FOLK TRADITION OF THE ISLAND OF KRK IN THE WORK OF ANTUN BONIFAČIĆ
Directory of Open Access Journals (Sweden)
Ruža Bonifačić
1995-01-01
Full Text Available The article deals with the influence of the folk tradition of Croatia and of the Island of Krk on the literary and editorial work of Antun Bonifačić. Great attention is given to the musical aspects of folk tradition, and to the literal or consciously changed citations of the Krk traditional songs. The professional concepts connected with the folk music of Istrian-Adriatic area are discussed together with the selected traditional terms. From the opus of Antun Bonifačić is emerging, up to now unknown, field of his interest - folkloristics.
Monte Carlo simulations of Higgs-boson production at the LHC with the KrkNLO method
Jadach, S.
2017-01-01
We present numerical tests and predictions of the KrkNLO method for matching of NLO QCD corrections to hard processes with LO parton shower Monte Carlo generators. This method was described in detail in our previous publications, where its advantages over other approaches, such as MCatNLO and POWHEG, were pointed out. Here we concentrate on presenting some numerical results (cross sections and distributions) for $Z/\\gamma^*$ (Drell-Yan) and Higgs-boson production processes at the LHC. The Drell--Yan process is used mainly to validate the KrkNLO implementation in the Herwig 7 program with respect to the previous implementation in Sherpa. We also show predictions for this process with the new, complete, MC-scheme parton distribution functions and compare them with our previously published results. Then, we present the first results of the KrkNLO method for the Higgs production in gluon--gluon fusion at the LHC and compare them with the predictions of other programs, such as MCFM, MCatNLO, POWHEG and HNNLO, as w...
A follow-up on Hanhart's dwarfs of Krk.
Zergollern, L
1971-05-01
Krk is the largest of the Yugoslav islands. On it, due to isolation and consanguineous marriages, certain hereditary diseases such as dwarfism, albinism and a progressive spastic quadriplegia associated with cataracts and mental defect, appear more frequently than in the rest of the population. In this short review, the primary concern is with the first of the disorders. Evidence is presented that Hanhart's dwarfs, as they have been called, have recessively inherited panhypopituitarism.
Characterization of the modular design of the autolysin/adhesin Aaa from Staphylococcus aureus.
Hirschhausen, Nina; Schlesier, Tim; Peters, Georg; Heilmann, Christine
2012-01-01
Staphylococcus aureus is a frequent cause of serious and life-threatening infections, such as endocarditis, osteomyelitis, pneumonia, and sepsis. Its adherence to various host structures is crucial for the establishment of diseases. Adherence may be mediated by a variety of adhesins, among them the autolysin/adhesins Atl and Aaa. Aaa is composed of three N-terminal repeated sequences homologous to a lysin motif (LysM) that can confer cell wall attachment and a C-terminally located cysteine, histidine-dependent amidohydrolase/peptidase (CHAP) domain having bacteriolytic activity in many proteins. Here, we show by surface plasmon resonance that the LysM domain binds to fibrinogen, fibronectin, and vitronectin respresenting a novel adhesive function for this domain. Moreover, we demonstrated that the CHAP domain not only mediates the bacteriolytic activity, but also adherence to fibrinogen, fibronectin, and vitronectin, thus demonstrating for the first time an adhesive function for this domain. Adherence of an S. aureus aaa mutant and the complemented aaa mutant is slightly decreased and increased, respectively, to vitronectin, but not to fibrinogen and fibronectin, which might at least in part result from an increased expression of atl in the aaa mutant. Furthermore, an S. aureus atl mutant that showed enhanced adherence to fibrinogen, fibronectin, and endothelial cells also demonstrated increased aaa expression and production of Aaa. Thus, the redundant functions of Aaa and Atl might at least in part be interchangeable. Lastly, RT-PCR and zymographic analysis revealed that aaa is negatively regulated by the global virulence gene regulators agr and SarA. We identified novel functions for two widely distributed protein domains, LysM and CHAP, i.e. the adherence to the extracellular matrix proteins fibrinogen, fibronectin, and vitronectin. The adhesive properties of Aaa might promote S. aureus colonization of host extracellular matrix and tissue, suggesting a role for
Monte Carlo simulations of Higgs-boson production at the LHC with the KrkNLO method
Energy Technology Data Exchange (ETDEWEB)
Jadach, S.; Skrzypek, M. [Polish Academy of Sciences, Institute of Nuclear Physics, Krakow (Poland); Nail, G. [University of Manchester, Particle Physics Group, School of Physics and Astronomy, Manchester (United Kingdom); Karlsruhe Institute of Technology, Institute for Theoretical Physics, Karlsruhe (Germany); Placzek, W. [Jagiellonian University, Marian Smoluchowski Institute of Physics, Krakow (Poland); Sapeta, S.; Siodmok, A. [Polish Academy of Sciences, Institute of Nuclear Physics, Krakow (Poland); Theoretical Physics Department, CERN, Geneva (Switzerland)
2017-03-15
We present numerical tests and predictions of the KrkNLO method for matching of NLO QCD corrections to hard processes with LO parton-shower Monte Carlo generators (NLO+PS). This method was described in detail in our previous publications, where it was also compared with other NLO+PS matching approaches (MC rate at NLO and POWHEG) as well as fixed-order NLO and NNLO calculations. Here we concentrate on presenting some numerical results (cross sections and distributions) for Z/γ* (Drell-Yan) and Higgs-boson production processes at the LHC. The Drell-Yan process is used mainly to validate the KrkNLO implementation in the Herwig 7 program with respect to the previous implementation in Sherpa. We also show predictions for this process with the new, complete, MC-scheme parton distribution functions and compare them with our previously published results. Then we present the first results of the KrkNLO method for Higgs production in gluon-gluon fusion at the LHC and compare them with MC rate at NLO and POWHEG predictions from Herwig 7, fixed-order results from HNNLO and a resummed calculation from HqT, as well as with experimental data from the ATLAS collaboration. (orig.)
The Weekend Effect in AAA Repair.
O'Donnell, Thomas F X; Li, Chun; Swerdlow, Nicholas J; Liang, Patric; Pothof, Alexander B; Patel, Virendra I; Giles, Kristina A; Malas, Mahmoud B; Schermerhorn, Marc L
2018-04-18
Conflicting reports exist regarding whether patients undergoing surgery on the weekend or later in the week experience worse outcomes. We identified patients undergoing abdominal aortic aneurysm (AAA) repair in the Vascular Quality Initiative between 2009 and 2017 [n = 38,498; 30,537 endovascular aneurysm repair (EVAR) and 7961 open repair]. We utilized mixed effects logistic regression to compare adjusted rates of perioperative mortality based on the day of repair. Tuesday was the most common day for elective repair (22%), Friday for symptomatic repairs (20%), and ruptured aneurysms were evenly distributed. Patients with ruptured aneurysms experienced similar adjusted mortality whether they underwent repair during the week or on weekends. Transfers of ruptured AAA were more common over the weekend. However, patients transferred on the weekend experienced higher adjusted mortality than those transferred during the week (28% vs 21%, P = 0.02), despite the fact that during the week, transferred patients actually experienced lower adjusted mortality than patients treated at the index hospital (21% vs 31%, P AAA repair. However, patients with ruptured AAA transferred on the weekend experienced higher mortality than those transferred during the week, suggesting a need for improvement in weekend transfer processes.
DEFF Research Database (Denmark)
Ottosson, R O; Hauer, Anna Karlsson; Behrens, C.F.
2010-01-01
to normal tissue sparing weighted. All optimized treatment plans were calculated using three different calculation algorithms (PBC, AAA and MC). In order to study the influence of motion, two virtual lung phantoms were created. The idea was to mimic two different situations: one where the GTV is located...... centrally in the PTV and another where the GTV was close to the edge of the PTV. PBC is in poor agreement with MC and AAA for all cases and treatment plans. AAA overestimates the dose, compared to MC. This effect is more pronounced for 15 than 6MV. AAA and MC both predict similar perturbations in dose...... distributions when moving the GTV to the edge of the PTV. PBC, however, predicts results contradicting those of AAA and MC. This study shows that PB-based dose calculation algorithms are clinically insufficient for patient geometries involving large density inhomogeneities. AAA is in much better agreement...
Structure and Function of p97 and Pex1/6 Type II AAA+ Complexes.
Saffert, Paul; Enenkel, Cordula; Wendler, Petra
2017-01-01
Protein complexes of the Type II AAA+ (ATPases associated with diverse cellular activities) family are typically hexamers of 80-150 kDa protomers that harbor two AAA+ ATPase domains. They form double ring assemblies flanked by associated domains, which can be N-terminal, intercalated or C-terminal to the ATPase domains. Most prominent members of this family include NSF (N-ethyl-maleimide sensitive factor), p97/VCP (valosin-containing protein), the Pex1/Pex6 complex and Hsp104 in eukaryotes and ClpB in bacteria. Tremendous efforts have been undertaken to understand the conformational dynamics of protein remodeling type II AAA+ complexes. A uniform mode of action has not been derived from these works. This review focuses on p97/VCP and the Pex1/6 complex, which both structurally remodel ubiquitinated substrate proteins. P97/VCP plays a role in many processes, including ER- associated protein degradation, and the Pex1/Pex6 complex dislocates and recycles the transport receptor Pex5 from the peroxisomal membrane during peroxisomal protein import. We give an introduction into existing knowledge about the biochemical and cellular activities of the complexes before discussing structural information. We particularly emphasize recent electron microscopy structures of the two AAA+ complexes and summarize their structural differences.
The mitochondrial inner membrane AAA metalloprotease family in metazoans.
Juhola, M K; Shah, Z H; Grivell, L A; Jacobs, H T
2000-09-15
Three metalloproteases belonging to the AAA superfamily (Yme1p, Afg3p and Rca1p) are involved in protein turnover and respiratory chain complex assembly in the yeast inner mitochondrial membrane. Analysis of the completed genome sequences of Caenorhabditis elegans and Drosophila melanogaster indicates that this gene family typically comprises 3-4 members in metazoans. Phylogenetic analysis reveals three main branches represented, respectively, by Saccharomyces cerevisiae YME1, human SPG7 (paraplegin) and S. cerevisiae AFG3 and RCA1. mt-AAA metalloproteases are weak candidates for several previously studied Drosophila mutants. A full elucidation of the cellular and physiological roles of mt-AAA metalloproteases in metazoans will require the creation of targeted mutations.
Prattes, Michael; Loibl, Mathias; Zisser, Gertrude; Luschnig, Daniel; Kappel, Lisa; Rössler, Ingrid; Grassegger, Manuela; Hromic, Altijana; Krieger, Elmar; Gruber, Karl; Pertschy, Brigitte; Bergler, Helmut
2017-03-17
AAA-ATPases fulfil essential roles in different cellular pathways and often act in form of hexameric complexes. Interaction with pathway-specific substrate and adaptor proteins recruits them to their targets and modulates their catalytic activity. This substrate dependent regulation of ATP hydrolysis in the AAA-domains is mediated by a non-catalytic N-terminal domain. The exact mechanisms that transmit the signal from the N-domain and coordinate the individual AAA-domains in the hexameric complex are still the topic of intensive research. Here, we present the characterization of a novel mutant variant of the eukaryotic AAA-ATPase Drg1 that shows dysregulation of ATPase activity and altered interaction with Rlp24, its substrate in ribosome biogenesis. This defective regulation is the consequence of amino acid exchanges at the interface between the regulatory N-domain and the adjacent D1 AAA-domain. The effects caused by these mutations strongly resemble those of pathological mutations of the AAA-ATPase p97 which cause the hereditary proteinopathy IBMPFD (inclusion body myopathy associated with Paget's disease of the bone and frontotemporal dementia). Our results therefore suggest well conserved mechanisms of regulation between structurally, but not functionally related members of the AAA-family.
Dasari, Suvarna; Kölling, Ralf
2016-07-01
We studied presequence processing of the mitochondrial-matrix targeted acetohydroxyacid synthase (Ilv2). C-terminal 3HA-tagging altered the cleavage pattern from a single step to sequential two-step cleavage, giving rise to two Ilv2-3HA forms (A and B). Both cleavage events were dependent on the mitochondrial processing peptidase (MPP). We present evidence for the involvement of three AAA ATPases, m- and i-AAA proteases, and Mcx1, in Ilv2-3HA processing. Both, precursor to A-form and A-form to B-form cleavage were strongly affected in a ∆yme1 mutant. These defects could be suppressed by overexpression of MPP, suggesting that MPP activity is limiting in the ∆yme1 mutant. Our data suggest that for some substrates AAA ATPases could play an active role in the translocation of matrix-targeted proteins.
Selective Intra-procedural AAA sac Embolization During EVAR Reduces the Rate of Type II Endoleak.
Mascoli, C; Freyrie, A; Gargiulo, M; Gallitto, E; Pini, R; Faggioli, G; Serra, C; De Molo, C; Stella, A
2016-05-01
The pre-treatment presence of at least six efferent patent vessels (EPV) from the AAA sac and/or AAA thrombus volume ratio (VR%) AAA sac embolization (Group A, 2012-2013) were retrospectively selected and compared with a control group of patients with the same p-MRF, who underwent EVAR without intra-procedural sac embolization (Group B, 2008-2010). The presence of ELIIp was evaluated by duplex ultrasound at 0 and 6 months, and by contrast enhanced ultrasound at 12 months. The association between AAA diameter, age, COPD, smoking, anticoagulant therapy, and AAA sac embolization with ELIIp was evaluated using multiple logistic regression. The primary endpoint was the effectiveness of the intra-procedural AAA sac embolization for ELIIp prevention. Secondary endpoints were AAA sac evolution and freedom from ELIIp and embolization related re-interventions at 6-12 months. Seventy patients were analyzed: 26 Group A and 44 Group B; the groups were homogeneous for clinical/morphological characteristics. In Group A the median number of coils positioned in AAA sac was 4.1 (IQR 1). There were no complications related to the embolization procedures. A significantly lower number of ELIIp was detected in Group A than in Group B (8/26 vs. 33/44, respectively, p AAA sac embolization was the only factor independently associated with freedom from ELIIp at 6 (OR 0.196, 95% CI 0.06-0.63; p = .007) and 12 months (OR 0.098, 95% CI 0.02-0.35; p AAA sac diameter shrinkage were detected between the two groups at 6-12 months (p = .42 and p = .58, respectively). Freedom from ELIIp related and embolization related re-interventions was 100% in both groups, at 6 and 12 months. Selective intra-procedural AAA sac embolization in patients with p-MRF is safe and could be an effective method to reduce ELIIp. Further studies are mandatory to support these results at long-term follow up. Copyright © 2015 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
Loss of Drosophila i-AAA protease, dYME1L, causes abnormal mitochondria and apoptotic degeneration.
Qi, Y; Liu, H; Daniels, M P; Zhang, G; Xu, H
2016-02-01
Mitochondrial AAA (ATPases Associated with diverse cellular Activities) proteases i-AAA (intermembrane space-AAA) and m-AAA (matrix-AAA) are closely related and have major roles in inner membrane protein homeostasis. Mutations of m-AAA proteases are associated with neuromuscular disorders in humans. However, the role of i-AAA in metazoans is poorly understood. We generated a deletion affecting Drosophila i-AAA, dYME1L (dYME1L(del)). Mutant flies exhibited premature aging, progressive locomotor deficiency and neurodegeneration that resemble some key features of m-AAA diseases. dYME1L(del) flies displayed elevated mitochondrial unfolded protein stress and irregular cristae. Aged dYME1L(del) flies had reduced complex I (NADH/ubiquinone oxidoreductase) activity, increased level of reactive oxygen species (ROS), severely disorganized mitochondrial membranes and increased apoptosis. Furthermore, inhibiting apoptosis by targeting dOmi (Drosophila Htra2/Omi) or DIAP1, or reducing ROS accumulation suppressed retinal degeneration. Our results suggest that i-AAA is essential for removing unfolded proteins and maintaining mitochondrial membrane architecture. Loss of i-AAA leads to the accumulation of oxidative damage and progressive deterioration of membrane integrity, which might contribute to apoptosis upon the release of proapoptotic molecules such as dOmi. Containing ROS level could be a potential strategy to manage mitochondrial AAA protease deficiency.
Prior Radiological Investigations in 65-Year-Old Men Screened for AAA.
Meecham, Lewis; Summerour, Virginia; Hobbs, Simon; Newman, Jeremy; Wall, Michael L
2018-05-01
The National Health Service abdominal aortic aneurysm screening programme (NAAASP) is now fully operational. Those who have previously been formally investigated for abdominal aortic aneurysm (AAA) are excluded; however, many patients undergo radiological investigation of the abdomen for other reasons. Such practices may find incidental AAA which may be eroding the performance of the NAAASP. We investigated the rates of preinvestigation before invitation to screening in our local AAA screening programme. Electronic patient records were retrospectively reviewed for all patients called between March 2013 and February 2016 in 1 local AAA screening programme. Their records were interrogated to identify any abdominal imaging within 5 years of their invitation to screening. Two thousand six hundred thirty-eight men were invited for screening; of these, 563 (21.3%) had been "prescreened". Median time between prescreening and screening was 19 months (0-60 months). Ultrasound abdomen was the most prevalent at 248 (44.0%). Two thousand two hundred forty-three (85.0%) men attended screening, and 6 (0.27%) were excluded for known AAA. Prevalence of AAA was 1.8% (n = 41). Of these, 15 (36.6%) had prior investigation with 6 (40.0%) having AAA diagnosed. Therefore, 9 (22.0%) had potential missed AAA on "prescreening" (mean diameter 35 mm [30-45], mean time lapse between investigation and screening 21.1 months [1-49]). Incidence of missed aneurysm in the "prescreened" cohort was 1.6% (9/563). Large numbers of men invited for AAA screening have undergone preinvestigation of their abdominal aorta, with 60% of the present AAA being missed. Reliance on incidental detection of AAA would leave many patients undiagnosed in the community-at risk of future rupture. Copyright © 2018 Elsevier Inc. All rights reserved.
Risk of abdominal aortic aneurysm (AAA) among male and female relatives of AAA patients.
van de Luijtgaarden, Koen M; Rouwet, Ellen V; Hoeks, Sanne E; Stolker, Robert J; Verhagen, Hence Jm; Majoor-Krakauer, Danielle
2017-04-01
Sex affects the presentation, treatment, and outcomes of abdominal aortic aneurysm (AAA). Although AAAs are less prevalent in women, at least in the general population, women with an AAA have a poorer prognosis in comparison to men. Sex differences in the genetic predisposition for aneurysm disease remain to be established. In this study we investigated the familial risk of AAA for women compared to men. All living AAA patients included in a 2004-2012 prospective database were invited to the multidisciplinary vascular/genetics outpatient clinic between 2009 and 2012 for assessment of family history using detailed questionnaires. AAA risk for male and female relatives was calculated separately and stratified by sex of the AAA patients. Families of 568 AAA patients were investigated and 22.5% of the patients had at least one affected relative. Female relatives had a 2.8-fold and male relatives had a 1.7-fold higher risk than the estimated sex-specific population risk. Relatives of female AAA patients had a higher aneurysm risk than relatives of male patients (9.0 vs 5.9%, p = 0.022), corresponding to 5.5- and 2.0-fold increases in aneurysm risk in the female and male relatives, respectively. The risk for aortic aneurysm in relatives of AAA patients is higher than expected from population risk. The excess risk is highest for the female relatives of AAA patients and for the relatives of female AAA patients. These findings endorse targeted AAA family screening for female and male relatives of all AAA patients.
NASA Airborne Astronomy Ambassadors (AAA)
Backman, D. E.; Harman, P. K.; Clark, C.
2016-12-01
NASA's Airborne Astronomy Ambassadors (AAA) is a three-part professional development (PD) program for high school physics and astronomy teachers. The AAA experience consists of: (1) blended-learning professional development composed of webinars, asynchronous content learning, and a series of hands-on workshops (2) a STEM immersion experience at NASA Armstrong Flight Research Center's B703 science research aircraft facility in Palmdale, California, and (3) ongoing participation in the AAA community of practice (CoP) connecting participants with astrophysics and planetary science Subject Matter Experts (SMEs). The SETI Institute (SI) is partnering with school districts in Santa Clara and Los Angeles Counties during the AAA program's "incubation" period, calendar years 2016 through 2018. AAAs will be selected by the school districts based on criteria developed during spring 2016 focus group meetings led by the program's external evaluator, WestEd.. Teachers with 3+ years teaching experience who are assigned to teach at least 2 sections in any combination of the high school courses Physics (non-AP), Physics of the Universe (California integrated model), Astronomy, or Earth & Space Sciences are eligible. Partner districts will select at least 48 eligible applicants with SI oversight. WestEd will randomly assign selected AAAs to group A or group B. Group A will complete PD in January - June of 2017 and then participate in SOFIA science flights during fall 2017 (SOFIA Cycle 5). Group B will act as a control during the 2017-18 school year. Group B will then complete PD in January - June of 2018 and participate in SOFIA science flights in fall 2018 (Cycle 6). Under the current plan, opportunities for additional districts to seek AAA partnerships with SI will be offered in 2018 or 2019. A nominal two-week AAA curriculum component will be developed by SI for classroom delivery that will be aligned with selected California Draft Science Framework Disciplinary Core Ideas
Biochemical Analysis of Two Single Mutants that Give Rise to a Polymorphic G6PD A-Double Mutant
Directory of Open Access Journals (Sweden)
Edson Jiovany Ramírez-Nava
2017-10-01
Full Text Available Glucose-6-phosphate dehydrogenase (G6PD is a key regulatory enzyme that plays a crucial role in the regulation of cellular energy and redox balance. Mutations in the gene encoding G6PD cause the most common enzymopathy that drives hereditary nonspherocytic hemolytic anemia. To gain insights into the effects of mutations in G6PD enzyme efficiency, we have investigated the biochemical, kinetic, and structural changes of three clinical G6PD variants, the single mutations G6PD A+ (Asn126AspD and G6PD Nefza (Leu323Pro, and the double mutant G6PD A− (Asn126Asp + Leu323Pro. The mutants showed lower residual activity (≤50% of WT G6PD and displayed important kinetic changes. Although all Class III mutants were located in different regions of the three-dimensional structure of the enzyme and were not close to the active site, these mutants had a deleterious effect over catalytic activity and structural stability. The results indicated that the G6PD Nefza mutation was mainly responsible for the functional and structural alterations observed in the double mutant G6PD A−. Moreover, our study suggests that the G6PD Nefza and G6PD A− mutations affect enzyme functions in a similar fashion to those reported for Class I mutations.
Abdominal Aortic Aneurysm (AAA)
... Professions Site Index A-Z Abdominal Aortic Aneurysm (AAA) Abdominal aortic aneurysm (AAA) occurs when atherosclerosis or plaque buildup causes the ... weak and bulge outward like a balloon. An AAA develops slowly over time and has few noticeable ...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4
Pathophysiology of AAA: heredity vs environment.
Björck, Martin; Wanhainen, Anders
2013-01-01
Abdominal aortic aneurysm (AAA) has a complex pathophysiology, in which both environmental and genetic factors play important roles, the most important being smoking. The recently reported falling prevalence rates of AAA in northern Europe and Australia/New Zeeland are largely explained by healthier smoking habits. Dietary factors and obesity, in particular abdominal obesity, are also of importance. A family history of AAA among first-degree relatives is present in approximately 13% of incident cases. The probability that a monozygotic twin of a person with an AAA has the disease is 24%, 71 times higher than that for a monozygotic twin of a person without AAA. Approximately 1000 SNPs in 100 candidate genes have been studied, and three genome-wide association studies were published, identifying different diverse weak associations. An example of interaction between environmental and genetic factors is the effect of cholesterol, where genetic and dietary factors affect levels of both HDL and LDL. True epigenetic studies have not yet been published. Copyright © 2013 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Ottosson, R O; Karlsson, A; Behrens, C F, E-mail: riolot01@heh.regionh.d [Department of Oncology (R), Division of Radiophysics (52AA), Copenhagen University Hospital Herlev, Herlev Ringvej 75, DK-2730 Herlev (Denmark)
2010-08-21
The pencil beam dose calculation method is frequently used in modern radiation therapy treatment planning regardless of the fact that it is documented inaccurately for cases involving large density variations. The inaccuracies are larger for higher beam energies. As a result, low energy beams are conventionally used for lung treatments. The aim of this study was to analyze the advantages and disadvantages of dynamic IMRT treatment planning for high and low photon energy in order to assess if deviating from the conventional low energy approach could be favorable in some cases. Furthermore, the influence of motion on the dose distribution was investigated. Four non-small cell lung cancer cases were selected for this study. Inverse planning was conducted using Varian Eclipse. A total number of 31 dynamic IMRT plans, distributed amongst the four cases, were created ranging from PTV conformity weighted to normal tissue sparing weighted. All optimized treatment plans were calculated using three different calculation algorithms (PBC, AAA and MC). In order to study the influence of motion, two virtual lung phantoms were created. The idea was to mimic two different situations: one where the GTV is located centrally in the PTV and another where the GTV was close to the edge of the PTV. PBC is in poor agreement with MC and AAA for all cases and treatment plans. AAA overestimates the dose, compared to MC. This effect is more pronounced for 15 than 6 MV. AAA and MC both predict similar perturbations in dose distributions when moving the GTV to the edge of the PTV. PBC, however, predicts results contradicting those of AAA and MC. This study shows that PB-based dose calculation algorithms are clinically insufficient for patient geometries involving large density inhomogeneities. AAA is in much better agreement with MC, but even a small overestimation of the dose level by the algorithm might lead to a large part of the PTV being underdosed. It is advisable to use low energy as a
Ottosson, R O; Karlsson, A; Behrens, C F
2010-08-21
The pencil beam dose calculation method is frequently used in modern radiation therapy treatment planning regardless of the fact that it is documented inaccurately for cases involving large density variations. The inaccuracies are larger for higher beam energies. As a result, low energy beams are conventionally used for lung treatments. The aim of this study was to analyze the advantages and disadvantages of dynamic IMRT treatment planning for high and low photon energy in order to assess if deviating from the conventional low energy approach could be favorable in some cases. Furthermore, the influence of motion on the dose distribution was investigated. Four non-small cell lung cancer cases were selected for this study. Inverse planning was conducted using Varian Eclipse. A total number of 31 dynamic IMRT plans, distributed amongst the four cases, were created ranging from PTV conformity weighted to normal tissue sparing weighted. All optimized treatment plans were calculated using three different calculation algorithms (PBC, AAA and MC). In order to study the influence of motion, two virtual lung phantoms were created. The idea was to mimic two different situations: one where the GTV is located centrally in the PTV and another where the GTV was close to the edge of the PTV. PBC is in poor agreement with MC and AAA for all cases and treatment plans. AAA overestimates the dose, compared to MC. This effect is more pronounced for 15 than 6 MV. AAA and MC both predict similar perturbations in dose distributions when moving the GTV to the edge of the PTV. PBC, however, predicts results contradicting those of AAA and MC. This study shows that PB-based dose calculation algorithms are clinically insufficient for patient geometries involving large density inhomogeneities. AAA is in much better agreement with MC, but even a small overestimation of the dose level by the algorithm might lead to a large part of the PTV being underdosed. It is advisable to use low energy as a
International Nuclear Information System (INIS)
Ottosson, R O; Karlsson, A; Behrens, C F
2010-01-01
The pencil beam dose calculation method is frequently used in modern radiation therapy treatment planning regardless of the fact that it is documented inaccurately for cases involving large density variations. The inaccuracies are larger for higher beam energies. As a result, low energy beams are conventionally used for lung treatments. The aim of this study was to analyze the advantages and disadvantages of dynamic IMRT treatment planning for high and low photon energy in order to assess if deviating from the conventional low energy approach could be favorable in some cases. Furthermore, the influence of motion on the dose distribution was investigated. Four non-small cell lung cancer cases were selected for this study. Inverse planning was conducted using Varian Eclipse. A total number of 31 dynamic IMRT plans, distributed amongst the four cases, were created ranging from PTV conformity weighted to normal tissue sparing weighted. All optimized treatment plans were calculated using three different calculation algorithms (PBC, AAA and MC). In order to study the influence of motion, two virtual lung phantoms were created. The idea was to mimic two different situations: one where the GTV is located centrally in the PTV and another where the GTV was close to the edge of the PTV. PBC is in poor agreement with MC and AAA for all cases and treatment plans. AAA overestimates the dose, compared to MC. This effect is more pronounced for 15 than 6 MV. AAA and MC both predict similar perturbations in dose distributions when moving the GTV to the edge of the PTV. PBC, however, predicts results contradicting those of AAA and MC. This study shows that PB-based dose calculation algorithms are clinically insufficient for patient geometries involving large density inhomogeneities. AAA is in much better agreement with MC, but even a small overestimation of the dose level by the algorithm might lead to a large part of the PTV being underdosed. It is advisable to use low energy as a
Sonawane, Kailas D; Kamble, Asmita S; Fandilolu, Prayagraj M
2017-12-27
Deficiency of 5-taurinomethyl-2-thiouridine, τm 5 s 2 U at the 34th 'wobble' position in tRNA Lys causes MERRF (Myoclonic Epilepsy with Ragged Red Fibers), a neuromuscular disease. This modified nucleoside of mt tRNA Lys , recognizes AAA/AAG codons during protein biosynthesis process. Its preference to identify cognate codons has not been studied at the atomic level. Hence, multiple MD simulations of various molecular models of anticodon stem loop (ASL) of mt tRNA Lys in presence and absence of τm 5 s 2 U 34 and N 6 -threonylcarbamoyl adenosine (t 6 A 37 ) along with AAA and AAG codons have been accomplished. Additional four MD simulations of multiple ASL mt tRNA Lys models in the context of ribosomal A-site residues have also been performed to investigate the role of A-site in recognition of AAA/AAG codons. MD simulation results show that, ASL models in presence of τm 5 s 2 U 34 and t 6 A 37 with codons AAA/AAG are more stable than the ASL lacking these modified bases. MD trajectories suggest that τm 5 s 2 U recognizes the codons initially by 'wobble' hydrogen bonding interactions, and then tRNA Lys might leave the explicit codon by a novel 'single' hydrogen bonding interaction in order to run the protein biosynthesis process smoothly. We propose this model as the 'Foot-Step Model' for codon recognition, in which the single hydrogen bond plays a crucial role. MD simulation results suggest that, tRNA Lys with τm 5 s 2 U and t 6 A recognizes AAA codon more preferably than AAG. Thus, these results reveal the consequences of τm 5 s 2 U and t 6 A in recognition of AAA/AAG codons in mitochondrial disease, MERRF.
Ružić, Igor; Marović, Ivan; Benac, Čedomir; Ilić, Suzana
2014-12-01
The aim of this study was to examine the capability of structure-from-motion photogrammetry in defining the geometry of cliffs and undercuts in rocks of complex geomorphology. A case site was chosen along pocket beaches near the village of Stara Ba\\vska on the Adriatic Sea island of Krk, Gulf of Kvarner, Croatia, where cliff erosion of 5 m in breccias was identified by comparison of aerial photographs from 1960 and 2004. The 3D point cloud was derived from approx. 800 photos taken on 9 January 2014 by a single camera from various elevations and angles, and processed using the online software ReCap (Autodesk). Data acquisition was found to be quick and the method easy to implement. The difference between the georeferenced 3D cloud points and an RTK-GPS survey was 7 cm, i.e. within the limits of RTK-GPS precision. Quantifying the spatial variation in undercut geometries revealed that the deepest and largest (17 m3) undercut was in the south-eastern sector of the beach. Reconstructing the detailed geomorphology of this 3.8-m-deep undercut convincingly demonstrates the high efficiency of the method. Such assessments of spatiotemporal changes in undercut and overhang volumes can prove useful for evaluations of cliff erosion risk. Coupled with the low cost and relatively simple application, this is evidently an attractive technique for meaningful geotechnical and coastal engineering monitoring in the future on the island of Krk and, for that matter, also on other Adriatic islands and in similar settings worldwide.
Esaki, Masatoshi; Islam, Md Tanvir; Tani, Naoki; Ogura, Teru
2017-07-14
Yeast Cdc48 is a well-conserved, essential chaperone of ATPases associated with diverse cellular activity (AAA) proteins, which recognizes substrate proteins and modulates their conformations to carry out many cellular processes. However, the fundamental mechanisms underlying the diverse pivotal roles of Cdc48 remain unknown. Almost all AAA proteins form a ring-shaped structure with a conserved aromatic amino acid residue that is essential for proper function. The threading mechanism hypothesis suggests that this residue guides the intrusion of substrate proteins into a narrow pore of the AAA ring, thereby becoming unfolded. By contrast, the aromatic residue in one of the two AAA rings of Cdc48 has been eliminated through evolution. Here, we show that artificial retrieval of this aromatic residue in Cdc48 is lethal, and essential features to support the threading mechanism are required to exhibit the lethal phenotype. In particular, genetic and biochemical analyses of the Cdc48 lethal mutant strongly suggested that when in complex with the 20S proteasome, essential proteins are abnormally forced to thread through the Cdc48 pore to become degraded, which was not detected in wild-type Cdc48. Thus, the widely applicable threading model is less effective for wild-type Cdc48; rather, Cdc48 might function predominantly through an as-yet-undetermined mechanism.
AAA Foundation for Traffic Safety
... of Top Deadly Mistakes Made by Teen Drivers -- AAA AAA: Road debris causes avoidable crashes, deaths Save the ... and 500 deaths! Foundation News Stay Tuned New AAA Foundation for Traffic Safety website coming Fall 2017 ...
AAA-ATPases in Protein Degradation
Directory of Open Access Journals (Sweden)
Ravikiran S. Yedidi
2017-06-01
Full Text Available Proteolytic machineries containing multisubunit protease complexes and AAA-ATPases play a key role in protein quality control and the regulation of protein homeostasis. In these protein degradation machineries, the proteolytically active sites are formed by either threonines or serines which are buried inside interior cavities of cylinder-shaped complexes. In eukaryotic cells, the proteasome is the most prominent protease complex harboring AAA-ATPases. To degrade protein substrates, the gates of the axial entry ports of the protease need to be open. Gate opening is accomplished by AAA-ATPases, which form a hexameric ring flanking the entry ports of the protease. Protein substrates with unstructured domains can loop into the entry ports without the assistance of AAA-ATPases. However, folded proteins require the action of AAA-ATPases to unveil an unstructured terminus or domain. Cycles of ATP binding/hydrolysis fuel the unfolding of protein substrates which are gripped by loops lining up the central pore of the AAA-ATPase ring. The AAA-ATPases pull on the unfolded polypeptide chain for translocation into the proteolytic cavity of the protease. Conformational changes within the AAA-ATPase ring and the adjacent protease chamber create a peristaltic movement for substrate degradation. The review focuses on new technologies toward the understanding of the function and structure of AAA-ATPases to achieve substrate recognition, unfolding and translocation into proteasomes in yeast and mammalian cells and into proteasome-equivalent proteases in bacteria and archaea.
AAA-ATPases in Protein Degradation.
Yedidi, Ravikiran S; Wendler, Petra; Enenkel, Cordula
2017-01-01
Proteolytic machineries containing multisubunit protease complexes and AAA-ATPases play a key role in protein quality control and the regulation of protein homeostasis. In these protein degradation machineries, the proteolytically active sites are formed by either threonines or serines which are buried inside interior cavities of cylinder-shaped complexes. In eukaryotic cells, the proteasome is the most prominent protease complex harboring AAA-ATPases. To degrade protein substrates, the gates of the axial entry ports of the protease need to be open. Gate opening is accomplished by AAA-ATPases, which form a hexameric ring flanking the entry ports of the protease. Protein substrates with unstructured domains can loop into the entry ports without the assistance of AAA-ATPases. However, folded proteins require the action of AAA-ATPases to unveil an unstructured terminus or domain. Cycles of ATP binding/hydrolysis fuel the unfolding of protein substrates which are gripped by loops lining up the central pore of the AAA-ATPase ring. The AAA-ATPases pull on the unfolded polypeptide chain for translocation into the proteolytic cavity of the protease. Conformational changes within the AAA-ATPase ring and the adjacent protease chamber create a peristaltic movement for substrate degradation. The review focuses on new technologies toward the understanding of the function and structure of AAA-ATPases to achieve substrate recognition, unfolding and translocation into proteasomes in yeast and mammalian cells and into proteasome-equivalent proteases in bacteria and archaea.
African Journals Online (AJOL)
Adesope, AAA. Vol 10, No 1 (2010) - Articles Effect of waste water on vegetable production. Abstract PDF · Vol 10, No 1 (2010) - Articles Willingness to pay for safety label on sugar and vegetable oil among households in South – Western Nigeria Abstract PDF · Vol 10, No 2 (2010) - Articles Analysis of physical and chemical ...
International Nuclear Information System (INIS)
Tang, Wai-Kwan; Li, Dongyang; Esser, Lothar; Xia, Di
2009-01-01
Mutations in the human AAA+ protein p97 cause a disease in humans called IBMPFD. How these mutations affect the structure and function of p97 is unknown. Here, the crystallization of three disease-related mutants of p97 in the presence of ATPγS are reported. The human type II AAA+ protein p97 participates in various cellular activities, presumably through its involvement in the ubiquitin–proteasome degradation pathway. Mutations in p97 have been implicated in patients with inclusion-body myopathy associated with Paget’s disease of the bone and frontotemporal dementia (IBMPFD). In this work, three mutant p97 N-D1 fragments, R86A, R95G and R155H, were crystallized in the presence of ATPγS with PEG 3350 as a main precipitant, yielding two different crystal forms. The R155H mutant crystal belonged to space group R3, with unit-cell parameters in the hexagonal setting of a = b = 134.2, c = 182.9 Å, and was merohedrally twinned, with an estimated twin fraction of 0.34. The crystals of the R86A and R95G mutants belonged to space group P1, with similar unit-cell parameters of a = 90.89, b = 102.6, c = 107.2 Å, α = 97.5, β = 90.6, γ = 91.5° and a = 92.76, b = 103.7, c = 107.7 Å, α = 97.7, β = 91.9, γ = 89.7°, respectively
LMIP/AAA: Local Authentication, Authorization and Accounting (AAA) Protocol for Mobile IP
Chenait, Manel
Mobile IP represents a simple and scalable global mobility solution. However, it inhibits various vulnerabilities to malicious attacks and, therefore, requires the integration of appropriate security services. In this paper, we discuss two authentication schemes suggested for Mobile IP: standard authentication and Mobile IP/AAA authentication. In order to provide Mobile IP roaming services including identity verication, we propose an improvement to Mobile/AAA authentication scheme by applying a local politic key management in each domain, hence we reduce hando latency by avoiding the involvement of AAA infrastructure during mobile node roaming.
Cell lineage of timed cohorts of Tbx6-expressing cells in wild-type and Tbx6 mutant embryos
Directory of Open Access Journals (Sweden)
Daniel Concepcion
2017-07-01
Full Text Available Tbx6 is a T-box transcription factor with multiple roles in embryonic development as evidenced by dramatic effects on mesoderm cell fate determination, left/right axis determination, and somite segmentation in mutant mice. The expression of Tbx6 is restricted to the primitive streak and presomitic mesoderm, but some of the phenotypic features of mutants are not easily explained by this expression pattern. We have used genetically-inducible fate mapping to trace the fate of Tbx6-expressing cells in wild-type and mutant embryos to explain some of the puzzling features of the mutant phenotype. We created an inducible Tbx6-creERT2 transgenic mouse in which cre expression closely recapitulates endogenous Tbx6 expression both temporally and spatially. Using a lacZ-based Cre reporter and timed tamoxifen injections, we followed temporally overlapping cohorts of cells that had expressed Tbx6 and found contributions to virtually all mesodermally-derived embryonic structures as well as the extraembryonic allantois. Contribution to the endothelium of major blood vessels may account for the embryonic death of homozygous mutant embryos. In mutant embryos, Tbx6-creERT2-traced cells contributed to the abnormally segmented anterior somites and formed the characteristic ectopic neural tubes. Retention of cells in the mutant tail bud indicates a deficiency in migratory behavior of the mutant cells and the presence of Tbx6-creERT2-traced cells in the notochord, a node derivative provides a possible explanation for the heterotaxia seen in mutant embryos.
Xu, Xuewen; Ji, Jing; Xu, Qiang; Qi, Xiaohua; Weng, Yiqun; Chen, Xuehao
2018-03-01
In plants, the formation of hypocotyl-derived adventitious roots (ARs) is an important morphological acclimation to waterlogging stress; however, its genetic basis remains fragmentary. Here, through combined use of bulked segregant analysis-based whole-genome sequencing, SNP haplotyping and fine genetic mapping, we identified a candidate gene for a major-effect QTL, ARN6.1, that was responsible for waterlogging tolerance due to increased AR formation in the cucumber line Zaoer-N. Through multiple lines of evidence, we show that CsARN6.1 is the most possible candidate for ARN6.1 which encodes an AAA ATPase. The increased formation of ARs under waterlogging in Zaoer-N could be attributed to a non-synonymous SNP in the coiled-coil domain region of this gene. CsARN6.1 increases the number of ARs via its ATPase activity. Ectopic expression of CsARN6.1 in Arabidopsis resulted in better rooting ability and lateral root development in transgenic plants. Transgenic cucumber expressing the CsARN6.1 Asp allele from Zaoer-N exhibited a significant increase in number of ARs compared with the wild type expressing the allele from Pepino under waterlogging conditions. Taken together, these data support that the AAA ATPase gene CsARN6.1 has an important role in increasing cucumber AR formation and waterlogging tolerance. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Persistent type II endoleak after EVAR: the predictive value of the AAA thrombus volume.
Gallitto, Enrico; Gargiulo, Mauro; Mascoli, Chiara; Freyrie, Antonio; DE Matteis, Massimo; Serra, Carla; Bianchini Massoni, Claudio; Faggioli, Gianluca; Stella, Andrea
2018-02-01
Persistent type II endoleaks (ELIIp, ≥6 months) after an endovascular aneurysm repair (EVAR) can be associated with adverse outcomes. The aims of this study are the evaluation of the incidence of ELIIp, their preoperative morphological predictive features (PMF) and the post-EVAR abdominal aortic aneurysm (AAA) evolution in the presence of ELIIp. Patients underwent EVAR between 2008 and 2010 were prospectively collected. Cases with ELIIp (group A: AG) were identified. A control group without ELIIp (group B: BG), homogeneous for clinical characteristics, follow-up timing and methods (CTA and/or CEUS at 6.12 months and yearly thereafter) was retrospectively selected. The PMF evaluated by computed-tomography-angiography (CTA) were: AAA-diameter, number and diameter of AAA efferent patent vessels (EPV), AAA-total volume (TV), AAA-thrombus volume (THV) and TV/THV rate (%VR). Volumes were calculated by the dedicated vessels analysis software. AG and BG were compared. The primary endpoint was to evaluate the incidence of ELIIp. Secondary endpoints were to analyze the relation between PMF and ELIIp and to assess the post-EVAR AAA-evolution in the presence of ELIIp. Between 2008 and 2010, 200 patients underwent EVAR to treat AAA electively. An ELIIp was detected in 35cases (17.5%) (AG). Twenty-seven patients (13.5%) were included in BG. An overall of 62 patients (GA+GB) were analyzed. The mean pre-operative AAA diameter and EPV were 58±11.6 mm and 5.5±1.8 mm, respectively. The mean TV and THV were 187±111.5 cc and 82±75 cc, respectively. The median %VR was 42.3%. ELIIp was correlated to EPV≥6 (χ2, p=.015) and %VR AAA growth post-EVAR. ELIIp is a not rare complication and it could require re-interventions. Our data suggest that VEP≥6 or %VT<40% are risk factors for ELIIp. No PMF was able to predict the ELIIp evolution. The relative high rate of re-interventions, could suggest the need of adjunctive/preventing primary procedures in patients at high-risk for ELIIp.
Corrado, Giovanni; Durante, Alessandro; Genchi, Vincenzo; Trabattoni, Loris; Beretta, Sandro; Rovelli, Enza; Foglia-Manzillo, Giovanni; Ferrari, Giovanni
2016-08-01
The prognosis for abdominal aortic aneurysm (AAA) rupture is poor. Long-term follow-up of population-based randomized trials has demonstrated that ultrasound (US) screening for abdominal aortic aneurysms (AAAs) measuring 3 cm or greater decreases AAA-related mortality rates and is cost-effective. We though to prospectively perform during a 26-month period a limited US examination of the infrarenal aorta in volunteers of both gender aged 60-85 years without history of AAA living in the area of Como, Italy. From September 2010 to November 2013 ComoCuore, a no-profit nongovernmental association, enrolled 1555 people (aged 68.8 ± 6.8 years; 48.6 % males). Clinical data and a US imaging of the aorta were collected for each participant. AAA was found in 22 volunteers (1.4 %) mainly males (2.5 % in males vs. 0.4 % in females p = 0.005). Overall, the prevalence of cardiovascular risk factors was higher in patients with vs. without AAA (mean 2.9 ± 3.0 vs. 1.4 ± 1.0 respectively, p AAA on multivariate analysis were age (OR 1.14, 1.06-1.22; p AAA in a large cohort of asymptomatic people. Independent predictors of AAA were male sex, older age and a history of smoking. Accordingly to recent data the prevalence of AAA seems to be declining, maybe due to a reduction of smoking in Italy.
Effects of doping and bias voltage on the screening in AAA-stacked trilayer graphene
Mohammadi, Yawar; Moradian, Rostam; Shirzadi Tabar, Farzad
2014-09-01
We calculate the static polarization of AAA-stacked trilayer graphene (TLG) and study its screening properties within the random phase approximation (RPA) in all undoped, doped and biased regimes. We find that the static polarization of undoped AAA-stacked TLG is a combination of the doped and undoped single-layer graphene static polarization. This leads to an enhancement of the dielectric background constant along a Thomas-Fermi screening with the Thomas-Fermi wave vector which is independent of carrier concentrations and a 1/r3 power law decay for the long-distance behavior of the screened Coulomb potential. We show that effects of a bias voltage can be taken into account by a renormalization of the interlayer hopping energy to a new bias-voltage-dependent value, indicating screening properties of AAA-stacked TLG can be tuned electrically. We also find that screening properties of doped AAA-stacked TLG, when μ exceeds √{2}γ, are similar to that of doped SLG only depending on doping. While for μ<√{2}γ, its screening properties are combination of SLG and AA-stacked bilayer graphene screening properties and they are determined by doping and the interlayer hopping energy.
Role of AAA(+)-proteins in peroxisome biogenesis and function.
Grimm, Immanuel; Erdmann, Ralf; Girzalsky, Wolfgang
2016-05-01
Mutations in the PEX1 gene, which encodes a protein required for peroxisome biogenesis, are the most common cause of the Zellweger spectrum diseases. The recognition that Pex1p shares a conserved ATP-binding domain with p97 and NSF led to the discovery of the extended family of AAA+-type ATPases. So far, four AAA+-type ATPases are related to peroxisome function. Pex6p functions together with Pex1p in peroxisome biogenesis, ATAD1/Msp1p plays a role in membrane protein targeting and a member of the Lon-family of proteases is associated with peroxisomal quality control. This review summarizes the current knowledge on the AAA+-proteins involved in peroxisome biogenesis and function.
International Nuclear Information System (INIS)
Davis, Freddie; Dixon, Cathy
2002-01-01
The AAA University Fellowship Program (AAA-UFP) was developed by the Amarillo National Research Center (ANRC) in fiscal year 2001 for The Department of Energy, Office of Nuclear Energy, Science, and Technology (NE), Office of Advanced Accelerator Applications (AAA). The AAA-UFP provides financial support for science and engineering students to pursue master's degrees in areas that support the AAA Program. Each fellow's thesis research must relate to the AAA program and must be approved by the Department of Energy. ANRC manages the AAA-UFP program and managed the solicitation in an open and competitive process, resulting in the award of 10 fellowships. This paper discusses the process, the response, results and recommendations for subsequent program years. (authors)
Improved Resident Adherence to AAA Screening Guidelines via an Electronic Reminder.
Sypert, David; Van Dyke, Kenneth; Dhillon, Namrata; Elliott, John O; Jordan, Kim
The 2014 United States Preventive Services Task Force systematic review found abdominal aortic aneurysm (AAA) screening decreased related mortality by close to half. Despite the simplicity of screening, research suggests poor adherence to the recommended AAA screening guidelines. Using the quality improvement plan-study-do-act cycle, we retrospectively established poor adherence to AAA screening and poor documentation of smoking history in our resident clinic. An electronic reminder was prospectively implemented into our electronic medical record (EMR) with the goal of improving screening rates. After 1 year, a retrospective chart review was conducted. Comparisons of the pre- and post-electronic reminder intervention data were made using chi-square tests and odds ratios (OR). The purposeful AAA screening rate improved 27.8% during the intervention, 40.3% (95% confidence interval [CI]: 28.6-52.0%) versus 12.5% (95% CI: 3.1-21.9%), p = .002, suggesting patients were more likely to be screened as a result of the electronic reminder, OR = 4.73 (95% CI: 1.77-12.65). This improvement translates to a large effect size, Cohen's d = 0.86 (95% CI: 0.31-1.40). Electronic reminders are a simple EMR addition that can provide evidence-based education while improving adherence rates with preventive health screening measures.
Functional characterization of fidgetin, an AAA-family protein mutated in fidget mice
International Nuclear Information System (INIS)
Yang Yan; Mahaffey, Connie L.; Berube, Nathalie; Nystuen, Arne; Frankel, Wayne N.
2005-01-01
The mouse fidget mutation is an autosomal recessive mutation that renders reduced or absent semicircular canals, microphthalmia, and various skeletal abnormalities to affected mice. We previously identified the defective gene which encodes fidgetin, a new member of the ATPases associated with diverse cellular activities (AAA proteins). Here, we report on the subcellular localization of fidgetin as well as that of two closely related proteins, fidgetin-like 1 and fidgetin-like 2. Epitope-tagging and immunostaining revealed that both fidgetin and fidgetin-like 2 were predominantly localized to the nucleus, whereas fidgetin-like 1 was both nuclear and cytoplasmic. Furthermore, deletion studies identified a putative bipartite nuclear localization signal in the middle portion of the fidgetin protein. Since AAA proteins are known to form functional hetero- or homo-hexamers, we used reciprocal immunoprecipitation to examine the potential interaction among these proteins. We found that fidgetin interacted with itself and this specific interaction was abolished when either the N- or C-terminus of the protein was truncated. Taken together, our results suggest that fidgetin is a nuclear AAA-family protein with the potential to form homo-oligomers, thus representing the first step towards the elucidation of fidgetin's cellular function and the disease mechanism in fidget mutant mice
Multifunctional Mitochondrial AAA Proteases.
Glynn, Steven E
2017-01-01
Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle.
Carroni, Marta; Franke, Kamila B; Maurer, Michael; Jäger, Jasmin; Hantke, Ingo; Gloge, Felix; Linder, Daniela; Gremer, Sebastian; Turgay, Kürşad; Bukau, Bernd; Mogk, Axel
2017-11-22
Ring-forming AAA+ chaperones exert ATP-fueled substrate unfolding by threading through a central pore. This activity is potentially harmful requiring mechanisms for tight repression and substrate-specific activation. The AAA+ chaperone ClpC with the peptidase ClpP forms a bacterial protease essential to virulence and stress resistance. The adaptor MecA activates ClpC by targeting substrates and stimulating ClpC ATPase activity. We show how ClpC is repressed in its ground state by determining ClpC cryo-EM structures with and without MecA. ClpC forms large two-helical assemblies that associate via head-to-head contacts between coiled-coil middle domains (MDs). MecA converts this resting state to an active planar ring structure by binding to MD interaction sites. Loss of ClpC repression in MD mutants causes constitutive activation and severe cellular toxicity. These findings unravel an unexpected regulatory concept executed by coiled-coil MDs to tightly control AAA+ chaperone activity.
Kolodziejczak, Marta; Skibior-Blaszczyk, Renata; Janska, Hanna
2018-05-01
For optimal mitochondrial activity, the mitochondrial proteome must be properly maintained or altered in response to developmental and environmental stimuli. Based on studies of yeast and humans, one of the key players in this control are m-AAA proteases, mitochondrial inner membrane-bound ATP-dependent metalloenzymes. This study focuses on the importance of m-AAA proteases in plant mitochondria, providing their first experimentally proven physiological substrate. We found that the Arabidopsis m- AAA complexes composed of AtFTSH3 and/or AtFTSH10 are involved in the proteolytic maturation of ribosomal subunit L32. Consequently, in the double Arabidopsis ftsh3/10 mutant, mitoribosome biogenesis, mitochondrial translation and functionality of OXPHOS (oxidative phosphorylation) complexes are impaired. However, in contrast to their mammalian or yeast counterparts, plant m-AAA complexes are not critical for the survival of Arabidopsis under optimal conditions; ftsh3/10 plants are only slightly smaller in size at the early developmental stage compared with plants containing m-AAA complexes. Our data suggest that a lack of significant visible morphological alterations under optimal growth conditions involves mechanisms which rely on existing functional redundancy and induced functional compensation in Arabidopsis mitochondria.
Beneficial effect of statins on total mortality in abdominal aortic aneurysm (AAA) repair.
Mathisen, Sven Ross; Abdelnoor, Michael
2017-10-01
In this single center, retrospective cohort study we wished to compare early and total mortality for all patients treated for abdominal aortic aneurysms (AAA) with open surgery who were taking statins compared to those who were not. A cohort of 640 patients with AAA was treated with open surgery between 1999 and 2012. Patients were consecutively recruited from a source population of 390,000; 21.3% were female, and the median age was 73 years. The median follow-up was 3.93 years, with an interquartile range of 1.79-6.58 years. The total follow-up was 2855 patient-years. An explanatory strategy was used. The propensity score (PS) was implemented to control for selection bias and confounders. The crude effect of statin use showed a 78% reduction of the 30-day mortality. A stratified analysis using the Mantel-Haenszel method on quintiles of the PS gave an adjusted effect of the odds ratio equal to 0.43 (95% CI: 0.18-0.96), indicating a 57% reduction of the 30-day mortality for statin users. The adjusted rate ratio was 0.62 (95% CI: 0.45-0.83), indicating a reduction of long-term mortality of 38% for statin users compared to non-users for a median follow-up of 3.93 years. This retrospective cohort study showed a significant beneficial effect of statin use on early and long-term survival for patients treated with open surgery. To be conclusive, our results need to be replicated by a randomized clinical trial.
Africa Agribusiness Academy (AAA) Year Report 2014
Nijhoff, G.H.; Vugt, van S.M.
2015-01-01
The Africa Agribusiness Academy (AAA) supports African SME agrifood companies in growing their business. An AAA member companies can enhance knowledge, skills and expertise, and get support in accessing finance and markets. By the end of 2014, AAA had 200 members in five countries: Tanzania, Kenya,
Pratesi, Giovanni; Pratesi, Carlo; Chiesa, Roberto; Coppi, Gioacchino; Scheinert, Dierk; Brunkwall, Jan S; van der Meulen, Stefaan; Torsello, Giovanni
2017-10-01
This paper reports the 4-year safety and effectiveness of the INCRAFT® AAA Stent-Graft System (Cordis Corp., Milpitas, CA, USA), an ultra-low-profile device for the treatment of abdominal aortic aneurysms. The INNOVATION Trial is the prospective, first-in-human, multicenter trial to evaluate the safety and effectiveness of the INCRAFT® System. Patients underwent annual clinical and computed tomography angiography examination as part of the study protocol. The INCRAFT® AAA Stent-Graft System is a customizable tri-modular design, with an ultra-low profile (14-Fr) delivery system. Patient were treated under approved protocol, the prescribed clinical and imaging follow-up at annually through 5 years. Results analyzed and adjudicated by a clinical events committee, independent core laboratory, and a data safety and monitoring board. This manuscript reports results through 4 years of follow-up. A total of 60 patients were enrolled in the trial, all of whom were successfully treated. Follow-up rates at 1 and 4 years were 93% (56/60) and 85% (51/60), respectively. All-cause mortality at 4 years was 17.6% and no death was AAA-, device-, or procedure-related. The secondary reintervention rate at 1 year was 4.6%, primarily the result of stent thrombosis. In total, 10 patients required 13 post-procedure interventions within 4-years of follow-up (2 to repair a type I endoleak, 4 to repair a type II endoleak, 1 for stent thrombosis, 1 for renal stenosis, 1 for aneurysm enlargement, 2 for limb migration and 2 for prosthesis stenosis or occlusion). There were 4 cases (10%) of aneurysm enlargement reported at the 4 year follow-up. At 4 years, 38 out of 39 patients were free from type I and III endoleaks. There were no proximal type I or type III endoleaks at 4-year follow-up. Core laboratory evaluation of the postoperative imaging studies indicated absence of endograft migration while a single fracture was demonstrated without any clinical sequelae. The INCRAFT® AAA Stent
Lifescience Database Archive (English)
Full Text Available AAAAACTAGTAATTTAAAAAAAAA AAAAACCAAAAAAAAAAXXXXXXXXXXATGATGTCGAATGTCCANATTTCCATANA...seq. 137 3' end seq. ID SFE484Z 3' end seq. >SFE484Z.Seq ----------ATGATGTCGAATGTCCANATTTCCATANATGTGTTTAAANA...AACTAGTAATTTAAAAAAAAA AAAAACCAAAAAAAAAA----------ATGATGTCGAATGTCCANATTTCCATANATGTG TTTAAANACGTGGNGGNATCTTAAG
42 CFR 441.484 - Financial management services.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Financial management services. 441.484 Section 441... Optional Self-Directed Personal Assistance Services Program § 441.484 Financial management services. (a) States may choose to provide financial management services to participants, or their representatives, as...
Toghill, Bradley J; Saratzis, Athanasios; Freeman, Peter J; Sylvius, Nicolas; Bown, Matthew J
2018-01-01
Abdominal aortic aneurysm (AAA) is a deadly cardiovascular disease characterised by the gradual, irreversible dilation of the abdominal aorta. AAA is a complex genetic disease but little is known about the role of epigenetics. Our objective was to determine if global DNA methylation and CpG-specific methylation at known AAA risk loci is associated with AAA, and the functional effects of methylation changes. We assessed global methylation in peripheral blood mononuclear cell DNA from 92 individuals with AAA and 93 controls using enzyme-linked immunosorbent assays, identifying hyper-methylation in those with large AAA and a positive linear association with AAA diameter ( P AAA risk loci identified in genome-wide association studies, using bisulphite next-generation sequencing (NGS) in vascular smooth muscle cells (VSMCs) taken from aortic tissues of 44 individuals (24 AAAs and 20 controls). In IL6R , 2 CpGs were hyper-methylated ( P = 0.0145); in ERG , 13 CpGs were hyper-methylated ( P = 0.0005); in SERPINB9 , 6 CpGs were hypo-methylated ( P = 0.0037) and 1 CpG was hyper-methylated ( P = 0.0098); and in SMYD2 , 4 CpGs were hypo-methylated ( P = 0.0012).RT-qPCR was performed for each differentially methylated gene on mRNA from the same VSMCs and compared with methylation. This analysis revealed downregulation of SMYD2 and SERPINB9 in AAA, and a direct linear relationship between SMYD2 promoter methylation and SMYD2 expression ( P = 0.038). Furthermore, downregulation of SMYD2 at the site of aneurysm in the aortic wall was further corroborated in 6 of the same samples used for methylation and gene expression analysis with immunohistochemistry. This study is the first to assess DNA methylation in VSMCs from individuals with AAA using NGS, and provides further evidence there is an epigenetic basis to AAA. Our study shows that methylation status of the SMYD2 promoter may be linked with decreased SMYD2 expression in disease pathobiology. In
International Nuclear Information System (INIS)
Kitagawa, Atsushi; Okita, Yutaka; Okada, Kenji
2009-01-01
Since 2007, the EVAR (endovascular abdominal aortic repair) grafts, Zenith, Excluder and Powerlink had been commercially available in Japan. However, a small iliac artery, typical of Japanese population especially in women, was a limiting factor to indicate EVAR. We analyzed the suitability of EVAR in Japanese population according to the inclusion criteria of Zenith AAA stent graft in the current study. From January 2006 to December 2007, 106 AAA (abdominal aortic aneurysm) patients (88 men, 18 women) with a mean age of 73 years were investigated in our institution by multi-slice CT scan in terms of suitability of EVAR, then we measured their abdominal aorta and iliac artery parameters as follows; proximal neck diameter (PND) and length (PNL), common iliac artery diameter (CIAD) and length (CIAL), suprarenal (SNA) and infrarenal neck angulation (INA), external iliac artery diameter (EIAD) and aortic length from the lowest renal artery to the aortic bifurcation (AOL). The inclusion criteria for Zenith AAA stent graft treatment were; PND: 18-28 mm, PNL more than 15 mm, unilateral CIAD less than 20 mm, CIAL at least 10 mm, SNA less than 45 degree and INA less than 60 degree, unilateral EIAD more than 7.5 mm. The indication of EVAR was 25.5% (27/106 patients), and was especially very low in women (5.6%) strictly according to the inclusion criteria of the Zenith AAA stent graft. The main reason of exclusion of EVAR was proximal short neck (40.5%), small iliac artery (30.4%) and infrarenal aortic neck angulation (29.1%). In our analysis, female AAA patients had small PNL and EIAD with angulated neck compared with male AAA ones. Anatomical suitability of EVAR in Japanese population strictly following by the inclusion criteria of Zenith AAA stent graft was low due to their characteristic differences from the European Union (EU) and the United States (US) patients, such as short proximal neck, steep neck angulation and small iliac artery, especially in women. More flexible
Khashram, M; Jones, G T; Roake, J A
2015-08-01
There is compelling level 1 evidence in support of screening men for abdominal aortic aneurysm (AAA) to reduce AAA mortality. However, New Zealand (NZ) lacks data on AAA prevalence, and national screening has not been implemented. The aim of this study was to determine the prevalence of AAA in a population undergoing a computed tomography colonography (CTC) for gastrointestinal symptoms. This was an observational study; all consecutive CTCs performed in three regions of the South Island of NZ over a 4 year period were reviewed. Data on abdominal and thoracic aorta diameters ≥30 mm, and iliac and femoral aneurysms ≥20 mm were recorded. Previous aortic surgical grafts or endovascular stents were also documented. Demographics, survival, and AAA related outcomes were collected and used for analysis. Included were 4,893 scans on 4,644 patients (1,933 men [41.6%], 2,711 women [58.4%]) with a median age of 69.3 years (range 17.0-97.0 years). There were 309 scans on 289 patients (75.4% men) who had either an aneurysm or a previous aortic graft with a median age of 79.6 years (range 57.0-96.0 years). Of these, 223 had a native AAA ≥30 mm. The prevalence of AAA rose with age from 1.3% in men aged 55-64 years, to 9.1% in 65-74 year olds, 16.8% in 75-84 year olds, and 22.0% in ≥85 year olds. The corresponding figures in women were 0.4%, 2%, 3.9%, and 6.2%, respectively. In this observational study, the prevalence of AAA was high and warrants further evaluation. The results acquired help to define a population that may benefit from a national AAA screening programme. Copyright © 2015 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
Kloster, Brian O; Lund, Lars; Lindholt, Jes S
2016-05-01
The vast majority of abdominal aortic aneurysms found in screening programs are small, and as no effective treatment exits, many will expand until surgery is indicated. Therefore, it remains intriguing to develop a safe and low cost treatment of these small aneurysms, that is able to prevent or delay their expansion. In this study, we investigated whether intraluminal delivered pentagalloyl glucose (PGG) can impair the early AAA development in a porcine model. The infrarenal aorta was exposed in thirty pigs. Twenty underwent an elastase based AAA inducing procedure and ten of these received an additional intraluminal PGG infusion. The final 10 were sham operated and served as controls. All pigs who only had an elastase infusion developed macroscopically expanding AAAs. In pigs treated with an additional PGG infusion the growth rate of the AP-diameter rapidly returned to physiological values as seen in the control group. In the elastase group, histology revealed more or less complete resolution of the elastic lamellae in the media while they were more abundant, coherent and structurally organized in the PGG group. The control group displayed normal physiological growth and histology. In our model, intraluminal delivered PGG is able to penetrate the aortic wall from the inside and impair the early AAA development by stabilizing the elastic lamellae and preserving their integrity. The principle holds a high clinical potential if it can be translated to human conditions, since it, if so, potentially could represent a new drug for stabilizing small abdominal aneurysms.
Structural Elements Regulating AAA+ Protein Quality Control Machines.
Chang, Chiung-Wen; Lee, Sukyeong; Tsai, Francis T F
2017-01-01
Members of the ATPases Associated with various cellular Activities (AAA+) superfamily participate in essential and diverse cellular pathways in all kingdoms of life by harnessing the energy of ATP binding and hydrolysis to drive their biological functions. Although most AAA+ proteins share a ring-shaped architecture, AAA+ proteins have evolved distinct structural elements that are fine-tuned to their specific functions. A central question in the field is how ATP binding and hydrolysis are coupled to substrate translocation through the central channel of ring-forming AAA+ proteins. In this mini-review, we will discuss structural elements present in AAA+ proteins involved in protein quality control, drawing similarities to their known role in substrate interaction by AAA+ proteins involved in DNA translocation. Elements to be discussed include the pore loop-1, the Inter-Subunit Signaling (ISS) motif, and the Pre-Sensor I insert (PS-I) motif. Lastly, we will summarize our current understanding on the inter-relationship of those structural elements and propose a model how ATP binding and hydrolysis might be coupled to polypeptide translocation in protein quality control machines.
DEFF Research Database (Denmark)
Kloster, Brian O; Lund, Lars; Lindholt, Jes S
2016-01-01
to prevent or delay their expansion. In this study, we investigated whether intraluminal delivered pentagalloyl glucose (PGG) can impair the early AAA development in a porcine model. METHODS: The infrarenal aorta was exposed in thirty pigs. Twenty underwent an elastase based AAA inducing procedure and ten...... of these received an additional intraluminal PGG infusion. The final 10 were sham operated and served as controls. RESULTS: All pigs who only had an elastase infusion developed macroscopically expanding AAAs. In pigs treated with an additional PGG infusion the growth rate of the AP-diameter rapidly returned...... and histology. CONCLUSION: In our model, intraluminal delivered PGG is able to penetrate the aortic wall from the inside and impair the early AAA development by stabilizing the elastic lamellae and preserving their integrity. The principle holds a high clinical potential if it can be translated to human...
2010-10-01
... AND CERTIFICATION HOME HEALTH SERVICES Prospective Payment System for Home Health Agencies § 484.202... resource intensity among different groups in the clinical model. Discipline means one of the six home...
Dosimetric comparison of Acuros XB, AAA, and XVMC in stereotactic body radiotherapy for lung cancer
International Nuclear Information System (INIS)
Tsuruta, Yusuke; Nakata, Manabu; Higashimura, Kyoji; Nakamura, Mitsuhiro; Matsuo, Yukinori; Monzen, Hajime; Mizowaki, Takashi; Hiraoka, Masahiro
2014-01-01
Purpose: To compare the dosimetric performance of Acuros XB (AXB), anisotropic analytical algorithm (AAA), and x-ray voxel Monte Carlo (XVMC) in heterogeneous phantoms and lung stereotactic body radiotherapy (SBRT) plans. Methods: Water- and lung-equivalent phantoms were combined to evaluate the percentage depth dose and dose profile. The radiation treatment machine Novalis (BrainLab AG, Feldkirchen, Germany) with an x-ray beam energy of 6 MV was used to calculate the doses in the composite phantom at a source-to-surface distance of 100 cm with a gantry angle of 0°. Subsequently, the clinical lung SBRT plans for the 26 consecutive patients were transferred from the iPlan (ver. 4.1; BrainLab AG) to the Eclipse treatment planning systems (ver. 11.0.3; Varian Medical Systems, Palo Alto, CA). The doses were then recalculated with AXB and AAA while maintaining the XVMC-calculated monitor units and beam arrangement. Then the dose-volumetric data obtained using the three different radiation dose calculation algorithms were compared. Results: The results from AXB and XVMC agreed with measurements within ±3.0% for the lung-equivalent phantom with a 6 × 6 cm 2 field size, whereas AAA values were higher than measurements in the heterogeneous zone and near the boundary, with the greatest difference being 4.1%. AXB and XVMC agreed well with measurements in terms of the profile shape at the boundary of the heterogeneous zone. For the lung SBRT plans, AXB yielded lower values than XVMC in terms of the maximum doses of ITV and PTV; however, the differences were within ±3.0%. In addition to the dose-volumetric data, the dose distribution analysis showed that AXB yielded dose distribution calculations that were closer to those with XVMC than did AAA. Means ± standard deviation of the computation time was 221.6 ± 53.1 s (range, 124–358 s), 66.1 ± 16.0 s (range, 42–94 s), and 6.7 ± 1.1 s (range, 5–9 s) for XVMC, AXB, and AAA, respectively. Conclusions: In the phantom
Dosimetric comparison of Acuros XB, AAA, and XVMC in stereotactic body radiotherapy for lung cancer.
Tsuruta, Yusuke; Nakata, Manabu; Nakamura, Mitsuhiro; Matsuo, Yukinori; Higashimura, Kyoji; Monzen, Hajime; Mizowaki, Takashi; Hiraoka, Masahiro
2014-08-01
To compare the dosimetric performance of Acuros XB (AXB), anisotropic analytical algorithm (AAA), and x-ray voxel Monte Carlo (XVMC) in heterogeneous phantoms and lung stereotactic body radiotherapy (SBRT) plans. Water- and lung-equivalent phantoms were combined to evaluate the percentage depth dose and dose profile. The radiation treatment machine Novalis (BrainLab AG, Feldkirchen, Germany) with an x-ray beam energy of 6 MV was used to calculate the doses in the composite phantom at a source-to-surface distance of 100 cm with a gantry angle of 0°. Subsequently, the clinical lung SBRT plans for the 26 consecutive patients were transferred from the iPlan (ver. 4.1; BrainLab AG) to the Eclipse treatment planning systems (ver. 11.0.3; Varian Medical Systems, Palo Alto, CA). The doses were then recalculated with AXB and AAA while maintaining the XVMC-calculated monitor units and beam arrangement. Then the dose-volumetric data obtained using the three different radiation dose calculation algorithms were compared. The results from AXB and XVMC agreed with measurements within ± 3.0% for the lung-equivalent phantom with a 6 × 6 cm(2) field size, whereas AAA values were higher than measurements in the heterogeneous zone and near the boundary, with the greatest difference being 4.1%. AXB and XVMC agreed well with measurements in terms of the profile shape at the boundary of the heterogeneous zone. For the lung SBRT plans, AXB yielded lower values than XVMC in terms of the maximum doses of ITV and PTV; however, the differences were within ± 3.0%. In addition to the dose-volumetric data, the dose distribution analysis showed that AXB yielded dose distribution calculations that were closer to those with XVMC than did AAA. Means ± standard deviation of the computation time was 221.6 ± 53.1 s (range, 124-358 s), 66.1 ± 16.0 s (range, 42-94 s), and 6.7 ± 1.1 s (range, 5-9 s) for XVMC, AXB, and AAA, respectively. In the phantom evaluations, AXB and XVMC agreed better with
26 CFR 1.1368-2 - Accumulated adjustments account (AAA).
2010-04-01
... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Accumulated adjustments account (AAA). 1.1368-2... adjustments account (AAA). (a) Accumulated adjustments account—(1) In general. The accumulated adjustments account is an account of the S corporation and is not apportioned among shareholders. The AAA is relevant...
Structure of Lmaj006129AAA, a hypothetical protein from Leishmania major
International Nuclear Information System (INIS)
Arakaki, Tracy; Le Trong, Isolde; Phizicky, Eric; Quartley, Erin; DeTitta, George; Luft, Joseph; Lauricella, Angela; Anderson, Lori; Kalyuzhniy, Oleksandr; Worthey, Elizabeth; Myler, Peter J.; Kim, David; Baker, David; Hol, Wim G. J.; Merritt, Ethan A.
2006-01-01
The crystal structure of a conserved hypothetical protein from L. major, Pfam sequence family PF04543, structural genomics target ID Lmaj006129AAA, has been determined at a resolution of 1.6 Å. The gene product of structural genomics target Lmaj006129 from Leishmania major codes for a 164-residue protein of unknown function. When SeMet expression of the full-length gene product failed, several truncation variants were created with the aid of Ginzu, a domain-prediction method. 11 truncations were selected for expression, purification and crystallization based upon secondary-structure elements and disorder. The structure of one of these variants, Lmaj006129AAH, was solved by multiple-wavelength anomalous diffraction (MAD) using ELVES, an automatic protein crystal structure-determination system. This model was then successfully used as a molecular-replacement probe for the parent full-length target, Lmaj006129AAA. The final structure of Lmaj006129AAA was refined to an R value of 0.185 (R free = 0.229) at 1.60 Å resolution. Structure and sequence comparisons based on Lmaj006129AAA suggest that proteins belonging to Pfam sequence families PF04543 and PF01878 may share a common ligand-binding motif
International Nuclear Information System (INIS)
Kutle, A.; Orescanin, V.; Obhodas, J.; Valkovic, V.
2004-01-01
Samples of soil, plant material and water collected on the Croatian island Krk in northern Adriatic sea were analyzed for a number of elements (Ca, Ti, Mn, Fe, Ni, Cu, Zn, As, Br, Rb, Sr, Zr, Pb) by using energy dispersive X-ray fluorescence (EDXRF) as an analytical tool. Some of these data have been previously used to produce geochemical map of the island. In addition, trace element contents of hair from children, attending elementary and secondary schools, has been investigated using the same analytical method for Mg, S, Ca, Cr, Mn, Fe, Ni, Cu, Zn, As, Hg and Pb elements. Concentrations of the twelve elements and nine variables from the questionnaire, i.e., age, sex, living place, transportation, medication, hair colour, hair type, type of shampoo used and hair treatment, were considered in the statistical analysis. The observed differences for the seven island's communes have also been discussed. (author)
Protein quality control in organelles - AAA/FtsH story.
Janska, Hanna; Kwasniak, Malgorzata; Szczepanowska, Joanna
2013-02-01
This review focuses on organellar AAA/FtsH proteases, whose proteolytic and chaperone-like activity is a crucial component of the protein quality control systems of mitochondrial and chloroplast membranes. We compare the AAA/FtsH proteases from yeast, mammals and plants. The nature of the complexes formed by AAA/FtsH proteases and the current view on their involvement in degradation of non-native organellar proteins or assembly of membrane complexes are discussed. Additional functions of AAA proteases not directly connected with protein quality control found in yeast and mammals but not yet in plants are also described shortly. Following an overview of the molecular functions of the AAA/FtsH proteases we discuss physiological consequences of their inactivation in yeast, mammals and plants. The molecular basis of phenotypes associated with inactivation of the AAA/FtsH proteases is not fully understood yet, with the notable exception of those observed in m-AAA protease-deficient yeast cells, which are caused by impaired maturation of mitochondrial ribosomal protein. Finally, examples of cytosolic events affecting protein quality control in mitochondria and chloroplasts are given. This article is part of a Special Issue entitled: Protein Import and Quality Control in Mitochondria and Plastids. Copyright © 2012 Elsevier B.V. All rights reserved.
Oostra, R. J.; van Galen, M. J.; Bolhuis, P. A.; Bleeker-Wagemakers, E. M.; van den Bogert, C.
1995-01-01
The electron transfer activity of Complex I of the respiratory chain and Complex I-linked ATP synthesis were investigated in leukocytes of four males affected by Leber hereditary optic neuropathy and a mutation in the ND6 gene at nucleotide position 14,484 of mtDNA. The electron transfer activity in
Dunne, Jonathan A; Bailey, Marc A; Griffin, Kathryn J; Sohrabi, Soroush; Coughlin, Patrick A; Scott, D Julian A
2014-01-01
In the era of Abdominal Aortic Aneurysm (AAA) screening, pharmacotherapies to attenuate AAA growth are sought. HMG Co-A reductase inhibitors (statins) have pleiotropic actions independent of their lipid lowering effects and have been suggested as potential treatment for small AAAs. We systematically review the clinical evidence for this effect. Medline, EMBASE and the Cochrane Central Register of Controlled Trials (1950-2011) were searched for studies reporting data on the role of statin therapy on AAA growth rate. No language restrictions were placed on the search. References of retrieved articles and pertinent journals were hand searched. Included studies were reviewed by 2 independent observers. The search retrieved 164 papers, 100 were irrelevant based on their title, 47 were reviews and 1 was a letter. 8 studies were excluded based on review of their abstract leaving 8 for inclusion in the study. Eight observational clinical studies with a total of 4,466 patients were reviewed. Four studies demonstrated reduced AAA expansion in statin users while 4 studies failed to demonstrate this effect. The method of determining AAA growth rates varied significantly between the studies and the ability of many studies to control for misclassification bias was poor. The claim that statins attenuate AAA growth remains questionable. Further prospective studies with stringent identification and verification of statin usage and a standardised method of estimating AAA growth rates are required. Statin type and dose also merit consideration.
Consolato, Francesco; Maltecca, Francesca; Tulli, Susanna; Sambri, Irene; Casari, Giorgio
2018-04-09
The proteolytic processing of dynamin-like GTPase OPA1, mediated by the activity of both YME1L1 [intermembrane (i)-AAA protease complex] and OMA1, is a crucial step in the regulation of mitochondrial dynamics. OMA1 is a zinc metallopeptidase of the inner mitochondrial membrane that undergoes pre-activating proteolytic and auto-proteolytic cleavage after mitochondrial import. Here, we identify AFG3L2 [matrix (m) - AAA complex] as the major protease mediating this event, which acts by maturing the 60 kDa pre-pro-OMA1 to the 40 kDa pro-OMA1 form by severing the N-terminal portion without recognizing a specific consensus sequence. Therefore, m - AAA and i - AAA complexes coordinately regulate OMA1 processing and turnover, and consequently control which OPA1 isoforms are present, thus adding new information on the molecular mechanisms of mitochondrial dynamics and neurodegenerative diseases affected by these phenomena.This article has an associated First Person interview with the first author of the paper. © 2018. Published by The Company of Biologists Ltd.
NASA Airborne Astronomy Ambassadors (AAA) Professional Development and NASA Connections
Backman, D. E.; Clark, C.; Harman, P. K.
2017-12-01
NASA's Airborne Astronomy Ambassadors (AAA) program is a three-part professional development (PD) experience for high school physics, astronomy, and earth science teachers. AAA PD consists of: (1) blended learning via webinars, asynchronous content learning, and in-person workshops, (2) a STEM immersion experience at NASA Armstrong's B703 science research aircraft facility in Palmdale, California, and (3) ongoing opportunities for connection with NASA astrophysics and planetary science Subject Matter Experts (SMEs). AAA implementation in 2016-18 involves partnerships between the SETI Institute and seven school districts in northern and southern California. AAAs in the current cohort were selected by the school districts based on criteria developed by AAA program staff working with WestEd evaluation consultants. The selected teachers were then randomly assigned by WestEd to a Group A or B to support controlled testing of student learning. Group A completed their PD during January - August 2017, then participated in NASA SOFIA science flights during fall 2017. Group B will act as a control during the 2017-18 school year, then will complete their professional development and SOFIA flights during 2018. A two-week AAA electromagnetic spectrum and multi-wavelength astronomy curriculum aligned with the Science Framework for California Public Schools and Next Generation Science Standards was developed by program staff for classroom delivery. The curriculum (as well as the AAA's pre-flight PD) capitalizes on NASA content by using "science snapshot" case studies regarding astronomy research conducted by SOFIA. AAAs also interact with NASA SMEs during flight weeks and will translate that interaction into classroom content. The AAA program will make controlled measurements of student gains in standards-based learning plus changes in student attitudes towards STEM, and observe & record the AAAs' implementation of curricular changes. Funded by NASA: NNX16AC51
SU-F-T-413: Calculation Accuracy of AAA and Acuros Using Cerrobend Blocks for TBI at 400cm
International Nuclear Information System (INIS)
Lamichhane, N; Studenski, M
2016-01-01
Purpose: It is essential to assess the lung dose during TBI to reduce toxicity. Here we characterize the accuracy of the AAA and Acuros algorithms when using cerrobend lung shielding blocks at an extended distance for TBI. Methods: We positioned a 30×30×30 cm3 solid water slab phantom at 400 cm SSD and measured PDDs (Exradin A12 and PTW parallel plate ion chambers). A 2 cm thick, 10×10 cm2 cerrobend block was hung 2 cm in front of the phantom. This geometry was reproduced in the planning system for both AAA and Acuros. In AAA, the mass density of the cerrobend block was forced to 9.38 g/cm3 and in Acuros it was forced to 8.0 g/cm3 (limited to selecting stainless steel). Three different relative electron densities (RED) were tested for each algorithm; 4.97, 6.97, and 8.97. Results: PDDs from both Acuros and AAA underestimated the delivered dose. AAA calculated that depth dose was higher for RED of 4.97 as compared to 6.97 and 8.97 but still lower than measured. There was no change in the percent depth dose with changing relative electron densities for Acuros. Conclusion: Care should be taken before using AAA or Acuros with cerrobend blocks as the planning system underestimates dose. Acuros limits the ability to modify RED when compared to AAA.
SU-F-T-413: Calculation Accuracy of AAA and Acuros Using Cerrobend Blocks for TBI at 400cm
Energy Technology Data Exchange (ETDEWEB)
Lamichhane, N; Studenski, M [University of Miami, Miami, FL (United States)
2016-06-15
Purpose: It is essential to assess the lung dose during TBI to reduce toxicity. Here we characterize the accuracy of the AAA and Acuros algorithms when using cerrobend lung shielding blocks at an extended distance for TBI. Methods: We positioned a 30×30×30 cm3 solid water slab phantom at 400 cm SSD and measured PDDs (Exradin A12 and PTW parallel plate ion chambers). A 2 cm thick, 10×10 cm2 cerrobend block was hung 2 cm in front of the phantom. This geometry was reproduced in the planning system for both AAA and Acuros. In AAA, the mass density of the cerrobend block was forced to 9.38 g/cm3 and in Acuros it was forced to 8.0 g/cm3 (limited to selecting stainless steel). Three different relative electron densities (RED) were tested for each algorithm; 4.97, 6.97, and 8.97. Results: PDDs from both Acuros and AAA underestimated the delivered dose. AAA calculated that depth dose was higher for RED of 4.97 as compared to 6.97 and 8.97 but still lower than measured. There was no change in the percent depth dose with changing relative electron densities for Acuros. Conclusion: Care should be taken before using AAA or Acuros with cerrobend blocks as the planning system underestimates dose. Acuros limits the ability to modify RED when compared to AAA.
The influence of wall stress on AAA growth and biomarkers
Speelman, L.; Hellenthal, F.A.M.V.I.; Pulinx, B.; Bosboom, E.M.H.; Breeuwer, M.; Sambeek, M.R.; Vosse, van de F.N.; Jacobs, M.J.H.M.; Wodzig, W.K.W.H.; Schurink, G.W.H.
2010-01-01
Objectives This study investigated the relation between abdominal aortic aneurysm (AAA) wall stress, AAA growth rate and biomarker concentrations. With increasing wall stress, more damage may be caused to the AAA wall, possibly leading to progression of the aneurysm and reflection in up- or
No evidence for cardiac dysfunction in Kif6 mutant mice.
Directory of Open Access Journals (Sweden)
Abdul Hameed
Full Text Available A KIF6 variant in man has been reported to be associated with adverse cardiovascular outcomes after myocardial infarction. No clear biological or physiological data exist for Kif6. We sought to investigate the impact of a deleterious KIF6 mutation on cardiac function in mice. Kif6 mutant mice were generated and verified. Cardiac function was assessed by serial echocardiography at baseline, after ageing and after exercise. Lipid levels were also measured. No discernable adverse lipid or cardiac phenotype was detected in Kif6 mutant mice. These data suggest that dysfunction of Kif6 is linked to other more complex biological/biochemical parameters or is unlikely to be of material consequence in cardiac function.
A structural analysis of the AAA+ domains in Saccharomyces cerevisiae cytoplasmic dynein.
Gleave, Emma S; Schmidt, Helgo; Carter, Andrew P
2014-06-01
Dyneins are large protein complexes that act as microtubule based molecular motors. The dynein heavy chain contains a motor domain which is a member of the AAA+ protein family (ATPases Associated with diverse cellular Activities). Proteins of the AAA+ family show a diverse range of functionalities, but share a related core AAA+ domain, which often assembles into hexameric rings. Dynein is unusual because it has all six AAA+ domains linked together, in one long polypeptide. The dynein motor domain generates movement by coupling ATP driven conformational changes in the AAA+ ring to the swing of a motile element called the linker. Dynein binds to its microtubule track via a long antiparallel coiled-coil stalk that emanates from the AAA+ ring. Recently the first high resolution structures of the dynein motor domain were published. Here we provide a detailed structural analysis of the six AAA+ domains using our Saccharomycescerevisiae crystal structure. We describe how structural similarities in the dynein AAA+ domains suggest they share a common evolutionary origin. We analyse how the different AAA+ domains have diverged from each other. We discuss how this is related to the function of dynein as a motor protein and how the AAA+ domains of dynein compare to those of other AAA+ proteins. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Validation of Varian's AAA algorithm with focus on lung treatments
International Nuclear Information System (INIS)
Roende, Heidi S.; Hoffmann, Lone
2009-01-01
The objective of this study was to examine the accuracy of the Anisotropic Analytical Algorithm (AAA). A variety of different field configurations in homogeneous and in inhomogeneous media (lung geometry) was tested for the AAA algorithm. It was also tested against the present Pencil Beam Convolution (PBC) algorithm. Materials and methods. Two dimensional (2D) dose distributions were measured for a variety of different field configurations in solid water with a 2D array of ion chambers. The dose distributions of patient specific treatment plans in selected transversal slices were measured in a Thorax lung phantom with Gafchromic dosimetry films. A Farmer ion chamber was used to check point doses in the Thorax phantom. The 2D dose distributions were evaluated with a gamma criterion of 3% in dose and 3 mm distance to agreement (DTA) for the 2D array measurements and for the film measurements. Results. For AAA, all fields tested in homogeneous media fulfilled the criterion, except asymmetric fields with wedges and intensity modulated plans where deviations of 5 and 4%, respectively, were seen. Overall, the measured and calculated 2D dose distributions for AAA in the Thorax phantom showed good agreement - both for 6 and 15 MV photons. More than 80% of the points in the high dose regions met the gamma criterion, though it failed at low doses and at gradients. For the PBC algorithm only 30-70% of the points met the gamma criterion. Conclusion. The AAA algorithm has been shown to be superior to the PBC algorithm in heterogeneous media, especially for 15 MV. For most treatment plans the deviations in the lung and the mediastinum regions are below 3%. However, the algorithm may underestimate the dose to the spinal cord by up to 7%
Fundamental Characteristics of AAA+ Protein Family Structure and Function.
Miller, Justin M; Enemark, Eric J
2016-01-01
Many complex cellular events depend on multiprotein complexes known as molecular machines to efficiently couple the energy derived from adenosine triphosphate hydrolysis to the generation of mechanical force. Members of the AAA+ ATPase superfamily (ATPases Associated with various cellular Activities) are critical components of many molecular machines. AAA+ proteins are defined by conserved modules that precisely position the active site elements of two adjacent subunits to catalyze ATP hydrolysis. In many cases, AAA+ proteins form a ring structure that translocates a polymeric substrate through the central channel using specialized loops that project into the central channel. We discuss the major features of AAA+ protein structure and function with an emphasis on pivotal aspects elucidated with archaeal proteins.
42 CFR 484.4 - Personnel qualifications.
2010-10-01
... (CONTINUED) STANDARDS AND CERTIFICATION HOME HEALTH SERVICES General Provisions § 484.4 Personnel... baccalaureate degree in social work, psychology, sociology, or other field related to social work, and has had...
Molecular Mechanisms Regulating Ocular Apoptosis in Zebrafish gdf6a Mutants
DEFF Research Database (Denmark)
Pant, Sameer D.; March, Lindsey D.; Famulski, Jakub K.
2013-01-01
intrinsic or extrinsic apoptotic mechanisms were involved, morpholino antisense oligonucleotides targeting baxa, baxb, and p53 were employed. Caspase-3 immunohistochemistry (IHC) was performed to assay apoptosis. Pharmacologic inhibition (using SB203580) and IHC were used to investigate the role of p38...... occurs 28 hours post fertilization (hpf) in gdf6a(-/-) mutants that is mediated independently of p53 by intrinsic mechanisms involving Bax proteins. Also, gdf6a(-/-) mutants exhibit markedly increased p38 MAP kinase activation that can be inhibited to significantly reduce retinal apoptosis. A reduction...... in retinal smad1 expression was also noted in gdf6a(-/-) mutants. CONCLUSIONS. gdf6a(-/-)-induced apoptosis is characterized by the involvement of intrinsic apoptotic pathways, p38 MAP kinases, and dysregulated smad expression. Modulation of key mediators can inhibit retinal apoptosis offering potential...
Assessing heterogeneity in oligomeric AAA+ machines.
Sysoeva, Tatyana A
2017-03-01
ATPases Associated with various cellular Activities (AAA+ ATPases) are molecular motors that use the energy of ATP binding and hydrolysis to remodel their target macromolecules. The majority of these ATPases form ring-shaped hexamers in which the active sites are located at the interfaces between neighboring subunits. Structural changes initiate in an active site and propagate to distant motor parts that interface and reshape the target macromolecules, thereby performing mechanical work. During the functioning cycle, the AAA+ motor transits through multiple distinct states. Ring architecture and placement of the catalytic sites at the intersubunit interfaces allow for a unique level of coordination among subunits of the motor. This in turn results in conformational differences among subunits and overall asymmetry of the motor ring as it functions. To date, a large amount of structural information has been gathered for different AAA+ motors, but even for the most characterized of them only a few structural states are known and the full mechanistic cycle cannot be yet reconstructed. Therefore, the first part of this work will provide a broad overview of what arrangements of AAA+ subunits have been structurally observed focusing on diversity of ATPase oligomeric ensembles and heterogeneity within the ensembles. The second part of this review will concentrate on methods that assess structural and functional heterogeneity among subunits of AAA+ motors, thus bringing us closer to understanding the mechanism of these fascinating molecular motors.
Differential expression of TRAIL and its receptors relative to calcification in AAA
International Nuclear Information System (INIS)
Liu, Xun; Winrow, Vivienne R.; Horrocks, Michael; Stevens, Cliff R.
2007-01-01
Abdominal aortic aneurysm (AAA) is commonly associated with atherosclerosis. Human AAA tissue displays cells undergoing all stages of apoptosis. Tumour necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) induces apoptosis in tumour cells but not in normal cells. It has death receptors and decoy receptors. An inhibitor of TRAIL, osteoprotegerin (OPG), is involved in osteogenesis and vascular calcification. We investigated TRAIL and its receptors in AAA compared within normal aorta (NA). Both qualitative and quantitative analyses of calcification in AAA walls were determined using Von Kossa staining and pre-operation computer tomography (CT) scans. There was a significant difference in calcification level at different locations in the AAA wall (p < 0.05). Apoptosis was confirmed in AAA by TUNEL assay. A significant difference in TRAIL and its receptor expression was observed between normal aortae and AAA (p < 0.05). Significant differences were also observed between tissues displaying different extents of calcification for TRAIL mRNA (p < 0.05) by RT-PCR examination and OPG protein (p < 0.01) by protein blotting examination. We propose that this pattern of expression of TRAIL and its receptors may contribute to AAA formation and calcification in the AAA wall
Gavali, H; Mani, K; Tegler, G; Kawati, R; Covaciu, L; Wanhainen, A
2017-08-01
The aim of the study was to investigate the frequency and outcome of prolonged intensive care unit (ICU) length of stay (LOS) after abdominal aortic aneurysm (AAA) repair in the endovascular era. All patients operated on for AAA between 1999 and 2013 at Uppsala University hospital were identified. Data were retrieved from the Swedish Vascular registry, the Swedish Intensive Care registry, the National Population registry, and case records. Prolonged ICU LOS was defined as ≥ 48 h during the primary hospital stay. Patients surviving ≥ 48 h after AAA surgery were included in the analysis. A total of 725 patients were identified, of whom 707 (97.5%) survived ≥ 48 h; 563 (79.6%) underwent intact AAA repair and 144 (20.4%) ruptured AAA repair. A total of 548 patients (77.5%) required AAA repairs in 1999 to 7.3% in 2013 (p < .001) whereas the use of endovascular aortic repair (EVAR) increased from 6.9% in 1999 to 78.0% in 2013 (p < .001). The 30 day survival rate was 98.2% for those with < 48 h ICU stay versus 93.0% for 2-6 days versus 81.8% for ≥ 7 days (p < .001); the corresponding 90 day survival was 97.1% versus 86.1% versus 63.6% (p < .001) respectively. For patients surviving 90 days after repair, there was no difference in long-term survival between the groups. During the period of progressively increasing use of EVAR, a simultaneous significant reduction in frequency of prolonged ICU LOS occurred. Although prolonged ICU LOS was associated with a high short-term mortality, long-term outcome among those surviving the initial 90 days was less affected. Copyright © 2017 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
Biomarkers for AAA: Encouraging steps but clinical relevance still to be delivered.
Htun, Nay Min; Peter, Karlheinz
2014-10-01
Potential biomarkers have been investigated using proteomic studies in a variety of diseases. Some biomarkers have central roles in both diagnosis and monitoring of various disorders in clinical medicine, such as troponins, brain natriuretic peptide, and C-reactive protein. Although several biomarkers have been suggested in human abdominal aortic aneurysm (AAA), reliable markers have been lacking. In this issue, Moxon et al. [Proteomics Clin Appl. 2014, 8, 762-772] undertook a broad and systematic proteomic approach toward identification of biomarkers in a commonly used AAA mouse model (AAA created by angiotensin-II infusion). In this mouse model, apolipoprotein C1 and matrix metalloproteinase-9 were identified as novel biomarkers of stable AAA. This finding represents an important step forward, toward a clinically relevant role of biomarkers in AAA. This also encourages for further studies toward the identification of biomarkers (or their combinations) that can predict AAA progression and rupture, which would represent a major progress in AAA management and would establish an AAA biomarker as a much anticipated clinical tool. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Electron cryomicroscopy structure of a membrane-anchored mitochondrial AAA protease.
Lee, Sukyeong; Augustin, Steffen; Tatsuta, Takashi; Gerdes, Florian; Langer, Thomas; Tsai, Francis T F
2011-02-11
FtsH-related AAA proteases are conserved membrane-anchored, ATP-dependent molecular machines, which mediate the processing and turnover of soluble and membrane-embedded proteins in eubacteria, mitochondria, and chloroplasts. Homo- and hetero-oligomeric proteolytic complexes exist, which are composed of homologous subunits harboring an ATPase domain of the AAA family and an H41 metallopeptidase domain. Mutations in subunits of mitochondrial m-AAA proteases have been associated with different neurodegenerative disorders in human, raising questions on the functional differences between homo- and hetero-oligomeric AAA proteases. Here, we have analyzed the hetero-oligomeric yeast m-AAA protease composed of homologous Yta10 and Yta12 subunits. We combined genetic and structural approaches to define the molecular determinants for oligomer assembly and to assess functional similarities between Yta10 and Yta12. We demonstrate that replacement of only two amino acid residues within the metallopeptidase domain of Yta12 allows its assembly into homo-oligomeric complexes. To provide a molecular explanation, we determined the 12 Å resolution structure of the intact yeast m-AAA protease with its transmembrane domains by electron cryomicroscopy (cryo-EM) and atomic structure fitting. The full-length m-AAA protease has a bipartite structure and is a hexamer in solution. We found that residues in Yta12, which facilitate homo-oligomerization when mutated, are located at the interface between neighboring protomers in the hexamer ring. Notably, the transmembrane and intermembrane space domains are separated from the main body, creating a passage on the matrix side, which is wide enough to accommodate unfolded but not folded polypeptides. These results suggest a mechanism regarding how proteins are recognized and degraded by m-AAA proteases.
m-AAA proteases, mitochondrial calcium homeostasis and neurodegeneration.
Patron, Maria; Sprenger, Hans-Georg; Langer, Thomas
2018-03-01
The function of mitochondria depends on ubiquitously expressed and evolutionary conserved m-AAA proteases in the inner membrane. These ATP-dependent peptidases form hexameric complexes built up of homologous subunits. AFG3L2 subunits assemble either into homo-oligomeric isoenzymes or with SPG7 (paraplegin) subunits into hetero-oligomeric proteolytic complexes. Mutations in AFG3L2 are associated with dominant spinocerebellar ataxia (SCA28) characterized by the loss of Purkinje cells, whereas mutations in SPG7 cause a recessive form of hereditary spastic paraplegia (HSP7) with motor neurons of the cortico-spinal tract being predominantly affected. Pleiotropic functions have been assigned to m-AAA proteases, which act as quality control and regulatory enzymes in mitochondria. Loss of m-AAA proteases affects mitochondrial protein synthesis and respiration and leads to mitochondrial fragmentation and deficiencies in the axonal transport of mitochondria. Moreover m-AAA proteases regulate the assembly of the mitochondrial calcium uniporter (MCU) complex. Impaired degradation of the MCU subunit EMRE in AFG3L2-deficient mitochondria results in the formation of deregulated MCU complexes, increased mitochondrial calcium uptake and increased vulnerability of neurons for calcium-induced cell death. A reduction of calcium influx into the cytosol of Purkinje cells rescues ataxia in an AFG3L2-deficient mouse model. In this review, we discuss the relationship between the m-AAA protease and mitochondrial calcium homeostasis and its relevance for neurodegeneration and describe a novel mouse model lacking MCU specifically in Purkinje cells. Our results pledge for a novel view on m-AAA proteases that integrates their pleiotropic functions in mitochondria to explain the pathogenesis of associated neurodegenerative disorders.
Gerdes, Florian; Tatsuta, Takashi; Langer, Thomas
2012-01-01
Mitochondrial AAA proteases play an important role in the maintenance of mitochondrial proteostasis. They regulate and promote biogenesis of mitochondrial proteins by acting as processing enzymes and ensuring the selective turnover of misfolded proteins. Impairment of AAA proteases causes pleiotropic defects in various organisms including neurodegeneration in humans. AAA proteases comprise ring-like hexameric complexes in the mitochondrial inner membrane and are functionally conserved from yeast to man, but variations are evident in the subunit composition of orthologous enzymes. Recent structural and biochemical studies revealed how AAA proteases degrade their substrates in an ATP dependent manner. Intersubunit coordination of the ATP hydrolysis leads to an ordered ATP hydrolysis within the AAA ring, which ensures efficient substrate dislocation from the membrane and translocation to the proteolytic chamber. In this review, we summarize recent findings on the molecular mechanisms underlying the versatile functions of mitochondrial AAA proteases and their relevance to those of the other AAA+ machines. Copyright © 2011 Elsevier B.V. All rights reserved.
2010-10-01
...-function health agency, such as the home care department of a hospital or the nursing division of a health... AND CERTIFICATION HOME HEALTH SERVICES General Provisions § 484.2 Definitions. As used in this part... governing the agency's operation. Branch office means a location or site from which a home health agency...
Initial stress and nonlinear material behavior in patient-specific AAA wall stress analysis
Speelman, L.; Bosboom, E.M.H.; Schurink, G.W.H.; Buth, J.; Breeuwer, M.; Jacobs, M.J.; Vosse, van de F.N.
2009-01-01
Rupture risk estimation of abdominal aortic aneurysms (AAA) is currently based on the maximum diameter of the AAA. A more critical approach is based on AAA wall stress analysis. For that, in most cases, the AAA geometry is obtained from CT-data and treated as a stress free geometry. However, during
Meiotic Clade AAA ATPases: Protein Polymer Disassembly Machines.
Monroe, Nicole; Hill, Christopher P
2016-05-08
Meiotic clade AAA ATPases (ATPases associated with diverse cellular activities), which were initially grouped on the basis of phylogenetic classification of their AAA ATPase cassette, include four relatively well characterized family members, Vps4, spastin, katanin and fidgetin. These enzymes all function to disassemble specific polymeric protein structures, with Vps4 disassembling the ESCRT-III polymers that are central to the many membrane-remodeling activities of the ESCRT (endosomal sorting complexes required for transport) pathway and spastin, katanin p60 and fidgetin affecting multiple aspects of cellular dynamics by severing microtubules. They share a common domain architecture that features an N-terminal MIT (microtubule interacting and trafficking) domain followed by a single AAA ATPase cassette. Meiotic clade AAA ATPases function as hexamers that can cycle between the active assembly and inactive monomers/dimers in a regulated process, and they appear to disassemble their polymeric substrates by translocating subunits through the central pore of their hexameric ring. Recent studies with Vps4 have shown that nucleotide-induced asymmetry is a requirement for substrate binding to the pore loops and that recruitment to the protein lattice via MIT domains also relieves autoinhibition and primes the AAA ATPase cassettes for substrate binding. The most striking, unifying feature of meiotic clade AAA ATPases may be their MIT domain, which is a module that is found in a wide variety of proteins that localize to ESCRT-III polymers. Spastin also displays an adjacent microtubule binding sequence, and the presence of both ESCRT-III and microtubule binding elements may underlie the recent findings that the ESCRT-III disassembly function of Vps4 and the microtubule-severing function of spastin, as well as potentially katanin and fidgetin, are highly coordinated. Copyright © 2015 Elsevier Ltd. All rights reserved.
Abdominal aorta aneurysm (AAA): Is there a role for prevention and therapy using antioxidants?
Pincemail, Joël; Defraigne, Jean-Olivier; Courtois, Audrey; Albert, Adelin; Cheramy-Bien, Jean-Paul; Sakalihasan, Natzi
2017-09-18
Abdominal aortic aneurysm (AAA) is a degenerative disease that cause mortality in people aged > 65 years. Increased reactive oxygen species (ROS) and oxidative stress seems to play a pivotal role in AAA pathogenesis. Several sources of ROS have been identified in aortic tissues using experimental models: inflammation, increased activity of NAD(P)H or NOX, over-expression of inducible nitric oxide synthase (iNOS), uncoupled endothelial nitric oxide synthase (eNOS), platelets activation and iron release from hemoglobin. Reducing oxidative stress by antioxidants has been shown to be a potential strategy for limiting AAA development. Human studies confirmed that oxidative stress and endothelial dysfunction are well associated with AAA development. Unfortunately, there is currently no evidence showing that strategies using low molecular weight antioxidants (vitamins C and E, β-carotene) as target for ROS is effective to reduce human AAA progression. However, recent epidemiological data have highlighted the positive role of a diet enriched in fruits which contain high amounts of antioxidant polyphenols. By their ability to restore endothelial function but also their capacity to stimulate enzymatic antioxidants trough activation of the Keap1/Nrf2/ARE pathway, polyphenols can represent a promising treatment target for reducing human AAA progression. Clinical studies are therefore urgently necessary to confirm such a suggestion. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Advanced, Analytic, Automated (AAA) Measurement of Engagement During Learning.
D'Mello, Sidney; Dieterle, Ed; Duckworth, Angela
2017-01-01
It is generally acknowledged that engagement plays a critical role in learning. Unfortunately, the study of engagement has been stymied by a lack of valid and efficient measures. We introduce the advanced, analytic, and automated (AAA) approach to measure engagement at fine-grained temporal resolutions. The AAA measurement approach is grounded in embodied theories of cognition and affect, which advocate a close coupling between thought and action. It uses machine-learned computational models to automatically infer mental states associated with engagement (e.g., interest, flow) from machine-readable behavioral and physiological signals (e.g., facial expressions, eye tracking, click-stream data) and from aspects of the environmental context. We present15 case studies that illustrate the potential of the AAA approach for measuring engagement in digital learning environments. We discuss strengths and weaknesses of the AAA approach, concluding that it has significant promise to catalyze engagement research.
Klarskov, Klaus; Gagnon, Hugo; Racine, Mathieu; Boudreault, Pierre-Luc; Normandin, Chad; Marsault, Eric; Gleich, Gerald J; Naylor, Stephen
2018-05-22
The eosinophilia-myalgia syndrome (EMS) outbreak that occurred in the USA and elsewhere in 1989 was caused by the ingestion of Showa Denko K.K. (SD) L-tryptophan (L-Trp). "Six compounds" detected in the L-Trp were reported as case-associated contaminants. Recently the final and most statistically significant contaminant, "Peak AAA" was structurally characterized. The "compound" was actually shown to be two structural isomers resulting from condensation reactions of L-Trp with fatty acids derived from the bacterial cell membrane. They were identified as the indole C-2 anteiso (AAA 1 -343) and linear (AAA 2 -343) aliphatic chain isomers. Based on those findings, we utilized a combination of on-line HPLC-electrospray ionization mass spectrometry (LC-MS), as well as both precursor and product ion tandem mass spectrometry (MS/MS) to facilitate identification of a homologous family of condensation products related to AAA 1 -343 and AAA 2 -343. We structurally characterized eight new AAA 1 -XXX/AAA 2 -XXX contaminants, where XXX represents the integer molecular ions of all the related homologs, differing by aliphatic chain length and isomer configuration. The contaminants were derived from the following fatty acids of the bacterial cell membrane, 5-methylheptanoic acid (anteiso-C8:0) for AAA 1 -315; n-octanoic acid (n-C8:0) for AAA 2 -315; 6-methyloctanoic acid (anteiso-C9:0) for AAA 1 -329; n-nonanoic acid (n-C9:0) for AAA 2 -329; 10-methyldodecanoic acid (anteiso-C13:0) for AAA 1 -385; n-tridecanoic acid (n-C13:0) for AAA 2 -385; 11-methyltridecanoic acid (anteiso-C14:0) for AAA 1 -399; and n-tetradecanoic acid (n-C14:0) for AAA 2 -399. The concentration levels for these contaminants were estimated to be 0.1 - 7.9 μg / 500 mg of an individual SD L-Trp tablet or capsule The structural similarity of these homologs to case-related contaminants of Spanish Toxic Oil Syndrome (TOS) is discussed. Copyright © 2018. Published by Elsevier B.V.
Multibands tunneling in AAA-stacked trilayer graphene
Redouani, Ilham; Jellal, Ahmed; Bahaoui, Abdelhadi; Bahlouli, Hocine
2018-04-01
We study the electronic transport through np and npn junctions for AAA-stacked trilayer graphene. Two kinds of gates are considered where the first is a single gate and the second is a double gate. After obtaining the solutions for the energy spectrum, we use the transfer matrix method to determine the three transmission probabilities for each individual cone τ = 0 , ± 1 . We show that the quasiparticles in AAA-stacked trilayer graphene are not only chiral but also labeled by an additional cone index τ. The obtained bands are composed of three Dirac cones that depend on the chirality indexes. We show that there is perfect transmission for normal or near normal incidence, which is a manifestation of the Klein tunneling effect. We analyze also the corresponding total conductance, which is defined as the sum of the conductance channels in each individual cone. Our results are numerically discussed and compared with those obtained for ABA- and ABC-stacked trilayer graphene.
The Mitochondrial m-AAA Protease Prevents Demyelination and Hair Greying.
Wang, Shuaiyu; Jacquemyn, Julie; Murru, Sara; Martinelli, Paola; Barth, Esther; Langer, Thomas; Niessen, Carien M; Rugarli, Elena I
2016-12-01
The m-AAA protease preserves proteostasis of the inner mitochondrial membrane. It ensures a functional respiratory chain, by controlling the turnover of respiratory complex subunits and allowing mitochondrial translation, but other functions in mitochondria are conceivable. Mutations in genes encoding subunits of the m-AAA protease have been linked to various neurodegenerative diseases in humans, such as hereditary spastic paraplegia and spinocerebellar ataxia. While essential functions of the m-AAA protease for neuronal survival have been established, its role in adult glial cells remains enigmatic. Here, we show that deletion of the highly expressed subunit AFG3L2 in mature mouse oligodendrocytes provokes early-on mitochondrial fragmentation and swelling, as previously shown in neurons, but causes only late-onset motor defects and myelin abnormalities. In contrast, total ablation of the m-AAA protease, by deleting both Afg3l2 and its paralogue Afg3l1, triggers progressive motor dysfunction and demyelination, owing to rapid oligodendrocyte cell death. Surprisingly, the mice showed premature hair greying, caused by progressive loss of melanoblasts that share a common developmental origin with Schwann cells and are targeted in our experiments. Thus, while both neurons and glial cells are dependant on the m-AAA protease for survival in vivo, complete ablation of the complex is necessary to trigger death of oligodendrocytes, hinting to cell-autonomous thresholds of vulnerability to m-AAA protease deficiency.
APC-PCI complex levels for screening of AAA in patients with peripheral atherosclerosis.
Zarrouk, Moncef; Keshavarz, Kave; Lindblad, Bengt; Gottsäter, Anders
2013-11-01
To evaluate the use of activated protein C-protein C inhibitor (APC-PCI) complex levels for detection of abdominal aortic aneurysm (AAA) in patients with peripheral atherosclerotic disease (PAD). APC-PCI levels and aortic diameter evaluated in 511 PAD patients without previously known AAA followed-up concerning survival for 4.8(0.5) years. AAA was found in 13% of patients. Aortic diameter correlated (r = 0.138; p = 0.002) with APC-PCI levels which were higher (0.40[0.45] vs. 0.30[0.49] μg/l; p = 0.004) in patients with AAA. This difference persisted in multivariate analysis (p = 0.029). A threshold value of APC-PCI ≥0.15 μg/L showed a specificity of 11%, a sensitivity of 97% and a negative predictive value of 96% for an AAA diagnosis. APC-PCI levels were higher in patients with AAA, and showed high sensitivity but low specificity for the diagnosis and can therefore not be considered as a screening tool in PAD patients. An AAA prevalence of 13% in patients with PAD indicates a need for AAA screening within this population.
Masunun, P.; Tangboonduangjit, P.; Dumrongkijudom, N.
2016-03-01
The purpose of this study is to compare the build-up region doses on breast Rando phantom surface with the bolus covered, the doses in breast Rando phantom and also the doses in a lung that is the heterogeneous region by two algorithms. The AAA in Eclipse TPS and the collapsed cone convolution algorithm in Pinnacle treatment planning system were used to plan in tangential field technique with 6 MV photon beam at 200 cGy total doses in Breast Rando phantom with bolus covered (5 mm and 10 mm). TLDs were calibrated with Cobalt-60 and used to measure the doses in irradiation process. The results in treatment planning show that the doses in build-up region and the doses in breast phantom were closely matched in both algorithms which are less than 2% differences. However, overestimate of doses in a lung (L2) were found in AAA with 13.78% and 6.06% differences at 5 mm and 10 mm bolus thickness, respectively when compared with CCC algorithm. The TLD measurements show the underestimate in buildup region and in breast phantom but the doses in a lung (L2) were overestimated when compared with the doses in the two plannings at both thicknesses of the bolus.
International Nuclear Information System (INIS)
Mynampati, D; Scripes, P Godoy; Kuo, H; Yaparpalvi, R; Tome, W
2015-01-01
Purpose: To evaluate dosimetric differences between superposition beam model (AAA) and determinant photon transport solver (AXB) in lung SBRT and Cranial SRS dose computations. Methods: Ten Cranial SRS and ten Lung SBRT plans using Varian, AAA -11.0 were re-planned using Acuros -XB-11.0 with fixed MU. 6MV photon Beam model with HD120-MLC used for dose calculations. Four non-coplanar conformal arcs used to deliver 21Gy or 18Gy to SRS targets (0.4 to 6.2cc). 54Gy (3Fractions) or 50Gy (5Fractions) was planned for SBRT targets (7.3 to 13.9cc) using two VAMT non-coplanar arcs. Plan comparison parameters were dose to 1% PTV volume (D1), dose to 99% PTV volume( D99), Target mean (Dmean), Conformity index (ratio of prescription isodose volume to PTV), Homogeneity Index [ (D2%-D98%)/Dmean] and R50 (ratio of 50% of prescription isodose volume to PTV). OAR parameters were Brain volume receiving 12Gy dose (V12Gy) and maximum dose (D0.03) to Brainstem for SRS. For lung SBRT, maximum dose to Heart and Cord, Mean lung dose (MLD) and volume of lung receiving 20Gy (V20Gy) were computed. PTV parameters compared by percentage difference between AXB and AAA parameters. OAR parameters and HI compared by absolute difference between two calculations. For analysis, paired t-test performed over the parameters. Results: Compared to AAA, AXB SRS plans have on average 3.2% lower D99, 6.5% lower CI and 3cc less Brain-V12. However, AXB SBRT plans have higher D1, R50 and Dmean by 3.15%, 1.63% and 2.5%. For SRS and SBRT, AXB plans have average HI 2 % and 4.4% higher than AAA plans. In both techniques, all other parameters vary within 1% or 1Gy. In both sets only two parameters have P>0.05. Conclusion: Even though t-test results signify difference between AXB and AAA plans, dose differences in dose estimations by both algorithms are clinically insignificant
Fogliata, Antonella; Lobefalo, Francesca; Reggiori, Giacomo; Stravato, Antonella; Tomatis, Stefano; Scorsetti, Marta; Cozzi, Luca
2016-10-01
Small field measurements are challenging, due to the physical characteristics coming from the lack of charged particle equilibrium, the partial occlusion of the finite radiation source, and to the detector response. These characteristics can be modeled in the dose calculations in the treatment planning systems. Aim of the present work is to evaluate the MU calculation accuracy for small fields, defined by jaw or MLC, for anisotropic analytical algorithm (AAA) and Acuros XB algorithms, relative to output measurements on the beam central axis. Single point output factor measurement was acquired with a PTW microDiamond detector for 6 MV, 6 and 10 MV unflattened beams generated by a Varian TrueBeam STx equipped with high definition-MLC. Fields defined by jaw or MLC apertures were set; jaw-defined: 0.6 × 0.6, 0.8 × 0.8, 1 × 1, 2 × 2, 3 × 3, 4 × 4, 5 × 5, and 10 × 10 cm 2 ; MLC-defined: 0.5 × 0.5 cm 2 to the maximum field defined by the jaw, with 0.5 cm stepping, and jaws set to: 2 × 2, 3 × 3, 4 × 4, 5 × 5, and 10 × 10 cm 2 . MU calculation was obtained with 1 mm grid in a virtual water phantom for the same fields, for AAA and Acuros algorithms implemented in the Varian eclipse treatment planning system (version 13.6). Configuration parameters as the effective spot size (ESS) and the dosimetric leaf gap (DLG) were varied to find the best parameter setting. Differences between calculated and measured doses were analyzed. Agreement better than 0.5% was found for field sizes equal to or larger than 2 × 2 cm 2 for both algorithms. A dose overestimation was present for smaller jaw-defined fields, with the best agreement, averaged over all the energies, of 1.6% and 4.6% for a 1 × 1 cm 2 field calculated by AAA and Acuros, respectively, for a configuration with ESS = 1 mm for both X and Y directions for AAA, and ESS = 1.5 and 0 mm for X and Y directions for Acuros. Conversely, a calculated dose underestimation was found for small MLC-defined fields, with the
AAA (2010) CAPD clinical practice guidelines: need for an update.
DeBonis, David A
2017-09-01
Review and critique of the clinical value of the AAA CAPD guidance document in light of criteria for credible and useful guidance documents, as discussed by Field and Lohr. A qualitative review of the of the AAA CAPD guidelines using a framework by Field and Lohr to assess their relative value in supporting the assessment and management of CAPD referrals. Relevant literature available through electronic search tools and published texts were used along with the AAA CAPD guidance document and the chapter by Field and Lohr. The AAA document does not meet many of the key requirements discussed by Field and Lohr. It does not reflect the current literature, fails to help clinicians understand for whom auditory processing testing and intervention would be most useful, includes contradictory suggestions which reduce clarity and appears to avoid conclusions that might cast the CAPD construct in a negative light. It also does not include input from diverse affected groups. All of these reduce the document's credibility. The AAA CAPD guidance document will need to be updated and re-conceptualised in order to provide meaningful guidance for clinicians.
CERN Bulletin
2011-01-01
The American Association for the Advancement of Science held its annual meeting in the Walter E. Washington Convention Center in Washington D.C. last week. Veteran science writer Tim Radford introduces LHC scientists during a media briefing at the AAAS annual meeting. Left to right: Felicitas Pauss, Tom LeCompte, Yves Schutz and Nick Hadley. As the world’s largest popular science meeting, the AAAS meeting is a major event in the calendar of science journalists. At this year’s LHC session, CERN’s coordinator for international relations, Felicitas Pauss, opened the discussion, paving the way for Tom LeCompte of ATLAS, Joe Incandela of CMS, Yves Schutz of ALICE and Monica Pepe-Altarelli of LHCb to report on the status of the first year’s analysis from their experiments.
Advanced, Analytic, Automated (AAA) Measurement of Engagement during Learning
D'Mello, Sidney; Dieterle, Ed; Duckworth, Angela
2017-01-01
It is generally acknowledged that engagement plays a critical role in learning. Unfortunately, the study of engagement has been stymied by a lack of valid and efficient measures. We introduce the advanced, analytic, and automated (AAA) approach to measure engagement at fine-grained temporal resolutions. The AAA measurement approach is grounded in…
The m-AAA Protease Associated with Neurodegeneration Limits MCU Activity in Mitochondria.
König, Tim; Tröder, Simon E; Bakka, Kavya; Korwitz, Anne; Richter-Dennerlein, Ricarda; Lampe, Philipp A; Patron, Maria; Mühlmeister, Mareike; Guerrero-Castillo, Sergio; Brandt, Ulrich; Decker, Thorsten; Lauria, Ines; Paggio, Angela; Rizzuto, Rosario; Rugarli, Elena I; De Stefani, Diego; Langer, Thomas
2016-10-06
Mutations in subunits of mitochondrial m-AAA proteases in the inner membrane cause neurodegeneration in spinocerebellar ataxia (SCA28) and hereditary spastic paraplegia (HSP7). m-AAA proteases preserve mitochondrial proteostasis, mitochondrial morphology, and efficient OXPHOS activity, but the cause for neuronal loss in disease is unknown. We have determined the neuronal interactome of m-AAA proteases in mice and identified a complex with C2ORF47 (termed MAIP1), which counteracts cell death by regulating the assembly of the mitochondrial Ca 2+ uniporter MCU. While MAIP1 assists biogenesis of the MCU subunit EMRE, the m-AAA protease degrades non-assembled EMRE and ensures efficient assembly of gatekeeper subunits with MCU. Loss of the m-AAA protease results in accumulation of constitutively active MCU-EMRE channels lacking gatekeeper subunits in neuronal mitochondria and facilitates mitochondrial Ca 2+ overload, mitochondrial permeability transition pore opening, and neuronal death. Together, our results explain neuronal loss in m-AAA protease deficiency by deregulated mitochondrial Ca 2+ homeostasis. Copyright © 2016 Elsevier Inc. All rights reserved.
An AAA-DDD triply hydrogen-bonded complex easily accessible for supramolecular polymers.
Han, Yi-Fei; Chen, Wen-Qiang; Wang, Hong-Bo; Yuan, Ying-Xue; Wu, Na-Na; Song, Xiang-Zhi; Yang, Lan
2014-12-15
For a complementary hydrogen-bonded complex, when every hydrogen-bond acceptor is on one side and every hydrogen-bond donor is on the other, all secondary interactions are attractive and the complex is highly stable. AAA-DDD (A=acceptor, D=donor) is considered to be the most stable among triply hydrogen-bonded sequences. The easily synthesized and further derivatized AAA-DDD system is very desirable for hydrogen-bonded functional materials. In this case, AAA and DDD, starting from 4-methoxybenzaldehyde, were synthesized with the Hantzsch pyridine synthesis and Friedländer annulation reaction. The association constant determined by fluorescence titration in chloroform at room temperature is 2.09×10(7) M(-1) . The AAA and DDD components are not coplanar, but form a V shape in the solid state. Supramolecular polymers based on AAA-DDD triply hydrogen bonded have also been developed. This work may make AAA-DDD triply hydrogen-bonded sequences easily accessible for stimuli-responsive materials. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Protective Effects of Diabetes Mellitus on Post-EVAR AAA Growth and Reinterventions.
Png, Chien Yi M; Tadros, Rami O; Kang, Ming; Beckerman, William E; Tardiff, Melissa L; Vouyouka, Ageliki G; Marin, Michael L; Faries, Peter L
2017-08-01
This study aims to investigate the effect of diabetes on post-endovascular aneurysm repairs (EVARs) of abdominal aortic aneurysms (AAAs). A total of 1,479 consecutive patients who underwent AAA EVAR were reviewed. The cohorts were divided based on their diabetes status and compared. Preoperative demographic and comorbidity data were analyzed using the t-test and chi-squared test, whereas post-EVAR outcomes were analyzed using Probit multivariate model, followed by Kaplan-Meier survival curve and Cox regression. Of our 1,479 patients, 993 met inclusion criteria. One hundred eighty-three were diabetics (18.4%) compared with 810 nondiabetics (81.6%). Coronary artery disease (CAD; diabetics: 70.49%, nondiabetics: 60.76%, P = 0.014) and hypertension (HTN; diabetics: 90.16%, nondiabetics: 79.46%, P = 0.0008) were the only comorbidities analyzed, including follow-up length, which had any significant differences between the diabetic and nondiabetic groups. Probit multivariate analysis using a combined cohort follow-up mean of 51 months showed a significant decrease in aneurysm sac enlargement in diabetic patients (diabetics: 13.11%, nondiabetics: 19.43%, model estimate: 0.3058; 95% confidence interval [CI]: 0.0486-0.5629, Pr > ChiSq = 0.0198) and trended toward significantly fewer reinterventions (diabetics: 23.50%, nondiabetics: 28.41%, model estimate: 0.1990; 95% CI: -0.0262 to 0.4243, Pr > ChiSq = 0.0833). In the Cox regressions, diabetes had a significant protective factor on reinterventions (hazard ratio [HR]: 0.697, Pr > ChiSq = 0.0151), and was trending toward significance for aneurysm sac enlargement (HR: 0.750, Pr > ChiSq = 0.1961). There was no significant difference across diabetic status in any other outcomes, including mortality and endoleak occurrence. Although a higher proportion of diabetic patients present with HTN and CAD, they have decreased long-term rates of aneurysm sac enlargement after EVAR. As a result, this cohort trends
Energy Technology Data Exchange (ETDEWEB)
Shiheido, Hirokazu, E-mail: shiheido@ak.med.kyoto-u.ac.jp; Shimizu, Jun
2015-02-20
BEN domain-containing protein 3 (BEND3) has recently been reported to function as a heterochromatin-associated protein in transcriptional repression in the nucleus. BEND3 should have nuclear localization signals (NLSs) to localize to the nucleus in light of its molecular weight, which is higher than that allowed to pass through nuclear pore complexes. We here analyzed the subcellular localization of deletion/site-directed mutants of human BEND3 by an immunofluorescence assay in an attempt to identify the amino acids essential for its nuclear localization. We found that three basic amino acid residues located in the N-terminal region of BEND3 (BEND3{sub 56–58}, KRK) are essential, suggesting that these residues play a role as a functional NLS. These results provide valuable information for progressing research on BEND3. - Highlights: • BEND3 localizes to the nucleus. • The N-terminal 60 amino acids region of BEND3 contains NLS. • Amino acids located between 56 and 58 of BEND3 (KRK) are part of NLS. • KRK motif is highly conserved among BEND3 homologs.
CTA Contribution by Evaluation of Treatment AAA
International Nuclear Information System (INIS)
Mikulas, J.; Majercik, M.; Klepanec, A.; Balazs, T.; Bazik, R.; Vulev, I.
2010-01-01
Over the past decade, the EVAR (Endovascular aortic aneurysm repair) became an accepted treatment of abdominal aortic aneurysms (AAA) as compared with the radical open surgical treatment. Due to the latest generation of stents, 60% of infra renal AAA can be treated by the endovascular method or even percutaneously, without any surgical procedure, and only under the local anesthesia. We retrospectively evaluated the findings of patients following elective EVAR who underwent CTA examination immediately after the procedure and three months after the procedure, for the period from June 2009 to February 2010 (9 months).
A methodology for developing anisotropic AAA phantoms via additive manufacturing.
Ruiz de Galarreta, Sergio; Antón, Raúl; Cazón, Aitor; Finol, Ender A
2017-05-24
An Abdominal Aortic Aneurysm (AAA) is a permanent focal dilatation of the abdominal aorta at least 1.5 times its normal diameter. The criterion of maximum diameter is still used in clinical practice, although numerical studies have demonstrated the importance of biomechanical factors for rupture risk assessment. AAA phantoms could be used for experimental validation of the numerical studies and for pre-intervention testing of endovascular grafts. We have applied multi-material 3D printing technology to manufacture idealized AAA phantoms with anisotropic mechanical behavior. Different composites were fabricated and the phantom specimens were characterized by biaxial tensile tests while using a constitutive model to fit the experimental data. One composite was chosen to manufacture the phantom based on having the same mechanical properties as those reported in the literature for human AAA tissue; the strain energy and anisotropic index were compared to make this choice. The materials for the matrix and fibers of the selected composite are, respectively, the digital materials FLX9940 and FLX9960 developed by Stratasys. The fiber proportion for the composite is equal to 0.15. The differences between the composite behavior and the AAA tissue are small, with a small difference in the strain energy (0.4%) and a maximum difference of 12.4% in the peak Green strain ratio. This work represents a step forward in the application of 3D printing technology for the manufacturing of AAA phantoms with anisotropic mechanical behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wang, Dile; Qu, Bihui; He, Tao
2017-08-01
The objective of the present study was to evaluate the efficacy of combination of endovascular graft exclusion and drugs for hypertension/hyperglycemia for the treatment of abdominal aortic aneurysm (AAA). We analyzed 156 patients with AAA. Eighty-four patients were hypertensive and 72 were hyperglycemic. After endovascular graft exclusion, hypertensive patients were divided into four groups and treated with cyclopenthiazide, reserpine, propranolol, and placebo respectively. Hyperglycemic patients were divided into three groups and treated with metformin, insulin, and placebo respectively. Body temperature and peripheral blood leukocytes were measured at day 1, 2, 7, and 14 after endovascular graft exclusion. Size of AAAs, blood pressure, and blood sugar were measured again after 1 year. In hypertensive patients, the size of AAAs reduced after endovascular graft exclusion, while the combined treatments with cyclopenthiazide, reserpine, or propranolol helped to reduce blood pressure (blood pressure decrease AAA size decreased in the control group (PAAAs reduced after endovascular graft exclusion. Combined treatment with Metformin and Insulin reduced blood sugar (control, blood sugar >7.8 mmol/L (22/24), AAA size (P7.8 mmol/L (14/24), AAA size (P7.8 mmol/L (11/24), AAA size (PAAA therapy.
Fluviokarst and classical karst: Examples from the Dinarics (Krk Island, Northern Adriatic, Croatia)
Benac, Čedomir; Juračić, Mladen; Matičec, Dubravko; Ružić, Igor; Pikelj, Kristina
2013-02-01
In order to contribute to the debate on the role of fluvial erosion in the shaping of karst, two nearby areas with different karstic landscapes were compared. Areas A and B are located relatively close to each other on the southern side of the Krk Island (Adriatic Sea, Croatia). Both areas are composed of similar limestone with a very high CaCO3 content. Area A is a typical doline or polygonal type ("classical") of karst with numerous dolines (up to 57/km2) covered with terra rossa (red soil) and Mediterranean maquis shrubland. Dolines are located in zones which correspond to the strike of the main geological structures. Dry karstic valleys are visible only on gently inclined coastal slopes bordering the karstic plateau. In contrast, area B is typical of a bare karst landscape with a strong (palaeo)fluvial imprint. The dolines are absent, and the bedrock is only sporadically covered with terra rossa. Palaeogene marls have been observed in a few elongated depressions and in the coastal zone of area B. Along steep coastal slopes, valleys (up to 460 m/km2) are cut into the carbonates. The traces of episodic surface flows are visible in some of these valleys, in contrast to the valleys in area A. Remnants of a disrupted ancient fluvial network are clearly visible on the elevated karstic plateau in area B. Differences in the recent morphology are attributed mainly to varying thicknesses of the Palaeogene impermeable marly cover, and the intensity of tectonics in the two areas.
Aortocaval fistula (ACF) in patients operated for ruptured aortic aneurysm (rAAA)
DEFF Research Database (Denmark)
Warning, Karina; Houlind, Kim Christian; Ravn, Hans
Aortocaval fistula (ACF) in patients operated for Ruptured Acute Aorta Aneurysm (rAAA): A surgical challenge. Introduction Aortocaval fistula is a rare complication of abdominal aortic aneurysm (AAA). It been reported to be present in less than 1% of all AAAs. ACF arise in patients with large...... aneurysms and is typically discovered peroperatively in patients with rAAA. Open surgical treatment is associated with high mortality and morbidity. ACF is a result of spontaneously rupture of large atherosclerotic aneurysms into the inferior vena cava in 80%, 15% arise after trauma and 5% are iatrogenic....... Patients During the last 9 month, we have operated three cases with rAAA and ACF. All patients had an open, acute operation. All ACFs detected during operation. Common for all operations was that the patients had large aneurysms (>10 cm) and extensive bleeding (3-4 l) immediately when the aneurysm...
International Nuclear Information System (INIS)
Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo
2006-01-01
Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone
Multi-Centre Study on Cardiovascular Risk Management on Patients Undergoing AAA Surveillance.
Saratzis, A; Dattani, N; Brown, A; Shalhoub, J; Bosanquet, D; Sidloff, D; Stather, P
2017-07-01
The risk of cardiovascular events and death in patients with abdominal aortic aneurysms (AAA) is high. Screening has been introduced to reduce AAA related mortality; however, after AAA diagnosis, cardiovascular modification may be as important to patient outcomes as surveillance. The aim of this study was to assess cardiovascular risk reduction in patients with small AAA. Institutional approval was granted for The Vascular and Endovascular Research Network (VERN) to retrospectively collect data pertaining to cardiovascular risk reduction from four tertiary vascular units in England. Patients with small AAA (January 2013-December 2015) were included. Demographic details, postcode, current medications, and smoking status were recorded using a bespoke electronic database and analysed. In a secondary analysis VERN contacted all AAA screening units in England and Wales to assess their current protocols relating to CV protection. In total, 1053 patients were included (mean age 74 ± 9 years, all men). Of these, 745 patients (70.8%) had been prescribed an antiplatelet agent and 787 (74.7%) a statin. Overall, only 666 patients (63.2%) were prescribed both a statin and antiplatelet. Two hundred and sixty eight patients (32.1%) were current smokers and the proportion of patients who continued to smoke decreased with age. Overall, only 401 patients (48.1%) were prescribed a statin, antiplatelet, and had stopped smoking. In the secondary analysis 38 AAA screening units (84% national coverage) replied. Thirty-one units (82%) suggest changes to the patient's prescription; however, none monitor compliance with these recommendations or assess whether the general practitioner has been made aware of the AAA diagnosis or prescription advice. Many patients with small AAA are not prescribed an antiplatelet/statin, and still smoke cigarettes, and therefore remain at high risk of cardiovascular morbidity and mortality. National guidance to ensure this high risk group of patients is
Energy Technology Data Exchange (ETDEWEB)
Bacelar, A.; Ferret, A.A.; Vanni, S.; Galhardi, M.P.; Lykawka, R., E-mail: abacelar@hepa.ufrgs.br, E-mail: allferret@gmail.com, E-mail: svanni@hepa.ufrgs.br, E-mail: mpgalhardi@gmail.com, E-mail: rlykawka@hepa.ufrgs.br [Hospital de Clinicas de Porto Alegre (HCPA), Porto Alegre, RS (Brazil)
2013-10-01
Objective: the initiative AAA - Awareness , Appropriateness and Audit , promotes consciousness ( Awareness) , fitness ( Appropriateness ) and Audit ( Audit) . This paper analyzes the application of the concept in the AAA requests and justifications examinations using ionizing radiation within a large public hospital. Materials and methods: we collected and analyzed data between the years 2011 and 2012, concerning the number of exams performed with the use of radiation and their justifications. After, we sought to raise awareness of the clinical team through training on the risks and benefits of the various modalities of the radiology department and the need to justify the use of ionizing radiation on health. After the data were collected again of test requests for verification of the effectiveness of training. Results: the mean requests that need to be appropriate to the AAA in the last quarter of 2011 was 75 % lower than the average demands of the first quarter, matched against the last two months of 2012 increased by up to four times the number requests that require improvements in relation to the excellent results obtained in July 2012. Conclusion: it is shown in this paper the need of implementing this initiative AAA continuously added to the clinical staff awareness about the risk of the use of ionizing radiation, the appropriateness of the requests of these tests , as well as the control of this process in order to optimize use of ionizing radiation on health.
International Nuclear Information System (INIS)
Zifoyda, Jackson M.; Challens, Cameron H.C.; Hsieh, Wen-Long
2016-01-01
When implementing Acuros XB (AXB) as a substitute for anisotropic analytic algorithm (AAA) in the Eclipse Treatment Planning System, one is faced with a dilemma of reporting either dose to medium, AXB-Dm or dose to water, AXB-Dw. To assist with decision making on selecting either AXB-Dm or AXB-Dw for dose reporting, a retrospective study of treated patients for head & neck (H&N), prostate, breast and lung is presented. Ten patients, previously treated using AAA plans, were selected for each site and re-planned with AXB-Dm and AXB-Dw. Re-planning was done with fixed monitor units (MU) as well as non-fixed MUs. Dose volume histograms (DVH) of targets and organs at risk (OAR), were analyzed in conjunction with ICRU-83 recommended dose reporting metrics. Additionally, comparisons of plan homogeneity indices (HI) and MUs were done to further highlight the differences between the algorithms. Results showed that, on average AAA overestimated dose to the target volume and OARs by less than 2.0 %. Comparisons between AXB-Dw and AXB-Dm, for all sites, also showed overall dose differences to be small (<1.5 %). However, in non-water biological media, dose differences between AXB-Dw and AXB-Dm, as large as 4.6 % were observed. AXB-Dw also tended to have unexpectedly high 3D maximum dose values (>135 % of prescription dose) for target volumes with high density materials. Homogeneity indices showed that AAA planning and optimization templates would need to be adjusted only for the H&N and Lung sites. MU comparison showed insignificant differences between AXB-Dw relative to AAA and between AXB-Dw relative to AXB-Dm. However AXB-Dm MUs relative to AAA, showed an average difference of about 1.3 % signifying an underdosage by AAA. In conclusion, when dose is reported as AXB-Dw, the effect that high density structures in the PTV has on the dose distribution should be carefully considered. As the results show overall small dose differences between the algorithms, when transitioning
Padmanaban, Sriram; Warren, Samantha; Walsh, Anthony; Partridge, Mike; Hawkins, Maria A
2014-12-23
To investigate systematic changes in dose arising when treatment plans optimised using the Anisotropic Analytical Algorithm (AAA) are recalculated using Acuros XB (AXB) in patients treated with definitive chemoradiotherapy (dCRT) for locally advanced oesophageal cancers. We have compared treatment plans created using AAA with those recalculated using AXB. Although the Anisotropic Analytical Algorithm (AAA) is currently more widely used in clinical routine, Acuros XB (AXB) has been shown to more accurately calculate the dose distribution, particularly in heterogeneous regions. Studies to predict clinical outcome should be based on modelling the dose delivered to the patient as accurately as possible. CT datasets from ten patients were selected for this retrospective study. VMAT (Volumetric modulated arc therapy) plans with 2 arcs, collimator rotation ± 5-10° and dose prescription 50 Gy / 25 fractions were created using Varian Eclipse (v10.0). The initial dose calculation was performed with AAA, and AXB plans were created by re-calculating the dose distribution using the same number of monitor units (MU) and multileaf collimator (MLC) files as the original plan. The difference in calculated dose to organs at risk (OAR) was compared using dose-volume histogram (DVH) statistics and p values were calculated using the Wilcoxon signed rank test. The potential clinical effect of dosimetric differences in the gross tumour volume (GTV) was evaluated using three different TCP models from the literature. PTV Median dose was apparently 0.9 Gy lower (range: 0.5 Gy - 1.3 Gy; p AAA plans re-calculated with AXB and GTV mean dose was reduced by on average 1.0 Gy (0.3 Gy -1.5 Gy; p AAA plan (on average, dose reduction: lung 1.7%, heart 2.4%). Similar trends were seen for CRT plans. Differences in dose distribution are observed with VMAT and CRT plans recalculated with AXB particularly within soft tissue at the tumour/lung interface, where AXB has been shown to more
Gadopentate dimeglumine enhanced MR angiography (MRA) for staging AAA: a correlation with DSA and CT
International Nuclear Information System (INIS)
Arlart, I.P.; Gerlach, A.; Kolb, M.; Erpenbach, S.; Wuerstlin, S.
1997-01-01
Purpose: To evaluate a contrast-enhanced (CE) MRA sequence for staging AAA. Methods: In 24 patients (male=20, female=4, age=44-81 y) with known AAA the abdominal aorta and its branches including the iliac arteries were imaged, using a 3D GRE-FISP sequence (1.5 T, T R /T E /FA=25/6/35, slab=100-140 mm, 32 part., FOV=440-450 mm, matrix=256x256) during an i.v. infusion of 40 ml of gadopentate dimeglumine. In addition, representative axial single slices (2D breathhold FLASH-sequence: T R /T E /FA=82/5/30) were acquired following contrast application. MR-results were correlated with i.a. DSA and CT studies. Results: With CE-MRA, AAA (n=24) and iliac aneurysms (n=17) could be evaluated in all cases (sens.=100%, spec.=100%) including luminal patency and mural thrombus. 50/54 renal arteries could be identified, 4/6 accessory renal arteries (sens=66,6%, spec.=100%), 8/9 renal artery stenoses>50% (sens.=88.8%, spec.=89.3%), 1/1 renal artery occlusion and 7/8 iliac artery stenoses>50% (sens.=87.5%, spec.=97.5%) were depicted correctly. Proximal portion of sup. mes. art. could be detected and evaluated in 21/24 cases. Quantitative determination of therapeutically relevant vascular paramters using MRA was comparable to DSA and CT. (orig./AJ) [de
DEFF Research Database (Denmark)
2013-01-01
Sonnesgade 11 The exhibition at the AAA library presents selected work produced by students prior to the exhibition of installations in project and praxis constructing an archive at Sonnesgade 11. The exhibition at Sonnesgade 11 was the culmination of collaboration with SLETH architects and studio...
On the Impact of Intraluminal Thrombus Mechanical Behavior in AAA Passive Mechanics.
Riveros, Fabián; Martufi, Giampaolo; Gasser, T Christian; Rodriguez-Matas, Jose F
2015-09-01
Intraluminal thrombus (ILT) is a pseudo-tissue that develops from coagulated blood, and is found in most abdominal aortic aneurysms (AAAs) of clinically relevant size. A number of studies have suggested that ILT mechanical characteristics may be related to AAA risk of rupture, even though there is still great controversy in this regard. ILT is isotropic and inhomogeneous and may appear as a soft (single-layered) or stiff (multilayered fibrotic) tissue. This paper aims to investigate how ILT constitution and topology influence the magnitude and location of peak wall stress (PWS). In total 21 patient-specific AAAs (diameter 4.2-5.4 cm) were reconstructed from computer tomography images and biomechanically analyzed using state-of-the-art modeling assumptions. Results indicated that PWS correlated stronger with ILT volume (ρ = 0.44, p = 0.05) and minimum thickness of ILT layer (ρ = 0.73, p = 0.001) than with maximum AAA diameter (ρ = 0.05, p = 0.82). On average PWS was 20% (SD 12%) higher for FE models that used soft instead of stiff ILT models (p AAA diameter and was independent from ILT stiffness. In addition, ILT heterogeneity, i.e., the spatial composition of soft and stiff thrombus tissue, can considerably influence stress in the AAA wall. The present study is limited to identification of influential biomechanical factors, and how its findings translate to an AAA rupture risk assessment remains to be explored by clinical studies.
Park, Brian; Dargon, Phong; Binette, Christopher; Babic, Bruna; Thomas, Tina; Divinagracia, Thomas; Dahn, Michael S; Menzoian, James O
2011-10-01
Moderate (body mass index [BMI] ≥30) and morbid obesity (BMI ≥35) is increasing at an alarming rate in vascular surgery patients. The objective of this study was to determine the impact of obesity on perioperative and long-term clinical outcomes following open abdominal aortic aneurysm (AAA) repair or endovascular aneurysm repair (EVAR). This review includes patients that underwent open AAA repair (n = 403) or EVAR (n = 223) from 1999 to 2009. Specific patient characteristics such as comorbid diseases, medications, and body mass index (BMI) were assessed. Specific perioperative outcomes such as length of stay, myocardial infarctions, and mortality were reviewed. In addition, long-term outcomes such as rates of reintervention, permanent renal dysfunction, and mortality beyond 30 days were also assessed. The incidence of obesity in open AAA patients was 25.3% (documented incidence 1.5%) and for EVAR was 24.6% (documented incidence 4%). Moderate and morbid obesity was associated with longer intensive care unit (ICU) admissions for both open AAA or EVAR patients (P AAA repair or EVAR (P > .05). Similarly, moderate and morbid obesity was not associated with significant differences in rates of reintervention, permanent renal dysfunction, and mortality beyond 30 days for patients undergoing open AAA repair or EVAR (P > .05). The results of this study indicate that moderate and morbid obesity are not independently associated with adverse perioperative and long-term clinical outcomes for patients undergoing open AAA repair or EVAR. Therefore, either open AAA repair or EVAR can be accomplished safely in moderately obese and morbidly obese patients.
SOFIA Technology: The NASA Airborne Astronomy Ambassador (AAA) Experience and Online Resources
Clark, C.; Harman, P. K.; Backman, D. E.
2016-12-01
SOFIA, an 80/20 partnership of NASA and the German Aerospace Center (DLR), consists of a modified Boeing 747SP carrying a reflecting telescope with an effective diameter of 2.5 meters. SOFIA is the largest airborne observatory in the world, capable of observations impossible for even the largest and highest ground-based telescopes. The SOFIA Program Office is at NASA ARC, Moffett Field, CA; the aircraft is based in Palmdale, CA. During its planned 20-year lifetime, SOFIA will foster development of new scientific instrumentation and inspire the education of young scientists and engineers. Astrophysicists are awarded time on SOFIA to study many kinds of astronomical objects and phenomena. Among the most interesting are: Star birth, evolution, and death Formation of new planetary systems Chemistry of complex molecules in space Planet and exoplanet atmospheres Galactic gas & dust "ecosystems" Environments around supermassive black holes SOFIA currently has eight instruments, five US-made and three German. The instruments — cameras, spectrometers, and a photometer,— operate at near-, mid- and far-infrared wavelengths, each spectral range being best suited to studying particular celestial phenomena. NASA's Airborne Astronomy Ambassadors' (AAAs) experience includes a STEM immersion component. AAAs are onboard during two overnight SOFIA flights that provide insight into the acquisition of scientific data as well as the interfaces between the telescope, instrument, & aircraft. AAAs monitor system performance and view observation targets from their dedicated workstation during flights. Future opportunities for school district partnerships leading to selection of future AAA cohorts will be offered in 2018-19. AAAs may access public archive data via the SOFIA Data Cycle System (DCS) https://dcs.sofia.usra.edu/. Additional SOFIA science and other resources are available at: www.sofia.usra.edu, including lessons that use photovoltaic circuits, and other technology for the
Dwivany, Fenny Martha; Esyanti, Rizkita R.; Prapaisie, Adeline; Puspa Kirana, Listya; Latief, Chunaeni; Ginaldi, Ari
2016-11-01
The objective of the research was to determine the effect of microgravity simulation by 3D clinostat on Cavendish banana (Musa acuminata AAA group) ripening process. In this study, physical, physiological changes as well as genes expression were analysed. The result showed that in microgravity simulation condition ripening process in banana was delayed and the MaACOl, MaACSl and MaACS5 gene expression were affected.
Functional characterization of the mammalian iAAA protease subunit, YME1L
Majczak, Joanna
2008-01-01
The iAAA protease is an ATP-dependent proteolytic complex in the mitochondrial inner membrane and belongs to the highly conserved family of AAA proteins. In the yeast Saccharomyces cerevisiae, the iAAA protease is a homo-oligomeric complex composed of Yme1p subunits which are active in the intermembrane space and mediate protein quality control. Yeast cells lacking Yme1p are characterized by pleiotropic phenotypes including a respiratory deficiency at elevated temperature and an aberrant mito...
Polymorphisms of the interleukin-6 gene promoter and abdominal aortic aneurysm.
Smallwood, L; Allcock, R; van Bockxmeer, F; Warrington, N; Palmer, L J; Iacopetta, B; Norman, P E
2008-01-01
Elevated levels of circulating interleukin-6 (IL-6) have been reported in patients with abdominal aortic aneurysms (AAAs). Although this implicates inflammation as a cause of AAAs, there is also evidence that the aneurysmal aorta may secrete IL-6 into the circulation as a result of aortic proteolysis. Genetic association studies are one means of trying to clarify the role of specific mediators in the causal pathway. The aim of the present study was to examine the association between variants of the IL-6 gene and AAAs. An association study involving 677 men with screen-detected AAAs and 656 age-matched controls was performed. Three variants in the IL-6 promoter region were analysed: IL-6-174G>C (rs1800795), IL-6-572G>C (rs1800796) and IL-6-597G>A (rs1800797). Univariate regression of SNP genotype on AAA as a binary outcome was initially performed under a range of genetic models (additive, dominant and recessive). This was followed by multivariate analyses, testing the same models but including risk factors known to be associated with AAAs. All analyses and haplotype estimation were performed under a generalized linear model framework. IL-6-572G>C polymorphism (frequency 1.5% in cases) was identified as an independent risk factor for AAA with an odds ratio (OR) of 6.00 (95%CI: 1.22, 29.41) when applied to the recessive model. No association was seen in the additive or dominant models. In a multivariate analysis using the most common haplotype (h.111, frequency 48.7%) as a reference, h.211 (frequency 4.4%) was an independent risk factor for AAA (OR 1.56, 95%CI: 1.02, 2.39). The IL-6 572G>C polymorphism (and h.211 haplotype) is associated with AAA, however it is too rare to be an important cause of most AAAs. This does not support the concept that the elevated level of IL-6 reported in patients with AAAs is a primary cause of the aneurysmal process.
Law, Kelsey B; Bronte-Tinkew, Dana; Di Pietro, Erminia; Snowden, Ann; Jones, Richard O; Moser, Ann; Brumell, John H; Braverman, Nancy; Kim, Peter K
2017-05-04
Peroxisome biogenesis disorders (PBDs) are metabolic disorders caused by the loss of peroxisomes. The majority of PBDs result from mutation in one of 3 genes that encode for the peroxisomal AAA ATPase complex (AAA-complex) required for cycling PEX5 for peroxisomal matrix protein import. Mutations in these genes are thought to result in a defect in peroxisome assembly by preventing the import of matrix proteins. However, we show here that loss of the AAA-complex does not prevent matrix protein import, but instead causes an upregulation of peroxisome degradation by macroautophagy, or pexophagy. The loss of AAA-complex function in cells results in the accumulation of ubiquitinated PEX5 on the peroxisomal membrane that signals pexophagy. Inhibiting autophagy by genetic or pharmacological approaches rescues peroxisome number, protein import and function. Our findings suggest that the peroxisomal AAA-complex is required for peroxisome quality control, whereas its absence results in the selective degradation of the peroxisome. Thus the loss of peroxisomes in PBD patients with mutations in their peroxisomal AAA-complex is a result of increased pexophagy. Our study also provides a framework for the development of novel therapeutic treatments for PBDs.
Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei
2011-07-01
ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.
Functional Diversity of AAA+ Protease Complexes in Bacillus subtilis
Elsholz, Alexander K. W.; Birk, Marlene S.; Charpentier, Emmanuelle; Turgay, K?r?ad
2017-01-01
Here, we review the diverse roles and functions of AAA+ protease complexes in protein homeostasis, control of stress response and cellular development pathways by regulatory and general proteolysis in the Gram-positive model organism Bacillus subtilis. We discuss in detail the intricate involvement of AAA+ protein complexes in controlling sporulation, the heat shock response and the role of adaptor proteins in these processes. The investigation of these protein complexes and their adaptor pro...
Regionalization of Emergent Vascular Surgery for Patients With Ruptured AAA Improves Outcomes.
Warner, Courtney J; Roddy, Sean P; Chang, Benjamin B; Kreienberg, Paul B; Sternbach, Yaron; Taggert, John B; Ozsvath, Kathleen J; Stain, Steven C; Darling, R Clement
2016-09-01
Safe and efficient endovascular aneurysm repair (EVAR) for ruptured abdominal aortic aneurysm (r-AAA) requires advanced infrastructure and surgical expertise not available at all US hospitals. The objective was to assess the impact of regionalizing r-AAA care to centers equipped for both open surgical repair (r-OSR) and EVAR (r-EVAR) by vascular surgeons. A retrospective review of all patients with r-AAA undergoing open or endovascular repair in a 12-hospital region. Patient demographics, transfer status, type of repair, and intraoperative variables were recorded. Outcomes included perioperative morbidity and mortality. Four hundred fifty-one patients with r-AAA were treated from 2002 to 2015. Three hundred twenty-one patients (71%) presented initially to community hospitals (CHs) and 130 (29%) presented to the tertiary medical center (MC). Of the 321 patients presenting to CH, 133 (41%) were treated locally (131 OSR; 2 EVAR) and 188 (59%) were transferred to the MC. In total, 318 patients were treated at the MC (122 OSR; 196 EVAR). At the MC, r-EVAR was associated with a lower mortality rate than r-OSR (20% vs 37%, P = 0.001). Transfer did not influence r-EVAR mortality (20% in r-EVAR presenting to MC vs 20% in r-EVAR transferred, P > 0.2). Overall, r-AAA mortality at the MC was 20% lower than CH (27% vs 46%, P AAA repair to centers equipped for both r-EVAR and r-OSR decreased mortality by approximately 20%. Transfer did not impact the mortality of r-EVAR at the tertiary center. Care of r-AAA in the US should be centralized to centers equipped with available technology and vascular surgeons.
AAA application in diagnosis exams in a large public hospital, RS, Brazil
International Nuclear Information System (INIS)
Bacelar, A.; Ferret, A.A.; Vanni, S.; Galhardi, M.P.; Lykawka, R.
2013-01-01
Objective: the initiative AAA - Awareness , Appropriateness and Audit , promotes consciousness ( Awareness) , fitness ( Appropriateness ) and Audit ( Audit) . This paper analyzes the application of the concept in the AAA requests and justifications examinations using ionizing radiation within a large public hospital. Materials and methods: we collected and analyzed data between the years 2011 and 2012, concerning the number of exams performed with the use of radiation and their justifications. After, we sought to raise awareness of the clinical team through training on the risks and benefits of the various modalities of the radiology department and the need to justify the use of ionizing radiation on health. After the data were collected again of test requests for verification of the effectiveness of training. Results: the mean requests that need to be appropriate to the AAA in the last quarter of 2011 was 75 % lower than the average demands of the first quarter, matched against the last two months of 2012 increased by up to four times the number requests that require improvements in relation to the excellent results obtained in July 2012. Conclusion: it is shown in this paper the need of implementing this initiative AAA continuously added to the clinical staff awareness about the risk of the use of ionizing radiation, the appropriateness of the requests of these tests , as well as the control of this process in order to optimize use of ionizing radiation on health
Fernandez-García, Carlos-Ernesto; Tarin, Carlos; Roldan-Montero, Raquel; Martinez-Lopez, Diego; Torres-Fonseca, Monica; Lindhot, Jes S; Vega de Ceniga, Melina; Egido, Jesus; Lopez-Andres, Natalia; Blanco-Colio, Luis-Miguel; Martín-Ventura, Jose-Luis
2017-11-15
Abdominal aortic aneurysm (AAA) evolution is unpredictable and no specific treatment exists for AAA, except surgery to prevent aortic rupture. Galectin-3 has been previously associated with CVD, but its potential role in AAA has not been addressed. Galectin-3 levels were increased in the plasma of AAA patients ( n =225) compared with the control group ( n =100). In addition, galectin-3 concentrations were associated with the need for surgical repair, independently of potential confounding factors. Galectin-3 mRNA and protein expression were increased in human AAA samples compared with healthy aortas. Experimental AAA in mice was induced via aortic elastase perfusion. Mice were treated intravenously with the galectin-3 inhibitor modified citrus pectin (MCP, 10 mg/kg, every other day) or saline. Similar to humans, galectin-3 serum and aortic mRNA levels were also increased in elastase-induced AAA mice compared with control mice. Mice treated with MCP showed decreased aortic dilation, as well as elastin degradation, vascular smooth muscle cell (VSMC) loss, and macrophage content at day 14 postelastase perfusion compared with control mice. The underlying mechanism(s) of the protective effect of MCP was associated with a decrease in galectin-3 and cytokine (mainly CCL5) mRNA and protein expression. Interestingly, galectin-3 induced CCL5 expression by a mechanism involving STAT3 activation in VSMC. Accordingly, MCP treatment decreased STAT3 phosphorylation in elastase-induced AAA. In conclusion, increased galectin-3 levels are associated with AAA progression, while galectin-3 inhibition decreased experimental AAA development. Our data suggest the potential role of galectin-3 as a therapeutic target in AAA. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
International Nuclear Information System (INIS)
Padmanaban, Sriram; Warren, Samantha; Walsh, Anthony; Partridge, Mike; Hawkins, Maria A
2014-01-01
To investigate systematic changes in dose arising when treatment plans optimised using the Anisotropic Analytical Algorithm (AAA) are recalculated using Acuros XB (AXB) in patients treated with definitive chemoradiotherapy (dCRT) for locally advanced oesophageal cancers. We have compared treatment plans created using AAA with those recalculated using AXB. Although the Anisotropic Analytical Algorithm (AAA) is currently more widely used in clinical routine, Acuros XB (AXB) has been shown to more accurately calculate the dose distribution, particularly in heterogeneous regions. Studies to predict clinical outcome should be based on modelling the dose delivered to the patient as accurately as possible. CT datasets from ten patients were selected for this retrospective study. VMAT (Volumetric modulated arc therapy) plans with 2 arcs, collimator rotation ± 5-10° and dose prescription 50 Gy / 25 fractions were created using Varian Eclipse (v10.0). The initial dose calculation was performed with AAA, and AXB plans were created by re-calculating the dose distribution using the same number of monitor units (MU) and multileaf collimator (MLC) files as the original plan. The difference in calculated dose to organs at risk (OAR) was compared using dose-volume histogram (DVH) statistics and p values were calculated using the Wilcoxon signed rank test. The potential clinical effect of dosimetric differences in the gross tumour volume (GTV) was evaluated using three different TCP models from the literature. PTV Median dose was apparently 0.9 Gy lower (range: 0.5 Gy - 1.3 Gy; p < 0.05) for VMAT AAA plans re-calculated with AXB and GTV mean dose was reduced by on average 1.0 Gy (0.3 Gy −1.5 Gy; p < 0.05). An apparent difference in TCP of between 1.2% and 3.1% was found depending on the choice of TCP model. OAR mean dose was lower in the AXB recalculated plan than the AAA plan (on average, dose reduction: lung 1.7%, heart 2.4%). Similar trends were seen for CRT plans
Identifying patients with AAA with the highest risk following endovascular repair.
Cadili, Ali; Turnbull, Robert; Hervas-Malo, Marilou; Ghosh, Sunita; Chyczij, Harold
2012-08-01
It has been demonstrated that endovascular repair of arterial disease results in reduced perioperative morbidity and mortality compared to open surgical repair. The rates of complications and need for reinterventions, however, have been found to be higher than that in open repair. The purpose of this study was to identify the predictors of endograft complications and mortality in patients undergoing endovascular abdominal aortic aneurysm (AAA) repair; specifically, our aim was to identify a subset of patients with AAA whose risk of periprocedure mortality was so high that they should not be offered endovascular repair. We undertook a prospective review of patients with AAA receiving endovascular therapy at a single institution. Collected variables included age, gender, date of procedure, indication for procedure, size of aneurysm (where applicable), type of endograft used, presence of rupture, American Society of Anesthesiologists (ASA) class, major medical comorbidities, type of anesthesia (general, epidural, or local), length of intensive care unit (ICU) stay, and length of hospital stay. These factors were correlated with the study outcomes (overall mortality, graft complications, morbidity, and reintervention) using univariate and multivariate logistic regression. A total of 199 patients underwent endovascular AAA repair during the study period. The ICU stay, again, was significantly correlated with the primary outcomes (death and graft complications). In addition, length of hospital stay greater than 3 days, also emerged as a statistically significant predictor of graft complications in this subgroup (P = .024). Survival analysis for patients with AAA revealed that age over 85 years and ICU stay were predictive of decreased survival. Statistical analysis for other subgroups of patients (inflammatory AAA or dissection) was not performed due to the small numbers in these subgroups. Patients with AAA greater than 85 years of age are at a greater risk of mortality
Directory of Open Access Journals (Sweden)
Frentzel Stefan
2010-06-01
Full Text Available Abstract Background Huntington's disease (HD is a progressive neurodegenerative disorder caused by a CAG repeat expansion within the huntingtin gene. Mutant huntingtin protein misfolds and accumulates within neurons where it mediates its toxic effects. Promoting mutant huntingtin clearance by activating macroautophagy is one approach for treating Huntington's disease (HD. In this study, we evaluated the mTOR kinase inhibitor and macroautophagy promoting drug everolimus in the R6/2 mouse model of HD. Results Everolimus decreased phosphorylation of the mTOR target protein S6 kinase indicating brain penetration. However, everolimus did not activate brain macroautophagy as measured by LC3B Western blot analysis. Everolimus protected against early declines in motor performance; however, we found no evidence for neuroprotection as determined by brain pathology. In muscle but not brain, everolimus significantly decreased soluble mutant huntingtin levels. Conclusions Our data suggests that beneficial behavioral effects of everolimus in R6/2 mice result primarily from effects on muscle. Even though everolimus significantly modulated its target brain S6 kinase, this did not decrease mutant huntingtin levels or provide neuroprotection.
MDRL lncRNA regulates the processing of miR-484 primary transcript by targeting miR-361.
Directory of Open Access Journals (Sweden)
Kun Wang
2014-07-01
Full Text Available Long noncoding RNAs (lncRNAs are emerging as new players in gene regulation, but whether lncRNAs operate in the processing of miRNA primary transcript is unclear. Also, whether lncRNAs are involved in the regulation of the mitochondrial network remains to be elucidated. Here, we report that a long noncoding RNA, named mitochondrial dynamic related lncRNA (MDRL, affects the processing of miR-484 primary transcript in nucleus and regulates the mitochondrial network by targeting miR-361 and miR-484. The results showed that miR-361 that predominantly located in nucleus can directly bind to primary transcript of miR-484 (pri-miR-484 and prevent its processing by Drosha into pre-miR-484. miR-361 is able to regulate mitochondrial fission and apoptosis by regulating miR-484 levels. In exploring the underlying molecular mechanism by which miR-361 is regulated, we identified MDRL and demonstrated that it could directly bind to miR-361 and downregulate its expression levels, which promotes the processing of pri-miR-484. MDRL inhibits mitochondrial fission and apoptosis by downregulating miR-361, which in turn relieves inhibition of miR-484 processing by miR-361. Our present study reveals a novel regulating model of mitochondrial fission program which is composed of MDRL, miR-361 and miR-484. Our work not only expands the function of the lncRNA pathway in gene regulation but also establishes a new mechanism for controlling miRNA expression.
Biros, E; Staffa, R
2011-12-01
Using retrospective analysis, we sought to investigate the incidence, risk factors and therapeutic outcomes of ischemic colitis in patients after surgical and endovascular repair of abdominal aortic aneurysms (AAA). The complete inpatient and outpatient medical records of all patients undergoing surgical or endovascular AAA repair in our Department from January 2005 to December 2009 were retrospectively reviewed. We selected all patients who had developed an acute or chronic form of postoperative large or small bowel ischemia. We carried out data analysis and focused on determining the incidence and risk factors of this complication and the outcomes of its treatment. Two hundred and seven AAA repairs were performed in the 2nd Department of Surgery of St. Anne's University Hospital in Brno and the Faculty of Medicine of Masaryk University in Brno during the studied period. This number includes endovascular AAA repairs (13 patients; 6.3%) as well as one robot-assisted operation, and also the whole clinical spectrum of AAA manifestations, from non-symptomatic forms to ruptured aneurysm forms. The rest of the patients underwent open operation. Bowel ischemia developed in a total of 11 patients (5.3 %), who all underwent open AAA repair. Six of these patients presented with non-ruptured AAA and the remaining 5 with ruptured AAA. In 3 patients, bowel ischemia was diagnosed with a delay of several months from the original revascularization operation in the clinical form of postischemic stricture of the large bowel (2 patients) or postischemic colitis (1 patient). 8 patients were diagnosed with acute ischemic colitis affecting an isolated segment of the small bowel in one patient, extended segments of the large bowel (descending colon + sigmoid colon + rectum) in 2 patients, and typically the descending and sigmoid colon in 5 patients. None of the three patients with late manifestation of ischemic colitis died. Of the 8 patients with acute presentation, resection of the
Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; González-Valdez, Abigail; Martínez-Rosas, Víctor; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Castillo-Rodríguez, Rosa Angélica; Cuevas-Cruz, Miguel; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto
2016-01-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency in humans causes severe disease, varying from mostly asymptomatic individuals to patients showing neonatal jaundice, acute hemolysis episodes or chronic nonspherocytic hemolytic anemia. In order to understand the effect of the mutations in G6PD gene function and its relation with G6PD deficiency severity, we report the construction, cloning and expression as well as the detailed kinetic and stability characterization of three purified clinical variants of G6PD that present in the Mexican population: G6PD Zacatecas (Class I), Vanua-Lava (Class II) and Viangchan (Class II). For all the G6PD mutants, we obtained low purification yield and altered kinetic parameters compared with Wild Type (WT). Our results show that the mutations, regardless of the distance from the active site where they are located, affect the catalytic properties and structural parameters and that these changes could be associated with the clinical presentation of the deficiency. Specifically, the structural characterization of the G6PD Zacatecas mutant suggests that the R257L mutation have a strong effect on the global stability of G6PD favoring an unstable active site. Using computational analysis, we offer a molecular explanation of the effects of these mutations on the active site. PMID:27213370
Assessment of the accuracy of AortaScan for detection of abdominal aortic aneurysm (AAA).
Abbas, A; Smith, A; Cecelja, M; Waltham, M
2012-02-01
AortaScan AMI 9700 is a portable 3D ultrasound device that automatically measures the maximum diameter of the abdominal aorta without the need for a trained sonographer. It is designed to rapidly diagnose or exclude an AAA and may have particular use in screening programs. Our objective was to determine its accuracy to detect AAA. Subjects from our AAA screening and surveillance programs were examined. The aorta was scanned using the AortaScan and computed tomography (CT). Ninety-one subjects underwent imaging (44 AAA on conventional ultrasound surveillance and 47 controls). The largest measurement obtained by AortaScan was compared against the CT-aortic measurement. The mean aortic diameter was 2.8 cm. The CT scan confirmed the diagnosis of AAA in 43 subjects. There was one false positive measurement on conventional ultrasound. AortaScan missed the diagnosis of AAA in eight subjects. There were thirteen false positive measurements. The sensitivity, specificity, positive and negative predictive values were 81%, 72%, 72% and 81% respectively. A device to detect AAA without the need for a trained operator would have potential in a community-based screening programme. The AortaScan, however, lacks adequate sensitivity and significant technical improvement is necessary before it could be considered a replacement for trained screening personnel. Copyright © 2011 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Bechel Nevada
2004-01-01
This Streamlined Approach for Environmental Restoration plan details the activities necessary to close Corrective Action Unit (CAU) 484: Surface Debris, Waste Sites, and Burn Area (Tonopah Test Range). CAU 484 consists of sites located at the Tonopah Test Range, Nevada, and is currently listed in Appendix III of the Federal Facility Agreement and Consent Order. CAU 484 consists of the following six Corrective Action Sites: (1) CAS RG-52-007-TAML, Davis Gun Penetrator Test; (2) CAS TA-52-001-TANL, NEDS Detonation Area; (3) CAS TA-52-004-TAAL, Metal Particle Dispersion Test; (4) CAS TA-52-005-TAAL, Joint Test Assembly DU Sites; (5) CAS TA-52-006-TAPL, Depleted Uranium Site; and (6) CAS TA-54-001-TANL, Containment Tank and Steel Structure
Ambler, Graeme K; Gohel, Manjit S; Mitchell, David C; Loftus, Ian M; Boyle, Jonathan R
2015-01-01
Accurate adjustment of surgical outcome data for risk is vital in an era of surgeon-level reporting. Current risk prediction models for abdominal aortic aneurysm (AAA) repair are suboptimal. We aimed to develop a reliable risk model for in-hospital mortality after intervention for AAA, using rigorous contemporary statistical techniques to handle missing data. Using data collected during a 15-month period in the United Kingdom National Vascular Database, we applied multiple imputation methodology together with stepwise model selection to generate preoperative and perioperative models of in-hospital mortality after AAA repair, using two thirds of the available data. Model performance was then assessed on the remaining third of the data by receiver operating characteristic curve analysis and compared with existing risk prediction models. Model calibration was assessed by Hosmer-Lemeshow analysis. A total of 8088 AAA repair operations were recorded in the National Vascular Database during the study period, of which 5870 (72.6%) were elective procedures. Both preoperative and perioperative models showed excellent discrimination, with areas under the receiver operating characteristic curve of .89 and .92, respectively. This was significantly better than any of the existing models (area under the receiver operating characteristic curve for best comparator model, .84 and .88; P AAA repair. These models were carefully developed with rigorous statistical methodology and significantly outperform existing methods for both elective cases and overall AAA mortality. These models will be invaluable for both preoperative patient counseling and accurate risk adjustment of published outcome data. Copyright © 2015 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Badkul, R; Nicolai, W; Pokhrel, D; Jiang, H; Wang, F; Lominskac, C [University of Kansas Medical Center, Kansas City, KS (United States); Ramanjappa, T [S. K. University, Anantapur, AP (India)
2016-06-15
Purpose: To compare the impact of Pencil Beam(PB) and Anisotropic Analytic Algorithm(AAA) dose calculation algorithms on OARs and planning target volume (PTV) in thoracic spine stereotactic body radiation therapy (SBRT). Methods: Ten Spine SBRT patients were planned on Brainlab iPlan system using hybrid plan consisting of 1–2 non-coplanar conformal-dynamic arcs and few IMRT beams treated on NovalisTx with 6MV photon. Dose prescription varied from 20Gy to 30Gy in 5 fractions depending on the situation of the patient. PB plans were retrospectively recalculated using the Varian Eclipse with AAA algorithm using same MUs, MLC pattern and grid size(3mm).Differences in dose volume parameters for PTV, spinal cord, lung, and esophagus were analyzed and compared for PB and AAA algorithms. OAR constrains were followed per RTOG-0631. Results: Since patients were treated using PB calculation, we compared all the AAA DVH values with respect to PB plan values as standard, although AAA predicts the dose more accurately than PB. PTV(min), PTV(Max), PTV(mean), PTV(D99%), PTV(D90%) were overestimated with AAA calculation on average by 3.5%, 1.84%, 0.95%, 3.98% and 1.55% respectively as compared to PB. All lung DVH parameters were underestimated with AAA algorithm mean deviation of lung V20, V10, V5, and 1000cc were 42.81%,19.83%, 18.79%, and 18.35% respectively. AAA overestimated Cord(0.35cc) by mean of 17.3%; cord (0.03cc) by 12.19% and cord(max) by 10.5% as compared to PB. Esophagus max dose were overestimated by 4.4% and 5cc by 3.26% for AAA algorithm as compared to PB. Conclusion: AAA overestimated the PTV dose values by up to 4%.The lung DVH had the greatest underestimation of dose by AAA versus PB. Spinal cord dose was overestimated by AAA versus PB. Given the critical importance of accuracy of OAR and PTV dose calculation for SBRT spine, more accurate algorithms and validation of calculated doses in phantom models are indicated.
Levels of H-ras codon 61 CAA to AAA mutation: response to 4-ABP-treatment and Pms2-deficiency.
Parsons, Barbara L; Delongchamp, Robert R; Beland, Frederick A; Heflich, Robert H
2006-01-01
DNA mismatch repair (MMR) deficiencies result in increased frequencies of spontaneous mutation and tumor formation. In the present study, we tested the hypothesis that a chemically-induced mutational response would be greater in a mouse with an MMR-deficiency than in the MMR-proficient mouse models commonly used to assay for chemical carcinogenicity. To accomplish this, the induction of H-ras codon 61 CAA-->AAA mutation was examined in Pms2 knockout mice (Pms2-/-, C57BL/6 background) and sibling wild-type mice (Pms2+/+). Groups of five or six neonatal male mice were treated with 0.3 micromol 4-aminobiphenyl (4-ABP) or the vehicle control, dimethylsulfoxide. Eight months after treatment, liver DNAs were isolated and analysed for levels of H-ras codon 61 CAA-->AAA mutation using allele-specific competitive blocker-PCR. In Pms2-proficient and Pms2-deficient mice, 4-ABP treatment caused an increase in mutant fraction (MF) from 1.65x10(-5) to 2.91x10(-5) and from 3.40x10(-5) to 4.70x10(-5), respectively. Pooling data from 4-ABP-treated and control mice, the approximately 2-fold increase in MF observed in Pms2-deficient as compared with Pms2-proficient mice was statistically significant (P=0.0207) and consistent with what has been reported previously in terms of induction of G:C-->T:A mutation in a Pms2-deficient background. Pooling data from both genotypes, the increase in H-ras MF in 4-ABP-treated mice, as compared with control mice, did not reach the 95% confidence level of statistical significance (P=0.0606). The 4-ABP treatment caused a 1.76-fold and 1.38-fold increase in average H-ras MF in Pms2-proficient and Pms2-deficient mice, respectively. Furthermore, the levels of induced mutation in Pms2-proficient and Pms2-deficient mice were nearly identical (1.26x10(-5) and 1.30x10(-5), respectively). We conclude that Pms2-deficiency does not result in an amplification of the H-ras codon 61 CAA-->AAA mutational response induced by 4-ABP.
Dosimetric comparison of peripheral NSCLC SBRT using Acuros XB and AAA calculation algorithms.
Ong, Chloe C H; Ang, Khong Wei; Soh, Roger C X; Tin, Kah Ming; Yap, Jerome H H; Lee, James C L; Bragg, Christopher M
2017-01-01
There is a concern for dose calculation in highly heterogenous environments such as the thorax region. This study compares the quality of treatment plans of peripheral non-small cell lung cancer (NSCLC) stereotactic body radiation therapy (SBRT) using 2 calculation algorithms, namely, Eclipse Anisotropic Analytical Algorithm (AAA) and Acuros External Beam (AXB), for 3-dimensional conformal radiation therapy (3DCRT) and volumetric-modulated arc therapy (VMAT). Four-dimensional computed tomography (4DCT) data from 20 anonymized patients were studied using Varian Eclipse planning system, AXB, and AAA version 10.0.28. A 3DCRT plan and a VMAT plan were generated using AAA and AXB with constant plan parameters for each patient. The prescription and dose constraints were benchmarked against Radiation Therapy Oncology Group (RTOG) 0915 protocol. Planning parameters of the plan were compared statistically using Mann-Whitney U tests. Results showed that 3DCRT and VMAT plans have a lower target coverage up to 8% when calculated using AXB as compared with AAA. The conformity index (CI) for AXB plans was 4.7% lower than AAA plans, but was closer to unity, which indicated better target conformity. AXB produced plans with global maximum doses which were, on average, 2% hotter than AAA plans. Both 3DCRT and VMAT plans were able to achieve D95%. VMAT plans were shown to be more conformal (CI = 1.01) and were at least 3.2% and 1.5% lower in terms of PTV maximum and mean dose, respectively. There was no statistically significant difference for doses received by organs at risk (OARs) regardless of calculation algorithms and treatment techniques. In general, the difference in tissue modeling for AXB and AAA algorithm is responsible for the dose distribution between the AXB and the AAA algorithms. The AXB VMAT plans could be used to benefit patients receiving peripheral NSCLC SBRT. Copyright © 2017 American Association of Medical Dosimetrists. Published by Elsevier Inc. All rights
Parallel Agent-as-a-Service (P-AaaS Based Geospatial Service in the Cloud
Directory of Open Access Journals (Sweden)
Xicheng Tan
2017-04-01
Full Text Available To optimize the efficiency of the geospatial service in the flood response decision making system, a Parallel Agent-as-a-Service (P-AaaS method is proposed and implemented in the cloud. The prototype system and comparisons demonstrate the advantages of our approach over existing methods. The P-AaaS method includes both parallel architecture and a mechanism for adjusting the computational resources—the parallel geocomputing mechanism of the P-AaaS method used to execute a geospatial service and the execution algorithm of the P-AaaS based geospatial service chain, respectively. The P-AaaS based method has the following merits: (1 it inherits the advantages of the AaaS-based method (i.e., avoiding transfer of large volumes of remote sensing data or raster terrain data, agent migration, and intelligent conversion into services to improve domain expert collaboration; (2 it optimizes the low performance and the concurrent geoprocessing capability of the AaaS-based method, which is critical for special applications (e.g., highly concurrent applications and emergency response applications; and (3 it adjusts the computing resources dynamically according to the number and the performance requirements of concurrent requests, which allows the geospatial service chain to support a large number of concurrent requests by scaling up the cloud-based clusters in use and optimizes computing resources and costs by reducing the number of virtual machines (VMs when the number of requests decreases.
AAA+ Machines of Protein Destruction in Mycobacteria.
Alhuwaider, Adnan Ali H; Dougan, David A
2017-01-01
The bacterial cytosol is a complex mixture of macromolecules (proteins, DNA, and RNA), which collectively are responsible for an enormous array of cellular tasks. Proteins are central to most, if not all, of these tasks and as such their maintenance (commonly referred to as protein homeostasis or proteostasis) is vital for cell survival during normal and stressful conditions. The two key aspects of protein homeostasis are, (i) the correct folding and assembly of proteins (coupled with their delivery to the correct cellular location) and (ii) the timely removal of unwanted or damaged proteins from the cell, which are performed by molecular chaperones and proteases, respectively. A major class of proteins that contribute to both of these tasks are the AAA+ (ATPases associated with a variety of cellular activities) protein superfamily. Although much is known about the structure of these machines and how they function in the model Gram-negative bacterium Escherichia coli , we are only just beginning to discover the molecular details of these machines and how they function in mycobacteria. Here we review the different AAA+ machines, that contribute to proteostasis in mycobacteria. Primarily we will focus on the recent advances in the structure and function of AAA+ proteases, the substrates they recognize and the cellular pathways they control. Finally, we will discuss the recent developments related to these machines as novel drug targets.
Functional Diversity of AAA+ Protease Complexes in Bacillus subtilis
Elsholz, Alexander K. W.; Birk, Marlene S.; Charpentier, Emmanuelle; Turgay, Kürşad
2017-01-01
Here, we review the diverse roles and functions of AAA+ protease complexes in protein homeostasis, control of stress response and cellular development pathways by regulatory and general proteolysis in the Gram-positive model organism Bacillus subtilis. We discuss in detail the intricate involvement of AAA+ protein complexes in controlling sporulation, the heat shock response and the role of adaptor proteins in these processes. The investigation of these protein complexes and their adaptor proteins has revealed their relevance for Gram-positive pathogens and their potential as targets for new antibiotics. PMID:28748186
Functional Diversity of AAA+ Protease Complexes in Bacillus subtilis.
Elsholz, Alexander K W; Birk, Marlene S; Charpentier, Emmanuelle; Turgay, Kürşad
2017-01-01
Here, we review the diverse roles and functions of AAA+ protease complexes in protein homeostasis, control of stress response and cellular development pathways by regulatory and general proteolysis in the Gram-positive model organism Bacillus subtilis . We discuss in detail the intricate involvement of AAA+ protein complexes in controlling sporulation, the heat shock response and the role of adaptor proteins in these processes. The investigation of these protein complexes and their adaptor proteins has revealed their relevance for Gram-positive pathogens and their potential as targets for new antibiotics.
International Nuclear Information System (INIS)
Bufacchi, Antonella; Nardiello, Barbara; Capparella, Roberto; Begnozzi, Luisa
2013-01-01
Retrospective analysis of 3D clinical treatment plans to investigate qualitative, possible, clinical consequences of the use of PBC versus AAA. The 3D dose distributions of 80 treatment plans at four different tumour sites, produced using PBC algorithm, were recalculated using AAA and the same number of monitor units provided by PBC and clinically delivered to each patient; the consequences of the difference on the dose-effect relations for normal tissue injury were studied by comparing different NTCP model/parameters extracted from a review of published studies. In this study the AAA dose calculation is considered as benchmark data. The paired Student t-test was used for statistical comparison of all results obtained from the use of the two algorithms. In the prostate plans, the AAA predicted lower NTCP value (NTCP AAA ) for the risk of late rectal bleeding for each of the seven combinations of NTCP parameters, the maximum mean decrease was 2.2%. In the head-and-neck treatments, each combination of parameters used for the risk of xerostemia from irradiation of the parotid glands involved lower NTCP AAA , that varied from 12.8% (sd=3.0%) to 57.5% (sd=4.0%), while when the PBC algorithm was used the NTCP PBC ’s ranging was from 15.2% (sd=2.7%) to 63.8% (sd=3.8%), according the combination of parameters used; the differences were statistically significant. Also NTCP AAA regarding the risk of radiation pneumonitis in the lung treatments was found to be lower than NTCP PBC for each of the eight sets of NTCP parameters; the maximum mean decrease was 4.5%. A mean increase of 4.3% was found when the NTCP AAA was calculated by the parameters evaluated from dose distribution calculated by a convolution-superposition (CS) algorithm. A markedly different pattern was observed for the risk relating to the development of pneumonitis following breast treatments: the AAA predicted higher NTCP value. The mean NTCP AAA varied from 0.2% (sd = 0.1%) to 2.1% (sd = 0.3%), while the
An, Young Jun; Na, Jung-Hyun; Kim, Myung-Il; Cha, Sun-Shin
2015-10-01
Lon proteases degrade defective or denature proteins as well as some folded proteins for the control of cellular protein quality. There are two types of Lon proteases, LonA and LonB. Each consists of two functional components: a protease component and an ATPase associated with various cellular activities (AAA+ module). Here, we report the 2.03 -resolution crystal structure of the isolated AAA+ module (iAAA+ module) of LonB from Thermococcus onnurineus NA1 (TonLonB). The iAAA+ module, having no bound nucleotide, adopts a conformation virtually identical to the ADP-bound conformation of AAA+ modules in the hexameric structure of TonLonB; this provides insights into the ATP-independent proteolytic activity observed in a LonB protease. Structural comparison of AAA+ modules between LonA and LonB revealed that the AAA+ modules of Lon proteases are separated into two distinct clades depending on their structural features. The AAA+ module of LonB belongs to the -H2 & Ins1 insert clade (HINS clade)- defined for the first time in this study, while the AAA+ module of LonA is a member of the HCLR clade.
The AAA protein spastin possesses two levels of basal ATPase activity.
Fan, Xiangyu; Lin, Zhijie; Fan, Guanghui; Lu, Jing; Hou, Yongfei; Habai, Gulijiazi; Sun, Linyue; Yu, Pengpeng; Shen, Yuequan; Wen, Maorong; Wang, Chunguang
2018-04-30
The AAA ATPase spastin is a microtubule-severing enzyme that plays important roles in various cellular events including axon regeneration. Herein, we found that the basal ATPase activity of spastin is negatively regulated by spastin concentration. By determining a spastin crystal structure, we demonstrate the necessity of intersubunit interactions between spastin AAA domains. Neutralization of the positive charges in the microtubule-binding domain (MTBD) of spastin dramatically decreases the ATPase activity at low concentration, although the ATP-hydrolyzing potential is not affected. These results demonstrate that, in addition to the AAA domain, the MTBD region of spastin is also involved in regulating ATPase activity, making interactions between spastin protomers more complicated than expected. © 2018 Federation of European Biochemical Societies.
Clinical implementation of AXB from AAA for breast: Plan quality and subvolume analysis.
Guebert, Alexandra; Conroy, Leigh; Weppler, Sarah; Alghamdi, Majed; Conway, Jessica; Harper, Lindsay; Phan, Tien; Olivotto, Ivo A; Smith, Wendy L; Quirk, Sarah
2018-04-25
Two dose calculation algorithms are available in Varian Eclipse software: Anisotropic Analytical Algorithm (AAA) and Acuros External Beam (AXB). Many Varian Eclipse-based centers have access to AXB; however, a thorough understanding of how it will affect plan characteristics and, subsequently, clinical practice is necessary prior to implementation. We characterized the difference in breast plan quality between AXB and AAA for dissemination to clinicians during implementation. Locoregional irradiation plans were created with AAA for 30 breast cancer patients with a prescription dose of 50 Gy to the breast and 45 Gy to the regional node, in 25 fractions. The internal mammary chain (IMC CTV ) nodes were covered by 80% of the breast dose. AXB, both dose-to-water and dose-to-medium reporting, was used to recalculate plans while maintaining constant monitor units. Target coverage and organ-at-risk doses were compared between the two algorithms using dose-volume parameters. An analysis to assess location-specific changes was performed by dividing the breast into nine subvolumes in the superior-inferior and left-right directions. There were minimal differences found between the AXB and AAA calculated plans. The median difference between AXB and AAA for breast CTV V 95% , was AAA for breast radiotherapy is not expected to result in changes in clinical practice for prescribing or planning breast radiotherapy. © 2018 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.
Regioselective alkane hydroxylation with a mutant CYP153A6 enzyme
Koch, Daniel J.; Arnold, Frances H.
2013-01-29
Cytochrome P450 CYP153A6 from Myobacterium sp. strain HXN1500 was engineered using in-vivo directed evolution to hydroxylate small-chain alkanes regioselectively. Mutant CYP153A6-BMO1 selectively hydroxylates butane and pentane at the terminal carbon to form 1-butanol and 1-pentanol, respectively, at rates greater than wild-type CYP153A6 enzymes. This biocatalyst is highly active for small-chain alkane substrates and the regioselectivity is retained in whole-cell biotransformations.
International Nuclear Information System (INIS)
Yeom, Mi Suk; Bae, Seong Soo; Kim, Dae Sup; Back, Geum Mun
2012-01-01
Anisotropic Analytical Algorithm (AAA) provides more accurate dose calculation regarding impact on scatter and tissue inhomogeneity in comparison to Pencil Beam Convolution (PBC) algorithm. This study tries to analyze the difference of dose distribution according to PBC algorithm and dose calculation algorithm of AAA on breast cancer tangential plan. Computerized medical care plan using Eclipse treatment planning system (version 8.9, VARIAN, USA) has been established for the 10 breast cancer patients using 6 MV energy of Linac (CL-6EX, VARIAN, USA). After treatment plan of Conventional Radiation Therapy plan (Conventional plan) and Field-in-Field Intensity Modulated Radiation Therapy plan (FiF plan) using PBC algorithm has been established, MU has been fixed, implemented dose calculation after changing it to AAA, and compared and analyzed treatment plan using Dose Volume Histogram (DVH). Firstly, as a result of evaluating PBC algorithm of Conventional plan and the difference according to AAA, the average difference of CI value on target volume has been highly estimated by 0.295 on PBC algorithm and as a result of evaluating dose of lung, V 47 Gy and has been highly evaluated by 5.83% and 4.04% each, Mean dose, V 20 , V 5 , V 3 Gy has been highly evaluated 0.6%, 0.29%, 6.35%, 10.23% each on AAA. Secondly, in case of FiF plan, the average difference of CI value on target volume has been highly evaluated on PBC algorithm by 0.165, and dose on ipsilateral lung, V 47 , V 45 Gy, Mean dose has been highly evaluated 6.17%, 3.80%, 0.15% each on PBC algorithm, V 20 , V 5 , V 3 Gy has been highly evaluated 0.14%, 4.07%, 4.35% each on AAA. When calculating with AAA on breast cancer tangential plan, compared to PBC algorithm, Conformity on target volume of Conventional plan, FiF plan has been less evaluated by 0.295, 0.165 each. For the reason that dose of high dose region of ipsilateral lung has been showed little amount, and dose of low dose region has been showed much amount
The Airborne Astronomy Ambassadors (AAA) Program and NASA Astrophysics Connections
Backman, Dana Edward; Clark, Coral; Harman, Pamela
2018-01-01
The NASA Airborne Astronomy Ambassadors (AAA) program is a three-part professional development (PD) experience for high school physics, astronomy, and earth science teachers. AAA PD consists of: (1) blended learning via webinars, asynchronous content delivery, and in-person workshops, (2) a STEM immersion experience at NASA Armstrong’s B703 science research aircraft facility in Palmdale, California, including interactions with NASA astrophysics & planetary science Subject Matter Experts (SMEs) during science flights on SOFIA, and (3) continuing post-flight opportunities for teacher & student connections with SMEs.
International Nuclear Information System (INIS)
Yaparpalvi, R; Mynampati, D; Kuo, H; Garg, M; Tome, W; Kalnicki, S
2016-01-01
Purpose: To study the influence of superposition-beam model (AAA) and determinant-photon transport-solver (Acuros XB) dose calculation algorithms on the treatment plan quality metrics and on normal lung dose in Lung SBRT. Methods: Treatment plans of 10 Lung SBRT patients were randomly selected. Patients were prescribed to a total dose of 50-54Gy in 3–5 fractions (10?5 or 18?3). Doses were optimized accomplished with 6-MV using 2-arcs (VMAT). Doses were calculated using AAA algorithm with heterogeneity correction. For each plan, plan quality metrics in the categories- coverage, homogeneity, conformity and gradient were quantified. Repeat dosimetry for these AAA treatment plans was performed using AXB algorithm with heterogeneity correction for same beam and MU parameters. Plan quality metrics were again evaluated and compared with AAA plan metrics. For normal lung dose, V_2_0 and V_5 to (Total lung- GTV) were evaluated. Results: The results are summarized in Supplemental Table 1. PTV volume was mean 11.4 (±3.3) cm"3. Comparing RTOG 0813 protocol criteria for conformality, AXB plans yielded on average, similar PITV ratio (individual PITV ratio differences varied from −9 to +15%), reduced target coverage (−1.6%) and increased R50% (+2.6%). Comparing normal lung doses, the lung V_2_0 (+3.1%) and V_5 (+1.5%) were slightly higher for AXB plans compared to AAA plans. High-dose spillage ((V105%PD - PTV)/ PTV) was slightly lower for AXB plans but the % low dose spillage (D2cm) was similar between the two calculation algorithms. Conclusion: AAA algorithm overestimates lung target dose. Routinely adapting to AXB for dose calculations in Lung SBRT planning may improve dose calculation accuracy, as AXB based calculations have been shown to be closer to Monte Carlo based dose predictions in accuracy and with relatively faster computational time. For clinical practice, revisiting dose-fractionation in Lung SBRT to correct for dose overestimates attributable to algorithm
Energy Technology Data Exchange (ETDEWEB)
Yaparpalvi, R; Mynampati, D; Kuo, H; Garg, M; Tome, W; Kalnicki, S [Montefiore Medical Center, Bronx, NY (United States)
2016-06-15
Purpose: To study the influence of superposition-beam model (AAA) and determinant-photon transport-solver (Acuros XB) dose calculation algorithms on the treatment plan quality metrics and on normal lung dose in Lung SBRT. Methods: Treatment plans of 10 Lung SBRT patients were randomly selected. Patients were prescribed to a total dose of 50-54Gy in 3–5 fractions (10?5 or 18?3). Doses were optimized accomplished with 6-MV using 2-arcs (VMAT). Doses were calculated using AAA algorithm with heterogeneity correction. For each plan, plan quality metrics in the categories- coverage, homogeneity, conformity and gradient were quantified. Repeat dosimetry for these AAA treatment plans was performed using AXB algorithm with heterogeneity correction for same beam and MU parameters. Plan quality metrics were again evaluated and compared with AAA plan metrics. For normal lung dose, V{sub 20} and V{sub 5} to (Total lung- GTV) were evaluated. Results: The results are summarized in Supplemental Table 1. PTV volume was mean 11.4 (±3.3) cm{sup 3}. Comparing RTOG 0813 protocol criteria for conformality, AXB plans yielded on average, similar PITV ratio (individual PITV ratio differences varied from −9 to +15%), reduced target coverage (−1.6%) and increased R50% (+2.6%). Comparing normal lung doses, the lung V{sub 20} (+3.1%) and V{sub 5} (+1.5%) were slightly higher for AXB plans compared to AAA plans. High-dose spillage ((V105%PD - PTV)/ PTV) was slightly lower for AXB plans but the % low dose spillage (D2cm) was similar between the two calculation algorithms. Conclusion: AAA algorithm overestimates lung target dose. Routinely adapting to AXB for dose calculations in Lung SBRT planning may improve dose calculation accuracy, as AXB based calculations have been shown to be closer to Monte Carlo based dose predictions in accuracy and with relatively faster computational time. For clinical practice, revisiting dose-fractionation in Lung SBRT to correct for dose overestimates
SU-E-P-16: A Feasibility Study of Using Eclipse AAA for SRS Treatement
International Nuclear Information System (INIS)
Lim, S; LoSasso, T
2015-01-01
Purpose: To commission Varian Eclipse AAA for SRS treatment and compare the accuracy with Brainlab iPlan system for clinical cases measured with radiochromic film. Methods: A 6MV AAA clinical model for a Varian TrueBeam STx is used as baseline. The focal spot and field size of the baseline model(BASE) are (1.75,0.75) and 40×40cm 2 respectively. Maximum field sizes, output factors(S t ), FWHM focal spot and secondary source sizes are systematically adjusted to obtain an optimized model(OPT) by comparing the calculated PDD’s, profiles, and output factors with measurements taken with a stereotactic diode(SD) and, cc01 and cc04 ion chambers in Blue Phantom. In-phantom dose distributions of clinical SRS fields are calculated using the OPT and the clinical Brainlab iPlan pencil-beam. Within the 90% isodose-line(ROI), the average dose difference between the calculations and radiochromic film measurements are assessed. Results: The maximum field, focal spot and secondary source sizes for the OPT are 15×15cm 2 , (0,0), and 32.3mm respectively. The OPT St input at 1.0 and 2.0cm fields are increased by 4.5% and 1.5% from BASE. The calculated output of the BASE and OPT underestimate by 16.1%–3.2% respectively at 0.5×0.5cm 2 field and 3.1%−0.02% respectively at 1.0×1.0cm 2 field. The depth doses at 10cm are within 3.5% and 0.4% of measurements for 0.5×0.5 and 1.0×1.0cm 2 . The ROI dose of OPT and iPlan are within 1.6% and 0.6% of film measurements for 3.0cm clinical fields. For 1.0cm fields, the ROI dose of OPT underestimate 0.0–2.0% and iPlan overestimates 1.7–2.9% relative to measurements. Conclusion: The small field dose calculation of Eclipse AAA algorithm can be significantly improved by carefully adjusting the input parameters. The larger deviation of the OPT for 0.5×0.5cm 2 field from measurements can be attributed to the lowest 1.0cm field size input limit of AAA. The OPT compares reasonably well with the iPlan pencil-beam and measurements
SU-E-P-16: A Feasibility Study of Using Eclipse AAA for SRS Treatement
Energy Technology Data Exchange (ETDEWEB)
Lim, S; LoSasso, T [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)
2015-06-15
Purpose: To commission Varian Eclipse AAA for SRS treatment and compare the accuracy with Brainlab iPlan system for clinical cases measured with radiochromic film. Methods: A 6MV AAA clinical model for a Varian TrueBeam STx is used as baseline. The focal spot and field size of the baseline model(BASE) are (1.75,0.75) and 40×40cm{sup 2} respectively. Maximum field sizes, output factors(S{sub t}), FWHM focal spot and secondary source sizes are systematically adjusted to obtain an optimized model(OPT) by comparing the calculated PDD’s, profiles, and output factors with measurements taken with a stereotactic diode(SD) and, cc01 and cc04 ion chambers in Blue Phantom. In-phantom dose distributions of clinical SRS fields are calculated using the OPT and the clinical Brainlab iPlan pencil-beam. Within the 90% isodose-line(ROI), the average dose difference between the calculations and radiochromic film measurements are assessed. Results: The maximum field, focal spot and secondary source sizes for the OPT are 15×15cm{sup 2}, (0,0), and 32.3mm respectively. The OPT St input at 1.0 and 2.0cm fields are increased by 4.5% and 1.5% from BASE. The calculated output of the BASE and OPT underestimate by 16.1%–3.2% respectively at 0.5×0.5cm{sup 2} field and 3.1%−0.02% respectively at 1.0×1.0cm{sup 2} field. The depth doses at 10cm are within 3.5% and 0.4% of measurements for 0.5×0.5 and 1.0×1.0cm{sup 2}. The ROI dose of OPT and iPlan are within 1.6% and 0.6% of film measurements for 3.0cm clinical fields. For 1.0cm fields, the ROI dose of OPT underestimate 0.0–2.0% and iPlan overestimates 1.7–2.9% relative to measurements. Conclusion: The small field dose calculation of Eclipse AAA algorithm can be significantly improved by carefully adjusting the input parameters. The larger deviation of the OPT for 0.5×0.5cm{sup 2} field from measurements can be attributed to the lowest 1.0cm field size input limit of AAA. The OPT compares reasonably well with the iPlan pencil
Biochemical fate of N6 substituted purines (cytokinins) in normal ripening and mutant tomatoes
International Nuclear Information System (INIS)
Long, A.R.
1987-01-01
The initial rates of disappearance of cytokinins, as determined by high pressure liquid chromatography, for tomatoes which were vacuum infused with benzyladenine and isopentenyladenine were dissimilar between the normal ripening (Ohio CR-6 and Rutgers), ripening inhibited mutant (RIN) and non-ripening mutant (NOR) tomato varieties. Radiolabeled [8- 14 C]Benzyladenine metabolism was followed during a 2 h period utilizing thin layer chromatography and visualization by fluorography. The [8- 14 C]Benzyladenine metabolite patterns were different among the varieties. The [8- 14 C]Benzyladenine metabolite pattern in Ohio CR-6 tomato changed as the fruit ripened
Morphological State as a Predictor for Reintervention and Mortality After EVAR for AAA
Energy Technology Data Exchange (ETDEWEB)
Ohrlander, Tomas [Eksjoe County Hospital (Sweden); Dencker, Magnus [Malmoe University Hospital, Department of Clinical Physiology and Nuclear Medicine (Sweden); Acosta, Stefan, E-mail: stefan.acosta@telia.com [Malmoe University Hospital, Vascular Center Malmoe-Lund (Sweden)
2012-10-15
Purpose: This study was designed to assess aorto-iliac morphological characteristics in relation to reintervention and all-cause long-term mortality in patients undergoing standard EVAR for infrarenal AAA. Methods: Patients treated with EVAR (Zenith{sup Registered-Sign} Stentgrafts, Cook) between May 1998 and February 2006 were prospectively enrolled in a computerized database where comorbidities and preoperative aneurysm morphology were entered. Reinterventions and mortality were checked until December 1, 2010. Median follow-up time was 68 months. Results: A total of 304 patients were included, of which 86% were men. Median age was 74 years. The reintervention rate was 23.4% (71/304). A greater diameter of the common iliac artery (p = 0.037; hazard ratio (HR) 1.037 [1.002-1.073]) was an independent factor for an increased number of reinterventions. The 30-day mortality rate was 3.0% (9/304). Aneurysm-related deaths due to AAA occurred in 4.9% (15/304). Five patients died due to a concomitant ruptured thoracic aortic aneurysm. The mortality until end of follow-up was 54.3% (165/304). The proportion of deaths caused by vascular diseases was 61.6%. The severity of angulation of the iliac arteries (p = 0.014; HR 1.018 [95% confidence interval (CI) 1.004-1.033]) and anemia (p = 0.044; HR 2.79 [95% CI 1.029-7.556]) remained as independent factors associated with all-cause long-term mortality. The crude reintervention-free survival rate at 1, 3, and 5 years was 84.5%, 64.8%, and 51.6%, respectively. Conclusions: The initial aorto-iliac morphological state in patients scheduled for standard EVAR for AAA seems to be strongly related to the need for reinterventions and long-term mortality.
From one body mutant to one cell mutant. A progress of radiation breeding in crops
International Nuclear Information System (INIS)
Nagatomi, Shigeki
1996-01-01
An effective method was established to obtain non-chimeral mutants with wide spectrum of flower colors, regenerated from floral organs on which mutated sectors were come out on chronic irradiated plants. By this way, six mutant varieties of flower colors have been selected from one pink flower of chrysanthemum, and cultivated for cut-flower production. By the same method, 3 mutant varieties with small and spray type flowers were selected in Eustoma. Mutant varieties such as a rust disease resistant in sugarcane, 6 dwarfs in Cytisus and pure-white mushroom in velvet shank have been selected successively for short period. (J.P.N.)
Spontaneous and radiation-induced leukemogenesis of the mouse small eye mutant, Pax6Sey3H
International Nuclear Information System (INIS)
Nitta, Yumiko; Satoh, Kenichi; Yoshida, Kazuko; Senba, Kei; Nakagata, Naomi; Peters, J.; Cattanach, B.M.
2004-01-01
Allelic loss on the chromosome 2 is associated with radiation-induced murine acute myeloid leukemia. However, the gene, which contributes mainly to the leukemogenesis has not yet been identified. Expecting any predisposition to acute myeloid leukemia, we performed a radiation leukemogenesis experiment with Pax6 SeY3H , one of the small eye mutants carrying a congenital hemizygosity of the chromosome 2 middle region. A deletion mapping of Pax6 SeY3H with 50 sequence-tagged site (STS) markers indicated that the deleted segment extended between the 106.00 and 111.47 Mb site from the centromere with a length of 5.47 Mb. In the deleted segment, 6 known and 17 novel genes were located. Pax6 SeY3H mutants that crossed back into C3H/He did not develop myeloid leukemia spontaneously, but they did when exposed to gamma-rays. The final incidence of myeloid leukemia in mutants (25.8%) was as high as that in normal sibs (21.4%). Survival curves of leukemia-bearing mutants shifted toward the left (p=0.043 by the Log rank test). F1 hybrids of Pax6 SeY3H with JF1 were less susceptible to radiation than Pax6 SeY3H onto C3H/He in regard to survival (p=0.003 and p<0.00001 for mutants and normal sibs, respectively, by a test of the difference between two proportions). Congenital deletion of the 5.47 Mb segment at the middle region on chromosome 2 alone did not trigger myeloid stem cells to expand clonally in vivo; however, the deletion shortcut the latency of radiation-induced myeloid leukemia. (author)
42 CFR 484.230 - Methodology used for the calculation of the low-utilization payment adjustment.
2010-10-01
... 42 Public Health 5 2010-10-01 2010-10-01 false Methodology used for the calculation of the low... Prospective Payment System for Home Health Agencies § 484.230 Methodology used for the calculation of the low... amount is determined by using cost data set forth in § 484.210(a) and adjusting by the appropriate wage...
SU-E-T-538: Evaluation of IMRT Dose Calculation Based on Pencil-Beam and AAA Algorithms.
Yuan, Y; Duan, J; Popple, R; Brezovich, I
2012-06-01
To evaluate the accuracy of dose calculation for intensity modulated radiation therapy (IMRT) based on Pencil Beam (PB) and Analytical Anisotropic Algorithm (AAA) computation algorithms. IMRT plans of twelve patients with different treatment sites, including head/neck, lung and pelvis, were investigated. For each patient, dose calculation with PB and AAA algorithms using dose grid sizes of 0.5 mm, 0.25 mm, and 0.125 mm, were compared with composite-beam ion chamber and film measurements in patient specific QA. Discrepancies between the calculation and the measurement were evaluated by percentage error for ion chamber dose and γ〉l failure rate in gamma analysis (3%/3mm) for film dosimetry. For 9 patients, ion chamber dose calculated with AAA-algorithms is closer to ion chamber measurement than that calculated with PB algorithm with grid size of 2.5 mm, though all calculated ion chamber doses are within 3% of the measurements. For head/neck patients and other patients with large treatment volumes, γ〉l failure rate is significantly reduced (within 5%) with AAA-based treatment planning compared to generally more than 10% with PB-based treatment planning (grid size=2.5 mm). For lung and brain cancer patients with medium and small treatment volumes, γ〉l failure rates are typically within 5% for both AAA and PB-based treatment planning (grid size=2.5 mm). For both PB and AAA-based treatment planning, improvements of dose calculation accuracy with finer dose grids were observed in film dosimetry of 11 patients and in ion chamber measurements for 3 patients. AAA-based treatment planning provides more accurate dose calculation for head/neck patients and other patients with large treatment volumes. Compared with film dosimetry, a γ〉l failure rate within 5% can be achieved for AAA-based treatment planning. © 2012 American Association of Physicists in Medicine.
Initial stress and nonlinear material behavior in patient-specific AAA wall stress analysis
Speelman, L.; Bosboom, E.M.H.; Schurink, G.W.H.; Buth, J.; Breeuwer, M.; Jacobs, M.J.H.M.; Van De Vosse, F.N.
2009-01-01
An abdominal aortic aneurysm (AAA) is a local dilation in the abdominal aorta of more than 50% of the original diameter and occurs in about 1 of 20 men over 65 years of age [1]. The largest threat for an AAA is rupture. Aortic repair is considered when the risk of rupture exceeds the risk of the
Structural Insights into the Allosteric Operation of the Lon AAA+ Protease.
Lin, Chien-Chu; Su, Shih-Chieh; Su, Ming-Yuan; Liang, Pi-Hui; Feng, Chia-Cheng; Wu, Shih-Hsiung; Chang, Chung-I
2016-05-03
The Lon AAA+ protease (LonA) is an evolutionarily conserved protease that couples the ATPase cycle into motion to drive substrate translocation and degradation. A hallmark feature shared by AAA+ proteases is the stimulation of ATPase activity by substrates. Here we report the structure of LonA bound to three ADPs, revealing the first AAA+ protease assembly where the six protomers are arranged alternately in nucleotide-free and bound states. Nucleotide binding induces large coordinated movements of conserved pore loops from two pairs of three non-adjacent protomers and shuttling of the proteolytic groove between the ATPase site and a previously unknown Arg paddle. Structural and biochemical evidence supports the roles of the substrate-bound proteolytic groove in allosteric stimulation of ATPase activity and the conserved Arg paddle in driving substrate degradation. Altogether, this work provides a molecular framework for understanding how ATP-dependent chemomechanical movements drive allosteric processes for substrate degradation in a major protein-destruction machine. Copyright © 2016 Elsevier Ltd. All rights reserved.
Riveros, Fabián; Chandra, Santanu; Finol, Ender A; Gasser, T Christian; Rodriguez, Jose F
2013-04-01
Biomechanical studies on abdominal aortic aneurysms (AAA) seek to provide for better decision criteria to undergo surgical intervention for AAA repair. More accurate results can be obtained by using appropriate material models for the tissues along with accurate geometric models and more realistic boundary conditions for the lesion. However, patient-specific AAA models are generated from gated medical images in which the artery is under pressure. Therefore, identification of the AAA zero pressure geometry would allow for a more realistic estimate of the aneurysmal wall mechanics. This study proposes a novel iterative algorithm to find the zero pressure geometry of patient-specific AAA models. The methodology allows considering the anisotropic hyperelastic behavior of the aortic wall, its thickness and accounts for the presence of the intraluminal thrombus. Results on 12 patient-specific AAA geometric models indicate that the procedure is computational tractable and efficient, and preserves the global volume of the model. In addition, a comparison of the peak wall stress computed with the zero pressure and CT-based geometries during systole indicates that computations using CT-based geometric models underestimate the peak wall stress by 59 ± 64 and 47 ± 64 kPa for the isotropic and anisotropic material models of the arterial wall, respectively.
SFM-FDTD analysis of triangular-lattice AAA structure: Parametric study of the TEM mode
Hamidi, M.; Chemrouk, C.; Belkhir, A.; Kebci, Z.; Ndao, A.; Lamrous, O.; Baida, F. I.
2014-05-01
This theoretical work reports a parametric study of enhanced transmission through annular aperture array (AAA) structure arranged in a triangular lattice. The effect of the incidence angle in addition to the inner and outer radii values on the evolution of the transmission spectra is carried out. To this end, a 3D Finite-Difference Time-Domain code based on the Split Field Method (SFM) is used to calculate the spectral response of the structure for any angle of incidence. In order to work through an orthogonal unit cell which presents the advantage to reduce time and space of computation, special periodic boundary conditions are implemented. This study provides a new modeling of AAA structures useful for producing tunable ultra-compact devices.
Zifodya, Jackson M; Challens, Cameron H C; Hsieh, Wen-Long
2016-06-01
When implementing Acuros XB (AXB) as a substitute for anisotropic analytic algorithm (AAA) in the Eclipse Treatment Planning System, one is faced with a dilemma of reporting either dose to medium, AXB-Dm or dose to water, AXB-Dw. To assist with decision making on selecting either AXB-Dm or AXB-Dw for dose reporting, a retrospective study of treated patients for head & neck (H&N), prostate, breast and lung is presented. Ten patients, previously treated using AAA plans, were selected for each site and re-planned with AXB-Dm and AXB-Dw. Re-planning was done with fixed monitor units (MU) as well as non-fixed MUs. Dose volume histograms (DVH) of targets and organs at risk (OAR), were analyzed in conjunction with ICRU-83 recommended dose reporting metrics. Additionally, comparisons of plan homogeneity indices (HI) and MUs were done to further highlight the differences between the algorithms. Results showed that, on average AAA overestimated dose to the target volume and OARs by less than 2.0 %. Comparisons between AXB-Dw and AXB-Dm, for all sites, also showed overall dose differences to be small (135 % of prescription dose) for target volumes with high density materials. Homogeneity indices showed that AAA planning and optimization templates would need to be adjusted only for the H&N and Lung sites. MU comparison showed insignificant differences between AXB-Dw relative to AAA and between AXB-Dw relative to AXB-Dm. However AXB-Dm MUs relative to AAA, showed an average difference of about 1.3 % signifying an underdosage by AAA. In conclusion, when dose is reported as AXB-Dw, the effect that high density structures in the PTV has on the dose distribution should be carefully considered. As the results show overall small dose differences between the algorithms, when transitioning from AAA to AXB, no significant change to existing prescription protocols is expected. As most of the clinical experience is dose-to-water based and calibration protocols and clinical trials are
International Nuclear Information System (INIS)
Sterpin, E.; Tomsej, M.; Smedt, B. de; Reynaert, N.; Vynckier, S.
2007-01-01
The Anisotropic Analytical Algorithm (AAA) is a new pencil beam convolution/superposition algorithm proposed by Varian for photon dose calculations. The configuration of AAA depends on linear accelerator design and specifications. The purpose of this study was to investigate the accuracy of AAA for an Elekta SL25 linear accelerator for small fields and intensity modulated radiation therapy (IMRT) treatments in inhomogeneous media. The accuracy of AAA was evaluated in two studies. First, AAA was compared both with Monte Carlo (MC) and the measurements in an inhomogeneous phantom simulating lung equivalent tissues and bone ribs. The algorithm was tested under lateral electronic disequilibrium conditions, using small fields (2x2 cm 2 ). Good agreement was generally achieved for depth dose and profiles, with deviations generally below 3% in lung inhomogeneities and below 5% at interfaces. However, the effects of attenuation and scattering close to the bone ribs were not fully taken into account by AAA, and small inhomogeneities may lead to planning errors. Second, AAA and MC were compared for IMRT plans in clinical conditions, i.e., dose calculations in a computed tomography scan of a patient. One ethmoid tumor, one orophaxynx and two lung tumors are presented in this paper. Small differences were found between the dose volume histograms. For instance, a 1.7% difference for the mean planning target volume dose was obtained for the ethmoid case. Since better agreement was achieved for the same plans but in homogeneous conditions, these differences must be attributed to the handling of inhomogeneities by AAA. Therefore, inherent assumptions of the algorithm, principally the assumption of independent depth and lateral directions in the scaling of the kernels, were slightly influencing AAA's validity in inhomogeneities. However, AAA showed a good accuracy overall and a great ability to handle small fields in inhomogeneous media compared to other pencil beam convolution
International Nuclear Information System (INIS)
Kutle, A.; Obhodas, J.; Valkovic, V.
2006-01-01
It has been observed that among the seven municipalities of the Island of Krk the three in the central part of the island have increased disease incidence rates for the five groups of diseases: (a) neoplasm, (b) diseases of the blood and blood-forming organs and certain disorders involving the immune mechanism, (c) endocrine, nutritional and metabolic diseases, (d) mental and behavioral disorders and (e) diseases of the circulatory system. One of the etiological factors is assumed to be the influence of the geochemical environment. The average element concentration values of six trace elements (Mn, Fe, Ni, Cu, Zn and As) for the geochemical environment in the individual municipalities were determined by XRF analyses of soil, plant, potable water and hair samples. The data on disease incidence rates for the individual municipalities, from 1997 to 2001, have been obtained from the Public Health Institution in charge of monitoring population health on the island. Diseases' groups have been defined by the WHO methodology. The GPS-GIS methodology was used to obtain maps of trace elements in different matrices and disease incidence distributions. Data analyses were performed by multivariate statistical methods (principal component analysis and cluster analysis). It has been shown that the concentration levels of the elements could be related to disease incidence rates. (author)
2010-10-01
... outpatient physical therapy or speech pathology services. 484.38 Section 484.38 Public Health CENTERS FOR... furnish outpatient physical therapy or speech pathology services. An HHA that wishes to furnish outpatient physical therapy or speech pathology services must meet all the pertinent conditions of this part and also...
Rubisco Activases: AAA+ Chaperones Adapted to Enzyme Repair.
Bhat, Javaid Y; Thieulin-Pardo, Gabriel; Hartl, F Ulrich; Hayer-Hartl, Manajit
2017-01-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), the key enzyme of the Calvin-Benson-Bassham cycle of photosynthesis, requires conformational repair by Rubisco activase for efficient function. Rubisco mediates the fixation of atmospheric CO 2 by catalyzing the carboxylation of the five-carbon sugar ribulose-1,5-bisphosphate (RuBP). It is a remarkably inefficient enzyme, and efforts to increase crop yields by bioengineering Rubisco remain unsuccessful. This is due in part to the complex cellular machinery required for Rubisco biogenesis and metabolic maintenance. To function, Rubisco must undergo an activation process that involves carboxylation of an active site lysine by a non-substrate CO 2 molecule and binding of a Mg 2+ ion. Premature binding of the substrate RuBP results in an inactive enzyme. Moreover, Rubisco can also be inhibited by a range of sugar phosphates, some of which are "misfire" products of its multistep catalytic reaction. The release of the inhibitory sugar molecule is mediated by the AAA+ protein Rubisco activase (Rca), which couples hydrolysis of ATP to the structural remodeling of Rubisco. Rca enzymes are found in the vast majority of photosynthetic organisms, from bacteria to higher plants. They share a canonical AAA+ domain architecture and form six-membered ring complexes but are diverse in sequence and mechanism, suggesting their convergent evolution. In this review, we discuss recent advances in understanding the structure and function of this important group of client-specific AAA+ proteins.
Fujita, Takuo; Nakamura, Shoji; Ohue, Mutsumi; Fujii, Yoshio; Miyauchi, Akimitsu; Takagi, Yasuyuki; Tsugeno, Hirofumi
2007-01-01
Sway and postural instability have drawn attention as a risk factor for osteoporotic fracture, in addition to low bone mineral density (BMD) and poor bone quality. In view of the fracture-reducing effect of alfacalcidol and active absorbable algal calcium (AAA Ca) not readily explained by rather mild increases of BMD, attempts were made to evaluate postural stabilizing effect of alfacalcidol, AAA Ca, and calcium carbonate (CaCO(3)) by computerized posturography. Track of the gravity center was analyzed to calculate parameters related to tract length, track range, and track density to express the degree of sway before and after supplementation in 126 subjects ranging in age between 20 and 81 years randomly divided into four groups. Supplementation with AAA Ca containing 900 mg elemental Ca (group A), no calcium (group B), CaCO(3) also containing 900 mg elemental Ca (group C), or alfacalcidol (group D) continued daily for 12 months. For each parameter, the ratio closed eye value/open eye value (Romberg ratio) was calculated to detect aggravation of sway by eye closure. Age, parameters of Ca and P, and proportions of subjects with fracture and those with low BMD showed no marked deviation among the groups. With eyes open, significant decreases of a track range parameter (REC) from group B was noted in groups A (P = 0.0397) and D (P = 0.0296), but not in group C according to multiple comparison by Scheffe, indicating superior postural stabilizing effect of A and D over C. In the first 2 months, a significant fall was already evident in REC from group B in group D (P = 0.0120) with eyes open. Paired comparison of sway parameters before and after supplementation revealed a significant increase of track density parameter (LNGA), indicating sway control efficiency and a significant decrease of REC in groups A and D compared to group B with eyes open. With eyes closed, only group A showed a significant improvement from group B (P = 0.0456; Fig. 1), with a significant
International Nuclear Information System (INIS)
Nitta, Y.; Hoshi, M.; Yoshida, K.; Yamate, J.; Peters, J.; Cattanach, B.M.
2003-01-01
Full text: LOH at the chromosome 2 middle regions is common in the radiation-induced mouse acute myeloid leukemia (AML). To identify the suppressor or the modifier gene of AML at this region, the mouse deletion mutants, Del(2)Sey3H pax6 and Del(2)Sey3H pax6 could be the good models, as they deleted the chromosome 2 middle regions hemizygously. The allele of the partially deleted chromosome 2 was paternally generated and maintained hemizygously. The exact deleted regions of the two mutants were mapped by the PCR-based detection of polymorphism of the STS markers. The length of the deletions was 3.01Mb and 10.11MB for Del(2)Sey3H pax6 and Del(2)Sey3H pax6 , respectively. For the induction of tumors, a radiation, 3.0Gy of Co-60 and a chemical carcinogen, N-methyl-N-nitrosourea were applied to the mutants. Their tumorigenicity was compared with those of control as well as normal sibs by the Kaplan-Meier analysis. Both mutants were found to predispose to small intestinal tumors. Intestinal tumors developed spontaneously with the incidence of 30%. The radiation and the chemical accelerated the malignancy and increased the incidence of the intestinal tumors. Radiation shortened the latency of AML development in the Del(2)Sey3H pax6 mutant but not in the Del(2)Sey3H pax6 . Spontaneous AML has not been observed, nor any increase in the incidence of induced AMLs. The commonly deleted region of the two mutants, the 3.01Mb region, must be critical for the development of tumors and the high susceptibility to radiation. The role of Pax6 gene should be considered in the intestinal tumorigenesis, as the Pax6 gene plays an important role in the pancreas development during the embryogenesis. The Wt1, a tumor suppressor gene, which is deleted hemizygously in these mutants as well. The screening of homozygous deletion has been started using the induced as well as spontaneously developed tumors
O'Leary, Siobhan A; Mulvihill, John J; Barrett, Hilary E; Kavanagh, Eamon G; Walsh, Michael T; McGloughlin, Tim M; Doyle, Barry J
2015-02-01
Varying degrees of calcification are present in most abdominal aortic aneurysms (AAAs). However, their impact on AAA failure properties and AAA rupture risk is unclear. The aim of this work is evaluate and compare the failure properties of partially calcified and predominantly fibrous AAA tissue and investigate the potential reasons for failure. Uniaxial mechanical testing was performed on AAA samples harvested from 31 patients undergoing open surgical repair. Individual tensile samples were divided into two groups: fibrous (n=31) and partially calcified (n=38). The presence of calcification was confirmed by fourier transform infrared spectroscopy (FTIR). A total of 69 mechanical tests were performed and the failure stretch (λf), failure stress (σf) and failure tension (Tf) were recorded for each test. Following mechanical testing, the failure sites of a subset of both tissue types were examined using scanning electron microscopy (SEM)/energy dispersive X-ray spectroscopy (EDS) to investigate the potential reasons for failure. It has been shown that the failure properties of partially calcified tissue are significantly reduced compared to fibrous tissue and SEM and EDS results suggest that the junction between a calcification deposit and the fibrous matrix is highly susceptible to failure. This study implicates the presence of calcification as a key player in AAA rupture risk and provides further motivation for the development of non-invasive methods of measuring calcification. Copyright © 2014 Elsevier Ltd. All rights reserved.
Mig6 Puts the Brakes on Mutant EGFR-Driven Lung Cancer | Center for Cancer Research
Lung cancer is the most common cause of cancer-related death worldwide. These cancers are often induced by mutations in the epidermal growth factor receptor (EGFR), resulting in constitutive activation of the protein’s tyrosine kinase domain. Lung cancers expressing these EGFR mutants are initially sensitive to tyrosine kinase inhibitors (TKIs), such as erlotinib, but often become resistant by developing compensatory mutations in EGFR or other growth-promoting pathways. To better understand how mutant EGFR initiates and maintains tumor growth in the hopes of identifying novel targets for drug development, Udayan Guha, M.D., Ph.D., of CCR’s Thoracic and Gastrointestinal Oncology Branch, and his colleagues examined the landscape of proteins phosphorylated in EGFR wild type and mutant cells. One protein hyper-phosphorylated in mutant EGFR cells was Mig6, a putative tumor suppressor.
O6-methylguanine-DNA methyltransferase in wild-type and ada mutants of Escherichia coli
International Nuclear Information System (INIS)
Mitra, S.; Pal, B.C.; Foote, R.S.
1982-01-01
O 6 -Methylguanine-DNA methyltransferase is induced in Escherichia coli during growth in low levels of N-methyl-N'-nitro-N-nitrosoguanidine. We have developed a sensitive assay for quantitating low levels of this activity with a synthetic DNA substrate containing 3 H-labeled O 6 -methylguanine as the only modified base. Although both wild-type and adaptation-deficient (ada) mutants of E. coli contained low but comparable numbers (from 13 to 60) of the enzyme molecules per cell, adaptation treatment caused a significant increase of the enzyme in the wild type but not in the ada mutants, suggesting that the ada mutation is in a regulatory locus and not in the structural gene for the methyltransferase
Mutant breeding of Aspergillus niger irradiated by 12C6+ for hyper citric acid
International Nuclear Information System (INIS)
Hu Wei; Li Wenjian; Chen Jihong; Liu Jing; Wang Shuyang; Wang Jufang; Lu Dong
2014-01-01
In this study, strains of Aspergillus niger No.4 for hyper citric acid were irradiated to different doses by 80 MeV/u 12 C 6+ ion beams. Seven mutant strains showed marked citric acid over-production records and faster productivity than initial Aspergillus niger No.4 by shaking flash fermentation. The maximum product yield was 132.8 gL -1 (the H4002 strain) being a 8.8% increase to the initial strain. The scale-up experiment was carried out in a 100 L bioreactor. The mutant H4002 can accumulate 187gL -1 product yield of citric acid from starch liquefying supernatant. The productivity of citric acid was 2.75 g L -1 h -1 . So, the mutant H4002 possesses rapid sugar katabolism for producing citric acid. Meanwhile, the pellet morphology kept compact and round during the whole submerged fermentation, which was suited to produce citric acid. The results indicate that mutant H4002 has potential ability to produce citric acid rapidly. (authors)
DEFF Research Database (Denmark)
Martinez-Pinna, R; Lindholt, Jes S.; Blanco-Colio, L M
2010-01-01
Oxidative stress is a main mechanism involved in vascular pathologies. Increased thioredoxin (TRX) levels have been observed in several oxidative stress-associated cardiovascular diseases. We aim to test the potential role of TRX as a biomarker of oxidative stress in abdominal aortic aneurysm (AAA)....
Directory of Open Access Journals (Sweden)
Gibbons I R
2002-07-01
Full Text Available Abstract Background The largest open reading frame in the Saccharomyces genome encodes midasin (MDN1p, YLR106p, an AAA ATPase of 560 kDa that is essential for cell viability. Orthologs of midasin have been identified in the genome projects for Drosophila, Arabidopsis, and Schizosaccharomyces pombe. Results Midasin is present as a single-copy gene encoding a well-conserved protein of ~600 kDa in all eukaryotes for which data are available. In humans, the gene maps to 6q15 and encodes a predicted protein of 5596 residues (632 kDa. Sequence alignments of midasin from humans, yeast, Giardia and Encephalitozoon indicate that its domain structure comprises an N-terminal domain (35 kDa, followed by an AAA domain containing six tandem AAA protomers (~30 kDa each, a linker domain (260 kDa, an acidic domain (~70 kDa containing 35–40% aspartate and glutamate, and a carboxy-terminal M-domain (30 kDa that possesses MIDAS sequence motifs and is homologous to the I-domain of integrins. Expression of hemagglutamin-tagged midasin in yeast demonstrates a polypeptide of the anticipated size that is localized principally in the nucleus. Conclusions The highly conserved structure of midasin in eukaryotes, taken in conjunction with its nuclear localization in yeast, suggests that midasin may function as a nuclear chaperone and be involved in the assembly/disassembly of macromolecular complexes in the nucleus. The AAA domain of midasin is evolutionarily related to that of dynein, but it appears to lack a microtubule-binding site.
Kugo, Hirona; Moriyama, Tatsuya; Zaima, Nobuhiro
2018-01-15
Background Adipose tissue plays a role in the storage of excess energy as triglycerides (TGs). Excess fat accumulation causes various metabolic and cardiovascular diseases. It has been reported that ectopic fat deposition and excess TG accumulation in non-adipose tissue might be important predictors of cardiometabolic and vascular risk. For example, ectopic fat in perivascular tissue promotes atherosclerotic plaque formation in the arterial wall. Objective Recently, it has been reported that ectopic fat (adipocyte) in the vascular wall of an abdominal aortic aneurysm (AAA) is present in both human and experimental animal models. The pathological significance of adipocytes in the AAA wall has not been fully understood. In this review, we summarized the functions of adipocytes and discussed potential new drugs that target vascular adipocytes for AAA treatment. Result Previous studies suggest that adipocytes in vascular wall play an important role in the development of AAA. Conclusion Adipocytes in the vascular wall could be novel targets for the development of AAA therapeutic drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
DEFF Research Database (Denmark)
Fernandez-García, Carlos-Ernesto; Tarin, Carlos; Roldan-Montero, Raquel
2017-01-01
Abdominal aortic aneurysm (AAA) evolution is unpredictable. Moreover, no specific treatment exists for AAA, except surgery to prevent aortic rupture. Galectin-3 has been previously associated with CVD, but its potential role in AAA have not been addressed. Galectin-3 levels were increased in plasma...... of AAA patients (n=225) compared to controls (n=100). Moreover, galectin-3 concentrations were associated with need for surgical repair, independently of potential confounding factors. Galectin-3 mRNA and protein expression were increased in human AAA samples compared to healthy aortas. Experimental AAA...... in mice was induced by aortic elastase perfusion. Mice were treated i.v. with the galectin-3 inhibitor modified citrus pectin (MCP, 10mg/kg, every other day) or saline. Similar to humans, galectin-3 serum and aortic mRNA levels were also increased in elastase-induced AAA mice compared to control mice...
Characterization of ATPase activity of the AAA ARC from Bifidobacterium longum subsp. infantis.
Guzmán-Rodríguez, Mabel; de la Rosa, Ana Paulina Barba; Santos, Leticia
2015-01-01
Bifidobacteria are considered to be probiotics that exist in the large intestine and are helpful to maintain human health. Oral administration of bifidobacteria may be effective in improving the intestinal flora and environment, stimulating the immune response and possibly preventing cancer. However, for consistent and positive results, further well-controlled studies are urgently needed to describe the basic mechanisms of this microorganism. Analysis of the proteasome-lacking Bifidobacterium longum genome reveals that it possesses a gene, IPR003593 AAA ATPase core, which codes a 56 kDa protein containing one AAA ATPase domain. Phylogenetic classification made by CLANS, positioned this sequence into the ARC divergent branch of the AAA ATPase family of proteins. N-terminal analysis of the sequence indicates this protein is closely related to other ATPases such as the Rhodococcus erythropolis ARC, Archaeoglobus fulgidus PAN, Mycobacterium tuberculosis Mpa and the human proteasomal Rpt1 subunit. This gene was cloned, the full-length recombinant protein was overexpressed in Escherichia coli, purified as a high-molecular size complex and named Bl-ARC. Enzymatic characterization showed that Bl-ARC ATPase is active, Mg(+2)-dependent and sensitive to N-ethylmaleimide. Gene organization positions bl-arc in a region flanked by a cluster of genes that includes pup, dop and pafA genes. These findings point to a possible function as a chaperone in the degradation pathway via pupylation.
Increased AAA-TOB3 correlates with lymph node metastasis and advanced stage of lung adenocarcinoma.
Liu, Yanfeng; Bu, Lina; Li, Wei; Wu, Wei; Wang, Shengyu; Diao, Xin; Zhou, Jing; Chen, Guoan; Yang, Shuanying
2017-07-24
This study was to investigate the differential mitochondrial protein expressions in human lung adenocarcinoma and provide preliminary data for further exploration of the carcinogenic mechanism. Total proteins of A549 and 16HBE mitochondria were extracted through 2D polyacrylamide gel electrophoresis (2-DE). The differential mitochondria proteins were identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and were further confirmed by Western blot, immunoelectron microscopy and immunohistochemistry (IHC) in A549 cells as well as lung adenocarcinoma tissues. A total of 41 differentially expressed protein spots were found in A549 mitochondria. Of them, 15 proteins were highly expressed and 26 proteins were lowly expressed in the mitochondria of A549 (by more than 1.5 times). Among the 15 more highly expressed proteins, AAA-TOB3 (by more than 3 times) was highly expressed in the mitochondria of A549 compared with the 16HBE, by LC-MS/MS identification. High electron density and clear circular colloidal gold-marked AAA-TOB3 particles were observed in the A549 cells via immunoelectron microscopy. Besides, AAA-TOB3 was confirmed to be elevated in lung adenocarcinoma by Western blot and IHC. Moreover, increased AAA-TOB3 correlated with lymph node metastasis and advanced stage of lung adenocarcinoma (pAAA-TOB3 was highly expressed in lung adenocarcinoma, and the up-regulation of AAA-TOB3 correlated with lymph node metastasis and advanced stage of lung adenocarcinoma, which suggested that it could serve as a potential molecular marker for lung adenocarcinoma.
Oresic, Kristina; Mueller, Britta; Tortorella, Domenico
2009-06-01
NCLs (neuronal ceroid lipofuscinoses), a group of inherited neurodegenerative lysosomal storage diseases that predominantly affect children, are the result of autosomal recessive mutations within one of the nine cln genes. The wild-type cln gene products are composed of membrane and soluble proteins that localize to the lysosome or the ER (endoplasmic reticulum). However, the destiny of the Cln variants has not been fully characterized. To explore a possible link between ER quality control and processing of Cln mutants, we investigated the fate of two NCL-related Cln6 mutants found in patient samples (Cln6(G123D) and Cln6(M241T)) in neuronal-derived human cells. The point mutations are predicted to be in the putative transmembrane domains and most probably generate misfolded membrane proteins that are subjected to ER quality control. Consistent with this paradigm, both mutants underwent rapid proteasome-mediated degradation and complexed with components of the ER extraction apparatus, Derlin-1 and p97. In addition, knockdown of SEL1L [sel-1 suppressor of lin-12-like (Caenorhabditis elegans)], a member of an E3 ubiquitin ligase complex involved in ER protein extraction, rescued significant amounts of Cln6(G123D) and Cln6(M241T) polypeptides. The results implicate ER quality control in the instability of the Cln variants that probably contributes to the development of NCL.
Glerum, D M; Tzagoloff, A
1997-08-04
The concentration and submitochondrial distribution of the subunit polypeptides of cytochrome oxidase have been studied in wild type yeast and in different mutants impaired in assembly of this respiratory complex. All the subunit polypeptides of the enzyme are associated with mitochondrial membranes of wild type cells, except for a small fraction of subunits 4 and 6 that is recovered in the soluble protein fraction of mitochondria. Cytochrome oxidase mutants consistently display a severe reduction in the steady-state concentration of subunit 1 due to its increased turnover. As a consequence, most of subunit 4, which normally is associated with subunit 1, is found in the soluble fraction. A similar shift from membrane-bound to soluble subunit 6 is seen in mutants blocked in expression of subunit 5a. In contrast, null mutations in COX6 coding for subunit 6 promote loss of subunit 5a. The absence of subunit 5a in the cox6 mutant is the result of proteolytic degradation rather than regulation of its expression by subunit 6. The possible role of the ATP-dependent proteases Rca1p and Afg3p in proteolysis of subunits 1 and 5a has been assessed in strains with combined mutations in COX6, RCA1, and/or AFG3. Immunochemical assays indicate that another protease(s) must be responsible for most of the proteolytic loss of these proteins.
DEFF Research Database (Denmark)
Johansson, Per Ingemar; Swiatek, F.; Jorgensen, L.
2008-01-01
OBJECTIVES: Continued haemorrhage remains a significant contributor to mortality in massively transfused patients. We found that early administration of platelets and plasma reduced mortality from 54% to 36% in rAAA patients. The aim of the present evaluation was to evaluate whether reduced...... mortality in rAAA patients related to a pro-active transfusion therapy is maintained. DESIGN: Single-centre observational study. METHODS: Mortality of patients operated for rAAA 2006-07 was compared to that of patients operated 2004-05 (intervention group; n=50) and 2002-04 (control group, n=82). RESULTS......: 64 consecutive patients with rAAA received, similar to the intervention group, more platelets (5 and 4 vs. 0 units, P
Louwagie, Mathilde; Kieffer-Jaquinod, Sylvie; Dupierris, Véronique; Couté, Yohann; Bruley, Christophe; Garin, Jérôme; Dupuis, Alain; Jaquinod, Michel; Brun, Virginie
2012-07-06
Accurate quantification of pure peptides and proteins is essential for biotechnology, clinical chemistry, proteomics, and systems biology. The reference method to quantify peptides and proteins is amino acid analysis (AAA). This consists of an acidic hydrolysis followed by chromatographic separation and spectrophotometric detection of amino acids. Although widely used, this method displays some limitations, in particular the need for large amounts of starting material. Driven by the need to quantify isotope-dilution standards used for absolute quantitative proteomics, particularly stable isotope-labeled (SIL) peptides and PSAQ proteins, we developed a new AAA assay (AAA-MS). This method requires neither derivatization nor chromatographic separation of amino acids. It is based on rapid microwave-assisted acidic hydrolysis followed by high-resolution mass spectrometry analysis of amino acids. Quantification is performed by comparing MS signals from labeled amino acids (SIL peptide- and PSAQ-derived) with those of unlabeled amino acids originating from co-hydrolyzed NIST standard reference materials. For both SIL peptides and PSAQ standards, AAA-MS quantification results were consistent with classical AAA measurements. Compared to AAA assay, AAA-MS was much faster and was 100-fold more sensitive for peptide and protein quantification. Finally, thanks to the development of a labeled protein standard, we also extended AAA-MS analysis to the quantification of unlabeled proteins.
International Nuclear Information System (INIS)
Zhang Yanqiu; Qiu Xiaoping; Yang Zhen; Lu Zhiping
2011-01-01
In order to evaluate the calculation accuracy of Anisotropic Analytical Algorithm (AAA) for the situation with small fields in a water-bone phantom using Monte Carlo simulation as benchmarks. A water phantom with a bone slab was built,in which the depth dose (DD) and off-axis ratio (OAR) for field 2 cm x 2 cm to field 8 cm x 8 cm were calculated by AAA algorithms, PBC algorithms (as comparison), and Monte Carlo (MC) simulation. The evaluation of algorithms by MC simulation was achieved by the comparisons of DD and the 1 dimension gamma analysis of OAR. It was shown that both of AAA algorithm and PBC algorithm overestimated the DD in bone region, and the dose differences ranged from 2.16%-2.7%, 1.4%-2.03%, respectively. AAA algorithm and PBC algorithm underestimated the DD in back of bone region, and the dose differences ranged from -0.39% - -1.19%, -0.13% - -0.4%, respectively. AAA algorithm and PBC algorithm overestimated the dose of field inner edge and field outer edge,respectively. One dimension gamma analysis indicated that AAA algorithm and PBC algorithm gamma pass rate was 100%, 100%, 100%, 86%, 100%, 100%, 72%, 64%, respectively. In bone medium,the dose calculated by AAA was slightly higher than MC simulation, the calculation accuracy was not evidently higher than PBC. (authors)
Tenorio, Emanuel Junio Ramos; Braga, Andre Felipe Farias; Tirapelli, Daniela Pretti Da Cunha; Ribeiro, Mauricio Serra; Piccinato, Carlos Eli; Joviliano, Edwaldo Edner
2018-03-05
The purpose of this study was to quantify and evaluate the expression response of miRNA-191 and miRNA-455-3p endovascular repair of abdominal aortic aneurysm (AAA) based in whole blood samples. This report describes a prospective study of a single center of 30 patients with AAA who underwent endovascular repair. Blood samples were collected preoperatively and 6 months postoperatively. The differential expression of the miRNAs was performed by the real-time polymerase chain reaction method, after extraction of the RNA from the blood samples at the 2 moments. In addition, bioinformatic tools were used to determine pathophysiological pathways related to AAA. The miR-191 and miR-455-3p were overexpressed preoperatively. After 6 months postoperatively, miR-191 (median 0.98, IQR 0.5-2.1, P AAA showed no significant differences in the expression of miR-191 and miR-455-3p. Exclusion of the aneurysmal sac after endovascular treatment induces a decrease in the expression of the studied miRNAs in whole blood samples, which suggests a possible use of them as biomarkers of therapeutic success. Copyright © 2018 Elsevier Inc. All rights reserved.
Lee, Seoeun; Lee, Hunsang; Yoo, Suji; Kim, Hyun
2017-12-08
Protein complexes involved in respiration, ATP synthesis, and protein import reside in the mitochondrial inner membrane; thus, proper regulation of these proteins is essential for cell viability. The m -AAA protease, a conserved hetero-hexameric AAA (ATPase associated with diverse cellular activities) protease, composed of the Yta10 and Yta12 proteins, regulates mitochondrial proteostasis by mediating protein maturation and degradation. It also recognizes and mediates the dislocation of membrane-embedded substrates, including foreign transmembrane (TM) segments, but the molecular mechanism involved in these processes remains elusive. This study investigated the role of the TM domains in the m -AAA protease by systematic replacement of one TM domain at a time in yeast. Our data indicated that replacement of the Yta10 TM2 domain abolishes membrane dislocation for only a subset of substrates, whereas replacement of the Yta12 TM2 domain impairs membrane dislocation for all tested substrates, suggesting different roles of the TM domains in each m -AAA protease subunit. Furthermore, m -AAA protease-mediated membrane dislocation was impaired in the presence of a large downstream hydrophilic moiety in a membrane substrate. This finding suggested that the m -AAA protease cannot dislocate large hydrophilic domains across the membrane, indicating that the membrane dislocation probably occurs in a lipid environment. In summary, this study highlights previously underappreciated biological roles of TM domains of the m -AAA proteases in mediating the recognition and dislocation of membrane-embedded substrates. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Energy Technology Data Exchange (ETDEWEB)
Kawai, D [Kanagawa Cancer Center, Yokohama, Kanagawa (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Kamima, T [Cancer Institute Hospital Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Baba, H [The National Cancer Center Hospital East, Kshiwa, Chiba (Japan); Yamamoto, T; Kubo, Y [Otemae Hospital, Chuo-ku, Osaka (Japan); Ishibashi, S; Higuchi, Y [Sasebo City General Hospital, Sasebo, Nagasaki (Japan); Tani, K [St Luke’s International Hospital, Tokyo, Tokyo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)
2016-06-15
Purpose: Actual irradiated prescription dose to patients cannot be verified. Thus, independent dose verification and second treatment planning system are used as the secondary check. AAA dose calculation engine has contributed to lung SBRT. We conducted a multi-institutional study to assess variation of prescription dose for lung SBRT when using AAA in reference to using Acuros XB and Clarkson algorithm. Methods: Six institutes in Japan participated in this study. All SBRT treatments were planed using AAA in Eclipse and Adaptive Convolve (AC) in Pinnacle3. All of the institutes used a same independent dose verification software program (Simple MU Analysis: SMU, Triangle Product, Ishikawa, Japan), which implemented a Clarkson-based dose calculation algorithm using CT image dataset. A retrospective analysis for lung SBRT plans (73 patients) was performed to compute the confidence limit (CL, Average±2SD) in dose between the AAA and the SMU. In one of the institutes, a additional analysis was conducted to evaluate the variations between the AAA and the Acuros XB (AXB). Results: The CL for SMU shows larger systematic and random errors of 8.7±9.9 % for AAA than the errors of 5.7±4.2 % for AC. The variations of AAA correlated with the mean CT values in the voxels of PTV (a correlation coefficient : −0.7) . The comparison of AXB vs. AAA shows smaller systematic and random errors of −0.7±1.7%. The correlation between dose variations for AXB and the mean CT values in PTV was weak (0.4). However, there were several plans with more than 2% deviation of AAPM TG114 (Maximum: −3.3 %). Conclusion: In comparison for AC, prescription dose calculated by AAA may be more variable in lung SBRT patient. Even AXB comparison shows unexpected variation. Care should be taken for the use of AAA in lung SBRT. This research is partially supported by Japan Agency for Medical Research and Development (AMED)
Moro, Camila Fernandes; Gaspar, Marilia; da Silva, Felipe Rodrigues; Pattathil, Sivakumar; Hahn, Michael G; Salgado, Ione; Braga, Marcia Regina
2017-03-01
Nitric oxide (NO) exerts pleiotropic effects on plant development; however, its involvement in cell wall modification during root hair formation (RHF) has not yet been addressed. Here, mutants of Arabidopsis thaliana with altered root hair phenotypes were used to assess the involvement of S-nitrosoglutathione (GSNO), the primary NO source, in cell wall dynamics and gene expression in roots induced to form hairs. GSNO and auxin restored the root hair phenotype of the hairless root hair defective 6 (rhd6) mutant. A positive correlation was observed between increased NO production and RHF induced by auxin in rhd6 and transparent testa glabra (ttg) mutants. Deposition of an epitope within rhamnogalacturonan-I recognized by the CCRC-M2 antibody was delayed in root hair cells (trichoblasts) compared with nonhair cells (atrichoblasts). GSNO, but not auxin, restored the wild-type root glycome and transcriptome profiles in rhd6, modulating the expression of a large number of genes related to cell wall composition and metabolism, as well as those encoding ribosomal proteins, DNA and histone-modifying enzymes and proteins involved in post-translational modification. Our results demonstrate that NO plays a key role in cell wall remodelling in trichoblasts and suggest that it also participates in chromatin modification in root cells of A. thaliana. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Holsti, Mari; Wanhainen, Anders; Lundin, Christina; Björck, Martin; Tegler, Gustaf; Svensson, Johan; Sund, Malin
2018-04-12
Abdominal aortic aneurysm (AAA) is characterised by enhanced proteolytic activity, and extracellular matrix (ECM) remodelling in the vascular wall. Type IV and XVIII collagen/endostatin are structural proteins in vascular basement membrane (VBM), a specialised ECM structure. Here the association between plasma levels of these collagens with the aortic diameter and expansion rate is studied, and their expression in aortic tissue characterised. This was a retrospective population based cohort study. Type IV and XVIII collagen/endostatin were analysed in plasma by ELISA assay in 615 men, divided into three groups based on the aortic diameter: 1) normal aorta ≤ 25 mm, 2) sub-aneurysmal aorta (SAA) 26-29 mm, and 3) AAA ≥ 30 mm. Follow up data were available for 159 men. The association between collagen levels and aortic diameter at baseline, and with the expansion rate at follow up were analysed in ordinal logistic regression and linear regression models, controlling for common confounding factors. Tissue expression of the collagens was analysed in normal aorta (n = 6) and AAA (n = 6) by immunofluorescence. Plasma levels of type XVIII collagen/endostatin (136 ng/mL [SD 29] in individuals with a normal aorta diameter, 154 ng/ml [SD 45] in SAA, and 162 ng/ml [SD 46] in AAA; p = .001) and type IV collagen (105 ng/mL [SD 42] normal aorta, 124 ng/ml [SD 46] SAA, and 127 ng/ml [SD 47] AAA; p = .037) were associated with a larger aortic diameter. A significant association was found between the baseline levels of type XVIII/endostatin and the aortic expansion rate (p = .035), but in the multivariable model, only the initial aortic diameter remained significantly associated with expansion (p = .005). Altered expression patterns of both collagens were observed in AAA tissue. Plasma levels of circulating type IV and XVIII collagen/endostatin increase with AAA diameter. The expression pattern of VBM proteins is altered in the aneurysm wall. Copyright
Nakayama, Takuya; Fisher, Marilyn; Nakajima, Keisuke; Odeleye, Akinleye O; Zimmerman, Keith B; Fish, Margaret B; Yaoita, Yoshio; Chojnowski, Jena L; Lauderdale, James D; Netland, Peter A; Grainger, Robert M
2015-12-15
Mutations in the Pax6 gene cause ocular defects in both vertebrate and invertebrate animal species, and the disease aniridia in humans. Despite extensive experimentation on this gene in multiple species, including humans, we still do not understand the earliest effects on development mediated by this gene. This prompted us to develop pax6 mutant lines in Xenopus tropicalis taking advantage of the utility of the Xenopus system for examining early development and in addition to establish a model for studying the human disease aniridia in an accessible lower vertebrate. We have generated mutants in pax6 by using Transcription Activator-Like Effector Nuclease (TALEN) constructs for gene editing in X. tropicalis. Embryos with putative null mutations show severe eye abnormalities and changes in brain development, as assessed by changes in morphology and gene expression. One gene that we found is downregulated very early in development in these pax6 mutants is myc, a gene involved in pluripotency and progenitor cell maintenance and likely a mediator of some key pax6 functions in the embryo. Changes in gene expression in the developing brain and pancreas reflect other important functions of pax6 during development. In mutations with partial loss of pax6 function eye development is initially relatively normal but froglets show an underdeveloped iris, similar to the classic phenotype (aniridia) seen in human patients with PAX6 mutations. Other eye abnormalities observed in these froglets, including cataracts and corneal defects, are also common in human aniridia. The frog model thus allows us to examine the earliest deficits in eye formation as a result of pax6 lesions, and provides a useful model for understanding the developmental basis for the aniridia phenotype seen in humans. Copyright © 2015 Elsevier Inc. All rights reserved.
Peng, Wentao; Lin, Zhijie; Li, Weirong; Lu, Jing; Shen, Yuequan; Wang, Chunguang
2013-01-01
The FIGL-1 (fidgetin like-1) protein is a homolog of fidgetin, a protein whose mutation leads to multiple developmental defects. The FIGL-1 protein contains an AAA (ATPase associated with various activities) domain and belongs to the AAA superfamily. However, the biological functions and developmental implications of this protein remain unknown. Here, we show that the AAA domain of the Caenorhabditis elegans FIGL-1 protein (CeFIGL-1-AAA), in clear contrast to homologous AAA domains, has an unusually high ATPase activity and forms a hexamer in solution. By determining the crystal structure of CeFIGL-1-AAA, we found that the loop linking helices α9 and α10 folds into the short helix α9a, which has an acidic surface and interacts with a positively charged surface of the neighboring subunit. Disruption of this charge interaction by mutagenesis diminishes both the ATPase activity and oligomerization capacity of the protein. Interestingly, the acidic residues in helix α9a of CeFIGL-1-AAA are not conserved in other homologous AAA domains that have relatively low ATPase activities. These results demonstrate that the sequence of CeFIGL-1-AAA has adapted to establish an intersubunit charge interaction, which contributes to its strong oligomerization and ATPase activity. These unique properties of CeFIGL-1-AAA distinguish it from other homologous proteins, suggesting that CeFIGL-1 may have a distinct biological function. PMID:23979136
Peng, Wentao; Lin, Zhijie; Li, Weirong; Lu, Jing; Shen, Yuequan; Wang, Chunguang
2013-10-11
The FIGL-1 (fidgetin like-1) protein is a homolog of fidgetin, a protein whose mutation leads to multiple developmental defects. The FIGL-1 protein contains an AAA (ATPase associated with various activities) domain and belongs to the AAA superfamily. However, the biological functions and developmental implications of this protein remain unknown. Here, we show that the AAA domain of the Caenorhabditis elegans FIGL-1 protein (CeFIGL-1-AAA), in clear contrast to homologous AAA domains, has an unusually high ATPase activity and forms a hexamer in solution. By determining the crystal structure of CeFIGL-1-AAA, we found that the loop linking helices α9 and α10 folds into the short helix α9a, which has an acidic surface and interacts with a positively charged surface of the neighboring subunit. Disruption of this charge interaction by mutagenesis diminishes both the ATPase activity and oligomerization capacity of the protein. Interestingly, the acidic residues in helix α9a of CeFIGL-1-AAA are not conserved in other homologous AAA domains that have relatively low ATPase activities. These results demonstrate that the sequence of CeFIGL-1-AAA has adapted to establish an intersubunit charge interaction, which contributes to its strong oligomerization and ATPase activity. These unique properties of CeFIGL-1-AAA distinguish it from other homologous proteins, suggesting that CeFIGL-1 may have a distinct biological function.
Unciuleac, Mihaela-Carmen; Smith, Paul C; Shuman, Stewart
2016-05-15
AAA proteins (ATPases associated with various cellular activities) use the energy of ATP hydrolysis to drive conformational changes in diverse macromolecular targets. Here, we report the biochemical characterization and 2.5-Å crystal structure of a Mycobacterium smegmatis AAA protein Msm0858, the ortholog of Mycobacterium tuberculosis Rv0435c. Msm0858 is a magnesium-dependent ATPase and is active with all nucleoside triphosphates (NTPs) and deoxynucleoside triphosphates (dNTPs) as substrates. The Msm0858 structure comprises (i) an N-terminal domain (amino acids [aa] 17 to 201) composed of two β-barrel modules and (ii) two AAA domains, D1 (aa 212 to 473) and D2 (aa 476 to 744), each of which has ADP in the active site. Msm0858-ADP is a monomer in solution and in crystallized form. Msm0858 domains are structurally homologous to the corresponding modules of mammalian p97. However, the position of the N-domain modules relative to the AAA domains in the Msm0858-ADP tertiary structure is different and would impede the formation of a p97-like hexameric quaternary structure. Mutational analysis of the A-box and B-box motifs indicated that the D1 and D2 AAA domains are both capable of ATP hydrolysis. Simultaneous mutations of the D1 and D2 active-site motifs were required to abolish ATPase activity. ATPase activity was effaced by mutation of the putative D2 arginine finger, suggesting that Msm0858 might oligomerize during the ATPase reaction cycle. A truncated variant Msm0858 (aa 212 to 745) that lacks the N domain was characterized as a catalytically active homodimer. Recent studies have underscored the importance of AAA proteins (ATPases associated with various cellular activities) in the physiology of mycobacteria. This study reports the ATPase activity and crystal structure of a previously uncharacterized mycobacterial AAA protein, Msm0858. Msm0858 consists of an N-terminal β-barrel domain and two AAA domains, each with ADP bound in the active site. Msm0858 is a
Identification of Heading Date Six (Hd6 Gene Derived from Rice Mutant Varieties
Directory of Open Access Journals (Sweden)
Aryanti Aryanti
2017-04-01
Full Text Available Genes which were associated with flowering time to indicate the early maturity is known as heading date (Hd. Heading date six (Hd6 gene was identified from rice mutant varieties were Atomita 2, Atomita 3, Atomita 4, Bestari, Cilosari, Diah Suci, Sidenuk, Kahayan, Mayang, Meraoke, Mira-1, Pandan Putri, Superwin, Suluttan Unsrat 1, Suluttan Unsrat 2, Winongo, Woyla, Yuwono, while the rice var. Nipponbare was used as a positive control. All of rice mutant varieties derived from mutation induction by the dose of 0.2 kGy. The aim of this experiment was to find out the data base of mutant varieties which could be used as parent material with earlier maturity trait genetically. To obtain the DNA of plants, young leaves of each variety were extracted by liquid nitrogen, and then lysis and extracted by Kit Plant Genomic DNA. The amplification of DNA with 7 primers of Hd6 conducted of 40 cycles by PCR and were continues to separated by 1 % agarose. The results were shown that the rice Mira-1 and Bestari varieties obtained from mutation of Cisantana highly different from one to another on 7 primers of Hd6 used. Mayang variety from mutation of cross breeding between Cilosari and IR64, Pandan putri from Pandan wangi and Woyla from mutation of cross breeding from Atomita 2 and IR64 were highly different with those of their parents. Identification of Hd6 gene on Sidenuk variety was shown the same bands pattern with Nipponbare as control positive toward all primers used, this variety would be better for earlier maturity parent material compared to others. The information could be useful for breeding programs aiming to develop early maturing widely adaptive and high yielding rice cultivars.
Energy Technology Data Exchange (ETDEWEB)
Yoshikatsu, Yuki [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Ishida, Yo-ichi; Sudo, Haruka [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan); Yuasa, Keizo; Tsuji, Akihiko [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan)
2015-08-28
Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. - Highlights: • ATPase-deficient mutants of NVL2 have decreased pre-rRNA processing. • NVL2 associates with the nuclear exosome through interactions with MTR4 and RRP6. • MPP6 stabilizes MTR4-RRP6 interaction and allows NVL2 to interact with the complex.
Wairegi, L.; Asten, van P.
2011-01-01
Despite low yields and soil fertility problems, fertilizer use in the East African Highland banana (AAA-EA) production is absent. High fertilizer costs increase the need for site-specific fertilizer recommendations that address deficiencies. This study aimed to derive and compare norms for AAA-EA
Inflammatory cell phenotypes in AAAs; their role and potential as targets for therapy
Dale, Matthew A; Ruhlman, Melissa K.; Baxter, B. Timothy
2015-01-01
Abdominal aortic aneurysms are characterized by chronic inflammatory cell infiltration. AAA is typically an asymptomatic disease and caused approximately 15,000 deaths annually in the U.S. Previous studies have examined both human and murine aortic tissue for the presence of various inflammatory cell types. Studies show that in both human and experimental AAAs, prominent inflammatory cell infiltration, such as CD4+ T cells and macrophages, occurs in the damaged aortic wall. These cells have t...
NASA Astrophysics E/PO Impact: NASA SOFIA AAA Program Evaluation Results
Harman, Pamela; Backman, Dana E.; Clark, Coral; Inverness Research Sofia Aaa Evaluation Team, Wested Sofia Aaa Evaluation Team
2015-01-01
SOFIA is an airborne observatory, studying the universe at infrared wavelengths, capable of making observations that are impossible for even the largest and highest ground-based telescopes. SOFIA also inspires the development of new scientific instrumentation and fosters the education of young scientists and engineers.SOFIA is an 80% - 20% partnership of NASA and the German Aerospace Center (DLR), consisting of an extensively modified Boeing 747SP aircraft carrying a reflecting telescope with an effective diameter of 2.5 meters (100 inches). The SOFIA aircraft is based at NASA Armstrong Flight Research Center, Building 703, in Palmdale, California. The Science Program and Outreach Offices are located at NASA Ames Research center. SOFIA is a program in NASA's Science Mission Directorate, Astrophysics Division.Data will be collected to study many different kinds of astronomical objects and phenomena, including star cycles, solar system formation, identification of complex molecules in space, our solar system, galactic dust, nebulae and ecosystems.Airborne Astronomy Ambassador (AAA) Program:The SOFIA Education and Communications program exploits the unique attributes of airborne astronomy to contribute to national goals for the reform of science, technology, engineering, and math (STEM) education, and to elevate public scientific and technical literacy.The AAA effort is a professional development program aspiring to improve teaching, inspire students, and inform the community. To date, 55 educators from 21 states; Cycles 0, 1 and 2; have completed their astronomy professional development and their SOFIA science flight experience. Evaluation has confirmed the program's positive impact on the teacher participants, on their students, and in their communities. The inspirational experience has positively impacted their practice and career trajectory. AAAs have incorporated content knowledge and specific components of their experience into their curricula, and have given
International Nuclear Information System (INIS)
Knaap, A.G.A.C.; Simons, J.W.I.M.
1983-01-01
As it is not known to what extent differential growth rates of induced mutants lead to over- and under-representation of mutants in treated populations and thereby affect the determination of mutant frequencies, the mutation induction in X-irradiated L5178Y mouse lymphoma cells was determined via two methods. The first method involves the standard protocol which may suffer from the effect of differential growth rates, while the second method is based upon the fluctuation test in which the differential growth rates can be actually measured. It appeared that the standard protocol led to a mutant frequency that was similar to the mutant frequency determined in the fluctuation test. Therefore, the standard protocol appears to lead to only a minor under-estimation if any. Substantial heterogeneity in growth rates of induced mutants was observed, but the mutants with a selective advantage appear largely to compensate for the mutants that are lost because of selective disadvantage. It was calculated that the chance for isolating the same mutant twice from a treated population had been increased 2.2-fold because of the observed differential growth rates. (orig./AJ)
Inhibition of Early Stages of HIV-1 Assembly by INI1/hSNF5 Transdominant Negative Mutant S6 ▿
Cano, Jennifer; Kalpana, Ganjam V.
2011-01-01
INI1/hSNF5 is an HIV-1 integrase (IN) binding protein specifically incorporated into virions. A truncated mutant of INI1 (S6, amino acids 183 to 294) harboring the minimal IN binding Rpt1 domain potently inhibits HIV-1 particle production in a transdominant manner. The inhibition requires interaction of S6 with IN within Gag-Pol. While INI1 is a nuclear protein and harbors a masked nuclear export signal (NES), the transdominant negative mutant S6 is cytoplasmic, due to the unmasking of NES. Here, we examined the effects of subcellular localization of S6 on HIV-1 inhibition and further investigated the stages of assembly that are affected. We found that targeting a nuclear localization signal-containing S6 variant [NLS-S6(Rpt1)] to the nucleoplasm (but not to the nucleolus) resulted in complete reversal of inhibition of particle production. Electron microscopy indicated that although no electron-dense particles at any stage of assembly were seen in cells expressing S6, virions were produced in cells expressing the rescue mutant NLS-S6(Rpt1) to wild-type levels. Immunofluorescence analysis revealed that p24 exhibited a diffuse pattern of localization within the cytoplasm in cells expressing S6 in contrast to accumulation along the membrane in controls. Pulse-chase analysis indicated that in S6-expressing cells, although Gag(Pr55gag) protein translation was unaffected, processing and release of p24 were defective. Together, these results indicate that expression of S6 in the cytoplasm interferes with trafficking of Gag-Pol/Gag to the membrane and causes a defective processing leading to inhibition of assembly at an early stage prior to particle formation and budding. PMID:21159874
International Nuclear Information System (INIS)
Haladus, E.; Zuk, J.
1980-01-01
Spontaneous and UV-induced mitotic recombination was compared in diploids homozygous for rad6-1 mutation and in the wild-type strain carrying heterozygous markers for detecting gene conversion (hom 2-1, hom 2-2) and crossing over (ade 1, ade 2). Diploids homozygous for rad6-1 mutation were characterised by an elevated level of spontaneous and UV-induced mitotic recombination, particularly the intergenic events. Exposure of UV-irradiated strains to visible light resulted in an increased survival and decreased level of mitotic recombination. Liquid holding (LH) differentially affected frequency of mitotic intergenic and intragenic recombination in mutant and wild-type strains, being without any significant effect on cell survival. In a mutant strain intragenic recombination is significantly increased, intergenic only slightly. In the wild-type strain intragenic recombination is slightly decreased but intergenic is not changed by LH. Visible light applied after LH had no effect on survival and mitotic recombination in the wild type, while in the mutant strain photoreactivability of survival was fully preserved and accompanied by a decrease in the frequency of intragenic and intergenic recombination. The results suggest that metabolic pathways responsible for restoring cell survival are independent of or only partly overlapping with those concerning recombination events. (orig.) [de
Klarskov, Klaus; Gagnon, Hugo; Boudreault, Pierre-Luc; Normandin, Chad; Plancq, Baptiste; Marsault, Eric; Gleich, Gerald J; Naylor, Stephen
2018-01-05
The eosinophilia-myalgia syndrome (EMS) outbreak of 1989 that occurred in the USA and elsewhere was caused by the ingestion of l-Tryptophan (L-Trp) solely manufactured by the Japanese company Showa Denko K.K. (SD). Six compounds present in the SD L-Trp were reported to be case-associated contaminants. However, "one" of these compounds, Peak AAA has remained structurally uncharacterized, despite the fact that it was described as "the only statistically significant (p=0.0014) contaminant". Here, we employ on-line microcapillary-high performance liquid chromatography-electrospray ionization mass spectrometry (LC-MS), and tandem mass spectrometry (MS/MS) to determine that Peak AAA is in fact two structurally related isomers. Peak AAA 1 and Peak AAA 2 differed in LC retention times, and were determined by accurate mass-LC-MS to both have a protonated molecular ion (MH +) of mass 343.239Da (Da), corresponding to a molecular formula of C 21 H 30 N 2 O 2, and possessing eight degrees of unsaturation (DoU) for the non-protonated molecule. By comparing the LC-MS and LC-MS-MS retention times and spectra with authentic synthetic standards, Peak AAA 1 was identified as the intermolecular condensation product of L-Trp with anteiso 7-methylnonanoic acid, to afford (S)-2-amino-3-(2-((S,E)-7-methylnon-1-en-1-yl)-1H-indol-3-yl)propanoic acid. Peak AAA 2 was determined to be a condensation product of L-Trp with decanoic acid, which produced (S)-2-amino-3-(2-((E)-dec-1-en-1-yl)-1H-indol-3-yl)propanoic acid. Copyright © 2017 Elsevier B.V. All rights reserved.
Structural dynamics of the MecA-ClpC complex: a type II AAA+ protein unfolding machine.
Liu, Jing; Mei, Ziqing; Li, Ningning; Qi, Yutao; Xu, Yanji; Shi, Yigong; Wang, Feng; Lei, Jianlin; Gao, Ning
2013-06-14
The MecA-ClpC complex is a bacterial type II AAA(+) molecular machine responsible for regulated unfolding of substrates, such as transcription factors ComK and ComS, and targeting them to ClpP for degradation. The six subunits of the MecA-ClpC complex form a closed barrel-like structure, featured with three stacked rings and a hollow passage, where substrates are threaded and translocated through successive pores. Although the general concepts of how polypeptides are unfolded and translocated by internal pore loops of AAA(+) proteins have long been conceived, the detailed mechanistic model remains elusive. With cryoelectron microscopy, we captured four different structures of the MecA-ClpC complexes. These complexes differ in the nucleotide binding states of the two AAA(+) rings and therefore might presumably reflect distinctive, representative snapshots from a dynamic unfolding cycle of this hexameric complex. Structural analysis reveals that nucleotide binding and hydrolysis modulate the hexameric complex in a number of ways, including the opening of the N-terminal ring, the axial and radial positions of pore loops, the compactness of the C-terminal ring, as well as the relative rotation between the two nucleotide-binding domain rings. More importantly, our structural and biochemical data indicate there is an active allosteric communication between the two AAA(+) rings and suggest that concerted actions of the two AAA(+) rings are required for the efficiency of the substrate unfolding and translocation. These findings provide important mechanistic insights into the dynamic cycle of the MecA-ClpC unfoldase and especially lay a foundation toward the complete understanding of the structural dynamics of the general type II AAA(+) hexamers.
Energy Technology Data Exchange (ETDEWEB)
Ferreyra, M; Salinas Aranda, F; Dodat, D; Sansogne, R; Arbiser, S [Vidt Centro Medico, Ciudad Autonoma De Buenos Aires, Ciudad Autonoma de Buenos Aire (Argentina)
2016-06-15
Purpose: To use end-to-end testing to validate a 6 MV high dose rate photon beam, configured for Eclipse AAA algorithm using Golden Beam Data (GBD), for SBRT treatments using RapidArc. Methods: Beam data was configured for Varian Eclipse AAA algorithm using the GBD provided by the vendor. Transverse and diagonals dose profiles, PDDs and output factors down to a field size of 2×2 cm2 were measured on a Varian Trilogy Linac and compared with GBD library using 2% 2mm 1D gamma analysis. The MLC transmission factor and dosimetric leaf gap were determined to characterize the MLC in Eclipse. Mechanical and dosimetric tests were performed combining different gantry rotation speeds, dose rates and leaf speeds to evaluate the delivery system performance according to VMAT accuracy requirements. An end-to-end test was implemented planning several SBRT RapidArc treatments on a CIRS 002LFC IMRT Thorax Phantom. The CT scanner calibration curve was acquired and loaded in Eclipse. PTW 31013 ionization chamber was used with Keithley 35617EBS electrometer for absolute point dose measurements in water and lung equivalent inserts. TPS calculated planar dose distributions were compared to those measured using EPID and MapCheck, as an independent verification method. Results were evaluated with gamma criteria of 2% dose difference and 2mm DTA for 95% of points. Results: GBD set vs. measured data passed 2% 2mm 1D gamma analysis even for small fields. Machine performance tests show results are independent of machine delivery configuration, as expected. Absolute point dosimetry comparison resulted within 4% for the worst case scenario in lung. Over 97% of the points evaluated in dose distributions passed gamma index analysis. Conclusion: Eclipse AAA algorithm configuration of the 6 MV high dose rate photon beam using GBD proved efficient. End-to-end test dose calculation results indicate it can be used clinically for SBRT using RapidArc.
Structure and evolution of N-domains in AAA metalloproteases.
Scharfenberg, Franka; Serek-Heuberger, Justyna; Coles, Murray; Hartmann, Marcus D; Habeck, Michael; Martin, Jörg; Lupas, Andrei N; Alva, Vikram
2015-02-27
Metalloproteases of the AAA (ATPases associated with various cellular activities) family play a crucial role in protein quality control within the cytoplasmic membrane of bacteria and the inner membrane of eukaryotic organelles. These membrane-anchored hexameric enzymes are composed of an N-terminal domain with one or two transmembrane helices, a central AAA ATPase module, and a C-terminal Zn(2+)-dependent protease. While the latter two domains have been well studied, so far, little is known about the N-terminal regions. Here, in an extensive bioinformatic and structural analysis, we identified three major, non-homologous groups of N-domains in AAA metalloproteases. By far, the largest one is the FtsH-like group of bacteria and eukaryotic organelles. The other two groups are specific to Yme1: one found in plants, fungi, and basal metazoans and the other one found exclusively in animals. Using NMR and crystallography, we determined the subunit structure and hexameric assembly of Escherichia coli FtsH-N, exhibiting an unusual α+β fold, and the conserved part of fungal Yme1-N from Saccharomyces cerevisiae, revealing a tetratricopeptide repeat fold. Our bioinformatic analysis showed that, uniquely among these proteins, the N-domain of Yme1 from the cnidarian Hydra vulgaris contains both the tetratricopeptide repeat region seen in basal metazoans and a region of homology to the N-domains of animals. Thus, it is a modern-day representative of an intermediate in the evolution of animal Yme1 from basal eukaryotic precursors. Copyright © 2015. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
1987-01-01
In the variety TKM6 a high yielding semidwarf mutant has been induced. This TKM6 mutant was used in test crosses with a number of other varieties and mutants to examine the extent of heterosis of dwarfs in rice and to select superior crosses. An excerpt of the published data is given. It appears from the backcross of the mutant with its original variety, that an increase in number of productive tillers occurs in the hybrid, leading to a striking grain yield increase, while the semi-dwarf culm length (the main mutant character) reverts to the normal phenotype. In the cross with IR8 on the other hand, there is only a minimal increase in tiller number but a substantial increase in TGW leading to more than 30% yield increase over the better parent
Convergent mechanisms favor fast amyloid formation in two lambda 6a Ig light chain mutants.
Valdés-García, Gilberto; Millán-Pacheco, César; Pastor, Nina
2017-08-01
Extracellular deposition as amyloids of immunoglobulin light chains causes light chain amyloidosis. Among the light chain families, lambda 6a is one of the most frequent in light chain amyloidosis patients. Its germline protein, 6aJL2, and point mutants, R24G and P7S, are good models to study fibrillogenesis, because their stability and fibril formation characteristics have been described. Both mutations make the germline protein unstable and speed up its ability to aggregate. To date, there is no molecular mechanism that explains how these differences in amyloidogenesis can arise from a single mutation. To look into the structural and dynamical differences in the native state of these proteins, we carried out molecular dynamics simulations at room temperature. Despite the structural similarity of the germline protein and the mutants, we found differences in their dynamical signatures that explain the mutants' increased tendency to form amyloids. The contact network alterations caused by the mutations, though different, converge in affecting two anti-aggregation motifs present in light chain variable domains, suggesting a different starting point for aggregation in lambda chains compared to kappa chains. © 2017 Wiley Periodicals, Inc.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K
2017-01-01
The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Directory of Open Access Journals (Sweden)
Anup K Kundu
Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Baldus, S E; Thiele, J; Park, Y O; Hanisch, F G; Bara, J; Fischer, R
1996-08-01
Using immunochemical and immunohistochemical methods, the binding site of Anguilla anguilla agglutinin (AAA) was characterized and compared with the related fucose-specific lectin from Ulex europaeus (UEA-I). In solid-phase enzyme-linked immunoassays, the two lectins recognized Fuc alpha 1-2Gal beta-HSA. AAA additionally cross-reacted with neoglycolipids bearing lacto-N-fucopentaose (LNFP) I [H type 1] and II [Le(a)] and lactodifucotetraose (LDFT) as glycan moieties. UEA-I, on the other hand, bound to a LDFT-derived neoglycolipid but not to the other neoglycolipids tested. Binding of AAA to gastric mucin was competitively neutralized by Le(a)-specific monoclonal antibodies. UEA-I binding, on the other hand, was reduced after co-incubation with H type 2- and Le(y)-specific monoclonal antibodies. According to our results, AAA reacts with fucosylated type 1 chain antigens, whereas UEA-I binds only to the alpha 1-2-fucosylated LDFT-derived neoglycolipid. In immunohistochemical studies, the reactivity of AAA and UEA-I in normal pyloric mucosa from individuals with known Lewis and secretor status was analysed. AAA showed a broad reaction in the superficial pyloric mucosa from secretors and non-secretors, but AAA reactivity was more pronounced in Le(a+b-) individuals. On the other hand, UEA-I stained the superficial pyloric mucosa only from secretor individuals. A staining of deep mucous glands by the lectins was found in all specimens. Both reacted with most human carcinomas of different origin. Slight differences in their binding pattern were observed and may be explained by the different fine-specificities of the lectins.
Sakalihasan, Natzi; Defraigne, Jean-Olivier; Kerstenne, Marie-Ange; Cheramy-Bien, Jean-Paul; Smelser, Diane T; Tromp, Gerard; Kuivaniemi, Helena
2014-05-01
The objectives were to answer the following questions with the help of a well-characterized population in Liège, Belgium: 1) what percentage of patients with abdominal aortic aneurysm (AAA) have a positive family history for AAA? 2) what is the prevalence of AAAs among relatives of patients with AAA? and 3) do familial and sporadic AAA cases differ in clinical characteristics? Patients with unrelated AAA diagnosed at the Cardiovascular Surgery Department, University Hospital of Liège, Belgium, between 1999 and 2012 were invited to the study. A detailed family history was obtained in interviews and recorded using Progeny software. We divided the 618 patients into 2 study groups: group I, 296 patients with AAA (268; 91% men) were followed up with computerized tomography combined with positron emission tomography; and group II, 322 patients with AAA (295; 92% men) whose families were invited to ultrasonographic screening. In the initial interview, 62 (10%) of the 618 patients with AAA reported a positive family history for AAA. Ultrasonographic screening identified 24 new AAAs among 186 relatives (≥50 years) of 144 families yielding a prevalence of 13%. The highest prevalence (25%) was found among brothers. By combining the number of AAAs found by ultrasonographic screening with those diagnosed previously the observed lifetime prevalence of AAA was estimated to be 32% in brothers. The familial AAA cases were more likely to have a ruptured AAA than the sporadic cases (8% vs. 2.4%; P AAA among brothers, support genetic contribution to AAA pathogenesis, and provide rationale for targeted screening of relatives of patients with AAA. Copyright © 2014 Elsevier Inc. All rights reserved.
Hemenway, C S; Dolinski, K; Cardenas, M E; Hiller, M A; Jones, E W; Heitman, J
1995-11-01
We have characterized a Saccharomyces cerevisiae mutant strain that is hypersensitive to cyclosporin A (CsA) and FK506, immunosuppressants that inhibit calcineurin, a serine-threonine-specific phosphatase (PP2B). A single nuclear mutation, designated cev1 for calcineurin essential for viability, is responsible for the CsA-FK506-sensitive phenotype. The peptidyl-prolyl cis-trans isomerases cyclophilin A and FKBP12, respectively, mediate CsA and FK506 toxicity in the cev1 mutant strain. We demonstrate that cev1 is an allele of the VPH6 gene and that vph6 mutant strains fail to assemble the vacuolar H(+)-ATPase (V-ATPase). The VPH6 gene was mapped on chromosome VIII and is predicted to encode a 181-amino acid (21 kD) protein with no identity to other known proteins. We find that calcineurin is essential for viability in many mutant strains with defects in V-ATPase function or vacuolar acidification. In addition, we find that calcineurin modulates extracellular acidification in response to glucose, which we propose occurs via calcineurin regulation of the plasma membrane H(+)-ATPase PMA1. Taken together, our findings suggest calcineurin plays a general role in the regulation of cation transport and homeostasis.
Radiation dose assessment of musa acuminata - triploid (AAA)
International Nuclear Information System (INIS)
Maravillas, Mart Andrew S.; Locaylocay, Jocelyn R.; Mendoza, Concepcion S.
2008-01-01
Bananas are radioactive due to the presence of the radioisotope- 40 K. This imposes a possible health risk to the general public. This study intended to assess the annual equivalent dosages and the annual effective dosage committed by the body. This seeks to benefit the general public, students and researchers, and entrepreneurs. Using atomic absorption spectrophotometry, lakatan banana (Musa acuminata-triploid (AAA), the most purchased variety cultivated in Barangay Adlawon, Cebu City, Philippines, was found to contain 0.53 g of total potassium for every 100 g of its fresh fruit wherein 6.2 x 10 -5 g of which is potassium-40. Based on its 40 K content banana was calculated to have a radioactivity of 16 Bq/100 g. it was found out that the body is exposed to radiation dosages ranging from 2.8 x 10 -3 rem annually by eating 100 g of lakatan bananas everyday. Conversely, it is equivalent to the annual effective dosage of 0.0043 rem; the amount at which the body of an individual is uniformly exposed. However, no or extremely minute health risk was determined by just eating bananas. In fact, to exceed the radiation dose limits set by the International Commission on Radiation Protection, an individual may eat 116 kg of lakatan bananas everyday for a year. Fertilizers may be the major source of the radioisotope - 40 K and assimilated by the plants. (author)
Boron toxicity in banana (Musa AAA) plantations of Costa Rica
International Nuclear Information System (INIS)
Vargas, Alfonso; Serrano, Edgardo; Arias, Fulvio; Arias M, Oscar
2007-01-01
A marginal, irregular and continuous necrosis was observed in the leaves of in banana plants (Musa AAA, cvs. Grande Naine and Valery), This necrosis was developed from an irregular chlorotic area, from the edge towards the internal part of the leaf blade. The central portion of the leaf kept the original green color. Soil and foliar analyses showed that symptoms were caused by high boron concentrations, probably due to excessive soil or foliage applications of the nutriment, or to the effect of very frequent applications of boron during fertigation, combined with a decrease of calcium in the leaf. (author) [es
Target dose study of effects of changes in the AAA calculation resolution on lung SABR plan
International Nuclear Information System (INIS)
Kim, Dae Il; Son, Sang Jun; Ahn, Bum Seok; Jung, Chi Hoon; Yoo, Suk Hyun
2014-01-01
Changing the calculation grid of AAA in Lung SABR plan and to analyze the changes in target dose, and investigated the effects associated with it, and considered a suitable method of application. 4D CT image that was used to plan all been taken with Brilliance Big Bore CT (Philips, Netherlands) and in Lung SABR plan(Eclipse TM ver10.0.42, Varian, the USA), use anisotropic analytic algorithm(AAA, ver.10, Varian Medical Systems, Palo Alto, CA, USA) and, was calculated by the calculation grid 1.0, 3.0, 5.0 mm in each Lung SABR plan. Lung SABR plan of 10 cases are using each of 1.0 mm, 3.0 mm, 5.0 mm calculation grid, and in case of use a 1.0 mm calculation grid V98 of the prescribed dose is about 99.5%±1.5%, Dmin of the prescribed dose is about 92.5±1.5% and Homogeneity Index(HI) is 1.0489±0.0025. In the case of use a 3.0 mm calculation grid V98 dose of the prescribed dose is about 90±4.5% , Dmin of the prescribed dose is about 87.5±3% and HI is about 1.07±1. In the case of use a 5.0 mm calculation grid V98 dose of the prescribed dose is about 63±15%, Dmin of the prescribed dose is about 83±4% and HI is about 1.13±0.2, respectively. The calculation grid of 1.0 mm is better improves the accuracy of dose calculation than using 3.0 mm and 5.mm, although calculation times increase in the case of smaller PTV relatively. As lung, spread relatively large and low density and small PTV, it is considered and good to use a calculation grid of 1.0 mm
Inflammatory cell phenotypes in AAAs: their role and potential as targets for therapy.
Dale, Matthew A; Ruhlman, Melissa K; Baxter, B Timothy
2015-08-01
Abdominal aortic aneurysms (AAAs) are characterized by chronic inflammatory cell infiltration. AAA is typically an asymptomatic disease and caused ≈15 000 deaths annually in the United States. Previous studies have examined both human and murine aortic tissue for the presence of various inflammatory cell types. Studies show that in both human and experimental AAAs, prominent inflammatory cell infiltration, such as CD4(+) T cells and macrophages, occurs in the damaged aortic wall. These cells have the ability to undergo phenotypic modulation based on microenvironmental cues, potentially influencing disease progression. Proinflammatory CD4(+) T cells and classically activated macrophages dominate the landscape of aortic infiltrates. The skew to proinflammatory phenotypes alters disease progression and plays a role in causing chronic inflammation. The local cytokine production and presence of inflammatory mediators, such as extracellular matrix breakdown products, influence the uneven balance of the inflammatory infiltrate phenotypes. Understanding and developing new strategies that target the proinflammatory phenotype could provide useful therapeutic targets for a disease with no current pharmacological intervention. © 2015 American Heart Association, Inc.
Directory of Open Access Journals (Sweden)
Takao Sasado
Full Text Available Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68. CPSF6 is a component of the Cleavage Factor Im complex (CFIm which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.
Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi
2017-01-01
Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.
Gonzalez, Kim L; Fleming, Wendell A; Kao, Yun-Ting; Wright, Zachary J; Venkova, Savina V; Ventura, Meredith J; Bartel, Bonnie
2017-10-01
Catabolism of fatty acids stored in oil bodies is essential for seed germination and seedling development in Arabidopsis. This fatty acid breakdown occurs in peroxisomes, organelles that sequester oxidative reactions. Import of peroxisomal enzymes is facilitated by peroxins including PEX5, a receptor that delivers cargo proteins from the cytosol to the peroxisomal matrix. After cargo delivery, a complex of the PEX1 and PEX6 ATPases and the PEX26 tail-anchored membrane protein removes ubiquitinated PEX5 from the peroxisomal membrane. We identified Arabidopsis pex6 and pex26 mutants by screening for inefficient seedling β-oxidation phenotypes. The mutants displayed distinct defects in growth, response to a peroxisomally metabolized auxin precursor, and peroxisomal protein import. The low PEX5 levels in these mutants were increased by treatment with a proteasome inhibitor or by combining pex26 with peroxisome-associated ubiquitination machinery mutants, suggesting that ubiquitinated PEX5 is degraded by the proteasome when the function of PEX6 or PEX26 is reduced. Combining pex26 with mutations that increase PEX5 levels either worsened or improved pex26 physiological and molecular defects, depending on the introduced lesion. Moreover, elevating PEX5 levels via a 35S:PEX5 transgene exacerbated pex26 defects and ameliorated the defects of only a subset of pex6 alleles, implying that decreased PEX5 is not the sole molecular deficiency in these mutants. We found peroxisomes clustered around persisting oil bodies in pex6 and pex26 seedlings, suggesting a role for peroxisomal retrotranslocation machinery in oil body utilization. The disparate phenotypes of these pex alleles may reflect unanticipated functions of the peroxisomal ATPase complex. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Ferrell Robert E
2011-01-01
Full Text Available Abstract Background Abdominal aortic aneurysm (AAA is a complex disorder with multiple genetic risk factors. Using affected relative pair linkage analysis, we previously identified an AAA susceptibility locus on chromosome 19q13. This locus has been designated as the AAA1 susceptibility locus in the Online Mendelian Inheritance in Man (OMIM database. Methods Nine candidate genes were selected from the AAA1 locus based on their function, as well as mRNA expression levels in the aorta. A sample of 394 cases and 419 controls was genotyped for 41 SNPs located in or around the selected nine candidate genes using the Illumina GoldenGate platform. Single marker and haplotype analyses were performed. Three genes (CEBPG, PEPD and CD22 were selected for DNA sequencing based on the association study results, and exonic regions were analyzed. Immunohistochemical staining of aortic tissue sections from AAA and control individuals was carried out for the CD22 and PEPD proteins with specific antibodies. Results Several SNPs were nominally associated with AAA (p CEBPG, peptidase D (PEPD, and CD22. Haplotype analysis found a nominally associated 5-SNP haplotype in the CEBPG/PEPD locus, as well as a nominally associated 2-SNP haplotype in the CD22 locus. DNA sequencing of the coding regions revealed no variation in CEBPG. Seven sequence variants were identified in PEPD, including three not present in the NCBI SNP (dbSNP database. Sequencing of all 14 exons of CD22 identified 20 sequence variants, five of which were in the coding region and six were in the 3'-untranslated region. Five variants were not present in dbSNP. Immunohistochemical staining for CD22 revealed protein expression in lymphocytes present in the aneurysmal aortic wall only and no detectable expression in control aorta. PEPD protein was expressed in fibroblasts and myofibroblasts in the media-adventitia border in both aneurysmal and non-aneurysmal tissue samples. Conclusions Association testing
2010-10-01
... address changes to the case-mix that are a result of changes in the coding or classification of different...-day episode payment rate for case-mix and area wage levels. 484.220 Section 484.220 Public Health... Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and area wage levels...
Ali, Sikander; Nawaz, Wajeeha
2017-02-01
The optimisation of nutritional requirements for dopamine (DA) synthesis by calcium alginate-entrapped mutant variant of Aspergillus oryzae EMS-6 using submerged fermentation technique was investigated. A total of 13 strains were isolated from soil. Isolate I-2 was selected as a better producer of DA and improved by exposing with ethyl methylsulphonate (EMS). EMS-6 was selected as it exhibited 43 μg/mL DA activity. The mutant variable was further treated with low levels of l-cysteine HCl to make it resistant against diversion and environmental stress. The conidiospores of mutant variant were entrapped in calcium alginate beads for stable product formation. EMS-6 gave maximum DA activity (124 μg/mL) when supplemented with 0.1% peptone and 0.2% sucrose, under optimised parameters viz. pH 3, temperature of 55 °C and incubation time of 70 min. The study involves the high profile of DA activity and is needed, as DA is capable to control numerous neurogenic disorders.
Casillas-Berumen, Sergio; Rojas-Miguez, Florencia A; Farber, Alik; Komshian, Sevan; Kalish, Jeffrey A; Rybin, Denis; Doros, Gheorghe; Siracuse, Jeffrey J
2018-01-01
Open aortic aneurysm repair (AAA) repair can be resource intensive and associated with a prolonged length of stay (LOS). We sought to examine patient and aneurysm predictors of prolonged LOS to better identify those at risk in the preoperative setting. Patient data were obtained from the targeted AAA American College of Surgery National Surgical Quality Improvement Program database from 2012 to 2014 of patients undergoing open AAA repair. Multivariable logistic regression was used to determine predictors of prolonged postoperative LOS defined as greater than 10 days (75th percentile). There were 1172 open AAA repairs identified. The majority (54%) of patients were older than 70 years and male (74%). Surgical approach was transperitoneal (70.9%) and retroperitoneal (29.1%). Aneurysms were 51.4% infrarenal, 33% juxtarenal, 5.7% pararenal, 7.4% suprarenal, and 2.5% type IV thoracoabdominal. Mean and median LOS were 9.1 ± 7.4 and 7 (0-72) days, respectively. Independently associated with extended LOS factors were visceral revascularization (odds ratio [OR]: 5.32, 95% confidence interval [CI]: 2.77-10.22, P AAA repair. Prospective identification of high-risk patients may allow physicians and hospitals to engage in multidisciplinary collaborations preoperatively to try to improve LOS in this resource-intensive population.
International Nuclear Information System (INIS)
Kroon, Petra S; Hol, Sandra; Essers, Marion
2013-01-01
The main aim of the current study was to assess the dosimetric accuracy and clinical quality of volumetric modulated arc therapy (VMAT) plans for stereotactic (stage I) and conventional (stage III) lung cancer treatments planned with Eclipse version 10.0 Anisotropic Analytical Algorithm (AAA) and Acuros XB (AXB) algorithm. The dosimetric impact of using AAA instead of AXB, and grid size 2.5 mm instead of 1.0 mm for VMAT treatment plans was evaluated. The clinical plan quality of AXB VMAT was assessed using 45 stage I and 73 stage III patients, and was compared with published results, planned with VMAT and hybrid-VMAT techniques. The dosimetric impact on near-minimum PTV dose (D 98% ) using AAA instead of AXB was large (underdose up to 12.3%) for stage I and very small (underdose up to 0.8%) for stage III lung treatments. There were no significant differences for dose volume histogram (DVH) values between grid sizes. The calculation time was significantly higher for AXB grid size 1.0 than 2.5 mm (p < 0.01). The clinical quality of the VMAT plans was at least comparable with clinical qualities given in literature of lung treatment plans with VMAT and hybrid-VMAT techniques. The average mean lung dose (MLD), lung V 20Gy and V 5Gy in this study were respectively 3.6 Gy, 4.1% and 15.7% for 45 stage I patients and 12.4 Gy, 19.3% and 46.6% for 73 stage III lung patients. The average contra-lateral lung dose V 5Gy-cont was 35.6% for stage III patients. For stereotactic and conventional lung treatments, VMAT calculated with AXB grid size 2.5 mm resulted in accurate dose calculations. No hybrid technique was needed to obtain the dose constraints. AXB is recommended instead of AAA for avoiding serious overestimation of the minimum target doses compared to the actual delivered dose
International Nuclear Information System (INIS)
Fogliata, Antonella; Nicolini, Giorgia; Clivio, Alessandro; Vanetti, Eugenio; Cozzi, Luca
2011-01-01
Purpose: To assess the accuracy against measurements of two photon dose calculation algorithms (Acuros XB and the Anisotropic Analytical algorithm AAA) for small fields usable in stereotactic treatments with particular focus on RapidArc. Methods: Acuros XB and AAA were configured for stereotactic use. Baseline accuracy was assessed on small jaw-collimated open fields for different values for the spot sizes parameter in the beam data: 0.0, 0.5, 1, and 2 mm. Data were calculated with a grid of 1 x 1 mm 2 . Investigated fields were: 3 x 3, 2 x 2, 1 x 1, and 0.8 x 0.8 cm 2 with a 6 MV photon beam generated from a Clinac2100iX (Varian, Palo Alto, CA). Profiles, PDD, and output factors were measured in water with a PTW diamond detector (detector size: 4 mm 2 , thickness 0.4 mm) and compared to calculations. Four RapidArc test plans were optimized, calculated and delivered with jaw settings J3 x 3, J2 x 2, and J1 x 1 cm 2 , the last was optimized twice to generate high (H) and low (L) modulation patterns. Each plan consisted of one partial arc (gantry 110 deg. to 250 deg.), and collimator 45 deg. Dose to isocenter was measured in a PTW Octavius phantom and compared to calculations. 2D measurements were performed by means of portal dosimetry with the GLAaS method developed at authors' institute. Analysis was performed with gamma pass-fail test with 3% dose difference and 2 mm distance to agreement thresholds. Results: Open square fields: penumbrae from open field profiles were in good agreement with diamond measurements for 1 mm spot size setting for Acuros XB, and between 0.5 and 1 mm for AAA. Maximum MU difference between calculations and measurements was 1.7% for Acuros XB (0.2% for fields greater than 1 x 1 cm 2 ) with 0.5 or 1 mm spot size. Agreement for AAA was within 0.7% (2.8%) for 0.5 (1 mm) spot size. RapidArc plans: doses were evaluated in a 4 mm diameter structure at isocenter and computed values differed from measurements by 0.0, -0.2, 5.5, and -3.4% for
International Nuclear Information System (INIS)
Crompton, N.E.; Barth, B.; Kiefer, J.
1990-01-01
Chinese hamster V79-S cells capable of growing in suspension culture were exposed to 60Co gamma rays at a high dose rate (84 Gy/h), low dose rates (200, 50, and 39 mGy/h), and a spectrum of very low dose rates (between 29 and 4.5 mGy/h). Following time for appropriate expression the cultures were assayed for the induction of 6-thioguanine-resistant mutants. For a given dose, a decrease in mutation induction occurred as the dose rate was reduced from high dose rates to low dose rates. However, further reduction in dose rate resulted in a reverse dose-rate effect, and an increase in the frequency of mutants was observed. The contribution of background mutation frequency to this reverse dose-rate effect was studied, both by examining fluctuations of mutation frequency in nonirradiated culture and by its impact upon the dose-rate-independent nature of the reversed effect, and it was found to be negligible. The physiological state of the suspension culture under periods of protracted exposure to very low dose rates was also investigated. The effect of doubling time, plating efficiency, cell cycle distribution, and sensitivity on survival and mutation were examined. In no case was a change apparent during the very low-dose-rate exposures. The results are discussed in terms of the possible expression of cryptic radiation damage after prolonged culture times and/or the involvement of an error-free repair system which requires a certain amount of radiation damage to become active
Institute of Scientific and Technical Information of China (English)
XIAO Gui-qing[1,2; ZHANG Hal-wen[3; LU Xiang-yang[1,2; HUANG Rong-feng[3
2015-01-01
A novel rice lesion mimic mutant (LMM) was isolated from an ethane methyl sulfonate (EMS)-induced 02428 mutant bank. The mutant, tentatively designated as Imm6, develops necrotic lesions in the whole growth period along with changes in several important agronomic traits. We found that the initiation of the lesions was induced by light and cell death occurred in Imm6 accompanied with accumulation of reactive oxygen species (ROS). The lower chlorophyll content, soluble protein content and superoxide dismutase (SOD) activity, the higher malondialdehyde (MDA) content were detected in Imm6 than in the wild type (WT). Moreover, the observation by transmission electronic microscope (TEM) demonstrated that some organelles were damaged and the stroma lamella of chloroplast was irregular and loose in mesophyll cell of Imm6. In addition, Imm6 was more resistant than WT to rice blast fungus Magnaporthe grisea infection, which was consistent with increased expression of four genes involved in the defense-related reaction. Genetic analysis showed that mutant trait of Imm6 is inherited as a monogenic recessive nuclear gene located on the long arm of chromosome 6. Using simple sequence repeat (SSR) markers, the target gene was finally delimited to an interval of 80.8 kb between markers MM2359 and MM2370, containing 7 annotated genes. Taken together, our results provide the information to identify a new gene involved in rice lesion mimic, which will be helpful in clarifying the mechanism of cell death and disease resistance in rice.
Osadnik, Hendrik; Schöpfel, Michael; Heidrich, Eyleen; Mehner, Denise; Lilie, Hauke; Parthier, Christoph; Risselada, H Jelger; Grubmüller, Helmut; Stubbs, Milton T; Brüser, Thomas
2015-11-01
Phage shock protein A (PspA) belongs to the highy conserved PspA/IM30 family and is a key component of the stress inducible Psp system in Escherichia coli. One of its central roles is the regulatory interaction with the transcriptional activator of this system, the σ(54) enhancer-binding protein PspF, a member of the AAA+ protein family. The PspA/F regulatory system has been intensively studied and serves as a paradigm for AAA+ enzyme regulation by trans-acting factors. However, the molecular mechanism of how exactly PspA controls the activity of PspF and hence σ(54) -dependent expression of the psp genes is still unclear. To approach this question, we identified the minimal PspF-interacting domain of PspA, solved its structure, determined its affinity to PspF and the dissociation kinetics, identified residues that are potentially important for PspF regulation and analyzed effects of their mutation on PspF in vivo and in vitro. Our data indicate that several characteristics of AAA+ regulation in the PspA·F complex resemble those of the AAA+ unfoldase ClpB, with both proteins being regulated by a structurally highly conserved coiled-coil domain. The convergent evolution of both regulatory domains points to a general mechanism to control AAA+ activity for divergent physiologic tasks via coiled-coil domains. © 2015 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Panettieri, Vanessa; Barsoum, Pierre; Westermark, Mathias; Brualla, Lorenzo; Lax, Ingmar
2009-01-01
Background and purpose: In tangential beam treatments accurate dose calculation of the absorbed dose in the build-up region is of major importance, in particular when the target has superficial extension close to the skin. In most analytical treatment planning systems (TPSs) calculations depend on the experimental measurements introduced by the user in which accuracy might be limited by the type of detector employed to perform them. To quantify the discrepancy between analytically calculated and delivered dose in the build-up region, near the skin of a patient, independent Monte Carlo (MC) simulations using the PENELOPE code were performed. Dose distributions obtained with MC simulations were compared with those given by the Pencil Beam Convolution (PBC) algorithm and the Analytical Anisotropic Algorithm (AAA) implemented in the commercial TPS Eclipse. Material and methods: A cylindrical phantom was used to approximate the breast contour of a patient for MC simulations and the TPS. Calculations of the absorbed doses were performed for 6 and 18 MV beams for four different angles of incidence: 15 deg., 30 deg., 45 deg. and 75 deg. and different field sizes: 3 x 3 cm 2 , 10 x 10 cm 2 and 40 x 40 cm 2 . Absorbed doses along the phantom central axis were obtained with both the PBC algorithm and the AAA and compared to those estimated by the MC simulations. Additionally, a breast patient case was calculated with two opposed 6 MV photon beams using all the aforementioned analytical and stochastic algorithms. Results: For the 6 MV photon beam in the phantom case, both the PBC algorithm and the AAA tend to underestimate the absorbed dose in the build-up region in comparison to MC results. These differences are clinically irrelevant and are included in a 1 mm range. This tendency is also confirmed in the breast patient case. For the 18 MV beam the PBC algorithm underestimates the absorbed dose with respect to the AAA. In comparison to MC simulations the PBC algorithm tends
Mechanism of Enzyme Repair by the AAA+ Chaperone Rubisco Activase.
Bhat, Javaid Y; Miličić, Goran; Thieulin-Pardo, Gabriel; Bracher, Andreas; Maxwell, Andrew; Ciniawsky, Susanne; Mueller-Cajar, Oliver; Engen, John R; Hartl, F Ulrich; Wendler, Petra; Hayer-Hartl, Manajit
2017-09-07
How AAA+ chaperones conformationally remodel specific target proteins in an ATP-dependent manner is not well understood. Here, we investigated the mechanism of the AAA+ protein Rubisco activase (Rca) in metabolic repair of the photosynthetic enzyme Rubisco, a complex of eight large (RbcL) and eight small (RbcS) subunits containing eight catalytic sites. Rubisco is prone to inhibition by tight-binding sugar phosphates, whose removal is catalyzed by Rca. We engineered a stable Rca hexamer ring and analyzed its functional interaction with Rubisco. Hydrogen/deuterium exchange and chemical crosslinking showed that Rca structurally destabilizes elements of the Rubisco active site with remarkable selectivity. Cryo-electron microscopy revealed that Rca docks onto Rubisco over one active site at a time, positioning the C-terminal strand of RbcL, which stabilizes the catalytic center, for access to the Rca hexamer pore. The pulling force of Rca is fine-tuned to avoid global destabilization and allow for precise enzyme repair. Copyright © 2017 Elsevier Inc. All rights reserved.
Role of Thr399Ile and Asp299Gly polymorphisms of toll-like receptor-4 gene in acute dental abscess.
Miri-Moghaddam, Ebrahim; Farhad-Mollashahi, Narges; Baghaee, Elnaz; Bazi, Ali; Garme, Yasaman
2017-02-01
Apical Periodontitis (AP) is an inflammatory disease that affects the tissues surrounding the root end of a tooth. The disease which is caused by endodontic infections presents in different clinical ways including development of an acute abscess. Recent studies have provided information suggesting role of a multitude of factors in pathogenesis of acute apical abscess (AAA). In this case-control study, our goal was to evaluate the frequency and potential role of two common polymorphisms of toll like receptor-4 (TLR-4) gene; Thr399Ile (1196 C>T) and Asp299Gly (+896 A>G), in 50 patients with AAA as cases and 50 patients with asymptomatic apical periodontitis (AAP) as controls. Saliva sample containing mucosal epithelial cells was used for DNA extraction. Polymorphisms were detected by Tetra-ARMS (Amplification Refractory Mutation System) PCR method. Statistical analyses were carried out in SPSS 21 software. Homozygous wild type (CC) and heterozygous (CT) genotypes of Thr399Ile polymorphism were detected in 84% and 16% of AAA patients respectively. In controls, respective ratios were 94% (CC) and 6% (CT). Observed difference was not statistically significant ( P >0.05) for distribution of these genotypes. The mutant homozygous (TT) genotype of this polymorphism was identified in neither of the participants. Overall, T allele frequency was obtained 8% in AAA and 3% in AAP (OR=2.6, 95% CI; 0. 6-10.6, p >0.05). For Asp299Gly polymorphism, no individual was detected with the mutant allele in case or control groups. Our results indicated a possible role for Thr399Ile polymorphism in acute presentations of abscess in AAA. However, the impact of this polymorphism needs to be more assessed in future studies. Key words: Genetic polymorphism, periapical abscess, periapical periodontitis, toll-like receptor 4.
Rampello, Anthony J; Glynn, Steven E
2017-03-24
The i-AAA protease is a component of the mitochondrial quality control machinery that regulates respiration, mitochondrial dynamics, and protein import. The protease is required to select specific substrates for degradation from among the diverse complement of proteins present in mitochondria, yet the rules that govern this selection are unclear. Here, we reconstruct the yeast i-AAA protease, Yme1p, to examine the in vitro degradation of two intermembrane space chaperone subunits, Tim9 and Tim10. Yme1p degrades Tim10 more rapidly than Tim9 despite high sequence and structural similarity, and loss of Tim10 is accelerated by the disruption of conserved disulfide bonds within the substrate. An unstructured N-terminal region of Tim10 is necessary and sufficient to target the substrate to the protease through recognition of a short phenylalanine-rich motif, and the presence of similar motifs in other small Tim proteins predicts robust degradation by the protease. Together, these results identify the first specific degron sequence within a native i-AAA protease substrate. Copyright © 2017 Elsevier Ltd. All rights reserved.
Semi-dwarf mutants for rice improvement
International Nuclear Information System (INIS)
Othman, Ramli; Osman, Mohammad; Ibrahim, Rusli
1990-01-01
Full text: MARDI and the National University of Malaysia embarked on a programme to induce resistance against blast in rice in 1978. MARDI also obtained semi dwarf mutants of cvs 'Mahsuri', 'Muda', 'Pongsu seribu' and 'Jarum Mas', which are under evaluation. The popular local rice variety 'Manik' was subjected to gamma irradiation (15-40 krad) and 101 promising semidwarf mutants have been obtained following selection in M 2 -M 6 . 29 of them show grain yields of 6.0-7.3 t/ha, compared with 5.7t for 'Manik'. Other valuable mutants were found showing long grain, less shattering, earlier maturity, and glutinous endosperm. One mutant, resistant to brown plant hopper yields 6.3t/ha. (author)
Bufacchi, Antonella; Nardiello, Barbara; Capparella, Roberto; Begnozzi, Luisa
2013-07-04
Retrospective analysis of 3D clinical treatment plans to investigate qualitative, possible, clinical consequences of the use of PBC versus AAA. The 3D dose distributions of 80 treatment plans at four different tumour sites, produced using PBC algorithm, were recalculated using AAA and the same number of monitor units provided by PBC and clinically delivered to each patient; the consequences of the difference on the dose-effect relations for normal tissue injury were studied by comparing different NTCP model/parameters extracted from a review of published studies. In this study the AAA dose calculation is considered as benchmark data. The paired Student t-test was used for statistical comparison of all results obtained from the use of the two algorithms. In the prostate plans, the AAA predicted lower NTCP value (NTCPAAA) for the risk of late rectal bleeding for each of the seven combinations of NTCP parameters, the maximum mean decrease was 2.2%. In the head-and-neck treatments, each combination of parameters used for the risk of xerostemia from irradiation of the parotid glands involved lower NTCPAAA, that varied from 12.8% (sd=3.0%) to 57.5% (sd=4.0%), while when the PBC algorithm was used the NTCPPBC's ranging was from 15.2% (sd=2.7%) to 63.8% (sd=3.8%), according the combination of parameters used; the differences were statistically significant. Also NTCPAAA regarding the risk of radiation pneumonitis in the lung treatments was found to be lower than NTCPPBC for each of the eight sets of NTCP parameters; the maximum mean decrease was 4.5%. A mean increase of 4.3% was found when the NTCPAAA was calculated by the parameters evaluated from dose distribution calculated by a convolution-superposition (CS) algorithm. A markedly different pattern was observed for the risk relating to the development of pneumonitis following breast treatments: the AAA predicted higher NTCP value. The mean NTCPAAA varied from 0.2% (sd = 0.1%) to 2.1% (sd = 0.3%), while the mean NTCPPBC
Pöhler, Robert; Krahn, Jan H; van den Boom, Johannes; Dobrynin, Grzegorz; Kaschani, Farnusch; Eggenweiler, Hans-Michael; Zenke, Frank T; Kaiser, Markus; Meyer, Hemmo
2018-02-05
AAA ATPases have pivotal functions in diverse cellular processes essential for survival and proliferation. Revealing strategies for chemical inhibition of this class of enzymes is therefore of great interest for the development of novel chemotherapies or chemical tools. Here, we characterize the compound MSC1094308 as a reversible, allosteric inhibitor of the type II AAA ATPase human ubiquitin-directed unfoldase (VCP)/p97 and the type I AAA ATPase VPS4B. Subsequent proteomic, genetic and biochemical studies indicate that MSC1094308 binds to a previously characterized drugable hotspot of p97, thereby inhibiting the D2 ATPase activity. Our results furthermore indicate that a similar allosteric site exists in VPS4B, suggesting conserved allosteric circuits and drugable sites in both type I and II AAA ATPases. Our results may thus guide future chemical tool and drug discovery efforts for the biomedically relevant AAA ATPases. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Fogliata, Antonella; Nicolini, Giorgia; Clivio, Alessandro; Vanetti, Eugenio; Cozzi, Luca [Oncology Institute of Southern Switzerland, Medical Physics Unit, CH-6500 Bellinzona (Switzerland)
2011-11-15
Purpose: To assess the accuracy against measurements of two photon dose calculation algorithms (Acuros XB and the Anisotropic Analytical algorithm AAA) for small fields usable in stereotactic treatments with particular focus on RapidArc. Methods: Acuros XB and AAA were configured for stereotactic use. Baseline accuracy was assessed on small jaw-collimated open fields for different values for the spot sizes parameter in the beam data: 0.0, 0.5, 1, and 2 mm. Data were calculated with a grid of 1 x 1 mm{sup 2}. Investigated fields were: 3 x 3, 2 x 2, 1 x 1, and 0.8 x 0.8 cm{sup 2} with a 6 MV photon beam generated from a Clinac2100iX (Varian, Palo Alto, CA). Profiles, PDD, and output factors were measured in water with a PTW diamond detector (detector size: 4 mm{sup 2}, thickness 0.4 mm) and compared to calculations. Four RapidArc test plans were optimized, calculated and delivered with jaw settings J3 x 3, J2 x 2, and J1 x 1 cm{sup 2}, the last was optimized twice to generate high (H) and low (L) modulation patterns. Each plan consisted of one partial arc (gantry 110 deg. to 250 deg.), and collimator 45 deg. Dose to isocenter was measured in a PTW Octavius phantom and compared to calculations. 2D measurements were performed by means of portal dosimetry with the GLAaS method developed at authors' institute. Analysis was performed with gamma pass-fail test with 3% dose difference and 2 mm distance to agreement thresholds. Results: Open square fields: penumbrae from open field profiles were in good agreement with diamond measurements for 1 mm spot size setting for Acuros XB, and between 0.5 and 1 mm for AAA. Maximum MU difference between calculations and measurements was 1.7% for Acuros XB (0.2% for fields greater than 1 x 1 cm{sup 2}) with 0.5 or 1 mm spot size. Agreement for AAA was within 0.7% (2.8%) for 0.5 (1 mm) spot size. RapidArc plans: doses were evaluated in a 4 mm diameter structure at isocenter and computed values differed from measurements by 0.0, -0
Nyombi, K.; Asten, van P.J.A.; Corbeels, M.; Taulya, G.; Leffelaar, P.A.; Giller, K.E.
2010-01-01
Poor yields of East African highland bananas (Musa spp., AAA-EAHB) on smallholder farms have often been attributed to problems of poor soil fertility. We measured the effects of mineral fertilizers on crop performance at two sites over two to three crop cycles; Kawanda in central Uganda and Ntungamo
Herruzo, Esther; Ontoso, David; González-Arranz, Sara; Cavero, Santiago; Lechuga, Ana; San-Segundo, Pedro A
2016-09-19
Meiotic cells possess surveillance mechanisms that monitor critical events such as recombination and chromosome synapsis. Meiotic defects resulting from the absence of the synaptonemal complex component Zip1 activate a meiosis-specific checkpoint network resulting in delayed or arrested meiotic progression. Pch2 is an evolutionarily conserved AAA+ ATPase required for the checkpoint-induced meiotic block in the zip1 mutant, where Pch2 is only detectable at the ribosomal DNA array (nucleolus). We describe here that high levels of the Hop1 protein, a checkpoint adaptor that localizes to chromosome axes, suppress the checkpoint defect of a zip1 pch2 mutant restoring Mek1 activity and meiotic cell cycle delay. We demonstrate that the critical role of Pch2 in this synapsis checkpoint is to sustain Mec1-dependent phosphorylation of Hop1 at threonine 318. We also show that the ATPase activity of Pch2 is essential for its checkpoint function and that ATP binding to Pch2 is required for its localization. Previous work has shown that Pch2 negatively regulates Hop1 chromosome abundance during unchallenged meiosis. Based on our results, we propose that, under checkpoint-inducing conditions, Pch2 also possesses a positive action on Hop1 promoting its phosphorylation and its proper distribution on unsynapsed chromosome axes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Genetic analysis of plant height in induced mutants of aromatic rice
International Nuclear Information System (INIS)
Kole, P.C.
2005-01-01
Inheritance of plant height in five gamma-ray induced mutants of aromatic rice cultivar Gobindabhog was studied through 6 x 6 diallel cross and segregation analyses. Diallel analysis revealed presence of additive and non-additive gene action with the preponderance of the latter. Proportion of dominant and recessive alleles was distributed unequally among the parents. The direction of dominance was towards tallness. The number of groups of genes was found to be three. The segregation analysis indicated the role of a single major recessive gene for height reduction in three mutants and, in another mutant, a single major recessive gene with negative modifiers. The other semi-dwarf mutant had two major recessive genes with almost equal effect in height reduction. The mutant allele(s) of the latter two mutants were non-allelic to sd sub(1) gene, which could be used as an alternative source of Dee Gee Woo Gen to widen the genetic diversity in semi-dwarfism [it
Kathirvel, M; Subramanian, V Sai; Arun, G; Thirumalaiswamy, S; Ramalingam, K; Kumar, S Ashok; Jagadeesh, K
2012-06-01
To dosimetrically validate AcurosXB algorithm for Volumetric Modulated Arc Therapy (VMAT) in comparison with standard clinical Anisotropic Analytic Algorithm(AAA) and Collapsed Cone Convolution(CCC) dose calculation algorithms. AcurosXB dose calculation algorithm is available with Varian Eclipse treatment planning system (V10). It uses grid-based Boltzmann equation solver to predict dose precisely in lesser time. This study was made to realize algorithms ability to predict dose accurately as its delivery for which five clinical cases each of Brain, Head&Neck, Thoracic, Pelvic and SBRT were taken. Verification plans were created on multicube phantom with iMatrixx-2D detector array and then dose prediction was done with AcurosXB, AAA & CCC (COMPASS System) algorithm and the same were delivered onto CLINAC-iX treatment machine. Delivered dose was captured in iMatrixx plane for all 25 plans. Measured dose was taken as reference to quantify the agreement between AcurosXB calculation algorithm against previously validated AAA and CCC algorithm. Gamma evaluation was performed with clinical criteria distance-to-agreement 3&2mm and dose difference 3&2% in omnipro-I'MRT software. Plans were evaluated in terms of correlation coefficient, quantitative area gamma and average gamma. Study shows good agreement between mean correlation 0.9979±0.0012, 0.9984±0.0009 & 0.9979±0.0011 for AAA, CCC & Acuros respectively. Mean area gamma for criteria 3mm/3% was found to be 98.80±1.04, 98.14±2.31, 98.08±2.01 and 2mm/2% was found to be 93.94±3.83, 87.17±10.54 & 92.36±5.46 for AAA, CCC & Acuros respectively. Mean average gamma for 3mm/3% was 0.26±0.07, 0.42±0.08, 0.28±0.09 and 2mm/2% was found to be 0.39±0.10, 0.64±0.11, 0.42±0.13 for AAA, CCC & Acuros respectively. This study demonstrated that the AcurosXB algorithm had a good agreement with the AAA & CCC in terms of dose prediction. In conclusion AcurosXB algorithm provides a valid, accurate and speedy alternative to AAA
Directory of Open Access Journals (Sweden)
Md. Mahidul Islam Masum
2017-09-01
Full Text Available The Type VI secretion system (T6SS is a class of macromolecular machine that is required for the virulence of gram-negative bacteria. However, it is still not clear what the role of T6SS in the virulence of rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae (Aaa is. The aim of the current study was to investigate the contribution of T6SS in Aaa strain RS2 virulence using insertional deletion mutation and complementation approaches. This strain produced weak virulence but contains a complete T6SS gene cluster based on a genome-wide analysis. Here we compared the virulence-related phenotypes between the wild-type (RS-2 and 25 T6SS mutants, which were constructed using homologous recombination methods. The mutation of 15 T6SS genes significantly reduced bacterial virulence and the secretion of Hcp protein. Additionally, the complemented 7 mutations ΔpppA, ΔclpB, Δhcp, ΔdotU, ΔicmF, ΔimpJ, and ΔimpM caused similar virulence characteristics as RS-2. Moreover, the mutant ΔpppA, ΔclpB, ΔicmF, ΔimpJ and ΔimpM genes caused by a 38.3~56.4% reduction in biofilm formation while the mutants ΔpppA, ΔclpB, ΔicmF and Δhcp resulted in a 37.5~44.6% reduction in motility. All together, these results demonstrate that T6SS play vital roles in the virulence of strain RS-2, which may be partially attributed to the reductions in Hcp secretion, biofilm formation and motility. However, differences in virulence between strain RS-1 and RS-2 suggest that other factors may also be involved in the virulence of Aaa.
Masum, Md Mahidul Islam; Yang, Yingzi; Li, Bin; Olaitan, Ogunyemi Solabomi; Chen, Jie; Zhang, Yang; Fang, Yushi; Qiu, Wen; Wang, Yanli; Sun, Guochang
2017-09-21
The Type VI secretion system (T6SS) is a class of macromolecular machine that is required for the virulence of gram-negative bacteria. However, it is still not clear what the role of T6SS in the virulence of rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae (Aaa) is. The aim of the current study was to investigate the contribution of T6SS in Aaa strain RS2 virulence using insertional deletion mutation and complementation approaches. This strain produced weak virulence but contains a complete T6SS gene cluster based on a genome-wide analysis. Here we compared the virulence-related phenotypes between the wild-type (RS-2) and 25 T6SS mutants, which were constructed using homologous recombination methods. The mutation of 15 T6SS genes significantly reduced bacterial virulence and the secretion of Hcp protein. Additionally, the complemented 7 mutations Δ pppA , Δ clpB , Δ hcp , Δ dotU , Δ icmF , Δ impJ , and Δ impM caused similar virulence characteristics as RS-2. Moreover, the mutant Δ pppA , Δ clpB , Δ icmF , Δ impJ and Δ impM genes caused by a 38.3~56.4% reduction in biofilm formation while the mutants Δ pppA , Δ clpB , Δ icmF and Δ hcp resulted in a 37.5~44.6% reduction in motility. All together, these results demonstrate that T6SS play vital roles in the virulence of strain RS-2, which may be partially attributed to the reductions in Hcp secretion, biofilm formation and motility. However, differences in virulence between strain RS-1 and RS-2 suggest that other factors may also be involved in the virulence of Aaa.
Yamasaki, Takashi; Oohata, Yukiko; Nakamura, Toshiki; Watanabe, Yo-hei
2015-04-10
The ClpB/Hsp104 chaperone solubilizes and reactivates protein aggregates in cooperation with DnaK/Hsp70 and its cofactors. The ClpB/Hsp104 protomer has two AAA+ modules, AAA-1 and AAA-2, and forms a homohexamer. In the hexamer, these modules form a two-tiered ring in which each tier consists of homotypic AAA+ modules. By ATP binding and its hydrolysis at these AAA+ modules, ClpB/Hsp104 exerts the mechanical power required for protein disaggregation. Although ATPase cycle of this chaperone has been studied by several groups, an integrated understanding of this cycle has not been obtained because of the complexity of the mechanism and differences between species. To improve our understanding of the ATPase cycle, we prepared many ordered heterohexamers of ClpB from Thermus thermophilus, in which two subunits having different mutations were cross-linked to each other and arranged alternately and measured their nucleotide binding, ATP hydrolysis, and disaggregation abilities. The results indicated that the ATPase cycle of ClpB proceeded as follows: (i) the 12 AAA+ modules randomly bound ATP, (ii) the binding of four or more ATP to one AAA+ ring was sensed by a conserved Arg residue and converted another AAA+ ring into the ATPase-active form, and (iii) ATP hydrolysis occurred cooperatively in each ring. We also found that cooperative ATP hydrolysis in at least one ring was needed for the disaggregation activity of ClpB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Balchiuniene, L.
1995-01-01
Spontaneous and gamma-induced mutability was compared in two groups of genetically unstable barley ear structure mutants - tweaky spike (tw) and branched ear (be). Instability in different loci causes different levels of spontaneous and gamma-induced mutability. A high spontaneous level of chlorophyll mutations is peculiar to be-ust mutants. It is suggested that the high level of induced chlorophyll mutations in allelic tw mutants is a result of better surviving of chlorophyll mutation carriers in the genotypical-physiological environment created by mutant tw alleles. (author). 6 refs., 2 tabs
Energy Technology Data Exchange (ETDEWEB)
Prakash, L [Rochester Univ., N.Y. (USA). Dept. of Radiation Biology and Biophysics; Rochester Univ., N.Y. (USA). School of Medicine and Dentistry)
1977-10-01
The ability to remove ultraviolet-induced pyrimidine dimers was examined in four radiation-sensitive mutants of Saccharomyces cerevisiae. The susceptibility of DNA from irradiated cells to nicking by either the T4 uv-endonuclease or an endonuclease activity found in crude extracts of Micrococcus luteus was used to measure the presence of dimers in DNA. The rad3 and rad4 mutants are shown to be defective in dimer excision whereas the rad6 and rad9 mutants are proficient in dimer excision.
Brown midrib (bmr) mutants are being investigated for their ability to increase the conversion efficiency of sorghum biomass for lignocellulosic bioenergy. Brown midrib 6 and 12 (bmr6 and 12) are impaired in the last two steps of monolignol biosynthesis resulting in reduced lignin content and alter...
Opalińska, Magdalena; Parys, Katarzyna; Murcha, Monika W; Jańska, Hanna
2018-01-29
Mitochondria are multifunctional organelles that play a central role in energy metabolism. Owing to the life-essential functions of these organelles, mitochondrial content, quality and dynamics are tightly controlled. Across the species, highly conserved ATP-dependent proteases prevent malfunction of mitochondria through versatile activities. This study focuses on a molecular function of the plant mitochondrial inner membrane-embedded AAA protease (denoted i -AAA) FTSH4, providing its first bona fide substrate. Here, we report that the abundance of the Tim17-2 protein, an essential component of the TIM17:23 translocase (Tim17-2 together with Tim50 and Tim23), is directly controlled by the proteolytic activity of FTSH4. Plants that are lacking functional FTSH4 protease are characterized by significantly enhanced capacity of preprotein import through the TIM17:23-dependent pathway. Taken together, with the observation that FTSH4 prevents accumulation of Tim17-2, our data point towards the role of this i -AAA protease in the regulation of mitochondrial biogenesis in plants. © 2018. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Jian Chen
Full Text Available Retinoblastoma binding protein 6 (RBBP6 plays an important role in chaperone-mediated ubiquitination and interacts with TP53 in carcinogenesis. However, the clinicopathologic significance of RBBP6 expression in colon cancer is unknown; in particular, the prognostic value of RBBP6 combined with TP53 expression has not been explored. Therefore, quantitative real-time PCR and western blot analyses were performed to detect RBBP6 expression in colon cancer tissues. RBBP6 and TP53 expression were assessed by immunohistochemistry in a tissue microarray format, in which the primary colon cancer tissue was paired with noncancerous tissue. Tissue specimens were obtained from 203 patients. We found that RBBP6 was overexpressed in colon tumorous tissues and was significantly associated with clinical stage, depth of tumor invasion, lymph node metastasis (LNM, distant metastasis, and histologic grade. Further studies revealed that a corresponding correlation between RBBP6 overexpression and mutant TP53 was evident in colon cancer (r = 0.450; P<0.001. RBBP6 expression was an independent prognostic factor for overall survival (OS and disease free survival (DFS. Interestingly, patients with tumors that had both RBBP6 overexpression and mutant TP53 protein accumulation relapsed and died within a significantly short period after surgery (P<0.001. Multivariate analysis showed that patients with LNM and patients with both RBBP6- and TP53-positive tumors had extremely poor OS (HR 6.75; 95% CI 2.63-17.35; P<0.001 and DFS (HR 8.08; 95% CI 2.80-23.30; P<0.001. These clinical findings indicate that the assessment of both RBBP6 and mutant TP53 expression will be helpful in predicting colon cancer prognosis.
International Nuclear Information System (INIS)
Codel, G; Serin, E; Pacaci, P; Sanli, E; Cebe, M; Mabhouti, H; Doyuran, M; Kucukmorkoc, E; Kucuk, N; Altinok, A; Canoglu, D; Acar, H; Caglar Ozkok, H
2016-01-01
Purpose: In this study, the comparison of dosimetric accuracy of Acuros XB and AAA algorithms were investigated for small radiation fields incident on homogeneous and heterogeneous geometries Methods: Small open fields of Truebeam 2.0 unit (1×1, 2×2, 3×3, 4×4 fields) were used for this study. The fields were incident on homogeneous phantom and in house phantom containing lung, air, and bone inhomogeneities. Using the same film batch, the net OD to dose calibration curve was obtaine dusing Trubeam 2.0 for 6 MV, 6 FFF, 10 MV, 10 FFF, 15 MV energies by delivering 0- 800 cGy. Films were scanned 48 hours after irradiation using an Epson 1000XL flatbed scanner. The dosimetric accuracy of Acuros XB and AAA algorithms in the presence of the inhomogeneities was compared against EBT3 film dosimetry Results: Open field tests in a homogeneous phantom showed good agreement betweent wo algorithms and measurement. For Acuros XB, minimum gamma analysis passin grates between measured and calculated dose distributions were 99.3% and 98.1% for homogeneousand inhomogeneous fields in thecase of lung and bone respectively. For AAA, minimum gamma analysis passingrates were 99.1% and 96.5% for homogeneous and inhomogeneous fields respectively for all used energies and field sizes.In the case of the air heterogeneity, the differences were larger for both calculations algorithms. Over all, when compared to measurement, theAcuros XB had beter agreement than AAA. Conclusion: The Acuros XB calculation algorithm in the TPS is an improvemen tover theexisting AAA algorithm. Dose discrepancies were observed for in the presence of air inhomogeneities.
Energy Technology Data Exchange (ETDEWEB)
Codel, G; Serin, E; Pacaci, P; Sanli, E; Cebe, M; Mabhouti, H; Doyuran, M; Kucukmorkoc, E; Kucuk, N; Altinok, A; Canoglu, D; Acar, H; Caglar Ozkok, H [Medipol University, Istanbul, Istanbul (Turkey)
2016-06-15
Purpose: In this study, the comparison of dosimetric accuracy of Acuros XB and AAA algorithms were investigated for small radiation fields incident on homogeneous and heterogeneous geometries Methods: Small open fields of Truebeam 2.0 unit (1×1, 2×2, 3×3, 4×4 fields) were used for this study. The fields were incident on homogeneous phantom and in house phantom containing lung, air, and bone inhomogeneities. Using the same film batch, the net OD to dose calibration curve was obtaine dusing Trubeam 2.0 for 6 MV, 6 FFF, 10 MV, 10 FFF, 15 MV energies by delivering 0- 800 cGy. Films were scanned 48 hours after irradiation using an Epson 1000XL flatbed scanner. The dosimetric accuracy of Acuros XB and AAA algorithms in the presence of the inhomogeneities was compared against EBT3 film dosimetry Results: Open field tests in a homogeneous phantom showed good agreement betweent wo algorithms and measurement. For Acuros XB, minimum gamma analysis passin grates between measured and calculated dose distributions were 99.3% and 98.1% for homogeneousand inhomogeneous fields in thecase of lung and bone respectively. For AAA, minimum gamma analysis passingrates were 99.1% and 96.5% for homogeneous and inhomogeneous fields respectively for all used energies and field sizes.In the case of the air heterogeneity, the differences were larger for both calculations algorithms. Over all, when compared to measurement, theAcuros XB had beter agreement than AAA. Conclusion: The Acuros XB calculation algorithm in the TPS is an improvemen tover theexisting AAA algorithm. Dose discrepancies were observed for in the presence of air inhomogeneities.
Patient-specific AAA wall stress analysis: 99-percentile versus peak stress
Speelman, L.; Bosboom, E.M.H.; Schurink, G.W.H.; Hellenthal, F.A.M.V.I.; Buth, J.; Breeuwer, M.; Jacobs, M.J.; Vosse, van de F.N.
2008-01-01
Objective Biomechanically, rupture of an Abdominal Aortic Aneurysm (AAA) occurs when the stress acting on the wall due to the blood pressure, exceeds the strength of the wall. Peak wall stress estimations, based on CT reconstruction, may be prone to observer variation. This study focuses on the
Directory of Open Access Journals (Sweden)
Carmen Elena Usuga Osorio
2008-06-01
Full Text Available Bajo condiciones de invernadero (ubicado en el municipio de Bello - Antioquia (Colombia se evaluó el efecto independiente y combinado de los factores: tipo de inóculo de Hongos Micorriza Arbuscular (HMA, fertilización y aplicación de materia orgánica sobre el porcentaje de asociación de HMA en plantas de banano (Musa AAA cv. Gran Enano, así como en la acumulación de materia seca foliar y radical. Dentro del factor tipo de inóculo, se evaluaron inóculos nativos, de agroecosistemas bananeros y ecosistemas naturales del Urabá (Antioquia-Colombia, uno comercial y la especie Acaulospora morrowiae; con respecto a la fertilización se probó la mitad, completa y dos veces la dosis de la fertilización recomendada de acuerdo al análisis de suelo y a los requerimientos de la planta, y cada uno de estos factores con y sin la aplicación de materia orgánica; como testigos se usaron, la no aplicación del respectivo factor. Se usó como material vegetal plantas de banano micropropagadas del grupo Cavendish cv. Gran Enano (AAA. El sustrato utilizado para el crecimiento de las plantas de banano se compuso de suelo y arena en relación 70/30 v/v. El suelo se obtuvo de la granja experimental de Augura, ubicado en el municipio de Carepa en la región de Urabá. Los resultados encontrados, muestran que los factores que más incidieron en la asociación así como en la acumulación de biomasa en toda la planta son la micorrización y la adición de materia orgánica. Los resultados, también muestran un comportamiento positivo respecto al uso de inóculos nativos de agroecosistemas bananeros, con bajas aplicaciones de fertilizantes.The effects of independent an combined factors such as inoculum type, fertilization and organic matter application on the percentage of association of ‘H.M.A’ in banana plants (Musa AAA cv. ‘Gran Enano’, and on the accumulation of leaves and rrots material, were evaluated under greenhouse conditions. Natives samples
Evaluation of Pax6 mutant rat as a model for autism.
Directory of Open Access Journals (Sweden)
Toshiko Umeda
Full Text Available Autism is a highly variable brain developmental disorder and has a strong genetic basis. Pax6 is a pivotal player in brain development and maintenance. It is expressed in embryonic and adult neural stem cells, in astrocytes in the entire central nervous system, and in neurons in the olfactory bulb, amygdala, thalamus, and cerebellum, functioning in highly context-dependent manners. We have recently reported that Pax6 heterozygous mutant (rSey(2/+ rats with a spontaneous mutation in the Pax6 gene, show impaired prepulse inhibition (PPI. In the present study, we further examined behaviors of rSey(2/+ rats and revealed that they exhibited abnormality in social interaction (more aggression and withdrawal in addition to impairment in rearing activity and in fear-conditioned memory. Ultrasonic vocalization (USV in rSey(2+ rat pups was normal in male but abnormal in female. Moreover, treatment with clozapine successfully recovered the defects in sensorimotor gating function, but not in fear-conditioned memory. Taken together with our prior human genetic data and results in other literatures, rSey(2/+ rats likely have some phenotypic components of autism.
The ATPase of the phi29 DNA packaging motor is a member of the hexameric AAA+ superfamily.
Schwartz, Chad; De Donatis, Gian Marco; Fang, Huaming; Guo, Peixuan
2013-08-15
The AAA+ superfamily of proteins is a class of motor ATPases performing a wide range of functions that typically exist as hexamers. The ATPase of phi29 DNA packaging motor has long been a subject of debate in terms of stoichiometry and mechanism of action. Here, we confirmed the stoichiometry of phi29 motor ATPase to be a hexamer and provide data suggesting that the phi29 motor ATPase is a member of the classical hexameric AAA+ superfamily. Native PAGE, EMSA, capillary electrophoresis, ATP titration, and binomial distribution assay show that the ATPase is a hexamer. Mutations in the known Walker motifs of the ATPase validated our previous assumptions that the protein exists as another member of this AAA+ superfamily. Our data also supports the finding that the phi29 DNA packaging motor uses a revolution mechanism without rotation or coiling (Schwartz et al., this issue). Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
AAAS Communicating Science Program: Reflections on Evaluation
Braha, J.
2015-12-01
The AAAS Center for Public Engagement (Center) with science builds capacity for scientists to engage public audiences by fostering collaboration among natural or physical scientists, communication researchers, and public engagement practitioners. The recently launched Leshner Leadership Institute empowers cohorts of mid-career scientists to lead public engagement by supporting their networks of scientists, researchers, and practitioners. The Center works closely with social scientists whose research addresses science communication and public engagement with science to ensure that the Communicating Science training program builds on empirical evidence to inform best practices. Researchers ( Besley, Dudo, & Storkdieck 2015) have helped Center staff and an external evaluator develop pan instrument that measures progress towards goals that are suggested by the researcher, including internal efficacy (increasing scientists' communication skills and confidence in their ability to engage with the public) and external efficacy (scientists' confidence in engagement methods). Evaluation results from one year of the Communicating Science program suggest that the model of training yields positive results that support scientists in the area that should lead to greater engagement. This talk will explore the model for training, which provides a context for strategic communication, as well as the practical factors, such as time, access to public engagement practitioners, and technical skill, that seems to contribute to increased willingness to engage with public audiences. The evaluation program results suggest willingness by training participants to engage directly or to take preliminary steps towards engagement. In the evaluation results, 38% of trained scientists reported time as a barrier to engagement; 35% reported concern that engagement would distract from their work as a barrier. AAAS works to improve practitioner-researcher-scientist networks to overcome such barriers.
X-ray-induced mutants resistant to 8-azaguanine
International Nuclear Information System (INIS)
Carver, J.H.; Dewey, W.C.; Hopwood, L.E.
1976-01-01
Asynchronous Chinese hamster ovary cells were irradiated and colony survival in Alpha MEM medium with dialyzed serum was determined with or without 15 μg/ml 8-Azaguanine (AG). Data indicated that a reproducible assay for the system was dependent upon controlling cell density at least two days prior to induction as well as throughout the expression period. Generally, spontaneous and radiation-induced mutant frequencies decreased when cell densities exceeded a critical density of 3-6 x 10 4 cells/cm 2 . Infrequently, the critical density was exceeded by a factor of two with no observed decrease, possibly correlated with a longer cell doubling time. Drug depletion artifacts can occur because of drug degradation, or because wild-type cells utilize the drug or produce conditions which reduce uptake of the drug. Thus, as the effective drug concentration is lowered, the observed mutant frequency increases because a spectrum of mutants resistant to only low concentrations can now survive. In fact, refeeding with AG at intervals during the incubation period lowered spontaneous and radiation-induced frequencies approx. 5-fold. Therefore, to standardize conditions, cells were trypsinized at the end of the expression time and replated at a constant cell number for mutant selection by AG. Over two generations of growth during the expression period were required for optimal manifestation of induced mutants, and when densities were kept below 4 x 10 4 cells/cm 2 at all times, observed mutant frequencies did not change significantly over a period between 80 and 140 h post-induction (over 4 generations for irradiated cells and over 6 generations for controls). Previous reports of observed mutant frequencies decreasing beyond three generations may be due to cell interaction prior to mutant selection
An early maturing rice mutant released as a variety
International Nuclear Information System (INIS)
Azam, M.A.; Imtiaz Uddin, Md.
2001-01-01
In the content of food grain production deficiency (about 1.0-1.5 million tons of rice per year according to the Bangladesh Bureau of Statistics, 1998) an induced mutation programme was undertaken in 1985. One moderate early maturing and high yielding rice mutant line (BINA6-84-4-115) has been developed by irradiating F 2 seeds of the cross 'BR4' x 'Iratom 38'. Three treatments viz., 250, 300 and 350 Gy were given to the F 2 seeds. Finally, this line was selected in M 6 generation for advanced yield trial. The line was evaluated in comparative trials with another mutant line BINA6-84-4-163. These two mutant lines had been selected earlier from 300 Gy originated lines. The two check varieties, 'BR 11' and 'BR 22' were also included in the trial, which was conducted in two consecutive T. aman seasons (July to December) during 1994 and 1995 at five locations in Bangladesh. From the results, it was evident that the mutant BINA6-84-4-115 did not differ much with the other mutant lines or check varieties in respect to plant height, number of effective tillers and panicle length but it was 10-18 days earlier than the other 3 entries. It produced a similar yield as the check BR 11 in 1994 and a higher yield than the check BR 11 and BR 22 in 1995. This mutant line gave the highest yield per day among all the entries. In addition to this, the grains are long, fine and possess a high L/B ratio, which are of high commercial value. This line has been released by the National Seed Board of Bangladesh in 1998 as a commercial variety under the name 'BINADHAN-4' for cultivation throughout Bangladesh
First UN member state conference on the climate framework convention
International Nuclear Information System (INIS)
Lamprecht, F.
1995-01-01
The ''Framework Convention of the United Nations Concerning Climate Changes'' (Climate Framework Convention - KRK), which was passed at the 1992 World Environment Conference (UNCEO) in Rio de Janeiro and took effect on 21 March 1994, has instituted the UN Conference of Contracting Parties (VSK) as the organ presiding over this issue (Article 7 KRK). This annual conference has the task to implement the KRK and its associated legal instruments and pass the resolutions required to this end. Its premiere took place in Berlin (28 March to 7 April 1995). Delegates from 117 signatory and 53 observer states struggled before an audience of 2000 news reportes to find a solution to the pending tasks that might be tolerable for all participants. The present article gives a brief outline of these tasks and the results achieved in Berlin. The picture is rounded off by information on the different positions defended, lines of conflict and the course of the conference. (orig.) [de
Morito, Daisuke; Nishikawa, Kouki; Hoseki, Jun; Kitamura, Akira; Kotani, Yuri; Kiso, Kazumi; Kinjo, Masataka; Fujiyoshi, Yoshinori; Nagata, Kazuhiro
2014-03-01
Moyamoya disease is an idiopathic human cerebrovascular disorder that is characterized by progressive stenosis and abnormal collateral vessels. We recently identified mysterin/RNF213 as its first susceptibility gene, which encodes a 591-kDa protein containing enzymatically active P-loop ATPase and ubiquitin ligase domains and is involved in proper vascular development in zebrafish. Here we demonstrate that mysterin further contains two tandem AAA+ ATPase modules and forms huge ring-shaped oligomeric complex. AAA+ ATPases are known to generally mediate various biophysical and mechanical processes with the characteristic ring-shaped structure. Fluorescence correlation spectroscopy and biochemical evaluation suggested that mysterin dynamically changes its oligomeric forms through ATP/ADP binding and hydrolysis cycles. Thus, the moyamoya disease-associated gene product is a unique protein that functions as ubiquitin ligase and AAA+ ATPase, which possibly contributes to vascular development through mechanical processes in the cell.
Morito, Daisuke; Nishikawa, Kouki; Hoseki, Jun; Kitamura, Akira; Kotani, Yuri; Kiso, Kazumi; Kinjo, Masataka; Fujiyoshi, Yoshinori; Nagata, Kazuhiro
2014-01-01
Moyamoya disease is an idiopathic human cerebrovascular disorder that is characterized by progressive stenosis and abnormal collateral vessels. We recently identified mysterin/RNF213 as its first susceptibility gene, which encodes a 591-kDa protein containing enzymatically active P-loop ATPase and ubiquitin ligase domains and is involved in proper vascular development in zebrafish. Here we demonstrate that mysterin further contains two tandem AAA+ ATPase modules and forms huge ring-shaped oligomeric complex. AAA+ ATPases are known to generally mediate various biophysical and mechanical processes with the characteristic ring-shaped structure. Fluorescence correlation spectroscopy and biochemical evaluation suggested that mysterin dynamically changes its oligomeric forms through ATP/ADP binding and hydrolysis cycles. Thus, the moyamoya disease-associated gene product is a unique protein that functions as ubiquitin ligase and AAA+ ATPase, which possibly contributes to vascular development through mechanical processes in the cell. PMID:24658080
Evaluation of tall rice mutant
International Nuclear Information System (INIS)
Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.
1989-01-01
One tall mutant (Mut NS1) of rice variety Nizersail was put to multilocation on-farm trial. It showed improvement over the parent in respect of by earlier maturity and higher grain yield at all locations and thus it appears as an improved mutant of Nizersail. (author). 6 refs
Genetic fingerprinting of mutant rose cultivars
Energy Technology Data Exchange (ETDEWEB)
Kumar, S; Prasad, K V; Singh, K P; Singh, A.P. [Division of Floriculture and Landscaping, Indian Agricultural Research Institute, Pusa, New Delhi (India)], E-mail: kvprasad66@gmail.com
2008-07-01
Six rose mutants evolved at the Indian Agricultural Research Institute, New Delhi from four parent cultivars were characterized based on RAPD markers. Contrary to the earlier findings our effort has conclusively proven that the RAPD markers are indeed robust tools to discern the mutants from their parents. Among 40 primers screened, 7 primers produced inconsistent banding pattern. The number of polymorphic bands varied between 4 (OPA 14) and 10 (OPA1) with an average of 6.5 bands per primer. The percentage polymorphism ranged from 62.5 (OPM 9) to 100 percent (OPA 1). Most of the primers produced monomorphic bands between parent and mutant rose cultivars. When primer OPA 2 was used a specific band of 2.5 kb was noticed in mutant cv. Pusa Urmil and cv. Pusa Abhishek but was absent in parent cv. Jantar Mantar. A polymorphic band of 750 bp was noticed in the parent Kiss of Fire and helped in differentiating the parent from its mutant when amplified with OPK 3. Primer OPS 16 produced discriminatory band of 800 bp in mutant cv. Pink Sport of Montezuma while it was absent in its parent cv. Montezuma. Another specific band of 650 bp was present in parent cv. Montezuma and absent in its mutant cv. Pink Sport of Montezuma signifying the uniqueness of the mutant. Primer OPM 5 brought out distinct polymorphism among the parent Jantar Mantar and its three mutants with absence of a specific band of 1.5 kb in the parent. The four parents and 6 mutants were divided into four distinct groups in the Dendogram constructed by UPGMA method. The most genetically similar cultivar among the 10 cultivars analyzed are Montezuma and its pink sport of Montezuma whereas Abhisarika a mutant of cv. Kiss of Fire was distinctly different and formed a separate cluster. (author)
Pleiotropic effects of hemagglutinin amino acid substitutions of H5 influenza escape mutants
International Nuclear Information System (INIS)
Rudneva, Irina A.; Timofeeva, Tatiana A.; Ignatieva, Anna V.; Shilov, Aleksandr A.; Krylov, Petr S.; Ilyushina, Natalia A.; Kaverin, Nikolai V.
2013-01-01
In the present study we assessed pleiotropic characteristics of the antibody-selected mutations. We examined pH optimum of fusion, temperatures of HA heat inactivation, and in vitro and in vivo replication kinetics of the previously obtained influenza H5 escape mutants. Our results showed that HA1 N142K mutation significantly lowered the pH of fusion optimum. Mutations of the escape mutants located in the HA lateral loop significantly affected H5 HA thermostability (P<0.05). HA changes at positions 131, 144, 145, and 156 and substitutions at positions 131, 142, 145, and 156 affected the replicative ability of H5 escape mutants in vitro and in vivo, respectively. Overall, a co-variation between antigenic specificity and different HA phenotypic properties has been demonstrated. We believe that the monitoring of pleiotropic effects of the HA mutations found in H5 escape mutants is essential for accurate prediction of mutants with pandemic potential. - Highlights: • HA1 N142K mutation significantly lowered the pH of fusion optimum. • Mutations located in the HA lateral loop significantly affected H5 HA thermostability. • HA changes at positions 131, 142, 144, 145, and 156 affected the replicative ability of H5 mutants. • Acquisition of glycosylation site could lead to the emergence of multiple pleiotropic effects
Pleiotropic effects of hemagglutinin amino acid substitutions of H5 influenza escape mutants
Energy Technology Data Exchange (ETDEWEB)
Rudneva, Irina A.; Timofeeva, Tatiana A.; Ignatieva, Anna V.; Shilov, Aleksandr A.; Krylov, Petr S. [D.I. Ivanovsky Institute of Virology, 123098 Moscow (Russian Federation); Ilyushina, Natalia A., E-mail: Natalia.Ilyushina@fda.hhs.gov [FDA CDER, 29 Lincoln Drive, Bethesda, MD 20892 (United States); Kaverin, Nikolai V., E-mail: nik.kaverin@gmail.com [D.I. Ivanovsky Institute of Virology, 123098 Moscow (Russian Federation)
2013-12-15
In the present study we assessed pleiotropic characteristics of the antibody-selected mutations. We examined pH optimum of fusion, temperatures of HA heat inactivation, and in vitro and in vivo replication kinetics of the previously obtained influenza H5 escape mutants. Our results showed that HA1 N142K mutation significantly lowered the pH of fusion optimum. Mutations of the escape mutants located in the HA lateral loop significantly affected H5 HA thermostability (P<0.05). HA changes at positions 131, 144, 145, and 156 and substitutions at positions 131, 142, 145, and 156 affected the replicative ability of H5 escape mutants in vitro and in vivo, respectively. Overall, a co-variation between antigenic specificity and different HA phenotypic properties has been demonstrated. We believe that the monitoring of pleiotropic effects of the HA mutations found in H5 escape mutants is essential for accurate prediction of mutants with pandemic potential. - Highlights: • HA1 N142K mutation significantly lowered the pH of fusion optimum. • Mutations located in the HA lateral loop significantly affected H5 HA thermostability. • HA changes at positions 131, 142, 144, 145, and 156 affected the replicative ability of H5 mutants. • Acquisition of glycosylation site could lead to the emergence of multiple pleiotropic effects.
Lack of chemically induced mutation in repair-deficient mutants of yeast
International Nuclear Information System (INIS)
Prakash, L.
1974-01-01
Two genes, rad6 and rad9, that confer radiation sensitivity in the yeast Saccharomyces cerevisiae also greatly reduce the frequency of chemically-induced reversions of a tester mutant cyc1-131, which is a chain initiation mutant in the structural gene determining iso-1-cytochrome c. Mutations induced by ethyl methanesulfonate (EMS), diethyl sulfate (DES), methyl methanesulfonate (MMS), dimethyl sulfate (DMS), nitroquinoline oxide (NQO), nitrosoguanidine (NTG), nitrogen mustard (HN2), β-propiolactone, and tritiated uridine, as well as mutations induced by ultraviolet light (UV) and ionizing radiation were greatly diminished in strains homozygous for either the rad6 or rad9 gene. Nitrous acid and nitrosoimidazolidone (NIL), on the other hand, were highly mutagenic in these repair-deficient mutants, and at low doses, these mutagens acted with about the same efficiency as in the normal RAD strain. At high doses of either nitrous acid or NIL, however, reversion frequencies were significantly reduced in the two rad mutants compared to normal strains. Although both rad mutants are immutable to about the same extent, the rad9 strains tend to be less sensitive to the lethal effect of chemical mutagens than rad6 strains. It is concluded that yeast requires a functional repair system for mutation induction by chemical agents. (auth)
Lack of chemically induced mutation in repair-deficient mutants of yeast.
Prakash, L
1974-12-01
Two genes, rad6 and rad9, that confer radiation sensitivity in the yeast Saccharomyces cerevisiae also greatly reduce the frequency of chemically-induced reversions of a tester mutant cyc1-131, which is a chain initiation mutant in the structural gene determining iso-1-cytochrome c. Mutations induced by ethyl methanesulfonate (EMS), diethyl sulfate (DES), methyl methanesulfonate (MMS), dimethyl sulfate (DMS), nitroquinoline oxide (NQO), nitrosoguanidine (NTG), nitrogen mustard (HN2), beta-propiolactone, and tritiated uridine, as well as mutations induced by ultraviolet light (UV) and ionizing radiation were greatly diminished in strains homozygous for either the rad6 or rad9 gene. Nitrous acid and nitrosoimidazolidone (NIL), on the other hand, were highly mutagenic in these repair-deficient mutants, and at low doses, these mutagens acted with about the same efficiency as in the normal RAD strain. At high doses of either nitrous acid or NIL, however, reversion frequencies were significantly reduced in the two rad mutants compared to normal strains. Although both rad mutants are immutable to about the same extent, the rad9 strains tend to be less sensitive to the lethal effect of chemical mutagens than rad6 strains. It is concluded that yeast requires a functional repair system for mutation induction by chemical agents.
Anisimov, Andrey P; Bakhteeva, Irina V; Panfertsev, Evgeniy A; Svetoch, Tat'yana E; Kravchenko, Tat'yana B; Platonov, Mikhail E; Titareva, Galina M; Kombarova, Tat'yana I; Ivanov, Sergey A; Rakin, Alexander V; Amoako, Kingsley K; Dentovskaya, Svetlana V
2009-01-01
Two isogenic sets of Yersinia pestis strains were generated, composed of wild-type strains 231 and I-1996, their non-polar pH 6(-) mutants with deletions in the psaA gene that codes for its structural subunit or the whole operon, as well as strains with restored ability for temperature- and pH-dependent synthesis of adhesion pili or constitutive production of pH 6 antigen. The mutants were generated by site-directed mutagenesis of the psa operon and subsequent complementation in trans. It was shown that the loss of synthesis or constitutive production of pH 6 antigen did not influence Y. pestis virulence or the average survival time of subcutaneously inoculated BALB/c naïve mice or animals immunized with this antigen.
Pre-Test Analysis of the MEGAPIE Spallation Source Target Cooling Loop Using the TRAC/AAA Code
International Nuclear Information System (INIS)
Bubelis, Evaldas; Coddington, Paul; Leung, Waihung
2006-01-01
A pilot project is being undertaken at the Paul Scherrer Institute in Switzerland to test the feasibility of installing a Lead-Bismuth Eutectic (LBE) spallation target in the SINQ facility. Efforts are coordinated under the MEGAPIE project, the main objectives of which are to design, build, operate and decommission a 1 MW spallation neutron source. The technology and experience of building and operating a high power spallation target are of general interest in the design of an Accelerator Driven System (ADS) and in this context MEGAPIE is one of the key experiments. The target cooling is one of the important aspects of the target system design that needs to be studied in detail. Calculations were performed previously using the RELAP5/Mod 3.2.2 and ATHLET codes, but in order to verify the previous code results and to provide another capability to model LBE systems, a similar study of the MEGAPIE target cooling system has been conducted with the TRAC/AAA code. In this paper a comparison is presented for the steady-state results obtained using the above codes. Analysis of transients, such as unregulated cooling of the target, loss of heat sink, the main electro-magnetic pump trip of the LBE loop and unprotected proton beam trip, were studied with TRAC/AAA and compared to those obtained earlier using RELAP5/Mod 3.2.2. This work extends the existing validation data-base of TRAC/AAA to heavy liquid metal systems and comprises the first part of the TRAC/AAA code validation study for LBE systems based on data from the MEGAPIE test facility and corresponding inter-code comparisons. (authors)
Temperature sensitive riboflavin mutants of Penicillium vermiculatum Dangeard
International Nuclear Information System (INIS)
Mitra, J.; Chaudhari, K.L.
1974-01-01
Two temperature sensitive UV induced riboflavin mutants rib 1 and rib 6 have been physiologically and genetically characterized. The two mutants behave differently with regard to their temperature sensitivity. The rib 1 mutant exhibits a leaky growth in minimal medium between 15 0 C and 30 0 C but grows well when the medium is supplemented with riboflavin. At 35 0 C the growth response of the mutant is at its max. and at 40 0 C and below 15 0 C it ceases to grow. The rib 6 mutant which is red brown in colour shows wild type character at temp. below 25 0 C in minimal medium but requires riboflavin at 30 0 C and above. Heterokaryotic analysis revealed the nonallelic nature of the two temperature mutants. Genetic tests of allelic relationship between riboflavin markers by crossing were also done. (author)
Kan, Monica W K; Leung, Lucullus H T; So, Ronald W K; Yu, Peter K N
2013-03-01
To compare the doses calculated by the Acuros XB (AXB) algorithm and analytical anisotropic algorithm (AAA) with experimentally measured data adjacent to and within heterogeneous medium using intensity modulated radiation therapy (IMRT) and RapidArc(®) (RA) volumetric arc therapy plans for nasopharygeal carcinoma (NPC). Two-dimensional dose distribution immediately adjacent to both air and bone inserts of a rectangular tissue equivalent phantom irradiated using IMRT and RA plans for NPC cases were measured with GafChromic(®) EBT3 films. Doses near and within the nasopharygeal (NP) region of an anthropomorphic phantom containing heterogeneous medium were also measured with thermoluminescent dosimeters (TLD) and EBT3 films. The measured data were then compared with the data calculated by AAA and AXB. For AXB, dose calculations were performed using both dose-to-medium (AXB_Dm) and dose-to-water (AXB_Dw) options. Furthermore, target dose differences between AAA and AXB were analyzed for the corresponding real patients. The comparison of real patient plans was performed by stratifying the targets into components of different densities, including tissue, bone, and air. For the verification of planar dose distribution adjacent to air and bone using the rectangular phantom, the percentages of pixels that passed the gamma analysis with the ± 3%/3mm criteria were 98.7%, 99.5%, and 97.7% on the axial plane for AAA, AXB_Dm, and AXB_Dw, respectively, averaged over all IMRT and RA plans, while they were 97.6%, 98.2%, and 97.7%, respectively, on the coronal plane. For the verification of planar dose distribution within the NP region of the anthropomorphic phantom, the percentages of pixels that passed the gamma analysis with the ± 3%/3mm criteria were 95.1%, 91.3%, and 99.0% for AAA, AXB_Dm, and AXB_Dw, respectively, averaged over all IMRT and RA plans. Within the NP region where air and bone were present, the film measurements represented the dose close to unit density water
International Nuclear Information System (INIS)
Kan, Monica W. K.; Leung, Lucullus H. T.; So, Ronald W. K.; Yu, Peter K. N.
2013-01-01
Purpose: To compare the doses calculated by the Acuros XB (AXB) algorithm and analytical anisotropic algorithm (AAA) with experimentally measured data adjacent to and within heterogeneous medium using intensity modulated radiation therapy (IMRT) and RapidArc ® (RA) volumetric arc therapy plans for nasopharygeal carcinoma (NPC). Methods: Two-dimensional dose distribution immediately adjacent to both air and bone inserts of a rectangular tissue equivalent phantom irradiated using IMRT and RA plans for NPC cases were measured with GafChromic ® EBT3 films. Doses near and within the nasopharygeal (NP) region of an anthropomorphic phantom containing heterogeneous medium were also measured with thermoluminescent dosimeters (TLD) and EBT3 films. The measured data were then compared with the data calculated by AAA and AXB. For AXB, dose calculations were performed using both dose-to-medium (AXB Dm ) and dose-to-water (AXB Dw ) options. Furthermore, target dose differences between AAA and AXB were analyzed for the corresponding real patients. The comparison of real patient plans was performed by stratifying the targets into components of different densities, including tissue, bone, and air. Results: For the verification of planar dose distribution adjacent to air and bone using the rectangular phantom, the percentages of pixels that passed the gamma analysis with the ± 3%/3mm criteria were 98.7%, 99.5%, and 97.7% on the axial plane for AAA, AXB Dm , and AXB Dw , respectively, averaged over all IMRT and RA plans, while they were 97.6%, 98.2%, and 97.7%, respectively, on the coronal plane. For the verification of planar dose distribution within the NP region of the anthropomorphic phantom, the percentages of pixels that passed the gamma analysis with the ± 3%/3mm criteria were 95.1%, 91.3%, and 99.0% for AAA, AXB Dm , and AXB Dw , respectively, averaged over all IMRT and RA plans. Within the NP region where air and bone were present, the film measurements represented the
Rataj-Guranowska, M.; Pieczul, K.; Nowak, E.; Hiemstra, J.A.; Drapikowska, M.
2001-01-01
The effect of several media amended wit potassium chlorate (1.5% and 6%) on generation of nit mutants, especially nit M mutants from Verticillium dahliae, Colletotrichum gloeosporioides, Colletotrichum lindemuthianum and Fusarium oxysporum were studied. For all species minimal medium with 6%
DEFF Research Database (Denmark)
Nørgaard, Jan Værum; Canibe, Nuria; Assadi Soumeh, Elham
2016-01-01
The objective was to determine the concentration of l-Trp and l-Val to be substituted by feeding piglets Bacillus subtilis strains developed to overproduce Trp (B. subtilis Trp mutant [BsTrp]) and Val (B. subtilis Val mutant [BsVal]) and by using equations obtained in 3 dose–response studies......-Val per kilogram feed using curvilinear plateau and broken-line equations obtained by modeling the 6 AA levels. Bacillus subtilis Val mutant increased animal performance corresponding to 0.88 and 0.39 g l-Leu and 0.17 and 0.44 g l-Val per kilogram feed for 10x and 100x doses, respectively. Bacillus...... subtilis Trp mutant was equivalent to 0.02 and 0.11 g l-Trp/kg feed for 10x and 100x doses, respectively. Bacillus subtilis Val mutant (10x dose) increased (P Bacillus subtilis Trp mutant tended (P = 0.06) to increase Trp plasma concentrations...
McGrann, Graham R. D.; Steed, , Andrew; Burt, Christopher; Nicholson, Paul; Brown, James K. M.
2015-01-01
Lesion mimic mutants display spontaneous necrotic spots and chlorotic leaves as a result of mis-regulated cell death programmes. Typically these mutants have increased resistance to biotrophic pathogens but their response to facultative fungi that cause necrotrophic diseases is less well studied. The effect of altered cell death regulation on the development of disease caused by Ramularia collo-cygni, Fusarium culmorum and Oculimacula yallundae was explored using a collection of barley necrotic (nec) lesion mimic mutants. nec8 mutants displayed lower levels of all three diseases compared to nec9 mutants, which had increased R. collo-cygni but decreased F. culmorum disease symptoms. nec1 mutants reduced disease development caused by both R. collo-cygni and F. culmorum. The severity of the nec1-induced lesion mimic phenotype and F. culmorum symptom development was reduced by mutation of the negative cell death regulator MLO. The significant reduction in R. collo-cygni symptoms caused by nec1 was completely abolished in the presence of the mlo-5 allele and both symptoms and fungal biomass were greater than in the wild-type. These results indicate that physiological pathways involved in regulation of cell death interact with one another in their effects on different fungal pathogens. PMID:25873675
A preliminary yield trial of some soybean mutant lines
International Nuclear Information System (INIS)
Ratma, Rivaie
1985-01-01
A preliminary yield trial of some soybean mutant lines, derived from irradiated Orba variety with dose of 0.40 kGy, were carried out during the wet and dry season in 1979-1982 in Muara and Citayam, Bogor. The result obtained showed that yield potential of mutant lines no. M6/40/10 was higher than that of the control in dry season in 1979 as well as in the wet season of 1979/80 in Muara. Whereas, the yield potential of the mutant lines no. M6/40/8 and no. M6/40/14 were higher than that of the control only in the wet season. The yield potential of semi dwarf mutant lines no. M6/40/68 was highly significant compared to that of the control in dry season in Muara and the wet season in 1981/82 in Citayam. Whereas, the yield potential of the mutant lines no. M6/40/69 was higher yield compared to that of the control in dry season in 1981 in Muara. (author). 10 refs
Improved Medium for Selecting Nitrate-Nonutilizing (nit) Mutants of Verticillium dahliae.
Korolev, N; Katan, T
1997-10-01
ABSTRACT Nitrate-nonutilizing (nit) mutants are commonly used to determine vegetative compatibility between isolates of Verticillium dahliae by complementation (heterokaryon) testing. These mutants emerge spontaneously as chlorate-resistant sectors growing out of partially restricted, wild-type colonies on chlorate-amended media. The commonly used chlorate media are based on minimal medium (MMC) or cornmeal agar (CMC), amended with potassium chlorate. nit mutants recovered on these media constituted 10 to 36%(on MMC) and 25 to 45%(on CMC) of the apparently resistant sectors. An improved water agar chlorate medium (WAC) is described that is more effective for selecting chlorate-resistant nit mutants. WAC medium consists of agar (2%), glucose (0.02%), and potassium chlorate (2 to 5%). On WAC, growth of most V. dahliae isolates was strongly inhibited, and 66 to 100%(average >80%) of the chlorate-resistant sectors formed were nit mutants. Most mutants were characterized as nit1, and about 6% as NitM.
Biochemical characterization and cellular effects of CADASIL mutants of NOTCH3.
Directory of Open Access Journals (Sweden)
He Meng
Full Text Available Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL is the best understood cause of dominantly inherited stroke and results from NOTCH3 mutations that lead to NOTCH3 protein accumulation and selective arterial smooth muscle degeneration. Previous studies show that NOTCH3 protein forms multimers. Here, we investigate protein interactions between NOTCH3 and other vascular Notch isoforms and characterize the effects of elevated NOTCH3 on smooth muscle gene regulation. We demonstrate that NOTCH3 forms heterodimers with NOTCH1, NOTCH3, and NOTCH4. R90C and C49Y mutant NOTCH3 form complexes which are more resistant to detergents than wild type NOTCH3 complexes. Using quantitative NOTCH3-luciferase clearance assays, we found significant inhibition of mutant NOTCH3 clearance. In coculture assays of NOTCH function, overexpressed wild type and mutant NOTCH3 significantly repressed NOTCH-regulated smooth muscle transcripts and potently impaired the activity of three independent smooth muscle promoters. Wildtype and R90C recombinant NOTCH3 proteins applied to cell cultures also blocked canonical Notch fuction. We conclude that CADASIL mutants of NOTCH3 complex with NOTCH1, 3, and 4, slow NOTCH3 clearance, and that overexpressed wild type and mutant NOTCH3 protein interfere with key NOTCH-mediated functions in smooth muscle cells.
Directory of Open Access Journals (Sweden)
Muhammad Nauman Aftab
2012-03-01
Full Text Available The purpose of the current study was intended to obtain the enhanced production of bacitracin by Bacillus licheniformis through random mutagenesis and optimization of various parameters. Several isolates of Bacillus licheniformis were isolated from local habitat and isolate designated as GP-35 produced maximum bacitracin production (14±0.72 IU ml-1. Bacitracin production of Bacillus licheniformis GP-35 was increased to 23±0.69 IU ml-1 after treatment with ultraviolet (UV radiations. Similarly, treatment of vegetative cells of GP-35 with chemicals like N-methyl N'-nitro N-nitroso guanidine (MNNG and Nitrous acid (HNO2 increased the bacitracin production to a level of 31±1.35 IU ml-1 and 27±0.89 IU ml-1 respectively. Treatment of isolate GP-35 with combined effect of UV and chemical treatment yield significantly higher titers of bacitracin with maximum bacitracin production of 41.6±0.92 IU ml-1. Production of bacitracin was further enhanced (59.1±1.35 IU ml-1 by optimization of different parameters like phosphate sources, organic acids as well as temperature and pH. An increase of 4.22 fold in the production of bacitracin after mutagenesis and optimization of various parameters was achieved in comparison to wild type. Mutant strain was highly stable and produced consistent yield of bacitracin even after 15 generations. On the basis of kinetic variables, notably Yp/s (IU/g substrate, Yp/x (IU/g cells, Yx/s (g/g, Yp/s, mutant strain B. licheniformis UV-MN-HN-6 was found to be a hyperproducer of bacitracin.
Kamaleldin, Maha; Elsherbini, Nader A; Elshemey, Wael M
2017-09-27
The aim of this study is to evaluate the impact of anisotropic analytical algorithm (AAA) and 2 reporting systems (AXB-D m and AXB-D w ) of Acuros XB algorithm (AXB) on clinical plans of nasopharyngeal patients using intensity-modulated radiotherapy (IMRT) and RapidArc (RA) techniques. Six plans of different algorithm-technique combinations are performed for 10 patients to calculate dose-volume histogram (DVH) physical parameters for planning target volumes (PTVs) and organs at risk (OARs). The number of monitor units (MUs) and calculation time are also determined. Good coverage is reported for all algorithm-technique combination plans without exceeding the tolerance for OARs. Regardless of the algorithm, RA plans persistently reported higher D 2% values for PTV-70. All IMRT plans reported higher number of MUs (especially with AXB) than did RA plans. AAA-IMRT produced the minimum calculation time of all plans. Major differences between the investigated algorithm-technique combinations are reported only for the number of MUs and calculation time parameters. In terms of these 2 parameters, it is recommended to employ AXB in calculating RA plans and AAA in calculating IMRT plans to achieve minimum calculation times at reduced number of MUs. Copyright © 2017 American Association of Medical Dosimetrists. Published by Elsevier Inc. All rights reserved.
Characterization of novel Sorghum brown midrib mutants from an EMS-mutagenized population.
Sattler, Scott E; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L; Vermerris, Wilfred; Pedersen, Jeffrey F
2014-09-02
Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6, and bmr12, and, in addition, six bmr mutants were identified that were not allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Overall, most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles. Copyright © 2014 Sattler et al.
ELANE mutant-specific activation of different UPR pathways in congenital neutropenia.
Nustede, Rainer; Klimiankou, Maksim; Klimenkova, Olga; Kuznetsova, Inna; Zeidler, Cornelia; Welte, Karl; Skokowa, Julia
2016-01-01
A number of studies have demonstrated induction of the unfolded protein response (UPR) in patients with severe congenital neutropenia (CN) harbouring mutations of ELANE, encoding neutrophil elastase. Why UPR is not activated in patients with cyclic neutropenia (CyN) carrying the same ELANE mutations is unclear. We evaluated the effects of ELANE mutants on UPR induction in myeloid cells from CN and CyN patients, and analysed whether additional CN-specific defects contribute to the differences in UPR induction between CN and CyN patients harbouring identical ELANE mutations. We investigated CN-specific p.C71R and p.V174_C181del (NP_001963.1) and CN/CyN-shared p.S126L (NP_001963.1) ELANE mutants. We found that transduction of haematopoietic cells with p.C71R, but not with p.V174_C181del or p.S126L ELANE mutants induced expression of ATF6, and the ATF6 target genes PPP1R15A, DDIT3 and HSPA5. Recently, we found that levels of secretory leucocyte protease inhibitor (SLPI), a natural ELANE inhibitor, are diminished in myeloid cells from CN patients, but not CyN patients. Combined knockdown of SLPI by shRNA and transduction of ELANE p.S126L in myeloid cells led to elevated levels of ATF6, PPP1R15A and HSPA5 RNA, suggesting that normal levels of SLPI in CyN patients might protect them from the UPR induced by mutant ELANE. In summary, different ELANE mutants have different effects on UPR activation, and SLPI regulates the extent of ELANE-triggered UPR. © 2015 John Wiley & Sons Ltd.
Matias, Pedro M.; Baek, Sung Hee; Bandeiras, Tiago M.; Dutta, Anindya; Houry, Walid A.; Llorca, Oscar; Rosenbaum, Jean
2015-01-01
Pontin and Reptin are related partner proteins belonging to the AAA+ (ATPases Associated with various cellular Activities) family. They are implicated in multiple and seemingly unrelated processes encompassing the regulation of gene transcription, the remodeling of chromatin, DNA damage sensing and repair, and the assembly of protein and ribonucleoprotein complexes, among others. The 2nd International Workshop on Pontin and Reptin took place at the Instituto de Tecnologia Química e Biológica António Xavier in Oeiras, Portugal on October 10–12, 2014, and reported significant new advances on the mechanisms of action of these two AAA+ ATPases. The major points under discussion were related to the mechanisms through which these proteins regulate gene transcription, their roles as co-chaperones, and their involvement in pathophysiology, especially in cancer and ciliary biology and disease. Finally, they may become anticancer drug targets since small chemical inhibitors were shown to produce anti-tumor effects in animal models. PMID:25988184
Matias, Pedro M; Baek, Sung Hee; Bandeiras, Tiago M; Dutta, Anindya; Houry, Walid A; Llorca, Oscar; Rosenbaum, Jean
2015-01-01
Pontin and Reptin are related partner proteins belonging to the AAA+ (ATPases Associated with various cellular Activities) family. They are implicated in multiple and seemingly unrelated processes encompassing the regulation of gene transcription, the remodeling of chromatin, DNA damage sensing and repair, and the assembly of protein and ribonucleoprotein complexes, among others. The 2nd International Workshop on Pontin and Reptin took place at the Instituto de Tecnologia Química e Biológica António Xavier in Oeiras, Portugal on October 10-12, 2014, and reported significant new advances on the mechanisms of action of these two AAA+ ATPases. The major points under discussion were related to the mechanisms through which these proteins regulate gene transcription, their roles as co-chaperones, and their involvement in pathophysiology, especially in cancer and ciliary biology and disease. Finally, they may become anticancer drug targets since small chemical inhibitors were shown to produce anti-tumor effects in animal models.
Directory of Open Access Journals (Sweden)
Sara eAmorim-Vaz
2015-05-01
Full Text Available The aim of the present study was to identify C. albicans transcription factors (TF involved in virulence. Although mice are considered the gold-standard model to study fungal virulence, mini-host infection models have been increasingly used. Here, barcoded TF mutants were first screened in mice by pools of strains and fungal burdens quantified in kidneys. Mutants of unannotated genes which generated a kidney fungal burden significantly different from that of wild-type were selected and individually examined in G. mellonella. In addition, mutants that could not be detected in mice were also tested in G. mellonella. Only 25 % of these mutants displayed matching phenotypes in both hosts, highlighting a significant discrepancy between the two models. To address the basis of this difference (pool or host effects, a set of 19 mutants tested in G. mellonella were also injected individually into mice. Matching fungal burden phenotypes were observed in 50 % of the cases, highlighting the bias due to host effects. In contrast, 33.4 % concordance was observed between pool and single strain infections in mice, thereby highlighting the bias introduced by the pool effect. After filtering the results obtained from the two infection models, mutants for MBF1 and ZCF6 were selected. Independent marker-free mutants were subsequently tested in both hosts to validate previous results. The MBF1 mutant showed impaired infection in both models, while the ZCF6 mutant was only significant in mice infections. The two mutants showed no obvious in vitro phenotypes compared with the wild-type, indicating that these genes might be specifically involved in in vivo adaptation.
Molecular Genetic Identification Of Some Flax Mutants
International Nuclear Information System (INIS)
AMER, I.M.; MOUSTAFA, H.A.M.
2009-01-01
Five flax genotypes (Linum usitatissimum L.) i.e., commercial cultivar Sakha 2, the mother variety Giza 4 and three mutant types induced by gamma rays, were screened for their salinity tolerance in field experiments (salinity concentration was 8600 and 8300 ppm for soil and irrigation water, respectively). Mutation 6 was the most salt tolerant as compared to the other four genotypes.RAPD technique was used to detect some molecular markers associated with salt tolerance in flax (Mut 6), RAPD-PCR results using 12 random primers exhibited 149 amplified fragments; 91.9% of them were polymorphic and twelve molecular markers (8.1%) for salt tolerant (mutant 6) were identified with molecular size ranged from 191 to 4159 bp and only eight primers successes to amplify these specific markers. Concerning the other mutants, Mut 15 and Mut 25 exhibited 4.3% and 16.2% specific markers, respectively. The induced mutants exhibited genetic similarity to the parent variety were about 51%, 58.3% and 61.1% for Mut 25, Mut 6 and Mut 15, respectively. These specific markers (SM) are used for identification of the induced mutations and it is important for new variety registration.
Singh, Uma S; Mulamoottil, Varughese A; Chu, Chung K
2018-05-01
Chronic hepatitis B (CHB) is one of the major causes of morbidity and mortality worldwide. Currently, clinically approved nucleos(t)ide analogs (NAs) are very efficient in reducing the load of hepatitis B virus (HBV) with minimum side effects. However, the long-term administration of antiviral drugs promotes HBV for potential drug resistance. To overcome this problem, combination therapies are administered, but HBV progressively altered mutations remain a threat. Therefore, optimally designed NAs are urgently needed to treat drug-resistant HBV. Herein, 2'-fluoro-6'-methylene carbocyclic adenosine (FMCA) and its phosphoramidate (FMCAP) have been discovered, which may be utilized in combination therapies for curing drug-resistant chronic hepatitis B. In preclinical studies, these carbocyclic NAs demonstrated potential anti-HBV activity against adefovir, as well as lamivudine (LMV/LAM) drug-resistant mutants. In vitro, these molecules have demonstrated significant activity against LMV/entecavir (ETV) triple mutants (L180M + S202G + M204V). Also, preliminary studies of FMCA/FMCAP in chimeric mice and female Non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mouse models having the LMV/ETV triple mutant have shown a high rate of reduction of HBV DNA levels compared to ETV. In this review, we have summarized preclinical studies of FMCA and its phosphoramidate prodrug (FMCAP). © 2018 Wiley Periodicals, Inc.
Teich, Al; Frankel, Mark S.; Kling, Rob; Lee, Yaching
1999-01-01
Reports the results of a conference on the Internet and anonymous communication organized by the American Association for the Advancement of Science (AAAS). Discusses how anonymous communications can be shaped by the law, education, and public awareness, and highlights the importance of involving all affected interests in policy development.…
Induction of Mutants in Durum Wheat
International Nuclear Information System (INIS)
AL-Ubaidi, M.; Ibrahim, I.; AL-Hadithi, A.
2002-01-01
This investigation presents a breeding program for induction and development of a new genotype of durum wheat, resistant to lodging with high yield, by irradiation durum wheat hybrids (F2) with gamma rays 100 Gy, during 1990-1997 cultivation seasons. This program involves: induction of variability, selection evaluation of the mutants at three locations: Twaitha (Baghdad) Latifya ( Babylon) and Swari (Kutt). All mutants showed resistance to lodging and there was a significant reduction in plant height. Mutant SIXIZ-22 surpassed other mutants and its origin in lodging resistance and plant height (83.5,82.8 and 89.4 cm) in the three locations at generation M5 and M6, respectively. Also, there were significant differences between mutant and their origin in the number of spikes/M 2 and grain yild during the two successive generation. On the other hand, mutant IZxCO-105 surpassed other mutants in the number of spikes/M 2 (231.8,242.3 and 292) and grain yield (4336,3376 and 5232 kg/ha) in all testing location, respectively . (authors) 14 refs., 4 tabs
Selection and agronomic evaluation of induced mutant lines of sesame
International Nuclear Information System (INIS)
Hoballah, A.A.
2001-01-01
%), capsules/plant (33.6%), capsule length (19.0%), 100-seed weight (18.6%) and plant height (12.1%). Analysis of variance for combining ability indicated that general (GCA) and specific (SCA) combining ability variances were highly significant for all studied traits. Estimates of GCA effects showed that EXM90, EFM92 and Mutant 8 were the best general combiners for earliness; the variety Giza 32 and Mutant 48 the best for seed yield and number of capsules per plant. Both parents and their derived crosses could be utilized for hybrid sesame production and varietal improvement in terms of the probability of selecting desirable segregants for yield and yield components. Estimates of the type of gene action confirmed the importance of both additive and non-additive (dominant) gene effects in the inheritance of the studied characters in both F 1 and F 2 generations. However the dominance components were larger than the additive ones for most investigated traits in the F 1 and vice versa in the F 2 . Overdominance was also noted. Heritability in narrow sense (H n ) was low for most characters in the F 1 . On the other hand, high values of heritability (H n ) were recorded for all the investigated traits in the F 2 , indicating that the genetic variance associated with those traits was mostly due to additive effects of genes, and therefore, it could be concluded that selection based on the accumulation of additive effects would be very successful in improving such traits. (author)
Directory of Open Access Journals (Sweden)
Warren W Wakarchuk
Full Text Available The bacteria in the genus Cellulomonas are known for their ability to degrade plant cell wall biomass. Cellulomonas fimi ATCC 484 and C. flavigena ATCC 482 have been the subject of much research into secreted cellulases and hemicellulases. Recently the genome sequences of both C. fimi ATCC 484 and C. flavigena ATCC 482 were published, and a genome comparison has revealed their full spectrum of possible carbohydrate-active enzymes (CAZymes. Using mass spectrometry, we have compared the proteins secreted by C. fimi and C. flavigena during growth on the soluble cellulose substrate, carboxymethylcellulose (CMC, as well as a soluble xylan fraction. Many known C. fimi CAZymes were detected, which validated our analysis, as were a number of new CAZymes and other proteins that, though identified in the genome, have not previously been observed in the secretome of either organism. Our data also shows that many of these are co-expressed on growth of either CMC or xylan. This analysis provides a new perspective on Cellulomonas enzymes and provides many new CAZyme targets for characterization.
Resistance of some early mutant lines of soybean to rust fungus (Phakospora pachyrhizi Syd)
International Nuclear Information System (INIS)
Ratma, Rivaie
1984-01-01
A trial for resistance to rust fungus (Phakospora pachyrhizi Syd.) was conducted on 11 early mutant lines of soybean M6 (derived from Orba variety with a dose of 0.4 kGy of Co-60) at Citayam Experimental Station, Bogor, in the wet season of 80/81. Based on IWGSR rating system, soybean mutant lines number M6/40/6 was moderately susceptible to rust fungus (Phakospora pachyrhizi Syd). While 10 other soybean mutant lines M6/40/1, M6/40/2, M6/40/3, M6/40/4, M6/40/5, M6/40/7, M6/40/8, M6/40/9, M6/40/10 and M6/40/11 were susceptible to rust fungus. Significant differences in yield were observed between the early mutant lines M6/40/6 (moderate susceptible), 10 other mutant lines (susceptible) and ringgit variety (susceptible). However, a significant lower yield was produced by those mutant lines compared with the yield of orba variety. (author)
Directory of Open Access Journals (Sweden)
M.C.J. Freitas
2005-06-01
Full Text Available O amido de bananas tem sido pesquisado na área de nutrição a partir da introdução do conceito de Amido Resistente. O amido de Musa AAA-Nanicão e Musa AAB-Terra foram caracterizados quanto as suas respostas fisiológicas [12]. Em continuidade, o presente trabalho estudou características físicas e morfológicas dos grânulos de amido de ambas as espécies de banana comparando-as com amido nativo de milho comercial. O amido de bananas foi extraído segundo CHIANG, CHU & CHU [3]. A morfologia dos grânulos foi realizada após tratamento enzimático in vitro a 37°C/24h com alfa-amilase pancreática. Foram efetuados os respectivos amilogramas e difractogramas de raios-X. Os grânulos de amido da Musa Tipo AAA-Nanicão apresentaram comprimento entre 30-40µm. Em Musa AAB-Terra, os grânulos, também ovais e alongados, eram um pouco menores, 20-30µm. A corrosão enzimática in vitro iniciava-se sobre a superfície anteriormente lisa e formavam estrias superficiais e apicais. A Microscopia Eletrônica de Varredura (MEV mostrou que a hidrólise in vitro por 24 horas foi pequena e ocorria sobretudo nas camadas amorfas dos grânulos de ambas as espécies. O padrão de corrosão demonstrou-se distinto daquele ocorrido no amido de milho. As suspensões de amido de bananas ao viscosímetro demonstraram forte capacidade de hidratação e menor capacidade de retrogradação em relação ao milho, sobretudo do amido de Musa Tipo AAA-Nanicão; o amido de Musa Tipo AAB-Terra apresentou maior estabilidade de pasta. Na análise de difração de raios-X, os grânulos de bananas apresentaram padrão tipo B e C para Musa Tipo AAA-Nanicão e Musa Tipo AAB-Terra, respectivamente. Conclui-se que os amidos de Musa AAA-Nanicão e Musa AAB-Terra são estruturalmente distintos, justificando as respostas fisiológicas distintas encontradas posteriormente pelos mesmos autores. As distinções das propriedades físicas e bioquímicas obtidas para os grânulos, embora
International Nuclear Information System (INIS)
Lawrence, C.W.; Christensen, R.B.
1979-01-01
Dominant mutations at two newly identified loci, designated SRS1 and SRS2, that metabolically suppress the trimethoprim sensitivity of rad6 and rad18 strains, have been isolated from trimethorprim-resistant mutants arising spontaneously in rad6-1 rad18-2 strains of the yeast Saccharomyces cerevisiae. The SRS2 mutations also efficiently suppress the ultraviolet light sensitivity of the parent strains. They do not, however, suppress their sensitivity to ionizing radiation or their deficiency with respect to induced mutagenesis and sporulation. Such observations support the hypothesis that RAD6-dependent activities can be separated into two functionally distinct groups: a group of error-free repair activities that are responsible for a large amount of the radiation resistance of wild-type strains and also for their resistance to trimethoprim, and a group of error-prone activities that are responsible for induced mutagenesis and are also important in sporulation, but which account at best for only a very small amount of wild-type recovery
The mutant strain of ZHJ6 degrading organophosphorous pesticide by 60Co-γ irradiation
International Nuclear Information System (INIS)
Zhao Renbang; Chi Jian; He Yi
2013-01-01
The strain of Penicillium oxalicum ZHJ6 that can degrade methamidophos was employed to obtain the mutant stain which has higher degradation rate than original strain by 60 Co-γ irradiation. Results showed that the Penicillium oxalicum ZHJ6 was sensitive to 60 Co-γ irradiation, and was easy to be killed by 60 Co-γ irradiation. Under the absorbed dose of 2.1 kGy, the survival rate of the strain was 0.04%. Two strains of A17 and A18 were obtained from the irradiated strains after first- and second- screening and the degradation rate of methamidophos of A17 and A18 strains were 10% higher than that of A0 strain (original stain). Moreover, the abilities to degrade folimat, phoxim and glyphosate were improved. Through 5 generations, the variation coefficient in degradation rate of methamidophos in the 6th day was 1.2%, showing that the new strains had hereditary stability. (authors)
International Nuclear Information System (INIS)
Sizova, L.I.
1976-01-01
The paper comprises the results of the investigation of the storage effect in irradiated seeds on the frequency and the spectrum of structural mutations of chromosomes in normal green plants and in spontaneous chlorophyll mutants of sunflower. The seeds of chlorophyll mutants lutescens and xantha and those of green plants stored for 3 years have been 60 Co gamma-irradiated with doses of 0.5; 1.0; 2.0; 3.0; 5.0 and 10 kr. After the irradiation the seeds have been stored for a year under conventional laboratory conditions. As a result of the post-irradiation storage of seeds for a year the decrease in the proportion of aberrant cells by 3 to 6% at the expense of cells with paired fragments has been observed in green plants. In chlorophyll mutants the storage of seeds after the irradiation results in the 9 to 37% increase of the proportion of aberrant cells at the expense of cells with single and paired bridges and with paired fragments. This gives evidence in favour of the assumption that in spontaneous chlorophyll mutants the processes of the post-irradiation recovery either fail altogether, or proceed at a very low level
Lawrence, Paul; Pacheco, Juan; Stenfeldt, Carolina; Arzt, Jonathan; Rai, Devendra K; Rieder, Elizabeth
2016-05-01
A companion study reported Jumonji-C domain containing protein 6 (JMJD6) is involved in an integrin- and HS-independent pathway of FMDV infection in CHO cells. JMJD6 localization was investigated in animal tissues from cattle infected with either wild type A24-FMDV (A24-WT) or mutant FMDV (JMJD6-FMDV) carrying E95K/S96L and RGD to KGE mutations in VP1. Additionally, pathogenesis of mutant JMJD6-FMDV was investigated in cattle through aerosol and intraepithelial lingual (IEL) inoculation. Interestingly, JMJD6-FMDV pathogenesis was equivalent to A24-WT administered by IEL route. In contrast, JMJD6-FMDV aerosol-infected cattle did not manifest signs of FMD and animals showed no detectable viremia. Immunofluorescent microscopy of post-mortem tissue revealed JMJD6-FMDV exclusively co-localized with JMJD6(+) cells while A24-WT was occasionally found in JMJD6(+) cells. In vitro, chemical uptake inhibitors demonstrated JMJD6-FMDV entered cells via clathrin-coated pit endocytosis. In vivo, JMJD6-FMDV exhibited preference for JMJD6(+) cells, but availability of this alternative receptor likely depends on route of inoculation. Copyright © 2016. Published by Elsevier Inc.
X-ray-sensitive mutants of Chinese hamster ovary cell line
International Nuclear Information System (INIS)
Jeggo, P.A.; Kemp, L.M.
1983-01-01
A standard technique of microbial genetics, which involves the transfer of cells from single colonies by means of sterile toothpicks, has been adapted to somatic cell genetics. Its use has been demonstrated in the isolation of X-ray-sensitive mutants of CHO cells. 9000 colonies have been tested and 6 appreciably X-ray-sensitive mutants were isolated. (D 10 values 5-10-fold of wild-type D 10 value.) A further 6 mutants were obtained which showed a slight level of sensitivity (D 10 values less than 2-fold of wild-type D 10 value). The 6 more sensitive mutants were also sensitive to bleomycin, a chemotherapeutic agent inducing X-ray-like damage. Cross-sensitivity to UV-irradiation and treatment with the alkylating agents, MMS, EMS and MNNG, was investigated for these mutants. Some sensitivity to these other agents was observed, but in all cases it was less severe than the level of sensitivity to X-irradiation. Each mutant showed a different overall response to the spectrum of agents examined and these appear to represent new mutant phenotypes derived from cultured mammalian cell lines. One mutant strain, xrs-7, was cross-sensitive to all the DNA-damaging agents, but was proficient in the repair of single-strand breaks. (Auth.)
UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.
Lawrence, C W; O'Brien, T; Bond, J
1984-01-01
The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.
Juliana Domingues Lima; Wilson da Silva Moraes
2007-01-01
Esse trabalho teve por objetivo testar métodos de controle de contaminação bacteriana no processo de multiplicação in vitro de bananeira (Musa AAA cv. Caipira), utilizando-se hipoclorito de sódio (NaOCl), antibiótico rifampicina e suas combinações. Não houve oxidação excessiva dos explantes após a imersão em NaOCl ou rifampicina. O melhor tratamento para explantes recém isolados foi imersão em NaOCl a 1% (v/v), dura...
Evaluation of heterogeneity corrections in stereotactic body radiation therapy for the lung
International Nuclear Information System (INIS)
Matsuo, Yukinori; Narita, Yuichiro; Nakata, Manabu
2008-01-01
The purpose was to evaluate impact of heterogeneity corrections on dose distributions for stereotactic body radiation therapy (SBRT) for the lung. This study was conducted with the treatment plans of 28 cases in which we performed SBRT for solitary lung tumors with 48 Gy in 12-Gy fractions at the isocenter. The treatment plans were recalculated under three conditions of heterogeneity correction as follows: pencil beam convolution with Batho power law correction (PBC-BPL), pencil beam convolution with no correction (PBC-NC), and anisotropic analytical algorithm with heterogeneity correction (AAA). Dose-volumetric data were compared among the three conditions. Heterogeneity corrections had a significant impact on all dose-volumetric parameters. Means of isocenter dose were 48.0 Gy, 44.6 Gy, and 48.4 Gy in PBC-BPL, PBC-NC, and AAA, respectively. PTV D95 were 45.2 Gy, 41.1 Gy, and 42.1 Gy, and V20 of the lung were 4.1%, 3.7%, and 3.9%, respectively. Significant differences in dose distribution were observed among heterogeneity corrections. Attention needs to be paid to the differences. (author)
Neuromuscular regulation in zebrafish by a large AAA+ ATPase/ubiquitin ligase, mysterin/RNF213
Kotani, Yuri; Morito, Daisuke; Yamazaki, Satoru; Ogino, Kazutoyo; Kawakami, Koichi; Takashima, Seiji; Hirata, Hiromi; Nagata, Kazuhiro
2015-01-01
Mysterin (also known as RNF213) is a huge intracellular protein with two AAA+ ATPase modules and a RING finger ubiquitin ligase domain. Mysterin was originally isolated as a significant risk factor for the cryptogenic cerebrovascular disorder moyamoya disease, and was found to be involved in physiological angiogenesis in zebrafish. However, the function and the physiological significance of mysterin in other than blood vessels remain largely unknown, although mysterin is ubiquitously expressed in animal tissues. In this study, we performed antisense-mediated suppression of a mysterin orthologue in zebrafish larvae and revealed that mysterin-deficient larvae showed significant reduction in fast myofibrils and immature projection of primary motoneurons, leading to severe motor deficits. Fast muscle-specific restoration of mysterin expression cancelled these phenotypes, and interestingly both AAA+ ATPase and ubiquitin ligase activities of mysterin were indispensable for proper fast muscle formation, demonstrating an essential role of mysterin and its enzymatic activities in the neuromuscular regulation in zebrafish. PMID:26530008
Inflammatory cell phenotypes in AAAs; their role and potential as targets for therapy
Dale, Matthew A; Ruhlman, Melissa K.; Baxter, B. Timothy
2015-01-01
Abdominal aortic aneurysms are characterized by chronic inflammatory cell infiltration. AAA is typically an asymptomatic disease and caused approximately 15,000 deaths annually in the U.S. Previous studies have examined both human and murine aortic tissue for the presence of various inflammatory cell types. Studies show that in both human and experimental AAAs, prominent inflammatory cell infiltration, such as CD4+ T cells and macrophages, occurs in the damaged aortic wall. These cells have the ability to undergo phenotypic modulation based on microenvironmental cues, potentially influencing disease progression. Pro-inflammatory CD4+ T cells and classically activated macrophages dominate the landscape of aortic infiltrates. The skew to pro-inflammatory phenotypes alters disease progression and plays a role in causing chronic inflammation. The local cytokine production and presence of inflammatory mediators, such as extracellular matrix breakdown products, influence the uneven balance of the inflammatory infiltrate phenotypes. Understanding and developing new strategies that target the pro-inflammatory phenotype could provide useful therapeutic targets for a disease with no current pharmacological intervention. PMID:26044582
Biochemical characteristics of mutant lines of currant tomato
International Nuclear Information System (INIS)
Gorbatenko, I.Yu.; Khrustaleva, V.V.; Shcherbakov, V.K.
1988-01-01
The currant tomato is used in breeding for fruit quality. It contains up to 50 mg% ascorbic acid, a large quantity of sugar and 8-10% of dry matter. The weight of the fruit, however, does not exceed 1.2-1.5 g. The plants have long, spreading and very branchy stems. Gamma ray induced mutants of currant tomato were used, as initial material in breeding for fruit quality in varieties suitable for mechanized harvesting. The research was carried out mainly at the Department of Vegetable Growing Ukrainian Scientific Research Institute of Irrigation Farming. The regional variety Lebyazhinskij (suitable for mechanized harvesting) was adopted as the standard. Its fruits contain: 5.6% dry matter, 2.7% sugars, 0.543% titrated acidity, 26.6 mg/100 g ascorbic acid, 0.425 mg% carotene and 0.35% cellulose. The biochemical characteristics of the tomato mutants are shown. In terms of fruit dry matter, all mutants surpassed the standard. The acidity and the ascorbic acid content varied considerably. Most noteworthy in terms of carotene were the lines GP-5, GP-9 and GP-12. An important factor in the production of tomato paste is the fruit cellulose content. The lowest cellulose content is found in mutant GP-3. As shown, all of the mutants were early ripening. The mutants surpassed the standard in simultaneous fruit ripening. Mutant lines GP-3, GP-6, GP-9 and GP-12 will be used in the breeding programme for improving fruit quality of varieties suitable for mechanized harvesting
Directory of Open Access Journals (Sweden)
Satoru Noguchi
2014-01-01
Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.
DEFF Research Database (Denmark)
Grau, Tanja; Artemyev, Nikolai O; Rosenberg, Thomas
2011-01-01
study on PDE6C mutations including the mutation spectrum, its prevalence in a large cohort of ACHM/cone dysfunction patients, the clinical phenotype and the functional characterization of mutant PDE6C proteins. Twelve affected patients from seven independent families segregating PDE6C mutations were......Mutations in the gene encoding the catalytic subunit of the cone photoreceptor phosphodiesterase (PDE6C) have been recently reported in patients with autosomal recessive inherited achromatopsia (ACHM) and early-onset cone photoreceptor dysfunction. Here we present the results of a comprehensive...... identified in our total patient cohort of 492 independent families. Eleven different PDE6C mutations were found including two nonsense mutations, three mutations affecting transcript splicing as shown by minigene assays, one 1 bp-insertion and five missense mutations. We also performed a detailed functional...
Korohoda, Włodzimierz; Hapek, Anna; Pietrzak, Monika; Ryszawy, Damian; Madeja, Zbigniew
2016-11-01
The present study found that, similarly to 5-fluorouracil, low concentrations (1-10 µM) of 9-aminoacridine (9-AAA) inhibited the growth of the two rat prostate cancer AT-2 and Mat-LyLu cell lines and the human melanoma A375 cell line. However, at the same concentrations, 9-AAA had no effect on the growth and apoptosis of normal human skin fibroblasts (HSFs). The differences between the cellular responses of the AT-2 and Mat-LyLu cell lines, which differ in malignancy, were found to be relatively small compared with the differences between normal HSFs and the cancer cell lines. Visible effects on the cell growth and survival of tumor cell lines were observed after 24-48 h of treatment with 9-AAA, and increased over time. The inhibition of cancer cell growth was found to be due to the gradually increasing number of cells dying by apoptosis, which was observed using two methods, direct counting and FlowSight analysis. Simultaneously, cell motile activity decreased to the same degree in cancer and normal cells within the first 8 h of incubation in the presence of 9-AAA. The results presented in the current study suggest that short-lasting tests for potential anticancer substances can be insufficient; which may result in cell type-dependent differences in the responses of cells to tested compounds that act with a delay being overlooked. The observed differences in responses between normal human fibroblasts and cancer cells to 9-AAA show the requirement for additional studies to be performed simultaneously on differently reacting cancer and normal cells, to determine the molecular mechanisms responsible for these differences.
Radiation-induced mutagenicity in repair deficient Chinese hamster ovary (CHO) mutants
International Nuclear Information System (INIS)
Tesmer, J.G.; Saunders, E.H.; Chen, D.J.
1987-01-01
To determine if there is a relationship between DNA double-strand break repair and mutagenicity the authors utilized two x-ray sensitive mutants of Chinese hamster ovary cells along with the parental line K1. The two mutant lines xrs-5 and xrs-6, which have different DSB repair capabilities, were used to determine cell killing and 6-thioguanine resistance (6TG/sup r/) mutation frequencies induced by either x-rays of α-particles, x-ray survival data indicated the two mutant lines have similar sensitivity and are 5-7 fold more sensitive than the parental line K1. The mutant lines are also sensitive to α-particles but to a lesser extent. The authors' 6TG mutation data indicated that the two mutant lines are hypermutable. When mutation frequencies were plotted against the log of survival, mutation frequency at a given survival level was greater in mutant cell population than in parental K1 cells. Their results support the notion that repair of DSB play an important role in the expression of radiation-induced cell killing and mutagenicity
Moda, Bruno S; Ferreira-Júnior, José Ribamar; Barros, Mario H
2016-08-01
Recently, a large body of evidences indicates the existence in the mitochondrial matrix of foci that contain different proteins involved in mitochondrial RNA metabolism. Some of these proteins have a pentatricopeptide repeat motif that constitutes their RNA-binding structures. Here we report that MSC6, a mitochondrial pentatricopeptide protein of unknown function, is a multi copy suppressor of mutations in QRS1/HER2 a component of the trimeric complex that catalyzes the transamidation of glutamyl-tRNAQ to glutaminyl-tRNAQ. This is an essential step in mitochondrial translation because of the lack of a specific mitochondrial aminoacyl glutaminyl-tRNA synthetase. MSC6 over-expression did not abolish translation of an aberrant variant form of Cox2p detected in QRS1/HER2 mutants, arguing against a suppression mechanism that bypasses Qrs1p function. A slight decrement of the mitochondrial translation capacity as well as diminished growth on respiratory carbon sources media for respiratory activity was observed in the msc6 null mutant. Additionally, the msc6 null mutant did not display any impairment in RNA transcription, processing or turnover. We concluded that Msc6p is a mitochondrial matrix protein and further studies are required to indicate the specific function of Msc6p in mitochondrial translation.
International Nuclear Information System (INIS)
Engvild, K.C.; Rasmussen, K.
2005-01-01
Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants
International Nuclear Information System (INIS)
Alves, Gilberto Dias; Colaco, Waldeciro
1999-01-01
Buds from banana cv. Nanicao-AAA (3 mm x 3 mm) were aseptically cultured in a modified Murashige and Skoog (MS) basal medium supplement with bezylaminepurine and sucrose, and solidified with agar. Buds placed on sterile Petri dishes were irradiated with increasing gamma rays doses (10, 20, 30, and 40 Gy). The statistical design was completely randomized with 5 doses and 30 replications. After irradiation, buds were transferred to 10 ml of the same medium into test tubes, and allowed to grow in a controlled environment (25 deg C, 16 h illumination ) for 4 weeks. There were no significant differences (Tukey, 0,05) between doses in terms of oxidation: in around 20% for all treatments. On the other hand, a statistically significant decrease in the germination of new buds with increased doses of irradiation was observed. The treatment with 40 Gy reduced in 80% the germination of new buds by the end of the evaluated period (4 weeks), resulting in a mean production of 1,5 buds. Mean production in the control was 7,6 buds. no statistically significant differences were detected between treatments with 10, 20, and 30 Gy, with a mean production of 3 buds, less than half obtained in the control. (author)
Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess.
Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali
2018-06-01
Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals' susceptibility to certain infections. Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p = 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p > 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p > 0.05). Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations.
UV- and gamma-radiation sensitive mutants of Arabidopsis thaliana
International Nuclear Information System (INIS)
Jiang, C.Z.; Yen, C.N.; Cronin, K.; Mitchell, D.; Britt, A.B.
1997-01-01
Arabidopsis seedlings repair UV-induced DNA damage via light-dependent and -independent pathways. The mechanism of the ''dark repair'' pathway is still unknown. To determine the number of genes required for dark repair and to investigate the substrate-specificity of this process we isolated mutants with enhanced sensitivity to UV radiation in the absence of photoreactivating light. Seven independently derived UV sensitive mutants were isolated from an EMS-mutagenized population. These fell into six complementation groups, two of which (UVR1 and UVH1) have previously been defined. Four of these mutants are defective in the dark repair of UV-induced pyrimidine [6-4] pyrimidinone dimers. These four mutant lines are sensitive to the growth-inhibitory effects of gamma radiation, suggesting that this repair pathway is also involved in the repair of some type of gamma-induced DNA damage product. The requirement for the coordinate action of several different gene products for effective repair of pyrimidine dimers, as well as the nonspecific nature of the repair activity, is consistent with nucleotide excision repair mechanisms previously described in Saccharomyces cerevisiae and nonplant higher eukaryotes and inconsistent with substrate-specific base excision repair mechanisms found in some bacteria, bacteriophage, and fungi. (author)
Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P
2018-06-01
There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.
Dey, Sanjay; Biswas, Maitree; Sen, Udayaditya; Dasgupta, Jhimli
2015-04-03
Bacterial enhancer-binding proteins (bEBPs) oligomerize through AAA(+) domains and use ATP hydrolysis-driven energy to isomerize the RNA polymerase-σ(54) complex during transcriptional initiation. Here, we describe the first structure of the central AAA(+) domain of the flagellar regulatory protein FlrC (FlrC(C)), a bEBP that controls flagellar synthesis in Vibrio cholerae. Our results showed that FlrC(C) forms heptamer both in nucleotide (Nt)-free and -bound states without ATP-dependent subunit remodeling. Unlike the bEBPs such as NtrC1 or PspF, a novel cis-mediated "all or none" ATP binding occurs in the heptameric FlrC(C), because constriction at the ATPase site, caused by loop L3 and helix α7, restricts the proximity of the trans-protomer required for Nt binding. A unique "closed to open" movement of Walker A, assisted by trans-acting "Glu switch" Glu-286, facilitates ATP binding and hydrolysis. Fluorescence quenching and ATPase assays on FlrC(C) and mutants revealed that although Arg-349 of sensor II, positioned by trans-acting Glu-286 and Tyr-290, acts as a key residue to bind and hydrolyze ATP, Arg-319 of α7 anchors ribose and controls the rate of ATP hydrolysis by retarding the expulsion of ADP. Heptameric state of FlrC(C) is restored in solution even with the transition state mimicking ADP·AlF3. Structural results and pulldown assays indicated that L3 renders an in-built geometry to L1 and L2 causing σ(54)-FlrC(C) interaction independent of Nt binding. Collectively, our results underscore a novel mechanism of ATP binding and σ(54) interaction that strives to understand the transcriptional mechanism of the bEBPs, which probably interact directly with the RNA polymerase-σ(54) complex without DNA looping. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Energy Technology Data Exchange (ETDEWEB)
Messing, K.; Ferraris, J.; Bradley, W.E.; Swartz, J.; Seifert, A.M. (Universite du Quebec a Montreal (Canada))
1989-10-01
The frequency of hypoxanthine phosphoribosyl transferase (HPRT) mutants among peripheral T-lymphocytes of radiotherapy technicians primarily exposed to 60Co was measured by the T-cell cloning method. Mutant frequencies of these technicians in 1984 and 1986 were significantly higher than those of physiotherapy technicians who worked in a neighboring service, and correlated significantly with thermoluminescence dosimeter readings recorded during the 6 mo preceding mutant frequency determination. Correlations decreased when related to dose recorded over longer time intervals. HPRT mutant frequency determination in peripheral lymphocytes is a good measure of recently received biologically effective radiation dose in an occupationally exposed population.
International Nuclear Information System (INIS)
Messing, K.; Ferraris, J.; Bradley, W.E.; Swartz, J.; Seifert, A.M.
1989-01-01
The frequency of hypoxanthine phosphoribosyl transferase (HPRT) mutants among peripheral T-lymphocytes of radiotherapy technicians primarily exposed to 60Co was measured by the T-cell cloning method. Mutant frequencies of these technicians in 1984 and 1986 were significantly higher than those of physiotherapy technicians who worked in a neighboring service, and correlated significantly with thermoluminescence dosimeter readings recorded during the 6 mo preceding mutant frequency determination. Correlations decreased when related to dose recorded over longer time intervals. HPRT mutant frequency determination in peripheral lymphocytes is a good measure of recently received biologically effective radiation dose in an occupationally exposed population
The Swedish mutant barley collection
Energy Technology Data Exchange (ETDEWEB)
NONE
1989-07-01
Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)
The Swedish mutant barley collection
International Nuclear Information System (INIS)
1989-01-01
Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)
Photorepair mutants of Arabidopsis
International Nuclear Information System (INIS)
Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.
1997-01-01
UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system
Results of the use of induced mutants in maize breeding
International Nuclear Information System (INIS)
Balint, A.; Kovacs, Gezane; Hajos, Laszlone; Geczki, I.
1979-01-01
The investigated mutagens have the same effect on the increasing of protein content. In the case of WF9 mutants no essential improvement can be found compared with the untreated co trol selected for protein. ''Lines'' flowering 16-19 days earlier than controls were produced; the most effective agent of this production is the fast neutron. Mutation caused a significant change in their combining ability, but there were more negative variants than positive ones. Three hybrids with stronger stalk than that of MvSc 620 were obtained. Stalk standing ability of mutants did not improve. The flowering date of lines (male) is in r=+0.5672 +++ correlation to the yield of their test hybrid. Mutant lines in SC test cross seemed to be stable. The correlation of the yield of two years is r=+0.8659. The correlation of both the yield of test hybrids to the protein content of mutant lines (r=0.2307) and the flowering date of lines to their protein content (r=-0.3032) is loose. The earliest mutant line of WF9, which produced low crop (5000 kg/ha) when crossed with N6, gave a high-yielding hybrid when crossed with other lines. The average yield of eight combinations was 10050 kg/ha and the highest yield was 11680 kg/ha. (author)
SRAP analysis for space induced mutant line of maize (Zea mays L.)
International Nuclear Information System (INIS)
Du Wenping; Yu Guirong; Song Jun; Xu Liyuan
2011-01-01
In order to detect the effects of space mutation on maize, 16 SRAP primers were applied for the discrimination of the maize inbred line '968' and its 93 mutant materials, 154 polymorphic fragments were amplified. The average of polymorphic bands detected by per SRAP primer combination was 9.6 with a range from 5 to 18. Genetic similarities among the 94 materials ranged from 0.481 to 1.000 with an average of 0.903, and the largest genetic distance was found between mutant line 37 and control. The 94 materials were divided into six groups with the similarity coefficient of 0.732. The phylogenetic analysis showed distinct variation among the mutants. The results indicated that SRAP markers could be used for analyzing genetic variation of mutants. (authors)
Directory of Open Access Journals (Sweden)
David A. Dunn
2012-01-01
Full Text Available Nuclear encoding of mitochondrial DNA transgenes followed by mitochondrial targeting of the expressed proteins (allotopic expression; AE represents a potentially powerful strategy for creating animal models of mtDNA disease. Mice were created that allotopically express either a mutant (A6M or wildtype (A6W mt-Atp6 transgene. Compared to non-transgenic controls, A6M mice displayed neuromuscular and motor deficiencies (wire hang, pole, and balance beam analyses; P0.05. This study illustrates a mouse model capable of circumventing in vivo mitochondrial mutations. Moreover, it provides evidence supporting AE as a tool for mtDNA disease research with implications in development of DNA-based therapeutics.
A wheat cold resistance mutant derived from space mutagenesis
International Nuclear Information System (INIS)
Li Peng; Sun Mingzhu; Zhang Fengyun; Gao Guoqiang; Qiu Denglin; Li Xinhua
2012-01-01
A cold resistance mutant, obtained by spaceflight mutagenesis on the seeds of wheat variety Han6172, and the DNA of cold resistance mutant and contrast Han6172 were compared by SRAP technique. 380 pairs of primers were screened, 6 pairs of them had polymorphisms between mutant and contrast, the rate was 1.58%, and this data indicated that there are no obvious DNA differences between mutant and contrast Six specific fragments were obtained, 3 fragments of them were amplified in mutant. Homology analysis in GenBank showed that Me3-Em7-Mt, Me4-Em11-CK, Me7-Em19-CK and Me6-Em9-Mt all had homologous sequences with wheat chromosome 3B-specific BAC library, and this result indicated that the gene and regulator sequences associated with mutant cold resistance might locate on 3B chromosome. It was speculated that space mutation induced the mutation of 3B chromosome primary structure, and influenced the expressions of cold resistance genes, which resulted in the mutation of cold resistance ability. (authors)
A wheat cold resistance mutant derived from space mutagenesis
International Nuclear Information System (INIS)
Li Peng; Sun Mingzhu; Zhang Fengyun; Gao Guoqiang; Qiu Denglin; Li Xinhua
2011-01-01
A cold resistance mutant, obtained by spaceflight mutagenesis on the seeds of wheat variety Han6172, and the DNA of cold resistance mutant and contrast Han6172 were compared by SRAP technique. 380 pairs of primers were screened, 6 pairs of them had polymorphisms between mutant and contrast, the rate was 1.58%, and this data indicated that there are no obvious DNA differences between mutant and contrast. Six specific fragments were obtained, 3 fragments of them were amplified in mutant. Homology analysis in GenBank showed that Me3-Em7-Mt, Me4-Em11-CK, Me7-Em19-CK and Me6-Em9-Mt all had homologous sequences with wheat chromosome 3B-specific BAC library, and this result indicated that the gene and regulator sequences associated with mutant cold resistance might locate on 3B chromosome. It was speculated that space mutation induced the mutation of 3B chromosome primary structure, and influenced the expressions of cold resistance genes, which resulted in the mutation of cold resistance ability. (authors)
Esser, Karlheinz; Tursun, Baris; Ingenhoven, Martin; Michaelis, Georg; Pratje, Elke
2002-11-08
The yeast protein cytochrome c peroxidase (Ccp1) is nuclearly encoded and imported into the mitochondrial intermembrane space, where it is involved in degradation of reactive oxygen species. It is known, that Ccp1 is synthesised as a precursor with a N-terminal pre-sequence, that is proteolytically removed during transport of the protein. Here we present evidence for a new processing pathway, involving novel signal peptidase activities. The mAAA protease subunits Yta10 (Afg3) and Yta12 (Rca1) were identified both to be essential for the first processing step. In addition, the Pcp1 (Ygr101w) gene product was found to be required for the second processing step, yielding the mature Ccp1 protein. The newly identified Pcp1 protein belongs to the rhomboid-GlpG superfamily of putative intramembrane peptidases. Inactivation of the protease motifs in mAAA and Pcp1 blocks the respective steps of proteolysis. A model of coupled Ccp1 transport and N-terminal processing by the mAAA complex and Pcp1 is discussed. Similar processing mechanisms may exist, because the mAAA subunits and the newly identified Pcp1 protein belong to ubiquitous protein families.
International Nuclear Information System (INIS)
Balchiuniene, L.
1995-01-01
Gamma-irradiation effect was tested on the grain material of normal-initial barley c. 'Auksiniai II' and allelic mutants tw 1 and tw 2 . Dependence of the aging effects on genotype was obvious, especially in survival test. Differences were observed even on allelic mutants. These observations are important for the preservation strategy of plant genetical resources. (author). 11 refs., 3 tabs
Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion.
Ivanov, E L; Kovaltzova, S V; Korolev, V G
1989-08-01
We have developed a method to isolate yeast (Saccharomyces cerevisiae) mutants with enhanced induced mutagenesis based on nitrous acid-induced reversion of the ade2-42 allele. Six mutants have been isolated and designated him (high induced mutagenesis), and 4 of them were studied in more detail. The him mutants displayed enhanced reversion of the ade2-42 allele, either spontaneous or induced by nitrous acid, UV light, and the base analog 6-N-hydroxylaminopurine, but not by gamma-irradiation. It is worth noting that the him mutants turned out not to be sensitive to the lethal effects of the mutagens used. The enhancement in mutation induced by nitrous acid, UV light, and 6-N-hydroxylaminopurine has been confirmed in a forward-mutation assay (induction of mutations in the ADE1, ADE2 genes). The latter agent revealed the most apparent differences between the him mutants and the wild-type strain and was, therefore, chosen for the genetic analysis of mutants, him mutations analyzed behaved as a single Mendelian trait; complementation tests indicated 3 complementation groups (HIM1, HIM2, and HIM3), each containing 1 mutant allele. Uracil-DNA glycosylase activity was determined in crude cell extracts, and no significant differences between the wild-type and him strains were detected. Spontaneous mitotic gene conversion at the ADE2 locus is altered in him1 strains, either increased or decreased, depending on the particular heteroallelic combination. Genetic evidence strongly suggests him mutations to be involved in a process of mismatch correction of molecular heteroduplexes.
International Nuclear Information System (INIS)
Springer, Fabian; Pfeffer, Joachim-Georg; Schmitz-Rode, Thomas; Schlierf, Roland; Schnakenberg, Uwe; Mahnken, Andreas H.
2007-01-01
A feasibility study on a completely digital telemetric pressure sensor (TPS) to detect endoleaks was performed in an in vitro model of an abdominal aortic aneurysm (AAA). An endovascular-stented AAA silicone model with different types (I-III) and sizes (3-11 French) of endoleaks was created and pulsatile pressure was applied with physiological flow and pressure rates [mean intraaortic pressure (IAP): 95-130 mmHg] and different degrees of thrombosis of the aneurysm sac. Aneurysm sac pressure (ASP) was measured with the TPS and with wired pressure sensors (WPS) as a reference. Statistical analysis included paired t-test, Pearson's correlation analysis and Bland-Altman plots. After opening an endoleak, the mean ASP increased significantly (P < 0.0001) from 15 to almost 95% of the mean IAP depending on endoleak type and size. ASP could be measured accurately with the TPS and the WPS. The telemetric and wired ASP increase showed a high Pearson's correlation coefficient (r) for a non-thrombosed (r 0.97) and a thrombosed (r = 0.96) aneurysm sac. In an in vitro silicone model, the newly designed telemetric pressure sensor was able to detect the occurrence of an endoleak in a non-invasive way and might be a valuable device for follow-up of endovascular AAA repair. (orig.)
Hypermutability of a UV-sensitive aphidicolin-resistant mutant of Chinese hamster fibroblasts
International Nuclear Information System (INIS)
Liu, P.K.; Chang, C.; Trosko, J.E.
1982-01-01
An ultraviolet light (UV)-sensitive thymidine auxotroph of Chinese hamster V79 cells that exhibits pleiotropic effects such as a high level of deoxycytidine triphosphate, slow growth, sensitivity to cytidine, and high frequencies of site-specific bromodeoxyuridine-dependent chromosomal aberrations was selected by its resistance to aphidicolin. The UV-induced mutability of this mutant and one of its revertants, which retains some of the phenotypes listed above, was studied in 3 mutation assay systems. The results showed that the mutant was hypermutable for ouabain and diphtheria-toxin-resistant mutations compared to wild-type V79 cells at the same UV dose or the same survival level. The mutant exhibits a delayed expression of maximal frequency of induced 6-thioguanine-resistant mutants. When maximal frequencies are compared at the same UV dose, the mutant also has higher mutation frequencies at the hypoxanthine-guanine phosphoribosyl transferase locus. The revertant was similar to the wild-type in UV sensitivity and mutability. (orig./AJ)
Sorghum Brown Midrib Mutants, Tools to Improve Biomass for Biofuels
To improve sorghum for cellulosic bioenergy uses, brown midrib mutants are being investigated for their ability to increase the conversion efficiency of biomass. brown midrib 6 and 12 (bmr6 and 12) mutants affect monolignol biosynthesis resulting in reduced lignin content and altered lignin composi...
The mechanical role of thrombus on the growth rate of an abdominal aortic aneurysm (AAA)
Speelman, L.; Schurink, G.W.H.; Bosboom, E.M.H.; Buth, J.; Breeuwer, M.; Vosse, van de F.N.; Jacobs, M.J.H.M.
2010-01-01
Objectives: In the decision for surgical repair of abdominal aortic aneurysms (AAAs), the maximum diameter is the main factor. Several studies have concluded that the diameter may not be reliable as rupture risk criterion for the individual patient and wall stress was found to have a higher
Prattes, M.; Loibl, M.; Zisser, G.; Luschnig, D.; Kappel, L.; Rossler, I.; Grassegger, M.; Hromic, A.; Krieger, E.; Gruber, K.; Pertschy, B.; Bergler, H.
2017-01-01
AAA-ATPases fulfil essential roles in different cellular pathways and often act in form of hexameric complexes. Interaction with pathway-specific substrate and adaptor proteins recruits them to their targets and modulates their catalytic activity. This substrate dependent regulation of ATP
TRIP13 is a protein-remodeling AAA+ ATPase that catalyzes MAD2 conformation switching.
Ye, Qiaozhen; Rosenberg, Scott C; Moeller, Arne; Speir, Jeffrey A; Su, Tiffany Y; Corbett, Kevin D
2015-04-28
The AAA+ family ATPase TRIP13 is a key regulator of meiotic recombination and the spindle assembly checkpoint, acting on signaling proteins of the conserved HORMA domain family. Here we present the structure of the Caenorhabditis elegans TRIP13 ortholog PCH-2, revealing a new family of AAA+ ATPase protein remodelers. PCH-2 possesses a substrate-recognition domain related to those of the protein remodelers NSF and p97, while its overall hexameric architecture and likely structural mechanism bear close similarities to the bacterial protein unfoldase ClpX. We find that TRIP13, aided by the adapter protein p31(comet), converts the HORMA-family spindle checkpoint protein MAD2 from a signaling-active 'closed' conformer to an inactive 'open' conformer. We propose that TRIP13 and p31(comet) collaborate to inactivate the spindle assembly checkpoint through MAD2 conformational conversion and disassembly of mitotic checkpoint complexes. A parallel HORMA protein disassembly activity likely underlies TRIP13's critical regulatory functions in meiotic chromosome structure and recombination.
TRIP13 is a protein-remodeling AAA+ ATPase that catalyzes MAD2 conformation switching
Energy Technology Data Exchange (ETDEWEB)
Ye, Qiaozhen [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Rosenberg, Scott C. [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Moeller, Arne [National Resource for Automated Molecular Microscopy, Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, United States; Speir, Jeffrey A. [National Resource for Automated Molecular Microscopy, Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La Jolla, United States; Su, Tiffany Y. [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Corbett, Kevin D. [Ludwig Institute for Cancer Research, San Diego Branch, La Jolla, United States; Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, United States
2015-04-28
The AAA+ family ATPase TRIP13 is a key regulator of meiotic recombination and the spindle assembly checkpoint, acting on signaling proteins of the conserved HORMA domain family. Here we present the structure of the Caenorhabditis elegans TRIP13 ortholog PCH-2, revealing a new family of AAA+ ATPase protein remodelers. PCH-2 possesses a substrate-recognition domain related to those of the protein remodelers NSF and p97, while its overall hexameric architecture and likely structural mechanism bear close similarities to the bacterial protein unfoldase ClpX. We find that TRIP13, aided by the adapter protein p31(comet), converts the HORMA-family spindle checkpoint protein MAD2 from a signaling-active ‘closed’ conformer to an inactive ‘open’ conformer. We propose that TRIP13 and p31(comet) collaborate to inactivate the spindle assembly checkpoint through MAD2 conformational conversion and disassembly of mitotic checkpoint complexes. A parallel HORMA protein disassembly activity likely underlies TRIP13's critical regulatory functions in meiotic chromosome structure and recombination.
Isolation and characterization of MMS-sensitive mutants of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Prakash, L.; Prakash, S.
1977-01-01
We have isolated mutants sensitive to methyl methanesulfonate (MMS) in Saccharomyces cerevisiae. Alleles of rad1, rad4, rad6, rad52, rad55 and rad57 were found among these mms mutants. Twenty-nine of the mms mutants which complement the existing radiation-sensitive (rad and rev) mutants belong to 22 new complementation groups. Mutants from five complementation groups are sensitive only to MMS. Mutants of 11 complementation groups are sensitive to uv or x rays in addition to MMS, mutants of six complementation groups are sensitive to all three agents. The cross-sensitivities of these mms mutants to uv and x rays are discussed in terms of their possible involvement in DNA repair. Sporulation is reduced or absent in homozygous diploids of mms mutants from nine complementation groups
Mutation Breeding and Selection for Phenotypic Mutants in Standard Rice Varieties by Ion Beam
International Nuclear Information System (INIS)
Puddhanon, Prawit; Pintanon, Prateep; Chaithep, Waree; Songjuntuke, Ksan
2009-07-01
Full text: Effects of 80 keV ion beam (10 16 ion/cm 2 on mutations of RD6 and Sanpatong 1 rice varieties were studied in 2006. In order to obtain the phenotypic mutants, each variety was sown in the laboratory and under field conditions at Maejo University in 2007 dry season. Seed germination noticeably declined. For RD6, only 45.1% germinated in the laboratory, and 18.1% were established under the field condition. Similarly, 62.3% of Sanpatong 1 germinated in the laboratory and 31.4% established in the field. No phenotypic mutants were observed in the first generation (M 1 ). The M2 seeds were harvested separately from 3 panicles of each M plant in RD6 and Sanpatong1, totaling 810 and 1,878 lines, respectively. In 2007 rainy season, they were planted on a panicle to row basis. It was found that more phenotypic mutants were observed in the M 2 for Sanpatong 1 than for RD6. The mutant characters included dwarf plants, early maturity, male sterility and larger panicle sizes. As a result, about 420 within line selections were collected and the M 3 seeds were harvested for further field condition and gene markers evaluations
Energy Technology Data Exchange (ETDEWEB)
Muszynski, S; Darlewska, M [Department of Plant Breeding and Seed Science, Warsaw Agricultural University, Warsaw (Poland)
1990-01-01
Full text: Mutants were induced by treating dormant seeds with ionizing radiation (fast neutrons) or chemicals (N-nitroso-N-ethyl urea or sodium azide). Among several mutants obtained, of special value is the short-straw mutant No. 2714 and a late senescent mutant. (author)
Kuhn, Hannah; Lorek, Justine; Kwaaitaal, Mark; Consonni, Chiara; Becker, Katia; Micali, Cristina; Ver Loren van Themaat, Emiel; Bednarek, Paweł; Raaymakers, Tom M; Appiano, Michela; Bai, Yuling; Meldau, Dorothea; Baum, Stephani; Conrath, Uwe; Feussner, Ivo; Panstruga, Ralph
2017-01-01
Loss of function mutations of particular plant MILDEW RESISTANCE LOCUS O ( MLO ) genes confer durable and broad-spectrum penetration resistance against powdery mildew fungi. Here, we combined genetic, transcriptomic and metabolomic analyses to explore the defense mechanisms in the fully resistant Arabidopsis thaliana mlo2 mlo6 mlo12 triple mutant. We found that this genotype unexpectedly overcomes the requirement for indolic antimicrobials and defense-related secretion, which are critical for incomplete resistance of mlo2 single mutants. Comparative microarray-based transcriptome analysis of mlo2 mlo6 mlo12 mutants and wild type plants upon Golovinomyces orontii inoculation revealed an increased and accelerated accumulation of many defense-related transcripts. Despite the biotrophic nature of the interaction, this included the non-canonical activation of a jasmonic acid/ethylene-dependent transcriptional program. In contrast to a non-adapted powdery mildew pathogen, the adapted powdery mildew fungus is able to defeat the accumulation of defense-relevant indolic metabolites in a MLO protein-dependent manner. We suggest that a broad and fast activation of immune responses in mlo2 mlo6 mlo12 plants can compensate for the lack of single or few defense pathways. In addition, our results point to a role of Arabidopsis MLO2, MLO6, and MLO12 in enabling defense suppression during invasion by adapted powdery mildew fungi.
Milla, M. E.; Brown, B. M.; Sauer, R. T.
1993-01-01
Many mutant variants of the P22 Arc repressor are subject to intracellular proteolysis in Escherichia coli, which precludes their expression at levels sufficient for purification and subsequent biochemical characterization. Here we examine the effects of several different C-terminal extension sequences on the expression and activity of a set of Arc mutants. We show that two tail sequences, KNQHE (st5) and H6KNQHE (st11), increase the expression levels of most mutants from 10- to 20-fold and, ...
High lysine and high yielding mutants in wheat (Triticum aestivum) L
International Nuclear Information System (INIS)
Mohammad, T.; Mahmood, F.; Ahmad, A.; Sattar, A.; Khan, I.
1988-01-01
The dry seeds of the variety Lu-26 were irradiated with 20 krad of gamma rays. In M 2 about 300 mutant plants were selected for short stature, rust resistance and other desirable traits. As a result of further selection, in M 6 , eight superior lines were finally identified. The agronomic characteristics of these mutants, the parent variety (Lu-26) and a standard check variety (Pak-81) are shown. The selected mutants and commercially grown cultivars (Lu-26 and Pak-81) were studied for total protein content and amino acid pattern. The mutants WM-89-1, WM-6-17 and WM-81-2 showing high yield also contained comparatively high amounts of methionine and lysine. The lysine contents were 565, 410, and 370 mg/100g in the mutants WM-89-1, WM-6-17 and WM-81-2, respectively against a range value of 210-370 mg/100g in other mutants and 250-320 in the commercial cultivars. The mutant WM-81-2 was comparable to WM-56-1-5 in lysine content. The results of these experiments show a possibility of developing varieties having high yield and high amounts of essential amino acids such as lysine and methionine
Study on ionizing radiosensitivity of respiratory deficiency yeast mutants
International Nuclear Information System (INIS)
Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei
2006-01-01
The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)
Decreased uv mutagenesis in cdc8, a DNA replication mutant of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Prakash, L.; Hinkle, D.; Prakash, S.
1978-01-01
A DNA replication mutant of yeast, cdc8, was found to decrease uv-induced reversion of lys2-1, arg4-17, tryl and ural. This effect was observed with all three alleles of cdc8 tested. Survival curves obtained following uv irradiation in cdc8 rad double mutants show that cdc8 is epistatic to rad6, as well as to rad1; cdc8 rad51 double mutants seem to be more sensitive than the single mutants. Since uv-induced reversion in cdc8 rad1 and cdc8 rad51 double mutants is like that of the cdc8 single mutants, we conclude that CDC8 plays a direct role in error-prone repair. To test whether CDC8 codes for a DNA polymerase, we have purified both DNA polymerase I and DNA polymerase II from cdc8 and CDC+ cells. The purified DNA polymerases from cdc8 were no more heat labile than those from CDC+, suggesting that CDC8 is not a structural gene for either enzyme
Lin, Ching-Jung; Smibert, Peter; Zhao, Xiaoyu; Hu, Jennifer F.; Ramroop, Johnny; Kellner, Stefanie M.; Benton, Matthew A.; Govind, Shubha; Dedon, Peter C.; Sternglanz, Rolf; Lai, Eric C.
2015-01-01
N6-threonylcarbamoyl-adenosine (t6A) is one of the few RNA modifications that is universally present in life. This modification occurs at high frequency at position 37 of most tRNAs that decode ANN codons, and stabilizes cognate anticodon–codon interactions. Nearly all genetic studies of the t6A pathway have focused on single-celled organisms. In this study, we report the isolation of an extensive allelic series in the Drosophila ortholog of the core t6A biosynthesis factor Kae1. kae1 hemizygous larvae exhibit decreases in t6A that correlate with allele strength; however, we still detect substantial t6A-modified tRNAs even during the extended larval phase of null alleles. Nevertheless, complementation of Drosophila Kae1 and other t6A factors in corresponding yeast null mutants demonstrates that these metazoan genes execute t6A synthesis. Turning to the biological consequences of t6A loss, we characterize prominent kae1 melanotic masses and show that they are associated with lymph gland overgrowth and ectopic generation of lamellocytes. On the other hand, kae1 mutants exhibit other phenotypes that reflect insufficient tissue growth. Interestingly, whole-tissue and clonal analyses show that strongly mitotic tissues such as imaginal discs are exquisitely sensitive to loss of kae1, whereas nonproliferating tissues are less affected. Indeed, despite overt requirements of t6A for growth of many tissues, certain strong kae1 alleles achieve and sustain enlarged body size during their extended larval phase. Our studies highlight tissue-specific requirements of the t6A pathway in a metazoan context and provide insights into the diverse biological roles of this fundamental RNA modification during animal development and disease. PMID:26516084
Inter-ring rotations of AAA ATPase p97 revealed by electron cryomicroscopy.
Yeung, Heidi O; Förster, Andreas; Bebeacua, Cecilia; Niwa, Hajime; Ewens, Caroline; McKeown, Ciarán; Zhang, Xiaodong; Freemont, Paul S
2014-03-05
The type II AAA+ protein p97 is involved in numerous cellular activities, including endoplasmic reticulum-associated degradation, transcription activation, membrane fusion and cell-cycle control. These activities are at least in part regulated by the ubiquitin system, in which p97 is thought to target ubiquitylated protein substrates within macromolecular complexes and assist in their extraction or disassembly. Although ATPase activity is essential for p97 function, little is known about how ATP binding or hydrolysis is coupled with p97 conformational changes and substrate remodelling. Here, we have used single-particle electron cryomicroscopy (cryo-EM) to study the effect of nucleotides on p97 conformation. We have identified conformational heterogeneity within the cryo-EM datasets from which we have resolved two major p97 conformations. A comparison of conformations reveals inter-ring rotations upon nucleotide binding and hydrolysis that may be linked to the remodelling of target protein complexes.
Overexpression of mutant ataxin-3 in mouse cerebellum induces ataxia and cerebellar neuropathology.
Nóbrega, Clévio; Nascimento-Ferreira, Isabel; Onofre, Isabel; Albuquerque, David; Conceição, Mariana; Déglon, Nicole; de Almeida, Luís Pereira
2013-08-01
Machado-Joseph disease (MJD), also known as spinocerebellar ataxia type 3 (SCA3), is a fatal, dominant neurodegenerative disorder caused by the polyglutamine-expanded protein ataxin-3. Clinical manifestations include cerebellar ataxia and pyramidal signs culminating in severe neuronal degeneration. Currently, there is no therapy able to modify disease progression. In the present study, we aimed at investigating one of the most severely affected brain regions in the disorder--the cerebellum--and the behavioral defects associated with the neuropathology in this region. For this purpose, we injected lentiviral vectors encoding full-length human mutant ataxin-3 in the mouse cerebellum of 3-week-old C57/BL6 mice. We show that circumscribed expression of human mutant ataxin-3 in the cerebellum mediates within a short time frame--6 weeks, the development of a behavioral phenotype including reduced motor coordination, wide-based ataxic gait, and hyperactivity. Furthermore, the expression of mutant ataxin-3 resulted in the accumulation of intranuclear inclusions, neuropathological abnormalities, and neuronal death. These data show that lentiviral-based expression of mutant ataxin-3 in the mouse cerebellum induces localized neuropathology, which is sufficient to generate a behavioral ataxic phenotype. Moreover, this approach provides a physiologically relevant, cost-effective and time-effective animal model to gain further insights into the pathogenesis of MJD and for the evaluation of experimental therapeutics of MJD.
Wu, Yu-Yi; Hou, Bo-Han; Lee, Wen-Chi; Lu, Shin-Hua; Yang, Chen-Jui; Vaucheret, Hervé; Chen, Ho-Ming
2017-06-01
DICER-LIKE (DCL) enzymes process double-stranded RNA into small RNAs that act as regulators of gene expression. Arabidopsis DCL4 and DCL2 each allow the post-transcriptional gene silencing (PTGS) of viruses and transgenes, but primary PTGS-prone DCL4 outcompetes transitive PTGS-prone DCL2 in wild-type plants. This hierarchy likely prevents DCL2 having any detrimental effects on endogenous genes. Indeed, dcl4 mutants exhibit developmental defects and increased sensitivity to genotoxic stress. In this study, the mechanism underlying dcl4 defects was investigated using genetic, biochemical and high-throughput sequencing approaches. We show that the purple phenotype of dcl4 leaves correlates with carbohydrate over-accumulation and defective phloem transport, and depends on the activity of SUPPRESSOR OF GENE SILENCING 3, RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) and DCL2. This phenotype correlates with the downregulation of two genes expressed in the apex and the vasculature, SMAX1-LIKE 4 (SMXL4) and SMXL5, and the accumulation of DCL2- and RDR6-dependent small interfering RNAs derived from these two genes. Supporting a causal effect, smxl4 smxl5 double mutants exhibit leaf pigmentation, enhanced starch accumulation and defective phloem transport, similar to dcl4 plants. Overall, this study elucidates the detrimental action of DCL2 when DCL4 is absent, and indicates that DCL4 outcompeting DCL2 in wild-type plants is crucial to prevent the degradation of endogenous transcripts by DCL2- and RDR6-dependent transitive PTGS. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Screening of in vitro derived mutants of banana against nematodes ...
African Journals Online (AJOL)
The rest of the mutants namely Ro Im V4 6-1-2 and Si Im V4 6-2-5 were found to be susceptible to nematodes. The resistant and moderately resistant mutants of banana could be further used in breeding programmes as well as being recognized as potential cultivars of commerce. Key words: Banana, nematode, resistance, ...
Bradshaw, Nicholas J; Ukkola-Vuoti, Liisa; Pankakoski, Maiju; Zheutlin, Amanda B; Ortega-Alonso, Alfredo; Torniainen-Holm, Minna; Sinha, Vishal; Therman, Sebastian; Paunio, Tiina; Suvisaari, Jaana; Lönnqvist, Jouko; Cannon, Tyrone D; Haukka, Jari; Hennah, William
2017-11-01
Genetic studies of familial schizophrenia in Finland have observed significant associations with a group of biologically related genes, DISC1 , NDE1 , NDEL1 , PDE4B and PDE4D , the 'DISC1 network'. Here, we use gene expression and psychoactive medication use data to study their biological consequences and potential treatment implications. Gene expression levels were determined in 64 individuals from 18 families, while prescription medication information has been collected over a 10-year period for 931 affected individuals. We demonstrate that the NDE1 SNP rs2242549 associates with significant changes in gene expression for 2908 probes (2542 genes), of which 794 probes (719 genes) were replicable. A significant number of the genes altered were predicted targets of microRNA-484 ( p = 3.0 × 10 -8 ), located on a non-coding exon of NDE1 Variants within the NDE1 locus also displayed significant genotype by gender interaction to early cessation of psychoactive medications metabolized by CYP2C19. Furthermore, we demonstrate that miR-484 can affect the expression of CYP2C19 in a cell culture system. Thus, variation at the NDE1 locus may alter risk of mental illness, in part through modification of miR-484, and such modification alters treatment response to specific psychoactive medications, leading to the potential for use of this locus in targeting treatment. © 2017 The Authors.
International Nuclear Information System (INIS)
Kukimura, H.; Ikeda, F.; Fujita, H.; Maeta, T.; Nakajima, K.; Katagiri, K.; Nakahira, K.; Somegou, M.
1975-01-01
The study was aimed at elucidating the biological aspects of artificially induced mutations in perennial tree crops and at promoting the utilization of such mutations in a practical breeding programme. A number of mutants obtained particularly in Cryptomeria and mulberry (Morus spp.) by means of gamma radiation were examined for their practical usefulness. Doses from 7.5 to 15.0 kR were used. In mulbery, some mutant strains showed increased shoot growth, and one mutant strain showed a remarkable increase also in rooting ability. Entire leaf mutants were investigated for their breeding behaviour. None of the mutant strains showed acquired disease resistance. Changes in the number of isozyme bands and different staining intensity was observed in all the mutant strains compared to the original strains
Abo1, a conserved bromodomain AAA?ATPase, maintains global nucleosome occupancy and organisation
Gal, Csenge; Murton, Heather E; Subramanian, Lakxmi; Whale, Alex J; Moore, Karen M; Paszkiewicz, Konrad; Codlin, Sandra; B?hler, J?rg; Creamer, Kevin M; Partridge, Janet F; Allshire, Robin C; Kent, Nicholas A; Whitehall, Simon K
2015-01-01
Maintenance of the correct level and organisation of nucleosomes is crucial for genome function. Here, we uncover a role for a conserved bromodomain AAA-ATPase, Abo1, in the maintenance of nucleosome architecture in fission yeast. Cells lacking abo1+ experience both a reduction and mis-positioning of nucleosomes at transcribed sequences in addition to increased intragenic transcription, phenotypes that are hallmarks of defective chromatin re-establishment behind RNA polymerase II. Abo1 is rec...
International Nuclear Information System (INIS)
Qiu Qingrong
1990-01-01
In order to make good use of macro-mutants, we have studied the law of genetic variation and selective effect on the hybrid progenies of original varieties and of two macro-mutants with steady phenotypes. The results show that the hybrid progenies of the two experimental macro-mutants in the broad-sense heritability and the genetic advance of their main economical characters as well as the effect on selection are better than those of the hybrid progenies of the two original varieties. The selection rate from the macro-mutant hybrid progenies is 72.2% which is higher than that of the hybrid progenies of the two original varieties, and and a new prospecting strain has been obtained
Directory of Open Access Journals (Sweden)
Hassan Abdel-Latif A. Mohamed
2006-06-01
Full Text Available Exposing a wild-type culture of Trichoderma harzianum to gamma irradiation induced two stable salt-tolerant mutants (Th50M6 and Th50M11. Under saline conditions, both mutants greatly surpassed their wild type strain in growth rate, sporulation and biological proficiency against Fusarium oxysporum, the causal agent of tomato wilt disease. Tolerant T. harzianum mutants detained a capability to grow and convinced sporulation in growth media containing up to 69 mM NaCl. In comparison with their parent strain, characterization of both mutants confirmed that they have reinforced contents of proline and hydroxyproline, relatively higher sodium content compared to potassium, calcium or magnesium contents, higher level of total phenols. Electrophoretic analysis of total soluble proteins in the salt tolerance mutant Th50M6 showed different bands accumulated in response to 69 mM NaCl. Data also showed that mutants produce certain active metabolites, such as chitinases, cellulases, beta-galactosidases, as well as, some antibiotics i.e., trichodermin, gliotoxin and gliovirin. Trichoderma mutants significantly reduced wilt disease incidence and improved yield and mineral contents of tomato plants under both saline and non-saline soil conditions, as well as, under infested and natural conditions. T. harzianum mutants were also more efficient in dropping the F. oxysporum growth in rhizosphere compared to the wild type strain. Population density of both mutants in rhizosphere far exceeded that of T. harzianum wild type strain.A exposição de uma cepa selvagem de Trichoderma harzianum à irradiação gama induziu dois mutantes tolerantes a sal (Th50M6 e Th50M11. Em condições salinas, os dois mutantes foram muito superiores à cepa selvagem em relação à velocidade de multiplicação, esporulação e eficiência contra Fusarium oxysporum, o agente causador da doença wilt do tomate. Os mutantes tolerantes foram capazes de multiplicação e esporulação em
Dalgety, Michael Franklin
2012-01-01
The purpose of this exploratory qualitative study was to examine student-athlete perceptions of the role of summer pre-enrollment in their adjustment and transition to college. The study focused on student-athletes who received athletically-related financial aid at a National Collegiate Athletic Association (NCAA) Division I-AAA institution. The…
Cullen, Kirsty S; Matschinsky, Franz M; Agius, Loranne; Arden, Catherine
2011-12-01
The posttranslational regulation of glucokinase (GK) differs in hepatocytes and pancreatic β-cells. We tested the hypothesis that GK mutants that cause maturity-onset diabetes of the young (GK-MODY) show compromised activity and posttranslational regulation in β-cells. Activity and protein expression of GK-MODY and persistent hyperinsulinemic hypoglycemia of infancy (PHHI) mutants were studied in β-cell (MIN6) and non-β-cell (H4IIE) models. Binding of GK to phosphofructo-2-kinase, fructose-2,6-bisphosphatase (PFK2/FBPase2) was studied by bimolecular fluorescence complementation in cell-based models. Nine of 11 GK-MODY mutants that have minimal effect on enzyme kinetics in vitro showed decreased specific activity relative to wild type when expressed in β-cells. A subset of these were stable in non-β-cells but showed increased inactivation in conditions of oxidative stress and partial reversal of inactivation by dithiothreitol. Unlike the GK-MODY mutants, four of five GK-PHHI mutants had similar specific activity to wild type and Y214C had higher activity than wild type. The GK-binding protein PFK2/FBPase2 protected wild-type GK from oxidative inactivation and the decreased stability of GK-MODY mutants correlated with decreased interaction with PFK2/FBPase2. Several GK-MODY mutants show posttranslational defects in β-cells characterized by increased susceptibility to oxidative stress and/or protein instability. Regulation of GK activity through modulation of thiol status may be a physiological regulatory mechanism for the control of GK activity in β-cells.
Effects of ion beam irradiation on size of mutant sector and genetic damage in Arabidopsis
Energy Technology Data Exchange (ETDEWEB)
Hase, Yoshihiro, E-mail: hase.yoshihiro@qst.go.jp [Takasaki Advanced Radiation Research Institute, National Institutes for Quantum and Radiological Science and Technology (QST), 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Nozawa, Shigeki [Takasaki Advanced Radiation Research Institute, National Institutes for Quantum and Radiological Science and Technology (QST), 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Narumi, Issay [Faculty of Life Sciences, Toyo University, 1-1-1 Izumino, Itakura, Gunma 374-0193 (Japan); Oono, Yutaka [Takasaki Advanced Radiation Research Institute, National Institutes for Quantum and Radiological Science and Technology (QST), 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)
2017-01-15
Size of mutant sector and genetic damage were evaluated in Arabidopsis to further our understanding of effective ion beam use in plant mutation breeding. Arabidopsis seeds, heterozygous for the GLABRA1 (GL1) gene (GL1/gl1-1), were irradiated with 15.8 MeV/u neon ions (mean linear energy transfer (LET): 352 keV/μm), 17.3 MeV/u carbon ions (113 keV/μm), or {sup 60}Co gamma rays. The frequency and size of glabrous sectors generated because of inactivation of the GL1 allele were examined. The frequency and overall size of large deletions were evaluated based on the loss of heterozygosity of DNA markers using DNA isolated from glabrous tissue. Irrespective of the radiation properties, plants with mutant sectors were obtained at similar frequencies at the same effective dosage necessary for survival reduction. Ion beams tended to induce larger mutant sectors than gamma rays. The frequency of large deletions (>several kbp) increased as the LET value increased, with chromosome regions larger than 100 kbp lost in most large deletions. The distorted segregation ratio of glabrous plants in the progenies of irradiated GL1/gl1-1 plants suggested frequent occurrence of chromosome rearrangement, especially those subjected to neon ions. Exposure to ion beams with moderate LET values (30–110 keV/μm) is thought effective for inducing mutant sectors without causing extensive genetic damage.
International Nuclear Information System (INIS)
Roeber, B.; Reuter, G.
1982-01-01
Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)
Metabolic effect of streptomyces avermitilis irradiated by ion beam of "1"2C"6"+
International Nuclear Information System (INIS)
Wang Shuyang; Chen Jihong; Li Wenjian; Liang Jianping; Liu Jing; Bo Yongheng; Wang Lihua
2013-01-01
pH value, mycelium concentration, carbon source and nitrogen metabolism in flask fermentation of the mutant high-producing strain ZJAV-Yl-203 and the original strain ZJAV-A1 have been investigated, in order to show the metabolic effect of avermitilis irradiated by ion beam of "1"2C"6"+. In early stage (48 h) of the fermentation, pH value of the original fermentation was lower than that of the mutant strains. In 96∼196 h of fermentation, the nitrogen utilization in the strains ZJAV-Y1-203 was higher than that in the original strains, its reproductive was fast, and its growing was vigorous. The mycelium concentration of ZJAV-Yl-203 was greater than the original strain, and the pH value of fermentation were stable, so its metabolism was relatively more stable. In 144∼240 h of fermentation, the strain ZJAV-Y1-203 on sugar consumption was less than the original strains. The effect of "1"2C"6"+ ion irradiation on metabolism of Streptomyces avermitilis is conducive to the synthesis of avermectin. (authors)
Guragain, Yadhu N; Srinivasa Rao, P; Vara Prasad, P V; Vadlani, Praveen V
2017-11-01
Three sorghum backgrounds [Atlas, Early Hegari (EH), and Kansas Collier (KC)] and two bmr mutants (bmr6 and bmr12) of each line were evaluated and compared for grain and biomass yield, biomass composition, and 2,3-butanediol production from biomass. The data showed that the bmr6 mutation in EH background led to a significant decrease in stover yield and increase in grain yield, whereas the stover yield was increased by 64% without affecting grain yield in KC background. The bmr mutants had 10 to 25% and 2 to 9% less lignin and structural carbohydrate contents, respectively, and 24 to 93% more non-structural sugars than their parents in all sorghum lines, except EH bmr12. The total fermentable sugars released were 22 to 36% more in bmr mutants than in parents for Atlas and KC, but not for EH. The bmr6 mutation in KC background produced the most promising feedstock, among the evaluated bmr mutants, for 2,3-butanediol production without affecting grain yield, followed by KC bmr12 and Atlas bmr6, but the bmr mutation had an adverse effect in EH background. This indicated that the genetic background of the parent line and type of bmr mutation significantly affect the biomass quality as a feedstock for biochemical production.
Hu, Guangrong; Fan, Yong; Zhang, Lei; Yuan, Cheng; Wang, Jufang; Li, Wenjian; Hu, Qiang; Li, Fuli
2013-01-01
The unicellular green microalga Desmodesmus sp. S1 can produce more than 50% total lipid of cell dry weight under high light and nitrogen-limitation conditions. After irradiation by heavy (12)C(6+) ion beam of 10, 30, 60, 90 or 120 Gy, followed by screening of resulting mutants on 24-well microplates, more than 500 mutants were obtained. One of those, named D90G-19, exhibited lipid productivity of 0.298 g L(-1)⋅d(-1), 20.6% higher than wild type, likely owing to an improved maximum quantum efficiency (Fv/Fm) of photosynthesis under stress. This work demonstrated that heavy-ion irradiation combined with high-throughput screening is an effective means for trait improvement. The resulting mutant D90G-19 may be used for enhanced lipid production.
International Nuclear Information System (INIS)
Tang Jiahui; Yang Fumin; Wang Shuyang
2012-01-01
In order to improve the cellulose ion beam at 20, 40, 60, 80, 100, 120Gy and 140 enzyme vitality of Aspergillus niger (=AS3.316), heavy Gy doses was used for inducing mutation. Higher cellulose enzyme vitality strains were screened through the primary screening and secondary screening. The result showed that 5 mutants T2-1, T3-1, T5-1, T6-3, T6-4 were selected, and T6-4 had the highest cellulose enzyme activity. The activity of filter paper cellulose enzyme, endo-glucanase, exo-glucanase and 13-glucosidase of T6-4 was 61.3, 116.2, 29.9 U/mL and 35.9 U/mL respectively. Compared with the original A. niger (=AS3.316), the cellulose enzyme activity was increased by 3.5, 3.78, 2.76 and 2.52 times in turn. The activity of cellulose enzyme of the rest mutants sorted from strong to the weak were T6-3T5-1T3-1T2-1. The dose at 120 Gy showed the best mutagenesis effect. Mutants had different degree of changes in the genetic stability, but overall, the performance showed relatively stable
Selection of high hectolitre weight mutants of winter wheat
International Nuclear Information System (INIS)
Crowley, C.; Jones, P.
1989-01-01
Grain quality in wheat includes hectolitre weight (HLW) besides protein content and thousand-grain weight (TGW). The British winter wheat variety ''Guardian'' has a very high yield potential. Although the long grain of ''Guardian'' results in a desirable high TGW the HLW is too low. To select mutants exhibiting increased HLW the character was first analyzed to identify traits that could more easily be screened for using M 2 seeds. In comparison of 6 wheat cultivars, correlation analyses with HLW resulted in coefficients of -0.86 (grain length, L:P 2 seeds for shorter, less prolate grains. Mutagenesis was carried out using EMS sulphonate (1.8 or 3.6%), sodium azide (2 or 20 mM) or X-rays (7.5 or 20 kR). 69 M 2 grains with altered shape were selected. Examination of the M 3 progeny confirmed 6 grain-shape mutants, most of them resulting from EMS treatment (Table). Two of the mutants showed TGW values significantly below the parental variety, but three mutants exhibited HLW and TGW values significantly greater than those of the parental variety. Microplot yield trails on selected M 3 lines are in progress. The influence of physical grain characteristics on HLW offers prospects for mechanical fractionation of large M 2 populations. The application of gravity separators (fractionation on the basis of grain density) and sieves (fractionation on the basis of grain length) in screening mutants possessing improved grain quality is being investigated
Characteristics of mutant lines of sweet potato flour
International Nuclear Information System (INIS)
Aryanti
2012-01-01
Research on mutation induction of sweet potato Sari variety has been conducted. Flour mutant lines were obtained from selection of M1V5 tubers irradiated by gamma rays at the dose of 10 Gy. Flour was made by peeling of tubers, then dried, blended and sieved. The quality test of flour have been done by measuring degree of whiteness, proximate, amylose contents, water content, soluble water, swelling power, and flour characteristics. The result of this work showed that flour of C6.26.13 mutant line had higher protein content than the parent plant with concentration of 3.62 % and its amylose content was also higher than the other mutant lines. The soluble water value of mutant lines were significant different compared to the parent plant from 1.82 to 2.25 % and swelling power from 4.28 to 5.55 %. The flour granule of the mutant line was different compared to the parent plant. (author)
Betensky, Marisol; Babushok, Daria; Roth, Jacquelyn J.; Mason, Philip J; Biegel, Jaclyn A.; Busse, Tracy M; Li, Yimei; Lind, Curt; Papazoglou, Anna; Monos, Dimitri; Podsakoff, Gregory; Bessler, Monica; Olson, Timothy S.
2015-01-01
Acquired aplastic anemia (aAA) results from the T cell-mediated autoimmune destruction of hematopoietic stem cells. Factors predicting response to immune suppression therapy (IST) or development of myelodysplastic syndrome (MDS) are beginning to be elucidated. Our recent data suggest most patients with aAA treated with IST develop clonal somatic genetic alterations in hematopoietic cells. One frequent acquired abnormality is copy-number neutral loss of heterozygosity on chromosome 6p (6p CN-LOH) involving the human leukocyte antigen (HLA) locus. We hypothesized that because 6p CN-LOH clones may arise from selective pressure to escape immune surveillance through deletion of HLA alleles, the development of 6p CN-LOH may affect response to IST. We used single nucleotide polymorphism array genotyping and targeted next-generation sequencing of HLA alleles to assess frequency of 6p CN-LOH, identity of HLA alleles lost through 6p CN-LOH, and impact of 6p CN-LOH on response to IST. 6p CN-LOH clones were present in 11.3% of patients, remained stable over time, and were not associated with development of MDS-defining cytogenetic abnormalities. Notably, no patient with 6p CN-LOH treated with IST achieved a complete response. In summary, clonal 6p CN-LOH in aAA defines a unique subgroup of patients that may provide insights into hematopoietic clonal evolution. PMID:26702937
An AAA Motor-Driven Mechanical Switch in Rpn11 Controls Deubiquitination at the 26S Proteasome.
Worden, Evan J; Dong, Ken C; Martin, Andreas
2017-09-07
Poly-ubiquitin chains direct protein substrates to the 26S proteasome, where they are removed by the deubiquitinase Rpn11 during ATP-dependent substrate degradation. Rapid deubiquitination is required for efficient degradation but must be restricted to committed substrates that are engaged with the ATPase motor to prevent premature ubiquitin chain removal and substrate escape. Here we reveal the ubiquitin-bound structure of Rpn11 from S. cerevisiae and the mechanisms for mechanochemical coupling of substrate degradation and deubiquitination. Ubiquitin binding induces a conformational switch of Rpn11's Insert-1 loop from an inactive closed state to an active β hairpin. This switch is rate-limiting for deubiquitination and strongly accelerated by mechanical substrate translocation into the AAA+ motor. Deubiquitination by Rpn11 and ubiquitin unfolding by the ATPases are in direct competition. The AAA+ motor-driven acceleration of Rpn11 is therefore important to ensure that poly-ubiquitin chains are removed only from committed substrates and fast enough to prevent their co-degradation. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kronenberg, A; Little, J B
1989-04-01
In order to characterize the nature of mutants induced by densely ionizing radiations at an autosomal locus, the authors have isolated a series of 99 thymidine kinase (tk) mutants of human TK6 lymphoblastoid cells iraadiated with either fast neutrons or accelerated argon ions. Individual muant clones were examined for alterations in their restriction fragment pattern after hybridization with a human cDNA probe for tk. A restriction fragment length polymorphism (RFLP) allowed identification of the active tk allele. Among the neutron-induced mutants, 34/52 exhibited loss of the previously active allele while 6/52 exhibited intragenic rearrangements. Among the argon-induced mutants 27/46 exhibited allele loses and 10/46 showed rearrangements within the tk locus. The remaining mutants had restriction patterns indistinguishable from the TK6 parent. Each of the mutant clones was further examined for structural alterations within the c-erbAl locus which has been localized to chromosome 17q11-q22, at some unknown distance from the human tk locus at chromosome 17q21-q22. A substantial proportion (54%) of tk mutants induced by densely ionizing radiation showed loss of the c-erb locus on the homologous chromosome, suggesting that the mutations involve large-scale genetic changes. (author). 51 refs.; 2 figs.; 6 tabs.
A higher yielding mutant of black gram with improved nodule formation
International Nuclear Information System (INIS)
Singh, R.K.; Raghuvanshi, S.S.
1987-01-01
Dry seeds of black gram (Vigna mungo (L) Hopper) var. T 9 with 12.2% moisture content were irradiated at 10, 20 and 30 krad of gamma rays. This was followed by combined treatment of one set in each dose with freshly prepared 0. 25% EMS in phosphate buffer at 7.0 pH at 30± deg. C for 6 hours. In M 2 population of 20 krad two mutants with pentafoliate instead of trifoliate leaves were found. This character was true breeding in M 3 M 6 generation. Crosses revealed monogenic recessive inheritance of this character. The proposed gene symbol is p5. This mutant has normal maturity period and the plant height is the same as T 9 (ca. 50 cm). Preliminary yield trials indicate superiority of the mutant line over control. The mutant line also shows a significant improvement in number and weight of root nodules, potentially improving green manuring value. Improvement of root nodulation in mungbean mutants was reported before by others
International Nuclear Information System (INIS)
Kukimura, H.; Ikeda, F.; Fujita, H.; Maeta, T.; Nakajima, K.; Katagiri, K.; Nakahira, K.; Somegou, M.
1976-01-01
The plants studied included apple trees, cryptomeria (japanese cedar) and mulberry. In apple, dwarf and compact types of mutants from cv. Fuji were found to be graft incompatible on Maruba-kaido(Malus prunifolia) rootstock. In Sunki mandarin(Citrus sunki), the number of nucellar embryo per seed was affected by gamma-irradiation, and morphological mutants from nucellar seedlings were obtained at high rate by irradiation at floral bud stage with 2kR exposure. In Cryptomeria, re-irradiated waxless mutants by gamma-rays showed very high rate of somatic mutation when compared to other morphological mutants. Pollen sterility and pollen shaped PMC were found in the most of gamma-induced-mutants. Mutants forming pollen shaped PMC had a genetical tendency of continuous male flower bud formation for a longer term. With mulberry, time of sprouting of induced mutants differed from the originals. Ability of root initiation of semi-softwood cuttings in morphological mutants were tested. Cytochimera induction were found at considerably high rate when actively growing diploid plants were irradiated by gamma-rays. Eight kinds of cytochimeras were induced. Frequency of 2-4-4 was extremely high(approx. 50%), then 4-2-2 and 2-4-2 chimeras followed. Seven kinds were induced by semi-acute irradiation(200R/h), while 4 kinds by acute irradiation(5kR/h). By breeding test it was cleared that the elongate and entire leaf was sexually transmissible, whereas the 'dwarf' was not obvious and the 'marginally curledleaf' was not transmissible. Pyronin-methylgreen staining method proved to be useful in some morphological mutants to distinguish the histo-genetical differences which exist in the shoot apex.
Mutant power: using mutant allele collections for yeast functional genomics.
Norman, Kaitlyn L; Kumar, Anuj
2016-03-01
The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Molecular analyses of in vivo hprt mutant T cells from atomic bomb survivors
International Nuclear Information System (INIS)
Hakoda, M.; Hirai, Y.; Kyoizumi, S.; Akiyama, M.
1989-01-01
In vivo-derived hprt-deficient mutant T cells isolated from three nonirradiated controls and two atomic bomb survivors were studied by Southern blot analysis to investigate the molecular spectra of the mutations. Mutant frequencies for the three controls were 1.8, 2.3, and 7.3 x 10(-6), and those for the two survivors (who had received radiation doses of 2.46 and 2.15 Gy, based upon the revised atomic bomb shielded kerma estimates) were 9.3 and 14.4 x 10(-6), respectively. Fourteen (13%) of 105 mutant T-cell colonies from the controls showed various structural changes in the hprt gene. The frequency of mutants with hprt gene structural changes in one atomic bomb survivor, who exhibited a mutant frequency of 9.3 x 10(-6), was 26% (16/61), which was significantly higher than that of the controls. However, the frequency of structural changes in the other survivor (14%, 8/59) was not higher than that of the controls. Two sets of mutants (in total, eight mutants) from the survivor, who showed a significantly higher frequency of mutants with hprt gross alterations than did the controls, had the same hprt changes and the same rearrangements of T-cell receptor (TcR) beta- and gamma-chain genes, indicating a clonal expansion from one progenitor mutant. This phenomenon may reflect an in vivo recovery process of T cells in the periphery after exposure to atomic bomb radiation. However, when comparing the frequency of mutations, these two sets of mutants should be reduced. After reducing the total number of mutants from the number of gross hprt changes, the frequency was not significantly higher than that of the controls
Musi, Elgilda; Ambrosini, Grazia; de Stanchina, Elisa; Schwartz, Gary K.
2014-01-01
G-protein mutations are one of the most common mutations occurring in uveal melanoma activating the protein kinase C (PKC)/mitogen-activated protein kinase (MAPK) and phosphoinositide 3-Kinase (PI3K)/AKT pathways. In this study, we described the effect of dual pathway inhibition in uveal melanoma harboring GNAQ and GNA11 mutations via PKC inhibition with AEB071 (Sotrastaurin) and PI3k/AKT inhibition with BYL719, a selective PI3Kα inhibitor. Growth inhibition was observed in GNAQ/GNA11 mutant cells with AEB071 versus no activity in WT cells. In the GNAQ-mutant cells, AEB071 decreased phosphorylation of MARCKS, a substrate of PKC, along with ERK1/2 and ribosomal S6, but persistent AKT activation was present. BYL719 had minimal anti-proliferative activity in all uveal melanoma cell lines, and inhibited phosphorylation of AKT in most cell lines. In the GNA11 mutant cell line, similar effects were observed with ERK1/2 inhibition, mostly inhibited by BYL719. With the combination treatment, both GNAQ and GNA11 mutant cell lines showed synergistic inhibition of cell proliferation and apoptotic cell death. In vivo studies correlated with in vitro findings showing reduced xenograft tumor growth with the combination therapy in a GNAQ mutant model. These findings suggest a new therapy treatment option for G-protein mutant uveal melanoma with a focus on specific targeting of multiple downstream pathways as part of combination therapy. PMID:24563540
Musi, Elgilda; Ambrosini, Grazia; de Stanchina, Elisa; Schwartz, Gary K
2014-05-01
G-protein mutations are one of the most common mutations occurring in uveal melanoma activating the protein kinase C (PKC)/mitogen-activated protein kinase and phosphoinositide 3-kinase (PI3K)/AKT pathways. In this study, we described the effect of dual pathway inhibition in uveal melanoma harboring GNAQ and GNA11 mutations via PKC inhibition with AEB071 (sotrastaurin) and PI3K/AKT inhibition with BYL719, a selective PI3Kα inhibitor. Growth inhibition was observed in GNAQ/GNA11-mutant cells with AEB071 versus no activity in wild-type cells. In the GNAQ-mutant cells, AEB071 decreased phosphorylation of myristoylated alanine-rich C-kinase substrate, a substrate of PKC, along with ERK1/2 and ribosomal S6, but persistent AKT activation was present. BYL719 had minimal antiproliferative activity in all uveal melanoma cell lines, and inhibited phosphorylation of AKT in most cell lines. In the GNA11-mutant cell line, similar effects were observed with ERK1/2 inhibition, mostly inhibited by BYL719. With the combination treatment, both GNAQ- and GNA11-mutant cell lines showed synergistic inhibition of cell proliferation and apoptotic cell death. In vivo studies correlated with in vitro findings showing reduced xenograft tumor growth with the combination therapy in a GNAQ-mutant model. These findings suggest a new therapy treatment option for G-protein-mutant uveal melanoma with a focus on specific targeting of multiple downstream pathways as part of combination therapy.
A Mutant of Bacillus Subtilis with High-Producing Surfactin by Ion Beam Implantation
International Nuclear Information System (INIS)
Liu Qingmei; Yuan Hang; Wang Jun; Gong Guohong; Zhou Wei; Fan Yonghong; Wang Li; Yao Jianming; Yu Zengliang
2006-01-01
In order to generate a mutant of Bacillus subtilis with enhanced surface activity through low energy nitrogen ion beam implantation, the effects of energy and dose of ions implanted were studied. The morphological changes in the bacteria were observed by scanning electron microscope (SEM). The optimum condition of ions implantation, 20 keV of energy and 2.6x10 15 N + /cm 2 in dose, was determined. A mutant, B.s-E-8 was obtained, whose surface activity of 50-fold and 100-fold diluted cell-free Landy medium was as 5.6-fold and 17.4-fold as the wild strain. The microbial growth and biosurfactant production of both the mutant and the wild strain were compared. After purified by ultrafiltration and SOURCE 15PHE, the biosurfactant was determined to be a complex of surfactin family through analysis of electrospray ionization mass spectrum (ESI/MS) and there was an interesting finding that after the ion beam implantation the intensities of the components were different from the wild type strain
Isolation of glutathione-deficient mutants of the yeast Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Kistler, M.; Eckardt, F.; Summer, K.-H.
1986-01-01
Glutathione-deficient (gsh - ) mutants of the yeast Saccharomyces cerevisiae were isolated after UV treatment using MNNG as selective agent. For genetic and biochemical characterization 5 mutant strains were chosen which exhibited considerably decreased residual GSH contents varying from 2 to 6% of the wild-type levels. All 5 isolates showed a 2:2 segregation of the gsh - :GSH + phenotypes alluding to a monogenic recessive mutation. Complementation analysis indicates that all gsh - mutants belong to one complementation group. (Auth.)
International Nuclear Information System (INIS)
El-Banna, M.N.; El-Wakil, H.M.F.; Ebaid, R.A.; Sallam, R.A.
2009-01-01
Grains of eight rice mutants; SC 1, SC 6, RTY 1, RTY 3, HY 14, HYI 17, EH 4 and HYPI 22 were secured from Botany Department Faculty of Agriculture Cairo university. The procedures and the methodology for induction these mutants as well as the original mean performance of such mutants are presented else where; Sabbour, (1989) and Sabbour etal. (2002). Grains were sown (M4 generation) at the experimental farm in Itai EI-Baroud Agricultural Research Station Behaira Governorate Agricultural Research Center (ARC) in the summer season (2007). The mean performance of such mutants was studied during M4 generation. The most exciting results were as follows: the selected line SC 1 showed in M4 generation superior agronomic and yield traits. Sc 1 mutant line is not bred truly and it need more generations to reach stability. SC 6 in M4 generation showed considerable number of individuals scored low mean values toward the negative direction and lowering the overall trait mean performance. The rice lines RTY 1 and RTY 3 proved that, the average number of fertile tillers per plant of the selected lines maintained previously recorded mean values of M3 generation in M4. The traits showed significant differences among their progeny that recorded high CV% values as compared with those showed no significant differences. The rice lines HY 14 and HYI 17 showed a true breeding signs and no more breeding generations are required. Rice lines EH 4, showed a considerable reduction in number of days elapsed from date of cultivation till harvest. As, this mutant maintained 86.58 days till heading. Rice mutant line HYPI 22 did not bred truly for the original selected traits (high yield and high protein content) and it still need more generations of selection to reach considerable stability
Bacillus subtilis mutants deficient in the adaptive response to simple alkylating agents
Energy Technology Data Exchange (ETDEWEB)
Morohoshi, F.; Munakata, N.
1985-03-01
Three mutant strains exhibiting hyper-sensitivity to N-methyl-N'-nitro-N-nitrosoguanidine, but not to methyl methanesulfonate, were selected by a replica method from mutagenized spores of Bacillus subtilis. All three were totally deficient in the adaptive response to N-methyl-N'-nitro-N-nitrosoguanidine with regard to both lethality and mutagenesis. The activity to destroy O/sup 6/-methylguanine residues in the methylated DNA was not elevated in the mutant cells by the pretreatment with sublethal concentrations of N-methyl-N-nitro-N-nitrosoguanidine. This deficiency corresponded to the persistance of O/sup 6/-methylguanine residues in the DNA of both control and pretreated mutant cells challenged with the drug. The lethal and mutagenic sensitivity of the mutant strains were observed only for methyl- or ethyl-nitroso compounds that are thought to be active as inducers and are also active in O-alkylation. Except for the insensitivity to methyl methanesulfonate, the phenotypes of these mutants look very similar to those of ada mutants isolated previously in Escherichia coli.
Promissory rice mutants (Oryza sativa L.) obtained by Gamma Rays induction in Peru
International Nuclear Information System (INIS)
Heros, E.; Gomez, L.
2015-01-01
To improve the available rice cultivars in Peru under irrigated conditions, it was tried the rice seed Amazonas and Capirona, cultivars adapted to irrigated conditions in highland jungle, both characterized for late maturity (140-150 days). The doses were: 150-250-350 Gy that induced mutants with different characteristics to the original cultivar like: early maturity, shorter, high yield and milling quality. In Amazonas cultivar were selected 72 mutants of the M 2 generation with agronomy value and continue in evaluation only the mutant (M35-20). There were applied the same doses of gamma rays with the cultivar Capirona, there is much radiosensitivity at high doses, they were selected two early mutants (MC 35-21 and MC 35-123-3) with an early life cycle days (15 days) than parental cultivar. Two mutants tolerant to salinity (12 dSm). Six mutants are still under evaluation, two of them (MC 25-23-1 and MC 35-45-4) have better yields with performances of 9.1 t ha -1 versus 6.6 t ha -1 . These mutants show lodging and shattering resistance. (Author)
International Nuclear Information System (INIS)
Liu, Y.; Savinov, A.Yu.; McMinimy, D.L.; Kremlev, S.G.; Chapoval, A.I.; Egorov, I.K.
2000-01-01
The Aβ6 w302 gene and molecular mechanisms of resistance to the spread of lymphoma induced by γ-radiation ( 60 Co) in a mouse mutant, survivor-27 were studied. Metastatic tumors escape from immune response and spread in the body; survivors are very rare. Novel single exon genes Aβ4-7 and a pseudogene Aβ8Ψ have been cloned from survivors. Their protein coding sequences are similar major histocompatibility complex (MHC) class II β H2-Ab cDNA while their promoter is different from MHC promoters. The Aβ4 protein was demonstrated on macrophages (antigen presenting cells). The Aβ gene family is genetically unstable in germ line and somatic cells of survivors. Mutants S-27 and S-87/1 lost the Aβ5 s5 and acquired the Aβ6 w302 gene; the Ab gene mutated in S-27. The proposed mechanism of resistance is molecular instability of the Aβ gene family resulting in somatic mutations and wandering immune responses that destroy the tumor in the survivor [ru
International Nuclear Information System (INIS)
Kang, S; Suh, T; Chung, J
2015-01-01
Purpose: To verify the dose accuracy of Acuros XB (AXB) dose calculation algorithm at air-tissue interface using inhomogeneous phantom for 6-MV flattening filter-free (FFF) beams. Methods: An inhomogeneous phantom included air cavity was manufactured for verifying dose accuracy at the air-tissue interface. The phantom was composed with 1 and 3 cm thickness of air cavity. To evaluate the central axis doses (CAD) and dose profiles of the interface, the dose calculations were performed for 3 × 3 and 4 × 4 cm 2 fields of 6 MV FFF beams with AAA and AXB in Eclipse treatment plainning system. Measurements in this region were performed with Gafchromic film. The root mean square errors (RMSE) were analyzed with calculated and measured dose profile. Dose profiles were divided into inner-dose profile (>80%) and penumbra (20% to 80%) region for evaluating RMSE. To quantify the distribution difference, gamma evaluation was used and determined the agreement with 3%/3mm criteria. Results: The percentage differences (%Diffs) between measured and calculated CAD in the interface, AXB shows more agreement than AAA. The %Diffs were increased with increasing the thickness of air cavity size and it is similar for both algorithms. In RMSEs of inner-profile, AXB was more accurate than AAA. The difference was up to 6 times due to overestimation by AAA. RMSEs of penumbra appeared to high difference for increasing the measurement depth. Gamma agreement also presented that the passing rates decreased in penumbra. Conclusion: This study demonstrated that the dose calculation with AXB shows more accurate than with AAA for the air-tissue interface. The 2D dose distributions with AXB for both inner-profile and penumbra showed better agreement than with AAA relative to variation of the measurement depths and air cavity sizes
International Nuclear Information System (INIS)
Boshra, S.A.; Azer, S.A.
2004-01-01
some promising mutants of rice variety Giza 180 induced by using gamma rays were tested for susceptibility to infestation by angoumois grain moth, sitotroga cerealella in relation with grain physical characters. number of F1 progeny and percentage of adult emergence showed that mutants 7/1, 4/5 and 1/7 were the most susceptible o angoumois grain moth, while mutants 13/1,16/1 and 15/6 b were least susceptible . there was positive correlation between number of F1 adult progeny and grain weight loss. the development period of the insect ranged from 33.7 days on 1/7 to 42.9 days on 15/6 b and the adults that emerged from mutants 1/7,4/5,7/1,8/1,15/1 and 11/1 lived longer than those of the other ones. Grains of the mutants with thick and pubescent or intermediate hulls were the least susceptible to attack by this pest. the rice mutants 13/1,16/1,15/6 b and their parental cultivar Giza 180 had the highest grain yield
Energy Technology Data Exchange (ETDEWEB)
O' Neill, J.P.; Flint, K.B.
The cytotoxic and mutagenic effect of X-irradiation was determined with Chinese hamster ovary cells arrested in the G0/G1 phase of the cell cycle through 9 days incubation in serum-free medium. In comparison with exponential phase cultures, the arrested cells showed increased cytotoxicity and mutation induction over the dose range of 50-800 rad. Exponential cultures showed a linear mutant frequency-survival relationship while the arrested cells showed a biphasic linear relationship. A post irradiation holding period 24 h does not result in any change in the mutant frequency. The increased sensitivity of the arrested cells to the mutagenic effects of X-rays appears to be a cell-cycle phase phenomenon. Upon readdition of serum, the arrested cells re-enter the cell cycle in a synchronous manner, reaching S phase at 10-12 h. Cells irradiated at 5 h after serum addition, i.e. in G1, show a similar dose response for mutant frequency, while those irradiated at 10 h or later, i.e. in late G1, S or G2, show lower mutation induction. These observations are consistent with a chromosome interchange mechanism of mutation induction by X-rays, possibly through interactions between repairing regions of the DNA. Irradiation of cells in the G0/G1 phase allow more time for such interactions in the absence of semiconservative DNA replication. (orig.).
Directory of Open Access Journals (Sweden)
Stuart Caroline
2004-06-01
Full Text Available Abstract Background Triple-A syndrome (Allgrove syndrome is an autosomal recessive disorder characterized by adrenal insufficiency, alacrima, achalasia, and – occasionally – autonomic instability. Mutations have been found in the AAAS gene on 12q13. Case presentation We present the case of a 12 year-old boy with classic systemic features of triple-A syndrome and several prominent ophthalmic features, including: accommodative spasm, dry eye, superficial punctate keratopathy, and pupillary hypersensitivity to dilute pilocarpine. MRI showed small lacrimal glands bilaterally. DNA sequencing of PCR-amplified fragments from the 16 exons of the AAAS gene revealed compound heterozygosity for a new, out-of-frame 5-bp deletion in exon 15, c1368-1372delGCTCA, and a previously-described nonsense mutation in exon 9, c938C>T, R286X. Conclusions In addition to known ophthalmic manifestations, triple-A syndrome can present with accommodative dysregulation and ocular signs of autonomic dysfunction.
Effect of feeding frequencies on growth performance of Clarias ...
African Journals Online (AJOL)
Effect of feeding frequencies on growth performance of Clarias gariepinus. CI Ayo-Olalusi, AAA Ugwumba. Abstract. Investigations were carried out on the growth performance of juvenile Clarias gariepinus using four different feeding frequencies. Two hundred and forty juveniles (8.6 +0.0 g) were stocked in eight aquaria ...
Identification of some Rice Mutants using Morphological and Molecular Methods
International Nuclear Information System (INIS)
Sobieh, S.E.S.
2006-01-01
This investigation was conducted at the experimental farm of plant research department, nuclear research center, atomic energy authority, abu zaabal in order to verify four rice genotypes i.e sakha 102, giza 178, high yielding mutant (Ms 6) and high yielding mutant (MG 16). the (UPOV) rice descriptor was used to identify the germplasm morphologically .Molecular RAPD-PCR was used to identify genetic variability on the molecular level for the tested genotypes. 1- the results indicated that according to (UPOV) rice descriptor eight morphological traits were completely different between mutant Ms 6 in comparison with the parent sakha 102 and mut. MG 16 in comparison parent giza 178, the traits were ; stem thickness, stem length, panicle length, 1000-grain weight, grain length, grain width decorticated grain length and decorticated grain width. 2- using 10 arbitrary primers, through four rice genotypes on the molecular level using RAPD markers. the size of the amplified fragments were ranged from 0.201 to 2.036 k bp. two primers OPB-13 and OPB-16 showed no polymorphism among genotypes tested. 3- the total number of amplicons produced by the 8 polymorphic RAPD profiels was 66. the total number of monomorphic amplicons was 32. however, the total number of polymorphic amplicons was 34. 4- the percentage of polymorphism ranged from (22.22%) for primer OPA-18 to (90%) for primer OPB-11. 5-the highest genetic similarity (90.3%) was between sakha 102 and high yielding mut. (Ms 6). the genetic similarity (75.5%) was between giza 178 and high yielding mut.(MG 16). 6- one positive unique marker amplified by OPA-18 Primer identified the high yielding mutant Ms 6 but three positive unique markers amplified by OPB-17 primer and OPA-18 primer identified the high yielding mutant MG 16
A higher yielding mutant of black gram with improved nodule formation
Energy Technology Data Exchange (ETDEWEB)
Singh, R K; Raghuvanshi, S S [Plant Genetic Unit, Department of Botany, University of Lucknow (India)
1987-07-01
Dry seeds of black gram (Vigna mungo (L) Hopper) var. T{sub 9} with 12.2% moisture content were irradiated at 10, 20 and 30 krad of gamma rays. This was followed by combined treatment of one set in each dose with freshly prepared 0. 25% EMS in phosphate buffer at 7.0 pH at 30{+-} deg. C for 6 hours. In M{sub 2} population of 20 krad two mutants with pentafoliate instead of trifoliate leaves were found. This character was true breeding in M{sub 3} M{sub 6} generation. Crosses revealed monogenic recessive inheritance of this character. The proposed gene symbol is p5. This mutant has normal maturity period and the plant height is the same as T{sub 9} (ca. 50 cm). Preliminary yield trials indicate superiority of the mutant line over control. The mutant line also shows a significant improvement in number and weight of root nodules, potentially improving green manuring value. Improvement of root nodulation in mungbean mutants was reported before by others.
Zhao, Peng; Wang, Ji-Gang; Gao, Peng; Li, Xia; Brewer, Rubell
2016-01-01
The aim of this study is to identify and subclassify sudden natural death (sudden death from natural diseases) cases in Seychelles. A total of 484 sudden natural death cases with autopsy at the Clinical Pathology Laboratory, Victoria Hospital, Seychelles between 1997 through 2012 were retrospectively reviewed. Among them, 363 cases (75%) were male and 121 (25%) were female. The most frequent sudden deaths were attributed to cardiovascular diseases (78.5%), and then followed by infectious diseases (9.9%), and gastrointestinal diseases (9.1%). This is the largest population-based study on sudden natural deaths in Seychelles. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Nakano, Sachiko; Okauchi, Kenzo; Tsushima, Yoshito
2014-02-01
A 62-year-old male presented with sudden onset of low back and right leg pain. Contrast-enhanced computed tomography demonstrated an abdominal aortic aneurysm (AAA), along with a large mass lesion causing vertebral body erosion. Magnetic resonance imaging (MRI) suggested that the mass lesion consisted of a chronic hematoma. Fluorine-18-fluorodeoxyglucose positron emission tomography (FDG-PET) demonstrated increased uptake around the mass lesion, but not around the AAA. Surgical intervention was performed, and the subsequent histological diagnosis was chronic contained rupture of AAA. The mass lesion consisted of chronic hematoma and necrosis with inflammatory cell infiltration and hemosiderin deposition. This condition mimics some neoplastic diseases, but MRI and FDG-PET findings may help establish the correct diagnosis.
Betensky, Marisol; Babushok, Daria; Roth, Jacquelyn J; Mason, Philip J; Biegel, Jaclyn A; Busse, Tracy M; Li, Yimei; Lind, Curt; Papazoglou, Anna; Monos, Dimitri; Podsakoff, Gregory; Bessler, Monica; Olson, Timothy S
2016-01-01
Acquired aplastic anemia (aAA) results from the T cell-mediated autoimmune destruction of hematopoietic stem cells. Factors predicting response to immune suppression therapy (IST) or development of myelodysplastic syndrome (MDS) are beginning to be elucidated. Our recent data suggest most patients with aAA treated with IST develop clonal somatic genetic alterations in hematopoietic cells. One frequent acquired abnormality is copy-number neutral loss of heterozygosity on chromosome 6p (6p CN-LOH) involving the human leukocyte antigen (HLA) locus. We hypothesized that because 6p CN-LOH clones may arise from selective pressure to escape immune surveillance through deletion of HLA alleles, the development of 6p CN-LOH may affect response to IST. We used single nucleotide polymorphism array genotyping and targeted next-generation sequencing of HLA alleles to assess frequency of 6p CN-LOH, identity of HLA alleles lost through 6p CN-LOH, and impact of 6p CN-LOH on response to IST. 6p CN-LOH clones were present in 11.3% of patients, remained stable over time, and were not associated with development of MDS-defining cytogenetic abnormalities. Notably, no patient with 6p CN-LOH treated with IST achieved a complete response. In summary, clonal 6p CN-LOH in aAA defines a unique subgroup of patients that may provide insights into hematopoietic clonal evolution. Copyright © 2016 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Zeymer, Cathleen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de [Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg (Germany)
2014-02-01
High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg{sup 2+} ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis.
International Nuclear Information System (INIS)
Zeymer, Cathleen; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen
2014-01-01
High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg 2+ ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis
DEFF Research Database (Denmark)
Sweeney, Trevor; Cisnetto, Valentina; Bose, Daniel
2010-01-01
Foot-and-mouth disease virus (FMDV), a positive sense, single-stranded RNA virus, causes a highly contagious disease in cloven-hoofed livestock. Like other picornaviruses, FMDV has a conserved 2C protein assigned to the superfamily 3 helicases a group of AAA+ ATPases that has a predicted N-termin...
Directory of Open Access Journals (Sweden)
Jessica Porcelan
2012-01-01
Full Text Available Caenorhabditis elegans unc-13 mutants express decreased neuronal activity and thus are a good model strain for examining defective nervous systems. These unc-13 mutants as well as wild type N2 strains, show rapid mortality when under oxidative stress. However, the antioxidant vitamin E may prolong survival in unc-13 mutant and N2 strains under oxidative stress. The addition of vitamin E to organisms under oxidative stress has a protective effect in both N2 and unc-13 C. elegans strains. Interestingly, vitamin E resulted in a greater increase in survival rate in N2 worms than with unc-13 mutant worms. While both strains displayed lower mortality rates with the addition of vitamin E, this finding suggests that vitamin E more efficiently increases survival rates of C. elegans with typical nervous system function. The efficacy of vitamin E implies that use of antioxidants may lessen the damage caused by oxidative stress in both N2 and mutant worms.
International Nuclear Information System (INIS)
Broertjes, C.; Koene, P.; Veen, J.W.H. van.
1980-01-01
Radiation-induced sports in Chrysanthemum morifolium RAM. have been reported for several years. It has become an everyday practice to produce flower-colour mutants from outstanding cross-breeding products, even before they are distributed for the commercial production of cut flowers. One of the most successful and recent examples is that of cv. Horim, of which hundreds of mutants were produced by successive use of radiation-induced mutants in the mutation-breeding programme. Over about 4 years a variety of flower-colour mutants was obtained, not only largely including the outstanding characteristics of the original cultivar but sometimes even with an appreciable improvement in quality and yield. It is expected that the latter types, the Miros group, will soon completely supersede the spontaneous or raditation-induced Horim sports and mutants and take over the leading position of the Horim group in the production of all-year-round (AYR) cut-flowers. (orig.)
International Nuclear Information System (INIS)
Kang, S; Suh, T; Chung, J
2015-01-01
Purpose: This study was to verify the accuracy of Acuros XB (AXB) dose calculation algorithm on an air cavity for a single radiation field using 6-MV flattening filter-free (FFF) beam. Methods: A rectangular slab phantom containing an air cavity was made for this study. The CT images of the phantom for dose calculation were scanned with and without film at measurement depths (4.5, 5.5, 6.5 and 7.5 cm). The central axis doses (CADs) and the off-axis doses (OADs) were measured by film and calculated with Analytical Anisotropic Algorithm (AAA) and AXB for field sizes ranging from 2 Χ 2 to 5 Χ 5 cm 2 of 6-MV FFF beams. Both algorithms were divided into AXB-w and AAA -w when included the film in phantom for dose calculation, and AXB-w/o and AAA-w/o in calculation without film. The calculated OADs for both algorithms were compared with the measured OADs and difference values were determined using root means squares error (RMSE) and gamma evaluation. Results: The percentage differences (%Diffs) between the measured and calculated CAD for AXB-w was most agreement than others. Compared to the %Diff with and without film, the %Diffs with film were decreased than without within both algorithms. The %Diffs for both algorithms were reduced with increasing field size and increased relative to the depth increment. RMSEs of CAD for AXB-w were within 10.32% for both inner-profile and penumbra, while the corresponding values of AAA-w appeared to 96.50%. Conclusion: This study demonstrated that the dose calculation with AXB within air cavity shows more accurate than with AAA compared to the measured dose. Furthermore, we found that the AXB-w was superior to AXB-w/o in this region when compared against the measurements
Semi-dwarf mutants in triticale and wheat breeding
International Nuclear Information System (INIS)
Driscoll, C.J.
1984-01-01
The triticale lines Beagle and DR-IRA have been subjected to ionizing irradiation and chemical mutagenesis in order to produce semi-dwarf mutants. Beagle is 100 cm tall and DR-IRA 80 cm under average field conditions. A bulk then pedigree method is currently represented by 158 single plots of M 6 (or in some cases M 7 ) mutants that are from 5 to 35 cm shorter than the control variety. The shortest mutants are 65 cm in height. Forty of these mutants are also earlier flowering than the control varieties. Replicated yield testing will be conducted on confirmed mutants in 1983. Response to gibberellic acid of these mutants will also be determined. The Cornerstone male-sterility mutant (ms1c) on chromosome arm 4Aα has been combined with the GA-insensitive/reduced height gene Gai/Rht1 which is also on chromosome arm 4Aα. The ms1c mutant has also been combined with Gai/Rht2 on chromosome 4D and with both Gai/Rht1 and Gai/Rht2. The combination ms1c and Gai/Rht1 has been chosen as the basis of a composite cross. Thirteen varieties were tested with GA 3 and seven (Warigal, Aroona, Oxley, Banks, Avocet, Matipo and Toquifen) which contain Gai/Rht1 were crossed with ms1c Gai/Rht1 and entered into an interpollinating F 2 . The entire composite is homozygous for this semi-dwarf allele and selection will be practiced for increased height on a GA-insensitive background. (author)
HTTP as a Data Access Protocol: Trials with XrootD in CMS’s AAA Project
Balcas, J.; Bockelman, B. P.; Kcira, D.; Newman, H.; Vlimant, J.; Hendricks, T. W.; CMS Collaboration
2017-10-01
The main goal of the project to demonstrate the ability of using HTTP data federations in a manner analogous to the existing AAA infrastructure of the CMS experiment. An initial testbed at Caltech has been built and changes in the CMS software (CMSSW) are being implemented in order to improve HTTP support. The testbed consists of a set of machines at the Caltech Tier2 that improve the support infrastructure for data federations at CMS. As a first step, we are building systems that produce and ingest network data transfers up to 80 Gbps. In collaboration with AAA, HTTP support is enabled at the US redirector and the Caltech testbed. A plugin for CMSSW is being developed for HTTP access based on the DaviX software. It will replace the present fork/exec or curl for HTTP access. In addition, extensions to the XRootD HTTP implementation are being developed to add functionality to it, such as client-based monitoring identifiers. In the future, patches will be developed to better integrate HTTP-over-XRootD with the Open Science Grid (OSG) distribution. First results of the transfer tests using HTTP are presented in this paper together with details about the initial setup.
Wang, Zhen; Niu, Jianrui; Wang, Shuangshan
2013-01-01
To explore the effects of the genetic background on the characteristics of wboA gene deletion rough mutants generated from different parent Brucella sp. strains, we constructed the rough-mutant strains Brucella melitensis 16 M-MB6, B. abortus 2308-SB6, B. abortus S19-RB6, and B. melitensis NI-NB6 and evaluated their survival, pathogenicity, and induced protective immunity in mice and sheep. In mice, the survival times of the four mutants were very different in the virulence assay, from less than 6 weeks for B. abortus S19-RB6 to 11 weeks for B. abortus 2308-SB6 and B. melitensis NI-NB6. However, B. abortus S19-RB6 and B. melitensis 16 M-MB6, with a shorter survival time in mice, offered better protection against challenges with B. abortus 2308 in protection tests than B. abortus 2308-SB6 and B. melitensis NI-NB6. It seems that the induced protective immunity of each mutant might not be associated with its survival time in vivo. In the cross-protection assay, both B. melitensis 16 M-MB6 and B. abortus S19-RB6 induced greater protection against homologous challenges than heterologous challenges. When pregnant sheep were inoculated with B. abortus S19-RB6 and B. melitensis 16 M-MB6, B. abortus S19-RB6 did not induce abortion, whereas B. melitensis 16 M-MB6 did. These results demonstrated the differences in virulence, pathogenicity, and protective immunity in vivo in the wboA deletion mutants from genetically different parent Brucella spp. and also indicated that future rough vaccine strain development could be promising if suitable parent Brucella strains and/or genes were selected. PMID:23239800
Benefit, risks and cost-effectiveness of screening for abdominal aortic aneurysm
International Nuclear Information System (INIS)
Schmidt, T.; Muehlberger, N.; Siebert, U.; Chemelli-Steingruber, I.E.; Chemelli, Andreas; Strasak, A.; Kofler, B.
2010-01-01
Purpose: abdominal aortic aneurysms (AAA) cause a considerable number of deaths. A ruptured AAA is associated with a mortality rate of 80%. The purpose of this study was to summarize the current evidence from published health economic models for the long-term effectiveness and cost-effectiveness of screening programs for AAA. Materials and methods: medical, economic and health technology assessment (HTA) databases were systematically searched for cost-effectiveness models up to October 2007. Only models with a lifetime time horizon of evaluating AAA screening in men over 65 years were included in the review. Study data were extracted, standardized and summarized in evidence tables and cost-effectiveness plots. Results: we reviewed 8 cost-effectiveness models published between 1993 and 2007 comparing AAA screening and lack of screening in men over 60. One model yielded a loss of life-years at additional costs. The remaining seven models yielded gains in life expectancy ranging from 0.02 to 0.28LYs. Gains in quality-adjusted life expectancy reported by six of the seven models ranged from 0.015 to 0.059 QALYs. Incremental costs ranged from 96 to 721 Euros. Incremental cost-effectiveness ratios (ICER) ranged from 1443 to 13299 Euros per LY or QALY gained. Conclusion: based on our analysis, the introduction of a screening program to identify AAA will probably gain additional life years and quality of life at acceptable extra costs. The target population for a screening program should be men 65 years and older. (orig.)
Therapeutic Targeting of Spliceosomal-Mutant Acquired Bone Marrow Failure Disorders
2017-05-01
spliceosomal mutant cells . This effort has also highlighted a requirement for innate immune signaling in SF3B1-mutant MDS and has implicated a few specific...relative to single-mutant cells (Figure 5A). As innate immune signaling has been implicated in MDS pathogenesis (Basiorka et al., 2016; Fang et al...Sato et al., 2005; Tang et al., 2008; Vink et al., 2013; Xin et al., 2017). Here, we observed that SF3B1K700E/+ human lymphoid leukemia cells (NALM-6
Directory of Open Access Journals (Sweden)
E.Yu. Garnik
2015-12-01
Full Text Available The developmental stages and adaptability to different light intensity (150 µmol*m-2*s-1 and 100 µmol*m-2*s-1 in Arabidopsis mutant lines with defects of photosynthetic apparatus were analyzed. Plant development in the mutant lines depended on the light intensity to varying degrees. Lines ch1-1 (lack of the chlorophyllide a oxygenase and rtn16 (decreased chlorophyll a and b amounts were the most susceptible to the light decrease. No one of the investigated lines demonstrated chlorophyll a/b rate alteration under the different light conditions. The depleted chlorophyll content has had the major effect on the mutant plants development under the different light conditions. The different chlorophyll a/b rate correlated with the different adaptability of mutant plants to low light.
Directory of Open Access Journals (Sweden)
Zeng YX
2016-04-01
Full Text Available Yixuan Zeng,1,2,* Wenyuan Guo,1,* Guangqing Xu,3 Qinmei Wang,4 Luyang Feng,1,2 Simei Long,1 Fengyin Liang,1 Yi Huang,1 Xilin Lu,1 Shichang Li,5 Jiebin Zhou,5 Jean-Marc Burgunder,6 Jiyan Pang,5 Zhong Pei1,2 1Department of Neurology, National Key Clinical Department and Key Discipline of Neurology, Guangdong Key Laboratory for Diagnosis and Treatment of Major Neurological Disease, The First Affiliated Hospital, Sun Yat-sen University, 2Guangzhou Center, Chinese Huntington’s Disease Network, 3Department of Rehabilitation, The First Affiliated Hospital, 4Key laboratory on Assisted Circulation, Ministry of Health, Department of Cardiovascular Medicine of the First Affiliated Hospital, 5School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, Guangdong, People’s Republic of China; 6Swiss Huntington’s Disease Center, Department of Neurology, University of Bern, Bern, Switzerland *These authors contributed equally to this work Abstract: Huntington’s disease is an autosomal-dominant neurodegenerative disorder, with chorea as the most prominent manifestation. The disease is caused by abnormal expansion of CAG codon repeats in the IT15 gene, which leads to the expression of a glutamine-rich protein named mutant Huntingtin (Htt. Because of its devastating disease burden and lack of valid treatment, development of more effective therapeutics for Huntington’s disease is urgently required. Xyloketal B, a natural product from mangrove fungus, has shown protective effects against toxicity in other neurodegenerative disease models such as Parkinson’s and Alzheimer’s diseases. To identify potential neuroprotective molecules for Huntington’s disease, six derivatives of xyloketal B were screened in a Caenorhabditis elegans Huntington’s disease model; all six compounds showed a protective effect. Molecular docking studies indicated that compound 1 could bind to residues GLN369 and GLN393 of the mutant Htt protein, forming a
Role of conserved cysteine residues in Herbaspirillum seropedicae NifA activity.
Oliveira, Marco A S; Baura, Valter A; Aquino, Bruno; Huergo, Luciano F; Kadowaki, Marco A S; Chubatsu, Leda S; Souza, Emanuel M; Dixon, Ray; Pedrosa, Fábio O; Wassem, Roseli; Monteiro, Rose A
2009-01-01
Herbaspirillum seropedicae is an endophytic diazotrophic bacterium that associates with economically important crops. NifA protein, the transcriptional activator of nif genes in H. seropedicae, binds to nif promoters and, together with RNA polymerase-sigma(54) holoenzyme, catalyzes the formation of open complexes to allow transcription initiation. The activity of H. seropedicae NifA is controlled by ammonium and oxygen levels, but the mechanisms of such control are unknown. Oxygen sensitivity is attributed to a conserved motif of cysteine residues in NifA that spans the central AAA+ domain and the interdomain linker that connects the AAA+ domain to the C-terminal DNA binding domain. Here we mutagenized this conserved motif of cysteines and assayed the activity of mutant proteins in vivo. We also purified the mutant variants of NifA and tested their capacity to bind to the nifB promoter region. Chimeric proteins between H. seropedicae NifA, an oxygen-sensitive protein, and Azotobacter vinelandii NifA, an oxygen-tolerant protein, were constructed and showed that the oxygen response is conferred by the central AAA+ and C-terminal DNA binding domains of H. seropedicae NifA. We conclude that the conserved cysteine motif is essential for NifA activity, although single cysteine-to-serine mutants are still competent at binding DNA.
Collection of rice mutants and application studies of their agronomic characters
International Nuclear Information System (INIS)
Sun Shuxiang; Jin Wei; Luo Qian; Sheng Ping; Huang Rongmin
1993-01-01
More than 1600 accessions of rice mutant germplasm have been collected since 1980, and 1142 accessions of mutants have been identified according to their agronomy and pattern characters. A part of mutants were compared with their original cultivars in eight main agronomic characters. The results showed that the agronomic characters of mutants induced by ionizing radiations changed to both positive and negative directions compared with their original cultivars. Only 6.3% mutants varied in single agronomic character, and 91.1% mutants varied in two to six agronomic characters. Tenetic analysis and Cellular observations were carried out for two kinds of early mutants. It showed that early mutants 'Yuan Feng Zao' are controlled by two independent and incomplete dominant genes. For the dwarf, the reduction of the number of longitudinal cell layers causes the stem shorter and the increase of the number of horizontal cell layers causes the stem wall thicker. More than 100 preserved accessions of mutants were supplied to breeding units as parents or for genetic studies. Sixteen cultivars (lines) were bred from the parents which played an important role in raising the output of rice production
Rollins, K E; Shak, J; Ambler, G K; Tang, T Y; Hayes, P D; Boyle, J R
2014-02-01
Emergency endovascular repair (EVAR) for ruptured abdominal aortic aneurysm (rAAA) may have lower operative mortality rates than open surgical repair. Concerns remain that the early survival benefit after EVAR for rAAA may be offset by late reinterventions. The aim of this study was to compare reintervention rates and cost-effectiveness of EVAR and open repair for rAAA. A retrospective analysis was undertaken of patients with rAAA undergoing EVAR or open repair over 6 years. A health economic model developed for the cost-effectiveness of elective EVAR was used in the emergency setting. Sixty-two patients (mean age 77·9 years) underwent EVAR and 85 (mean age 75·9 years) had open repair of rAAA. Median follow-up was 42 and 39 months respectively. There was no significant difference in 30-day mortality rates after EVAR and open repair (18 and 26 per cent respectively; P = 0·243). Reintervention rates were also similar (32 and 31 per cent; P = 0·701). The mean cost per patient was €26,725 for EVAR and €30,297 for open repair, and the cost per life-year gained was €7906 and €9933 respectively (P = 0·561). Open repair had greater initial costs: longer procedural times (217 versus 178·5 min; P < 0·001) and intensive care stay (5·0 versus 1·0 days; P = 0·015). Conversely, EVAR had greater reintervention (€156,939 versus €35,335; P = 0·001) and surveillance (P < 0·001) costs. There was no significant difference in reintervention rates after EVAR or open repair for rAAA. EVAR was as cost-effective at mid-term follow-up. The increased procedural costs of open repair are not outweighed by greater surveillance and reintervention costs after EVAR. © 2014 BJS Society Ltd. Published by John Wiley & Sons Ltd.
Effects of mutants in bHLH region on structure stability and protein-DNA binding energy in DECs.
Kong, Yi; Wang, Zhen; Jia, Yanfei; Li, Ping; Hao, Shuhua; Wang, Yunshan
2017-07-01
The human DEC subfamily contains two highly conserved members belonging to basic helix-loop-helix (bHLH) transcription factors. This conserved family is spread widely among various species with the function of regulating various crucial molecular signaling pathways. Due to the significance of DECs for important biological processes, their relationship with diseases and the lack of experimentally proven structures, we have implemented a comparative modeling for the bHLH region of DECs as homodimers with themselves and heterodimers with HES-1. Three mutants with predicted roles in reducing intramolecular binding (H57A, R65A, and LL7879AA in DEC1 and LL7071AA in DEC2) were investigated on DEC monomers. Molecular dynamics (MD) simulations were also employed to evaluate the behavior of the mutant molecules in aqueous solution. The monomer was divided into subregions for accurate investigation. The fluctuation in the basic region of mutants was higher than that of wild-type molecules. The binding energy value between protein and DNA obviously increased in the homodimer harboring R65A mutants, which led to more unstable status between protein and DNA. Thus, the mutant R65A interfered DNA-binding affinity. A study on the spatial structures of wild-type and mutant DECs may facilitate functional prediction for mutation effects and dynamic behavior under various conditions and may ultimately help in targeted drug design.
International Nuclear Information System (INIS)
Nakano, Sachiko; Okauchi, Kenzo; Tsushima, Yoshito
2014-01-01
A 62-year-old male presented with sudden onset of low back and right leg pain. Contrast-enhanced computed tomography demonstrated an abdominal aortic aneurysm (AAA), along with a large mass lesion causing vertebral body erosion. Magnetic resonance imaging (MRI) suggested that the mass lesion consisted of a chronic hematoma. Fluorine-18-fluorodeoxyglucose positron emission tomography (FDG-PET) demonstrated increased uptake around the mass lesion, but not around the AAA. Surgical intervention was performed, and the subsequent histological diagnosis was chronic contained rupture of AAA. The mass lesion consisted of chronic hematoma and necrosis with inflammatory cell infiltration and hemosiderin deposition. This condition mimics some neoplastic diseases, but MRI and FDG-PET findings may help establish the correct diagnosis. (author)
Induced mutants of Streptococcus lactis by gamma irradiation and its effect on milk acidity
International Nuclear Information System (INIS)
Daowd, A.H.; Sabbour, M.M.; Newigy, N.A.; Wahab, G.A.M.
1988-01-01
Streptococus lactis was exposed to different doses of gamma-irradiation (10, 50, 100 and 150 Kr). The results of acidity production in sterilized milk inoculated by isolates from radiation treatments and control could be summarized in the following: 1. The mean acidity produced by S. lactis isolates after irradiation at 10 Kr increased to be 0.66% than that of control isolates (0.62%). The acidity produced by the isolates of the 50 Kr treatment showed more increment to reach the peak (0.7%). Thereafter, acidity production decreased by isolates of the 100 Kr (0.53%) and 150 Kr (0.51%) treatments. Heme, the 50 Kr treatment could be considered activation dose to S. lactis starter for acid production. 2. Two mutants were selected. Acidity production by mutant I (from 10 Kr treatment) was 0.95%, and that of mutant II (from 50 Kr treatment) was 1.0%, while acid production by the parent S. lactis culture was 0.62%. Concerning the stability of the isolates, it was found that acid production by mutant I and mutant II slightly decreased by time. The mutants were re-irradiated after 37 and 60 days at doses 10, 25 and 50 Kr. Acid production in milk by isolates of the radiation treatments was determined. The following results were obtained: -The re-irradiation of the mutants decreased the ability of the isolates for acid production than that of parent mutants. -The re-irradiation of the mutants after 60 days yielded isolates which showed more reduction in acid produced than of isolates obtained from re-irridation of the mutants after 37-days. -The higher the dose of the re-irradiation of the mutants, the lower the mean of acid production by isolates of the treatment
Male sterile mutant in Vigna radiata
International Nuclear Information System (INIS)
Pande, Kalpana; Raghuvanshi, S.S.
1987-01-01
Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)
Directory of Open Access Journals (Sweden)
Leonardo J Moreno-Bermúdez
2015-10-01
Full Text Available Bananas and bananas are grown in the tropical and subtropical regions of the world, by hence they are adapted to good humidity conditions. The productivity of these crops is affected by abiotic factors such as drought, which has increased in recent years due to the effects of climate change. In vitro selection of tolerant genotypes offers advantages over field selection as it saves time, resources and permit to work with larger plant volumes. The aim of this work was to determine the effect of in vitro water stress induced with polyethylene glycol 6000 (PEG 6000 on water content (WC of Musa spp. ‘Grande naine’ (AAA and ‘Pelipita’ (ABB cultivars. In ‘Pelipita’ cultivar WC was not affected by PEG 6000 effect, but in ‘Grande naine’ this trait was significantly reduced in those plants under stress. Both, ‘Pelipita’ and ‘Grande naine’ cultivars differentially respond to water stress induced in vitro by PEG 6000 and could be used as reference in plants evaluation obtained by plant breeding for drought tolerance. Key words: banana, climate change, drought, in vitro selection
Directory of Open Access Journals (Sweden)
Jenna VanLiere Canzoniero
2017-07-01
Full Text Available Barcoding techniques are used to reduce error from next-generation sequencing, with applications ranging from understanding tumor subclone populations to detecting circulating tumor DNA. Collisions occur when more than one sample molecule is tagged by the same unique identifier (UID and can result in failure to detect very-low-frequency mutations and error in estimating mutation frequency. Here, we created computer models of barcoding technique, with and without amplification bias introduced by the UID, and analyzed the effect of collisions for a range of mutant allele frequencies (1e−6 to 0.2, number of sample molecules (10 000 to 1e7, and number of UIDs (4 10 -4 14 . Inability to detect rare mutant alleles occurred in 0% to 100% of simulations, depending on collisions and number of mutant molecules. Collisions also introduced error in estimating mutant allele frequency resulting in underestimation of minor allele frequency. Incorporating an understanding of the effect of collisions into experimental design can allow for optimization of the number of sample molecules and number of UIDs to minimize the negative impact on rare mutant detection and mutant frequency estimation.
Energy Technology Data Exchange (ETDEWEB)
Salmeron E, J.; Mastache L, A. A.; Diaz V, G. E.; Valencia E, F.; Ranfla C, R.; Melendez P, M. [Colegio Superior Agropecuario del Estado de Guerrero, Vicente Guerrero No. 81, Col. Centro, 40000 Iguala, Guerrero (Mexico); Cervantes S, T. [Instituto de Recursos Geneticos y Productividad, Colegio de Postgraduados, Carretera Mexico-Texcoco Km. 36.5, Montecillo, 56230 Texcoco, Estado de Mexico (Mexico); De la Cruz T, E.; Garcia A, J. M.; Falcon B, T., E-mail: csaegro@prodigy.net.m [ININ, Departamento de Biologia, Carretera Mexico-Toluca s/n, Ocoyoacac 52750, Estado de Mexico (Mexico)
2009-07-01
The present work has the objective of to evaluate the yield and the agronomic behavior of 2 mutant lines of soybean for human consumption, obtained by means of a process of recurrent irradiation of soybean seed ISAAEG-BM{sub 2} with gammas of Co{sup 60} and selection in the generation R{sub 4}M{sub 18}. For the variable yield significant statistical differences were not observed, but considering the rest of the evaluated agronomic characteristics the mutant lines L{sub 6} and Bombona they were excellent with values of 3,934.6 and 3,806.8 Kg ha-{sup 1} to 15% of grain humidity, they also possess excellent genetic characteristics result of the irradiations and selections of these new genetic materials. (Author)
An epistatic effect of KRT25 on SP6 is involved in curly coat in horses.
Thomer, Annika; Gottschalk, Maren; Christmann, Anna; Naccache, Fanny; Jung, Klaus; Hewicker-Trautwein, Marion; Distl, Ottmar; Metzger, Julia
2018-04-23
Curly coat represents an extraordinary type of coat in horses, particularly seen in American Bashkir Curly Horses and Missouri Foxtrotters. In some horses with curly coat, a hypotrichosis of variable extent was observed, making the phenotype appear more complex. In our study, we aimed at investigating the genetic background of curly coat with and without hypotrichosis using high density bead chip genotype and next generation sequencing data. Genome-wide association analysis detected significant signals (p = 1.412 × 10 -05 -1.102 × 10 -08 ) on horse chromosome 11 at 22-35 Mb. In this significantly associated region, six missense variants were filtered out from whole-genome sequencing data of three curly coated horses of which two variants within KRT25 and SP6 could explain all hair phenotypes. Horses heterozygous or homozygous only for KRT25 variant showed curly coat and hypotrichosis, whereas horses with SP6 variant only, exhibited curly coat without hypotrichosis. Horses with mutant alleles in both variants developed curly hair and hypotrichosis. Thus, mutant KRT25 allele is masking SP6 allele effect, indicative for epistasis of KRT25 variant over SP6 variant. In summary, genetic variants in two different genes, KRT25 and SP6, are responsible for curly hair. All horses with KRT25 variant are additionally hypotrichotic due to the KRT25 epistatic effect on SP6.
Yamashita, Arisa; Hiraki, Yuri; Yamazaki, Tetsuo
2017-06-10
αB-crystallin (αBC) is a small heat shock protein. Mutations in the αBC gene are linked to α-crystallinopathy, a hereditary myopathy histologically characterized by intracellular accumulation of protein aggregates. The disease-causing R120G αBC mutant, harboring an arginine-to-glycine replacement at position 120, is an aggregate-prone protein. We previously showed that the R120G mutant's aggregation in HeLa cells was prevented by enforced expression of αBC on the endoplasmic reticulum (ER). To elucidate the molecular nature of the preventive effect on the R120G mutant, we isolated proteins binding to ER-anchored αBC (TMαBC). The ER transmembrane CLN6 protein was identified as a TMαBC's binder. CLN6 knockdown in HeLa cells attenuated TMαBC's anti-aggregate activity against the R120G mutant. Conversely, CLN6 overexpression enhanced the activity, indicating that CLN6 operates as a downstream effector of TMαBC. CLN6 physically interacted with the R120G mutant, and repressed its aggregation in HeLa cells even when TMαBC was not co-expressed. Furthermore, CLN6's antagonizing effect on the R120G mutant was compromised upon treatment with a lysosomal inhibitor, suggesting CLN6 requires the intact autophagy-lysosome system to prevent the R120G mutant from aggregating. We hence conclude that CLN6 is not only a molecular entity of the anti-aggregate activity conferred by the ER manipulation using TMαBC, but also serves as a potential target of therapeutic interventions. Copyright © 2017 Elsevier Inc. All rights reserved.
Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.
Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y
2016-10-07
CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.
Temperature-sensitive host range mutants of herpes simplex virus type 2
International Nuclear Information System (INIS)
Koment, R.W.; Rapp, F.
1975-01-01
Herpesviruses are capable of several types of infection of a host cell. To investigate the early events which ultimately determine the nature of the virus-host cell interaction, a system was established utilizing temperature-sensitive mutants of herpes simplex virus type 2. Four mutants have been isolated which fail to induce cytopathic effects and do not replicate at 39 C in hamster embryo fibroblast cells. At least one mutant is virus DNA negative. Since intracellular complementation is detectable between pairs of mutants, a virus function is known to be temperature sensitive. However, all four mutants induce cytopathic effects and replicate to parental virus levels in rabbit kidney cells at 39 C. This suggests that a host cell function, lacking or nonfunctional in HEF cells but present in rabbit kidney cells at 39 C, is required for the replication of these mutants in hamster embryo fibroblast cells at 39 C. Therefore, we conclude that these mutants are both temperature sensitive and exhibit host range properties
The AAA-ATPase NVL2 is a telomerase component essential for holoenzyme assembly
Energy Technology Data Exchange (ETDEWEB)
Her, Joonyoung [Departments of Biology and Integrated Omics for Biomedical Science, Yonsei University, Seoul 120-749 (Korea, Republic of); Chung, In Kwon, E-mail: topoviro@yonsei.ac.kr [Departments of Biology and Integrated Omics for Biomedical Science, Yonsei University, Seoul 120-749 (Korea, Republic of)
2012-01-20
Highlights: Black-Right-Pointing-Pointer Identification of the AAA-ATPase NVL2 as a novel hTERT-interacting protein. Black-Right-Pointing-Pointer NVL2 associates with catalytically active telomerase via an interaction with hTERT. Black-Right-Pointing-Pointer NVL2 is a telomerase component essential for holoenzyme assembly. Black-Right-Pointing-Pointer ATP-binding activity of NVL2 is required for hTERT binding and telomerase assembly. -- Abstract: Continued cell proliferation requires telomerase to maintain functional telomeres that are essential for chromosome integrity. Although the core enzyme includes a telomerase reverse transcriptase (TERT) and a telomerase RNA component (TERC), a number of auxiliary proteins have been identified to regulate telomerase assembly, localization, and enzymatic activity. Here we describe the characterization of the AAA-ATPase NVL2 as a novel hTERT-interacting protein. NVL2 interacts and co-localizes with hTERT in the nucleolus. NLV2 is also found in association with catalytically competent telomerase in cell lysates through an interaction with hTERT. Depletion of endogenous NVL2 by small interfering RNA led to a decrease in hTERT without affecting the steady-state levels of hTERT mRNA, thereby reducing telomerase activity, suggesting that NVL2 is an essential component of the telomerase holoenzyme. We also found that ATP-binding activity of NVL2 is required for hTERT binding as well as telomerase assembly. Our findings suggest that NVL2, in addition to its role in ribosome biosynthesis, is essential for telomerase biogenesis and provides an alternative approach for inhibiting telomerase activity in cancer.
International Nuclear Information System (INIS)
Parkin, D.W.; Mentch, F.; Banks, G.A.; Horenstein, B.A.; Schramm, V.L.
1991-01-01
The transition state of the V max mutant of AMP nucleosidase from Azotobacter vinelandii has been characterized by heavy-atom kinetic isotope effects in the presence and absence of MgATP, the allosteric activator. The enzyme catalyzes hydrolysis of the N-glycosidic bond of AMP at approximately 2% of the rate of the normal enzyme with only minor changes in the K m for substrate, the activation constant for MgATP, and the K i for formycin 5'-phosphate, a tight-binding competitive inhibitor. Isotope effects were measured as a function of the allosteric activator concentration that increases the turnover number of the enzyme from 0.006 s -1 . The kinetic isotope effects were measured with the substrates [1'- 3 H]AMP, [2'- 2 H]AMP, [9- 15 N]AMP, and [1',9- 14 C, 15 N]AMP. All substrates gave significant kinetic isotope effects in a pattern that establishes that the reaction expresses intrinsic kinetic isotope effects in the presence or absence of MgATP. Transition-state analysis using bond-energy and bond-order vibrational analysis indicated that the transition state for the mutant enzyme has a similar position in the reaction coordinate compared to that for the normal enzyme. The mutant enzyme is less effective in stabilizing the carbocation-like intermediate and in the ability to protonate N7 of adenine to create a better leaving group. This altered transition-state structure was confirmed by an altered substrate specificity for the mutant protein
Energy Technology Data Exchange (ETDEWEB)
Brown, R; Stretch, A; Thacker, J
1986-04-01
A large series of independent mutants deficient in HPRT enzyme activity, isolated from V79-4 hamster cells, were assessed for properties which reflect the nature of the genetic changes induced. A total of 88 mutants were screened, 43 isolated from ..gamma..-ray-treated cultures and 45 induced by ethyl methanesulphonate (EMS). Firstly, each mutant was assayed for the presence of protein with the antigenic response of HPRT. In a competitive inhibition assay, 31% of EMS-induced mutants were CRM-positive compared to 7% of the ..gamma..-ray series. Secondly, each mutant was tested for ability to revert to HPRT proficiency. All except 2 of the EMS-induced mutants reverted with ethyl nitrosourea ENU, and many reverted spontaneously, under the given conditions. However reversion was not detected in about 80% of ..gamma..-ray-induced mutants, suggesting that the types of forward mutation caused by ionizing radiation differ qualitatively from those caused by EMS. (Auth.). 30 refs.; 6 figs.; 2 tabs.
Hepatitis B surface gene 145 mutant as a minor population in hepatitis B virus carriers
Directory of Open Access Journals (Sweden)
Komatsu Haruki
2012-01-01
Full Text Available Abstract Background Hepatitis B virus (HBV can have mutations that include the a determinant, which causes breakthrough infection. In particular, a single mutation at amino acid 145 of the surface protein (G145 is frequently reported in the failure of prophylactic treatment. The aim of this study was to evaluate the frequency of the a determinant mutants, especially the G145 variant, in Japan, where universal vaccination has not been adopted. Methods The present study was a retrospective study. The study cohorts were defined as follows: group 1, children with failure to prevent mother-to-child transmission despite immunoprophylaxis (n = 18, male/female = 8/10, age 1-14 years; median 6 years; group 2, HBV carriers who had not received vaccination or hepatitis B immunoglobulin (n = 107, male/female = 107, age 1-52 years; median 16 years. To detect the G145R and G145A mutants in patients, we designed 3 probes for real-time PCR. We also performed direct sequencing and cloning of PCR products. Results By mutant-specific real-time PCR, one subject (5.6% was positive for the G145R mutant in group 1, while the G145 mutant was undetectable in group 2. The a determinant mutants were detected in one (5.6% of the group 1 subjects and 10 (9.3% of the group 2 subjects using direct sequencing, but direct sequencing did not reveal the G145 mutant as a predominant strain in the two groups. However, the subject who was positive according to the mutant-specific real-time PCR in group 1 had overlapped peaks at nt 587 in the electropherogram. In group 2, 11 patients had overlapped peaks at nt 587 in the electropherogram. Cloning of PCR products allowed detection of the G145R mutant as a minor strain in 7 (group 1: 1 subject, group 2: 6 subjects of 12 subjects who had overlapped peaks at nt 587 in the electropherogram. Conclusions The frequency of the a determinant mutants was not high in Japan. However, the G145R mutant was often present as a minor population in
Masking responses to light in period mutant mice.
Pendergast, Julie S; Yamazaki, Shin
2011-10-01
Masking is an acute effect of an external signal on an overt rhythm and is distinct from the process of entrainment. In the current study, we investigated the phase dependence and molecular mechanisms regulating masking effects of light pulses on spontaneous locomotor activity in mice. The circadian genes, Period1 (Per1) and Per2, are necessary components of the timekeeping machinery and entrainment by light appears to involve the induction of the expression of Per1 and Per2 mRNAs in the suprachiasmatic nuclei (SCN). We assessed the roles of the Per genes in regulating masking by assessing the effects of light pulses on nocturnal locomotor activity in C57BL/6J Per mutant mice. We found that Per1(-/-) and Per2(-/-) mice had robust negative masking responses to light. In addition, the locomotor activity of Per1(-/-)/Per2(-/-) mice appeared to be rhythmic in the light-dark (LD) cycle, and the phase of activity onset was advanced (but varied among individual mice) relative to lights off. This rhythm persisted for 1 to 2 days in constant darkness in some Per1(-/-)/Per2(-/-) mice. Furthermore, Per1(-/-)/Per2(-/-) mice exhibited robust negative masking responses to light. Negative masking was phase dependent in wild-type mice such that maximal suppression was induced by light pulses at zeitgeber time 14 (ZT14) and gradually weaker suppression occurred during light pulses at ZT16 and ZT18. By measuring the phase shifts induced by the masking protocol (light pulses were administered to mice maintained in the LD cycle), we found that the phase responsiveness of Per mutant mice was altered compared to wild-types. Together, our data suggest that negative masking responses to light are robust in Per mutant mice and that the Per1(-/-)/Per2(-/-) SCN may be a light-driven, weak/damping oscillator.
Semi-dwarf mutant lines of hexaploid triticale
International Nuclear Information System (INIS)
Pidra, M.
1989-01-01
A spring form of hexaploid secondary triticale ADD 143/71, bred by MOGILEVA at the Plant Breeding Station at Uhretice was used for the mutagen treatment. The mutation experiment started in 1979. Seeds were treated with a 0.8 mM water solution of N-methyl-N-nitrosourea (MNH) (CETL and RELICHOVA, unpublished). From 180 M 1 plants, one spike was harvested per plant. A random sample of these seeds was sown as M 2 in 1980 and several plants with shorter main culm were selected. Selfed progenies of eight mutant plants designated ADD 143-m1, ADD 143-m2, ADD 143-m3 etc. were further tested in M 3 and M 4 . There were significant differences in culm length and in some other characters between the original line and the mutant lines. Especially the line m8 looks like a promising source of semi-dwarfness for breeding programmes of hexaploid triticale. During 1985-1987 genetic analysis was performed on the ADD 143/71 and the mutant lines m2, m6, m7 and m8, which suggest that their mutant genes are allelic and recessive
Tajima, Satoshi; Itoh, Yoko; Sugimoto, Takashi; Kato, Tatsuya; Park, Enoch Y
2009-10-01
The production of riboflavin from vegetable oil was increased using a mutant strain of Ashbya gossypii. This mutant was generated by treating the wild-type strain with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). Riboflavin production was 10-fold higher in the mutant compared to the wild-type strain. The specific intracellular catalase activity after 3 d of culture was 6-fold higher in the mutant than in the wild-type strain. For the mutant, riboflavin production in the presence of 40 mM hydrogen peroxide was 16% less than that in the absence of hydrogen peroxide, whereas it was 56% less for the wild-type strain. The isocitrate lyase (ICL) activity of the mutant was 0.26 mU/mg of protein during the active riboflavin production phase, which was 2.6-fold higher than the wild-type strain. These data indicate that the mutant utilizes the carbon flux from the TCA cycle to the glyoxylate cycle more efficiently than the wild-type strain, resulting in enhanced riboflavin production. This novel mutant has the potential to be of use for industrial-scale riboflavin production from waste-activated bleaching earth (ABE), thereby transforming a useless material into a valuable bioproduct.
Vitamins and abdominal aortic aneurysm.
Takagi, Hisato; Umemoto, Takuya
2017-02-01
To summarize the association of vitamins (B6, B12, C, D, and E) and abdominal aortic aneurysm (AAA), we reviewed clinical studies with a comprehensive literature research and meta-analytic estimates. To identify all clinical studies evaluating the association of vitamins B6/B12/C/D/E and AAA, databases including MEDLINE, EMBASE, and the Cochrane Central Register of Controlled Trials were searched through April 2015, using Web-based search engines (PubMed and OVID). For each case-control study, data regarding vitamin levels in both the AAA and control groups were used to generate standardized mean differences (SMDs) and 95% confidence intervals (CIs). Pooled analyses of the 4 case-control studies demonstrated significantly lower circulating vitamin B6 levels (SMD, -0.33; 95% CI, -0.55 to -0.11; P=0.003) but non-significantly lower vitamin B12 levels (SMD, -0.42; 95% CI, -1.09 to 0.25; P=0.22) in patients with AAA than subjects without AAA. Pooled analyses of the 2 case-control studies demonstrated significantly lower levels of circulating vitamins C (SMD, -0.71; 95% CI, -1.23 to -0.19; P=0.007) and E (SMD, -1.76; 95% CI, -2.93 to 0.60; P=0.003) in patients with AAA than subjects without AAA. Another pooled analysis of the 3 case-control studies demonstrated significantly lower circulating vitamin D (25-hydroxyvitamin D) levels (SMD, -0.25; 95% CI, -0.50 to -0.01; P=0.04) in patients with AAA than subjects without AAA. In a double-blind controlled trial, 4.0-year treatment with a high-dose folic acid and vitamin B6/B12 multivitamin in kidney transplant recipients did not reduce a rate of AAA repair despite significant reduction in homocysteine level. In another randomized, double-blind, placebo-controlled trial, 5.8-year supplementation with α-tocopherol (vitamin E) had no preventive effect on large AAA among male smokers. In clinical setting, although low circulating vitamins B6/C/D/E (not B12) levels are associated with AAA presence, vitamins B6/B12/E
Zhang, ShouDong; Zhan, Xiangqiang; Xu, Xiaoming; Cui, Peng; Zhu, Jian-Kang; Xia, Yiji; Xiong, Liming
2015-01-01
HDA6 is a RPD3-like histone deacetylase. In Arabidopsis, it mediates transgene and some endogenous target transcriptional gene silencing (TGS) via histone deacetylation and DNA methylation. Here, we characterized two hda6 mutant alleles that were recovered as second-site suppressors of the DNA demethylation mutant ros1–1. Although both alleles derepressed 35S::NPTII and RD29A::LUC in the ros1–1 background, they had distinct effects on the expression of these two transgenes. In accordance to expression profiles of two transgenes, the alleles have distinct opposite methylation profiles on two reporter gene promoters. Furthermore, both alleles could interact in vitro and in vivo with the DNA methyltransferase1 with differential interactive strength and patterns. Although these alleles accumulated different levels of repressive/active histone marks, DNA methylation but not histone modifications in the two transgene promoters was found to correlate with the level of derepression of the reporter genes between the two had6 alleles. Our study reveals that mutations in different domains of HDA6 convey different epigenetic status that in turn controls the expression of the transgenes as well as some endogenous loci.
Zhang, ShouDong
2015-12-15
HDA6 is a RPD3-like histone deacetylase. In Arabidopsis, it mediates transgene and some endogenous target transcriptional gene silencing (TGS) via histone deacetylation and DNA methylation. Here, we characterized two hda6 mutant alleles that were recovered as second-site suppressors of the DNA demethylation mutant ros1–1. Although both alleles derepressed 35S::NPTII and RD29A::LUC in the ros1–1 background, they had distinct effects on the expression of these two transgenes. In accordance to expression profiles of two transgenes, the alleles have distinct opposite methylation profiles on two reporter gene promoters. Furthermore, both alleles could interact in vitro and in vivo with the DNA methyltransferase1 with differential interactive strength and patterns. Although these alleles accumulated different levels of repressive/active histone marks, DNA methylation but not histone modifications in the two transgene promoters was found to correlate with the level of derepression of the reporter genes between the two had6 alleles. Our study reveals that mutations in different domains of HDA6 convey different epigenetic status that in turn controls the expression of the transgenes as well as some endogenous loci.
Creation and evaluation of best cotton mutant lines
International Nuclear Information System (INIS)
Rastegari, S. J.; Hosseini, Z.
2001-01-01
During (1997-1999) a study was carried out to recognize the best mutant lines, which were already obtained from a mutation breeding project. A Triple Rectangular Latis Design (8 7) in form of randomized complete blocks (RCB) with fifty- six treatments and three replications, were used in Estahban, Kordkouy and Varamin, under different ecological conditions, rainfall (Kordkouy) desert (Varamin) hot and dry (Estahban). During growing season some important morphological characteristics were recorded. Some lines had specific characters, for example: line 3191 (Chirpan 150 gray) had a low leaf number per plant, line 3169 (Bakhtegan 200 gray) plants were clustered. The results of the data in Varamin station showed that Bakhtegan irradiated with 150 gray line 3485 and Tashkand with 300 gray line 3451 compared to check (Varamin with 4373 kg/ha) had highest yield with 4942 kg/ha, and 4871 kg/ha respectively. In view of boll weight line 3405 of Sahel irradiated with 200 gray had highest boll weight (6.5 g/boll). In Kordkouy station the best mutant line was Chirpan irradiated with 250 gray, line 3208, with 20% yield increase compared to Sahel and 30% yield increase compared to original Chirpan. In respect to irradiation effect on lint percentage and fiber quality, the results showed; there was a positive effect on lint percentage of all varieties, especially in Tashkant, Bakhtegan and Chirpan which are inherently weak in lint percentage. As a whole gamma radiation did not have any negative effect on fiber quality. Even in Estahban 1.6 to 2.4 mm fiber increase were observed in some Chirpan irradiated material (C150-3516) and (C200-3523)
Hrahsel, Lalremsiami; Basu, Adreeja; Sahoo, Lingaraj; Thangjam, Robert
2014-02-01
An efficient in vitro propagation method has been developed for the first time for Musa acuminata (AAA) cv. Vaibalhla, an economically important banana cultivar of Mizoram, India. Immature male flowers were used as explants. Murashige and Skoog's (MS) medium supplemented with plant growth regulators (PGRs) were used for the regeneration process. Out of different PGR combinations, MS medium supplemented with 2 mg L(-1) 6-benzylaminopurine (BAP) + 0.5 mg L(-1) α-naphthalene acetic acid (NAA) was optimal for production of white bud-like structures (WBLS). On this medium, explants produced the highest number of buds per explant (4.30). The highest percentage (77.77) and number (3.51) of shoot formation from each explants was observed in MS medium supplemented with 2 mg L(-1) kinetin + 0.5 mg L(-1) NAA. While MS medium supplemented with a combination of 2 mg L(-1) BAP + 0.5 mg L(-1) NAA showed the maximum shoot length (14.44 cm). Rooting efficiency of the shoots was highest in the MS basal medium without any PGRs. The plantlets were hardened successfully in the greenhouse with 96% survival rate. Random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers were employed to assess the genetic stability of in vitro regenerated plantlets of M. acuminata (AAA) cv. Vaibalhla. Eight RAPD and 8 ISSR primers were successfully used for the analysis from the 40 RAPD and 30 ISSR primers screened initially. The amplified products were monomorphic across all the regenerated plants and were similar to the mother plant. The present standardised protocol will find application in mass production, conservation and genetic transformation studies of this commercially important banana.
International Nuclear Information System (INIS)
Heude, M
1988-01-01
In order to discover whether the nuclear recombinational repair pathway also acts on lesions induced in mitochondrial DNA (mtDNA), the possible role of the RAD50, -51, -55 and -56 genes on the induction of rho - mutants by radiations was studied. Such induction appeared to be independent of this pathway. Nevertheless, an efficient induction of respiration-deficient mutants was observed in γ-irradiated rad52 diploids. We demonstrate that these mutants do not result from a lack of mtDNA repair, but from chromosome losses induced by γ-rays. Such an impairment of the respiratory ability of diploids by chromosome lossed was effectively observed in the aneuploid progeny of unirradiated RAD + cdc6 diploids incubated at the restrictive temperature. (author). 60 refs.; 3 figs.; 6 tabs
Identification of dominant male sterile mutants in rice (Oryza sativa L.)
International Nuclear Information System (INIS)
Zhu Xudong; Rutger, J.N.
2000-01-01
Genetic male sterile mutants 1783 and 1789 were selected from US variety Orion and Kaybonnet seeds treated by gamma irradiation. Investigation of fertility characterization of pollen and spikelets of these mutants were made by progeny tests in 1783 M 7 and 1789 M 6 generations. The results showed that genetic male sterile mutants 1783 and 1789 with the fertility segregating of 1 sterile: 1 fertile were controlled by a single dominant gene. The pollen staining of mutants characterized partial sterility. Open-pollinated seed set was about 30% and bagged seed set was only 0.3%-3.5%. It is concluded that dominant genetic male sterile is a useful tool in improvement of population for rice breeding
International Nuclear Information System (INIS)
Fingerhut, R.; Kiefer, J.; Otto, F.
1983-01-01
Radiosensitive mutants rad2, rad9, and rad51 of Saccharomyces cerevisiae were X-irradiated with 120 Gy or 60 Gy, heated at 50 0 C for 30 min or treated with a combination of both and incubated in nutrient medium at 30 0 C. Cell number, percentage of budding cells, and cell cycle progression were determined in 45-min intervals. Cell cycle kinetics were investigated by flow cytofluorometry. Hyperthermia leads mainly to a lengthening of G1, whereas X-rays arrest cells of the rad2 and rad9 mutant in G2 and the rad51 - mutant additionaly in a state with DNA contents above G2. Cell division dealy is influenced by oxygen in all strains but to a lesser extent in the rad2 mutant. The effect of the combined treatment appears to be merely additive in the rad2 and rad9 mutant while the rad51 mutant is sensitized to X-irradiation by hyperthermia. No selective action of hyperthermia on hypoxic cells was found. (orig.)
Genetic study on salt tolerance involving mutants of barley
International Nuclear Information System (INIS)
Patil, S.S.; Sharma, R.P.
1990-01-01
Full text: Cultivar 'R-16' was subjected to mutagenesis through gamma irradiation, EMS and their combination treatments. M 6 lines differing in salt tolerance were utilised along with untreated control to generate 8x3 diallel crosses. The magnitude of combining ability variances indicated a relatively prominent role of SCA variance (non additive). The values of GCA effects indicate high breeding value of the mutant M-3 for salt tolerance based on measuring shoot length and root length of 10 day old seedlings. (author)
Directory of Open Access Journals (Sweden)
Kai Hung Tiong
Full Text Available Human cytochrome P450 2A6 (CYP2A6 is a highly polymorphic isoform of CYP2A subfamily. Our previous kinetic study on four CYP2A6 allelic variants (CYP2A6 15, CYP2A6 16, CYP2A6 21 and CYP2A6 22 have unveiled the functional significance of sequence mutations in these variants on coumarin 7-hydroxylation activity. In the present study, we further explored the ability of a typical CYP2A6 inhibitor, 8-methoxypsoralen (8-MOP, in inhibition of these alleles and we hypothesized that translational mutations in these variants are likely to give impact on 8-MOP inhibitory potency. The CYP2A6 variant and the wild type proteins were subjected to 8-MOP inhibition to yield IC50 values. In general, a similar trend of change in the IC50 and Km values was noted among the four mutants towards coumarin oxidation. With the exception of CYP2A6 16, differences in IC50 values were highly significant which implied compromised interaction of the mutants with 8-MOP. Molecular models of CYP2A6 were subsequently constructed and ligand-docking experiments were performed to rationalize experimental data. Our docking study has shown that mutations have induced enlargement of the active site volume in all mutants with the exception of CYP2A6 16. Furthermore, loss of hydrogen bond between 8-MOP and active site residue Asn297 was evidenced in all mutants. Our data indicate that the structural changes elicited by the sequence mutations could affect 8-MOP binding to yield differential enzymatic activities in the mutant CYP2A6 proteins.
Variation of root system characters in collection of semi-dwarf spring barley mutants
International Nuclear Information System (INIS)
Nawrot, M.; Zbieszczyk, J.; Maluszynski, M.
2000-01-01
The collection of 371 semi-dwarf mutants, derived from 12 spring barley varieties has been used as material for analysis of root system. The mutants have been obtained after mutagenic treatment with N-methyl-N-nitroso urea (MNH), sodium azide (NaN3), gamma-rays and fast neutrons. The following analysis of root system were performed: seminal root growth of 8-day old seedlings, seminal and adventitious root growth of 6-week old plants and dynamics of root growth during first 6 weeks of plant growth. Seminal root length, root number and the length of the first leaf in barley mutants were investigated with the use of paper rollers. Root system analysis of 6-week old plants was performed on genotypes grown in PVC tubes filled with sand, supplemented with 1 mineral salts of MS medium. The following measurements were made: the length of the longest seminal root and the longest adventitious root, the number of adventitious roots and the number of tillers. Analysis of dynamics of root growth during the first six weeks of vegetation was performed at the end of each 7-day growth period in the PVC tubes filled with sand. Great variability in the seminal root length was found in analysed 8-day old seedling population. Almost half of the analysed mutants showed significant root length reduction, but about ten percent of semi-dwarf mutants developed roots with an increased length in comparison to parents. No significant differences were found between analysed mutants and corresponding parent varieties regarding the number of seminal roots. After six weeks of growth, the selected mutants showed differences in the reduction of root length in comparison to the 8-day old seedlings. The results of root growth dynamics indicated that analysed mutants had different patterns in comparison to the parent variety. Differences in the growth dynamics were also observed among the parent varieties. The observed differences in pattern of root growth between mutants and corresponding parents
High protein mutants of winter fodder barley induced by radiation and chemical mutagens
Energy Technology Data Exchange (ETDEWEB)
Yankulov, M.; Genchev, K.; Nikolov, Kh.
1982-01-01
Several induced mutants of winter fodder barley with higher rpotein content are described. These mutants were produced by treating seeds of cvs. Vogelsaenger Gold, Ager and 468 with gamma-rays, sodium azide and ethyl methanesulfonate (alone and in combinations) and with ethylene and formamide. The gamma-ray induced mutants of winter fodder barley have 1-4% higher protein content. The mutant line 109 has, besides high protein content (17,37%), 5.96 lysine per 100 g protein, but its endosperm is wrinkeled. Mutants produced by chemical mutagens have 6-7% higher protein content than the initial cultivars. All induced mutants have 85-95 cm high stems, i.e. they are by 10-20 cm shorter than the initial cultivars. Some of these mutants are now resistant to the diseases Helminthosporium gramineum and Ustilago nuda. The recommended mutants could be successfully used in breeding programs for producing of higher protein content and quality in winter fodder barley.
High protein mutants of winter fodder barley induced by radiation and chemical mutagens
International Nuclear Information System (INIS)
Yankulov, M.; Genchev, K.; Nikolov, Kh.
1982-01-01
Several induced mutants of winter fodder barley with higher rpotein content are described. These mutants were produced by treating seeds of cvs. Vogelsaenger Gold, Ager and 468 with gamma-rays, sodium azide and ethyl methanesulfonate (alone and in combinations) and with ethylene and formamide. The gamma-ray induced mutants of winter fodder barley have 1-4% higher protein content. The mutant line 109 has, besides high protein content (17,37%), 5.96 lysine per 100 g protein, but its endosperm is wrinkeled. Mutants produced by chemical mutagens have 6-7% higher protein content than the initial cultivars. All induced mutants have 85-95 cm high stems, i.e. they are by 10-20 cm shorter than the initial cultivars. Some of these mutants are now resistant to the diseases Helminthosporium gramineum and Ustilago nuda. The recommended mutants could be successfully used in breeding programs for producing of higher protein content and quality in winter fodder barley
Defective glycinergic synaptic transmission in zebrafish motility mutants
Directory of Open Access Journals (Sweden)
Hiromi Hirata
2010-01-01
Full Text Available Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR β subunit genes. These mutants exhibit a loss of glycinergic synaptic transmission due to a lack of synaptic aggregation of GlyRs. Due to the consequent loss of reciprocal inhibition of motor circuits between the two sides of the spinal cord, motor neurons activate simultaneously on both sides resulting in bilateral contraction of axial muscles of beo mutants, eliciting the so-called ‘accordion’ phenotype. Similar defects in GlyR subunit genes have been observed in several mammals and are the basis for human hyperekplexia/startle disease. By contrast, zebrafish shocked (sho mutants have a defect in slc6a9, encoding GlyT1, a glycine transporter that is expressed by astroglial cells surrounding the glycinergic synapse in the hindbrain and spinal cord. GlyT1 mediates rapid uptake of glycine from the synaptic cleft, terminating synaptic transmission. In zebrafish sho mutants, there appears to be elevated extracellular glycine resulting in persistent inhibition of postsynaptic neurons and subsequent reduced motility, causing the ‘twitch once’ phenotype. We review current knowledge regarding zebrafish ‘accordion’ and ‘twitch once’ mutants, including beo and sho, and report the identification of a new α2 subunit that revises the phylogeny of zebrafish GlyRs.
Defective Glycinergic Synaptic Transmission in Zebrafish Motility Mutants
Hirata, Hiromi; Carta, Eloisa; Yamanaka, Iori; Harvey, Robert J.; Kuwada, John Y.
2009-01-01
Glycine is a major inhibitory neurotransmitter in the spinal cord and brainstem. Recently, in vivo analysis of glycinergic synaptic transmission has been pursued in zebrafish using molecular genetics. An ENU mutagenesis screen identified two behavioral mutants that are defective in glycinergic synaptic transmission. Zebrafish bandoneon (beo) mutants have a defect in glrbb, one of the duplicated glycine receptor (GlyR) β subunit genes. These mutants exhibit a loss of glycinergic synaptic transmission due to a lack of synaptic aggregation of GlyRs. Due to the consequent loss of reciprocal inhibition of motor circuits between the two sides of the spinal cord, motor neurons activate simultaneously on both sides resulting in bilateral contraction of axial muscles of beo mutants, eliciting the so-called ‘accordion’ phenotype. Similar defects in GlyR subunit genes have been observed in several mammals and are the basis for human hyperekplexia/startle disease. By contrast, zebrafish shocked (sho) mutants have a defect in slc6a9, encoding GlyT1, a glycine transporter that is expressed by astroglial cells surrounding the glycinergic synapse in the hindbrain and spinal cord. GlyT1 mediates rapid uptake of glycine from the synaptic cleft, terminating synaptic transmission. In zebrafish sho mutants, there appears to be elevated extracellular glycine resulting in persistent inhibition of postsynaptic neurons and subsequent reduced motility, causing the ‘twitch-once’ phenotype. We review current knowledge regarding zebrafish ‘accordion’ and ‘twitch-once’ mutants, including beo and sho, and report the identification of a new α2 subunit that revises the phylogeny of zebrafish GlyRs. PMID:20161699
An extra early mutant of pigeonpea
International Nuclear Information System (INIS)
Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.
2001-01-01
The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant
Zhang, Yahui; Li, Wanjie; Chu, Mi; Chen, Hengye; Yu, Haoyuan; Fang, Chaoguang; Sun, Ningze; Wang, Qiming; Luo, Tian; Luo, Kaiju; She, Xueping; Zhang, Mengqian; Yang, Dong
2016-06-01
Candida albicans is an opportunistic human pathogen, and its pathogenicity is associated with hyphal formation. Previous studies have shown that at neutral-to-alkaline pH, hyphal growth is dependent on the Rim101 pathway whose activation requires Snf7, a member of the ESCRT system. In this work, we described the purification and characterization of the C. albicans Vps4, an AAA ATPase required for recycling of the ESCRTs. Its role on hyphal growth has been investigated. Our data suggest deletion of Vps4 decreases overall hyphal growth at pH 7 and increases the growth of multiple hyphae induced by serum, which indicates that the ESCRTs may make a Rim101-independent contribution to hyphal growth. Furthermore, DBeQ, an inhibitor of the AAA ATPase p97, was shown to inhibit the ATPase activity of Vps4 with an IC50 of about 11.5 μM. To a less degree, it also inhibits hyphal growth. Our work may provide a new strategy to control C. albicans infection.
Perng, Guey-Chuen; Esmaili, Daniel; Slanina, Susan M.; Yukht, Ada; Ghiasi, Homayon; Osorio, Nelson; Mott, Kevin R.; Maguen, Barak; Jin, Ling; Nesburn, Anthony B.; Wechsler, Steven L.
2001-01-01
Herpes simplex virus type 1 latency-associated transcript (LAT)-null mutants have decreased reactivation but normal virulence in rabbits and mice. We report here on dLAT1.5, a mutant with LAT nucleotides 76 to 1667 deleted. Following ocular infection of rabbits, dLAT1.5 reactivated at a lower rate than its wild-type parent McKrae (6.1 versus 11.8%; P = 0.0025 [chi-square test]). Reactivation was restored in the marker-rescued virus dLAT1.5R (12.6%; P = 0.53 versus wild type), confirming the importance of the deleted region in spontaneous reactivation. Compared with wild-type or marker-rescued virus, dLAT1.5 had similar or slightly reduced virulence in rabbits (based on survival following ocular infection). In contrast, in mice, dLAT1.5 had increased virulence (P Wechsler, J. Virol. 73:920–929, 1999), had decreased virulence in mice (P = 0.03). In addition, we also found that dLAT371, a LAT mutant that we previously reported to have wild-type virulence in rabbits (G. C. Perng, S. M. Slanina, H. Ghiasi, A. B. Nesburn, and S. L. Wechsler, J. Virol. 70:2014–2018, 1996), had decreased virulence in mice (P < 0.05). Thus, these three mutants, each of which encodes a different LAT RNA, have different virulence phenotypes. dLAT1.5 had wild-type virulence in rabbits but increased virulence in mice. In contrast, LAT2.9A had increased virulence in rabbits but decreased virulence in mice, and dLAT371 had wild-type virulence in rabbits but decreased virulence in mice. Taken together, these results suggest that (i) the 5′ end of LAT and/or a gene that overlaps part of this region is involved in viral virulence, (ii) this virulence appears to have species-specific effects, and (iii) regulation of this virulence may be complex. PMID:11533165
Molecular and genetic characterization of OSH6 ( Oryza sativa ...
African Journals Online (AJOL)
Genetic studies of dissociation (Ds) insertion mutant rice plants indicated that ectopic expression of truncated OSH6 (Oryza sativa Homeobox 6) mRNA may be responsible for the mutant phenotype of knotted leaf formation at the peduncle. Additionally, ectopic expression of truncated OSH6 mRNA in the OSH6-Ds mutant ...
Development of high yielding mutants in lentil
International Nuclear Information System (INIS)
Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.
2001-01-01
Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)
Gromiha, M Michael; Anoosha, P; Huang, Liang-Tsung
2016-01-01
Protein stability is the free energy difference between unfolded and folded states of a protein, which lies in the range of 5-25 kcal/mol. Experimentally, protein stability is measured with circular dichroism, differential scanning calorimetry, and fluorescence spectroscopy using thermal and denaturant denaturation methods. These experimental data have been accumulated in the form of a database, ProTherm, thermodynamic database for proteins and mutants. It also contains sequence and structure information of a protein, experimental methods and conditions, and literature information. Different features such as search, display, and sorting options and visualization tools have been incorporated in the database. ProTherm is a valuable resource for understanding/predicting the stability of proteins and it can be accessed at http://www.abren.net/protherm/ . ProTherm has been effectively used to examine the relationship among thermodynamics, structure, and function of proteins. We describe the recent progress on the development of methods for understanding/predicting protein stability, such as (1) general trends on mutational effects on stability, (2) relationship between the stability of protein mutants and amino acid properties, (3) applications of protein three-dimensional structures for predicting their stability upon point mutations, (4) prediction of protein stability upon single mutations from amino acid sequence, and (5) prediction methods for addressing double mutants. A list of online resources for predicting has also been provided.
Sodium azide mutagenesis in wheat: Mutants with golden glumes
International Nuclear Information System (INIS)
Siddiqui, K.A.; Jafri, K.A.; Arain, M.A.
1989-01-01
In bread wheat, Triticum aestivum L. (2n=6x=42, AABBDD), detection of induced mutations is hampered by the presence of duplicate and triplicate genes. Induced changes in spike characteristics are known, but mutants with changed glume colour do not seem to have been reported. Physical mutagens such as gamma rays, thermal neutrons and fast neutrons, and chemical mutagens like EMS, El, dES and NEH have been extensively used for induction of mutations in bread wheat but it seems as if these mutagens did not induce mutants with changed glume colour. We used sodium azide for inducing mutations in the widely adapted cultivar 'Sonalika', which is characterized by brown glume colour. Presoaked seeds were treated with 0.2M sodium azide for 3 hours. Three spikes were harvested from each M 1 plant. M 2 generation was space-planted as spike progeny. We were successful in identifying 3 mutants with golden glumes. The mutants resemble 'Sonalika' in other spike characteristics. The mutants glume colour was confirmed in M 3 . The mutants were also evaluated for agronomically important characteristics. Some characters were significantly different from the parent. Glume colours may be useful as genetic markers since such characters are less influenced by the environment. Our investigation confirms that also agronomically useful genetic variation may be readily induced in bread wheat through sodium azide
TOMATOMA Update: Phenotypic and Metabolite Information in the Micro-Tom Mutant Resource.
Shikata, Masahito; Hoshikawa, Ken; Ariizumi, Tohru; Fukuda, Naoya; Yamazaki, Yukiko; Ezura, Hiroshi
2016-01-01
TOMATOMA (http://tomatoma.nbrp.jp/) is a tomato mutant database providing visible phenotypic data of tomato mutant lines generated by ethylmethane sulfonate (EMS) treatment or γ-ray irradiation in the genetic background of Micro-Tom, a small and rapidly growing variety. To increase mutation efficiency further, mutagenized M3 seeds were subjected to a second round of EMS treatment; M3M1 populations were generated. These plants were self-pollinated, and 4,952 lines of M3M2 mutagenized seeds were generated. We checked for visible phenotypes in the M3M2 plants, and 618 mutant lines with 1,194 phenotypic categories were identified. In addition to the phenotypic information, we investigated Brix values and carotenoid contents in the fruits of individual mutants. Of 466 samples from 171 mutant lines, Brix values and carotenoid contents were between 3.2% and 11.6% and 6.9 and 37.3 µg g(-1) FW, respectively. This metabolite information concerning the mutant fruits would be useful in breeding programs as well as for the elucidation of metabolic regulation. Researchers are able to browse and search this phenotypic and metabolite information and order seeds of individual mutants via TOMATOMA. Our new Micro-Tom double-mutagenized populations and the metabolic information could provide a valuable genetic toolkit to accelerate tomato research and potential breeding programs. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Yang, Ying; Zhang, Lujia; Guo, Mingrong; Sun, Jiaqi; Matsukawa, Shingo; Xie, Jingli; Wei, Dongzhi
2015-04-15
In the process of gene mining for novel α-L-arabinofuranosidases (AFs), the gene Celf_3321 from Cellulomonas fimi ATCC 484 encodes an AF, termed as AbfCelf, with potent activity, 19.4 U/mg under the optimum condition, pH 6.0 and 40 °C. AbfCelf can hydrolyze α-1,5-linked oligosaccharides, sugar beet arabinan, linear 1,5-α-arabinan, and wheat flour arabinoxylan, which is partly different from some previously well-characterized GH 51 AFs. The traditional substrate-specificity analysis for AFs is labor-consuming and money costing, because the substrates include over 30 kinds of various 4-nitrophenol (PNP)-glycosides, oligosaccharides, and polysaccharides. Hence, a preliminary structure and mechanism based method was applied for substrate-specificity analysis. The binding energy (ΔG, kcal/mol) obtained by docking suggested the reaction possibility and coincided with the experimental results. AbfA crystal 1QW9 was used to test the rationality of docking method in simulating the interaction between enzyme and substrate, as well the credibility of the substrate-specificity analysis method in silico.
Origin Licensing Requires ATP Binding and Hydrolysis by the MCM Replicative Helicase
Coster, Gideon; Frigola, Jordi; Beuron, Fabienne; Morris, Edward P.; Diffley, John F.X.
2014-01-01
Summary Loading of the six related Minichromosome Maintenance (MCM) proteins as head-to-head double hexamers during DNA replication origin licensing is crucial for ensuring once-per-cell-cycle DNA replication in eukaryotic cells. Assembly of these prereplicative complexes (pre-RCs) requires the Origin Recognition Complex (ORC), Cdc6, and Cdt1. ORC, Cdc6, and MCM are members of the AAA+ family of ATPases, and pre-RC assembly requires ATP hydrolysis. Here we show that ORC and Cdc6 mutants defective in ATP hydrolysis are competent for origin licensing. However, ATP hydrolysis by Cdc6 is required to release nonproductive licensing intermediates. We show that ATP binding stabilizes the wild-type MCM hexamer. Moreover, by analyzing MCM containing mutant subunits, we show that ATP binding and hydrolysis by MCM are required for Cdt1 release and double hexamer formation. This work alters our view of how ATP is used by licensing factors to assemble pre-RCs. PMID:25087873
Subunit-specific phenotypes of Salmonella typhimurium HU mutants.
Hillyard, D R; Edlund, M; Hughes, K T; Marsh, M; Higgins, N P
1990-01-01
Salmonella hupA and hupB mutants were studied to determine the reasons for the high degree of conservation in HU structure in bacteria. We found one HU-1-specific effect; the F'128 plasmid was 25-fold less stable in hupB compared with hupA or wild-type cells. F' plasmids were 120-fold more unstable in hupA hupB double mutants compared with wild-type cells, and the double mutant also had a significant alteration in plasmid DNA structure. pBR322 DNA isolated from hupA hupB strains was deficient...
Generation of a Mutant Mucor hiemalis Endoglycosidase That Acts on Core-fucosylated N-Glycans.
Katoh, Toshihiko; Katayama, Takane; Tomabechi, Yusuke; Nishikawa, Yoshihide; Kumada, Jyunichi; Matsuzaki, Yuji; Yamamoto, Kenji
2016-10-28
Endo-β-N-acetylglucosaminidase M (Endo-M), an endoglycosidase from the fungus Mucor hiemalis, is a useful tool for chemoenzymatic synthesis of glycoconjugates, including glycoprotein-based therapeutics having a precisely defined glycoform, by virtue of its transglycosylation activity. Although Endo-M has been known to act on various N-glycans, it does not act on core-fucosylated N-glycans, which exist widely in mammalian glycoproteins, thus limiting its application. Therefore, we performed site-directed mutagenesis on Endo-M to isolate mutant enzymes that are able to act on mammalian-type core-α1,6-fucosylated glycans. Among the Endo-M mutant enzymes generated, those in which the tryptophan at position 251 was substituted with alanine or asparagine showed altered substrate specificities. Such mutant enzymes exhibited increased hydrolysis of a synthetic α1,6-fucosylated trimannosyl core structure, whereas their activity on the afucosylated form decreased. In addition, among the Trp-251 mutants, the W251N mutant was most efficient in hydrolyzing the core-fucosylated substrate. W251N mutants could act on the immunoglobulin G-derived core-fucosylated glycopeptides and human lactoferrin glycoproteins. This mutant was also capable of transferring the sialyl glycan from an activated substrate intermediate (sialyl glyco-oxazoline) onto an α1,6-fucosyl-N-acetylglucosaminyl biotin. Furthermore, the W251N mutant gained a glycosynthase-like activity when a N175Q substitution was introduced and it caused accumulation of the transglycosylation products. These findings not only give insights into the substrate recognition mechanism of glycoside hydrolase family 85 enzymes but also widen their scope of application in preparing homogeneous glycoforms of core-fucosylated glycoproteins for the production of potent glycoprotein-based therapeutics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Human liver cell trafficking mutants: characterization and whole exome sequencing.
Directory of Open Access Journals (Sweden)
Fei Yuan
Full Text Available The HuH7 liver cell mutant Trf1 is defective in membrane trafficking and is complemented by the casein kinase 2α subunit CK2α''. Here we identify characteristic morphologies, trafficking and mutational changes in six additional HuH7 mutants Trf2-Trf7. Trf1 cells were previously shown to be severely defective in gap junction functions. Using a Lucifer yellow transfer assay, remarkable attenuation of gap junction communication was revealed in each of the mutants Trf2-Trf7. Electron microscopy and light microscopy of thiamine pyrophosphatase showed that several mutants exhibited fragmented Golgi apparatus cisternae compared to parental HuH7 cells. Intracellular trafficking was investigated using assays of transferrin endocytosis and recycling and VSV G secretion. Surface binding of transferrin was reduced in all six Trf2-Trf7 mutants, which generally correlated with the degree of reduced expression of the transferrin receptor at the cell surface. The mutants displayed the same transferrin influx rates as HuH7, and for efflux rate, only Trf6 differed, having a slower transferrin efflux rate than HuH7. The kinetics of VSV G transport along the exocytic pathway were altered in Trf2 and Trf5 mutants. Genetic changes unique to particular Trf mutants were identified by exome sequencing, and one was investigated in depth. The novel mutation Ile34Phe in the GTPase RAB22A was identified in Trf4. RNA interference knockdown of RAB22A or overexpression of RAB22AI34F in HuH7 cells caused phenotypic changes characteristic of the Trf4 mutant. In addition, the Ile34Phe mutation reduced both guanine nucleotide binding and hydrolysis activities of RAB22A. Thus, the RAB22A Ile34Phe mutation appears to contribute to the Trf4 mutant phenotype.
Sinuraya, M.; Hanafiah, D. S.; Romulo, A.; Barus, A.
2018-02-01
The aim of the research was to study the variation in antioxidant and antimicrobial activity as well as the total quercetin content of the fifth generation genotypes mutant Samosir shallot irradiated by gamma rays. The studies conducted included the assessment of quercetin content, antioxidant and antimicrobial activity in shallot bulbs after long-term storage (6 months in the room temperature). Quercetin content of 20 selected genotype mutants of irradiated shallot bulbs along with untreated populations were calculated using quercetin (QU) as a standard. Antioxidant activities of 8 genotype mutant were determined using DPPH. Antimicrobial activity of bulb extracts were tested against six bacteria including Staphylococcus aurous, Enterococcus faecalis, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae and oneyeastCandida albicans. The results showed that population of genotype mutants irradiated with dosage 2Gy, 4 Gy, 5 Gy and 6 Gy have higher quercetin content than control samples. None of the genotype mutants exhibited antibacterial inhibitory against all microorganism tested except for the sample number 2 and 6 (bulbs generated from the plants irradiated by gamma rays with dosage at 2 Gy and 6 Gy). There was also none of the genotypes observed exhibited significant antioxidant efficacy.
Augustyniak, Rafal; Kay, Lewis E
2018-05-22
Protein remodeling by AAA+ enzymes is central for maintaining proteostasis in a living cell. However, a detailed structural description of how this is accomplished at the level of the substrate molecules that are acted upon is lacking. Here, we combine chemical cross-linking and methyl transverse relaxation-optimized NMR spectroscopy to study, at atomic resolution, the stepwise unfolding and subsequent refolding of the two-domain substrate calmodulin by the VAT AAA+ unfoldase from Thermoplasma acidophilum By engineering intermolecular disulphide bridges between the substrate and VAT we trap the substrate at different stages of translocation, allowing structural studies throughout the translocation process. Our results show that VAT initiates substrate translocation by pulling on intrinsically unstructured N or C termini of substrate molecules without showing specificity for a particular amino acid sequence. Although the B1 domain of protein G is shown to unfold cooperatively, translocation of calmodulin leads to the formation of intermediates, and these differ on an individual domain level in a manner that depends on whether pulling is from the N or C terminus. The approach presented generates an atomic resolution picture of substrate unfolding and subsequent refolding by unfoldases that can be quite different from results obtained via in vitro denaturation experiments.
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Diminished self-chaperoning activity of the DeltaF508 mutant of CFTR results in protein misfolding.
Directory of Open Access Journals (Sweden)
Adrian W R Serohijos
2008-02-01
Full Text Available The absence of a functional ATP Binding Cassette (ABC protein called the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR from apical membranes of epithelial cells is responsible for cystic fibrosis (CF. Over 90% of CF patients carry at least one mutant allele with deletion of phenylalanine at position 508 located in the N-terminal nucleotide binding domain (NBD1. Biochemical and cell biological studies show that the DeltaF508 mutant exhibits inefficient biosynthetic maturation and susceptibility to degradation probably due to misfolding of NBD1 and the resultant misassembly of other domains. However, little is known about the direct effect of the Phe508 deletion on the NBD1 folding, which is essential for rational design strategies of cystic fibrosis treatment. Here we show that the deletion of Phe508 alters the folding dynamics and kinetics of NBD1, thus possibly affecting the assembly of the complete CFTR. Using molecular dynamics simulations, we find that meta-stable intermediate states appearing on wild type and mutant folding pathways are populated differently and that their kinetic accessibilities are distinct. The structural basis of the increased misfolding propensity of the DeltaF508 NBD1 mutant is the perturbation of interactions in residue pairs Q493/P574 and F575/F578 found in loop S7-H6. As a proof-of-principle that the S7-H6 loop conformation can modulate the folding kinetics of NBD1, we virtually design rescue mutations in the identified critical interactions to force the S7-H6 loop into the wild type conformation. Two redesigned NBD1-DeltaF508 variants exhibited significantly higher folding probabilities than the original NBD1-DeltaF508, thereby partially rescuing folding ability of the NBD1-DeltaF508 mutant. We propose that these observed defects in folding kinetics of mutant NBD1 may also be modulated by structures separate from the 508 site. The identified structural determinants of increased misfolding propensity of
International Nuclear Information System (INIS)
Njoroge, N.C.; Tremblay, L.; Lefebvre, D.D.
2006-01-01
% germination for seedlings grown only on on 250mM mannitol. Apparently, ABA and mannitol exert a synergistic effect on it's germination performance. Under these conditions, the wild type and NN3 do not germinate. However, the germination of NN3 was 98% on 250mM mannitol alone. The ABA levels in dry seeds of mutants NN143 and NN3 were 40% and 6.5% higher than in the wild type seeds, respectively. The ability of the mutants to tolerant salt and/or osmotic stress is not due to deficienccy of ABA. Possible mechanisms underlying such stress in mutants NN3 and NN143 are discussed.(author)
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong Sub; Kim, Jin Baek; Song, Jae Young; Jeon, Jae Beom; Lee, Young Mi; Lee, Geung Joo; Kang, Si Yong [Radiation Research Center for Bio-technology, Advanced Radiation Research Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Kang, Kwon Kyoo [Division of Life Science, Hankyong National University, Anseong (Korea, Republic of); Cho, Yong Gu [College of Agriculture, Life and Environment Sciences, Chungbuk National University, Cheongju (Korea, Republic of); Kim, Bo Kyeong [Division of Rice Breeding and Cultivation, Honam Agricultural Research Institute, NICS, Iksan (Korea, Republic of)
2008-11-15
For an increase of specific free amino acids through embryo cultures, the rice (Oryza sativa L.) mutant lines resistant to a growth inhibition by 5-methyltryptophan (5MT) were selected from calli irradiated with 0-90 Gy gamma rays in 3 rice cultivars, Dongjinbyeo, Donganbyeo and Jakwangdo. The optimum 5MT concentrations for a resistance selection were 0.25 mM at the callus level. In the test of the radiation sensitivity for the callus level, radiation doses of RD50 (50% reduction on fresh weight) were 71.2, 64.0, and 68.2 Gy in the cvs. Dongjinbyeo, Donganbyeo and Jakwangdo by each exponential function. The appearance of 5MT resistant calli seemed to be dependent on a combination between the radiation dose and the 5MT selection pressure. The treatment of mutagens for the selection of amino acid analog resistant mutants has a different influence among cultivars on the resistance frequency. In the effect of growth regulators on a regeneration, a combination of 0.1 mg/l IAA and 5 mg/l kinetin, was the optimum concentration for a regeneration of calli induced from rice embryo. The regeneration rate of cv. Donganbyeo was 14.8%, which was 3.5 times and 2.6 times higher than cv. Dongjinbyeo (4.2%) and cv. Jakwangdo (5.6%), respectively. In the progeny test, the 5MT resistance character is inherited to the next generation and is expressed in the germinating M2 seeds and would appear to be a dominant trait. The 5MT resistant mutants will be useful in molecular and biochemical studies for the regulation of the nutritional quality in rice.
SRAP analysis of M3 lotus mutants induced by Fe+ ion implantation
International Nuclear Information System (INIS)
Jia Yanyan; Deng Chuanliang; Gao Jun; Ren Yingxue; Wang Ningna; Gao Wujun; Lu Longdou; Zhang Tao; Li Pengfei
2011-01-01
To examine and determine the lotus mutants induced by the same Fe + ion implantation at the molecular level, the SRAP technique was used, and the non denatured polyacrylamide gel electrophoresis was undertaken to analyze the PCR products. At the optimized SRAP reaction condition, of the 121 primer pairs tested, 10 primer pairs could amplify stable and remarkable specific bands, with primer polymorphism of 8.26%. This 10 primer pairs amplified a total of 215 bands, 83 of which were polymorphic, and the percent of polymorphic bands was 38.6%. A total of 141 bands were amplified for the mutant 1, 22 of which were different from the control with the variation ratio of 15.6%. However, the variation ratios of mutant 2 to 6 were 16.4%, 17.1%, 16.9%, 18.2% and 20.5% respectively. The results indicated that Fe + ion implantation into the seeds of Baiyangdian red lotus could induce random genetic DNA variations. (authors)
Directory of Open Access Journals (Sweden)
Zhiyong eYang
2015-01-01
Full Text Available IGFBP-6 inhibits angiogenesis as well as proliferation and survival of rhabdomyosarcoma cells. However, it promotes migration of these cells in an IGF-independent manner. The IGF system is implicated in ovarian cancer, so we studied the effects of IGFBP-6 in ovarian cancer cells.Methods: The effects of wild type (wt and a non-IGF-binding mutant (m of IGFBP-6 on migration of HEY and SKOV-3 ovarian cancer cells, which respectively represent aggressive and transitional cancers, were studied. ERK and JNK phosphorylation were measured by Western blotting.Results: IGF-II, wt- and mIGFBP-6 each promoted SKOV3 cell migration by 77-98% (p<0.01. In contrast, IGF-II also increased HEY cell migration to 155 ± 13% of control (p<0.001, but wtIGFBP-6 and mIGFBP-6 decreased migration to 62 ± 5% and 66 ± 3% respectively (p<0.001. In these cells, coincubation of IGF-II with wt but not mIGFBP-6 increased migration. MAP kinase pathways are involved in IGFBP-6-induced rhabdomyosarcoma cell migration, so activation of these pathways in HEY and SKOV3 cells was studied. wt and mIGFBP-6 increased ERK phosphorylation by 62-99% in both cell lines (p<0.05. wtIGFBP-6 also increased JNK phosphorylation by 139-153% in both cell lines (p<0.05, but the effect of mIGFBP-6 was less clear. ERK and JNK inhibitors partially inhibited the migratory effects of wt and mIGFBP-6 in SKOV3 cells, whereas the ERK inhibitor partially restored wt and mIGFBP-6-induced inhibition of HEY cell migration. The JNK inhibitor had a lesser effect on the actions of wtIGFBP-6 and no effect on the actions of mIGFBP-6 in HEY cells.Conclusions: IGFBP-6 has opposing effects on migration of HEY and SKOV3 ovarian cancer cells, but activates MAP kinase pathways in both. Delineating the pathways underlying the differential effects on migration will increase our understanding of ovarian cancer metastasis and shed new light on the IGF-independent effects of IGFBP-6.
International Nuclear Information System (INIS)
Cruz, A.D. da; Curry, J.; Glickman, B.W.
1996-01-01
Modern technologies have provided the opportunity to monitor mutations in people in vivo. The subjects of this study were accidentally exposed to 137 Cesium in a radiological accident that occurred in September 1987 in Goiania, Brazil, during which more than 150 people received doses greater than 0.1 Gy and as high as 7 Gy. The objective of this study was to determine how long the hprt mutant T-cells in the peripheral blood contribute to mutant T-cells in the peripheral blood contribute to mutant frequency by examining the timecourse of the T-lymphocyte response to ionizing radiation. This report describes the results obtained over a period of 2.3 to 4.5 years subsequent to the accident, from 11 subjects with doses ranging from 1 to 7 Gy, and from nine control subjects selected from the same population. The mean In MF (±SE) of the control group was 2.5 (±0.2) + In10 -6 . The exposed group had a significantly increased mutant frequency; the mean ln MF (±SE) were 3.3 (±0.3) + In10 -6 , 2.8 (±0.2) + In10 -6 , and 2.3 (±0.2) + In10 -6 , in the years 1990-1992 respectively and using Buckton's models, we demonstrated that mutant T-cells have a short-term memory with a half-life of 2.1 years. This relatively short half-half limits the effective use of the hprt assay as the method of choice to monitor past exposure. The data also demonstrate a positive correlation with age, and an inverse correlation with plating efficiency. 77 refs., 3 figs., 4 tabs
Nakaya, Makoto; Shojo, Aiko; Hirai, Hiroaki; Matsumoto, Kenji; Kitamura, Shinichi
2013-01-01
waxy/amylose-extender (wx/ae) double-mutant japonica rice (Oryza sativa L.) produces resistant starch (RS) and a large amount of γ-oryzanol. Our previous study has shown the hypolipidemic effect of wx/ae brown rice on mice. To identify the functional constituents of the hypolipidemic activity in wx/ae rice, we prepared pure wx/ae starch and γ-oryzanol from wx/ae rice and investigated their effect on the lipid metabolism in BALB/c.KOR/Stm Slc-Apoe(shl) mice. The mice were fed for 3 weeks a diet containing non-mutant rice starch, non-mutant rice starch plus γ-oryzanol, wx/ae starch, or wx/ae starch plus γ-oryzanol. γ-Oryzanol by itself had no effect on the lipid metabolism, and wx/ae starch prevented an accumulation of triacylglycerol (TAG) in the liver. Interestingly, the combination of wx/ae starch plus γ-oryzanol not only prevented a TAG accumulation in the liver, but also partially suppressed the rise in plasma TAG concentration, indicating that wx/ae starch and γ-oryzanol could have a synergistic effect on the lipid metabolism.
Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans
2015-01-01
We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603
Hassan, Cesare; Pickhardt, Perry J; Pickhardt, Perry; Laghi, Andrea; Kim, Daniel H; Kim, Daniel; Zullo, Angelo; Iafrate, Franco; Di Giulio, Lorenzo; Morini, Sergio
2008-04-14
In addition to detecting colorectal neoplasia, abdominal computed tomography (CT) with colonography technique (CTC) can also detect unsuspected extracolonic cancers and abdominal aortic aneurysms (AAA).The efficacy and cost-effectiveness of this combined abdominal CT screening strategy are unknown. A computerized Markov model was constructed to simulate the occurrence of colorectal neoplasia, extracolonic malignant neoplasm, and AAA in a hypothetical cohort of 100,000 subjects from the United States who were 50 years of age. Simulated screening with CTC, using a 6-mm polyp size threshold for reporting, was compared with a competing model of optical colonoscopy (OC), both without and with abdominal ultrasonography for AAA detection (OC-US strategy). In the simulated population, CTC was the dominant screening strategy, gaining an additional 1458 and 462 life-years compared with the OC and OC-US strategies and being less costly, with a savings of $266 and $449 per person, respectively. The additional gains for CTC were largely due to a decrease in AAA-related deaths, whereas the modeled benefit from extracolonic cancer downstaging was a relatively minor factor. At sensitivity analysis, OC-US became more cost-effective only when the CTC sensitivity for large polyps dropped to 61% or when broad variations of costs were simulated, such as an increase in CTC cost from $814 to $1300 or a decrease in OC cost from $1100 to $500. With the OC-US approach, suboptimal compliance had a strong negative influence on efficacy and cost-effectiveness. The estimated mortality from CT-induced cancer was less than estimated colonoscopy-related mortality (8 vs 22 deaths), both of which were minor compared with the positive benefit from screening. When detection of extracolonic findings such as AAA and extracolonic cancer are considered in addition to colorectal neoplasia in our model simulation, CT colonography is a dominant screening strategy (ie, more clinically effective and more cost-effective
Induction of diphtheria toxin-resistant mutants in human cells by ultraviolet light
International Nuclear Information System (INIS)
Rocchi, P.; Ferreri, A.M.; Capucci, A.; Prodi, G.
1981-01-01
Stable spontaneous mutants resistant to the protein synthesis inhibitor diphtheria toxin (DT) have been selected in human cell line EUE at a very low frequency (less than 8 x 10(-6)). U.v.-induced mutation has been quantitatively measured: treatment of cells with u.v. light increased the frequencies of diphtheria toxin resistant (DTr) mutants up to 1000-fold. The maximum recovery of DTr mutants was observed after a short expression period, for all u.v. doses tested, and was followed by a decrease in mutation frequency on subsequent passages
Induction of diphtheria toxin-resistant mutants in human cells by ultraviolet light
International Nuclear Information System (INIS)
Rocchi, P.; Ferreri, A.M.; Capucci, A.; Prodi, G.
1981-01-01
Stable spontaneous mutants resistant to the protein synthesis inhibitor diphtheria toxin (DT) have been selected in human cell line EUE at a very low frequency ( -6 ). U.v.-induced mutation has been quantitatively measured: treatment of cells with u.v. light increased the frequencies of diphtheria toxin resistant (DTsup(r)) mutants up to 1000-fold. The maximum recovery of DTsup(r) mutants was observed after a short expression period, for all u.v. doses tested, and was followed by a decrease in mutation frequency on subsequent passages. (author)
International Nuclear Information System (INIS)
Sato, K.; Hieda, N.
1980-01-01
The mutant mouse lymphoma cell Q31, which is sensitive to 4-nitroquinoline 1-oxide and ultraviolet radiation (UV), was compared with the parental L5178Y cell for the effect of caffeine and mutation induction after UV irradiation. Caffeine potentiated the lethal effect of UV in both cell strains to a similar extent, indicating that the defective process in Q31 cells was caffeine-insensitive. UV-induced mutation to 6-thioguanine resistance was determined in L5178Y and Q31 cells. The maximal yield of mutants was obtained 7 days post-irradiation in L5178Y cells and 14 days in Q31 cells for higher UV doses. It appears that a much longer time is required for the mutant cells than for the parental cells for full expression of the resistance phenotype even at equitoxic UV doses. A substantially higher frequency in induced mutations was observed in Q31 cells than in L5178Y cells at a given dose of UV. A plot of induced mutation frequency as a function of logarithm of surviving fraction again indicates hypermutability of Q31 cells as compared with the parental strain. In contrast, X-rays induced a similar frequency of mutations to 6-thioguanine resistance in L5178Y and Q31 cells. (orig.)
Ali, Sikander; Nawaz, Wajeeha
2016-08-01
The present research work is concerned with the biotransformation of L-tyrosine to dopamine (DA) by calcium alginate entrapped conidiospores of a mutant strain of Aspergillus oryzae. Different strains of A. oryzae were isolated from soil. Out of 13 isolated strains, isolate-2 (I-2) was found to be a better DA producer. The wild-type I-2 was chemically improved by treating it with different concentrations of ethyl methyl sulfonate (EMS). Among seven mutant variants, EMS-6 exhibiting maximal DA activity of 43 μg/ml was selected. The strain was further exposed with L-cysteine HCl to make it resistant against diversion and environmental stress. The conidiospores of selected mutant variant A. oryzae EMS-6 strain were entrapped in calcium alginate beads. Different parameters for immobilization were investigated. The activity was further improved from 44 to 62 μg/ml under optimized conditions (1.5 % sodium alginate, 2 ml inoculum, and 2 mm bead size). The best resistant mutant variable exhibited over threefold increase in DA activity (62 μg/ml) than did wild-type I-2 (21 μg/ml) in the reaction mixture. From the results presented in the study, it was observed that high titers of DA activity in vitro could effectively be achieved by the EMS-induced mutagenesis of filamentous fungus culture used.
Masking Responses to Light in Period Mutant Mice
Pendergast, Julie S.; Yamazaki, Shin
2013-01-01
Masking is an acute effect of an external signal on an overt rhythm and is distinct from the process of entrainment. In the current study, we investigated the phase dependence and molecular mechanisms regulating masking effects of light pulses on spontaneous locomotor activity in mice. The circadian genes, Period1 (Per1) and Per2, are necessary components of the timekeeping machinery and entrainment by light appears to involve the induction of the expression of Per1 and Per2 mRNAs in the suprachiasmatic nuclei (SCN). We assessed the roles of the Per genes in regulating masking by assessing the effects of light pulses on nocturnal locomotor activity in C57BL/6J Per mutant mice. We found that Per1−/− and Per2−/− mice had robust negative masking responses to light. In addition, the locomotor activity of Per1−/−/Per2−/− mice appeared to be rhythmic in the light-dark (LD) cycle, and the phase of activity onset was advanced (but varied among individual mice) relative to lights off. This rhythm persisted for 1 to 2 days in constant darkness in some Per1−/−/Per2−/− mice. Furthermore, Per1−/−/Per2−/− mice exhibited robust negative masking responses to light. Negative masking was phase dependent in wild-type mice such that maximal suppression was induced by light pulses at zeitgeber time 14 (ZT14) and gradually weaker suppression occurred during light pulses at ZT16 and ZT18. By measuring the phase shifts induced by the masking protocol (light pulses were administered to mice maintained in the LD cycle), we found that the phase responsiveness of Per mutant mice was altered compared to wild-types. Together, our data suggest that negative masking responses to light are robust in Per mutant mice and that the Per1−/−/Per2−/− SCN may be a light-driven, weak/damping oscillator. PMID:21793695
Circulation of Pneumocystis dihydropteroate synthase mutants in France.
Le Gal, Solène; Damiani, Céline; Perrot, Maëla; Rouillé, Amélie; Virmaux, Michèle; Quinio, Dorothée; Moalic, Elodie; Saliou, Philippe; Berthou, Christian; Le Meur, Yann; Totet, Anne; Nevez, Gilles
2012-10-01
Data on the prevalence of Pneumocystis jirovecii (P. jirovecii) dihydropteroate synthase (DHPS) mutants in France are still limited. In this study, mutant prevalence in the Brest region (western France) was determined. Archival pulmonary specimens from 85 patients infected with P. jirovecii and admitted to our institution (University Hospital, Brest) from October 2007 to February 2010 were retrospectively typed at the DHPS locus using a polymerase chain reaction-restriction fragment length polymorphism assay. Type identification was successful in 66 of 85 patients. Sixty-four patients were infected with a wild type, whereas mutants were found in 2 patients (2/66, 3%). Medical chart analysis revealed that these 2 patients usually lived in Paris. Another patient usually lived on the French Riviera, whereas 63 patients were from the city of Brest. Thus, the corrected prevalence of mutants in patients who effectively lived in our geographic area was 0% (0/63). Taking into account that i) Paris is characterized by a high prevalence of mutants from 18.5% to 40%, ii) infection diagnoses were performed in the 2 Parisians during their vacation Paris to Brest through infected vacationers. The study shows that the usual city of patient residence, rather than the city of infection diagnosis, is a predictor of mutants and that P. jirovecii infections involving mutants do not represent a public health issue in western France. Copyright © 2012 Elsevier Inc. All rights reserved.
Li, L; Lin, K; Correia, J J; Pilkis, S J
1992-08-15
Lysine 356 has been implicated by protein modification studies as a fructose-2,6-bisphosphate binding site residue in the 6-phosphofructo-2-kinase domain of rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (Kitajima, S., Thomas, H., and Uyeda, K. (1985) J. Biol. Chem. 260, 13995-14002). However, Lys-356 is found in the fructose-2,6-bisphosphatase domain (Bazan, F., Fletterick, R., and Pilkis, S. J. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 9642-9646). In order to ascertain whether Lys-356 is involved in fructose-2,6-bisphosphatase catalysis and/or domain/domain interactions of the bifunctional enzyme, Lys-356 was mutated to Ala, expressed in Escherichia coli, and then purified to homogeneity. Circular dichroism experiments indicated that the secondary structure of the Lys-356-Ala mutant was not significantly different from that of the wild-type enzyme. The Km for fructose 2,6-bisphosphate and the Ki for the noncompetitive inhibitor, fructose 6-phosphate, for the fructose-2,6-bisphosphatase of the Lys-356-Ala mutant were 2700- and 2200-fold higher, respectively, than those of the wild-type enzyme. However, the maximal velocity and the Ki for the competitive product inhibitor, inorganic phosphate, were unchanged compared to the corresponding values of the wild-type enzyme. Furthermore, in contrast to the wild-type enzyme, which exhibits substrate inhibition, there was no inhibition by substrate of the Lys-356-Ala mutant. In the presence of saturating substrate, inorganic phosphate, which acts by relieving fructose-6-phosphate and substrate inhibition, is an activator of the bisphosphatase. The Ka for inorganic phosphate of the Lys-356-Ala mutant was 1300-fold higher than that of the wild-type enzyme. The kinetic properties of the 6-phosphofructo-2-kinase of the Lys-356-Ala mutant were essentially identical with that of the wild-type enzyme. The results demonstrate that: 1) Lys-356 is a critical residue in fructose-2,6-bisphosphatase for binding the 6
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams.
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-07-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar 'Sasanishiki') that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined.
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams
International Nuclear Information System (INIS)
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N.; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-01-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UVTolerantRice319), was isolated from a mutagenized population derived from 2500 M 1 seeds (of the UVB-resistant cultivar ‘Sasanishiki’) that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined
Further studies on a temperature-sensitive mutant of Escherichia coli with defective repair capacity
International Nuclear Information System (INIS)
Morfiadakis, I.; Geissler, E.; Akademie der Wissenschaften der DDR, Berlin. Zentralinstitut fuer Molekularbiologie)
1981-01-01
A temperature-sensitive mutant of E. coli, WG24, was studied with respect to its sensitivity to photodynamic action, its capacity to perform host controlled reactivation, and its sensitivity to transduction at elevated temperatures. Mutant cells are much more sensitive than wild type cells to photodynamic action by thiopyronine and visible light at elevated temperatures. As well defined rec mutants, WG24 cells are less able to reactivate UV irradiated lambdac phages at elevated temperatures, while their ability to repair T1 phages is less impaired. Mutant cells cannot be transduced to T6 resistance at a detectable rate at elevated temperature. It is concluded, therefore, that some rec gene carries a ts mutation in this mutant. (author)
DEFF Research Database (Denmark)
Lindholt, Jes Sanddal; Norman, P
2008-01-01
Four randomised controlled trials of screening older men for abdominal aortic aneurysms (AAA) have been completed. A meta-analysis was performed to examine the pooled effects of screening on both mid- and long-term AAA-related and total mortality, and operations for AAA....
The AAA+ ATPase p97, a cellular multitool.
Stach, Lasse; Freemont, Paul S
2017-08-17
The AAA+ (ATPases associated with diverse cellular activities) ATPase p97 is essential to a wide range of cellular functions, including endoplasmic reticulum-associated degradation, membrane fusion, NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) activation and chromatin-associated processes, which are regulated by ubiquitination. p97 acts downstream from ubiquitin signaling events and utilizes the energy from ATP hydrolysis to extract its substrate proteins from cellular structures or multiprotein complexes. A multitude of p97 cofactors have evolved which are essential to p97 function. Ubiquitin-interacting domains and p97-binding domains combine to form bi-functional cofactors, whose complexes with p97 enable the enzyme to interact with a wide range of ubiquitinated substrates. A set of mutations in p97 have been shown to cause the multisystem proteinopathy inclusion body myopathy associated with Paget's disease of bone and frontotemporal dementia. In addition, p97 inhibition has been identified as a promising approach to provoke proteotoxic stress in tumors. In this review, we will describe the cellular processes governed by p97, how the cofactors interact with both p97 and its ubiquitinated substrates, p97 enzymology and the current status in developing p97 inhibitors for cancer therapy. © 2017 The Author(s).
International Nuclear Information System (INIS)
Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.
1988-01-01
Two induced mutants namely, Mut NS 1 (tall) and Mut NS 5 (semi-dwarf) derived from rice variety Nizersail were evaluated for various agronomic characters at four locations in Bangladesh. Both the mutants matured about three weeks earlier and yielded significantly higher than the parent variety Nizersail. (author). 3 tabs., 9 refs
Yield of two mutant lines of soybean for human consumption
International Nuclear Information System (INIS)
Salmeron E, J.; Mastache L, A. A.; Diaz V, G. E.; Valencia E, F.; Ranfla C, R.; Melendez P, M.; Cervantes S, T.; De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.
2009-01-01
The present work has the objective of to evaluate the yield and the agronomic behavior of 2 mutant lines of soybean for human consumption, obtained by means of a process of recurrent irradiation of soybean seed ISAAEG-BM 2 with gammas of Co 60 and selection in the generation R 4 M 18 . For the variable yield significant statistical differences were not observed, but considering the rest of the evaluated agronomic characteristics the mutant lines L 6 and Bombona they were excellent with values of 3,934.6 and 3,806.8 Kg ha- 1 to 15% of grain humidity, they also possess excellent genetic characteristics result of the irradiations and selections of these new genetic materials. (Author)
Gao, Peng; Si, Jiyuan; Yang, Bin; Yu, Jixiang
2017-02-18
BACKGROUND The objective of the present study was to identify the association between miR-15a-5p and CDKN2B, and their roles in regulating the development of abdominal aortic aneurysm (AAA). MATERIAL AND METHODS We searched the miRNA database online (www.mirdb.org) and used a luciferase reporter assay system to study the regulatory relationship between miR-15a-5p and CDKN2B. We also conducted real-time PCR and Western blot analysis to study the mRNA and protein expression level of CDKN2B among different patient groups (participants with abdominal aortic aneurysm (AAA) and normal controls) or cells treated with scramble control, miR-15a-5p mimics, CDKN2B siRNA, and miR-15a-5p inhibitors. RESULTS We found that CDKN2B was a virtual target of miR-15a-5p with potential binding sites in the 3'UTR of CDKN2B (77-83 bp). We also showed that miR-15a-5p could bind to the CDKN2B 3'UTR, resulting in a significant decrease in luciferase activity compared with the scramble control. Furthermore, we found that the cells isolated from AAA participants showed an over-expression of miR-15a-5p compared to the normal controls, while the CDKN2B mRNA and protein expression level of the AAA group were much lower than the normal control group. Additionally, the expression of CDKN2B mRNA and the protein of the cells transfected with miR-15a-5p mimics and CDKN2B siRNA was downregulated, while the cells showed upregulated expression subsequent to transfection with miR-15a-5p inhibitors compared to the scramble control. CONCLUSIONS The data revealed a negative regulatory role of miR-15a-5p in the apoptosis of smooth muscle cells via targeting CDKN2B, and showed that miR-15a-5p could be a novel therapeutic target of AAA.
Toxicidad de boro en plantaciones de banano(Musa AAA en Costa Rica
Directory of Open Access Journals (Sweden)
Alfonso Vargas
2007-01-01
Full Text Available En las hojas de plantas de banano (Musa AAA, cvs. Grande Naine y Valery, se observó una necrosis marginal irregular y continua, la cual se desarrolló a partir de un área clorótica igualmente irregular, que avanzó del margen hacia el interior de la hoja. La parte central de la lámina foliar retuvo siempre su coloración verde original. Los análisis de suelo y tejido foliar mostraron que los síntomas fueron causados por altas concentraciones de boro, debido ya fuese a aplicaciones excesivas del nutrimento al suelo y al follaje, o por el efecto de aplicaciones muy frecuentes de boro vía fertirriego, combinado con una disminución de la concentración de calcio en la hoja
International Nuclear Information System (INIS)
Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian
2008-01-01
In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)
Genes and Alcohol Consumption: Studies with Mutant Mice
Mayfield, Jody; Arends, Michael A.; Harris, R. Adron; Blednov, Yuri A.
2017-01-01
In this chapter, we review the effects of global null mutant and overexpressing transgenic mouse lines on voluntary self-administration of alcohol. We examine approximately 200 publications pertaining to the effects of 155 mouse genes on alcohol consumption in different drinking models. The targeted genes vary in function and include neurotransmitter, ion channel, neuroimmune, and neuropeptide signaling systems. The alcohol self-administration models include operant conditioning, two- and four-bottle choice continuous and intermittent access, drinking in the dark limited access, chronic intermittent ethanol, and scheduled high alcohol consumption tests. Comparisons of different drinking models using the same mutant mice are potentially the most informative, and we will highlight those examples. More mutants have been tested for continuous two-bottle choice consumption than any other test; of the 137 mouse genes examined using this model, 97 (72%) altered drinking in at least one sex. Overall, the effects of genetic manipulations on alcohol drinking often depend on the sex of the mice, alcohol concentration and time of access, genetic background, as well as the drinking test. PMID:27055617
Combined BRAF and HSP90 inhibition in patients with unresectable BRAF V600E mutant melanoma.
Eroglu, Zeynep; Chen, Yian Ann; Gibney, Geoffrey T; Weber, Jeffrey S; Kudchadkar, Ragini R; Khushalani, Nikhil I; Markowitz, Joseph; Brohl, Andrew S; Tetteh, Leticia F; Ramadan, Howida; Arnone, Gina; Li, Jiannong; Zhao, Xiuhua; Sharma, Ritin; Darville, Lancia N F; Fang, Bin; Smalley, Inna; Messina, Jane L; Koomen, John M; Sondak, Vernon K; Smalley, Keiran S M
2018-04-19
BRAF inhibitors are clinically active in patients with advanced BRAF V600 -mutant melanoma, although acquired resistance remains common. Preclinical studies demonstrated that resistance could be overcome using concurrent treatment with the HSP90 inhibitor XL888. Vemurafenib (960 mg PO BID) combined with escalating doses of XL888 (30, 45, 90 or 135 mg PO twice weekly) was investigated in 21 patients with advanced BRAF V600 -mutant melanoma. Primary endpoints were safety and determination of a maximum tolerated dose. Correlative proteomic studies were performed to confirm HSP inhibitor activity. Objective responses were observed in 15/20 evaluable patients (75%; 95% CI: 51-91%), with 3 complete and 12 partial responses. Median progression-free and overall survival were 9.2 months (95% CI: 3.8-not reached) and 34.6 months (6.2-not reached), respectively. The most common grade 3/4 toxicities were skin toxicities such as rash (n=4, 19%) and cutaneous squamous cell carcinomas (n=3, 14%), along with diarrhea (n=3, 14%). Pharmacodynamic analysis of patients' PBMCs showed increased day 8 HSP70 expression compared to baseline in the three cohorts with XL888 doses ≥45 mg. Diverse effects of vemurafenib-XL888 upon intratumoral HSP-client protein expression were noted, with the expression of multiple proteins (including ERBB3 and BAD) modulated on therapy. XL888 in combination with vemurafenib has clinical activity in patients with advanced BRAF V600 -mutant melanoma, with a tolerable side-effect profile. HSP90 inhibitors warrant further evaluation in combination with current standard-of-care BRAF plus MEK inhibitors in BRAF V600 -mutant melanoma. Copyright ©2018, American Association for Cancer Research.
Hemenway, C. S.; Dolinski, K.; Cardenas, M. E.; Hiller, M. A.; Jones, E. W.; Heitman, J.
1995-01-01
We have characterized a Saccharomyces cerevisiae mutant strain that is hypersensitive to cyclosporin A (CsA) and FK506, immunosuppressants that inhibit calcineurin, a serine-threonine-specific phosphatase (PP2B). A single nuclear mutation, designated cev1 for calcineurin essential for viability, is responsible for the CsA-FK506-sensitive phenotype. The peptidyl-prolyl cis-trans isomerases cyclophilin A and FKBP12, respectively, mediate CsA and FK506 toxicity in the cev1 mutant strain. We demo...
Proteomic analysis of the flooding tolerance mechanism in mutant soybean.
Komatsu, Setsuko; Nanjo, Yohei; Nishimura, Minoru
2013-02-21
Flooding stress of soybean is a serious problem because it reduces growth; however, flooding-tolerant cultivars have not been identified. To analyze the flooding tolerance mechanism of soybean, the flooding-tolerant mutant was isolated and analyzed using a proteomic technique. Flooding-tolerance tests were repeated five times using gamma-ray irradiated soybeans, whose root growth (M6 stage) was not suppressed even under flooding stress. Two-day-old wild-type and mutant plants were subjected to flooding stress for 2days, and proteins were identified using a gel-based proteomic technique. In wild-type under flooding stress, levels of proteins related to development, protein synthesis/degradation, secondary metabolism, and the cell wall changed; however, these proteins did not markedly differ in the mutant. In contrast, an increased number of fermentation-related proteins were identified in the mutant under flooding stress. The root tips of mutant plants were not affected by flooding stress, even though the wild-type plants had damaged root. Alcohol dehydrogenase activity in the mutant increased at an early stage of flooding stress compared with that of the wild-type. Taken together, these results suggest that activation of the fermentation system in the early stages of flooding may be an important factor for the acquisition of flooding tolerance in soybean. Copyright © 2012 Elsevier B.V. All rights reserved.
Phanerochaete mutants with enhanced ligninolytic activity
International Nuclear Information System (INIS)
Kakar, S.N.; Perez, A.; Gonzales, J.
1994-01-01
In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d
Development of compact mutants in apple and sour cherry
International Nuclear Information System (INIS)
Zagaja, S.W.; Przybyla, A.; Machnik, B.
1982-01-01
During the period 1973 - 79 studies were conducted with the aim of developing compact mutants in apple and cherry cultivars and in apple vegetative rootstocks. During the investigations the effect of the dose of gamma rays on frequency of the mutants was studied. Attempts were also made to evolve a micropropagation technique adapted to propagate P 2 and P 22 apple rootstocks, as an aid in mutation breeding. Several mutants were produced in all the material studied, but none of them have yet reached a sufficient developmental stage to enable their complete assessment. On the basis of the results obtained so far the following conclusions can be drawn: higher doses of irradiation resulted in higher frequency of mutants in most apple cultivars and apple rootstocks; in sour cherries the effect of dose depended on the cultivars. Among V 1 shoots developed from sleeping buds on irradiated scion wood, compact mutants were found; their frequency, however, was about 60% lower than among V 1 shoots developed directly from irradiated dormant buds. In apple rootstocks A 2 and M 26 several dwarfed mutants were found; some of these produced thorny plants and some had lower rooting ability; both these characteristics are inferior from the practical point of view. Multiplication and rooting media for in vitro propagation of apple rootstocks, worked out for M 26, were found unsuitable for the rootstocks P 2 and P 22; modifications made in the growth substance composition of the above media enabled satisfactory propagation to be obtained. (author)
Characterization of MMS-sensitive mutants of Neurospora crassa
Energy Technology Data Exchange (ETDEWEB)
DeLange, A.M.; Mishra, N.C.
1982-01-01
Several MMS-sensitive mutants of Neurospora crassa were compared with the wild-type strain for their relative sensitivities to UV, X-ray, and histidine. They were also compared for the frequency of spontaneous mutation at the loci which confer resistance to p-fluorophenylalanine. The mutants were also examined for possible defects in meiotic behavior in homozygous crosses and for any change in the inducible DNA salvage pathways. On the basis of these characterizations, the present MMS-sensitive mutants of Neurospora can be placed into three groups. On the basis of data presented, the MMS sensitivity of the first group mutants cannot be ascertained to arise from a defect in the DNA repair pathways; instead, it may stem from altered cell permeability or other pleotropic effects of the mus mutations. However, it can be suggested that the second and third group of mus mutants may indeed result from a defect in the DNA repair pathways controlled by the mus genes; this conclusion is based on their cross-sensitivity to a number of DNA-damaging agents such as MMS, UV and/or X-rays, high frequencies of spontaneous mutation and defects in meiotic behavior.
Induction of two mutants in birdsfoot trefoil (Lotus corniculatus) by x-rays and chemical mutagens
International Nuclear Information System (INIS)
Therrien, M.C.; Grant, W.F.
1982-01-01
The mutagenic effects of X-rays, ethyl methanesulfonate (EMS), 8-ethoxycaffeine (EOC), N-hydroxyurea (HU) and 2-aminopurine (2AP) on seed treatment of birdsfoot trefoil (Lotus corniculatus L. 'Mirabel') were assessed over four generations. Mutants were recovered in the M 2 , M 3 and M 4 generations from selfed lines, from crosses derived form selfed lines and from open pollination lines. Mutant plants exhibiting vestigial floret character were recovered from X-rays, EMS, EOC and HU treatments. Mutant chlorotica plants were obtained from EMS treatment only. No mutants were recovered from 2AP treatment, EMS, the most effective mutagen, produced nine vestigial floret and 12 chlorotica mutants. Mutants were obtained from only one exposure of X-rays (12 krad). There was evidence for preferential elimination of gametes. The chlorotica and vestigial floret mutants were inherited as tetrasomic recessives. Mutation frequencies of 0.4 - 3.1% in a tetrasomic background are indicative of the effectiveness of EMS in birdsfoot trefoil
Induction of two mutants in birdsfoot trefoil (Lotus corniculatus) by x-rays and chemical mutagens
Energy Technology Data Exchange (ETDEWEB)
Therrien, M.C.; Grant, W.F. (McGill Univ., Ste. Anne de Bellevue, Quebec (Canada). Macdonald Coll.)
1982-10-01
The mutagenic effects of X-rays, ethyl methanesulfonate (EMS), 8-ethoxycaffeine (EOC), N-hydroxyurea (HU) and 2-aminopurine (2AP) on seed treatment of birdsfoot trefoil (Lotus corniculatus L. 'Mirabel') were assessed over four generations. Mutants were recovered in the M/sub 2/, M/sub 3/ and M/sub 4/ generations from selfed lines, from crosses derived form selfed lines and from open pollination lines. Mutant plants exhibiting vestigial floret character were recovered from X-rays, EMS, EOC and HU treatments. Mutant chlorotica plants were obtained from EMS treatment only. No mutants were recovered from 2AP treatment, EMS, the most effective mutagen, produced nine vestigial floret and 12 chlorotica mutants. Mutants were obtained from only one exposure of X-rays (12 krad). There was evidence for preferential elimination of gametes. The chlorotica and vestigial floret mutants were inherited as tetrasomic recessives. Mutation frequencies of 0.4 - 3.1% in a tetrasomic background are indicative of the effectiveness of EMS in birdsfoot trefoil.
International Nuclear Information System (INIS)
Freeze, H.; Willies, L.; Hamilton, S.
1986-01-01
The lysosomal enzymes of Dictyostelium discoideum share highly immunogenic oligosaccharides which contain multiple Man-6-SO 4 residues. Two mutant strains which lack the shared antigenic determinant were analyzed in an attempt to identify the primary defect in each. [ 3 H]Man labelled N-linked oligosaccharides of secreted glycoproteins were released by Endo/PNGaseF digestion and analyzed. Both of the mutant strains produced smaller, less sulfated oligosaccharides compared to the wild-type, yet both still contained considerable amounts of Man-6-SO 4 . The size of the precursor lipid-linked oligosaccharide from the wild-type is consistent with a Glc 3 Man 9 GlcNAc 2 structure, while those from both of the mutants have an oligosaccharide the size of Man 5 GlcNAc 2 . The authors conclude that both of the mutants are defective in the biosynthesis of the precursor oligosaccharide. Both oligosaccharides from the mutants contain a tri-mannosyl core and are not glucosylated. Two of the five Man residues are released by a 1,2 specific α mannosidase. Based on the size and mannosidase digestions the authors conclude that 4/5 of the Man residues on the α1,6 branch of the β-linked Man residues are missing. Thus, these residues must be required to define the shared antigenic determinant
Chen, Yuling; Asano, Tomoya; Fujiwara, Makoto T; Yoshida, Shigeo; Machida, Yasunori; Yoshioka, Yasushi
2009-05-01
Plastids are maintained in cells by proliferating prior to cell division and being partitioned to each daughter cell during cell division. It is unclear, however, whether cells without plastids are generated when plastid division is suppressed. The crumpled leaf (crl) mutant of Arabidopsis thaliana is a plastid division mutant that displays severe abnormalities in plastid division and plant development. We show that the crl mutant contains cells lacking detectable plastids; this situation probably results from an unequal partitioning of plastids to each daughter cell. Our results suggest that crl has a partial defect in plastid expansion, which is suggested to be important in the partitioning of plastids to daughter cells when plastid division is suppressed. The absence of cells without detectable plastids in the accumulation and replication of chloroplasts 6 (arc6) mutant, another plastid division mutant of A. thaliana having no significant defects in plant morphology, suggests that the generation of cells without detectable plastids is one of the causes of the developmental abnormalities seen in crl plants. We also demonstrate that plastids with trace or undetectable amounts of chlorophyll are generated from enlarged plastids by a non-binary fission mode of plastid replication in both crl and arc6.
Gamma ray induced mutants in Coleus
Energy Technology Data Exchange (ETDEWEB)
Vasudevan, K; Jos, J S [Central Tuber Crops Research Institute, Trivandrum, Kerala (India)
1988-07-01
The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M{sub 1}V{sub 1} generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m{sup 2} area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing.
Gamma ray induced mutants in Coleus
International Nuclear Information System (INIS)
Vasudevan, K.; Jos, J.S.
1988-01-01
The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing
International Nuclear Information System (INIS)
Kalinin, V.L.; Petrov, V.N.; Petrova, T.M.
1981-01-01
Vegetative cells of Bac. thuringiensis var. galleriae (the wild-type strain 351) are much more sensitive to lethal effects of UV light and 60 Co-γ-rays than those of Bac. subtilis (the wild-type strain 168). This difference is less pronounced for spores of these strains. By means of repeated γ-irradiation-regrowth cycles radioresistant mutants Bac. thuringiensis Gamsup(r) 14 and Bac. subtilis Gamsup(r) 9 were selected. The vegetative cells of these mutants are correspondingly 19 times and 3.9 times more resistant to lethal effects of γ-radiation than the cells of the parental strains. The resistance of the Gamsup(r) mutant cells to lethal effects of UV light and H 2 O 2 is also increased. The spores of the Gamsup(r) 14 mutant are 1.5-1.7 times more resistant to γ-radiation and UV light than the wild-type spores. The radioresistant mutants and the parental strains do not vary in their capacity for host-cell reactivation of UV- or γ-irradiated phages Tg13 and 105
Isolation of L-methionine-enriched mutant of a methylotrophic yeast, Candida boidinii No.2201
International Nuclear Information System (INIS)
Tani, Y.; Lim, W.J.; Yang, H.C.
1988-01-01
Six strains of methylotrophic yeast were examined for production of L-methionine-enriched cells. Candida boidinii (kloeckera sp.) No. 2201,which accumulated 0.54 mg/g-dry cell weight (DCW) of free L-methionine (pool methionine), was selected as the parental strain for breeding L-methionine-rich mutants. Ethionine-resistant mutants were derived from the strain by UV irradiation. A mutant strain, E500-78,which was resistant to 500 μg/ml of DL-ethionine, accumulated 6.02 mg/g-DCW of pool methionine. The culture conditions for mutant strain E500-78 to increase pool methionine accumulation were optimized. As a result, the mutant strain accumulated 8.80 mg/g-DCW of pool methionine and contained 16.02 mg/g-DCW total methionine
Data on quantification of signaling pathways activated by KIT and PDGFRA mutants
Directory of Open Access Journals (Sweden)
Christelle Bahlawane
2016-12-01
Full Text Available The present data are related to the article entitled “Insights into ligand stimulation effects on gastro-intestinal stromal tumors signaling” (C. Bahlawane, M. Schmitz, E. Letellier, K. Arumugam, N. Nicot, P.V. Nazarov, S. Haan, 2016 [1]. Constitutive and ligand-derived signaling pathways mediated by KIT and PDGFRA mutated proteins found in gastrointestinal stromal tumors (GIST were compared. Expression of mutant proteins was induced by doxycycline in an isogenic background (Hek293 cells. Kit was identified by FACS at the cell surface and found to be quickly degraded or internalized upon SCF stimulation for both Kit Wild type and Kit mutant counterparts. Investigation of the main activated pathways in GIST unraveled a new feature specific for oncogenic KIT mutants, namely their ability to be further activated by Kit ligand, the stem cell factor (scf. We were also able to identify the MAPK pathway as the most prominent target for a common inhibition of PDGFRA and KIT oncogenic signaling. Western blotting and micro-array analysis were applied to analyze the capacities of the mutant to induce an effective STATs response. Among all Kit mutants, only Kit Ex11 deletion mutant was able to elicit an effective STATs response whereas all PDGFRA were able to do so.
Yoshizaki, Kaichi; Furuse, Tamio; Kimura, Ryuichi; Tucci, Valter; Kaneda, Hideki; Wakana, Shigeharu; Osumi, Noriko
2016-01-01
Neurodevelopmental disorders such as autism spectrum disorder (ASD) and attention deficit and hyperactivity disorder (ADHD) have increased over the last few decades. These neurodevelopmental disorders are characterized by a complex etiology, which involves multiple genes and gene-environmental interactions. Various genes that control specific properties of neural development exert pivotal roles in the occurrence and severity of phenotypes associated with neurodevelopmental disorders. Moreover, paternal aging has been reported as one of the factors that contribute to the risk of ASD and ADHD. Here we report, for the first time, that paternal aging has profound effects on the onset of behavioral abnormalities in mice carrying a mutation of Pax6, a gene with neurodevelopmental regulatory functions. We adopted an in vitro fertilization approach to restrict the influence of additional factors. Comprehensive behavioral analyses were performed in Sey/+ mice (i.e., Pax6 mutant heterozygotes) born from in vitro fertilization of sperm taken from young or aged Sey/+ fathers. No body weight changes were found in the four groups, i.e., Sey/+ and wild type (WT) mice born to young or aged father. However, we found important differences in maternal separation-induced ultrasonic vocalizations of Sey/+ mice born from young father and in the level of hyperactivity of Sey/+ mice born from aged fathers in the open-field test, respectively, compared to WT littermates. Phenotypes of anxiety were observed in both genotypes born from aged fathers compared with those born from young fathers. No significant difference was found in social behavior and sensorimotor gating among the four groups. These results indicate that mice with a single genetic risk factor can develop different phenotypes depending on the paternal age. Our study advocates for serious considerations on the role of paternal aging in breeding strategies for animal studies.
Directory of Open Access Journals (Sweden)
Kaichi Yoshizaki
Full Text Available Neurodevelopmental disorders such as autism spectrum disorder (ASD and attention deficit and hyperactivity disorder (ADHD have increased over the last few decades. These neurodevelopmental disorders are characterized by a complex etiology, which involves multiple genes and gene-environmental interactions. Various genes that control specific properties of neural development exert pivotal roles in the occurrence and severity of phenotypes associated with neurodevelopmental disorders. Moreover, paternal aging has been reported as one of the factors that contribute to the risk of ASD and ADHD. Here we report, for the first time, that paternal aging has profound effects on the onset of behavioral abnormalities in mice carrying a mutation of Pax6, a gene with neurodevelopmental regulatory functions. We adopted an in vitro fertilization approach to restrict the influence of additional factors. Comprehensive behavioral analyses were performed in Sey/+ mice (i.e., Pax6 mutant heterozygotes born from in vitro fertilization of sperm taken from young or aged Sey/+ fathers. No body weight changes were found in the four groups, i.e., Sey/+ and wild type (WT mice born to young or aged father. However, we found important differences in maternal separation-induced ultrasonic vocalizations of Sey/+ mice born from young father and in the level of hyperactivity of Sey/+ mice born from aged fathers in the open-field test, respectively, compared to WT littermates. Phenotypes of anxiety were observed in both genotypes born from aged fathers compared with those born from young fathers. No significant difference was found in social behavior and sensorimotor gating among the four groups. These results indicate that mice with a single genetic risk factor can develop different phenotypes depending on the paternal age. Our study advocates for serious considerations on the role of paternal aging in breeding strategies for animal studies.
Dwarf mutant of Papaver somniferum with high morphine content
International Nuclear Information System (INIS)
Chauhan, S.P.; Patra, N.K.; Srivastava, H.K.
1987-01-01
Opium poppy, Papaver somniferum L. is an important medicinal plant known for its morphine, codeine, and thebaine alkaloids. This Institute had earlier released two latex opium yielding poppy varieties, Shyama and Shweta, which are now cultivated by the farmers under the supervision of the Narcotic Department of the Government of India. However, both these varieties became susceptible to downy mildew (Peronospora arborescens). Lodging due to heavy capsule weight is another problem affecting latex yield. With these problems in mind, we undertook mutation breeding on the above mentioned two varieties employing gamma rays (5 kR, 15 kR, 20 kR) and EMS (0.2%, 0.4%, 0.6%) and combined mutagens (5 kR + 0.2% EMS, 5 kR + 0.4% EMS and 5 kR + 0.6% EMS). M 1 from the treated seeds (405 plants) was raised in winter 1984-85. M 2 generation of 13,500 plants (i.e. 270 M 1 progenies x 50 plants) was raised in winter 1985/86. A dwarf mutant with high morphine content was identified in M 2 from the variety Shweta treated with 5 kR + 0.4% EMS. The mutant differs by its dwarf stature, compact leaf arrangements, multilocular capsules, increased capsule number, and small capsule size. The mutant is under testing for its superior morphine production. It may be used as dwarf gene source in hybridization for improving lodging resistance. This mutant is a novel type, which was not available in our germplasm collection
DEFF Research Database (Denmark)
Lindholt, Jes Sanddal; Juul, Søren; Fasting, H
2006-01-01
The aim of this study was to estimate the cost effectiveness of screening for abdominal aortic aneurysm (AAA).......The aim of this study was to estimate the cost effectiveness of screening for abdominal aortic aneurysm (AAA)....
International Nuclear Information System (INIS)
Hu Xiufang; Gao Yuanyuan; Fang Qionglou; Wu Jinguang; Chen Jishuang
2008-01-01
Effect of ion implantation on strain KNP414 of Bacillus mucilaginosus was investigated. Survival ratio of isolate KNP414 was independent of the tested ions species and energy, but was highly dependent on their doses and the presence of bacterial capsule. 14 phytate-degradation mutants were obtained from the spores implanted with N + (20 keV, 5 x 10 15 -5 x 10 16 ions cm -2 ), and their phytate-degradation capacities were 15%-35%. Amongst, 3 mutants (KNP414-04, KNP414- 05, KNP414-12) with higher solubilizing capacities of mineral phosphate and potassium were identified. Their solubilizing capacities of the two minerals increased by 14.7%-27.5% and 16.2%-26.4%, respectively. Mutant KNP414-12 was found to be able to dissolve 57.3% phytate in the optimized medium and the degradation ratio was comparatively stable in seven continuous generations and during the storage process. In conclusion, ion implantation was an effective mutagenic source for isolate KNP414, since it increased the abilities to solubilize phosphate and potassium as well as to degradate phytate. Meanwhile the screening method used in this study has been proved to be successful for rapid selection of phytate-degradation mutants. (authors)