoli, Marina; Sozzi, Giuliano; Salmaggi, Andrea; Tagliavini, Fabrizio; Giaccone, Giorgio

    2018-01-01

    Null mutations in progranulin gene (GRN) reduce the progranulin production resulting in haploinsufficiency and are tightly associated with tau-negative frontotemporal lobar degeneration with TAR DNA-binding protein 43-positive inclusions (FTLD-TDP). Missense mutations of GRN were also identified, but their effects are not completely clear, in particular unanswered is the question of what neuropathology they elicit, also considering that their occurrence has been reported in patients with typical clinical features of Alzheimer disease. They describe two fraternal twins carrying the missense GRN Cys139Arg mutation affected by late-onset dementia and we report the neuropathological study of one of them. Both patients were examined by neuroimaging, neuropsychological assessment and genetic analysis of GRN and other genes associated with dementia. The brain of one was obtained at autopsy and examined neuropathologically. One sister presented clinical and MRI features leading to the diagnosis of Alzheimer disease. The other underwent autopsy and the brain showed neuropathological hallmarks of Alzheimer disease with abundant Aβ-amyloid deposition and Braak stage V of neurofibrillary pathology, in the absence of the hallmark lesions of FTLD-TDP. Their findings may contribute to better clarify the role of progranulin in neurodegenerative diseases indicating that some GRN mutations, in particular missense ones, may act as strong risk factor for Alzheimer disease rather than induce FTLD-TDP. © 2016 International Society of Neuropathology.

  1. Resistance to linezolid in Staphylococcus spp. clinical isolates associated with ribosomal binding site modifications: novel mutation in domain V of 23S rRNA.

    Science.gov (United States)

    Musumeci, Rosario; Calaresu, Enrico; Gerosa, Jolanda; Oggioni, Davide; Bramati, Simone; Morelli, Patrizia; Mura, Ida; Piana, Andrea; Are, Bianca Maria; Cocuzza, Clementina Elvezia

    2016-10-01

    Linezolid is the main representative of the oxazolidinones, introduced in 2000 in clinical practice to treat severe Gram-positive infections. This compound inhibits protein synthesis by binding to the peptidyl transferase centre of the 50S bacterial ribosomal subunit. The aim of this study was to characterize 12 clinical strains of linezolid-resistant Staphylococcus spp. isolated in Northern Italy. All isolates of Staphylococcus spp. studied showed a multi-antibiotic resistance phenotype. In particular, all isolates showed the presence of the mecA gene associated with SSCmec types IVa, V or I. Mutations in domain V of 23S rRNA were shown to be the most prevalent mechanism of linezolid resistance: among these a new C2551T mutation was found in S. aureus, whilst the G2576T mutation was shown to be the most prevalent overall. Moreover, three S. epidermidis isolates were shown to have linezolid resistance associated only with alterations in both L3 and L4 ribosomal proteins. No strain was shown to harbor the previously described cfr gene. These results have shown how the clinical use of linezolid in Northern Italy has resulted in the selection of multiple antibiotic-resistant clinical isolates of Staphylococcus spp., with linezolid resistance in these strains being associated with mutations in 23S rRNA or ribosomal proteins L3 and L4.

  2. Mutations in the estrogen receptor alpha hormone binding domain promote stem cell phenotype through notch activation in breast cancer cell lines.

    Science.gov (United States)

    Gelsomino, L; Panza, S; Giordano, C; Barone, I; Gu, G; Spina, E; Catalano, S; Fuqua, S; Andò, S

    2018-04-24

    The detection of recurrent mutations affecting the hormone binding domain (HBD) of estrogen receptor alpha (ERα/ESR1) in endocrine therapy-resistant and metastatic breast cancers has prompted interest in functional characterization of these genetic alterations. Here, we explored the role of HBD-ESR1 mutations in influencing the behavior of breast cancer stem cells (BCSCs), using various BC cell lines stably expressing wild-type or mutant (Y537 N, Y537S, D538G) ERα. Compared to WT-ERα clones, mutant cells showed increased CD44 + /CD24 - ratio, mRNA levels of stemness genes, Mammosphere Forming Efficiency (MFE), Self-Renewal and migratory capabilities. Mutant clones exhibited high expression of NOTCH receptors/ligands/target genes and blockade of NOTCH signaling reduced MFE and migratory potential. Mutant BCSC activity was dependent on ERα phosphorylation at serine 118, since its inhibition decreased MFE and NOTCH4 activation only in mutant cells. Collectively, we demonstrate that the expression of HBD-ESR1 mutations may drive BC cells to acquire stem cell traits through ER/NOTCH4 interplay. We propose the early detection of HBD-ESR1 mutations as a challenge in precision medicine strategy, suggesting the development of tailored-approaches (i.e. NOTCH inhibitors) to prevent disease development and metastatic spread in BC mutant-positive patients. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. [Epigenome: what we learned from Rett syndrome, a neurological disease caused by mutation of a methyl-CpG binding protein].

    Science.gov (United States)

    Kubota, Takeo

    2013-01-01

    Epigenome is defined as DNA and histone modification-dependent gene regulation system. Abnormalities in this system are known to cause various neuro-developmental diseases. We recently reported that neurological symptoms of Rett syndrome, which is an autistic disorder caused by mutations in methyl-CpG binding protein 2 (MeCP2), was associated with failure of epigenomic gene regulation in neuronal cells, and that clinical differences in the identical twins with Rett syndrome in the differences in DNA methylation in neuronal genes, but not caused by DNA sequence differences. Since central nervus system requires precise gene regulation, neurological diseases including Alzheimer and Parkinson diseases may be caused by acquired DNA modification (epigenomic) changes that results in aberrant gene regulation as well as DNA sequence changes congenitally occurred (mutation).

  4. Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

    International Nuclear Information System (INIS)

    Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.

    2013-01-01

    Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants

  5. Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Roehrig, John T., E-mail: jtr1@cdc.gov [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Butrapet, Siritorn; Liss, Nathan M. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Bennett, Susan L. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States); Blair, Carol D. [Arthropod-borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523 (United States); Huang, Claire Y.-H. [Division of Vector-Borne Diseases, Centers for Disease Control and Prevention, Fort Collins, CO 80521 (United States)

    2013-07-05

    Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.

  6. Mutation of the SHP-2 binding site in growth hormone (GH) receptor prolongs GH-promoted tyrosyl phosphorylation of GH receptor, JAK2, and STAT5B

    DEFF Research Database (Denmark)

    Stofega, M R; Herrington, J; Billestrup, Nils

    2000-01-01

    phosphorylation. Consistent with the effects on STAT5B phosphorylation, tyrosine-to-phenylalanine mutation of tyrosine 595 prolongs the duration of tyrosyl phosphorylation of GHR and JAK2. These data suggest that tyrosine 595 is a major site of interaction of GHR with SHP-2, and that GHR-bound SHP-2 negatively......Binding of GH to GH receptor (GHR) rapidly and transiently activates multiple signal transduction pathways that contribute to the growth-promoting and metabolic effects of GH. While the events that initiate GH signal transduction, such as activation of the Janus tyrosine kinase JAK2, are beginning...

  7. Effects of Mutations in the Substrate-Binding Domain of Poly[(R)-3-Hydroxybutyrate] (PHB) Depolymerase from Ralstonia pickettii T1 on PHB Degradation▿

    OpenAIRE

    Hiraishi, Tomohiro; Hirahara, Yoko; Doi, Yoshiharu; Maeda, Mizuo; Taguchi, Seiichi

    2006-01-01

    Poly[(R)-3-hydroxybutyrate] (PHB) depolymerase from Ralstonia pickettii T1 (PhaZRpiT1) adsorbs to denatured PHB (dPHB) via its substrate-binding domain (SBD) to enhance dPHB degradation. To evaluate the amino acid residues participating in dPHB adsorption, PhaZRpiT1 was subjected to a high-throughput screening system consisting of PCR-mediated random mutagenesis targeted to the SBD gene and a plate assay to estimate the effects of mutations in the SBD on dPHB degradation by PhaZRpiT1. Genetic...

  8. Uncoupling of Obesity from Insulin Resistance Through a Targeted Mutation in aP2, the Adipocyte Fatty Acid Binding Protein

    Science.gov (United States)

    Hotamisligil, Gokhan S.; Johnson, Randall S.; Distel, Robert J.; Ellis, Ramsey; Papaioannou, Virginia E.; Spiegelman, Bruce M.

    1996-11-01

    Fatty acid binding proteins (FABPs) are small cytoplasmic proteins that are expressed in a highly tissue-specific manner and bind to fatty acids such as oleic and retinoic acid. Mice with a null mutation in aP2, the gene encoding the adipocyte FABP, were developmentally and metabolically normal. The aP2-deficient mice developed dietary obesity but, unlike control mice, they did not develop insulin resistance or diabetes. Also unlike their obese wild-type counterparts, obese aP2-/- animals failed to express in adipose tissue tumor necrosis factor-α (TNF-α), a molecule implicated in obesity-related insulin resistance. These results indicate that aP2 is central to the pathway that links obesity to insulin resistance, possibly by linking fatty acid metabolism to expression of TNF-α.

  9. Mutation of Tyr137 of the universal Escherichia coli fimbrial adhesin FimH relaxes the tyrosine gate prior to mannose binding

    Directory of Open Access Journals (Sweden)

    Said Rabbani

    2017-01-01

    Full Text Available The most prevalent diseases manifested by Escherichia coli are acute and recurrent bladder infections and chronic inflammatory bowel diseases such as Crohn's disease. E. coli clinical isolates express the FimH adhesin, which consists of a mannose-specific lectin domain connected via a pilin domain to the tip of type 1 pili. Although the isolated FimH lectin domain has affinities in the nanomolar range for all high-mannosidic glycans, differentiation between these glycans is based on their capacity to form predominantly hydrophobic interactions within the tyrosine gate at the entrance to the binding pocket. In this study, novel crystal structures of tyrosine-gate mutants of FimH, ligand-free or in complex with heptyl α-d-O-mannopyranoside or 4-biphenyl α-d-O-mannopyranoside, are combined with quantum-mechanical calculations and molecular-dynamics simulations. In the Y48A FimH crystal structure, a large increase in the dynamics of the alkyl chain of heptyl α-d-O-mannopyranoside attempts to compensate for the absence of the aromatic ring; however, the highly energetic and stringent mannose-binding pocket of wild-type FimH is largely maintained. The Y137A mutation, on the other hand, is the most detrimental to FimH affinity and specificity: (i in the absence of ligand the FimH C-terminal residue Thr158 intrudes into the mannose-binding pocket and (ii ethylenediaminetetraacetic acid interacts strongly with Glu50, Thr53 and Asn136, in spite of multiple dialysis and purification steps. Upon mutation, pre-ligand-binding relaxation of the backbone dihedral angles at position 137 in the tyrosine gate and their coupling to Tyr48 via the interiorly located Ile52 form the basis of the loss of affinity of the FimH adhesin in the Y137A mutant.

  10. Mutation in the factor VII hepatocyte nuclear factor 4α-binding site contributes to factor VII deficiency.

    Science.gov (United States)

    Zheng, Xing-Wu; Kudaravalli, Rama; Russell, Theresa T; DiMichele, Donna M; Gibb, Constance; Russell, J Eric; Margaritis, Paris; Pollak, Eleanor S

    2011-10-01

    Severe coagulant factor VII (FVII) deficiency in postpubertal dizygotic twin males results from two point mutations in the FVII gene, a promoter region T→C transition at -60 and a His-to-Arg substitution at amino acid 348; both mutations prevent persistence of plasma functional FVII. This report documents longitudinal laboratory measurements from infancy to adulthood of FVII coagulant activity (FVII:C) in the twin FVII-deficient patients; it also details specific biochemical analyses of the -60 T→C mutation. The results revealed FVII:C levels of less than 1% in infancy that remain severely decreased through puberty and into adulthood. In-vitro analyses utilizing hepatocyte nuclear factor 4α (HNF4α) co-transfection and a chromatin immunoprecipitation assay indicate that the -60 T→C mutation severely diminishes functional interaction between the FVII promoter and transcription factor HNF4α. The importance of interaction between the FVII gene and HNF4α in normal FVII expression provides an in-vivo illustration of the regulated expression of an autosomal gene encoding a coagulation protein. The constancy of FVII:C and peripubertal patient symptomatology reported here illustrates androgen-independent expression in contrast to expression with an analogous mutation in the promoter region of the gene encoding coagulation FIX.

  11. Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1

    Energy Technology Data Exchange (ETDEWEB)

    Jenson, Justin M.; Ryan, Jeremy A.; Grant, Robert A.; Letai, Anthony; Keating, Amy E. (DFCI); (MIT)

    2017-06-08

    Overexpression of anti-apoptotic Bcl-2 family proteins contributes to cancer progression and confers resistance to chemotherapy. Small molecules that target Bcl-2 are used in the clinic to treat leukemia, but tight and selective inhibitors are not available for Bcl-2 paralog Bfl-1. Guided by computational analysis, we designed variants of the native BH3 motif PUMA that are > 150-fold selective for Bfl-1 binding. The designed peptides potently trigger disruption of the mitochondrial outer membrane in cells dependent on Bfl-1, but not in cells dependent on other anti-apoptotic homologs. High-resolution crystal structures show that designed peptide FS2 binds Bfl-1 in a shifted geometry, relative to PUMA and other binding partners, due to a set of epistatic mutations. FS2 modified with an electrophile reacts with a cysteine near the peptide-binding groove to augment specificity. Designed Bfl-1 binders provide reagents for cellular profiling and leads for developing enhanced and cell-permeable peptide or small-molecule inhibitors.

  12. CfaE tip mutations in enterotoxigenic Escherichia coli CFA/I fimbriae define critical human intestinal binding sites.

    Science.gov (United States)

    Baker, K K; Levine, M M; Morison, J; Phillips, A; Barry, E M

    2009-05-01

    Enterotoxigenic Escherichia coli (ETEC) use colonization factors to attach to the human intestinal mucosa, followed by enterotoxin expression that induces net secretion and diarrhoeal illness. ETEC strain H10407 expresses CFA/I fimbriae, which are composed of multiple CfaB structural subunits and a CfaE tip subunit. Currently, the contribution of these individual fimbrial subunits in intestinal binding remains incompletely defined. To identify the role of CfaE in attachment in the native ETEC background, an R181A single-amino-acid substitution was introduced by recombination into the H10407 genome. The substitution of R181A eliminated haemagglutination and binding of intestinal mucosa biopsies in in vitro organ culture assays, without loss of CFA/I fimbriae expression. Wild-type in trans plasmid-expressed cfaE restored the binding phenotype. In contrast, in trans expression of cfaE containing amino acid 181 substitutions with similar amino acids, lysine, methionine and glutamine did not restore the binding phenotype, indicating that the loss of the binding phenotype was due to localized areas of epitope disruption. R181 appears to have an irreplaceable role in the formation of a receptor-binding feature on CFA/I fimbriae. The results specifically indicate that the CfaE tip protein is a required binding factor in CFA/I-mediated ETEC colonization, making it a potentially important vaccine antigen. © 2009 Blackwell Publishing Ltd.

  13. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  14. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

    Science.gov (United States)

    Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

    2005-08-15

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

  15. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

    International Nuclear Information System (INIS)

    Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana; Mingarro, Ismael; Pallas, Vicente

    2005-01-01

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed

  16. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  17. A novel alpha-tropomyosin mutation associates with dilated and non-compaction cardiomyopathy and diminishes actin binding

    NARCIS (Netherlands)

    van de Meerakker, Judith B. A.; Christiaans, Imke; Barnett, Phil; Lekanne Deprez, Ronald H.; Ilgun, Aho; Mook, Olaf R. F.; Mannens, Marcel M. A. M.; Lam, Jan; Wilde, Arthur A. M.; Moorman, Antoon F. M.; Postma, Alex V.

    2013-01-01

    Dilated cardiomyopathy (DCM) is characterized by idiopathic dilatation and systolic contractile dysfunction of the ventricle(s) leading to an impaired systolic function. The origin of DCM is heterogeneous, but genetic transmission of the disease accounts for up to 50% of the cases. Mutations in

  18. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  19. Mutational analysis of the high-affinity zinc binding site validates a refined human dopamine transporter homology model.

    Directory of Open Access Journals (Sweden)

    Thomas Stockner

    Full Text Available The high-resolution crystal structure of the leucine transporter (LeuT is frequently used as a template for homology models of the dopamine transporter (DAT. Although similar in structure, DAT differs considerably from LeuT in a number of ways: (i when compared to LeuT, DAT has very long intracellular amino and carboxyl termini; (ii LeuT and DAT share a rather low overall sequence identity (22% and (iii the extracellular loop 2 (EL2 of DAT is substantially longer than that of LeuT. Extracellular zinc binds to DAT and restricts the transporter's movement through the conformational cycle, thereby resulting in a decrease in substrate uptake. Residue H293 in EL2 praticipates in zinc binding and must be modelled correctly to allow for a full understanding of its effects. We exploited the high-affinity zinc binding site endogenously present in DAT to create a model of the complete transmemberane domain of DAT. The zinc binding site provided a DAT-specific molecular ruler for calibration of the model. Our DAT model places EL2 at the transporter lipid interface in the vicinity of the zinc binding site. Based on the model, D206 was predicted to represent a fourth co-ordinating residue, in addition to the three previously described zinc binding residues H193, H375 and E396. This prediction was confirmed by mutagenesis: substitution of D206 by lysine and cysteine affected the inhibitory potency of zinc and the maximum inhibition exerted by zinc, respectively. Conversely, the structural changes observed in the model allowed for rationalizing the zinc-dependent regulation of DAT: upon binding, zinc stabilizes the outward-facing state, because its first coordination shell can only be completed in this conformation. Thus, the model provides a validated solution to the long extracellular loop and may be useful to address other aspects of the transport cycle.

  20. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  1. Epigenetic mismatches with mutated transcribing genes at leukemogenic S-phase binding/start sites--potential targets for therapy with enzyme inhibitors.

    Science.gov (United States)

    Prindull, Gregor

    2012-11-01

    This review focuses on gene transcription patterns of leukemogenic S-phases in mitotic cell cycles for identification of enzymatic reactions as potential targets for epigenetics-based drug therapy. Transcription of leukemic genes is triggered by reprogrammed transcription factors (TFs) mediated by chromatin histones. Reprogrammed TFs originate from transcriptional alterations of CpG methylation patterns of mutated epigenetic genes. They preserve memory information of earlier leukemogenic exposures, even transgenerationally via the zygote, through small (e.g. pi)RNA transmitted between cells by exosomes. Normally, reprogrammed TFs are enzymatically silenced and stored as markers in heterochromatic domains. Failure of intra S-phase surveillance (IS) permits the formation and continual operation of DNA replication forks in spite of persisting genotoxic stress. Silenced TFs are re-activated by euchromatin, most likely through leakages of insulator barriers of cis-regulating chromatin modulators (CRM) that normally separate hetero- from euchromatin domains. During transport by sliding nucleosomes, reprogrammed leukemogenic TFs are misplaced at transcription factor binding-/starting-sites (TFBS /TSS) allowing them to interact with and trigger replication of mutated leukemic genes. Interactions of enzymatically reprogrammed TFs, transcribed from mutated epigenetic genes, with replicating leukemic genes at TFBS/TSSs are key driving forces in leukemogenesis. Probably, epigenetic genes, although mutated, still retain their control of replication of leukemic genes. Epigenetics-based enzyme inhibitors must target reprogrammed TFs. Prudently, therapeutic corrections should be introduced within the frame of conventional, cytoreductive treatment protocols. Alternatively, reprogrammed TFs could be replaced by cell populations with regular TF production. Clinically, classification of leukemias should be based on their epigenetic presentation.

  2. Impact of the [delta]F508 Mutation in First Nucleotide-binding Domain of Human Cystic Fibrosis Transmembrane Conductance Regulator on Domain Folding and Structure

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Hal A.; Zhao, Xun; Wang, Chi; Sauder, J. Michael; Rooney, Isabelle; Noland, Brian W.; Lorimer, Don; Kearins, Margaret C.; Conners, Kris; Condon, Brad; Maloney, Peter C.; Guggino, William B.; Hunt, John F.; Emtage, Spencer (SG); (Columbia); (JHU)

    2010-07-19

    Cystic fibrosis is caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), commonly the deletion of residue Phe-508 (DeltaF508) in the first nucleotide-binding domain (NBD1), which results in a severe reduction in the population of functional channels at the epithelial cell surface. Previous studies employing incomplete NBD1 domains have attributed this to aberrant folding of DeltaF508 NBD1. We report structural and biophysical studies on complete human NBD1 domains, which fail to demonstrate significant changes of in vitro stability or folding kinetics in the presence or absence of the DeltaF508 mutation. Crystal structures show minimal changes in protein conformation but substantial changes in local surface topography at the site of the mutation, which is located in the region of NBD1 believed to interact with the first membrane spanning domain of CFTR. These results raise the possibility that the primary effect of DeltaF508 is a disruption of proper interdomain interactions at this site in CFTR rather than interference with the folding of NBD1. Interestingly, increases in the stability of NBD1 constructs are observed upon introduction of second-site mutations that suppress the trafficking defect caused by the DeltaF508 mutation, suggesting that these suppressors might function indirectly by improving the folding efficiency of NBD1 in the context of the full-length protein. The human NBD1 structures also solidify the understanding of CFTR regulation by showing that its two protein segments that can be phosphorylated both adopt multiple conformations that modulate access to the ATPase active site and functional interdomain interfaces.

  3. Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.

    Science.gov (United States)

    Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang

    2013-12-01

    The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.

  4. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  5. Changing folding and binding stability in a viral coat protein: a comparison between substitutions accessible through mutation and those fixed by natural selection.

    Science.gov (United States)

    Miller, Craig R; Lee, Kuo Hao; Wichman, Holly A; Ytreberg, F Marty

    2014-01-01

    Previous studies have shown that most random amino acid substitutions destabilize protein folding (i.e. increase the folding free energy). No analogous studies have been carried out for protein-protein binding. Here we use a structure-based model of the major coat protein in a simple virus, bacteriophage φX174, to estimate the free energy of folding of a single coat protein and binding of five coat proteins within a pentameric unit. We confirm and extend previous work in finding that most accessible substitutions destabilize both protein folding and protein-protein binding. We compare the pool of accessible substitutions with those observed among the φX174-like wild phage and in experimental evolution with φX174. We find that observed substitutions have smaller effects on stability than expected by chance. An analysis of adaptations at high temperatures suggests that selection favors either substitutions with no effect on stability or those that simultaneously stabilize protein folding and slightly destabilize protein binding. We speculate that these mutations might involve adjusting the rate of capsid assembly. At normal laboratory temperature there is little evidence of directional selection. Finally, we show that cumulative changes in stability are highly variable; sometimes they are well beyond the bounds of single substitution changes and sometimes they are not. The variation leads us to conclude that phenotype selection acts on more than just stability. Instances of larger cumulative stability change (never via a single substitution despite their availability) lead us to conclude that selection views stability at a local, not a global, level.

  6. The E2.65A mutation disrupts dynamic binding poses of SB269652 at the dopamine D2 and D3 receptors.

    Directory of Open Access Journals (Sweden)

    Ravi Kumar Verma

    2018-01-01

    Full Text Available The dopamine D2 and D3 receptors (D2R and D3R are important targets for antipsychotics and for the treatment of drug abuse. SB269652, a bitopic ligand that simultaneously binds both the orthosteric binding site (OBS and a secondary binding pocket (SBP in both D2R and D3R, was found to be a negative allosteric modulator. Previous studies identified Glu2.65 in the SBP to be a key determinant of both the affinity of SB269652 and the magnitude of its cooperativity with orthosteric ligands, as the E2.65A mutation decreased both of these parameters. However, the proposed hydrogen bond (H-bond between Glu2.65 and the indole moiety of SB269652 is not a strong interaction, and a structure activity relationship study of SB269652 indicates that this H-bond may not be the only element that determines its allosteric properties. To understand the structural basis of the observed phenotype of E2.65A, we carried out molecular dynamics simulations with a cumulative length of ~77 μs of D2R and D3R wild-type and their E2.65A mutants bound to SB269652. In combination with Markov state model analysis and by characterizing the equilibria of ligand binding modes in different conditions, we found that in both D2R and D3R, whereas the tetrahydroisoquinoline moiety of SB269652 is stably bound in the OBS, the indole-2-carboxamide moiety is dynamic and only intermittently forms H-bonds with Glu2.65. Our results also indicate that the E2.65A mutation significantly affects the overall shape and size of the SBP, as well as the conformation of the N terminus. Thus, our findings suggest that the key role of Glu2.65 in mediating the allosteric properties of SB269652 extends beyond a direct interaction with SB269652, and provide structural insights for rational design of SB269652 derivatives that may retain its allosteric properties.

  7. Mutational analysis of divalent metal ion binding in the active site of class II α-mannosidase from sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Hansen, Dennis K.; Webb, Helen; Nielsen, Jonas Willum

    2015-01-01

    Mutational analysis of Sulfolobus solfataricus class II α-mannosidase was focused on side chains that interact with the hydroxyls of the-1 mannosyl of the substrate (Asp-534) or form ligands to the active site divalent metal ion (His-228 and His-533) judged from crystal structures of homologous e......, although less dramatically with some activating metal ions. No major differences in the pH dependence between wild-type and mutant enzymes were found in the presence of different metal ions. The pH optimum was 5, but enzyme instability was observed at pH...

  8. Mutations in the SPARC-related modular calcium-binding protein 1 gene, SMOC1, cause waardenburg anophthalmia syndrome.

    Science.gov (United States)

    Abouzeid, Hana; Boisset, Gaëlle; Favez, Tatiana; Youssef, Mohamed; Marzouk, Iman; Shakankiry, Nihal; Bayoumi, Nader; Descombes, Patrick; Agosti, Céline; Munier, Francis L; Schorderet, Daniel F

    2011-01-07

    Waardenburg anophthalmia syndrome, also known as microphthalmia with limb anomalies, ophthalmoacromelic syndrome, and anophthalmia-syndactyly, is a rare autosomal-recessive developmental disorder that has been mapped to 10p11.23. Here we show that this disease is heterogeneous by reporting on a consanguineous family, not linked to the 10p11.23 locus, whose two affected children have a homozygous mutation in SMOC1. Knockdown experiments of the zebrafish smoc1 revealed that smoc1 is important in eye development and that it is expressed in many organs, including brain and somites.

  9. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  10. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  11. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  12. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  13. Mouse models of two missense mutations in actin-binding domain 1 of dystrophin associated with Duchenne or Becker muscular dystrophy.

    Science.gov (United States)

    McCourt, Jackie L; Talsness, Dana M; Lindsay, Angus; Arpke, Robert W; Chatterton, Paul D; Nelson, D'anna M; Chamberlain, Christopher M; Olthoff, John T; Belanto, Joseph J; McCourt, Preston M; Kyba, Michael; Lowe, Dawn A; Ervasti, James M

    2018-02-01

    Missense mutations in the dystrophin protein can cause Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD) through an undefined pathomechanism. In vitro studies suggest that missense mutations in the N-terminal actin-binding domain (ABD1) cause protein instability, and cultured myoblast studies reveal decreased expression levels that can be restored to wild-type with proteasome inhibitors. To further elucidate the pathophysiology of missense dystrophin in vivo, we generated two transgenic mdx mouse lines expressing L54R or L172H mutant dystrophin, which correspond to missense mutations identified in human patients with DMD or BMD, respectively. Our biochemical, histologic and physiologic analysis of the L54R and L172H mice show decreased levels of dystrophin which are proportional to the phenotypic severity. Proteasome inhibitors were ineffective in both the L54R and L172H mice, yet mice homozygous for the L172H transgene were able to express even higher levels of dystrophin which caused further improvements in muscle histology and physiology. Given that missense dystrophin is likely being degraded by the proteasome but whole body proteasome inhibition was not possible, we screened for ubiquitin-conjugating enzymes involved in targeting dystrophin to the proteasome. A myoblast cell line expressing L54R mutant dystrophin was screened with an siRNA library targeting E1, E2 and E3 ligases which identified Amn1, FBXO33, Zfand5 and Trim75. Our study establishes new mouse models of dystrophinopathy and identifies candidate E3 ligases that may specifically regulate dystrophin protein turnover in vivo. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  15. Mutation of androgen receptor N-terminal phosphorylation site Tyr-267 leads to inhibition of nuclear translocation and DNA binding.

    Directory of Open Access Journals (Sweden)

    Mehmet Karaca

    Full Text Available Reactivation of androgen receptor (AR may drive recurrent prostate cancer in castrate patients. Ack1 tyrosine kinase is overexpressed in prostate cancer and promotes castrate resistant xenograft tumor growth and enhances androgen target gene expression and AR recruitment to enhancers. Ack1 phosphorylates AR at Tyr-267 and possibly Tyr-363, both in the N-terminal transactivation domain. In this study, the role of these phosphorylation sites was investigated by characterizing the phosphorylation site mutants in the context of full length and truncated AR lacking the ligand-binding domain. Y267F and Y363F mutants showed decreased transactivation of reporters. Expression of wild type full length and truncated AR in LNCaP cells increased cell proliferation in androgen-depleted conditions and increased colony formation. However, the Y267F mutant of full length and truncated AR was defective in stimulating cell proliferation. The Y363F mutant was less severely affected than the Y267F mutant. The full length AR Y267F mutant was defective in nuclear translocation induced by androgen or Ack1 kinase. The truncated AR was constitutively localized to the nucleus. Chromatin immunoprecipitation analysis showed that it was recruited to the target enhancers without androgen. The truncated Y267F AR mutant did not exhibit constitutive nuclear localization and androgen enhancer binding activity. These results support the concept that phosphorylation of Tyr-267, and to a lesser extent Tyr-363, is required for AR nuclear translocation and recruitment and DNA binding and provide a rationale for development of novel approaches to inhibit AR activity.

  16. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  17. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    Science.gov (United States)

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  19. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  20. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  1. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  2. Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing.

    Science.gov (United States)

    Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

    2013-02-01

    The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.

  3. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  4. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  5. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  6. Molecular dynamics simulation reveals insights into the mechanism of unfolding by the A130T/V mutations within the MID1 zinc-binding Bbox1 domain.

    Directory of Open Access Journals (Sweden)

    Yunjie Zhao

    Full Text Available The zinc-binding Bbox1 domain in protein MID1, a member of the TRIM family of proteins, facilitates the ubiquitination of the catalytic subunit of protein phosphatase 2A and alpha4, a protein regulator of PP2A. The natural mutation of residue A130 to a valine or threonine disrupts substrate recognition and catalysis. While NMR data revealed the A130T mutant Bbox1 domain failed to coordinate both structurally essential zinc ions and resulted in an unfolded structure, the unfolding mechanism is unknown. Principle component analysis revealed that residue A130 served as a hinge point between the structured β-strand-turn-β-strand (β-turn-β and the lasso-like loop sub-structures that constitute loop1 of the ββα-RING fold that the Bbox1 domain adopts. Backbone RMSD data indicate significant flexibility and departure from the native structure within the first 5 ns of the molecular dynamics (MD simulation for the A130V mutant (>6 Å and after 30 ns for A130T mutant (>6 Å. Overall RMSF values were higher for the mutant structures and showed increased flexibility around residues 125 and 155, regions with zinc-coordinating residues. Simulated pKa values of the sulfhydryl group of C142 located near A130 suggested an increased in value to ~9.0, paralleling the increase in the apparent dielectric constants for the small cavity near residue A130. Protonation of the sulfhydryl group would disrupt zinc-coordination, directly contributing to unfolding of the Bbox1. Together, the increased motion of residues of loop 1, which contains four of the six zinc-binding cysteine residues, and the increased pKa of C142 could destabilize the structure of the zinc-coordinating residues and contribute to the unfolding.

  7. The phosphomimetic mutation of syndecan-4 binds and inhibits Tiam1 modulating Rac1 activity in PDZ interaction-dependent manner.

    Directory of Open Access Journals (Sweden)

    Aniko Keller-Pinter

    Full Text Available The small GTPases of the Rho family comprising RhoA, Rac1 and Cdc42 function as molecular switches controlling several essential biochemical pathways in eukaryotic cells. Their activity is cycling between an active GTP-bound and an inactive GDP-bound conformation. The exchange of GDP to GTP is catalyzed by guanine nucleotide exchange factors (GEFs. Here we report a novel regulatory mechanism of Rac1 activity, which is controlled by a phosphomimetic (Ser179Glu mutant of syndecan-4 (SDC4. SDC4 is a ubiquitously expressed transmembrane, heparan sulfate proteoglycan. In this study we show that the Ser179Glu mutant binds strongly Tiam1, a Rac1-GEF reducing Rac1-GTP by 3-fold in MCF-7 breast adenocarcinoma cells. Mutational analysis unravels the PDZ interaction between SDC4 and Tiam1 is indispensable for the suppression of the Rac1 activity. Neither of the SDC4 interactions is effective alone to block the Rac1 activity, on the contrary, lack of either of interactions can increase the activity of Rac1, therefore the Rac1 activity is the resultant of the inhibitory and stimulatory effects. In addition, SDC4 can bind and tether RhoGDI1 (GDP-dissociation inhibitor 1 to the membrane. Expression of the phosphomimetic SDC4 results in the accumulation of the Rac1-RhoGDI1 complex. Co-immunoprecipitation assays (co-IP-s reveal that SDC4 can form complexes with RhoGDI1. Together, the regulation of the basal activity of Rac1 is fine tuned and SDC4 is implicated in multiple ways.

  8. The phosphomimetic mutation of syndecan-4 binds and inhibits Tiam1 modulating Rac1 activity in PDZ interaction–dependent manner

    Science.gov (United States)

    Keller-Pinter, Aniko; Ughy, Bettina; Domoki, Monika; Pettko-Szandtner, Aladar; Letoha, Tamas; Tovari, Jozsef; Timar, Jozsef

    2017-01-01

    The small GTPases of the Rho family comprising RhoA, Rac1 and Cdc42 function as molecular switches controlling several essential biochemical pathways in eukaryotic cells. Their activity is cycling between an active GTP-bound and an inactive GDP-bound conformation. The exchange of GDP to GTP is catalyzed by guanine nucleotide exchange factors (GEFs). Here we report a novel regulatory mechanism of Rac1 activity, which is controlled by a phosphomimetic (Ser179Glu) mutant of syndecan-4 (SDC4). SDC4 is a ubiquitously expressed transmembrane, heparan sulfate proteoglycan. In this study we show that the Ser179Glu mutant binds strongly Tiam1, a Rac1-GEF reducing Rac1-GTP by 3-fold in MCF-7 breast adenocarcinoma cells. Mutational analysis unravels the PDZ interaction between SDC4 and Tiam1 is indispensable for the suppression of the Rac1 activity. Neither of the SDC4 interactions is effective alone to block the Rac1 activity, on the contrary, lack of either of interactions can increase the activity of Rac1, therefore the Rac1 activity is the resultant of the inhibitory and stimulatory effects. In addition, SDC4 can bind and tether RhoGDI1 (GDP-dissociation inhibitor 1) to the membrane. Expression of the phosphomimetic SDC4 results in the accumulation of the Rac1–RhoGDI1 complex. Co-immunoprecipitation assays (co-IP-s) reveal that SDC4 can form complexes with RhoGDI1. Together, the regulation of the basal activity of Rac1 is fine tuned and SDC4 is implicated in multiple ways. PMID:29121646

  9. The phosphomimetic mutation of syndecan-4 binds and inhibits Tiam1 modulating Rac1 activity in PDZ interaction-dependent manner.

    Science.gov (United States)

    Keller-Pinter, Aniko; Ughy, Bettina; Domoki, Monika; Pettko-Szandtner, Aladar; Letoha, Tamas; Tovari, Jozsef; Timar, Jozsef; Szilak, Laszlo

    2017-01-01

    The small GTPases of the Rho family comprising RhoA, Rac1 and Cdc42 function as molecular switches controlling several essential biochemical pathways in eukaryotic cells. Their activity is cycling between an active GTP-bound and an inactive GDP-bound conformation. The exchange of GDP to GTP is catalyzed by guanine nucleotide exchange factors (GEFs). Here we report a novel regulatory mechanism of Rac1 activity, which is controlled by a phosphomimetic (Ser179Glu) mutant of syndecan-4 (SDC4). SDC4 is a ubiquitously expressed transmembrane, heparan sulfate proteoglycan. In this study we show that the Ser179Glu mutant binds strongly Tiam1, a Rac1-GEF reducing Rac1-GTP by 3-fold in MCF-7 breast adenocarcinoma cells. Mutational analysis unravels the PDZ interaction between SDC4 and Tiam1 is indispensable for the suppression of the Rac1 activity. Neither of the SDC4 interactions is effective alone to block the Rac1 activity, on the contrary, lack of either of interactions can increase the activity of Rac1, therefore the Rac1 activity is the resultant of the inhibitory and stimulatory effects. In addition, SDC4 can bind and tether RhoGDI1 (GDP-dissociation inhibitor 1) to the membrane. Expression of the phosphomimetic SDC4 results in the accumulation of the Rac1-RhoGDI1 complex. Co-immunoprecipitation assays (co-IP-s) reveal that SDC4 can form complexes with RhoGDI1. Together, the regulation of the basal activity of Rac1 is fine tuned and SDC4 is implicated in multiple ways.

  10. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  11. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  13. Mutational analysis of the EMCV 2A protein identifies a nuclear localization signal and an eIF4E binding site

    International Nuclear Information System (INIS)

    Groppo, Rachel; Brown, Bradley A.; Palmenberg, Ann C.

    2011-01-01

    Cardioviruses have a unique 2A protein (143 aa). During genome translation, the encephalomyocarditis virus (EMCV) 2A is released through a ribosome skipping event mitigated through C-terminal 2A sequences and by subsequent N-terminal reaction with viral 3C pro . Although viral replication is cytoplasmic, mature 2A accumulates in nucleoli shortly after infection. Some protein also transiently associates with cytoplasmic 40S ribosomal subunits, an activity contributing to inhibition of cellular cap-dependent translation. Cardiovirus sequences predict an eIF4E binding site (aa 126-134) and a nuclear localization signal (NLS, aa 91-102), within 2A, both of which are functional during EMCV infection. Point mutations preventing eIF4E:2A interactions gave small-plaque phenotype viruses, but still inhibited cellular cap-dependent translation. Deletions within the NLS motif relocalized 2A to the cytoplasm and abrogated the inhibition of cap-dependent translation. A fusion protein linking the 2A NLS to eGFP was sufficient to redirect the reporter to the nucleus but not into nucleoli.

  14. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  15. High resolution melting for mutation scanning of TP53 exons 5–8

    International Nuclear Information System (INIS)

    Krypuy, Michael; Dobrovic, Alexander; Ahmed, Ahmed Ashour; Etemadmoghadam, Dariush; Hyland, Sarah J; Australian Ovarian Cancer Study Group; Fazio, Anna de; Fox, Stephen B; Brenton, James D; Bowtell, David D

    2007-01-01

    p53 is commonly inactivated by mutations in the DNA-binding domain in a wide range of cancers. As mutant p53 often influences response to therapy, effective and rapid methods to scan for mutations in TP53 are likely to be of clinical value. We therefore evaluated the use of high resolution melting (HRM) as a rapid mutation scanning tool for TP53 in tumour samples. We designed PCR amplicons for HRM mutation scanning of TP53 exons 5 to 8 and tested them with DNA from cell lines hemizygous or homozygous for known mutations. We assessed the sensitivity of each PCR amplicon using dilutions of cell line DNA in normal wild-type DNA. We then performed a blinded assessment on ovarian tumour DNA samples that had been previously sequenced for mutations in TP53 to assess the sensitivity and positive predictive value of the HRM technique. We also performed HRM analysis on breast tumour DNA samples with unknown TP53 mutation status. One cell line mutation was not readily observed when exon 5 was amplified. As exon 5 contained multiple melting domains, we divided the exon into two amplicons for further screening. Sequence changes were also introduced into some of the primers to improve the melting characteristics of the amplicon. Aberrant HRM curves indicative of TP53 mutations were observed for each of the samples in the ovarian tumour DNA panel. Comparison of the HRM results with the sequencing results revealed that each mutation was detected by HRM in the correct exon. For the breast tumour panel, we detected seven aberrant melt profiles by HRM and subsequent sequencing confirmed the presence of these and no other mutations in the predicted exons. HRM is an effective technique for simple and rapid scanning of TP53 mutations that can markedly reduce the amount of sequencing required in mutational studies of TP53

  16. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  17. High- and low-affinity binding of S-citalopram to the human serotonin transporter mutated at 20 putatively important amino acid positions

    DEFF Research Database (Denmark)

    Plenge, Per; Wiborg, Ove

    2005-01-01

    of presumed importance. Binding of S-citalopram, both to the high-affinity-binding site and to the allosteric binding site, was measured in these mutants with the purpose of investigating the connection between the two binding sites. The amino acid substitutions did not introduce large changes in the two...

  18. Mutation of mapped TIA-1/TIAR binding sites in the 3' terminal stem-loop of West Nile virus minus-strand RNA in an infectious clone negatively affects genomic RNA amplification.

    Science.gov (United States)

    Emara, Mohamed M; Liu, Hsuan; Davis, William G; Brinton, Margo A

    2008-11-01

    Previous data showed that the cellular proteins TIA-1 and TIAR bound specifically to the West Nile virus 3' minus-strand stem-loop [WNV3'(-)SL] RNA (37) and colocalized with flavivirus replication complexes in WNV- and dengue virus-infected cells (21). In the present study, the sites on the WNV3'(-)SL RNA required for efficient in vitro T-cell intracellular antigen-related (TIAR) and T-cell intracellular antigen-1 (TIA-1) protein binding were mapped to short AU sequences (UAAUU) located in two internal loops of the WNV3'(-)SL RNA structure. Infectious clone RNAs with all or most of the binding site nucleotides in one of the 3' (-)SL loops deleted or substituted did not produce detectable virus after transfection or subsequent passage. With one exception, deletion/mutation of a single terminal nucleotide in one of the binding sequences had little effect on the efficiency of protein binding or virus production, but mutation of a nucleotide in the middle of a binding sequence reduced both the in vitro protein binding efficiency and virus production. Plaque size, intracellular genomic RNA levels, and virus production progressively decreased with decreasing in vitro TIAR/TIA-1 binding activity, but the translation efficiency of the various mutant RNAs was similar to that of the parental RNA. Several of the mutant RNAs that inefficiently interacted with TIAR/TIA-1 in vitro rapidly reverted in vivo, indicating that they could replicate at a low level and suggesting that an interaction between TIAR/TIA-1 and the viral 3'(-)SL RNA is not required for initial low-level symmetric RNA replication but instead facilitates the subsequent asymmetric amplification of genome RNA from the minus-strand template.

  19. A point mutation in the [2Fe–2S] cluster binding region of the NAF-1 protein (H114C) dramatically hinders the cluster donor properties

    Energy Technology Data Exchange (ETDEWEB)

    Tamir, Sagi; Eisenberg-Domovich, Yael [The Hebrew University of Jerusalem, Edmond J. Safra Campus at Givat Ram, Jerusalem 91904 (Israel); Conlan, Andrea R.; Stofleth, Jason T.; Lipper, Colin H.; Paddock, Mark L. [University of California at San Diego, La Jolla, CA 92093 (United States); Mittler, Ron [University of North Texas, Denton, TX 76203 (United States); Jennings, Patricia A. [University of California at San Diego, La Jolla, CA 92093 (United States); Livnah, Oded, E-mail: oded.livnah@huji.ac.il; Nechushtai, Rachel, E-mail: oded.livnah@huji.ac.il [The Hebrew University of Jerusalem, Edmond J. Safra Campus at Givat Ram, Jerusalem 91904 (Israel)

    2014-06-01

    NAF-1 has been shown to be related with human health and disease, is upregulated in epithelial breast cancer and suppression of its expression significantly suppresses tumor growth. It is shown that replacement of the single His ligand with Cys resulted in dramatic changes to the properties of its 2Fe-2S clusters without any global crystal structural changes. NAF-1 is an important [2Fe–2S] NEET protein associated with human health and disease. A mis-splicing mutation in NAF-1 results in Wolfram Syndrome type 2, a lethal childhood disease. Upregulation of NAF-1 is found in epithelial breast cancer cells, and suppression of NAF-1 expression by knockdown significantly suppresses tumor growth. Key to NAF-1 function is the NEET fold with its [2Fe–2S] cluster. In this work, the high-resolution structure of native NAF-1 was determined to 1.65 Å resolution (R factor = 13.5%) together with that of a mutant in which the single His ligand of its [2Fe–2S] cluster, His114, was replaced by Cys. The NAF-1 H114C mutant structure was determined to 1.58 Å resolution (R factor = 16.0%). All structural differences were localized to the cluster binding site. Compared with native NAF-1, the [2Fe–2S] clusters of the H114C mutant were found to (i) be 25-fold more stable, (ii) have a redox potential that is 300 mV more negative and (iii) have their cluster donation/transfer function abolished. Because no global structural differences were found between the mutant and the native (wild-type) NAF-1 proteins, yet significant functional differences exist between them, the NAF-1 H114C mutant is an excellent tool to decipher the underlying biological importance of the [2Fe–2S] cluster of NAF-1 in vivo.

  20. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Science.gov (United States)

    Timmins, Amy; de Visser, Sam P.

    2017-01-01

    Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM) study on wildtype and mutant structures. In a previous study (Timmins et al., 2017) we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD) study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter. PMID:29170737

  1. Mutation and crystallization of the first KH domain of human polycytosine-binding protein 1 (PCBP1) in complex with DNA

    International Nuclear Information System (INIS)

    Yoga, Yano M. K.; Traore, Daouda A. K.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

    2011-01-01

    The successful preparation of a mutant KH domain representing the first KH domain of PCBP1 and its crystallization in complex with a C-rich DNA are reported. This structure is anticipated to provide high-resolution information that will allow better understanding of the basis of cytosine specificity by PCBPs. Polycytosine-binding proteins (PCBPs) are triple KH-domain proteins that play an important role in the regulation of translation of eukaryotic mRNA. They are also utilized by viral RNA and have been shown to interact with ssDNA. Underlying their function is the specific recognition of C-rich nucleotides by their KH domains. However, the structural basis of this recognition is only partially understood. Here, the preparation of a His-tagged KH domain is described, representing the first domain of PCBP1 that incorporates a C54S mutation as well as the addition of a C-terminal tryptophan. This construct has facilitated the preparation of highly diffracting crystals in complex with C-rich DNA (sequence ACCCCA). Crystals of the KH1–DNA complex were grown using the hanging-drop vapour-diffusion method in 0.1 M phosphate–citrate pH 4.2, 40%(v/v) PEG 300. X-ray diffraction data were collected to 1.77 Å resolution and the diffraction was consistent with space group P2 1 , with unit-cell parameters a = 38.59, b = 111.88, c = 43.42 Å, α = γ = 90.0, β = 93.37°. The structure of the KH1–DNA complex will further our insight into the basis of cytosine specificity by PCBPs

  2. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Directory of Open Access Journals (Sweden)

    Amy Timmins

    2017-11-01

    Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

  3. A point mutation in the [2Fe–2S] cluster binding region of the NAF-1 protein (H114C) dramatically hinders the cluster donor properties

    International Nuclear Information System (INIS)

    Tamir, Sagi; Eisenberg-Domovich, Yael; Conlan, Andrea R.; Stofleth, Jason T.; Lipper, Colin H.; Paddock, Mark L.; Mittler, Ron; Jennings, Patricia A.; Livnah, Oded; Nechushtai, Rachel

    2014-01-01

    NAF-1 has been shown to be related with human health and disease, is upregulated in epithelial breast cancer and suppression of its expression significantly suppresses tumor growth. It is shown that replacement of the single His ligand with Cys resulted in dramatic changes to the properties of its 2Fe-2S clusters without any global crystal structural changes. NAF-1 is an important [2Fe–2S] NEET protein associated with human health and disease. A mis-splicing mutation in NAF-1 results in Wolfram Syndrome type 2, a lethal childhood disease. Upregulation of NAF-1 is found in epithelial breast cancer cells, and suppression of NAF-1 expression by knockdown significantly suppresses tumor growth. Key to NAF-1 function is the NEET fold with its [2Fe–2S] cluster. In this work, the high-resolution structure of native NAF-1 was determined to 1.65 Å resolution (R factor = 13.5%) together with that of a mutant in which the single His ligand of its [2Fe–2S] cluster, His114, was replaced by Cys. The NAF-1 H114C mutant structure was determined to 1.58 Å resolution (R factor = 16.0%). All structural differences were localized to the cluster binding site. Compared with native NAF-1, the [2Fe–2S] clusters of the H114C mutant were found to (i) be 25-fold more stable, (ii) have a redox potential that is 300 mV more negative and (iii) have their cluster donation/transfer function abolished. Because no global structural differences were found between the mutant and the native (wild-type) NAF-1 proteins, yet significant functional differences exist between them, the NAF-1 H114C mutant is an excellent tool to decipher the underlying biological importance of the [2Fe–2S] cluster of NAF-1 in vivo

  4. F104S c-Mpl responds to a transmembrane domain-binding thrombopoietin receptor agonist: proof of concept that selected receptor mutations in congenital amegakaryocytic thrombocytopenia can be stimulated with alternative thrombopoietic agents.

    Science.gov (United States)

    Fox, Norma E; Lim, Jihyang; Chen, Rose; Geddis, Amy E

    2010-05-01

    To determine whether specific c-Mpl mutations might respond to thrombopoietin receptor agonists. We created cell line models of type II c-Mpl mutations identified in congenital amegakaryocytic thrombocytopenia. We selected F104S c-Mpl for further study because it exhibited surface expression of the receptor. We measured proliferation of cell lines expressing wild-type or F104S c-Mpl in response to thrombopoietin receptor agonists targeting the extracellular (m-AMP4) or transmembrane (LGD-4665) domains of the receptor by 1-methyltetrazole-5-thiol assay. We measured thrombopoietin binding to the mutant receptor using an in vitro thrombopoietin uptake assay and identified F104 as a potentially critical residue for the interaction between the receptor and its ligand by aligning thrombopoietin and erythropoietin receptors from multiple species. Cells expressing F104S c-Mpl proliferated in response to LGD-4665, but not thrombopoietin or m-AMP4. Compared to thrombopoietin, LGD-4665 stimulates signaling with delayed kinetics in both wild-type and F104S c-Mpl-expressing cells. Although F104S c-Mpl is expressed on the cell surface in our BaF3 cell line model, the mutant receptor does not bind thrombopoietin. Comparison to the erythropoietin receptor suggests that F104 engages in hydrogen-bonding interactions that are critical for binding to thrombopoietin. These findings suggest that a small subset of patients with congenital amegakaryocytic thrombocytopenia might respond to treatment with thrombopoietin receptor agonists, but that responsiveness will depend on the type of mutation and agonist used. We postulate that F104 is critical for thrombopoietin binding. The kinetics of signaling in response to a transmembrane domain-binding agonist are delayed in comparison to thrombopoietin. 2010 ISEH Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

  5. Mutations in the putative zinc-binding motif of UL52 demonstrate a complex interdependence between the UL5 and UL52 subunits of the human herpes simplex virus type 1 helicase/primase complex.

    Science.gov (United States)

    Chen, Yan; Carrington-Lawrence, Stacy D; Bai, Ping; Weller, Sandra K

    2005-07-01

    Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface.

  6. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...... at positions 2032, 2453, and 2499 to human cytosolic base identity did not confer significantly reduced susceptibility to linezolid. The largest decrease in linezolid susceptibility for any of the introduced single mutations was observed with the G2576U mutation at a position that is 7.9 Å from linezolid....... Smaller decreases were observed with the A2503G, U2504G, and G2505A mutations at nucleotides proximal to linezolid, showing that the degree of resistance conferred is not simply inversely proportional to the nucleotide-drug distance. The double mutations G2032A-C2499A, G2032A-U2504G, C2055A-U2504G, and C...

  7. Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Tan, Yu-Hong [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Shaw, Gary [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States); Zhou, Zheng; Bai, Yawen [Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, Bethesda, MD 20892 (United States); Luo, Ray [Department of Molecular Biology and Biochemistry, University of California at Irvine, Irvine, CA 92697 (United States); Ji, Xinhua, E-mail: jix@ncifcrf.gov [Macromolecular Crystallography Laboratory, National Cancer Institute, Frederick, MD 21702 (United States)

    2008-05-01

    The impact of hotspot mutation R282Q on the structure of human p53 DNA-binding domain has been characterized by X-ray crystallography and molecular-dynamics simulations. Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53.

  8. Mechanism of the Dual Activities of Human CYP17A1 and Binding to Anti-Prostate Cancer Drug Abiraterone Revealed by a Novel V366M Mutation Causing 17,20 Lyase Deficiency

    Directory of Open Access Journals (Sweden)

    Mónica Fernández-Cancio

    2018-04-01

    Full Text Available The CYP17A1 gene regulates sex steroid biosynthesis in humans through 17α-hydroxylase/17,20 lyase activities and is a target of anti-prostate cancer drug abiraterone. In a 46, XY patient with female external genitalia, together with a loss of function mutation S441P, we identified a novel missense mutation V366M at the catalytic center of CYP17A1 which preferentially impaired 17,20 lyase activity. Kinetic experiments with bacterially expressed proteins revealed that V366M mutant enzyme can bind and metabolize pregnenolone to 17OH-pregnenolone, but 17OH-pregnenolone binding and conversion to dehydroepiandrosterone (DHEA was impaired, explaining the patient’s steroid profile. Abiraterone could not bind and inhibit the 17α-hydroxylase activity of the CYP17A1-V366M mutant. Molecular dynamics (MD simulations showed that V366M creates a “one-way valve” and suggests a mechanism for dual activities of human CYP17A1 where, after the conversion of pregnenolone to 17OH-pregnenolone, the product exits the active site and re-enters for conversion to dehydroepiandrosterone. The V366M mutant also explained the effectiveness of the anti-prostate cancer drug abiraterone as a potent inhibitor of CYP17A1 by binding tightly at the active site in the WT enzyme. The V366M is the first human mutation to be described at the active site of CYP17A1 that causes isolated 17,20 lyase deficiency. Knowledge about the specificity of CYP17A1 activities is of importance for the development of treatments for polycystic ovary syndrome and inhibitors for prostate cancer therapy.

  9. Intronic PAH gene mutations cause a splicing defect by a novel mechanism involving U1snRNP binding downstream of the 5' splice site

    DEFF Research Database (Denmark)

    Martínez-Pizarro, Ainhoa; Dembic, Maja; Pérez, Belén

    2018-01-01

    Phenylketonuria (PKU), one of the most common inherited diseases of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene. Recently, PAH exon 11 was identified as a vulnerable exon due to a weak 3' splice site, with different exonic mutations affecting exon 11 ...

  10. Human small cell lung cancer NYH cells selected for resistance to the bisdioxopiperazine topoisomerase II catalytic inhibitor ICRF-187 demonstrate a functional R162Q mutation in the Walker A consensus ATP binding domain of the alpha isoform

    DEFF Research Database (Denmark)

    Wessel, I; Jensen, L H; Jensen, P B

    1999-01-01

    in expression of the beta isoform. Sequencing of the entire topoisomerase IIalpha cDNA from NYH/187 cells demonstrated a homozygous G-->A point mutation at nucleotide 485, leading to a R162Q conversion in the Walker A consensus ATP binding site (residues 161-165 in the alpha isoform), this being the first drug......-selected mutation described at this site. Western blotting after incubation with ICRF-187 showed no depletion of the alpha isoform in NYH/187 cells in contrast to wild-type (wt) cells, whereas equal depletion of the beta isoform was observed in the two sublines. Alkaline elution assay demonstrated a lack...... of inhibition of etoposide-induced DNA single-stranded breaks in NYH/187 cells, whereas this inhibition was readily apparent in NYH cells. Site-directed mutagenesis in human topoisomerase IIalpha introduced into a yeast Saccharomyces cerevisiae strain with a temperature-conditional yeast TOP2 mutant...

  11. Mutational analysis of the extracellular disulphide bridges of the atypical chemokine receptor ACKR3/CXCR7 uncovers multiple binding and activation modes for its chemokine and endogenous non-chemokine agonists.

    Science.gov (United States)

    Szpakowska, Martyna; Meyrath, Max; Reynders, Nathan; Counson, Manuel; Hanson, Julien; Steyaert, Jan; Chevigné, Andy

    2018-07-01

    The atypical chemokine receptor ACKR3/CXCR7 plays crucial roles in numerous physiological processes but also in viral infection and cancer. ACKR3 shows strong propensity for activation and, unlike classical chemokine receptors, can respond to chemokines from both the CXC and CC families as well as to the endogenous peptides BAM22 and adrenomedullin. Moreover, despite belonging to the G protein coupled receptor family, its function appears to be mainly dependent on β-arrestin. ACKR3 has also been shown to continuously cycle between the plasma membrane and the endosomal compartments, suggesting a possible role as a scavenging receptor. So far, the molecular basis accounting for these atypical binding and signalling properties remains elusive. Noteworthy, ACKR3 extracellular domains bear three disulphide bridges. Two of them lie on top of the two main binding subpockets and are conserved among chemokine receptors, and one, specific to ACKR3, forms an intra-N terminus four-residue-loop of so far unknown function. Here, by mutational and functional studies, we examined the impact of the different disulphide bridges for ACKR3 folding, ligand binding and activation. We showed that, in contrast to most classical chemokine receptors, none of the extracellular disulphide bridges was essential for ACKR3 function. However, the disruption of the unique ACKR3 N-terminal loop drastically reduced the binding of CC chemokines whereas it only had a mild impact on CXC chemokine binding. Mutagenesis also uncovered that chemokine and endogenous non-chemokine ligands interact and activate ACKR3 according to distinct binding modes characterized by different transmembrane domain subpocket occupancy and N-terminal loop contribution, with BAM22 mimicking the binding mode of CC chemokine N terminus. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  13. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  14. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  15. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  16. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...... demonstrated a marked difference between wild-type and the mutant probe, which uniquely bound one or several transcription factors extracted from Caco-2 cells. This finding supports a model in which ectopic anterior SHH expression in the developing limb results from abnormal binding of one or more...

  17. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    Science.gov (United States)

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Pituitary resistance to thyroid hormone associated with a base mutation in the hormone-binding domain of the human 3, 5,3[prime]-triiodothyronine receptor-[beta

    Energy Technology Data Exchange (ETDEWEB)

    Sasaki, Shigekazu; Nakamura, Hirotoshi; Tagami, Tetsuya; Miyoshi, Yohzi; Nogimori, Tsuyoshi; Mitsuma, Terunori; Imura, Hiroo (Kyoto Univ. School of Medicine, Aichi (Japan))

    1993-05-01

    Point mutations in the human T[sub 3] receptor-[beta] (TR[beta]) gene causing single amino acid substitutions have been identified in several different kindred with generalized resistance to thyroid hormone. Until now, no study has been reported on the TR gene in cases of pituitary resistance (PRTH). In the present study, the authors analyzed the TR[beta] gene in a 30-yr-old Japanese female with PRTH. She exhibited clinical features of hyperthyroidism, elevated serum thyroid hormone levels accompanied by inappropriately increased secretion of TSH, mildly elevated basal metabolic rate, and increased urinary excretion of hydroxyproline. No pituitary tumor was detected. DNA fragments of exons 3-8 of the geonomic TR[beta] gene were generated by the polymerase chain reaction and analyzed by a single stranded conformation polymorphism method. Exon 7 of the patient's TR[beta] gene showed an abnormal band, suggesting the existence of mutation(s). By subcloning and sequencing the DNA, a point mutation was identified in one allele at nucleotide 1297 (C to T), which altered the 333rd amino acid, arginine, to tryptophan. Neither of her apparently normal parents had any mutations of the TR[beta] gene. In vitro translation products of the mutant TR[beta] gene showed remarkably decreased T[sub 3]-binding activity (K[sub a], 2.1 [times] 10[sup 8] M[sup [minus]1]; normal TR[beta] K[sub a], 1.1 [times] 10[sup 10] M[sup [minus]1]). Since the molecular defect detected in a patient with PRTH is similar to that seen in subjects with generalized resistance to thyroid hormone, both types of the syndrome may represent a continuous spectrum of the same etiological defect with variable tissue resistance to thyroid hormone.

  19. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  20. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  1. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  2. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  3. Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1.

    Science.gov (United States)

    Chappell, J D; Gunn, V L; Wetzel, J D; Baer, G S; Dermody, T S

    1997-03-01

    The reovirus attachment protein, sigma1, determines numerous aspects of reovirus-induced disease, including viral virulence, pathways of spread, and tropism for certain types of cells in the central nervous system. The sigma1 protein projects from the virion surface and consists of two distinct morphologic domains, a virion-distal globular domain known as the head and an elongated fibrous domain, termed the tail, which is anchored into the virion capsid. To better understand structure-function relationships of sigma1 protein, we conducted experiments to identify sequences in sigma1 important for viral binding to sialic acid, a component of the receptor for type 3 reovirus. Three serotype 3 reovirus strains incapable of binding sialylated receptors were adapted to growth in murine erythroleukemia (MEL) cells, in which sialic acid is essential for reovirus infectivity. MEL-adapted (MA) mutant viruses isolated by serial passage in MEL cells acquired the capacity to bind sialic acid-containing receptors and demonstrated a dependence on sialic acid for infection of MEL cells. Analysis of reassortant viruses isolated from crosses of an MA mutant virus and a reovirus strain that does not bind sialic acid indicated that the sigma1 protein is solely responsible for efficient growth of MA mutant viruses in MEL cells. The deduced sigma1 amino acid sequences of the MA mutant viruses revealed that each strain contains a substitution within a short region of sequence in the sigma1 tail predicted to form beta-sheet. These studies identify specific sequences that determine the capacity of reovirus to bind sialylated receptors and suggest a location for a sialic acid-binding domain. Furthermore, the results support a model in which type 3 sigma1 protein contains discrete receptor binding domains, one in the head and another in the tail that binds sialic acid.

  4. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  5. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  6. Homozygous missense mutation (G56R in glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPI-HBP1 in two siblings with fasting chylomicronemia (MIM 144650

    Directory of Open Access Journals (Sweden)

    Hegele Robert A

    2007-09-01

    Full Text Available Abstract Background Mice with a deleted Gpihbp1 gene encoding glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPI-HBP1 develop severe chylomicronemia. We screened the coding regions of the human homologue – GPIHBP1 – from the genomic DNA of 160 unrelated adults with fasting chylomicronemia and plasma triglycerides >10 mmol/L, each of whom had normal sequence of the LPL and APOC2 genes. Results One patient with severe type 5 hyperlipoproteinemia (MIM 144650, fasting chylomicronemia and relapsing pancreatitis resistant to standard therapy was found to be homozygous for a novel GPIHBP1 missense variant, namely G56R. This mutation was absent from the genomes of 600 control subjects and 610 patients with hyperlipidemia. The GPIHBP1 G56 residue has been conserved throughout evolution and the G56R mutation was predicted to have compromised function. Her homozygous brother also had refractory chylomicronemia and relapsing pancreatitis together with early coronary heart disease. G56R heterozygotes in the family had fasting mild hypertriglyceridemia. Conclusion Thus, a very rare GPIHBP1 missense mutation appears to be associated with severe hypertriglyceridemia and chylomicronemia.

  7. Experimental validation of the predicted binding site of Escherichia coli K1 outer membrane protein A to human brain microvascular endothelial cells: identification of critical mutations that prevent E. coli meningitis.

    Science.gov (United States)

    Pascal, Tod A; Abrol, Ravinder; Mittal, Rahul; Wang, Ying; Prasadarao, Nemani V; Goddard, William A

    2010-11-26

    Escherichia coli K1, the most common cause of meningitis in neonates, has been shown to interact with GlcNAc1-4GlcNAc epitopes of Ecgp96 on human brain microvascular endothelial cells (HBMECs) via OmpA (outer membrane protein A). However, the precise domains of extracellular loops of OmpA interacting with the chitobiose epitopes have not been elucidated. We report the loop-barrel model of these OmpA interactions with the carbohydrate moieties of Ecgp96 predicted from molecular modeling. To test this model experimentally, we generated E. coli K1 strains expressing OmpA with mutations of residues predicted to be critical for interaction with the HBMEC and tested E. coli invasion efficiency. For these same mutations, we predicted the interaction free energies (including explicit calculation of the entropy) from molecular dynamics (MD), finding excellent correlation (R(2) = 90%) with experimental invasion efficiency. Particularly important is that mutating specific residues in loops 1, 2, and 4 to alanines resulted in significant inhibition of E. coli K1 invasion in HBMECs, which is consistent with the complete lack of binding found in the MD simulations for these two cases. These studies suggest that inhibition of the interactions of these residues of Loop 1, 2, and 4 with Ecgp96 could provide a therapeutic strategy to prevent neonatal meningitis due to E. coli K1.

  8. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin

    Czech Academy of Sciences Publication Activity Database

    Sheehan, A.; Messer, A.E.; Papadaki, M.; Choudhry, A.; Křen, Vladimír; Biedermann, David; Blagg, B.; Khandelwal, A.; Marston, S.B.

    2018-01-01

    Roč. 9, MAR 27 2018 (2018), č. článku 243. ISSN 1664-042X R&D Projects: GA MZd(CZ) NV16-27317A Institutional support: RVO:61388971 Keywords : cardiomyopathy * sarcomeric protein mutations * troponin I phosphorylation OBOR OECD: Cardiac and Cardiovascular systems Impact factor: 4.134, year: 2016

  9. Mutations in the FTSJ1 gene coding for a novel S-adenosylmethionine-binding protein cause nonsyndromic X-linked mental retardation

    DEFF Research Database (Denmark)

    Freude, Kristine; Hoffmann, Kirsten; Jensen, Lars-Riff

    2004-01-01

    Nonsyndromic X-linked mental retardation (NSXLMR) is a very heterogeneous condition, and most of the underlying gene defects are still unknown. Recently, we have shown that approximately 30% of these genes cluster on the proximal Xp, which prompted us to perform systematic mutation screening...

  10. Mutations in the TGF beta Binding-Protein-Like Domain 5 of FBN1 Are Responsible for Acromicric and Geleophysic Dysplasias

    NARCIS (Netherlands)

    Le Goff, Carine; Mahaut, Clementine; Wang, Lauren W.; Allali, Slimane; Abhyankar, Avinash; Jensen, Sacha; Zylberberg, Louise; Collod-Beroud, Gwenaelle; Bonnet, Damien; Alanay, Yasemin; Brady, Angela. F.; Cordier, Marie-Pierre; Devriendt, Koen; Genevieve, David; Kiper, Pelin Ozlem Simsek; Kitoh, Hiroshi; Krakow, Deborah; Lynch, Sally Ann; Le Merrer, Martine; Megarbane, Andre; Mortier, Geert; Odent, Sylvie; Polak, Michel; Rohrbach, Marianne; Sillence, David; Stolte-Dijkstra, Irene; Superti-Furga, Andrea; Rimoin, David L.; Topouchian, Vicken; Unger, Sheila; Zabel, Bernhard; Bole-Feysot, Christine; Nitschke, Patrick; Handford, Penny; Casanova, Jean-Laurent; Boileau, Catherine; Apte, Suneel S.; Munnich, Arnold; Cormier-Dairel, Valerie

    2011-01-01

    Geleophysic (GD) and acromicric dysplasia (AD) belong to the acromelic dysplasia group and are both characterized by severe short stature, short extremities, and stiff joints. Although All has an unknown molecular basis, we have previously identified ADAMTSL2 mutations in a subset of GD patients.

  11. Mutational library analysis of selected amino acids in the receptor binding domain of envelope of Akv murine leukemia virus by conditionally replication competent bicistronic vectors

    DEFF Research Database (Denmark)

    Bahrami, Shervin; Jespersen, Thomas; Pedersen, Finn Skou

    2003-01-01

    The envelope protein of retroviruses is responsible for viral entry into host cells. Here, we describe a mutational library approach to dissect functional domains of the envelope protein involving a retroviral vector, which expresses both the envelope protein of Akv murine leukemia virus (MLV) an...

  12. Mutations within the LINC-HELLP non-coding RNA differentially bind ribosomal and RNA splicing complexes and negatively affect trophoblast differentiation

    NARCIS (Netherlands)

    van Dijk, M.; Visser, A.; Buabeng, K.M.L.; Poutsma, A.; van der Schors, R.C.; Oudejans, C.B.M.

    2015-01-01

    LINC-HELLP, showing chromosomal linkage with the pregnancy-specific HELLP syndrome in Dutch families, reduces differentiation from a proliferative to an invasive phenotype of first-trimester extravillous trophoblasts. Here we show that mutations in LINC-HELLP identified in HELLP families negatively

  13. Familial partial lipodystrophy phenotype resulting from a single-base mutation in deoxyribonucleic acid-binding domain of peroxisome proliferator-activated receptor-gamma

    NARCIS (Netherlands)

    Monajemi, Houshang; Zhang, Lin; Li, Gang; Jeninga, Ellen H.; Cao, Henian; Maas, Mario; Brouwer, C. B.; Kalkhoven, Eric; Stroes, Erik; Hegele, Robert A.; Leff, Todd

    2007-01-01

    CONTEXT: Familial partial lipodystrophy (FPLD) results from coding sequence mutations either in LMNA, encoding nuclear lamin A/C, or in PPARG, encoding peroxisome proliferator-activated receptor-gamma (PPARgamma). The LMNA form is called FPLD2 (MIM 151660) and the PPARG form is called FPLD3 (MIM

  14. Alpha-tubulin missense mutations correlate with antimicrotubule drug resistance in Eleusine indica.

    Science.gov (United States)

    Yamamoto, E; Zeng, L; Baird, W V

    1998-02-01

    Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, highly resistant and intermediately resistant biotypes of goosegrass (Eleusine indica) developed in previously wild-type populations. Three alpha-tubulin cDNA classes (designated TUA1, TUA2, and TUA3) were isolated from each biotype. Nucleotide differences between the susceptible and the resistant (R) alpha-tubulins were identified in TUA1 and TUA2. The most significant differences were missense mutations that occurred in TUA1 of the R and intermediately resistant (I) biotypes. Such mutations convert Thr-239 to Ile in the R biotype and Met-268 to Thr in the I biotype. These amino acid substitutions alter hydrophobicity; therefore, they may alter the dinitroaniline binding property of the protein. These mutations were correlated with the dinitroaniline response phenotypes (Drp). Plants homozygous for susceptibility possessed the wild-type TUA1 allele; plants homozygous for resistance possessed the mutant tua1 allele; and plants heterozygous for susceptibility possessed both wild-type and mutant alleles. Thus, we conclude that TUA1 is at the Drp locus. Using polymerase chain reaction primer-introduced restriction analysis, we demonstrated that goosegrass genomic DNA can be diagnosed for Drp alleles. Although not direct proof, these results suggest that a mutation in an alpha-tubulin gene confers resistance to dinitroanilines in goosegrass.

  15. A new point mutation in the deoxyribonuclic acid-binding domain of the vitamine D receptor in a kindred with hereditary 1,25-dihydroxyvitamin d-resistant rickets

    Energy Technology Data Exchange (ETDEWEB)

    Yagi, Hideki; Miyake, Hiroshi; Nagashima, Kanji; Kuroume, Takayoshi (Gunma Univ. School of Medicine (Japan)); Ozone, K.; Pike, J.W. (Baylor College of Medicine, Houston, TX (United States))

    1993-02-01

    Hereditary 1,25-dihydroxyvitamin D [1,25-(OH)[sub 2]D]-resistant rickets (HVDRR) is a rare disorder characterized by rickets, alopecia, hypocalcemia, secondary hyperparathyroidism, and normal or elevated serum 1,25-dihydroxyvitamin D levels. The authors describe a patient with typical clinical characteristics of HVDRR, except that elevated levels of serum phosphorus were present coincident with increased levels of serum intact PTH. The patient was treated with high dose calcium infusion after an ineffective treatment with 1[alpha]-hydroxyvitamin D[sub 3]; serum calcium and phosphorus as well as intact PTH and alkaline phosphatase levels were normalized. Evaluation of phytohemagglutinin-activated lymphocytes derived from this patient revealed that 1,25-(OH)[sub 2]D[sub 3] was unable to inhibit thymidine incooperation, a result that contrast with the capacity of 1,25-(OH)[sub 2]D[sub 3] to inhibit uptake into normal activated lymphocytes. 1,25-(OH)[sub 2]D[sub 3] did not induce human osteocalcin promoter activity after transfection of this DNA linked to a reporter gene into patient cells. Cointroduction of a human vitamin D receptor (VDR) cDNA expression vector with the reporter plasmid, however, restored the hormone response. Evaluation of extracts from the patient cells for VDR DNA binding revealed a defect in DNA binding. Analysis of genomic DNA from the patient's cells by PCR confirmed the presence of a point mutation in exon 2 of the VDR. This exon directs synthesis of a portion of the DNA-binding domain of the receptor. We conclude that the genetic basis for 1,25-(OH)[sub 2]D[sub 3] resistance in this kindred with VDR-positive HVDRR is due to a single base mutation in the VDR that leads to production of a receptor unable to interact appropriately with DNA. 20 refs., 3 figs., 1 tab.

  16. A single, specific thymine mutation in the ComK-Binding site severely decreases binding and transcription activation by the competence transcription factor ComK of Bacillus subtilis

    NARCIS (Netherlands)

    Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.

    The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.

  17. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  18. A Point Mutation in the Exon Junction Complex Factor Y14 Disrupts Its Function in mRNA Cap Binding and Translation Enhancement*

    Science.gov (United States)

    Chuang, Tzu-Wei; Lee, Kuo-Ming; Lou, Yuan-Chao; Lu, Chia-Chen; Tarn, Woan-Yuh

    2016-01-01

    Eukaryotic mRNA biogenesis involves a series of interconnected steps mediated by RNA-binding proteins. The exon junction complex core protein Y14 is required for nonsense-mediated mRNA decay (NMD) and promotes translation. Moreover, Y14 binds the cap structure of mRNAs and inhibits the activity of the decapping enzyme Dcp2. In this report, we show that an evolutionarily conserved tryptophan residue (Trp-73) of Y14 is critical for its binding to the mRNA cap structure. A Trp-73 mutant (W73V) bound weakly to mRNAs and failed to protect them from degradation. However, this mutant could still interact with the NMD and mRNA degradation factors and retained partial NMD activity. In addition, we found that the W73V mutant could not interact with translation initiation factors. Overexpression of W73V suppressed reporter mRNA translation in vitro and in vivo and reduced the level of a set of nascent proteins. These results reveal a residue of Y14 that confers cap-binding activity and is essential for Y14-mediated enhancement of translation. Finally, we demonstrated that Y14 may selectively and differentially modulate protein biosynthesis. PMID:26887951

  19. A Point Mutation in the Exon Junction Complex Factor Y14 Disrupts Its Function in mRNA Cap Binding and Translation Enhancement.

    Science.gov (United States)

    Chuang, Tzu-Wei; Lee, Kuo-Ming; Lou, Yuan-Chao; Lu, Chia-Chen; Tarn, Woan-Yuh

    2016-04-15

    Eukaryotic mRNA biogenesis involves a series of interconnected steps mediated by RNA-binding proteins. The exon junction complex core protein Y14 is required for nonsense-mediated mRNA decay (NMD) and promotes translation. Moreover, Y14 binds the cap structure of mRNAs and inhibits the activity of the decapping enzyme Dcp2. In this report, we show that an evolutionarily conserved tryptophan residue (Trp-73) of Y14 is critical for its binding to the mRNA cap structure. A Trp-73 mutant (W73V) bound weakly to mRNAs and failed to protect them from degradation. However, this mutant could still interact with the NMD and mRNA degradation factors and retained partial NMD activity. In addition, we found that the W73V mutant could not interact with translation initiation factors. Overexpression of W73V suppressed reporter mRNA translation in vitro and in vivo and reduced the level of a set of nascent proteins. These results reveal a residue of Y14 that confers cap-binding activity and is essential for Y14-mediated enhancement of translation. Finally, we demonstrated that Y14 may selectively and differentially modulate protein biosynthesis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Mutations at the CXCR4 interaction sites for AMD3100 influence anti-CXCR4 antibody binding and HIV-1 entry

    DEFF Research Database (Denmark)

    Hatse, Sigrid; Princen, Katrien; Vermeire, Kurt

    2003-01-01

    The interaction of the CXCR4 antagonist AMD3100 with its target is greatly influenced by specific aspartate residues in the receptor protein, including Asp(171) and Asp(262). We have now found that aspartate-to-asparagine substitutions at these positions differentially affect the binding of four...

  1. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  2. Effects of Lys to Glu mutations in GsMTx4 on membrane binding, peptide orientation, and self-association propensity, as analyzed by molecular dynamics simulations.

    Science.gov (United States)

    Nishizawa, Kazuhisa; Nishizawa, Manami; Gnanasambandam, Radhakrishnan; Sachs, Frederick; Sukharev, Sergei I; Suchyna, Thomas M

    2015-11-01

    GsMTx4, a gating modifier peptide acting on cationic mechanosensitive channels, has a positive charge (+5e) due to six Lys residues. The peptide does not have a stereospecific binding site on the channel but acts from the boundary lipids within a Debye length of the pore probably by changing local stress. To gain insight into how these Lys residues interact with membranes, we performed molecular dynamics simulations of Lys to Glu mutants in parallel with our experimental work. In silico, K15E had higher affinity for 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine bilayers than wild-type (WT) peptide or any other mutant tested, and showed deeper penetration than WT, a finding consistent with the experimental data. Experimentally, the inhibitory activities of K15E and K25E were most compromised, whereas K8E and K28E inhibitory activities remained similar to WT peptide. Binding of WT in an interfacial mode did not influence membrane thickness. With interfacial binding, the direction of the dipole moments of K15E and K25E was predicted to differ from WT, whereas those of K8E and K28E oriented similarly to that of WT. These results support a model in which binding of GsMTx4 to the membrane acts like an immersible wedge that serves as a membrane expansion buffer reducing local stress and thus inhibiting channel activity. In simulations, membrane-bound WT attracted other WT peptides to form aggregates. This may account for the positive cooperativity observed in the ion channel experiments. The Lys residues seem to fine-tune the depth of membrane binding, the tilt angle, and the dipole moments. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  4. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  5. Generalized resistance to thyroid hormone associated with a mutation in the ligand-binding domain of the human thyroid hormone receptor β

    International Nuclear Information System (INIS)

    Sakurai, A.; Takeda, K.; Ain, K.; Ceccarelli, P.; Nakai, A.; Seino, S.; Bell, G.I.; Refetoff, S.; DeGroot, L.J.

    1989-01-01

    The syndrome of generalized resistance to thyroid hormone is characterized by elevated circulating levels of thyroid hormone in the presence of an overall eumetabolic state and failure to respond normally to triiodothyronine. The authors have evaluated a family with inherited generalized resistance to thyroid hormone for abnormalities in the thyroid hormone nuclear receptors. A single guanine → cytosine replacement in the codon for amino acid 340 resulted in a glycine → arginine substitution in the hormone-binding domain of one of two alleles of the patient's thyroid hormone nuclear receptor β gene. In vitro translation products of this mutant human thyroid hormone nuclear receptor β gene did not bind triiodothyronine. Thus, generalized resistance to thyroid hormone can result from expression of an abnormal thyroid hormone nuclear receptor molecule

  6. KRAS mutation detection in colorectal cancer by a commercially available gene chip array compares well with Sanger sequencing.

    Science.gov (United States)

    French, Deborah; Smith, Andrew; Powers, Martin P; Wu, Alan H B

    2011-08-17

    Binding of a ligand to the epidermal growth factor receptor (EGFR) stimulates various intracellular signaling pathways resulting in cell cycle progression, proliferation, angiogenesis and apoptosis inhibition. KRAS is involved in signaling pathways including RAF/MAPK and PI3K and mutations in this gene result in constitutive activation of these pathways, independent of EGFR activation. Seven mutations in codons 12 and 13 of KRAS comprise around 95% of the observed human mutations, rendering monoclonal antibodies against EGFR (e.g. cetuximab and panitumumab) useless in treatment of colorectal cancer. KRAS mutation testing by two different methodologies was compared; Sanger sequencing and AutoGenomics INFINITI® assay, on DNA extracted from colorectal cancers. Out of 29 colorectal tumor samples tested, 28 were concordant between the two methodologies for the KRAS mutations that were detected in both assays with the INFINITI® assay detecting a mutation in one sample that was indeterminate by Sanger sequencing and a third methodology; single nucleotide primer extension. This study indicates the utility of the AutoGenomics INFINITI® methodology in a clinical laboratory setting where technical expertise or access to equipment for DNA sequencing does not exist. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin.

    Science.gov (United States)

    Sheehan, Alice; Messer, Andrew E; Papadaki, Maria; Choudhry, Afnan; Kren, Vladimír; Biedermann, David; Blagg, Brian; Khandelwal, Anuj; Marston, Steven B

    2018-01-01

    The inherited cardiomyopathies, hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) are relatively common, potentially life-threatening and currently untreatable. Mutations are often in the contractile proteins of cardiac muscle and cause abnormal Ca 2+ regulation via troponin. HCM is usually linked to higher myofilament Ca 2+ -sensitivity whilst in both HCM and DCM mutant tissue there is often an uncoupling of the relationship between troponin I (TnI) phosphorylation by PKA and modulation of myofilament Ca 2+ -sensitivity, essential for normal responses to adrenaline. The adrenergic response is blunted, and this may predispose the heart to failure under stress. At present there are no compounds or interventions that can prevent or treat sarcomere cardiomyopathies. There is a need for novel therapies that act at a more fundamental level to affect the disease process. We demonstrated that epigallocatechin-3 gallate (EGCG) was found to be capable of restoring the coupled relationship between Ca 2+ -sensitivity and TnI phosphorylation in mutant thin filaments to normal in vitro , independent of the mutation (15 mutations tested). We have labeled this property "re-coupling." The action of EGCG in vitro to reverse the abnormality caused by myopathic mutations would appear to be an ideal pharmaceutical profile for treatment of inherited HCM and DCM but EGCG is known to be promiscuous in vivo and is thus unsuitable as a therapeutic drug. We therefore investigated whether other structurally related compounds can re-couple myofilaments without these off-target effects. We used the quantitative in vitro motility assay to screen 40 compounds, related to C-terminal Hsp90 inhibitors, and found 23 that can re-couple mutant myofilaments. There is no correlation between re-couplers and Hsp90 inhibitors. The Ca 2+ -sensitivity shift due to TnI phosphorylation was restored to 2.2 ± 0.01-fold ( n = 19) compared to 2.0 ± 0.24-fold ( n = 7) in wild-type thin filaments

  8. Molecular Defects in Cardiac Myofilament Ca2+-Regulation Due to Cardiomyopathy-Linked Mutations Can Be Reversed by Small Molecules Binding to Troponin

    Directory of Open Access Journals (Sweden)

    Alice Sheehan

    2018-03-01

    Full Text Available The inherited cardiomyopathies, hypertrophic cardiomyopathy (HCM and dilated cardiomyopathy (DCM are relatively common, potentially life-threatening and currently untreatable. Mutations are often in the contractile proteins of cardiac muscle and cause abnormal Ca2+ regulation via troponin. HCM is usually linked to higher myofilament Ca2+-sensitivity whilst in both HCM and DCM mutant tissue there is often an uncoupling of the relationship between troponin I (TnI phosphorylation by PKA and modulation of myofilament Ca2+-sensitivity, essential for normal responses to adrenaline. The adrenergic response is blunted, and this may predispose the heart to failure under stress. At present there are no compounds or interventions that can prevent or treat sarcomere cardiomyopathies. There is a need for novel therapies that act at a more fundamental level to affect the disease process. We demonstrated that epigallocatechin-3 gallate (EGCG was found to be capable of restoring the coupled relationship between Ca2+-sensitivity and TnI phosphorylation in mutant thin filaments to normal in vitro, independent of the mutation (15 mutations tested. We have labeled this property “re-coupling.” The action of EGCG in vitro to reverse the abnormality caused by myopathic mutations would appear to be an ideal pharmaceutical profile for treatment of inherited HCM and DCM but EGCG is known to be promiscuous in vivo and is thus unsuitable as a therapeutic drug. We therefore investigated whether other structurally related compounds can re-couple myofilaments without these off-target effects. We used the quantitative in vitro motility assay to screen 40 compounds, related to C-terminal Hsp90 inhibitors, and found 23 that can re-couple mutant myofilaments. There is no correlation between re-couplers and Hsp90 inhibitors. The Ca2+-sensitivity shift due to TnI phosphorylation was restored to 2.2 ± 0.01-fold (n = 19 compared to 2.0 ± 0.24-fold (n = 7 in wild-type thin

  9. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  10. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  11. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  12. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  13. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  14. Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains

    Directory of Open Access Journals (Sweden)

    Espinola Emilio E

    2006-05-01

    Full Text Available Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures in the correct genotyping of G1, G2, G8, G9 and G10 rotavirus strains were reported in the most commonly used reverse transcription (RT-PCR strategies. Collecting VP7 gene sequences of G1 rotavirus strains from databases we found that 74 (61.2 % out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure of G1-typing. Thus, a great percentage of the G1 strains from lineage I worldwide reported could not have been typed if the Das's RT-PCR strategy were used. This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages. Therefore, the use of different RT-PCR strategies with different primer binding locations on the VP7 gene or new typing methodologies -like microarrays procedures- could be a better option to avoid the failure of the G-typing of rotavirus strains detected during surveillance programs.

  15. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  16. Digestion and Interaction of Starches with α-Amylases: I. Mutational analysis of Carbohydrate Binding Sites in barley. II. In Vitro Starch Digestion of Legumes

    DEFF Research Database (Denmark)

    Nielsen, Morten Munch

    2006-01-01

    the hydrolysis of internal 1,4-α-D-glucosidic bonds in starch and related polysaccharides. The present thesis concerns studies of two α-amylases: 1) secondary substrate binding sites in barley α-amylase 1 (AMY1), and 2) the involvement of anti-nutrients in in vitro digestion of starch in legumes by porcine...... in morphology between high amylose starch granules and normal starch granules. Legumes (beans, peas, and lentils) are characterised by low blood glucose raising potential, which is proportional to the in vitro starch digestion rates. The high amount of anti-nutritional factors (phytate, proteinaceous inhibitors......, tannins, and lectins) in legumes has been associated with the slow starch digestion. However, it is still debated in literature to which extent the legume starch digestibility is affected by anti-nutritional factors. The in vitro starch digestion (hydrolytic index, HI) of pea (Pisum sativum) and mixtures...

  17. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  18. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  19. Fibrillin mutations in the Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Price, C.E.; Wang, M.; Wang, J.; Godfrey, M. [Univ. of Nebraska Medical Center, Omaha, NE (United States)

    1994-09-01

    The Marfan syndrome (MFS) is an autosomal dominant heritable disorder of connective tissue manifested by variable and pleiotropic defect in the skeletal, ocular, and cardiovascular systems. We have recently begun to use intron-specific primers that have become available through the International Marfan Syndrome Consortium to screen for fibrillin mutations in MFS patients. Using the genomic PCR-based approach in addition to RT-PCR methodologies, we have identified several novel mutations. A single base insertion was identified in all affected individuals of one family. The insertion of an {open_quote}A{close_quote} at position 1891 in exon 15 causes a premature stop codon and thus a truncated polypeptide. The truncated protein of 617 amino acids has an expected molecular weight of 63 kD. Metabolic labeling and immunoprecipitation studies are in progress. A C{r_arrow}T transition at position 1634 in exon 12 causing a 5th position Cys to Phe substitution in an EGF-like motif was observed in another MFS patient. Finally, we have identified a G{r_arrow}A transition at the +1 position of the donor splice site that causes the deletion of fibrillin exon 32 in a patient with the neonatal form of MFS. Exon 32 is a precursor EGF-like calcium binding motif that is located in a single stretch of 12 similar domains. We had previously identified the skipping of this exon due to an A{r_arrow}T transversion at the -2 position of the consensus acceptor splice site in another patient with neonatal MFS. The reason that the skipping of exon 32 causes a neonatal lethal MFS phenotype is presently unclear. These studies will help elucidate the role of diverse regions of fibrillin.

  20. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  1. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  2. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  3. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  4. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  5. The effect of a DeltaK280 mutation on the unfolded state of a microtubule-binding repeat in Tau.

    Directory of Open Access Journals (Sweden)

    Austin Huang

    Full Text Available Tau is a natively unfolded protein that forms intracellular aggregates in the brains of patients with Alzheimer's disease. To decipher the mechanism underlying the formation of tau aggregates, we developed a novel approach for constructing models of natively unfolded proteins. The method, energy-minima mapping and weighting (EMW, samples local energy minima of subsequences within a natively unfolded protein and then constructs ensembles from these energetically favorable conformations that are consistent with a given set of experimental data. A unique feature of the method is that it does not strive to generate a single ensemble that represents the unfolded state. Instead we construct a number of candidate ensembles, each of which agrees with a given set of experimental constraints, and focus our analysis on local structural features that are present in all of the independently generated ensembles. Using EMW we generated ensembles that are consistent with chemical shift measurements obtained on tau constructs. Thirty models were constructed for the second microtubule binding repeat (MTBR2 in wild-type (WT tau and a DeltaK280 mutant, which is found in some forms of frontotemporal dementia. By focusing on structural features that are preserved across all ensembles, we find that the aggregation-initiating sequence, PHF6*, prefers an extended conformation in both the WT and DeltaK280 sequences. In addition, we find that residue K280 can adopt a loop/turn conformation in WT MTBR2 and that deletion of this residue, which can adopt nonextended states, leads to an increase in locally extended conformations near the C-terminus of PHF6*. As an increased preference for extended states near the C-terminus of PHF6* may facilitate the propagation of beta-structure downstream from PHF6*, these results explain how a deletion at position 280 can promote the formation of tau aggregates.

  6. Mutation of a zinc-binding residue in the glycine receptor α1 subunit changes ethanol sensitivity in vitro and alcohol consumption in vivo.

    Science.gov (United States)

    McCracken, Lindsay M; Blednov, Yuri A; Trudell, James R; Benavidez, Jillian M; Betz, Heinrich; Harris, R Adron

    2013-02-01

    Ethanol is a widely used drug, yet an understanding of its sites and mechanisms of action remains incomplete. Among the protein targets of ethanol are glycine receptors (GlyRs), which are potentiated by millimolar concentrations of ethanol. In addition, zinc ions also modulate GlyR function, and recent evidence suggests that physiologic concentrations of zinc enhance ethanol potentiation of GlyRs. Here, we first built a homology model of a zinc-bound GlyR using the D80 position as a coordination site for a zinc ion. Next, we investigated in vitro the effects of zinc on ethanol action at recombinant wild-type (WT) and mutant α1 GlyRs containing the D80A substitution, which eliminates zinc potentiation. At D80A GlyRs, the effects of 50 and 200 mM ethanol were reduced as compared with WT receptors. Also, in contrast to what was seen with WT GlyRs, neither adding nor chelating zinc changed the magnitude of ethanol enhancement of mutant D80A receptors. Next, we evaluated the in vivo effects of the D80A substitution by using heterozygous Glra1(D80A) knock-in (KI) mice. The KI mice showed decreased ethanol consumption and preference, and they displayed increased startle responses compared with their WT littermates. Other behavioral tests, including ethanol-induced motor incoordination and strychnine-induced convulsions, revealed no differences between the KI and WT mice. Together, our findings indicate that zinc is critical in determining the effects of ethanol at GlyRs and suggest that zinc binding at the D80 position may be important for mediating some of the behavioral effects of ethanol action at GlyRs.

  7. Molecular mechanisms of conformational specificity: A study of Hox in vivo target DNA binding specificities and the structure of a Ure2p mutation that affects fibril formation rates

    Science.gov (United States)

    Bauer, William Joseph, Jr.

    The fate of an individual cell, or even an entire organism, is often determined by minute, yet very specific differences in the conformation of a single protein species. Very often, proteins take on alternate folds or even side chain conformations to deal with different situations present within the cell. These differences can be as large as a whole domain or as subtle as the alteration of a single amino acid side chain. Yet, even these seemingly minor side chain conformational differences can determine the development of a cell type during differentiation or even dictate whether a cell will live or die. Two examples of situations where minor conformational differences within a specific protein could lead to major differences in the life cycle of a cell are described herein. The first example describes the variations seen in DNA conformations which can lead to slightly different Hox protein binding conformations responsible for recognizing biologically relevant regulatory sites. These specific differences occur in the minor groove of the bound DNA and are limited to the conformation of only two side chains. The conformation of the bound DNA, however, is not solely determined by the sequence of the DNA, as multiple sequences can result in the same DNA conformation. The second example takes place in the context of a yeast prion protein which contains a mutation that decreases the frequency at which fibrils form. While the specific interactions leading to this physiological change were not directly detected, it can be ascertained from the crystal structure that the structural changes are subtle and most likely involve another binding partner. In both cases, these conformational changes are very slight but have a profound effect on the downstream processes.

  8. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  9. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  10. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  11. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  12. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  13. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  14. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  15. Investigation of the effect of mutations of rat albumin on the binding affinity to the alpha(4)beta(1) integrin antagonist, 4-[1-[3-chloro-4-[N'-(2-methylphenyl)ureido]phenylacetyl]-(4S)-fluoro-(2S)-pyrrolidine-2-yl]methoxybenzoic acid (D01-4582), using recombinant rat albumins.

    Science.gov (United States)

    Ito, Takashi; Takahashi, Masayuki; Okazaki, Osamu; Sugiyama, Yuichi

    2010-08-02

    The authors reported previously rat strain differences in plasma protein binding to alpha(4)beta(1) antagonist D01-4582, resulting in a great strain difference in its pharmacokinetics (19-fold differences in the AUC). The previous study suggested that amino acid changes of V238L and/or T293I in albumin reduced the binding affinity. In order to elucidate the relative significance of these mutations, an expression system was developed to obtain recombinant rat albumins (rRSA) using Pichia pastoris, followed by a binding analysis of four rRSAs by the ultracentrifugation method. The equilibrium dissociation constant (K(d)) of wild-type rRSA was 210 nM, while K(d) of rRSA that carried both V238L and T293I mutations was 974 nM. K(d) of artificial rRSA that carried only V238L was 426 nM, and K(d) of artificial rRSA that carried only T293I was 191 nM. These results suggested that V238L would be more important in the alteration of K(d). However, since none of the single mutations were sufficient to explain the reduction of affinity, the possibility was also suggested that T293I interacted cooperatively to reduce the binding affinity of rat albumin to D01-4582. Further investigation is required to elucidate the mechanism of the possible cooperative interaction.

  16. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  17. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  18. Simultaneous Profiling of DNA Mutation and Methylation by Melting Analysis Using Magnetoresistive Biosensor Array

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Lee, Jung-Rok; Dahl, Christina

    2017-01-01

    specificity. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using nondiscriminatory primers, and the amplicons are then hybridized to a giant magnetoresistive (GMR) biosensor array followed by melting curve measurements. The GMR biosensor platform offers scalable multiplexed detection...

  19. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  20. Laser desorption mass spectrometry for point mutation detection

    Energy Technology Data Exchange (ETDEWEB)

    Taranenko, N.I.; Chung, C.N.; Zhu, Y.F. [Oak Ridge National Lab., TN (United States)] [and others

    1996-10-01

    A point mutation can be associated with the pathogenesis of inherited or acquired diseases. Laser desorption mass spectrometry coupled with allele specific polymerase chain reaction (PCR) was first used for point mutation detection. G551D is one of several mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene present in 1-3% of the mutant CFTR alleles in most European populations. In this work, two different approaches were pursued to detect G551D point mutation in the cystic fibrosis gene. The strategy is to amplify the desired region of DNA template by PCR using two primers that overlap one base at the site of the point mutation and which vary in size. If the two primers based on the normal sequence match the target DNA sequence, a normal PCR product will be produced. However, if the alternately sized primers that match the mutant sequence recognize the target DNA, an abnormal PCR product will be produced. Thus, the mass spectrometer can be used to identify patients that are homozygous normal, heterozygous for a mutation or homozygous abnormal at a mutation site. Another approach to identify similar mutations is the use of sequence specific restriction enzymes which respond to changes in the DNA sequence. Mass spectrometry is used to detect the length of the restriction fragments generated by digestion of a PCR generated target fragment. 21 refs., 10 figs., 2 tabs.

  1. Laser desorption mass spectrometry for point mutation detection

    Energy Technology Data Exchange (ETDEWEB)

    Taranenko, N.I.; Chung, C.N.; Zhu, Y.F. [Oak Ridge National Lab., TN (United States)] [and others

    1996-12-31

    A point mutation can be associated with the pathogenesis of inherited or acquired diseases. Laser desorption mass spectrometry coupled with allele specific polymerase chain reaction (PCR) was first used for point mutation detection. G551D is one of several mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene present in 1-3% of the mutant CFTR alleles in most European populations. In this work, two different approaches were pursued to detect G551D point mutation in the cystic fibrosis gene. The strategy is to amplify the desired region of DNA template by PCR using two primers that overlap one base at the site of the point mutation and which vary in size. If the two primers based on the normal sequence match the target DNA sequence, a normal PCR product will be produced. However, if the alternately sized primers that match the mutant sequence recognize the target DNA, an abnormal PCR product will be produced. Thus, the mass spectrometer can be used to identify patients that are homozygous normal, heterozygous for a mutation or homozygous abnormal at a mutation site. Another approach to identify similar mutations is the use of sequence specific restriction enzymes which respond to changes in the DNA sequence. Mass spectrometry is used to detect the length of the restriction fragments by digestion of a PCR generated target fragment. 21 refs., 10 figs., 2 tabs.

  2. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  3. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  4. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  5. Carboxyhemoglobin: a primer for clinicians.

    Science.gov (United States)

    Hampson, Neil B

    2018-01-01

    One of carbon monoxide's several mechanisms of toxicity is binding with circulating hemoglobin to form carboxyhemoglobin, resulting in a functional anemia. While patients with carbon monoxide poisoning are often said to be "cherry-red," such discoloration is rarely seen. Carboxyhemoglobin levels cannot be measured with conventional pulse oximetry, can be approximated with pulse CO-oximetry, and are most accurately measured with a laboratory CO-oximeter. Carboxyhemoglobin levels are quite stable and can be accurately measured on a transported blood sample. For clinical purposes, arterial and venous carboxyhemoglobin levels can be considered to be equivalent. Carboxyhemoglobin levels are typically lower than 2% in non-smokers and lower than 5% in smokers. A level over 9% is almost always due to exogenous carbon monoxide exposure, even among smokers. Conversely, a low level does not exclude significant exposure under certain circumstances. As carboxyhemoglobin levels of poisoned patients do not correlate with symptoms or outcome, their greatest utility is a marker of exposure. Copyright© Undersea and Hyperbaric Medical Society.

  6. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  7. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  8. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  9. Random mutagenesis of the nucleotide-binding domain of NRC1 (NB-LRR Required for Hypersensitive Response-Associated Cell Death-1), a downstream signalling nucleotide-binding, leucine-rich repeat (NB-LRR) protein, identifies gain-of-function mutations in the nucleotide-binding pocket

    NARCIS (Netherlands)

    Sueldo, D.J.; Shimels, M.Z.; Spiridon, L.N.; Caldararu, O.; Petrescu, A.J.; Joosten, M.H.A.J.; Tameling, W.I.L.

    2015-01-01

    •Plant nucleotide-binding, leucine-rich repeat (NB-LRR) proteins confer immunity to pathogens possessing the corresponding avirulence proteins. Activation of NB-LRR proteins is often associated with induction of the hypersensitive response (HR), a form of programmed cell death. •NRC1 (NB-LRR

  10. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  11. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  12. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  13. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  14. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  15. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  16. Adaptive evolution of transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Berg Johannes

    2004-10-01

    Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.

  17. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  18. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  19. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  20. Mutations of the kissing-loop dimerization sequence influence the site specificity of murine leukemia virus recombination in vivo

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Duch, M

    2000-01-01

    synthesis in newly infected cells. We have previously shown that template shifts within the 5' leader of murine leukemia viruses occur preferentially within the kissing stem-loop motif, a cis element crucial for in vitro RNA dimer formation. By use of a forced recombination approach based on single......-cycle transfer of Akv murine leukemia virus-based vectors harboring defective primer binding site sequences, we now report that modifications of the kissing-loop structure, ranging from a deletion of the entire sequence to introduction of a single point mutation in the loop motif, significantly disturb site...... specificity of recombination within the highly structured 5' leader region. In addition, we find that an intact kissing-loop sequence favors optimal RNA encapsidation and vector transduction. Our data are consistent with the kissing-loop dimerization model and suggest that a direct intermolecular RNA...

  1. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  2. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  3. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  4. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  5. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  6. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity

    International Nuclear Information System (INIS)

    Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.

    1989-01-01

    Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development

  7. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

  8. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  9. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  10. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  11. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  12. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  13. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  14. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  15. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  16. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  17. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  18. Effects of Mutations and Ligands on the Thermostability of the l-Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l-Type Amino Acid Transporters

    Directory of Open Access Journals (Sweden)

    Hüseyin Ilgü

    2018-03-01

    Full Text Available The l-arginine/agmatine transporter AdiC is a prokaryotic member of the SLC7 family, which enables pathogenic enterobacteria to survive the extremely acidic gastric environment. Wild-type AdiC from Escherichia coli, as well as its previously reported point mutants N22A and S26A, were overexpressed homologously and purified to homogeneity. A size-exclusion chromatography-based thermostability assay was used to determine the melting temperatures (Tms of the purified AdiC variants in the absence and presence of the selected ligands l-arginine (Arg, agmatine, l-arginine methyl ester, and l-arginine amide. The resulting Tms indicated stabilization of AdiC variants upon ligand binding, in which Tms and ligand binding affinities correlated positively. Considering results from this and previous studies, we revisited the role of AdiC residue S26 in Arg binding and proposed interactions of the α-carboxylate group of Arg exclusively with amide groups of the AdiC backbone. In the context of substrate binding in the human SLC7 family member l-type amino acid transporter-1 (LAT1; SLC7A5, an analogous role of S66 in LAT1 to S26 in AdiC is discussed based on homology modeling and amino acid sequence analysis. Finally, we propose a binding mechanism for l-amino acid substrates to LATs from the SLC7 family.

  19. Effects of Mutations and Ligands on the Thermostability of the l-Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l-Type Amino Acid Transporters.

    Science.gov (United States)

    Ilgü, Hüseyin; Jeckelmann, Jean-Marc; Colas, Claire; Ucurum, Zöhre; Schlessinger, Avner; Fotiadis, Dimitrios

    2018-03-20

    The l-arginine/agmatine transporter AdiC is a prokaryotic member of the SLC7 family, which enables pathogenic enterobacteria to survive the extremely acidic gastric environment. Wild-type AdiC from Escherichia coli, as well as its previously reported point mutants N22A and S26A, were overexpressed homologously and purified to homogeneity. A size-exclusion chromatography-based thermostability assay was used to determine the melting temperatures ( T m s) of the purified AdiC variants in the absence and presence of the selected ligands l-arginine (Arg), agmatine, l-arginine methyl ester, and l-arginine amide. The resulting T m s indicated stabilization of AdiC variants upon ligand binding, in which T m s and ligand binding affinities correlated positively. Considering results from this and previous studies, we revisited the role of AdiC residue S26 in Arg binding and proposed interactions of the α-carboxylate group of Arg exclusively with amide groups of the AdiC backbone. In the context of substrate binding in the human SLC7 family member l-type amino acid transporter-1 (LAT1; SLC7A5), an analogous role of S66 in LAT1 to S26 in AdiC is discussed based on homology modeling and amino acid sequence analysis. Finally, we propose a binding mechanism for l-amino acid substrates to LATs from the SLC7 family.

  20. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  3. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  5. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    Directory of Open Access Journals (Sweden)

    Assawamakin Anunchai

    2007-08-01

    Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number

  6. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    Science.gov (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  7. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  8. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  9. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  10. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  11. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  12. SQSTM1 Mutations and Glaucoma.

    Directory of Open Access Journals (Sweden)

    Todd E Scheetz

    Full Text Available Glaucoma is the most common cause of irreversible blindness worldwide. One subset of glaucoma, normal tension glaucoma (NTG occurs in the absence of high intraocular pressure. Mutations in two genes, optineurin (OPTN and TANK binding kinase 1 (TBK1, cause familial NTG and have known roles in the catabolic cellular process autophagy. TKB1 encodes a kinase that phosphorylates OPTN, an autophagy receptor, which ultimately activates autophagy. The sequestosome (SQSTM1 gene also encodes an autophagy receptor and also is a target of TBK1 phosphorylation. Consequently, we hypothesized that mutations in SQSTM1 may also cause NTG. We tested this hypothesis by searching for glaucoma-causing mutations in a cohort of NTG patients (n = 308 and matched controls (n = 157 using Sanger sequencing. An additional 1098 population control samples were also analyzed using whole exome sequencing. A total of 17 non-synonymous mutations were detected which were not significantly skewed between cases and controls when analyzed separately, or as a group (p > 0.05. These data suggest that SQSTM1 mutations are not a common cause of NTG.

  13. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  14. Contribution of TARDBP mutations to sporadic amyotrophic lateral sclerosis.

    Science.gov (United States)

    Daoud, H; Valdmanis, P N; Kabashi, E; Dion, P; Dupré, N; Camu, W; Meininger, V; Rouleau, G A

    2009-02-01

    Mutations in the TARDBP gene, which encodes the TAR DNA binding protein (TDP-43), have been described in individuals with familial and sporadic amyotrophic lateral sclerosis (ALS). We screened the TARDBP gene in 285 French sporadic ALS patients to assess the frequency of TARDBP mutations in ALS. Six individuals had potentially deleterious mutations of which three were novel including a Y374X truncating mutation and P363A and A382P missense mutations. This suggests that TARDBP mutations may predispose to ALS in approximately 2% of the individuals followed in this study. Our findings, combined with those from other collections, brings the total number of mutations in unrelated ALS patients to 17, further suggesting that mutations in the TARDBP gene have an important role in the pathogenesis of ALS.

  15. Enhanced peptide nucleic acid binding to supercoiled DNA: possible implications for DNA "breathing" dynamics

    DEFF Research Database (Denmark)

    Bentin, T; Nielsen, Peter E.

    1996-01-01

    The influence of DNA topology on peptide nucleic acid (PNA) binding was studied. Formation of sequence-specific PNA2/dsDNA (double-stranded DNA) complexes was monitored by a potassium permanganate probing/primer extension assay. At low ionic strengths, the binding of PNA was 2-3 times more...

  16. Usher syndrome in Denmark: mutation spectrum and some clinical observations.

    Science.gov (United States)

    Dad, Shzeena; Rendtorff, Nanna Dahl; Tranebjærg, Lisbeth; Grønskov, Karen; Karstensen, Helena Gásdal; Brox, Vigdis; Nilssen, Øivind; Roux, Anne-Françoise; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth Birk

    2016-09-01

    Usher syndrome (USH) is a genetically heterogeneous deafness-blindness syndrome, divided into three clinical subtypes: USH1, USH2 and USH3. Mutations in 21 out of 26 investigated Danish unrelated individuals with USH were identified, using a combination of molecular diagnostic methods. Before Next Generation Sequencing (NGS) became available mutations in nine individuals (1 USH1, 7 USH2, 1 USH3) were identified by Sanger sequencing of USH1C , USH2A or CLRN1 or by Arrayed Primer EXtension (APEX) method. Mutations in 12 individuals (7 USH1, 5 USH2) were found by targeted NGS of ten known USH genes. Five novel pathogenic variants were identified. We combined our data with previously published, and obtained an overview of the USH mutation spectrum in Denmark, including 100 unrelated individuals; 32 with USH1, 67 with USH2, and 1 with USH3. Macular edema was observed in 44 of 117 individuals. Olfactory function was tested in 12 individuals and found to be within normal range in all. Mutations that lead to USH1 were predominantly identified in MYO7A (75%), whereas all mutations in USH2 cases were identified in USH2A . The MYO7A mutation c.93C>A, p.(Cys31*) accounted for 33% of all USH1 mutations and the USH2A c.2299delG, p.(Glu767Serfs*21) variant accounted for 45% of all USH2 mutations in the Danish cohort.

  17. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  18. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  19. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  20. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  1. Structural and functional consequences of binding site mutations in transferrin: crystal structures of the Asp63Glu and Arg124Ala mutants of the N-lobe of human transferrin.

    Science.gov (United States)

    Baker, Heather M; He, Qing-Yu; Briggs, Sara K; Mason, Anne B; Baker, Edward N

    2003-06-17

    Human transferrin is a serum protein whose function is to bind Fe(3+) with very high affinity and transport it to cells, for delivery by receptor-mediated endocytosis. Structurally, the transferrin molecule is folded into two globular lobes, representing its N-terminal and C-terminal halves, with each lobe possessing a high-affinity iron binding site, in a cleft between two domains. Central to function is a highly conserved set of iron ligands, including an aspartate residue (Asp63 in the N-lobe) that also hydrogen bonds between the two domains and an arginine residue (Arg124 in the N-lobe) that binds an iron-bound carbonate ion. To further probe the roles of these residues, we have determined the crystal structures of the D63E and R124A mutants of the N-terminal half-molecule of human transferrin. The structure of the D63E mutant, determined at 1.9 A resolution (R = 0.245, R(free) = 0.261), showed that the carboxyl group still binds to iron despite the larger size of the Glu side chain, with some slight rearrangement of the first turn of alpha-helix residues 63-72, to which it is attached. The structure of the R124A mutant, determined at 2.4 A resolution (R = 0.219, R(free) = 0.288), shows that the loss of the arginine side chain results in a 0.3 A displacement of the carbonate ion, and an accompanying movement of the iron atom. In both mutants, the iron coordination is changed slightly, the principal change being in each case a lengthening of the Fe-N(His249) bond. Both mutants also release iron more readily than the wild type, kinetically and in terms of acid lability of iron binding. We attribute this to more facile protonation of the synergistically bound carbonate ion, in the case of R124A, and to strain resulting from the accommodation of the larger Glu side chain, in the case of D63E. In both cases, the weakened Fe-N(His) bond may also contribute, consistent with protonation of the His ligand being an early intermediate step in iron release, following the

  2. Identification of eight new mutations in familial neurogenic diabetes insipidus supports the concept that defective folding of the mutant provasopressin-neurophysin causes the disease

    Energy Technology Data Exchange (ETDEWEB)

    Rittig, S.; Siggaard, C.; Pedersen, E.B. [University Hospital in Aarhus (Denmark)] [and others

    1994-09-01

    Familial neurogenic diabetes insipidus (FNDI) is an autosomal dominant disorder with a uniform phenotype characterized by polyuria, polydipsia and a severe deficiency of arginine vasopressin (AVP). These abnormalities develop postnatally and appear to be due to progressive degeneration of AVP producing neurons. Previous studies in 8 FNDI kindreds have identified 5 different mutations in the gene that codes for the AVP-neurophysin (NP) precursor, AVP-NP. Four kindreds had the same missense mutation in the part of exon 1 that codes for the C-terminal amino acid of the signal peptide (SP). The other 4 had different missense mutations or a codon deletion in exon 2 which codes for the highly conserved part of NP. In the present study, the AVP-NP genes from 8 other kindreds with FNDI were sequenced bidirectionally using sequence and single-stranded DNA amplified by PCR with biotinylated primers flanking each of the 3 exons. We find that each of the 8 kindreds has a different, previously unreported mutation in either the SP coding part of exon 1, in exon 2 or in the variable, NP-coding part of exon 3. Combining these 8 new mutations with the 5 described previously reveals a distribution pattern that corresponds closely to the domains involved in the mutually interactive processes of AVP binding, folding and dimerization of NP. Based on these findings and the clinical features of FNDI, we postulate that the precursors produced by the mutant alleles are cytotoxic because they do not fold or dimerize properly for subsequent packaging and processing.

  3. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  4. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  5. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  6. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  7. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  8. Advancing Our Understanding of the Etiologies and Mutational Landscapes of Basal Like, Luminal A, and Luminal B Breast Cancers

    Science.gov (United States)

    2016-10-01

    5-45, completed under Dr. Li’s supervision at FHCRC: a. Identification of controls, Months 5-45: General population controls with no prior history ...sequencing and analysis will be validated by SYBR Green based QPCR using Page 11 primers designed using Primer 3 to encompass the fusion junction on a...pools of multiplexed PCR products resequenced on Illumina next-generation sequencing equipment, we will screen any recurrently mutated gene appearing

  9. Mutations in FLNB cause boomerang dysplasia.

    Science.gov (United States)

    Bicknell, L S; Morgan, T; Bonafé, L; Wessels, M W; Bialer, M G; Willems, P J; Cohn, D H; Krakow, D; Robertson, S P

    2005-07-01

    Boomerang dysplasia (BD) is a perinatal lethal osteochondrodysplasia, characterised by absence or underossification of the limb bones and vertebrae. The BD phenotype is similar to a group of disorders including atelosteogenesis I, atelosteogenesis III, and dominantly inherited Larsen syndrome that we have recently shown to be associated with mutations in FLNB, the gene encoding the actin binding cytoskeletal protein, filamin B. We report the identification of mutations in FLNB in two unrelated individuals with boomerang dysplasia. The resultant substitutions, L171R and S235P, lie within the calponin homology 2 region of the actin binding domain of filamin B and occur at sites that are evolutionarily well conserved. These findings expand the phenotypic spectrum resulting from mutations in FLNB and underline the central role this protein plays during skeletogenesis in humans.

  10. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  11. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  12. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  13. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  14. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  15. Novel TBX22 mutations in Chinese nonsyndromic cleft lip/palate ...

    Indian Academy of Sciences (India)

    Jiewen Dai

    2018-06-06

    Jun 6, 2018 ... sense, frame-shift, splice-site, or missense mutation (Pauws et al. 2013). Except for ... 0.4.0, http:// · frodo.wi.mit.edu/) was used for primer design. The poly- ..... Sternberg M. J. 2015 The Phyre2 web portal for protein modeling ...

  16. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  17. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  18. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  19. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  20. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  1. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. [Insertional mutation in the AZOBR_p60120 gene is accompanied by defects in the synthesis of lipopolysaccharide and calcofluor-binding polysaccharides in the bacterium Azospirillum brasilense Sp245].

    Science.gov (United States)

    Katsy, E I; Prilipov, A G

    2015-03-01

    In the bacterium Azospirillum brasilense Sp245, extracellular calcofluor-binding polysaccharides (Cal+ phenotype) and two types of lipopolysaccharides, LPSI and LPSII, were previously identified. These lipopolysaccharides share the same repeating O-polysaccharide unit but have different antigenic structures and different charges of their O-polysaccharides and/or core oligosaccharides. Several dozens of predicted genes involved in the biosynthesis of polysaccharides have been localized in the AZOBR_p6 plasmid of strain Sp245 (GenBank accession no. HE577333). In the present work, it was demonstrated that an artificial transposon Omegon-Km had inserted into the central region of the AZOBR_p60120 gene in the A. brasilense Sp245 LPSI- Cal- KM252 mutant. In A. brasilense strain Sp245, this plasmid gene encodes a putative glycosyltransferase containing conserved domains characteristic of the enzymes participating in the synthesis of O-polysaccharides and capsular polysaccharides (accession no. YP004987664). In mutant KM252, a respective predicted protein is expected to be completely inactivated. As a result of the analysis of the EcoRI fragment of the AZOBR_p6 plasmid, encompassing the AZOBR_p60120 gene and a number of other loci, novel data on the structure of AZOBR_p6 were obtained: an approximately 5-kb gap (GenBank accession no. KM189439) was closed in the nucleotide sequence of this plasmid.

  3. Integrating water exclusion theory into βcontacts to predict binding free energy changes and binding hot spots

    Science.gov (United States)

    2014-01-01

    Background Binding free energy and binding hot spots at protein-protein interfaces are two important research areas for understanding protein interactions. Computational methods have been developed previously for accurate prediction of binding free energy change upon mutation for interfacial residues. However, a large number of interrupted and unimportant atomic contacts are used in the training phase which caused accuracy loss. Results This work proposes a new method, βACV ASA , to predict the change of binding free energy after alanine mutations. βACV ASA integrates accessible surface area (ASA) and our newly defined β contacts together into an atomic contact vector (ACV). A β contact between two atoms is a direct contact without being interrupted by any other atom between them. A β contact’s potential contribution to protein binding is also supposed to be inversely proportional to its ASA to follow the water exclusion hypothesis of binding hot spots. Tested on a dataset of 396 alanine mutations, our method is found to be superior in classification performance to many other methods, including Robetta, FoldX, HotPOINT, an ACV method of β contacts without ASA integration, and ACV ASA methods (similar to βACV ASA but based on distance-cutoff contacts). Based on our data analysis and results, we can draw conclusions that: (i) our method is powerful in the prediction of binding free energy change after alanine mutation; (ii) β contacts are better than distance-cutoff contacts for modeling the well-organized protein-binding interfaces; (iii) β contacts usually are only a small fraction number of the distance-based contacts; and (iv) water exclusion is a necessary condition for a residue to become a binding hot spot. Conclusions βACV ASA is designed using the advantages of both β contacts and water exclusion. It is an excellent tool to predict binding free energy changes and binding hot spots after alanine mutation. PMID:24568581

  4. Elucidating the Interdependence of Drug Resistance from Combinations of Mutations.

    Science.gov (United States)

    Ragland, Debra A; Whitfield, Troy W; Lee, Sook-Kyung; Swanstrom, Ronald; Zeldovich, Konstantin B; Kurt-Yilmaz, Nese; Schiffer, Celia A

    2017-11-14

    HIV-1 protease is responsible for the cleavage of 12 nonhomologous sites within the Gag and Gag-Pro-Pol polyproteins in the viral genome. Under the selective pressure of protease inhibition, the virus evolves mutations within (primary) and outside of (secondary) the active site, allowing the protease to process substrates while simultaneously countering inhibition. The primary protease mutations impede inhibitor binding directly, while the secondary mutations are considered accessory mutations that compensate for a loss in fitness. However, the role of secondary mutations in conferring drug resistance remains a largely unresolved topic. We have shown previously that mutations distal to the active site are able to perturb binding of darunavir (DRV) via the protein's internal hydrogen-bonding network. In this study, we show that mutations distal to the active site, regardless of context, can play an interdependent role in drug resistance. Applying eigenvalue decomposition to collections of hydrogen bonding and van der Waals interactions from a series of molecular dynamics simulations of 15 diverse HIV-1 protease variants, we identify sites in the protease where amino acid substitutions lead to perturbations in nonbonded interactions with DRV and/or the hydrogen-bonding network of the protease itself. While primary mutations are known to drive resistance in HIV-1 protease, these findings delineate the significant contributions of accessory mutations to resistance. Identifying the variable positions in the protease that have the greatest impact on drug resistance may aid in future structure-based design of inhibitors.

  5. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.

    1983-01-01

    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  6. A Naturally Occurring Mutation K220T in the Pleiotropic Activator PrfA of Listeria Monocytogenes Results in a Loss of Virulence Due to Decreasing DNA-Binding Affinity

    Energy Technology Data Exchange (ETDEWEB)

    Velge,P.; Herler, M.; Johansson, J.; Roches, S.; Temoin, S.; Fedorov, A.; Gracieux, P.; Almo, S.; Goebel, W.; Cossart, P.

    2007-01-01

    The sequencing of prfA, encoding the transcriptional regulator of virulence genes, in 26 low-virulence field Listeria monocytogenes strains showed that eight strains exhibited the same single amino-acid substitution: PrfAK220T. These strains exhibited no expression of PrfA-regulated proteins and thus no virulence. This substitution inactivated PrfA, since expression of the PrfAK220T mutant gene in an EGD{Delta}prfA strain did not restore the haemolytic and phosphatidylcholine phospholipase C activities, in contrast to the wild-type prfA gene. The substitution of the lysine at position 220 occurred in the helix H. However, the data showed that the PrfAK220T protein is dimerized just as well as its wild-type counterpart, but does not bind to PrfA-boxes. PrfAK220T did not form a PrfA-DNA complex in electrophoretic mobility shift assays, but low concentrations of CI complexes (PrfAK220T-RNA polymerase-DNA complex) were formed by adding RNA polymerase, suggesting that PrfA interacted with RNA polymerase in solution in the absence of DNA. Formation of some transcriptionally active complexes was confirmed by in vitro runoff transcription assays and quantitative RT-PCR. Crystallographic analyses described the structure of native PrfA and highlighted the key role of allosteric changes in the activity of PrfA and especially the role of the Lys220 in the conformation of the helix-turn-helix (HTH) motif.

  7. Frequency and distribution of Notch mutations in tumor cell lines

    International Nuclear Information System (INIS)

    Mutvei, Anders Peter; Fredlund, Erik; Lendahl, Urban

    2015-01-01

    Deregulated Notch signaling is linked to a variety of tumors and it is therefore important to learn more about the frequency and distribution of Notch mutations in a tumor context. In this report, we use data from the recently developed Cancer Cell Line Encyclopedia to assess the frequency and distribution of Notch mutations in a large panel of cancer cell lines in silico. Our results show that the mutation frequency of Notch receptor and ligand genes is at par with that for established oncogenes and higher than for a set of house-keeping genes. Mutations were found across all four Notch receptor genes, but with notable differences between protein domains, mutations were for example more prevalent in the regions encoding the LNR and PEST domains in the Notch intracellular domain. Furthermore, an in silico estimation of functional impact showed that deleterious mutations cluster to the ligand-binding and the intracellular domains of NOTCH1. For most cell line groups, the mutation frequency of Notch genes is higher than in associated primary tumors. Our results shed new light on the spectrum of Notch mutations after in vitro culturing of tumor cells. The higher mutation frequency in tumor cell lines indicates that Notch mutations are associated with a growth advantage in vitro, and thus may be considered to be driver mutations in a tumor cell line context. The online version of this article (doi:10.1186/s12885-015-1278-x) contains supplementary material, which is available to authorized users

  8. Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma.

    Science.gov (United States)

    Chen, Xue; Zhang, Yang; Wang, Fang; Wang, Mangju; Teng, Wen; Lin, Yuehui; Han, Xiangping; Jin, Fangyuan; Xu, Yuanli; Cao, Panxiang; Fang, Jiancheng; Zhu, Ping; Tong, Chunrong; Liu, Hongxing

    2017-11-01

    Certain patients with lymphoma may harbor mutations in perforin 1 (PRF1), unc-13 homolog D (UNC13D), syntaxin 11 (STX11), STXBP2 (syntaxin binding protein 2) or SH2 domain containing 1A (SH2D1A), which causes functional defects of cytotoxic lymphocytes. Data regarding the association between genetic defects and the development of lymphoma in Chinese patients are limited to date. In the present study, 90 patients with lymphoma were analyzed for UNC13D, PRF1, STXBP2, STX11, SH2D1A and X-linked inhibitor of apoptosis. Mutations were observed in 24 (26.67%) patients; 16 patients exhibited mutations in UNC13D, 7 exhibited PRF1 mutations, and 1 exhibited monoallelic mutation in STX11. UNC13D c.2588G>A/p.G863D mutation was detected in 9 patients (10.00%) and in 4/210 controls (1.90%). This mutation was predicted to be pathogenic and it predominantly existed in the Chinese population. These findings suggest that impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. Furthermore, these data describe a distinct mutation spectrum in Chinese patients with lymphoma, whereby UNC13D is the most frequently mutated gene. In addition, these findings suggest UNC13D c.2588G>A mutation is a founder mutation in Chinese patients.

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    Energy Technology Data Exchange (ETDEWEB)

    Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: ramas@instem.res.in [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)

    2014-07-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  11. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    International Nuclear Information System (INIS)

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.

    2014-01-01

    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states

  12. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  13. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  14. Clonal mutations in primary human glial tumors: evidence in support of the mutator hypothesis

    Directory of Open Access Journals (Sweden)

    Sarkar Chitra

    2007-10-01

    Full Text Available Abstract Background A verifiable consequence of the mutator hypothesis is that even low grade neoplasms would accumulate a large number of mutations that do not influence the tumor phenotype (clonal mutations. In this study, we have attempted to quantify the number of clonal mutations in primary human gliomas of astrocytic cell origin. These alterations were identified in tumor tissue, microscopically confirmed to have over 70% neoplastic cells. Methods Random Amplified Polymorphic DNA (RAPD analysis was performed using a set of fifteen 10-mer primers of arbitrary but definite sequences in 17 WHO grade II astrocytomas (low grade diffuse astrocytoma or DA and 16 WHO grade IV astrocytomas (Glioblastoma Multiforme or GBM. The RAPD profile of the tumor tissue was compared with that of the leucocyte DNA of the same patient and alteration(s scored. A quantitative estimate of the overall genomic changes in these tumors was obtained by 2 different modes of calculation. Results The overall change in the tumors was estimated to be 4.24% in DA and 2.29% in GBM by one method and 11.96% and 6.03% in DA and GBM respectively by the other. The difference between high and lower grade tumors was statistically significant by both methods. Conclusion This study demonstrates the presence of extensive clonal mutations in gliomas, more in lower grade. This is consistent with our earlier work demonstrating that technique like RAPD analysis, unbiased for locus, is able to demonstrate more intra-tumor genetic heterogeneity in lower grade gliomas compared to higher grade. The results support the mutator hypothesis proposed by Loeb.

  15. Clonal mutations in primary human glial tumors: evidence in support of the mutator hypothesis

    International Nuclear Information System (INIS)

    Misra, Anjan; Chattopadhyay, Parthaprasad; Chosdol, Kunzang; Sarkar, Chitra; Mahapatra, Ashok K; Sinha, Subrata

    2007-01-01

    A verifiable consequence of the mutator hypothesis is that even low grade neoplasms would accumulate a large number of mutations that do not influence the tumor phenotype (clonal mutations). In this study, we have attempted to quantify the number of clonal mutations in primary human gliomas of astrocytic cell origin. These alterations were identified in tumor tissue, microscopically confirmed to have over 70% neoplastic cells. Random Amplified Polymorphic DNA (RAPD) analysis was performed using a set of fifteen 10-mer primers of arbitrary but definite sequences in 17 WHO grade II astrocytomas (low grade diffuse astrocytoma or DA) and 16 WHO grade IV astrocytomas (Glioblastoma Multiforme or GBM). The RAPD profile of the tumor tissue was compared with that of the leucocyte DNA of the same patient and alteration(s) scored. A quantitative estimate of the overall genomic changes in these tumors was obtained by 2 different modes of calculation. The overall change in the tumors was estimated to be 4.24% in DA and 2.29% in GBM by one method and 11.96% and 6.03% in DA and GBM respectively by the other. The difference between high and lower grade tumors was statistically significant by both methods. This study demonstrates the presence of extensive clonal mutations in gliomas, more in lower grade. This is consistent with our earlier work demonstrating that technique like RAPD analysis, unbiased for locus, is able to demonstrate more intra-tumor genetic heterogeneity in lower grade gliomas compared to higher grade. The results support the mutator hypothesis proposed by Loeb

  16. Deletion mutations of bacteriophage

    International Nuclear Information System (INIS)

    Ryo, Yeikou

    1975-01-01

    Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

  17. Measurement of genome changes of greenable albino mutation line c.v. W25

    International Nuclear Information System (INIS)

    Wu Dianxing; Xia Yingwu; Shu Qingyao; Zhang Yaozhou; Liu Guifu

    1997-01-01

    W25 was a greenable albino mutation line, which was derived from a temperature-sensitive genic male sterile rice 2177s, with 300 Gy gamma rays irradiation. During the whole growth duration, the leaves of W25 showed the following characters: white, greenism, albinism and greenism again. 70 primers were used for the detection of polymorphism, one of them gave polymorphic products. RAPD analysis of W25 and 2177s with random primer H05 indicated that there were two DNA bands differences

  18. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  19. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  20. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  1. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  2. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  3. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  4. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  5. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  6. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  7. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  8. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  9. Characterization of pathogenic germline mutations in human Protein Kinases

    Directory of Open Access Journals (Sweden)

    Orengo Christine A

    2011-07-01

    Full Text Available Abstract Background Protein Kinases are a superfamily of proteins involved in crucial cellular processes such as cell cycle regulation and signal transduction. Accordingly, they play an important role in cancer biology. To contribute to the study of the relation between kinases and disease we compared pathogenic mutations to neutral mutations as an extension to our previous analysis of cancer somatic mutations. First, we analyzed native and mutant proteins in terms of amino acid composition. Secondly, mutations were characterized according to their potential structural effects and finally, we assessed the location of the different classes of polymorphisms with respect to kinase-relevant positions in terms of subfamily specificity, conservation, accessibility and functional sites. Results Pathogenic Protein Kinase mutations perturb essential aspects of protein function, including disruption of substrate binding and/or effector recognition at family-specific positions. Interestingly these mutations in Protein Kinases display a tendency to avoid structurally relevant positions, what represents a significant difference with respect to the average distribution of pathogenic mutations in other protein families. Conclusions Disease-associated mutations display sound differences with respect to neutral mutations: several amino acids are specific of each mutation type, different structural properties characterize each class and the distribution of pathogenic mutations within the consensus structure of the Protein Kinase domain is substantially different to that for non-pathogenic mutations. This preferential distribution confirms previous observations about the functional and structural distribution of the controversial cancer driver and passenger somatic mutations and their use as a proxy for the study of the involvement of somatic mutations in cancer development.

  10. Imparting albumin-binding affinity to a human protein by mimicking the contact surface of a bacterial binding protein.

    Science.gov (United States)

    Oshiro, Satoshi; Honda, Shinya

    2014-04-18

    Attachment of a bacterial albumin-binding protein module is an attractive strategy for extending the plasma residence time of protein therapeutics. However, a protein fused with such a bacterial module could induce unfavorable immune reactions. To address this, we designed an alternative binding protein by imparting albumin-binding affinity to a human protein using molecular surface grafting. The result was a series of human-derived 6 helix-bundle proteins, one of which specifically binds to human serum albumin (HSA) with adequate affinity (KD = 100 nM). The proteins were designed by transferring key binding residues of a bacterial albumin-binding module, Finegoldia magna protein G-related albumin-binding domain (GA) module, onto the human protein scaffold. Despite 13-15 mutations, the designed proteins maintain the original secondary structure by virtue of careful grafting based on structural informatics. Competitive binding assays and thermodynamic analyses of the best binders show that the binding mode resembles that of the GA module, suggesting that the contacting surface of the GA module is mimicked well on the designed protein. These results indicate that the designed protein may act as an alternative low-risk binding module to HSA. Furthermore, molecular surface grafting in combination with structural informatics is an effective approach for avoiding deleterious mutations on a target protein and for imparting the binding function of one protein onto another.

  11. Enzymatic primer-extension with glycerol-nucleoside triphosphates on DNA templates.

    Directory of Open Access Journals (Sweden)

    Jesse J Chen

    Full Text Available BACKGROUND: Glycerol nucleic acid (GNA has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. PRINCIPAL FINDINGS: In this study, we investigated the ability of various DNA polymerases to use glycerol-nucleoside triphosphates (gNTPs as substrates for GNA synthesis on DNA templates. Therminator DNA polymerase catalyzes quantitative primer-extension by the incorporation of two glyceronucleotides, with much less efficient extension up to five glyceronucleotides. Steady-state kinetic experiments suggested that GNA synthesis by Therminator was affected by both decreased catalytic rates and weakened substrate binding, especially for pyrimidines. In an attempt to improve pyrimidine incorporation by providing additional stacking interactions, we synthesized two new gNTP analogs with 5-propynyl substituted pyrimidine nucleobases. This led to more efficient incorporation of gC, but not gT. CONCLUSIONS: We suggest that directed evolution of Therminator might lead to mutants with improved substrate binding and catalytic efficiency.

  12. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  13. Small finger protein of avian and murine retroviruses has nucleic acid annealing activity and positions the replication primer tRNA onto genomic RNA.

    Science.gov (United States)

    Prats, A C; Sarih, L; Gabus, C; Litvak, S; Keith, G; Darlix, J L

    1988-06-01

    Retrovirus virions carry a diploid genome associated with a large number of small viral finger protein molecules which are required for encapsidation. Our present results show that finger protein p12 of Rous sarcoma virus (RSV) and p10 of murine leukaemia virus (MuLV) positions replication primer tRNA on the replication initiation site (PBS) at the 5' end of the RNA genome. An RSV mutant with a Val-Pro insertion in the finger motif of p12 is able to partially encapsidate genomic RNA but is not infectious because mutated p12 is incapable of positioning the replication primer, tRNATrp. Since all known replication competent retroviruses, and the plant virus CaMV, code for finger proteins analogous to RSV p12 or MuLV p10, the initial stage of reverse transcription in avian, mammalian and human retroviruses and in CaMV is probably controlled in an analogous way.

  14. Insight on Mutation-Induced Resistance from Molecular Dynamics Simulations of the Native and Mutated CSF-1R and KIT.

    Directory of Open Access Journals (Sweden)

    Priscila Da Silva Figueiredo Celestino Gomes

    Full Text Available The receptors tyrosine kinases (RTKs for the colony stimulating factor-1, CSF-1R, and for the stem cell factor, SCFR or KIT, are important mediators of signal transduction. The abnormal function of these receptors, promoted by gain-of-function mutations, leads to their constitutive activation, associated with cancer or other proliferative diseases. A secondary effect of the mutations is the alteration of receptors' sensitivity to tyrosine kinase inhibitors, compromising effectiveness of these molecules in clinical treatment. In particular, the mutation V560G in KIT increases its sensitivity to Imatinib, while the D816V in KIT, and D802V in CSF-1R, triggers resistance to the drug. We analyzed the Imatinib binding affinity to the native and mutated KIT (mutations V560G, S628N and D816V and CSF-1R (mutation D802V by using molecular dynamics simulations and energy calculations of Imatinib•target complexes. Further, we evaluated the sensitivity of the studied KIT receptors to Imatinib by measuring the inhibition of KIT phosphorylation. Our study showed that (i the binding free energy of Imatinib to the targets is highly correlated with their experimentally measured sensitivity; (ii the electrostatic interactions are a decisive factor affecting the binding energy; (iii the most deleterious impact to the Imatinib sensitivity is promoted by D802V (CSF-1R and D816V (KIT mutations; (iv the role of the juxtamembrane region, JMR, in the imatinib binding is accessory. These findings contribute to a better description of the mutation-induced effects alternating the targets sensitivity to Imatinib.

  15. Characterization of cancer-associated missense mutations in MDM2

    OpenAIRE

    Chauhan, Krishna M.; Ramakrishnan, Gopalakrishnan; Kollareddy, Madhusudhan; Martinez, Luis A.

    2015-01-01

    MDM2 is an E3 ubiquitin ligase that binds the N-terminus of p53 and promotes its ubiquitin-dependent degradation. Elevated levels of MDM2 due to overexpression or gene amplification can contribute to tumor development by suppressing p53 activity. Since MDM2 is an oncogene, we explored the possibility that other genetic lesions, namely missense mutations, might alter its activities. We selected mutations in MDM2 that reside in one of the 4 key regions of the protein: p53 binding domain, acidic...

  16. Better plants through mutations

    International Nuclear Information System (INIS)

    1988-01-01

    This is a public relations film describing problems associated with the genetic improvement of crop plants through induced mutations. Mutations are the ultimate source of genetic variation in plants. Mutation induction is now established as a practical tool in plant breeding. The Joint FAO/IAEA Division and the IAEA's laboratory at Seibersdorf have supported research and practical implementation of mutation breeding of both seed propagated and vegetatively propagated plants. Plant biotechnology based on in vitro culture and recombinant DNA technology will make a further significant contribution to plant breeding

  17. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  18. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  19. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  20. Probing the binding of coumarins and cyclothialidines to DNA gyrase

    DEFF Research Database (Denmark)

    Kampranis, S C; Gormley, N A; Tranter, R

    1999-01-01

    B and coumarin and cyclothialidine drugs and made mutations by site-directed mutagenesis. We used proteolysis as a probe of drug binding to wild-type and mutant proteins. Limited proteolysis of gyrase revealed that binding of these antibiotics is associated with a characteristic proteolytic fingerprint......, suggesting a drug-induced conformational change. The ability of the mutants to bind the drugs was studied by testing their ability to induce the coumarin-associated proteolytic signature and to bind to a novobiocin-affinity column. To analyze further the interaction of the drugs with gyrase, we studied...

  1. Toehold-mediated strand displacement reaction triggered isothermal DNA amplification for highly sensitive and selective fluorescent detection of single-base mutation.

    Science.gov (United States)

    Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei

    2014-09-15

    Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Rapid identification of HEXA mutations in Tay-Sachs patients.

    Science.gov (United States)

    Giraud, Carole; Dussau, Jeanne; Azouguene, Emilie; Feillet, François; Puech, Jean-Philippe; Caillaud, Catherine

    2010-02-19

    Tay-Sachs disease (TSD) is a recessively inherited neurodegenerative disorder due to mutations in the HEXA gene resulting in a beta-hexosaminidase A (Hex A) deficiency. The purpose of this study was to characterize the molecular abnormalities in patients with infantile or later-onset forms of the disease. The complete sequencing of the 14 exons and flanking regions of the HEXA gene was performed with a unique technical condition in 10 unrelated TSD patients. Eleven mutations were identified, including five splice mutations, one insertion, two deletions and three single-base substitutions. Four mutations were novel: two splice mutations (IVS8+5G>A, IVS2+4delAGTA), one missense mutation in exon 6 (c.621T>G (p.D207E)) and one small deletion (c.1211-1212delTG) in exon 11 resulting in a premature stop codon at residue 429. The c.621T>G missense mutation was found in a patient presenting an infantile form. Its putative role in the pathogenesis of TSD is suspected as residue 207 is highly conserved in human, mouse and rat. Moreover, structural modelling predicted changes likely to affect substrate binding and catalytic activity of the enzyme. The time-saving procedure reported here could be useful for the characterization of Tay-Sachs-causing mutations, in particular in non-Ashkenazi patients mainly exhibiting rare mutations. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  3. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  4. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  5. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  6. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  7. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  8. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  9. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  10. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  11. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  12. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  13. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  14. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  15. Mild and severe muscular dystrophy caused by a single {gamma}-sarcoglycan mutation

    Energy Technology Data Exchange (ETDEWEB)

    McNally, E.M.; Boennemann, C.G.; Lidov, H.G.W. [Brigham and Women`s Hospital, Boston, MA (United States)] [and others

    1996-11-01

    Autosomal recessive muscular dystrophy is genetically heterogeneous. One form of this disorder, limb-girdle muscular dystrophy type 2C (LGMD 2C), is prevalent in northern Africa and has been shown to be associated with a single mutation in the gene encoding the dystrophin-associated protein {gamma}-sarcoglycan. The previous mutation analysis of {gamma}-sarcoglycan required the availability of muscle biopsies. To establish a mutation assay for genomic DNA, the intron-exon structure of the {gamma}-sarcoglycan gene was determined, and primers were designed to amplify each of the exons encoding {gamma}-sarcoglycan. We studied a group of Brazilian muscular dystrophy patients for mutations in the {gamma}-sarcoglycan gene. These patients were selected on the basis of autosomal inheritance and/or the presence of normal dystrophin and/or deficiency of {alpha}-sarcoglycan immunostaining. Four of 19 patients surveyed had a single, homozygous mutation in the {gamma}-sarcoglycan gene. The mutation identified in these patients, all of African-Brazilian descent, is identical to that seen in the North African population, suggesting that even patients of remote African descent may carry this mutation. The phenotype in these patients varied considerably. Of four families with an identical mutation, three have a severe Duchenne-like muscular dystrophy. However, one family has much milder symptoms, suggesting that other loci may be present that modify the severity of the clinical course resulting from {gamma}-sarcoglycan gene mutations. 19 refs., 5 figs., 3 tabs.

  16. Mutation and premating isolation

    Science.gov (United States)

    Woodruff, R. C.; Thompson, J. N. Jr

    2002-01-01

    While premating isolation might be traceable to different genetic mechanisms in different species, evidence supports the idea that as few as one or two genes may often be sufficient to initiate isolation. Thus, new mutation can theoretically play a key role in the process. But it has long been thought that a new isolation mutation would fail, because there would be no other individuals for the isolation-mutation-carrier to mate with. We now realize that premeiotic mutations are very common and will yield a cluster of progeny carrying the same new mutant allele. In this paper, we discuss the evidence for genetically simple premating isolation barriers and the role that clusters of an isolation mutation may play in initiating allopatric, and even sympatric, species divisions.

  17. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  18. Glutaric acidemia type II: gene structure and mutations of the electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) gene.

    Science.gov (United States)

    Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E

    2002-01-01

    Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.

  19. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  20. Cloning of an E. coli RecA and yeast RAD51 homolog, radA, an allele of the uvsC in Aspergillus nidulans and its mutator effects.

    Science.gov (United States)

    Seong, K Y; Chae, S K; Kang, H S

    1997-04-30

    An E. coli RecA and yeast RAD51 homolog from Aspergillus nidulans, radA, has been cloned by screening genomic and cDNA libraries with a PCR-amplified probe. This probe was generated using primers carrying the conserved sequences of eukaryotic RecA homologs. The deduced amino acid sequence revealed two conserved Walker-A and -B type nucleotide-binding domains and exhibited 88%, 60%, and 53% identity with Mei-3 of Neurospora crassa, rhp51+ of Schizosaccharomyces pombe, and Rad51 of Saccharomyces cerevisiae, respectively. radA null mutants constructed by replacing the whole coding region with a selection marker showed high methyl methanesulfonate (MMS) sensitivity. Heterozygous diploids of radA disruptant with the uvsC114 mutant failed to complement with respect to MMS-sensitivity, indicating that radA is an allele of uvsC. In selecting spontaneous forward selenate resistant mutations, mutator effects were observed in radA null mutants similarly to those shown in uvsC114 mutant strains.

  1. A high-throughput protocol for mutation scanning of the BRCA1 and BRCA2 genes

    International Nuclear Information System (INIS)

    Hondow, Heather L; Fox, Stephen B; Mitchell, Gillian; Scott, Rodney J; Beshay, Victoria; Wong, Stephen Q; Dobrovic, Alexander

    2011-01-01

    Detection of mutations by DNA sequencing can be facilitated by scanning methods to identify amplicons which may have mutations. Current scanning methods used for the detection of germline sequence variants are laborious as they require post-PCR manipulation. High resolution melting (HRM) is a cost-effective rapid screening strategy, which readily detects heterozygous variants by melting curve analysis of PCR products. It is well suited to screening genes such as BRCA1 and BRCA2 as germline pathogenic mutations in these genes are always heterozygous. Assays for the analysis of all coding regions and intron-exon boundaries of BRCA1 and BRCA2 were designed, and optimised. A final set of 94 assays which ran under identical amplification conditions were chosen for BRCA1 (36) and BRCA2 (58). Significant attention was placed on primer design to enable reproducible detection of mutations within the amplicon while minimising unnecessary detection of polymorphisms. Deoxyinosine residues were incorporated into primers that overlay intronic polymorphisms. Multiple 384 well plates were used to facilitate high throughput. 169 BRCA1 and 239 BRCA2 known sequence variants were used to test the amplicons. We also performed an extensive blinded validation of the protocol with 384 separate patient DNAs. All heterozygous variants were detected with the optimised assays. This is the first HRM approach to screen the entire coding region of the BRCA1 and BRCA2 genes using one set of reaction conditions in a multi plate 384 well format using specifically designed primers. The parallel screening of a relatively large number of samples enables better detection of sequence variants. HRM has the advantages of decreasing the necessary sequencing by more than 90%. This markedly reduced cost of sequencing will result in BRCA1 and BRCA2 mutation testing becoming accessible to individuals who currently do not undergo mutation testing because of the significant costs involved

  2. Indian hedgehog mutations causing brachydactyly type A1 impair Hedgehog signal transduction at multiple levels

    Science.gov (United States)

    Ma, Gang; Yu, Jiang; Xiao, Yue; Chan, Danny; Gao, Bo; Hu, Jianxin; He, Yongxing; Guo, Shengzhen; Zhou, Jian; Zhang, Lingling; Gao, Linghan; Zhang, Wenjuan; Kang, Yan; Cheah, Kathryn SE; Feng, Guoyin; Guo, Xizhi; Wang, Yujiong; Zhou, Cong-zhao; He, Lin

    2011-01-01

    Brachydactyly type A1 (BDA1), the first recorded Mendelian autosomal dominant disorder in humans, is characterized by a shortening or absence of the middle phalanges. Heterozygous missense mutations in the Indian Hedgehog (IHH) gene have been identified as a cause of BDA1; however, the biochemical consequences of these mutations are unclear. In this paper, we analyzed three BDA1 mutations (E95K, D100E, and E131K) in the N-terminal fragment of Indian Hedgehog (IhhN). Structural analysis showed that the E95K mutation changes a negatively charged area to a positively charged area in a calcium-binding groove, and that the D100E mutation changes the local tertiary structure. Furthermore, we showed that the E95K and D100E mutations led to a temperature-sensitive and calcium-dependent instability of IhhN, which might contribute to an enhanced intracellular degradation of the mutant proteins via the lysosome. Notably, all three mutations affected Hh binding to the receptor Patched1 (PTC1), reducing its capacity to induce cellular differentiation. We propose that these are common features of the mutations that cause BDA1, affecting the Hh tertiary structure, intracellular fate, binding to the receptor/partners, and binding to extracellular components. The combination of these features alters signaling capacity and range, but the impact is likely to be variable and mutation-dependent. The potential variation in the signaling range is characterized by an enhanced interaction with heparan sulfate for IHH with the E95K mutation, but not the E131K mutation. Taken together, our results suggest that these IHH mutations affect Hh signaling at multiple levels, causing abnormal bone development and abnormal digit formation. PMID:21537345

  3. Prognostic value of IDH1 mutations identified with PCR-RFLP assay in acute myeloid leukemia patients

    International Nuclear Information System (INIS)

    Elsayed, Gh.M.; Zaher, A.; Elnoshokaty, E.H.; Nassar, H.R.; Moneer, M.M.

    2014-01-01

    Background: Somatic mutations in isocitrate dehydrogenase 1 (1DH1) gene occur frequently in primary brain tumors. Recently theses mutations were demonstrated in acute myeloid leukemia (AML). So far, assessment of these mutations relied on the DNA sequencing technique. Aim of the work: The aim of this study was to detect somatic mutations in IDH1 gene using mismatched primers suitable for endonuclease based detection, without the need for DNA sequencing, and to estimate its prognostic value, on patients with de novo AML. Methods: Residual DNA extracted from pretreatment bone marrow (BM) samples of 100 patients with de novo AML was used. The polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) was adapted to IDHl gene, codon 132 mutations screening. Results: The frequency of IDH1 mutations was 13%. In the non-acute promyelocytic leukemia group (non-APL), IDH1 mutations were significantly associated with FLT3-ITD negative patients (p = 0.03). Patients with 1DH1 mutations did not achieve complete remission (CR). There was a trend for shorter overall survival (OS) in patients with IDH1 mutation compared to those with wild type (p = 0.08). Conclusion: IDH1 mutations are recurring genetic alterations in AML and they may have unfavorable impact on clinical outcome in adult AML. The PCR-RFLP method allows for a fast, inexpensive, and sensitive method for the detection of IDF11 mutations in AML.

  4. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  5. Table 1 Oligonucleotide primers used for SNP verification by Sanger ...

    Indian Academy of Sciences (India)

    charissa

    1 Ao W, Aldous S, Woodruf E, Hicke B, Rea L, Kreiswirth B, Jenison R. Rapid detection of rpoB gene mutations conferring rifampin resistance in Mycobacterium tuberculosis. J Clin Microbiol. 2012; 50: 2433-2440. 2 Bakuła Z, Napiórkowska A, Bielecki J et al. Mutations in the embB gene and their association with ethambutol ...

  6. Molecular dynamics simulations suggest that electrostatic funnel directs binding of Tamiflu to influenza N1 neuraminidases.

    Directory of Open Access Journals (Sweden)

    Ly Le

    2010-09-01

    Full Text Available Oseltamivir (Tamiflu is currently the frontline antiviral drug employed to fight the flu virus in infected individuals by inhibiting neuraminidase, a flu protein responsible for the release of newly synthesized virions. However, oseltamivir resistance has become a critical problem due to rapid mutation of the flu virus. Unfortunately, how mutations actually confer drug resistance is not well understood. In this study, we employ molecular dynamics (MD and steered molecular dynamics (SMD simulations, as well as graphics processing unit (GPU-accelerated electrostatic mapping, to uncover the mechanism behind point mutation induced oseltamivir-resistance in both H5N1 "avian" and H1N1pdm "swine" flu N1-subtype neuraminidases. The simulations reveal an electrostatic binding funnel that plays a key role in directing oseltamivir into and out of its binding site on N1 neuraminidase. The binding pathway for oseltamivir suggests how mutations disrupt drug binding and how new drugs may circumvent the resistance mechanisms.

  7. Screening for functional sequence variations and mutations in ABCA1

    NARCIS (Netherlands)

    Probst, Mario C. O.; Thumann, Harald; Aslanidis, Charalampos; Langmann, Thomas; Buechler, Christa; Patsch, Wolfgang; Baralle, Francisco E.; Dallinga-Thie, Geesje M.; Geisel, Jürgen; Keller, Christiane; Menys, Valentine C.; Schmitz, Gerd

    2004-01-01

    Mutations in the ATP-binding cassette 1 transporter gene (ABCA1) are responsible for the genetic HDL-deficiency syndromes, which are characterized by severely diminished plasma HDL-C levels and a predisposition to cardiovascular disease and splenomegaly. The ABCA1 gene contains 50 exons and codes

  8. Establishment and application of a multiplex genetic mutation-detection method of lung cancer based on MassARRAY platform

    International Nuclear Information System (INIS)

    Tian, Hong-Xia; Zhang, Xu-Chao; Wang, Zhen; Chen, Jian-Guang; Chen, Shi-Liang; Guo, Wei-Bang; Wu, Yi-Long

    2016-01-01

    Objective: This study aims to establish a method for highly parallel multiplexed detection of genetic mutations in Chinese lung cancer samples through Agena iPLEX chemistry and matrix-assisted laser desorption ionization time-of-flight analysis on MassARRAY mass spectrometry platform. Methods: We reviewed the related literature and data on lung cancer treatments. We also identified 99 mutation hot spots in 13 target genes closely related to the pathogenesis, drug resistance, and metastasis of lung cancer. A total of 297 primers, composed of 99 paired forward and reverse amplification primers and 99 matched extension primers, were designed using Assay Design software. The detection method was established by analyzing eight cell lines and six lung cancer specimens. The proposed method was then validated through comparisons by using a LungCarta TM kit. The sensitivity and specificity of the proposed method were evaluated by directly sequencing EGFR and KRAS genes in 100 lung cancer cases. Results: The proposed method was able to detect multiplex genetic mutations in lung cancer cell lines. This finding was consistent with the observations on previously reported mutations. The proposed method can also detect such mutations in clinical lung cancer specimens. This result was consistent with the observations with LungCarta TM kit. However, an FGFR2 mutation was detected only through the proposed method. The measured sensitivity and specificity were 100% and 96.3%, respectively. Conclusions: The proposed MassARRAY technology-based multiplex method can detect genetic mutations in Chinese lung cancer patients. Therefore, the proposed method can be applied to detect mutations in other cancer tissues

  9. Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.

    Science.gov (United States)

    Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

    2009-06-26

    Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.

  10. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  11. A novel MKRN3 missense mutation causing familial precocious puberty.

    Science.gov (United States)

    de Vries, L; Gat-Yablonski, G; Dror, N; Singer, A; Phillip, M

    2014-12-01

    Central precocious puberty may be familial in about a quarter of the idiopathic cases. However, little is known about the genetic causes responsible for the disorder. In this report we describe a family with central precocious puberty associated with a mutation in the makorin RING-finger protein 3 (MKRN3) gene. A novel missense mutation (p.H420Q) in the imprinted MKRN3 gene was identified in the four affected siblings, in their unaffected father and in his affected mother. An in silico mutant MKRN3 model predicts that the mutation p.H420Q leads to reduced zinc binding and, subsequently, impaired RNA binding. These findings support the fundamental role of the MKRN3 protein in determining pubertal timing. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Genetic Mutations in Cancer

    Science.gov (United States)

    Many different types of genetic mutations are found in cancer cells. This infographic outlines certain types of alterations that are present in cancer, such as missense, nonsense, frameshift, and chromosome rearrangements.

  13. AIP mutations and gigantism.

    Science.gov (United States)

    Rostomyan, Liliya; Potorac, Iulia; Beckers, Pablo; Daly, Adrian F; Beckers, Albert

    2017-06-01

    AIP mutations are rare in sporadic acromegaly but they are seen at a higher frequency among certain specific populations of pituitary adenoma patients (pituitary gigantism cases, familial isolated pituitary adenoma (FIPA) kindreds, and patients with macroadenomas who are diagnosed ≤30 years). AIP mutations are most prevalent in patients with pituitary gigantism (29% of this group were found to have mutations in AIP gene). These data support targeted genetic screening for AIP mutations/deletions in these groups of pituitary adenoma patients. Earlier diagnosis of AIP-related acromegaly-gigantism cases enables timely clinical evaluation and treatment, thereby improving outcomes in terms of excessive linear growth and acromegaly comorbidities. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  15. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  16. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  18. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  19. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  20. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  1. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  2. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  3. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  4. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  5. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  6. Distinct phosphotyrosines on a growth factor receptor bind to specific molecules that mediate different signaling pathways.

    Science.gov (United States)

    Fantl, W J; Escobedo, J A; Martin, G A; Turck, C W; del Rosario, M; McCormick, F; Williams, L T

    1992-05-01

    The receptor for platelet-derived growth factor (PDGF) binds two proteins containing SH2 domains, GTPase activating protein (GAP) and phosphatidylinositol 3-kinase (PI3-kinase). The sites on the receptor that mediate this interaction were identified by using phosphotyrosine-containing peptides representing receptor sequences to block specifically binding of either PI3-kinase or GAP. These results suggested that PI3-kinase binds two phosphotyrosine residues, each located in a 5 aa motif with an essential methionine at the fourth position C-terminal to the tyrosine. Point mutations at these sites caused a selective elimination of PI3-kinase binding and loss of PDGF-stimulated DNA synthesis. Mutation of the binding site for GAP prevented the receptor from associating with or phosphorylating GAP, but had no effect on PI3-kinase binding and little effect on DNA synthesis. Therefore, GAP and PI3-kinase interact with the receptor by binding to different phosphotyrosine-containing sequence motifs.

  7. Mutation breeding in peas

    Energy Technology Data Exchange (ETDEWEB)

    Jaranowski, J [Institute of Genetics and Plant Breeding, Academy of Agriculture, Poznan (Poland); Micke, A [Joint FAO/IAEA Division of Isotope and Radiation Applications of Atomic Energy for Food and Agricultural Development, International Atomic Energy Agency, Vienna (Austria)

    1985-02-01

    The pea as an ancient crop plant still today has wide uses and is an import source of food protein. It is also an important object for genetic studies and as such has been widely used in mutation induction experiments. However, in comparison with cereals this ancient crop plant (like several other grain legumes) has gained relatively little from advances in breeding. The review focuses on the prospects of genetic improvement of pea by induced mutations, discusses principles and gives methodological information. (author)

  8. Mutation breeding in peas

    International Nuclear Information System (INIS)

    Jaranowski, J.; Micke, A.

    1985-01-01

    The pea as an ancient crop plant still today has wide uses and is an import source of food protein. It is also an important object for genetic studies and as such has been widely used in mutation induction experiments. However, in comparison with cereals this ancient crop plant (like several other grain legumes) has gained relatively little from advances in breeding. The review focuses on the prospects of genetic improvement of pea by induced mutations, discusses principles and gives methodological information. (author)

  9. Total iron binding capacity

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003489.htm Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  10. An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

    International Nuclear Information System (INIS)

    Jin Tao; Zou Liuhe; Yang Ling

    2004-01-01

    Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

  11. Identification of amino acid residues in PEPHC1 important for binding to the tumor-specific receptor EGFRvIII

    DEFF Research Database (Denmark)

    Hansen, Charlotte Lund; Hansen, Paul Robert; Pedersen, Nina

    2008-01-01

    to identify the amino acid residues important for binding of PEPHC1 to EGFRvIII. The results indicate that the amino acid residues at the N-terminus of PEPHC1 are essential for the binding to the mutated receptor. One analog, [Ala(12)]PEPHC1, showed higher selective binding to EGFRvIII than PEPHC1...

  12. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  13. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  14. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  15. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  16. Mutator activity in Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Shneyour, Y.; Koltin, Y. (Tel Aviv Univ. (Israel). Dept. of Microbiology)

    1983-01-01

    A strain with an elevated level of spontaneous mutations and an especially high rate of reversion at a specific locus (pab/sup -/) was identified. The mutator trait is recessive. UV sensitivity and the absence of a UV-specific endonucleolytic activity were associated with the enhancement of the mutation rate in mutator strains. The endonuclease associated with the regulation of the mutation rate also acted on single-stranded DNA. The molecular weight of this enzyme is about 38,000 daltons.

  17. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  18. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  19. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  20. Complex long-distance effects of mutations that confer linezolid resistance in the large ribosomal subunit

    Science.gov (United States)

    Fulle, Simone; Saini, Jagmohan S.; Homeyer, Nadine; Gohlke, Holger

    2015-01-01

    The emergence of multidrug-resistant pathogens will make current antibiotics ineffective. For linezolid, a member of the novel oxazolidinone class of antibiotics, 10 nucleotide mutations in the ribosome have been described conferring resistance. Hypotheses for how these mutations affect antibiotics binding have been derived based on comparative crystallographic studies. However, a detailed description at the atomistic level of how remote mutations exert long-distance effects has remained elusive. Here, we show that the G2032A-C2499A double mutation, located > 10 Å away from the antibiotic, confers linezolid resistance by a complex set of effects that percolate to the binding site. By molecular dynamics simulations and free energy calculations, we identify U2504 and C2452 as spearheads among binding site nucleotides that exert the most immediate effect on linezolid binding. Structural reorganizations within the ribosomal subunit due to the mutations are likely associated with mutually compensating changes in the effective energy. Furthermore, we suggest two main routes of information transfer from the mutation sites to U2504 and C2452. Between these, we observe cross-talk, which suggests that synergistic effects observed for the two mutations arise in an indirect manner. These results should be relevant for the development of oxazolidinone derivatives that are active against linezolid-resistant strains. PMID:26202966

  1. Development of ultra-short PCR assay to reveal BRAF V600 mutation status in Thai colorectal cancer tissues.

    Science.gov (United States)

    Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat

    2018-01-01

    The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.

  2. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  3. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  5. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  6. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  7. The Impact of ESR1 Mutations on the Treatment of Metastatic Breast Cancer.

    Science.gov (United States)

    Pejerrey, Sasha M; Dustin, Derek; Kim, Jin-Ah; Gu, Guowei; Rechoum, Yassine; Fuqua, Suzanne A W

    2018-05-07

    After nearly 20 years of research, it is now established that mutations within the estrogen receptor (ER) gene, ESR1, frequently occur in metastatic breast cancer and influence response to hormone therapy. Though early studies presented differing results, sensitive sequencing techniques now show that ESR1 mutations occur at a frequency between 20 and 40% depending on the assay method. Recent studies have focused on several "hot spot mutations," a cluster of mutations found in the hormone-binding domain of the ESR1 gene. Throughout the course of treatment, tumor evolution can occur, and ESR1 mutations emerge and become enriched in the metastatic setting. Sensitive techniques to continually monitor mutant burden in vivo are needed to effectively treat patients with mutant ESR1. The full impact of these mutations on tumor response to different therapies remains to be determined. However, recent studies indicate that mutant-bearing tumors may be less responsive to specific hormonal therapies, and suggest that aromatase inhibitor (AI) therapy may select for the emergence of ESR1 mutations. Additionally, different mutations may respond discretely to targeted therapies. The need for more preclinical mechanistic studies on ESR1 mutations and the development of better agents to target these mutations are urgently needed. In the future, sequential monitoring of ESR1 mutational status will likely direct personalized therapeutic regimens appropriate to each tumor's unique mutational landscape.

  8. The identification of irreversible rituximab-resistant lymphoma caused by CD20 gene mutations

    Energy Technology Data Exchange (ETDEWEB)

    Mishima, Y [Department of Clinical Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan); Olympas Bio-Imaging Lab, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan); Terui, Y [Department of Clinical Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan); Takeuchi, K [Division of Pathology, Cancer Institute, Japanese Foundation for Cancer Research, Tokyo (Japan); Matsumoto-Mishima, Y; Matsusaka, S [Department of Clinical Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan); Utsubo-Kuniyoshi, R [Department of Clinical Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan); Olympas Bio-Imaging Lab, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan); Hatake, K [Department of Clinical Chemotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo (Japan)

    2011-04-01

    C-terminal mutations of CD20 constitute part of the mechanisms that resist rituximab therapy. Most CD20 having a C-terminal mutation was not recognized by L26 antibody. As the exact epitope of L26 has not been determined, expression and localization of mutated CD20 have not been completely elucidated. In this study, we revealed that the binding site of L26 monoclonal antibody is located in the C-terminal cytoplasmic region of CD20 molecule, which was often lost in mutated CD20 molecules. This indicates that it is difficult to distinguish the mutation of CD20 from under expression of the CD20 protein. To detect comprehensive CD20 molecules including the resistant mutants, we developed a novel monoclonal antibody that recognizes the N-terminal cytoplasm region of CD20 molecule. We screened L26-negative cases with our antibody and found several mutations. A rituximab-binding analysis using the cryopreserved specimen that mutation was identified in CD20 molecules indicated that the C-terminal region of CD20 undertakes a critical role in presentation of the large loop in which the rituximab-binding site locates. Thus, combination of antibodies of two kinds of epitope permits the identification of C-terminal CD20 mutations associated with irreversible resistance to rituximab and may help the decision of the treatment strategy.

  9. Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

    Science.gov (United States)

    Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

    2014-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

  10. Mcm1p binding sites in ARG1 positively regulate Gcn4p binding and SWI/SNF recruitment

    OpenAIRE

    Yoon, Sungpil; Hinnebusch, Alan G.

    2009-01-01

    Transcription of the arginine biosynthetic gene ARG1 is activated by Gcn4p, a transcription factor induced by starvation for any amino acid. Previously we showed that Gcn4p binding stimulates the recruitment of Mcm1p and co-activator SWI/SNF to ARG1 in cells via Gcn4p induction through amino acid starvation. Here we report that Gcn4p binding is reduced by point mutations of the Mcm1p binding site and increased by overexpression of Mcm1p. This result suggests that Mcm1p plays a positive role i...

  11. Novel mutations and mutation combinations of ryanodine receptor in a chlorantraniliprole resistant population of Plutella xylostella (L.)

    Science.gov (United States)

    Guo, Lei; Liang, Pei; Zhou, Xuguo; Gao, Xiwu

    2014-01-01

    A previous study documented a glycine to glutamic acid mutation (G4946E) in ryanodine receptor (RyR) was highly correlated to diamide insecticide resistance in field populations of Plutella xylostella (Lepidoptera: Plutellidae). In this study, a field population collected in Yunnan province, China, exhibited a 2128-fold resistance to chlorantraniliprole. Sequence comparison between resistant and susceptible P. xylostella revealed three novel mutations including a glutamic acid to valine substitution (E1338D), a glutamine to leucine substitution (Q4594L) and an isoleucine to methionine substitution (I4790M) in highly conserved regions of RyR. Frequency analysis of all four mutations in this field population showed that the three new mutations showed a high frequency of 100%, while the G4946E had a frequency of 20%. Furthermore, the florescent ligand binding assay revealed that the RyR containing multiple mutations displayed a significantly lower affinity to the chlorantraniliprole. The combined results suggested that the co-existence of different combinations of the four mutations was involved in the chlorantraniliprole resistance. An allele-specific PCR based method was developed for the diagnosis of the four mutations in the field populations of P. xylostella. PMID:25377064

  12. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  13. Are There Mutator Polymerases?

    Directory of Open Access Journals (Sweden)

    Miguel Garcia-Diaz

    2003-01-01

    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  14. Computational analysis of histidine mutations on the structural stability of human tyrosinases leading to albinism insurgence.

    Science.gov (United States)

    Hassan, Mubashir; Abbas, Qamar; Raza, Hussain; Moustafa, Ahmed A; Seo, Sung-Yum

    2017-07-25

    Misfolding and structural alteration in proteins lead to serious malfunctions and cause various diseases in humans. Mutations at the active binding site in tyrosinase impair structural stability and cause lethal albinism by abolishing copper binding. To evaluate the histidine mutational effect, all mutated structures were built using homology modelling. The protein sequence was retrieved from the UniProt database, and 3D models of original and mutated human tyrosinase sequences were predicted by changing the residual positions within the target sequence separately. Structural and mutational analyses were performed to interpret the significance of mutated residues (N 180 , R 202 , Q 202 , R 211 , Y 363 , R 367 , Y 367 and D 390 ) at the active binding site of tyrosinases. CSpritz analysis depicted that 23.25% residues actively participate in the instability of tyrosinase. The accuracy of predicted models was confirmed through online servers ProSA-web, ERRAT score and VERIFY 3D values. The theoretical pI and GRAVY generated results also showed the accuracy of the predicted models. The CCA negative correlation results depicted that the replacement of mutated residues at His within the active binding site disturbs the structural stability of tyrosinases. The predicted CCA scores of Tyr 367 (-0.079) and Q/R 202 (0.032) revealed that both mutations have more potential to disturb the structural stability. MD simulation analyses of all predicted models justified that Gln 202 , Arg 202 , Tyr 367 and D 390 replacement made the protein structures more susceptible to destabilization. Mutational results showed that the replacement of His with Q/R 202 and Y/R 363 has a lethal effect and may cause melanin associated diseases such as OCA1. Taken together, our computational analysis depicts that the mutated residues such as Q/R 202 and Y/R 363 actively participate in instability and misfolding of tyrosinases, which may govern OCA1 through disturbing the melanin biosynthetic pathway.

  15. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  16. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  17. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  18. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  19. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  20. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  1. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  2. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  3. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  4. KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

    Science.gov (United States)

    Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

    2010-06-01

    KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

  5. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  6. Feature Binding in Zebrafish

    Directory of Open Access Journals (Sweden)

    P Neri

    2012-07-01

    Full Text Available Binding operations are primarily ascribed to cortex or similarly complex avian structures. My experiments show that the zebrafish, a lower vertebrate lacking cortex, supports visual feature binding of form and motion for the purpose of social behavior. These results challenge the notion that feature binding may require highly evolved neural structures and demonstrate that the nervous system of lower vertebrates can afford unexpectedly complex computations.

  7. Null missense ABCR (ABCA4) mutations in a family with stargardt disease and retinitis pigmentosa.

    Science.gov (United States)

    Shroyer, N F; Lewis, R A; Yatsenko, A N; Lupski, J R

    2001-11-01

    To determine the type of ABCR mutations that segregate in a family that manifests both Stargardt disease (STGD) and retinitis pigmentosa (RP), and the functional consequences of the underlying mutations. Direct sequencing of all 50 exons and flanking intronic regions of ABCR was performed for the STGD- and RP-affected relatives. RNA hybridization, Western blot analysis, and azido-adenosine triphosphate (ATP) labeling was used to determine the effect of disease-associated ABCR mutations in an in vitro assay system. Compound heterozygous missense mutations were identified in patients with STGD and RP. STGD-affected individual AR682-03 was compound heterozygous for the mutation 2588G-->C and a complex allele, [W1408R; R1640W]. RP-affected individuals AR682-04 and-05 were compound heterozygous for the complex allele [W1408R; R1640W] and the missense mutation V767D. Functional analysis of the mutation V767D by Western blot and ATP binding revealed a severe reduction in protein expression. In vitro analysis of ABCR protein with the mutations W1408R and R1640W showed a moderate effect of these individual mutations on expression and ATP-binding; the complex allele [W1408R; R1640W] caused a severe reduction in protein expression. These data reveal that missense ABCR mutations may be associated with RP. Functional analysis reveals that the RP-associated missense ABCR mutations are likely to be functionally null. These studies of the complex allele W1408R; R1640W suggest a synergistic effect of the individual mutations. These data are congruent with a model in which RP is associated with homozygous null mutations and with the notion that severity of retinal disease is inversely related to residual ABCR activity.

  8. Effect of cobratoxin binding on the normal mode vibration within acetylcholine binding protein.

    Science.gov (United States)

    Bertaccini, Edward J; Lindahl, Erik; Sixma, Titia; Trudell, James R

    2008-04-01

    Recent crystal structures of the acetylcholine binding protein (AChBP) have revealed surprisingly small structural alterations upon ligand binding. Here we investigate the extent to which ligand binding may affect receptor dynamics. AChBP is a homologue of the extracellular component of ligand-gated ion channels (LGICs). We have previously used an elastic network normal-mode analysis to propose a gating mechanism for the LGICs and to suggest the effects of various ligands on such motions. However, the difficulties with elastic network methods lie in their inability to account for the modest effects of a small ligand or mutation on ion channel motion. Here, we report the successful application of an elastic network normal mode technique to measure the effects of large ligand binding on receptor dynamics. The present calculations demonstrate a clear alteration in the native symmetric motions of a protein due to the presence of large protein cobratoxin ligands. In particular, normal-mode analysis revealed that cobratoxin binding to this protein significantly dampened the axially symmetric motion of the AChBP that may be associated with channel gating in the full nAChR. The results suggest that alterations in receptor dynamics could be a general feature of ligand binding.

  9. Mutation, somatic mutation and diseases of man

    International Nuclear Information System (INIS)

    Burnet, F.M.

    1976-01-01

    The relevance of the intrinsic mutagenesis for the evolution process, genetic diseases and the process of aging is exemplified. The fundamental reaction is the function of the DNA and the DNA-enzymes like the DNA-polymerases in replication, repair, and transcription. These defects are responsible for the mutation frequency and the genetic drift in the evolution process. They cause genetic diseases like Xeroderma pigmentosum which is described here in detail. The accumulation of structural and functional mistakes leads to diseases of old age, for example to autoimmune diseases and immune suppression. There is a proportionality between the duration of life and the frequency of mistakes in the enzymatic repair system. No possibility of prophylaxis or therapy is seen. Methods for prognosis could be developed. (AJ) [de

  10. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  11. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  12. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  13. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  14. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  15. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  16. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  17. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  18. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  19. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  20. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  1. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  2. Investigating MUC1/ICAM-1 Binding Induced Signaling in Breast Cancer Metastasis

    Science.gov (United States)

    2011-05-01

    at the molecular weight expected for a CD8/MUC1 dimer (Fig 4.9C). MUC1-CD contains SH2 and SH3 binding domains which act to recruit Src kinase To...recruitment of Src kinase , we assayed dimerization in MUC1-CFP-Fv cells with SH2 and/or SH3 domains mutated (Fig 4.11). As described below, MUC1-CFP-Fv...contains SH2 and SH3 binding domains for Src kinase . MUCI-CFP-Fv cells with mutations of the SH2 (Y46F; b.SH2) and/ or the putative Src SH3 binding

  3. Mutations and chromosomal aberrations

    International Nuclear Information System (INIS)

    Kihlman, B.A.

    1977-01-01

    The genetic changes of mutations and chromosomal aberrations are discussed. The consequences of both depend not only on the type of genetic change produced but also on the type of cell that is affected and on the development stage of the organism. (C.F.)

  4. Mutations in GABRB3

    DEFF Research Database (Denmark)

    Møller, Rikke S; Wuttke, Thomas V; Helbig, Ingo

    2017-01-01

    OBJECTIVE: To examine the role of mutations in GABRB3 encoding the β3 subunit of the GABAA receptor in individual patients with epilepsy with regard to causality, the spectrum of genetic variants, their pathophysiology, and associated phenotypes. METHODS: We performed massive parallel sequencing ...

  5. Kin Selection - Mutation Balance

    DEFF Research Database (Denmark)

    Dyken, J. David Van; Linksvayer, Timothy Arnold; Wade, Michael J.

    2011-01-01

    selection-mutation balance, which provides an evolutionary null hypothesis for the statics and dynamics of cheating. When social interactions have linear fitness effects and Hamilton´s rule is satisfied, selection is never strong enough to eliminate recurrent cheater mutants from a population, but cheater...

  6. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    Science.gov (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  7. Mutations in galactosemia

    Energy Technology Data Exchange (ETDEWEB)

    Reichardt, J.K.V. [Univ. of Southern California School of Medicine, Los Angeles, CA (United States)

    1995-10-01

    This Letter raises four issues concerning two papers on galactosemia published in the March 1995 of the Journal. First, table 2 in the paper by Elsas et al. incorrectly attributes seven galactose-l-phosphate uridyl transferase (GALT) mutations (S135L, L195P, K285N, N314D, R333W, R333G, and K334R). The table also fails to mention that others have reported the same two findings attributed to {open_quotes}Leslie et al.; Elsas et al. and in press{close_quotes} and {open_quotes}Leslie et al.; Elsas et al.{close_quotes} The first finding on the prevalence of the Q188R galactosemia mutation in the G/G Caucasian population has also been described by Ng et al., and the second finding on the correlation of the N314D GALT mutation with the Duarte variant was reported by Lin et al. Second, Elsas et al. suggest that the E203K and N314D mutations may {open_quotes}produce intra-allelic complementation when in cis{close_quotes}. This speculation is supported by the activity data of individual III-2 but is inconsistent with the activities of three other individuals I-1, II-1, and III-1 of the same pedigree. The GALT activity measured in these three individuals suggests a dominant negative effect of E203K in E203K-N314D chromosomes, since they all have less than normal activity. Thus, the preponderance of the data in this paper is at odds with the authors speculation. It is worth recalling that Lin et al. also identified four N314D GALT mutations on 95 galactosemic chromosomes examined. A similar situation also appears to be the case in proband III-1 (with genotype E203K-N314D/IVSC) in the Elsas et al. paper. 9 refs.

  8. Mutation breeding newsletter. No. 45

    International Nuclear Information System (INIS)

    2001-07-01

    This issue of the Mutation Breeding newsletter contains 39 articles dealing with radiation induced mutations and chemical mutagenesis techniques in plant breeding programs with the aims of improving crop productivity and disease resistance as well as exploring genetic variabilities

  9. Mutation breeding newsletter. No. 33

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-01-01

    This issue of the newsletter reports a number of research news and research abstracts on application of radiation induced mutation techniques to increase mutagenesis and mutation frequency in plant breeding projects.

  10. Mutation breeding newsletter. No. 33

    International Nuclear Information System (INIS)

    1989-01-01

    This issue of the newsletter reports a number of research news and research abstracts on application of radiation induced mutation techniques to increase mutagenesis and mutation frequency in plant breeding projects

  11. Novel Calmodulin (CALM2) Mutations Associated with Congenital Arrhythmia Susceptibility

    Science.gov (United States)

    Makita, Naomasa; Yagihara, Nobue; Crotti, Lia; Johnson, Christopher N.; Beckmann, Britt-Maria; Roh, Michelle S.; Shigemizu, Daichi; Lichtner, Peter; Ishikawa, Taisuke; Aiba, Takeshi; Homfray, Tessa; Behr, Elijah R.; Klug, Didier; Denjoy, Isabelle; Mastantuono, Elisa; Theisen, Daniel; Tsunoda, Tatsuhiko; Satake, Wataru; Toda, Tatsushi; Nakagawa, Hidewaki; Tsuji, Yukiomi; Tsuchiya, Takeshi; Yamamoto, Hirokazu; Miyamoto, Yoshihiro; Endo, Naoto; Kimura, Akinori; Ozaki, Kouichi; Motomura, Hideki; Suda, Kenji; Tanaka, Toshihiro; Schwartz, Peter J.; Meitinger, Thomas; Kääb, Stefan; Guicheney, Pascale; Shimizu, Wataru; Bhuiyan, Zahurul A.; Watanabe, Hiroshi; Chazin, Walter J.; George, Alfred L.

    2014-01-01

    Background Genetic predisposition to life-threatening cardiac arrhythmias such as in congenital long-QT syndrome (LQTS) and catecholaminergic polymorphic ventricular tachycardia (CPVT) represent treatable causes of sudden cardiac death in young adults and children. Recently, mutations in calmodulin (CALM1, CALM2) have been associated with severe forms of LQTS and CPVT, with life-threatening arrhythmias occurring very early in life. Additional mutation-positive cases are needed to discern genotype-phenotype correlations associated with calmodulin mutations. Methods and Results We employed conventional and next-generation sequencing approaches including exome analysis in genotype-negative LQTS probands. We identified five novel de novo missense mutations in CALM2 in three subjects with LQTS (p.N98S, p.N98I, p.D134H) and two subjects with clinical features of both LQTS and CPVT (p.D132E, p.Q136P). Age of onset of major symptoms (syncope or cardiac arrest) ranged from 1–9 years. Three of five probands had cardiac arrest and one of these subjects did not survive. Although all probands had LQTS, two subjects also exhibited electrocardiographic features consistent with CPVT. The clinical severity among subjects in this series was generally less than that originally reported for CALM1 and CALM2 associated with recurrent cardiac arrest during infancy. Four of five probands responded to β-blocker therapy whereas one subject with mutation p.Q136P died suddenly during exertion despite this treatment. Mutations affect conserved residues located within calcium binding loops III (p.N98S, p.N98I) or IV (p.D132E, p.D134H, p.Q136P) and caused reduced calcium binding affinity. Conclusions CALM2 mutations can be associated with LQTS and with overlapping features of LQTS and CPVT. PMID:24917665

  12. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis.

    Science.gov (United States)

    Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A

    2004-10-01

    The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.

  13. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  14. The prevalent deep intronic c. 639+919 G>A GLA mutation causes pseudoexon activation and Fabry disease by abolishing the binding of hnRNPA1 and hnRNP A2/B1 to a splicing silencer

    DEFF Research Database (Denmark)

    Palhais, Bruno; Dembic, Maja; Sabaratnam, Rugivan

    2016-01-01

    Fabry disease is an X-linked recessive inborn disorder of the glycosphingolipid metabolism, caused by total or partial deficiency of the lysosomal α-galactosidase A enzyme due to mutations in the GLA gene. The prevalent c.639+919 G>A mutation in GLA leads to pathogenic insertion of a 57bp pseudoe...... oligonucleotide (SSO) mediated blocking of the pseudoexon 3'ss and 5'ss effectively restores normal GLA splicing. This indicates that SSO based splicing correction may be a therapeutic alternative in the treatment of Fabry disease....

  15. Melanin-binding radiopharmaceuticals

    International Nuclear Information System (INIS)

    Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed

  16. Competitive protein binding assay

    International Nuclear Information System (INIS)

    Kaneko, Toshio; Oka, Hiroshi

    1975-01-01

    The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)

  17. Prevalence of mutations and functional analyses of melanocortin 4 receptor variants identified among 750 men with juvenile-onset obesity

    DEFF Research Database (Denmark)

    Larsen, Lesli H; Echwald, Søren Morgenthaler; Sørensen, Thorkild I A

    2005-01-01

    )) for mutations in MC4R. A total of 14 different mutations were identified of which two, Ala219Val and Leu325Phe, were novel variants. The variant receptor, Leu325Phe, was unable to bind [Nle4,d-Phe7]-alphaMSH, whereas the Ala219Val variant showed a significantly impaired melanotan II induction of cAMP, compared...

  18. Activating and deactivating mutations in the receptor interaction site of GDF5 cause symphalangism or brachydactyly type A2

    DEFF Research Database (Denmark)

    Seemann, Petra; Schwappacher, Raphaela; Kjær, Klaus Wilbrandt

    2005-01-01

    Here we describe 2 mutations in growth and differentiation factor 5 (GDF5) that alter receptor-binding affinities. They cause brachydactyly type A2 (L441P) and symphalangism (R438L), conditions previously associated with mutations in the GDF5 receptor bone morphogenetic protein receptor type 1b...

  19. BRAF mutation testing in solid tumors: a methodological comparison.

    Science.gov (United States)

    Weyant, Grace W; Wisotzkey, Jeffrey D; Benko, Floyd A; Donaldson, Keri J

    2014-09-01

    Solid tumor genotyping has become standard of care for the characterization of proto-oncogene mutational status, which has traditionally been accomplished with Sanger sequencing. However, companion diagnostic assays and comparable laboratory-developed tests are becoming increasingly popular, such as the cobas 4800 BRAF V600 Mutation Test and the INFINITI KRAS-BRAF assay, respectively. This study evaluates and validates the analytical performance of the INFINITI KRAS-BRAF assay and compares concordance of BRAF status with two reference assays, the cobas test and Sanger sequencing. DNA extraction from FFPE tissue specimens was performed followed by multiplex PCR amplification and fluorescent label incorporation using allele-specific primer extension. Hybridization to a microarray, signal detection, and analysis were then performed. The limits of detection were determined by testing dilutions of mutant BRAF alleles within wild-type background DNA, and accuracy was calculated based on these results. The INFINITI KRAS-BRAF assay produced 100% concordance with the cobas test and Sanger sequencing and had sensitivity equivalent to the cobas assay. The INFINITI assay is repeatable with at least 95% accuracy in the detection of mutant and wild-type BRAF alleles. These results confirm that the INFINITI KRAS-BRAF assay is comparable to traditional sequencing and the Food and Drug Administration-approved companion diagnostic assay for the detection of BRAF mutations. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  20. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...