Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

Science.gov (United States)

Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

2009-07-30

This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

Directory of Open Access Journals (Sweden)

javad janpoor

2018-03-01

Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

[The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

Science.gov (United States)

Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

2009-01-01

The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

Science.gov (United States)

Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

2008-07-01

Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

Optimization of cultural conditions for biosurfactant production by Pleurotus djamor in solid state fermentation.

Science.gov (United States)

Velioglu, Zulfiye; Ozturk Urek, Raziye

2015-11-01

Being eco-friendly, less toxic, more biodegradable and biocompatible, biological surfactants have higher activity and stability compared to synthetic ones. In spite of the fact that there are abundant benefits of biosurfactants over the synthetic congeners, the problem related with the economical and large scale production proceeds. The utilization of several industrial wastes in the production media as substrates reduces the production cost. This current study aims optimization of biosurfactant production conditions by Pleurotus djamor, grown on sunflower seed shell, grape wastes or potato peels as renewable cheap substrates in solid state fermentation. After determination of the best substrate for biosurfactant production, we indicate optimum size and amount of solid substrate, volume of medium, temperature, pH and Fe(2+) concentrations on biosurfactant production. In optimum conditions, by reducing water surface tension to 28.82 ± 0.3 mN/m and having oil displacement diameter of 3.9 ± 0.3 cm, 10.205 ± 0.5 g/l biosurfactant was produced. Moreover, chemical composition of biosurfactant produced in optimum condition was determined by FTIR. Lastly, laboratory's large-scale production was carried out in optimum conditions in a tray bioreactor designed by us and 8.9 ± 0.5 g/l biosurfactant was produced with a significant surface activity (37.74 ± 0.3 mN/m). With its economical suggestions and applicability of laboratory's large-scale production, this work indicates the possibility of using low cost agro-industrial wastes as renewable substrates for biosurfactant production. Therefore, using economically produced biosurfactant will reduce cost in several applications such as bioremediation, oil recovery and biodegradation of toxic chemicals. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

Science.gov (United States)

Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

2010-10-01

Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

Oil palm empty fruit bunch as media for mushroom cultivation

International Nuclear Information System (INIS)

Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi

1998-01-01

The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting

DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

Directory of Open Access Journals (Sweden)

Hamid Akbarirad

2013-06-01

Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

Directory of Open Access Journals (Sweden)

M. Abu Sayeed

2014-01-01

Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

Alternative substrates for higher mushrooms mycelia cultivation

Directory of Open Access Journals (Sweden)

TETIANA KRUPODOROVA

2015-12-01

Full Text Available Cultivation of 29 species of higher mushroom mycelia on alternative substrates – wastes of Ukrainian oil-fat industry, has been investigated. The amount of mushroom mycelia obtaining on 12 investigated substrates varied significantly, from 1.0 g/L to 22.9 g/L on the 14th day of cultivation. The superficial cultivation adopted in this study allows for easy to choose appropriate medium (substrate for mycelia production. Alternative substrates (compared to glucose-peptone-yeast medium were selected for all studied species, from soybean cake – most suitable for the mycelial growth of 24 species, to walnut cake − suitable only for 2 species. The utilization of substrates has been evaluated by biological efficiency. The best index of biological efficiency varied from 19.0% to 41.6% depending on the mushroom species. It was established high biological efficiency of mycelia cultivation on substrates: wheat seed cake – Pleurotus djamor, Lyophyllum shimeji, Crinipellis schevczenkovi, Phellinus igniarius, Spongipellis litschaueri; oat seed cake – Ganoderma applanatum and G. lucidum; soybean cake – Hohenbuehelia myxotricha, Trametes versicolor, Morchella esculenta, Cordyceps sinensis, C. militaris, and Agrocybe aegerita; rape seed cake – Auriporia aurea; camelina seed cake – Fomes fomentarius. The cultivation of these species are perspective as a biotechnological process of agricultural wastes converted into mycelia, which could be used in different forms of products with therapeutic action: powder or tablets nutraceuticals or ingredients for functional foods.

Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2017-01-01

Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

Maize Residue as a Viable Substrate for Farm Scale Cultivation of Oyster Mushroom (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Abena O. Adjapong

2015-01-01

Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.

Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

Directory of Open Access Journals (Sweden)

Eustáquio Souza Dias

2003-12-01

Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

Cultivation Techniques and Medicinal Properties of Pleurotus spp.

Directory of Open Access Journals (Sweden)

Andrej Gregori

2007-01-01

Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

Science.gov (United States)

Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

2018-04-01

Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

2000-01-01

Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

Science.gov (United States)

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

Interaction of uranium with Pleurotus sp

International Nuclear Information System (INIS)

Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

2002-01-01

Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

Science.gov (United States)

Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

2012-01-01

Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

The fungistatic activity of organic selenium and its application to the production of cultivated mushrooms Agaricus bisporus and Pleurotus spp.

Directory of Open Access Journals (Sweden)

Savic Milena

2012-01-01

Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001

ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

Directory of Open Access Journals (Sweden)

Gabriela Popa

2016-11-01

Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

Directory of Open Access Journals (Sweden)

Maria Teresa Branà

Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)

International Nuclear Information System (INIS)

Idrus Kadir

2010-01-01

Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)

Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

Science.gov (United States)

Thongsook, T; Kongbangkerd, T

2011-08-01

Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

Institute of Scientific and Technical Information of China (English)

Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

2004-01-01

@@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

Directory of Open Access Journals (Sweden)

Petcharat, V. and

2004-09-01

Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

Laccase Enzymes in Inocula Pleurotus spp

Directory of Open Access Journals (Sweden)

Nora García-Oduardo

2017-01-01

Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

Bioavailability and Digestibility of Nutrients from the Dried Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes): In Vivo Experiments.

Science.gov (United States)

Regula, Julita; Suliburska, Joanna; Siwulski, Marek

2016-01-01

There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.

Determination of polysaccharide yield from the fruiting bodies and mycelium of selected mushroom species

International Nuclear Information System (INIS)

Shaiful Azuar Mohamad; Mat Rasol Awang

2006-01-01

Numerous polysaccharides and polysaccharides-protein complexes have been isolated from mushrooms and used as a source of therapeutic agents. The mycelium of Pleurotus sajor caju, Pleurotus tuber-regium, black ganoderma, and the fruiting bodies of Pleurotus sajor caju and Pleurotus florida were used to determine the percentage of polysaccharides obtained from the mushroom raw material. Hot water extraction method was used followed by refrigerated centrifuge and lyophilization. The yield from the various species will be compared. (Author)

Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

OpenAIRE

Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

2015-01-01

The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds

Directory of Open Access Journals (Sweden)

Sorina Ropciuc

2016-10-01

Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.

Performance of Pleurotus pulmonarius mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

Directory of Open Access Journals (Sweden)

Senzosenkosi Surprise MKHIZE

2017-10-01

Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.

Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Nam Wai Lun

2017-01-01

Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

Science.gov (United States)

Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

2017-11-01

Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

Essential trace elements in edible mushrooms by Neutron Activation Analysis

Energy Technology Data Exchange (ETDEWEB)

Moura, Patricia L.C.; Maihara, Vera A.; Castro, Lilian P. de [Instituto de Pesquisa e Energetica e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mail: patricialandim@ig.com.br; vmaihara@ipen.br; lilian.Pavanelli@terra.com.br; Figueira, Rubens C.L. [Universidade Cruzeiro do Sul, Sao Paulo, SP (Brazil)]. E-mail: figueiraru@yahoo.com.br

2007-07-01

Mushrooms are excellent nutritional sources since they provide proteins, fibers and mineral, such as K, P, Fe. They have also been the focus of medical research. In Brazil mushrooms are not consumed in large quantities by the general population since people know little about the nutritional and medicinal benefits that mushrooms offer. Hence, this study intends to contribute to a better understanding of the essential element content in edible mushrooms, which are currently commercialized in Sao Paulo state. Br Fe, K, Na and Zn concentrations were determined by Instrumental Neutron Activation Analysis in the following mushroom species: Shitake (Lentinus edodes), Shimeji (Pleurotus ssp), Paris Champignon (Agaricus bisporus), Hiratake ( Pleurotus ssp) and Eringue (Pleurotus Eryngu. The mushroom samples were acquired from commercial establishments in the city of Sao Paulo and directly from the producers. Essential element contents in mushrooms varied between Br 0.03 to 4.1 mg/kg; Fe 20 to 267 mg/kg; K 1.2 to 5.3 g/kg, Na 10 to 582 mg/kg and Zn 60 to 120 mg/kg. The results confirm that mushrooms can be considered a good source of K, Fe and Zn. The low Na level is a good nutritional benefit for the consumer. (author)

Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

Directory of Open Access Journals (Sweden)

Wei-Jie Wu

Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

International Nuclear Information System (INIS)

Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

Use of medicinal plants in different composts for yield improvement of various strains of oyster mushroom

International Nuclear Information System (INIS)

Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.

2010-01-01

Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human

Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

Directory of Open Access Journals (Sweden)

Cristina Ramos

2011-01-01

Full Text Available A utilização de substratos vegetais à base de palha tem vindo a assumir uma importância crescente na cultura de cogumelos sapróbios, principalmente do género Pleurotus. Estes cogumelos são considerados muito interessantes do ponto de vista comercial, não só pelas suas características organolépticas e nutricionais, mas também pela sua fácil adaptação e manutenção, crescimento rápido e relativo baixo custo de cultura. No entanto, por se tratar de alimentos perecíveis, devido sobretudo à sua composição e elevada taxa respiratória, podem apresentar reduzido valor comercial, caso a conservação não seja efectuada nas melhores condições. No sentido de minimizar estas alterações, os cogumelos frescos devem ser submetidos a um processamento mínimo com utilização combinada de embalagem em atmosfera modificada, de forma a manter a qualidade e estabilidade no período de conservação. Neste trabalho foram efectuados ensaios de produção de três espécies do género Pleurotus, cultivadas em palha de trigo, com a finalidade de determinar a espécie mais produtiva e avaliar a qualidade dos mesmos durante a conservação quando processados e embalados em atmosfera modificada. Os resultados permitem concluir que a espécie mais produtiva foi a P. ostreatus, seguida da P. sajor-caju e P. eryngii, tendo sido a P. eryngii a que mostrou maior resistência à degradação no período de conservação estabelecido.The use of substrates straw has been increasing importance in mushroom saprophytic species grown, especially of Pleurotus genus. They are considered very interesting from the commercial point of view, not only for its nutritional and organoleptic characteristics, but also for its easy adaptation, rapid growth and relatively low culture cost. Mushrooms have a short shelf life when compared to most vegetables at ambient temperatures mainly due to its composition and high respiration rate. After yield and to reduce losses and

Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

International Nuclear Information System (INIS)

Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

2005-01-01

A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

Directory of Open Access Journals (Sweden)

Nelson Menolli Junior

2010-04-01

Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

Intrastrain Comparison of the Chemical Composition and Antioxidant Activity of an Edible Mushroom, Pleurotus giganteus, and Its Potent Neuritogenic Properties

Directory of Open Access Journals (Sweden)

Chia-Wei Phan

2014-01-01

Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.

Oyster mycelium on the liquid medium

Directory of Open Access Journals (Sweden)

Mariusz Gapiński

2013-12-01

Full Text Available The research presents the results of oyster mycelium growth on the liquid medium. The growth of 4-mycelium genius: Pleurotus citrinopileatus Singer, Pleurotus djamor Fries, Boedjin, Pleurotus erynii Fr. Kumm. and Pleurotus precoce Fr. Quel was tested. The quality and quantity of mycelium was assumed.

Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation

International Nuclear Information System (INIS)

Moda, Evelise Moncaio

2008-01-01

The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 ± 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 ± 1 deg C and 90% UR for 8 days. CO 2 was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b * and enzymatic activity values in all treatments at the end of the storage period

Usage of Edible Mushrooms in Various Food Products

Directory of Open Access Journals (Sweden)

Özge Süfer

2016-03-01

Full Text Available Using of edible mushrooms which are generally consumed in houses in dried form is based on mainly instant soup and sauce formulations. Recently, the cultivations of Agaricus bisporus and Pleurotus ostreatus species have become widespread. Utilization of these cultivated mushrooms in recipes would bring added value to related food products. For this purpose, Agaricus bisporus and Pleurotus ostreatus species farmed in Osmaniye Korkut Ata University Mushroom House were dried and then pulverized. Firstly, a snack was prepared with Agaricus bisporus powder. Agaricus bisporus powder was substituted for wheat flour at the rates of 5 %, 10 %, 20 % and 30 % and thus the potential of food product which had relatively lower carbohydrate and fat level and higher fiber content was investigated. In the second part of the study, either 5 %, 10 % of Agaricus bisporus powder or 5 %, 10 % of Pleurotus ostreatus powder were added into traditional Turkish meatball (beef mince, salt which was cooked in conventional oven, so meat flavor could be replaced by herbal flavor coming from mushroom. This property mat obey the purpose that, the created new product will be consumed fondly especially by children. Sensory and physical (colour and texture analysis were performed in both snack and meatball samples and the results were evaluated statistically.

Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

Science.gov (United States)

Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

2018-04-20

Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

Science.gov (United States)

Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

2016-11-01

In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

Science.gov (United States)

This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

Energy Technology Data Exchange (ETDEWEB)

Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

2014-09-03

Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

Radiopasteurization of sawdust media used in propagation of mushrooms

International Nuclear Information System (INIS)

Ito, Hitoshi; Sato, Tomotaro

1975-01-01

In our country, cultivation of mushrooms such as Pleurotus ostreatus, Kuehneromyces nameko, and Lentinus edodes (Cortinellus shiitake) are expanding, and has reached considerable amounts. These mushrooms are cultivated generally on decaying logs of broad leaf trees. Recently, these mushrooms are also cultivated artificially on the sawdust-media containing rice bran and other nutrient in the room of which temperature is controlled. However, these artificial culture media must be germicidated for 2 or 6 hours at 100 to 120 0 C before inoculation of mushroom spawn. In this study, attempts were made to cultivate Pleurotus ostreatus on the sawdust-media pasteurized by ionizing radiation. Inhibition of mushrooms growth were caused mainly by multiplication of Citrobacter and Fusarium, and these organisms were eliminated by a dose of 0.5 Mrad gamma irradiation. A surprising result was that many of sawdust media subjected to 0.5, 1.0 and 2.0 Mrad increased mycelial growth rates more than heat treatments, and also mushroom yields were enhanced. The multiplication of remaining microorganisms such as Bacillus and yeasts after irradiation with a dose of 0.5 Mrad or 1.0 Mrad did not inhibit the mycelial growth of mushrooms. (auth.)

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Aceptación y apreciación de hongos comestibles Pleurotus djamor por expertos de cocina internacional y su perspectiva de comercialización en restaurantes de hoteles de Panamá. Año 2010

OpenAIRE

Alvarez, Marta; Vega Ríos, Aracelly

2016-01-01

El hongo comestible Pleutorus djamor (P. djamor) tiene alto valor nutritivo comparado con los hongos Crimini y Shiitake, posee macro y micronutrientes, vitaminas B9 y C en mayor cantidad que esas dos especies. Además, puede aportar al organismo más proteínas que otros vegetales y un 100 % de vitamina C más que las necesarias para el cuerpo humano. En otras culturas es común el consumo de hongos comestibles en la dieta diaria, sin embargo, es casi nula en la cultura de los hogares panameños. L...

Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

Science.gov (United States)

Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

2014-01-01

Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

Science.gov (United States)

Jayakumar, T; Ramesh, E; Geraldine, P

2006-12-01

This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

Science.gov (United States)

Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...

African Journals Online (AJOL)

PROF HORSFALL

pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.

Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey

Directory of Open Access Journals (Sweden)

Esra Altıntığ

2017-06-01

Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.

Effects of Cooking and In Vitro Digestion on Antioxidant Properties and Cytotoxicity of the Culinary-Medicinal Mushroom Pleurotus ostreatoroseus (Agaricomycetes).

Science.gov (United States)

Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

2018-01-01

In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.

Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

Science.gov (United States)

Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

2018-03-01

Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

Directory of Open Access Journals (Sweden)

Islam Md. Tariqul

2017-01-01

Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

International Nuclear Information System (INIS)

Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

2013-01-01

The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

Science.gov (United States)

Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

2011-01-01

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

Oyster mushroom (Pleurotus spp.) cultivation technique using re ...

African Journals Online (AJOL)

SARAH

2014-08-31

Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.

Accumulation of Heavy Metals by Wild Mushrooms in Ibadan, Nigeria

OpenAIRE

Chinatu Charity Ndimele; Prince Emeka Ndimele; Kanayo Stephen Chukwuka

2017-01-01

Background. Many companies in Nigeria generate industrial effluents, including heavy metals. These metals can be accumulated by biota such as mushrooms, which are then eaten by the populace. Objectives. The present study investigates the metal content of wild mushrooms in order to educate the local population on the safety of their consumption. Methods. Seven different species of wild mushrooms (Cortinarius melliolens, Chlorophyllum brunneum, Pleurotus florida, Volvariella speciosa, Can...

An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

Science.gov (United States)

Panjikkaran, Seeja Thomachan; Mathew, Deepu

2013-03-15

The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...

African Journals Online (AJOL)

Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...

Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...

African Journals Online (AJOL)

2012r

2014-09-24

Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.

Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

Science.gov (United States)

Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

2014-12-01

Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

Influence of growing conditions on heavy metals content in cultivated mushrooms

International Nuclear Information System (INIS)

Kmitene, L.

1997-01-01

The aim of the research was to investigate the influence of growing terms, microclimate conditions and growing medium on the mushroom harvest and quality. Champignons were grown according to the Polish technology. Pleurotus ostreatus was grown in perforate sacks using chopped wheat straw. Mycelium was sowed in different terms. It was established that the harvest of mushrooms, especially their quality, depends not only on growing conditions, but also on the kind of mushrooms, composte quality, mushroom size (diameter of cap), picking of mushrooms, storage time and other conditions. The technology of mushroom growing will be developed after studying all the factors determining the content of heavy metals and radiation in mushrooms

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.

Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

Science.gov (United States)

Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

2016-12-01

Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

Análise química de corpos de frutificação de Pleurotus sajor-caju cultivado em diferentes concentrações de nitrogênio Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

Directory of Open Access Journals (Sweden)

Evânia Geralda Silva

2007-03-01

Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.

Concentration of radiocesium in cultivated mushrooms and substrates

International Nuclear Information System (INIS)

Miyake, Sadaaki; Higasa, Mamoru; Urabe, Ken-ichi; Haraguchi, Masato; Omura, Toshitaka

2008-01-01

Concentrations of 134 Cs, 137 Cs and 40 K in mushrooms cultivated in Saitama prefecture and those substrates were measured by gamma-ray spectrometry. In all mushrooms and substrates, 134 Cs was not detected. Concentrations of 137 Cs in mushrooms were in the range of 0.012 - 2.1 Bq/kg·fresh, and those in substrates were in the range of 0.080 - 1.8 Bq/kg·dry. Concentrations of 137 Cs in mushrooms varied widely with mushroom species, and the average concentration of 137 Cs in Lentinus edodes (Shiitake) was over 30 times higher than that in Pleurotus ostreatus (Hiratake). Mushroom-to-substrate concentration ratios of 137 Cs (fresh/dry) were 0.11-0.53. They were higher than the reported transfer factors for common agricultural plants. (author)

Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

Science.gov (United States)

Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

2014-10-15

Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

Directory of Open Access Journals (Sweden)

Nualsri, C.

2005-01-01

Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

NARCIS (Netherlands)

Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

2006-01-01

When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

Science.gov (United States)

Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

2016-11-01

Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

Energy Technology Data Exchange (ETDEWEB)

Bercu, V., E-mail: vbercu@gmail.co [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Negut, C.D., E-mail: dnegut@nipne.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, 077125 Magurele (Ilfov) (Romania); Duliu, O.G., E-mail: duliu@b.astral.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania)

2010-12-15

The suitability of the EPR spectroscopy for detection of {gamma}-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

International Nuclear Information System (INIS)

Bercu, V.; Negut, C.D.; Duliu, O.G.

2010-01-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation;Aumento da vida util de cogumelos Pleurotus sajor-caju in natura com aplicacao de radiacao gama

Energy Technology Data Exchange (ETDEWEB)

Moda, Evelise Moncaio

2008-07-01

The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 +- 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 +- 1 deg C and 90% UR for 8 days. CO{sub 2} was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b{sup *} and enzymatic activity values in all treatments at the end of the storage

Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

Science.gov (United States)

Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

2015-10-01

Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus

International Nuclear Information System (INIS)

Galanda, D.; Matel, L.

2007-01-01

The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)

Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

Directory of Open Access Journals (Sweden)

Ivana Potočnik

2015-12-01

Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

Directory of Open Access Journals (Sweden)

Hanan Aref Hasan

2018-04-01

Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

Science.gov (United States)

Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

2016-04-01

The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

Radiocesium uptake mechanisms in wild and culture mushrooms

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi.

1993-01-01

Concentrations of 137 Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of 137 Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of 137 Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of 137 Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high 137 Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of 137 Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of 137 Cs concentration were stable in the order of 10 0 when the culture substrate was containing 10 000 Bq/kg (wet wt.) of 137 Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of 137 Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of 137 Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author)

Cadmium determination in Lentinus edodes mushroom species

Directory of Open Access Journals (Sweden)

Vera Akiko Maihara

2012-09-01

Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH

Directory of Open Access Journals (Sweden)

Paccola Edneia A. de Souza

2001-01-01

Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.

The first report on mushroom green mould disease in Croatia.

Science.gov (United States)

Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

2012-12-01

Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

Diversity of edible mushrooms in pakistan

International Nuclear Information System (INIS)

Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

2007-01-01

Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

Avaliação do cultivo de Pleurotus sajor-caju (fries sing. sobre o resíduo de algodão da industria têxtil para a produção de cogumelos e para alimentação animal Evaluation of the cultivation of Pleurotus sajor-caju (fries sing. on cotton textile mill waste for mushroom production and animal feeding

Directory of Open Access Journals (Sweden)

Clenderson Corradi de Mattos Gonçalves

2010-02-01

Full Text Available O resíduo proveniente do beneficiamento do algodão em lixadeiras na indústria têxtil é um material rico em lignocelulose, tem baixa digestibilidade e é pobre em proteínas e minerais, o que dificulta seu uso 'in natura' na alimentação de ruminantes. Neste tarbalho, objetivou-se avaliar a produtividade e eficiência biológica deste resíduo de algodão na produção do cogumelo comestível Pleurotus sajor-caju e avaliar as alterações promovidas no resíduo para alimentação de ruminantes. Foram realizados 5 tratamentos: T1- 80% de serragem de eucalipto + 20% de farelo de trigo (testemunha; T2- 50% de resíduo de algodão + 50% de serragem; T3- 45% de resíduo + 45% serragem + 10% de farelo; T4- 40% de resíduo + 40% serragem + 20% de farelo e T5- 80% de resíduo + 20% de farelo. O T5 apresentou os melhores resultados para produtividade (22,46% e eficiência biológica (71,48% do Pleurotus sajor-caju. O fungo alterou a constituição dos substratos nos estágios de produção do cogumelo, principalmente os constituintes da fibra e agregou N ao substrato. Dessa forma, o uso do resíduo de lixadeira de algodão no cultivo de Pleurotus sajor-caju pode se tornar uma alternativa viável para produção de cogumelo e melhorar a qualidade deste resíduo para alimentação animal.The waste coming from cotton processing in mills in the textile industry is a lignocellulose-rich material, but has low digestibility, and is poor in proteins and minerals, making it inappropriate for ruminant feeding. This study was intended to evaluate the productivity and biologic efficiency of cotton textile mill waste in the production of the edible mushroom Pleurotus sajor-caju, and to evaluate the alterations brought about in the waste for use in ruminant feeding. Five treatments were undertaken in the following manner: T1- 80% eucalyptus sawdust + 20% wheat bran (control; T2- 50% waste + 50% sawdust; T3- 45% waste + 45% sawdust + 10% wheat bran; T4- 40% waste

Inhibition of lipid peroxidation induced by γ- radiation and AAPH in rat liver and brain mitochondria by mushrooms

International Nuclear Information System (INIS)

Lakshmi, B.; Janardhanan, K.K.; Tilak, J.C.; Devasagayam, T.P.A.; Adhikari, S.

2005-01-01

Exposure to radiation or 2.2' Azobis(2-amidopropane) dihydrochloride (AAPH) induces generation of reactive oxygen species (ROS) especially hydroxyl radical ( . OH) and peroxyl radical (ROO . ), which are capable of inducing lipid peroxidation. Our earlier studies have demonstrated that extracts of the medicinal and edible mushrooms Ganoderma lucidum, Pleurotus florida, Pleurotus sajor-caju and Phellinus rimosus possessed significant antioxidant activity, measured as radical scavenging. In the present study, we examined the protective effect of these mushroom extracts against radiation- and AAPH-induced lipid peroxidation using rat liver and brain mitochondria as model systems. The results obtained showed that the investigated mushroom extracts significantly inhibited the formation of lipid hydroperoxide and thiobarbituric acid reactive substances, indicating membrane protective effects. The finding suggests the profound protective effect of the extracts of the fruiting bodies of G. lucidum, P. florida, P. sajor-caju and P. rimosus against lipid peroxidation by two major forms of ROS capable of inducing this type of damage in a major organelle, the mitochondria from both rat liver and brain. This observation can possibly explain the health benefits of these mushrooms. (author)

Chemical Composition and Bioactive Compounds of Some Wild Edible Mushrooms

Directory of Open Access Journals (Sweden)

Melinda NAGY

2017-05-01

Full Text Available Over the last decades, the consumption of mushrooms has significantly increased due to the scientific evidence of their ability to help the organism in the combat and prevention of several diseases (Kalac, 2009. Fruiting bodies of mushrooms are consumed as a delicacy for their texture and flavour, but also for their nutritional properties that makes them even more attractable (Heleno S. 2015. In this paper data were collected from several scientific studies with the aim to characterize the chemical composition and content of bioactive compounds of various mushrooms species: Agaricus bisporus, Boletus edulis, Cantharellus cibarius, Pleurotus ostreatus, Lactarius piperatus. The chemical composition of 5 wild edible studied mushrooms, including moisture, ash, total carbohydrates, total sugars, crude fat, crude protein and energy were determined according to AOAC procedures.

Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

Science.gov (United States)

Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

2016-01-01

An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

Antioxidant capacity and mineral contents of edible wild Australian mushrooms.

Science.gov (United States)

Zeng, X; Suwandi, J; Fuller, J; Doronila, A; Ng, K

2012-08-01

Five selected edible wild Australian mushrooms, Morchella elata, Suillus luteus, Pleurotus eryngii, Cyttaria gunnii, and Flammulina velutipes, were evaluated for their antioxidant capacity and mineral contents. The antioxidant capacities of the methanolic extracts of the dried caps of the mushrooms were determined using a number of different chemical reactions in evaluating multi-mechanistic antioxidant activities. These included the Trolox equivalent antioxidant capacity, ferric ion reducing antioxidant power, and ferrous ion chelating activity. Mineral contents of the dried caps of the mushrooms were also determined by inductively coupled plasma-optical emission spectroscopy. The results indicated that these edible wild mushrooms have a high antioxidant capacity and all, except C. gunnii, have a high level of several essential micro-nutrients such as copper, magnesium, and zinc. It can be concluded that these edible wild mushrooms are good sources of nutritional antioxidants and a number of mineral elements.

Fatty Acid Compositions of Six Wild Edible Mushroom Species

Science.gov (United States)

Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent

2013-01-01

The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377

Fatty Acid Compositions of Six Wild Edible Mushroom Species

Directory of Open Access Journals (Sweden)

Pelin Günç Ergönül

2013-01-01

Full Text Available The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2. Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids.

Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

Science.gov (United States)

Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

2015-01-01

The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

Oyster mushroom cultivation with rice and wheat straw.

Science.gov (United States)

Zhang, Ruihong; Li, Xiujin; Fadel, J G

2002-05-01

Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.

Performance of oyster mushroom (Pleurotus ostreatus) in different ...

African Journals Online (AJOL)

USER

2012-05-08

May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.

Enzyme-assisted extraction enhancing the umami taste amino acids recovery from several cultivated mushrooms

DEFF Research Database (Denmark)

Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo

2017-01-01

In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...

Enrichment of mushrooms: an interesting strategy for the acquisition of lithium.

Science.gov (United States)

de Assunção, Laélia Soares; da Luz, José Maria Rodrigues; da Silva, Marliane de Cássia Soares; Vieira, Patrícia Aparecida Fontes; Bazzolli, Denise Mara Soares; Vanetti, Maria Cristina Dantas; Kasuya, Maria Catarina Megumi

2012-09-15

The capability of Pleurotus ostreatus mushroom to accumulate lithium (Li) and the accessibility of this Li compared with lithium carbonate (Li(2)CO(3)), often used as psychiatric medicine, were investigated. Mushrooms were produced on a substrate-based on coffee husk, with different added concentrations of lithium chloride (LiCl). Biological efficiency (BE), the crude protein content, the concentration of Li and other elements present in mushrooms were determined. The sequential extraction and in vitro test were used to verify the accessibility and the degree of solubility of this element. Li concentration in mushrooms was directly influenced by increasing LiCl concentration in the substrate (Plithium can be an alternative source of Li, as well as being a food with high nutritional value. Copyright © 2012 Elsevier Ltd. All rights reserved.

Rice straw addition as sawdust substitution in oyster mushroom (Pleurotus ostreatus) planted media

Science.gov (United States)

Utami, Christine Pamardining; Susilawati, Puspita Ratna

2017-08-01

Oyster mushroom is favorite by the people because of the high nutrients. The oyster mushroom cultivation usually using sawdust. The availability of sawdust become difficult to find. It makes difficulties of mushroom cultivation. Rice straw as an agricultural waste can be used as planted media of oyster mushroom because they contain much nutrition needed to the mushroom growth. The aims of this research were to analysis the influence of rice straw addition in a baglog as planted media and to analysis the concentration of rice straw addition which can substitute sawdust in planted media of oyster mushroom. This research used 4 treatment of sawdust and rice straw ratio K = 75 % : 0 %, P1 = 60 % : 15 %, P2 = 40 % : 35 %, P3 = 15 % : 60 %. The same material composition of all baglog was bran 20%, chalk 5%, and water 70%. The parameters used in this research were wet weight, dry weight, moisture content and number of the mushroom fruit body. Data analysis was used ANOVA test with 1 factorial. The results of this research based on statistical analysis showed that there was no influence of rice straw addition in a planted media on the oyster mushroomgrowth. 15% : 60% was the concentrationof rice straw additionwhich can substitute the sawdust in planted media of oyster mushroom.

Neuronal health - can culinary and medicinal mushrooms help?

Science.gov (United States)

Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela

2013-01-01

Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.

Biological effects and ISSR analysis of 60Co γ-irradiation on edible mushroom mycelia

International Nuclear Information System (INIS)

Cai Weiming; Feng Weilin; Jin Qunli; Fan Lijun; Wu Yongzhi

2009-01-01

Mycelia of Agaricus bitorquis, Flammulina velutipes and Pleurotus eryngii were irradiated by 60 Co γ-rays at the dose of 0, 200, 500 and 800 Gy. The results showed that irradiation inhibited their mycelia growth positively. Of the three edible mushroom, Agaricus bitorquis was the most sensitive one to irradiation, its mycelia died at the dose of 800 Gy. Germination rate, growth rate and vigor of all mycelia irradiated with un-lethal doses increased along with the times of transfer of culture. Electrical conductivity (EC) analysis showed that irradiation increased EC of leaching solution of mycelia positively. The EC of leaching solution of mycelia of Flammulina velutipes and Pleurotus eryngii irradiated with 500 Gy, Agaricus bitorquis irradiated with 200 Gy, were significantly higher than CK. ISSR analysis revealed that 60 Co γ irradiation effect on DNA variation of Agaricus bitorquis, Flammulina velutipes and pleurotus eryngii mycelia in varying degrees. Number of polymorphic bands changed after irradiation. Flawing bands and increasing bands were observed in amplified bands of 14 selected ISSR primers. The ISSR variation rates of Agaricus bitorquis for 200 Gy and 599 Gy treatments were 33.3% and 50.5%; the ISSR variation rates of Flammulina velutipes for 200 Gy, 500 Gy and 800 Gy treatments were 2.3%, 2.3% and 3.1%, that of Pleurotus eryngii were 8.6%, 13.4% and 20.0%. It is possible to use 60 Co γ irradiation as a mutagen to screen new mushroom varieties. (authors)

The production of Pleurotus sajor-caju in peach palm leaves (Bactris gasipaes and evaluation of its use to enrich wheat flour

Directory of Open Access Journals (Sweden)

Paula Fernanda Bomfim Oliveira Cogorni

2014-06-01

Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.

Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

Science.gov (United States)

Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

2013-01-01

With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

Science.gov (United States)

Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

2015-01-01

The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

Energy Technology Data Exchange (ETDEWEB)

Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

2008-07-15

Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

Macro and trace elements in edible mushrooms, Shiitake, Shimeji and Cardoncello from Petrópolis, Rio de Janeiro, Brazil

Directory of Open Access Journals (Sweden)

Jaylei Monteiro Gonçalves

2014-05-01

Full Text Available The concentrations of twenty-five elements (Al, As, Ba, Bi, Ca, Cd, Cr, Cu, Fe, Ga, K, Li, Mg, Mn, Mo, Na, Ni, Pb, Rb , Sb, Se, Sn, Sr, V and Zn were determined in three edible mushrooms, Shiitake (Lentinula edodes, Black Shimeji (Pleurotus ostreatusi and Cardoncello (Pleurotus eryngyii from Petrópolis, Rio de Janeiro, Brazil. Samples were collected along the year 2010 and their preparations were made after drying, milling, an acid pre-digestion and a decomposition procedure in a muffle furnace. The analytical techniques employed for the elements determination were Mass Spectrometry with Inductively Coupled Plasma and Flame Atomic Absorption Spectrometry. Two certified reference materials, Apple Leaves and Mussel Tissue, were used for the evaluation of the analytical procedure and recovery values around 98% were obtained. The results showed that the analyzed mushrooms have high levels of Cu, Fe, K, Mg, Mn and Zn containing more than 30% the recommended daily intake for these nutrients according to Brazilian legislation. These mushrooms presented a very low ratio Na/K. Regarding the levels of some contaminants, the mushrooms had concentrations of Cd, Pb and As below the recommended maximum limits allowed by Brazilian legislation.

Neuronal Health – Can Culinary and Medicinal Mushrooms Help?

Science.gov (United States)

Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela

2013-01-01

Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets. PMID:24716157

Neuronal Health – Can Culinary and Medicinal Mushrooms Help?

Directory of Open Access Journals (Sweden)

Vikineswary Sabaratnam

2013-01-01

Full Text Available Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

Edible wild mushrooms of the Western Ghats: Data on the ethnic knowledge

Directory of Open Access Journals (Sweden)

Namera C. Karun

2017-10-01

Full Text Available The edible wild mushrooms are most important in food security of ethnic groups and tribals throughout the world. Various indigenous strategies are followed to trace wild mushrooms suitable for human consumption. Data presented in this article projects ethnic knowledge on 51 edible wild mushrooms (in 23 genera in the Western Ghats region of India. Information collected with support of ethnic groups/tribals pertains to habitats, substrates, mutualistic association, extent of availability, extent of edibility and method of processing of wild mushrooms. Extensive field visits and interactions with ethnic groups were performed to collect the data on each mushroom. Initially, most of these mushrooms were identified based on the indigenous methods and designated with vernacular names (Are-Gowda, Kodava and Tulu. Based on macromorphology (in field and micromorphology (in laboratory, each mushroom was identified with its systematic name. Among the 51 wild mushrooms irrespective of extent of availability, the most preferred include Astraeus hygrometricus, Clitocybe infundibuliformis, Fistulina hepatica, Lentinus sajor-caju, Pleurotus (5 spp. and Scleroderma citrinum and Termitomyces (18 spp.. This data forecasts the importance of documentation of traditional knowledge, protection of habitats, management of resources (tree species and substrates and sustainable exploitation of wild mushrooms.

Antioxidant activities of extracts from five edible mushrooms using different extractants

Directory of Open Access Journals (Sweden)

Suphaphit Boonsong

2016-03-01

Full Text Available Extractions were performed of the total phenolic and flavonoid contents and antioxidant properties of five edible mushroom samples—Lentinus edodes, Volvariella volvacea, Pleurotus eous, Pleurotus sajor-caju and Auricularia auricular—using three different extractants. Among the three different extractants, 50% (volume per volume; v/v ethanol was the most suitable for antioxidant extraction from the mushroom samples. The 50% (v/v ethanolic extract of dried L. edodes contained higher total phenolic and flavonoid contents than in the other mushroom extract samples. The antioxidant activities of 50% (v/v ethanolic extract of dried L. edodes showed the strongest 2,2-diphenyl-1-picrylhydrazyl radical-scavenging assay (64.34% compared to butylated hydroxyanisole (BHA and α-tocopherol at 500 μg/mL. The ethanolic extract showed a lower reducing power of 0.10 compared to BHA and α-tocopherol at 500 μg/mL. Moreover, the L. edodes ethanolic extract also had the highest chelating ability (66.28% which was lower than for ethylenediaminetetraacetic acid at 500 μg/mL and showed the strongest superoxide radical-scavenging activity (64.17% compared to BHA and α-tocopherol. Therefore, the 50% (v/v ethanolic extract of L. edodes could be used as a potential natural antioxidative source or as an ingredient in the fish and fishery product industries.

Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments

Directory of Open Access Journals (Sweden)

S.M. Badalyan

2004-04-01

Full Text Available Seventeen wood-decaying mushroom species (Coriolus versicolor, Flammulina velutipes, Ganoderma sp., Hypholoma fasciculare, H. sublateritium, Kühneromyces mutabilis, Lentinula edodes, Lentinus tigrinus, Pholiota alnicola, Ph. aurivella, Ph. destruens, Pleurotus cornucopiae, Pl. ostreatus, Polyporus subarcularius, Po. squamosus, Po. varius and Schizophyllum commune were paired with three Trichoderma species (T. harzianum, T. pseudokoningii, and T. viride and Clonostachys rosea in dual-culture experiments on an agar-based medium. Xylotrophic mushrooms and mycoparasitic fungi in general showed similar competitive ability; deadlock, or mutual inhibition after mycelial contact, was observed in 45.6% of pairings, while stable inhibition at a distance occurred in 4.4% of pairings. Replacement, or overgrowth of xylotrophic mushroom by a mycoparasitic fungus was observed in 29.4% of pairings; the opposite, overgrowth of the xylotrophic mushroom on the mycoparasitic fungus in 20.6%. of pairings. Of the xylotrophic mushrooms, Pl. ostreatus, Ganoderma sp., F. velutipes and H. fasciculare, showed the highest competitive ability against mycoparasitic fungi. Of the mycoparasitic fungi, T. harzianum showed the strongest competitive activity against xylotrophic mushrooms.

Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

Directory of Open Access Journals (Sweden)

I MADE SUDARMA

2015-09-01

Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

Investigation of antioxidative, antityrosinase and cytotoxic effects of extract of irradiated oyster mushroom

Directory of Open Access Journals (Sweden)

Nutsuda Banlangsawan

2016-02-01

Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

Science.gov (United States)

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-12-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

Science.gov (United States)

Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

2016-08-01

This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

Science.gov (United States)

Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

2013-01-01

The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

Directory of Open Access Journals (Sweden)

Ira Djajanegara

2012-02-01

Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

Risk of alpha radionuclides presence in cultivating substrate of oyster mushrooms - Pleurotus ostreatus

International Nuclear Information System (INIS)

Galanda, D.

2006-01-01

The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by ? -spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated. (author)

Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

International Nuclear Information System (INIS)

Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

International Nuclear Information System (INIS)

Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

2007-01-01

The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

Science.gov (United States)

Koutrotsios, Georgios; Zervakis, Georgios I.

2014-01-01

Olive mill wastewater (OMW) constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water) resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent's decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64%) followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW's phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment. PMID:24987685

Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

Directory of Open Access Journals (Sweden)

Georgios Koutrotsios

2014-01-01

Full Text Available Olive mill wastewater (OMW constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent’s decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64% followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW’s phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment.

Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

Directory of Open Access Journals (Sweden)

Ceci Sales-Campos

2009-12-01

Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

OpenAIRE

Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

2011-01-01

A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

Science.gov (United States)

Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez

2014-01-01

Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...

Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2016-09-01

Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

Structural Features and Healthy Properties of Polysaccharides Occurring in Mushrooms

Directory of Open Access Journals (Sweden)

Eva Guillamón

2012-12-01

Full Text Available Polysaccharides from mushrooms have attracted a great deal of attention due to the many healthy benefits they have demonstrated, such as immunomodulation, anticancer activity, prevention and treatment of cardiovascular diseases, antiviral and antimicrobial effects, among others. Isolation and purification of polysaccharides commonly involve several steps, and different techniques are actually available in order to increase extraction yield and purity. Studies have demonstrated that the molecular structure and arrangement significantly influence the biological activity; therefore, there is a wide range of analytical techniques for the elucidation of chemical structures. Different polysaccharides have been isolated from mushrooms, most of them consisting of β-linked glucans, such as lentinan from Lentinus edodes, pleuran from Pleurotus species, schizophyllan from Schizophyllum commune, calocyban from Calocybe indica, or ganoderan and ganopoly from Ganoderma lucidum. This article reviews the main methods of polysaccharide isolation and structural characterization, as well as some of the most important polysaccharides isolated from mushrooms and the healthy benefits they provide.

Extension of the shelf-life of fresh oyster mushrooms ( Pleurotus ...

African Journals Online (AJOL)

The objective of this study was to improve the preservation of fresh oyster mushrooms by modified atmosphere packaging (MAP) and chemical treatments. The MAP effects and treatments on organoleptic quality, weight loss, cell permeability, texture changes and polyphenol oxidase (PPO) activity were studied. In addition ...

Therapeutic potential of culinary-medicinal mushrooms for the management of neurodegenerative diseases: diversity, metabolite, and mechanism.

Science.gov (United States)

Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary

2015-01-01

Mushrooms have long been used not only as food but also for the treatment of various ailments. Although at its infancy, accumulated evidence suggested that culinary-medicinal mushrooms may play an important role in the prevention of many age-associated neurological dysfunctions, including Alzheimer's and Parkinson's diseases. Therefore, efforts have been devoted to a search for more mushroom species that may improve memory and cognition functions. Such mushrooms include Hericium erinaceus, Ganoderma lucidum, Sarcodon spp., Antrodia camphorata, Pleurotus giganteus, Lignosus rhinocerotis, Grifola frondosa, and many more. Here, we review over 20 different brain-improving culinary-medicinal mushrooms and at least 80 different bioactive secondary metabolites isolated from them. The mushrooms (either extracts from basidiocarps/mycelia or isolated compounds) reduced beta amyloid-induced neurotoxicity and had anti-acetylcholinesterase, neurite outgrowth stimulation, nerve growth factor (NGF) synthesis, neuroprotective, antioxidant, and anti-(neuro)inflammatory effects. The in vitro and in vivo studies on the molecular mechanisms responsible for the bioactive effects of mushrooms are also discussed. Mushrooms can be considered as useful therapeutic agents in the management and/or treatment of neurodegeneration diseases. However, this review focuses on in vitro evidence and clinical trials with humans are needed.

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates

OpenAIRE

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-01-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...

A Low Cost 3D Acquiring System for Mushroom Robot Based on Webcam and Line Laser

Directory of Open Access Journals (Sweden)

Gang Sun

2014-03-01

Full Text Available This paper presents a low cost 3D acquiring system for mushroom robot based on webcam and line laser. The system comprises Webcam, semiconductor line laser, motion platform and data process unit. The system can get the 3D information of the Pleurotus eryngii in bottle based on structured light scanning theory. Field test shows the accuracy of the height is less than 2mm and it can be use to locate the buds in the bottle correctly. It has the potention to fulfill the requirement of the location of the mushroom for thinning bud robot.

Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation

Directory of Open Access Journals (Sweden)

Silva Sueli Oliveira

2002-01-01

Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.

A Comprehensive Review of Tropical Milky White Mushroom (Calocybe indica P&C).

Science.gov (United States)

Subbiah, Krishnamoorthy Akkanna; Balan, Venkatesh

2015-09-01

A compressive description of tropical milky white mushroom (Calocybe indica P&C var. APK2) is provided in this review. This mushroom variety was first identified in the eastern Indian state of West Bengal and can be cultivated on a wide variety of substrates, at a high temperature range (30~38℃). However, no commercial cultivation was made until 1998. Krishnamoorthy 1997 rediscovered the fungus from Tamil Nadu, India and standardized the commercial production techniques for the first time in the world. This edible mushroom has a long shelf life (5~7 days) compared to other commercially available counterparts. A comprehensive and critical review on physiological and nutritional requirements viz., pH, temperature, carbon to nitrogen ratio, best carbon source, best nitrogen source, growth period, growth promoters for mycelia biomass production; substrate preparation; spawn inoculation; different supplementation and casing requirements to increase the yield of mushrooms has been outlined. Innovative and inexpensive methods developed to commercially cultivate milky white mushrooms on different lignocellulosic biomass is also described in this review. The composition profiles of milky white mushroom, its mineral contents and non-enzymatic antioxidants are provided in comparison with button mushroom (Agaricus bisporus) and oyster mushroom (Pleurotus ostreatus). Antioxidant assay results using methanol extract of milky white mushroom has been provided along with the information about the compounds that are responsible for flavor profile both in fresh and dry mushrooms. Milky white mushroom extracts are known to have anti-hyperglycemic effect and anti-lipid peroxidation effect. The advantage of growing at elevated temperature creates newer avenues to explore milky white mushroom cultivation economically around the world, especially, in humid tropical and sub-tropical zones. Because of its incomparable productivity and shelf life to any other cultivated mushrooms in the

Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

International Nuclear Information System (INIS)

Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

2013-01-01

Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

Effect of gamma and electron beam irradiation on the physico-chemical and nutritional properties of mushrooms: a review.

Science.gov (United States)

Fernandes, Ângela; Antonio, Amilcar L; Oliveira, M Beatriz P P; Martins, Anabela; Ferreira, Isabel C F R

2012-11-15

The short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. Thus, prolonging postharvest storage, while preserving their quality, would benefit the mushroom industry as well as consumers. There has been extensive research on finding the most appropriate technology for mushrooms preservation. Gamma, electron-beam and UV irradiation have been shown to be potential tools in extending the postharvest shelf-life of fresh mushrooms. Studies evaluating the effects of ionizing radiation are available mainly in cultivated species such as Agaricus bisporus, Lentinus edodes and Pleurotus ostreatus. This review comprises a comprehensive study of the effects of irradiation on physico-chemical parameters (weight, colour, texture and pH), chemical compounds including nutrients (proteins, sugars and vitamins) and non-nutrients (phenolics, flavonoids and flavour compounds), and on biochemical parameters such as enzymatic activity of mushrooms for different species and from different regions of the world. Copyright © 2012 Elsevier Ltd. All rights reserved.

First Collection and Identification of Wild Mushrooms in Western Iraq

Directory of Open Access Journals (Sweden)

Mustafa Nadhim Owaid

2014-04-01

Full Text Available Fungi are found everywhere and affect our lives every day from mushroom to industrially important product, plant helpers, plant pathogens and to human diseases. Therefore, we concentrated our attention on fungi that can be grown in our environment, while maintaining an interest in their performance in nature. About fifteen different species were collected and identified from different villages of Heet district, Anbar province, Iraq. Out of the fifteen, two species, naming Armillaria mellea and Coprinus disseminates were identified as species level and others: Pleurotus spp., Agaricus spp., Calvatia sp., Telephora sp., Fomes sp., Lepiota sp. and Morchella sp. as genus level only. This study was aimed to collect and identify wild mushrooms that grow naturally in different orchards and gardens on 2009-2013 in Heet city. A total of 15 species in 9 genera, 9 families and 5 orders belong to woody and fleshy species were identified for the first time in Anbar province. The collected mushrooms were appearing from November to February of each year.

Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

International Nuclear Information System (INIS)

Khalaf, M.A.; Atia, A.I.

2009-01-01

Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

Proximate compositions and bioactive compounds of edible wild and cultivated mushrooms from Northeast Thailand

Directory of Open Access Journals (Sweden)

Amporn Srikram

2016-11-01

Full Text Available Mushrooms are known as an excellent source of nutrients including macronutrients and bioactive compounds. Nutritional values were investigated involving proximate analysis, total antioxidant capacity (TAC, total phenol content (TPC and total flavonoid content (TFC of 10 edible wild mushroom species—Amanita calyptroderma Ark. et al., Amanita princeps Corner et Bas, A., Astraeus odoratus, Heimiella retispora (Pat. et. Bak. Boedijn., Mycoamaranthus cambodgensis (Pat. Trappe, Russula alboareolata Hongo, Russula cyanoxantha Schaeff.ex.Fr., Russula emetic (Schaeff. ex Fr. S.F.Gray., Russula virescens (Schaeff. fr., Termitomyces clypeatus Heim—and five cultivated mushroom species—Auricularia auricula-judae, Lentinus polychrous Lev., Lentinus squarrosulus Mont., Pleurotus sajor-caju (Fr. Sing, Volvariella vovacea (Bull. Ex.Fr. Sing. From the proximate analysis, the moisture contents of both wild and cultivated mushrooms ranged from 84.15% fresh weight (FW to 90.21% FW. The ash, crude protein, fat, crude fiber and carbohydrate contents of both wild and cultivated mushrooms were in the dry weight ranges 2.56–13.96%, 11.16–50.29%, 1.43–21.94%, 2.11–38.11% and 9.56–59.73%, respectively, and the contents of macronutrients in the mushrooms varied by variety. Wild mushrooms had a high fiber content compared to cultivated mushrooms. The contents of biologically active compounds of both wild and cultivated mushrooms also varied depending on the variety. Values for the TAC, TPC and TFC of wild mushrooms were higher than those of cultivated mushrooms. In conclusion, the proximate analysis for both wild and cultivated mushrooms was variety dependent and wild mushrooms contained a higher fiber content and more biologically active compounds than cultivated mushrooms.

Biosorption of cadmium (II) and lead (II) from aqueous solutions using mushrooms: A comparative study

Energy Technology Data Exchange (ETDEWEB)

Vimala, R., E-mail: vimararagu@yahoo.co.in [School of Biotechnology, Chemical and Biomedical Engineering, VIT University, Vellore 632014, Tamil Nadu (India); Das, Nilanjana [School of Biotechnology, Chemical and Biomedical Engineering, VIT University, Vellore 632014, Tamil Nadu (India)

2009-08-30

Sorption capacity of oyster mushroom (Pleurotus platypus), button mushroom (Agaricus bisporus) and milky mushroom (Calocybe indica) were evaluated on biosorption of heavy metals, viz. cadmium (II) and lead (II) from aqueous solutions. The optimum sorption conditions were studied for each metal separately. The desired pH of the aqueous solution was found to be 6.0 for the removal of cadmium (II) and 5.0 for removal of lead (II) for all the mushrooms. The percent removal of both the metals was found to increase with the increase in biosorbent dosage and contact time. The fitness of the biosorption data for Langmuir and Freundlich adsorption models was investigated. It was found that biosorption of cadmium (II) and lead (II) ions onto the biomass of the three mushrooms were better suitable to Langmuir than Freundlich adsorption model. P. platypus showed the highest metal uptake potential for cadmium (q{sub max} 34.96 mg/g) whereas A. bisporus exhibited maximum potential for lead (q{sub max} 33.78 mg/g). Milky mushroom showed the lowest metal uptake capacity for both the metals. The present data confirms that mushrooms may be used as efficient biosorbent for the removal of cadmium (II) and lead (II) ions from aqueous solution.

Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

Science.gov (United States)

Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

2015-01-01

Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

International Nuclear Information System (INIS)

Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

2014-01-01

Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

Characterization of Species of Cladobotryum which Cause Cobweb Disease in Edible Mushrooms Grown in Korea

OpenAIRE

Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young

2012-01-01

Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging...

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

Directory of Open Access Journals (Sweden)

Marli Camassola

2013-01-01

Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

The Removal of Turbidity and TSS of the Domestic Wastewater by Coagulation-Flocculation Process Involving Oyster Mushroom as Biocoagulant

Science.gov (United States)

Pardede, Astrid; Budihardjo, Mochamad Arief; Purwono

2018-02-01

Oyster mushroom (Pleurotus ostreatus) can be utilized as biocoagulant since it has chitin cell wall. Chitin has characteristics of bioactivity, biodegradability, absorption and could bind the metal ions. In this study, Oyster Mushroom is micronized and mixed with wastewater to treat turbidity and Total Suspended Solid (TSS) using coagulation-flocculation process employed jartest method. Various doses of Oyster mushroom, 600 mg/l, 1000 mg/l, and 2000 mg/l were tested in several rapid mixing rates which were 100 rpm, 125 rpm, and 150 rpm for 3 minutes followed by 12 minutes of slow mixing at 45 rpm. The mixture then was settled for 60 minutes with pH level maintained at 6-8. The result showed that the Oyster mushroom biocoagulant was able to remove 84% of turbidity and 90% of TSS. These reductions were achieved with biocoagulant dose of 600 mg/ L at 150 rpm mixing rate.

Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

Directory of Open Access Journals (Sweden)

Ayşenur Yılmaz

2017-01-01

Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

Essential and toxic element determination in edible mushrooms by neutron activation analysis

International Nuclear Information System (INIS)

Moura, Patricia Landim da Costa

2008-01-01

In this study concentrations of As, Br, Co, Cr, Cs, Fe, K, Na, Rb, Se and Zn were determined in edible mushrooms acquired from commercial establishments in the city of Sao Paulo and directly from Mogi das Cruzes, Suzano, Juquitiba and Mirandopolis producers. The analytical technique used for determining these elements in edible mushrooms was Instrumental Neutron Activation Analysis (INAA). Species of the Agaricus, Lentinus and Pleurotus genera were acquired during the period from November, 2006 to March, 2007. About 150 to 200 mg of freeze-dried mushrooms were irradiated in a neutron flux of 1012 cm -2 s -1 for 8 hours in the IEA-R1 nuclear research reactor at IPEN-CNEN-SP. In order to evaluate the precision and accuracy of the methodology, four reference materials: INCT-MPH-2 Mixed Polish Herbs and INCT-TL-1 Tea Leaves, NIST SRM 1577b Bovine Liver, and the material Mushroom from IAEA were analyzed. Results showed some variation in the element concentrations among the different genera. In some samples, arsenic was found but in low concentrations. Arsenic is probably derived from the contamination from pesticides used in the cultivation, in their the substrates where mushrooms uptake their nutrients. Although there are element concentration variations, mushrooms can still be considered a very rich nutritional source, mainly because of their low concentrations of Na, and due to the good source of K, Fe and Zn. (author)

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

Science.gov (United States)

Bercu, V.; Negut, C. D.; Duliu, O. G.

2010-12-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

Science.gov (United States)

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

Directory of Open Access Journals (Sweden)

Savić Milena D.

2009-01-01

Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

Directory of Open Access Journals (Sweden)

Eduardo Bernardi

2009-01-01

Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

Composted versus Raw Olive Mill Waste as Substrates for the Production of Medicinal Mushrooms: An Assessment of Selected Cultivation and Quality Parameters

Directory of Open Access Journals (Sweden)

Georgios I. Zervakis

2013-01-01

Full Text Available Two-phase olive mill waste (TPOMW, “alperujo” is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota, that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium. Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

Composted versus raw olive mill waste as substrates for the production of medicinal mushrooms: an assessment of selected cultivation and quality parameters.

Science.gov (United States)

Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis

2013-01-01

Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

Utilização do composto exaurido de Pleurotus sajor caju em rações de frangos de corte e seus efeitos no desempenho dessas aves - DOI: 10.4025/actascianimsci.v31i2.4811 Utilization of the spent substrate of Pleurotus sajor caju mushroom in broiler chicks ration and the effect on broiler chicken performance - DOI: 10.4025/actascianimsci.v31i2.4811

Directory of Open Access Journals (Sweden)

Antônio Gilberto Bertechini

2009-08-01

Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and

Modification of growth conditions by mm-waves of wood-decaying mushrooms cultures

International Nuclear Information System (INIS)

Avagyan, I.A.

2016-01-01

Basidial macromycetes are not only value food, but can be used as source of such biological active compounds as the genistein, β -glucans, glioxal-oxidase et al. In this work we used different frequencies of extremely high frequency of electromagnetic irradiation (EHF EMI) with the aim of obtaining mushroom cultures with increased fermentative activity by the modulation of its growth conditions during growth on the peptone media. We investigated the influence of the non-thermal extremely high frequency electromagnetic waves in the interval of 45-53 GHz on β-glucosidase activities of two species of wood-decaying mushroom. In this study we examined the most popular edible wood-decaying mushroom Pleurotus ostreatus, which is wide-spread in the forests and commercial mushroom Lentinula edodes, under influence of such an abiotic factor as the extremely high frequency waves in the interval of 45 GHz - 53 GHz during 20 and 40 min on the 7th day of mycelial culture's growth. After the treatment of cultures we continued their growth and on the 3th day we examined the influence of these waves on fermentative activity of mycelial extracts. The some conditions of such treatment led to significant rising of β-glucosidase activities in the extracts of mycelial cultures

Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

Directory of Open Access Journals (Sweden)

José Maria Rodrigues da Luz

2012-12-01

Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

Crescimento micelial de Pleurotus ostreatus em resíduo de Simarouba amara Mycelial growth of Pleurotus ostreatus in Simarouba amara sawdust

Directory of Open Access Journals (Sweden)

Ceci Sales-Campos

2008-11-01

Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.

Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

Directory of Open Access Journals (Sweden)

Li Fen

2014-01-01

Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

Discrimination Method of the Volatiles from Fresh Mushrooms by an Electronic Nose Using a Trapping System and Statistical Standardization to Reduce Sensor Value Variation

Directory of Open Access Journals (Sweden)

Kouki Fujioka

2013-11-01

Full Text Available Electronic noses have the benefit of obtaining smell information in a simple and objective manner, therefore, many applications have been developed for broad analysis areas such as food, drinks, cosmetics, medicine, and agriculture. However, measurement values from electronic noses have a tendency to vary under humidity or alcohol exposure conditions, since several types of sensors in the devices are affected by such variables. Consequently, we show three techniques for reducing the variation of sensor values: (1 using a trapping system to reduce the infering components; (2 performing statistical standardization (calculation of z-score; and (3 selecting suitable sensors. With these techniques, we discriminated the volatiles of four types of fresh mushrooms: golden needle (Flammulina velutipes, white mushroom (Agaricus bisporus, shiitake (Lentinus edodes, and eryngii (Pleurotus eryngii among six fresh mushrooms (hen of the woods (Grifola frondosa, shimeji (Hypsizygus marmoreus plus the above mushrooms. Additionally, we succeeded in discrimination of white mushroom, only comparing with artificial mushroom flavors, such as champignon flavor and truffle flavor. In conclusion, our techniques will expand the options to reduce variations in sensor values.

Vitamin D2 Stability During the Refrigerated Storage of Ultraviolet B-Treated Cultivated Culinary-Medicinal Mushrooms.

Science.gov (United States)

Slawinska, Aneta; Fornal, Emilia; Radzki, Wojciech; Jablonska-Rys, Ewa; Parfieniuk, Ewa

2017-01-01

The effects of ultraviolet B (UVB) irradiation on the synthesis of vitamin D2 and its stability during refrigerated storage was determined in fresh cultivated culinary-medicinal mushrooms (Agaricus bisporus, Pleurotus ostreatus, and Lentinus edodes) after harvest. The irradiated mushrooms were stored at 4°C for up to 10 days. The concentrations of vitamin D2 and ergosterol were determined using ultrahigh-performance liquid chromatography/tandem mass spectrometry. The cultivated mushrooms not treated with UVB were devoid of vitamin D2. After UVB irradiation, we obtained mushrooms with a large amount of ergocalciferol. A. bisporus showed the lowest vitamin D2 content (3.55 ± 0.11 μg D2/g dry weight); P. ostreatus contained 58.96 ± 1.15 μg D2/g dry weight, and L. edodes contained 29.46 ± 2.21 μg/g dry weight. During storage at 4°C, the amount of vitamin D2 was gradually decreased in P. ostreatus and L. edodes, whereas in A. bisporus vitamin D2 gradually increased until the sixth day, then decreased. Mushrooms exposed to UVB radiation contain a significant amount of vitamin D2 and are therefore an excellent food source of vitamin D.

Antihyperlipidemic activities of Pleurotus ferulae on biochemical and histological function in hypercholesterolemic rats

Directory of Open Access Journals (Sweden)

Nuhu Alam

2011-01-01

Full Text Available Background: Pleurotus ferulae is an edible mushroom has been widely used for nutritional and medicinal purposes. Irrespective of the medicinal importance or therapeutic potentials of P. ferulae, there have not been studies on anti-hyperlipidemic properties. Therefore, the present study investigates the effects of dietary P. ferulae fruiting bodies on plasma and feces biochemical and on the liver histological status in hypercholesterolemic rats. Methods: Six weeks old female Sprague-Dawley albino rats were divided into three groups of 10 rats each. Then biochemical and histological examinations were performed. Results: Feeding of a diet containing 5% P. ferulae fruiting bodies to hypercholesterolemic rat reduced plasma total cholesterol, triglyceride, low-density lipoprotein (LDL, total lipid, phospholipids, and LDL/high-density lipoprotein ratio by 30.02, 49.31, 71.15, 30.23, 21.93, and 65.31%, respectively. Mushroom also significantly reduced body weight in hypercholesterolemic rats. However, it had no adverse effects on plasma albumin, total bilirubin, direct bilirubin, creatinin, blood urea nitrogen, uric acid, glucose, total protein, calcium, sodium, potassium, chloride, inorganic phosphate, magnesium, and enzyme profiles. Feeding mushroom increased total lipid and cholesterol excretion in feces. The plasma lipoprotein fraction, separated by agarose gel electrophoresis, indicated that P. ferulae significantly reduced plasma β and pre-β-lipoprotein, while increased the α-lipoprotein. A histological study of hepatic cells by conventional hematoxylin-eosin and oil red O staining showed normal findings for mushroom-fed hypercholesterolemic rats. Conclusions: The present study suggests that 5% P. ferulae diet supplement provides health benefits, at least partially, by acting on the atherogenic lipid profile in hypercholesterolemic rats.

In Vitro Antioxidant and In Vivo Hypolipidemic Effects of the King Oyster Culinary-Medicinal Mushroom, Pleurotus eryngii var. ferulae DDL01 (Agaricomycetes), in Rats with High-Fat Diet-Induced Fatty Liver and Hyperlipidemia.

Science.gov (United States)

Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun

2017-01-01

We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.

Influence of 50 Hz magnetic field on growth of mushroom species: Shitake (Lentinus edodes) and Oyster (Pleurotus astreatus)

Energy Technology Data Exchange (ETDEWEB)

Bambang Anggoro; Pakpahan, P.M.; Fajar Dwi Kusnoaji; Sirait, K.T. [Bandung Institute of Technology (Indonesia). Faculty of Industrial Technology

1999-07-01

Investigation on effects of electromagnetic fields on different aspects of biological systems has been done by much research. Our present study, which has been carried out under the joint research between the laboratory of High voltage and High current Engineering and the Laboratory of Microbiology of Institut Teknologi Bandung, investigates the influence of 50 Hz magnetic field on the growth of several species of mushroom. In this study, we observed growth of mushroom, from spora up to fully ripped stages, under magnetic field exposure of different intensity from 0,1 mT to 1,7 mT. During exposure the room condition was held constant at a temperature of 20{sup o}C and 95% humidity. We noted that some parameters such as: mushroom growth velocity, shape, dimension, quantity, color and period of mushroom ovary are significantly influenced by magnetic energy absorbed. (author)

A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action

Directory of Open Access Journals (Sweden)

Ken-ichiro Minato

2017-01-01

Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.

Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

Science.gov (United States)

Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

2017-06-01

Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

Recycling of Vineyard and Winery Wastes as Nutritive Composts for Edible Mushroom Cultivation

Science.gov (United States)

Petre, Marian; Teodorescu, Alexandru

2011-01-01

Every year, in Romania huge amounts of wine and vine wastes cause serious environmental damages in vineyards as well as nearby winery factories, for instance, by their burning on the soil surface or their incorporation inside soil matrix. The optimal and efficient way to solve these problems is to recycle these biomass wastes as main ingredients in nutritive composts preparation that could be used for edible mushrooms cultivation. In this respect, the main aim of this work was to establish the best biotechnology of winery and vine wastes recycling by using them as appropriate growth substrata for edible and medicinal mushrooms. According to this purpose, two mushroom species of Basidiomycetes, namely Lentinula edodes as well as Pleurotus ostreatus were used as pure mushroom cultures in experiments. The experiments of inoculum preparation were set up under the following conditions: constant temperature, 23° C; agitation speed, 90-120 rev min-1 pH level, 5.0-6.0. All mycelia mushroom cultures were incubated for 120-168 h. In the next stage of experiments, the culture composts for mushroom growing were prepared from the lignocellulose wastes as vine cuttings and marc of grapes in order to be used as substrata in mycelia development and fruit body formation. The tested culture variants were monitored continuously to keep constant the temperature during the incubation as well as air humidity, air pressure and a balanced ratio of the molecular oxygen and carbon dioxide. In every mushroom culture cycle all the physical and chemical parameters that could influence the mycelia growing as well as fruit body formation of L. edodes and P. ostreatus were compared to the same fungal cultures that were grown on poplar logs used as control samples.

[Effect of cultivation in zinc media on the growth of and the degree of zinc in organic form in transgenic metallothionein mushroom].

Science.gov (United States)

Sheng, Ji-Ping; Shen, Lin; Ru, Bing-Gen

2009-03-01

Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich and metal-binding functional proteins. Transgenic MT mushroom can be used as functional food additives, but its zinc-enriching ability has not been studied systemically until now. The zinc contents in mycelia of transgenic MT mushroom (Pleurotus ostreatus) and wild type mushroom mycelia cultivated in different zinc concentration media were analyzed by ICP-OES. The growth status, zinc-enriching ability and degree of zinc in organic form (DZOF) were also analyzed. Results showed that MT mushroom mycelia grew rapidly, but the growth was inhibited when the zinc content in solid media was higher than 1.6 mmol x L(-1). MT mushroom mycelia could enrich more zinc than that of wild type, and the zinc content in MT mushroom mycelia could be 2.56-27.49 mg x kg(-1) when it was cultivated in a liquid media with 0.6-1.2 mmol x L(-1) zinc. DZOF of MT mushroom mycelia in a liquid media with 0.6 mmol x L(-1) zinc at 7 d was significantly higher (88.7%) than that in the wild type (82.1%, alpha = 0.05), but there was no significant difference in DZOF when the MT mushroom mycelia was cultivated in a liquid media with different zinc content at 7 d.

Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh Produtividade e composição nutricional de linhagens de cogumelo‑ostra recentemente lançadas em Bangladesh

Directory of Open Access Journals (Sweden)

Mostak Ahmed

2013-02-01

Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.

Antimelanogenesis and Anti-Inflammatory Activity of Selected Culinary-Medicinal Mushrooms.

Science.gov (United States)

Saad, Hazwani Mat; Sim, Kae Shin; Tan, Yee Shin

2018-01-01

Five culinary-medicinal mushrooms are commonly available in the Malaysian market: Agaricus bisporus (white and brown), Ganoderma lucidum, Hypsizygus marmoreus, Pleurotus floridanus, and P. pulmonarius. These species were selected for use in the current study, the aim of which was to investigate the antimelanogenesis and anti-inflammatory activity of these mushrooms in an attempt to evaluate their potential use in cosmeceuticals. Mushroom fruiting bodies were extracted with hot water, and the extracts were freeze-dried before testing. The antimelanogenesis activity of the extracts was determined by cell viability assay, measurement of intracellular melanin content, and cellular tyrosinase assay with B16F10 melanoma cells. The anti-inflammatory activity of the mushroom extracts was tested by measuring the levels of nitric oxide (NO), tumor necrosis factor (TNF)-α, and interleukin-10 excreted by RAW264.7 macrophages. Brown A. bisporus reduced intracellular melanin content to the largest extent-up to 57.05 ± 3.90%-without a cytotoxic effect on B16F10 melanoma cells. This extract also reduced cellular tyrosinase activity to 17.93 ± 2.65%, performing better than kojic acid, the positive control. In parallel, the extract from brown A. bisporus, at the highest concentration tested, has appreciable anti-inflammatory activity through reductions of NO and TNF-α levels. The other 5 extracts showed moderate antimelanogenesis and anti-inflammatory activities. In summary, our findings show that A. bisporus (brown) extract has the potential to be used as an ingredient in whitening skincare products and to sooth the inflammatory response on the skin.

EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Ummu Kalsum

2011-09-01

Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

Pengaruh jamur tiram putih (pleurotus ostreatus terhadap kadar glukosa darah, profil lipid dan kadar MDA pada tikus (rattus norvegicus diabetes melitus

Directory of Open Access Journals (Sweden)

Purbowati Purbowati

2016-06-01

Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.

Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

Science.gov (United States)

Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

2018-07-25

The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of umami taste in mushroom extracts by chemical analysis, sensory evaluation, and an electronic tongue system.

Science.gov (United States)

Phat, Chanvorleak; Moon, BoKyung; Lee, Chan

2016-02-01

Seventeen edible mushrooms commercially available in Korea were analysed for their umami taste compounds (5'-nucleotides: AMP, GMP, IMP, UMP, XMP; free amino acids: aspartic, glutamic acid) and subjected to human sensory evaluation and electronic tongue measurements. Amanita virgineoides featured the highest total 5'-nucleotide content (36.9 ± 1.50 mg/g), while monosodium glutamate-like components (42.4 ± 6.90 mg/g) were highest in Agaricus bisporus. The equivalent umami concentration (EUC) ranged from 1.51 ± 0.42 to 3890 ± 833 mg MSG/g dry weight; most mushrooms exhibited a high umami taste. Pleurotus ostreatus scored the highest in the human sensory evaluation, while Flammulina velutipes obtained the maximum score in the electronic tongue measurement. The EUC and the sensory score from the electronic tongue test were highly correlated, and also showed significant correlation with the human sensory evaluation score. These results suggest that the electronic tongue is suitable to determine the characteristic umami taste of mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dietary fibers from mushroom sclerotia. 4. In vivo mineral absorption using ovariectomized rat model.

Science.gov (United States)

Wong, Ka-Hing; Katsumata, Shin-Ichi; Masuyama, Ritsuko; Uehara, Mariko; Suzuki, Kazuharu; Cheung, Peter C K

2006-03-08

The effect of three novel dietary fibers (DFs) prepared from mushroom sclerotia, namely, Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos, on calcium and magnesium absorption was evaluated in ovariectomized (OVX) rats fed with sclerotial DF based and low Ca (0.3%) diets for 14 days. The animals in the W. cocos DF diet group possessed significantly (p cocos DF group were also significantly (p cocos DF could improve the overall Ca and Mg absorptions of the OVX rats fed a low Ca diet. The potential use of sclerotial DFs as a functional food ingredient for enhancing mineral absorption is also discussed.

Nutriceutical potential of Pleurotus tuber-regium sclerotium

Directory of Open Access Journals (Sweden)

R. C. Ohiri

2018-04-01

Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

Characterization of Species of Cladobotryum which Cause Cobweb Disease in Edible Mushrooms Grown in Korea.

Science.gov (United States)

Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young

2012-09-01

Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging from 5~32℃. Rapid growth of the isolates to colony diameters of 47~82 mm was observed at conditions of 18~22℃. No growth was observed at 32℃. C. mycophilum produced a yellowish red pigment while C. varium produced a cream colored pigment after cultivation for 25 days on PDA. Phylogenetic analysis of the internal transcribed spacer region and partial 28S rDNA from the four isolates confirmed they were C. mycophilum and C. varium. Cross pathogenicity tests revealed that the two isolates of C. mycophilum were highly pathogenic toward three mushroom types, but not toward H. marmoreus. The two isolates of C. varium were less pathogenic than those of C. mycophilum, but were pathogenic toward all mushroom types evaluated.

Yield and size of oyster mushroom grown on rice/wheat straw basal substrate supplemented with cotton seed hull.

Science.gov (United States)

Yang, Wenjie; Guo, Fengling; Wan, Zhengjie

2013-10-01

Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.

Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

Directory of Open Access Journals (Sweden)

Akpaja EO

2012-02-01

Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

Content of Chemical Elements in Wood-Destroying Fungi

Directory of Open Access Journals (Sweden)

Strapáč I.

2016-12-01

Full Text Available The aim of this study was to examine the content of chemical elements in the dried fruiting bodies of edible wood decaying fungi such as Honey mushrooms (Armillaria mellea, Shiitakes (Lentinus edodes and Oyster mushrooms (Pleurotus ostreatus. Powdered samples of fungi were mineralized in a microwave digestion. Twenty-one (21 chemical elements were detected in the plasma of the device ICP-MS AGILENT 7500c by accredited methods with the aid of calibration curves. The content of individual elements varied within a considerable range. The highest contents of K, Mn, Cu and Cd were found in the fruiting bodies of Honey mushrooms (Armillaria mellea. Shiitakes (Lentinus edodes had the highest content of B and Mo. Significant differences were found in the content of elements in the Oyster mushrooms (Pleurotus ostreatus from Slovakia, Hungary and China. The highest content of Al was found in the Oyster mushrooms (Pleurotus ostreatus from Hungary. The Chinese oysters had a maximum contents of Ca, Mg, Co, Pb, As and U. The Oyster mushrooms (Pleurotus ostreatus from Lemešany (Slovakia had the highest contents of Na, Zn, Fe, Se, Ag, Hg and Cr. The difference of chemical element content could be influenced by the genotype of the fungus and by the composition of substrate on which mushroom grow up.

Dietary fibers from mushroom sclerotia: 1. Preparation and physicochemical and functional properties.

Science.gov (United States)

Wong, Ka-Hing; Cheung, Peter C K

2005-11-30

Preparation of three novel dietary fibers (DFs) from mushroom sclerotia, namely, Pleurotus tuberregium, Polyporous rhinocerus, and Wolfiporia cocos, by a scale-up modified AOAC procedure using industrial enzymes was investigated. A remarkably high level of total dietary fiber (TDF) ranging from 81.7 to 96.3% sample dry matter (DM), in which a content of nonstarch polysaccharide (NSP) ranging from 86.6 to 94.3% sclerotial TDF DM, was obtained from the three sclerotia. All sclerotial DFs were rich in beta-glucan (the glucose residue ranged from 89.7 to 94.5% NSP DM) with a very low level of resistant glycogen (ranged from 3.77 to 3.94% sclerotial TDF DM). All three novel sclerotial DFs also exhibited similar, if not better, physicochemical and functional properties (pH, color, water binding capacity, oil holding capacity, and emulsifying properties) as those of barely DF control and commercial DF-rich ingredients. The potential use of the three mushroom sclerotial DFs as a new beta-glucan type DF-rich ingredient in the food industry was discussed.

SYNTHESIS OF AROMA COMPOUNDS BY Pleurotus ostreatus (Jacq.:Fr. Kumm. CULTURED ON VARIOUS SUBSTRATES E. N. Vlasenko, J. V. Stepnevskaya, O. V.

Directory of Open Access Journals (Sweden)

E. N. Vlasenko

2017-08-01

Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.

The potential of Pleurotus-treated olive mill solid waste as cattle feed.

Science.gov (United States)

Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

2009-12-01

The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and oyster (Pleurotus ostreatus) mushrooms.

Science.gov (United States)

Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E

2009-02-01

Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.

Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

Directory of Open Access Journals (Sweden)

Marian Petre

2009-11-01

Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts.The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum asthe longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for theirvalorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

Directory of Open Access Journals (Sweden)

Marian Petre

2009-12-01

Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts. The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum as the longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for their valorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

Science.gov (United States)

Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

2015-01-01

In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

UTILIZATION OF AREN (Arenga pinnata Merr. SAWMILLING WASTE FOR EDIBLE MUSHROOM CULTIVATION MEDIA

Directory of Open Access Journals (Sweden)

Djarwanto

2016-04-01

Full Text Available Aren (Arenga pinnata Merr. is a multipurpose tree that can be utilized for palm sugar, alcoholic drinks, beverages and construction wood. The use of aren sawdust has not been studied intensively. This study examines the utilization of aren sawdust as cultivation media for edible mushrooms. Aren sawdust was mixed with rice bran, CaCO3, gypsum, fertilizers and distilled water before sterilization in 30 minutes pressurized autoclave at 1210C and 1.5atm. The mixed media was inoculated with pure cultures containing four mushrooms species (Pleurotus flabellatus, P. ostreatus, P. sajor-caju and Lentinula edodes and incubated for five weeks to allow mycelium growth producing fruit bodies. The fruit bodies were harvested everyday within four months and examined for its gained mushroom-weight and biological conversion efficiency/BE. The core part of aren trunk was cut into smaller pieces of 10 cm (width by 5 cm (thickness, by 120 cm (length. Each core sample was bored from the surface inward, creating holes with a particular distance apart. Each hole was inoculated with pure cultures containing 6 mushroom species (four species above, P. cystidiosus and Auricularia polytricha. The inoculated samples were slanted on bamboo support, and placed in a bamboo hut. Harvesting was carried out everyday after the fruiting body became mature and examined for its gained mushroom weight. Results show that the use of sawdust supplemented with nutritious material is more likely to improve the mushroom yield than that of aren sawn-timber core. In this case, the BE values with aren-sawdust media were 21.97-89.45% (P. flabellatus, 15.36-105.36% (P. ostreatus, 63.88-76.86% (P. sajor-caju, and up to 62.88% (L. edodes. Meanwhile, the yields (gained mushroom weight with aren sawn-timber media were 210g (P. ostreatus, 368g (P. flabellatus, 331g (P. sajor-caju and 48g (A. polytricha; however, P. cystidiosus and L. edodes inoculated on aren stem core failed to grow.

Effects of Eryngii mushroom (Pleurotus eryngii) and Lactobacillus plantarum on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880).

Science.gov (United States)

Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa

2016-10-01

This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.

Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

Directory of Open Access Journals (Sweden)

Juliet B. Akinyele

2012-09-01

Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

Science.gov (United States)

Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

2014-01-01

Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

Characteristics of radiocesium concentration by mushrooms and microorganisms

International Nuclear Information System (INIS)

Sugiyama, Hideo; Terada, Hiroshi; Kuwahara, Chikako; Shibata, Hisashi; Maeda, Yoko; Kato, Fumio

2000-01-01

The 137 Cs values in cultured edible fruiting bodies of Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus) were 2-3 orders of magnitude higher than those in the wild mushrooms. The concentration ratio (CR, 137 Cs or Cs concentration in the dried cultured fruiting bodies or mycelia/ 137 Cs or Cs concentration in the fresh medium) suggested that 137 Cs in the medium actively migrated into the mushroom. The 137 Cs and stable Cs uptake by the cultured fruiting bodies of P. ostreatus were affected by the presence of K the same as the mycelia. Streptomyces lividans TK24 (S.lividans) and Streptomyces sp. TOHO-2 (Streptomyces sp.), one of the soil microorganisms, grown in the presence of Cs showed high accumulation of Cs in the mycelia. Elementary analysis of P. ostreatus and S. lividans were performed using a scanning electron microscopy-energy dispersive X-ray microanalyzer. The ratio of Cs in the stationary phase to that in the proliferation phase at the mycelial root of P. ostreatus formed in the early stage was about five times that at the mycelial tip. S. lividans and Streptomyces sp. grown on the YM agar plate containing CsCl showed white spots locating at a similar intervals. Concentrations of Cs, P, O and Mg in the white spots were higher than those in other regions. (author)

Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania

Directory of Open Access Journals (Sweden)

Jordan Merkuri

2016-03-01

Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.

Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde: Nutritional value and in vitro neurite outgrowth activity in rat pheochromocytoma cells.

Science.gov (United States)

Phan, Chia-Wei; Wong, Wei-Lun; David, Pamela; Naidu, Murali; Sabaratnam, Vikineswary

2012-07-19

Drugs dedicated to alleviate neurodegenerative diseases like Parkinson's and Alzheimer's have always been associated with debilitating side effects. Medicinal mushrooms which harness neuropharmacological compounds offer a potential possibility for protection against such diseases. Pleurotus giganteus (formerly known as Panus giganteus) has been consumed by the indigenous people in Peninsular Malaysia for many years. Domestication of this wild mushroom is gaining popularity but to our knowledge, medicinal properties reported for this culinary mushroom are minimal. The fruiting bodies P. giganteus were analysed for its nutritional values. Cytotoxicity of the mushroom's aqueous and ethanolic extracts towards PC12, a rat pheochromocytoma cell line was assessed by using 3-[4,5-dimethythiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Neurite outgrowth stimulation assay was carried out with nerve growth factor (NGF) as control. To elucidate signaling mechanisms involved by mushroom extract-induced neurite outgrowth, treatment of specific inhibitor for MEK/ERK and PI3K signalling pathway was carried out. The fruiting bodies of P. giganteus were found to have high carbohydrate, dietary fibre, potassium, phenolic compounds and triterpenoids. Both aqueous and ethanolic extracts induced neurite outgrowth of PC12 cells in a dose- and time-dependant manner with no detectable cytotoxic effect. At day 3, 25 μg/ml of aqueous extract and 15 μg/ml of ethanolic extract showed the highest percentage of neurite-bearing cells, i.e. 31.7 ± 1.1% and 33.3 ± 0.9%; respectively. Inhibition treatment results suggested that MEK/ERK and PI3K/Akt are responsible for neurite outgrowth of PC12 cells stimulated by P. giganteus extract. The high potassium content (1345.7 mg/100 g) may be responsible for promoting neurite extension, too. P. giganteus contains bioactive compounds that mimic NGF and are responsible for neurite stimulation. Hence, this mushroom may be

ALTERNATIVE NOURISHMENT BESIDE VEGETABLE AND FRUIT IN OUR COUNTRY SOURCE: WILD MUSHROOM (Pleurotus eryngii var. ferulae

Directory of Open Access Journals (Sweden)

Mehmet Akyüz

2007-04-01

Full Text Available P. eryngii var. ferulae which is known very well in Eastern Anatolia Region and picked up from the nature in spring months is sold by the side of the roads and in neighbour markets with the name of ‘’ çaşır, çakşır, çaşur, heliz, kırkor, göbek, göbelek and mendik’’ mushroom. As a member of Apiaceae family; Ferulae sp. that preads at the slope of the mountains, grows up naturally on the roots of its species that remained from the previous year especially at the altitude of 1000-2500 meters on high mountains. It is known that local people has benefited from the natural products special to periodic times. It is seen that it is not benefited from alternative natural nourishment resources like cultuıre vegetables and fruit with their important features and effective nutritive value. In our opinion, this article will be useful for mentioning the importance of the mushroom beside the vegetables and fruits which are vital for our life. It will be useful to expose the medical features, nourishment content and effective nutritive valu and effective nutritious features of mushroom. Furthermore, It is determined that it is necessary to describe P. eryngii and its similarities with the identification of scientific facts as species, subspecies, variety, taxa or synonym in our country.

Effect of substrate on the growth, nutritional and bioactive ...

African Journals Online (AJOL)

rosemary

2016-07-06

Jul 6, 2016 ... growth, determining nutritional and bioactive components of two oyster mushroom, Pleurotus ostreatus and. Pleurotus ... and the method of cultivation are of major importance ..... rendered alkaline with a few drops of ammonia solution. 5 ..... production and non-enzymatic antioxidant activity of Pleurotus.

Neurite outgrowth stimulatory effects of culinary-medicinal mushrooms and their toxicity assessment using differentiating Neuro-2a and embryonic fibroblast BALB/3T3.

Science.gov (United States)

Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary

2013-10-11

Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health.

Levels of platinum group elements and rare-earth elements in wild mushroom species growing in Poland.

Science.gov (United States)

Mleczek, Mirosław; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Gąsecka, Monika

2016-01-01

Due to limited data-describing abilities of mushrooms to accumulate platinum group elements (PGEs) and rare-earth elements (REEs), the aim of this study was to determine, by inductively coupled plasma optical emission spectrometry followed by microwave-assisted sample digestion by nitric acid, the content of these elements in 20 mushroom species (10 above ground and 10 growing on wood), mostly edible, collected near a busy trunk road. The highest content of PGEs in above-ground mushroom species was observed in Lepista gilva and Suillus bovinus fruit bodies (0.38 ± 0.05 and 0.37 ± 0.03 mg kg(-1) DW, respectively), while in mushrooms growing on wood, the highest content was observed in Pleurotus ostreatus (0.35 ± 0.04 mg kg(-1) DW). The mean content of PGEs for both these groups was 0.23 ± 0.08 and 0.26 ± 0.07 mg kg(-1) DW, respectively. The highest content of REEs in Suillus luteus and Tricholoma equestra was 5.03 ± 0.50 and 2.18 ± 0.56 mg kg(-1) DW, respectively, but within mushrooms growing on wood in Ganoderma applanatum fruiting bodies it was 4.19 ± 0.78 mg kg(-1) DW. Mean contents of REEs were 1.39 ± 1.21 and 1.61 ± 0.97 mg kg(-1) DW in above-ground species and species growing on wood, respectively. Generally, the group of mushroom species growing on wood was capable of slightly higher accumulation of both REEs and PGEs. No limits have been established for both the groups until now.

Efficiency of treatments for controlling Trichoderma spp during spawning in cultivation of lignicolous mushrooms.

Science.gov (United States)

Colavolpe, María Belén; Mejía, Santiago Jaramillo; Albertó, Edgardo

2014-01-01

Trichoderma spp is the cause of the green mold disease in mushroom cultivation production. Many disinfection treatments are commonly applied to lignocellulose substrates to prevent contamination. Mushroom growers are usually worried about the contaminations that may occur after these treatments during handling or spawning. The aim of this paper is to estimate the growth of the green mold Trichoderma sp on lignocellulose substrates after different disinfection treatments to know which of them is more effective to avoid contamination during spawning phase. Three different treatments were assayed: sterilization (121 °C), immersion in hot water (60 and 80 °C), and immersion in alkalinized water. Wheat straw, wheat seeds and Eucalyptus or Populus sawdust were used separately as substrates. After the disinfection treatments, bagged substrates were sprayed with 3 mL of suspension of conidia of Trichoderma sp (10(5) conidia/mL) and then separately spawned with Pleurotus ostreatus or Gymnopilus pampeanus. The growth of Trichoderma sp was evaluated based on a qualitative scale. Trichoderma sp could not grow on non-sterilized substrates. Immersions in hot water treatments and immersion in alkalinized water were also unfavorable treatments for its growth. Co- cultivation with mushrooms favored Trichoderma sp growth. Mushroom cultivation disinfection treatments of lignocellulose substrates influence on the growth of Trichoderma sp when contaminations occur during spawning phase. The immersion in hot water at 60 °C for 30 min or in alkalinized water for 36 h, are treatments which better reduced the contaminations with Trichoderma sp during spawning phase for the cultivation of lignicolous species.

Pleurotus sajor caju

African Journals Online (AJOL)

Administrator

The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

Cadmium determination in Lentinus edodes mushroom species Determinação de cádmio em cogumelos da espécie Lentinus edodes

Directory of Open Access Journals (Sweden)

Vera Akiko Maihara

2012-09-01

Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.Muitos estudos têm encontrado elementos tóxicos em cogumelos. Sabe-se que algumas espécies de cogumelos comestíveis acumulam elevados níveis de contaminantes inorgânicos, como cádmio, mercúrio e chumbo. Há cerca de duas mil espécies de cogumelos comestíveis, mas apenas 25 espécies são cultivadas e usadas como alimentos. No Brasil, as espécies mais comercializadas e consumidas são Agaricus bisporus, conhecida como Champignon de Paris; Lentinus edodes ou Shitake, e Pleurotus sp, também chamada de Shimeji ou Hiratake. Neste trabalho, o cádmio (Cd foi determinado em amostras de cogumelos da espécie Lentinus edodes cultivadas em diversas cidades do Estado de São Paulo e algumas amostras importadas do Japão e da China. O cádmio foi determinado por espectrometria de absor

EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

Directory of Open Access Journals (Sweden)

S. N. FASEHAH

2017-04-01

Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

Biodegradation and detoxification of olive mill wastewater by selected strains of the mushroom genera Ganoderma and Pleurotus

Czech Academy of Sciences Publication Activity Database

Ntougias, S.; Baldrian, Petr; Ehaliotis, C.; Nerud, František; Antoniou, T.; Merhautová, Věra; Zervakis, G.

2012-01-01

Roč. 88, č. 5 (2012), s. 620-626 ISSN 0045-6535 Institutional research plan: CEZ:AV0Z50200510 Keywords : White-rot fungi * Mushroom * Toxicity Subject RIV: EE - Microbiology, Virology Impact factor: 3.137, year: 2012

EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

Directory of Open Access Journals (Sweden)

MARÍA DEL PILAR RÍOS

2010-12-01

3 inteiramente casualizado. Na terceira seção avaliada, se avaliou a colonização e frutificação do fungo em bagaço de cana utilizando parâmetros biológicos, tais como desempenho, eficiência e taxa de produção de sementes, com o inteiramente casualizado 3x3. 0 meio alternativo em pH 5,0 foi o mais adequado para o crescimento de Pleurotus ostreatus, demonstrando sua adaptabilidade a meios com alto conteúdo de carboidrato, cujos níveis de renda foram adequados para a produção competitiva e fruticultura diminuindo o tempo de incubação e colheita.Alternative media were evaluated for the propagation of Pleurotus ostreatus and its behavior was compared with that of a commercial media. The response to these media was measured through the adaptation of the fungus in barley for obtaining the commercial seed and this one in its turn in the response to a substratum based on cane bagasse for obtaining oyster mushrooms. In the first phase the fungus was obtained and planted in a solid media of potato extract at two concentrations and three pH values using a factorial design 2x3 (pH vs. concentration of potato extract. In the second phase was measured the growth of Pleurotus ostreatus inoculated in sterilized hydrated barley through a completely random design 3x3. In the third phase was evaluated the colonization and fructification of the fungus in cane bagasse using parameters as biológical efficiency performance and seed production rate, with a completely random design 3x3. The alternative media with pH 5,0 was the most adequate for the growth of Pleurotus ostreatus, displaying its adaptability to media with high carbohydrates content which performances were appropiate to obtain competitive production levels in growth and fructification, diminishing thus the incubation and harvesting time.

New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

Science.gov (United States)

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-06-01

Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

Essential and toxic element determination in edible mushrooms by neutron activation analysis; Determinacao de elementos essenciais e toxicos em cogumelos comestiveis por analise por ativacao com neutrons

Energy Technology Data Exchange (ETDEWEB)

Moura, Patricia Landim da Costa

2008-07-01

In this study concentrations of As, Br, Co, Cr, Cs, Fe, K, Na, Rb, Se and Zn were determined in edible mushrooms acquired from commercial establishments in the city of Sao Paulo and directly from Mogi das Cruzes, Suzano, Juquitiba and Mirandopolis producers. The analytical technique used for determining these elements in edible mushrooms was Instrumental Neutron Activation Analysis (INAA). Species of the Agaricus, Lentinus and Pleurotus genera were acquired during the period from November, 2006 to March, 2007. About 150 to 200 mg of freeze-dried mushrooms were irradiated in a neutron flux of 1012 cm{sup -2} s{sup -1} for 8 hours in the IEA-R1 nuclear research reactor at IPEN-CNEN-SP. In order to evaluate the precision and accuracy of the methodology, four reference materials: INCT-MPH-2 Mixed Polish Herbs and INCT-TL-1 Tea Leaves, NIST SRM 1577b Bovine Liver, and the material Mushroom from IAEA were analyzed. Results showed some variation in the element concentrations among the different genera. In some samples, arsenic was found but in low concentrations. Arsenic is probably derived from the contamination from pesticides used in the cultivation, in their the substrates where mushrooms uptake their nutrients. Although there are element concentration variations, mushrooms can still be considered a very rich nutritional source, mainly because of their low concentrations of Na, and due to the good source of K, Fe and Zn. (author)

EVALUATION OF GIN WASTE AS A GROWING SUBSTRATE, ENRICHED WITH DIFFERENT VOLUME PERCENTAGE OF THE WHEAT BRAN FOR CULTIVATION OF OYSTER MUSHROOM (PLEUROTUS OSTREATUS

Directory of Open Access Journals (Sweden)

M. M. Akhtar

2016-08-01

Full Text Available Pleurotusostreatus mushroom was cultivated on cotton gin waste amended with wheat bran in order to judge its growth potential. Two substrates (cotton gin waste and wheat bran were employed alone and with different combinations. Experiment consisted of four treatments T0 (100 % cotton gin waste, T1(97% cotton gin waste + 3% wheat bran, T2(94% cotton gin waste + 6% wheat bran and T3(91% cotton gin waste + 9% wheat bran. Data about time needed for commencement of spawn run, time needed for completion of mycelial growth, time needed for initiation of pinheads, time needed for harvesting of 1st, 2nd and 3rd flush, fresh weight of 1st, 2nd and 3rd flush harvested, total yield, pH of mushroom, total soluble solids of mushroom, acidity and ascorbic acid contents, reducing sugars, non-reducing sugars and total sugars of mushroom, total nitrogen, phosphorus and potassium contents of mushroom was recorded. T0 (100 % cotton gin waste performed better as compared to other treatments.

Natural radionuclides and 137Cs in commercialized edible mushrooms in Sao Paulo-Brazil

International Nuclear Information System (INIS)

Castro, Lilian Pavanelli de

2008-01-01

Artificial and natural radionuclides are commonly found in several compartments of the earth's crust. Some mushroom species have a high capacity to absorb radionuclides and toxic elements from the soil. Diet is considered as one of the main routes of radioactive contamination. Therefore, radioactivity measurements in the environment and in food are extremely important to monitor the radiation levels that human can be exposed to either directly or indirectly. Environmental bio monitoring has demonstrated that diverse organisms such as crustaceans, fish and mushrooms are useful when evaluating both the contamination and the quality of the ecosystems. There are actually several radionuclides that can be accumulated in mushrooms, including 40 K, 137 Cs, 232 Th and 238 U. There are few studies in the Southern hemisphere countries, on the natural and artificial radioactivity levels in mushrooms. The present study evaluated 40 K, 137 Cs, 232 Th and 238 U in commercialized edible mushrooms in the state of Sao Paulo, Brazil. The edible mushroom samples were acquired in different commercial establishments in the Sao Paulo metropolitan region, specifically in Municipal Markets. Some samples were acquired directly from producers located in the cities of Mogi das Cruzes, Mirandopolis, Suzano and Juquitiba. About 400g were collected for each edible mushroom species, which included Agaricus sp, Pleurotus sp and Lentinula sp species. All the samples were prepared and stored in polyethylene bottles for approximately 35 days, so that secular equilibrium could be established before counting. The 40 K, 137 Cs, 232 Th and 238 U gamma activities were measured by gamma spectrometry. The equipment consisted of a Hyper pure Germanium detector connected to an electronic system. The detector efficiency was obtained from measurements of reference materials: IAEA-300, IAEA-327 and IAEA-375. The results for the specific activities in edible mushrooms samples ranged fi-om 461 to 1535 Bq kg -1

Isolation and characterization of differentially expressed genes in ...

African Journals Online (AJOL)

USER

Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

Mushroom acidic glycosphingolipid induction of cytokine secretion from murine T cells and proliferation of NK1.1 α/β TCR-double positive cells in vitro

International Nuclear Information System (INIS)

Nozaki, Hirofumi; Itonori, Saki; Sugita, Mutsumi; Nakamura, Kimihide; Ohba, Kiyoshi; Suzuki, Akemi; Kushi, Yasunori

2008-01-01

Interferon (IFN)-γ and interleukin (IL)-4 regulate many types of immune responses. Here we report that acidic glycosphingolipids (AGLs) of Hypsizigus marmoreus and Pleurotus eryngii induced secretion of IFN- γ and IL-4 from T cells in a CD11c-positive cell-dependent manner similar to that of α-galactosylceramide (α-GalCer) and isoglobotriaosylceramide (iGb3), although activated T cells by AGLs showed less secretion of cytokine than those activated by α-GalCer. In addition, stimulation of these mushroom AGLs induced proliferation of NK1.1 α/β TCR-double positive cells in splenocytes. Administration of a mixture of α-GalCer and AGLs affected the stimulation of α-GalCer and generally induced a subtle Th1 bias for splenocytes but induced an extreme Th2 bias for thymocytes. These results suggested that edible mushroom AGLs contribute to immunomodulation

Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

Science.gov (United States)

Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

2017-01-01

Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

Optimization of humidifying procedure in controlled environment for ...

African Journals Online (AJOL)

hp

2016-11-09

Nov 9, 2016 ... humidifying treatment had influenced the mushroom growth in ..... small water which is heavier than vapour and condense on floor very .... Indoor Mushroom Cultivation of Grey Oyster (Pleurotus pulmonarius) by Different ...

Bioconcentration of artificial radionuclides in edible mushrooms: in situ and in vitro studies

Energy Technology Data Exchange (ETDEWEB)

Dementyev, Dmitry V.; Manukovsky, Nikolai S.; Bolsunovsky, Alexander Ya.; Alexandrova, Yuliyana V. [Institute of Biophysics, Siberian Branch of the Russian Academy of Sciences, 660036, Krasnoyarsk (Russian Federation)

2014-07-01

grown on the soil-like substrate showed that accumulation of Am-241 from solution by mycelium of Pleurotus ostreatus and Neonothopanus nimbi reached 97%. Hence, these mushroom species can be used for bioremediation of solutions contaminated by radionuclides. The substrates prepared from Yenisei flood plain soils and bottom sediments, which contained Co-60, Cs-137, and Eu-152 and were also supplemented with Am-241, were used to grow fruiting bodies of P. ostreatus. The analysis showed that the fruiting bodies accumulated only Cs-137 and Am-241. The highest CF of Cs-137 by P. ostreatus grown on the sediment-based substrate was an order of magnitude higher than the CF of Cs-137 by the mushrooms grown on the soil-based substrate (0.1 vs. 0.008), due to differences in Cs-137 bioavailability in soil and sediment. Also, the CF of Am-241 was twice higher in the fruiting bodies grown on the sediment-based substrate than in those grown on the soil-based substrate (0.005 vs. 0.0026). Analysis of the CFs showed that under natural conditions, accumulation rates of Cs-137 by mushrooms were an order of magnitude higher than those of U-238. Under laboratory conditions, accumulation of Cs-137 in fruiting bodies was an order of magnitude greater than accumulation of Am-241, a transuranium radionuclide. The ability of mushrooms to accumulate artificial radionuclides makes them good candidates for bioremediation of contaminated solutions and soils. (authors)

Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

Directory of Open Access Journals (Sweden)

Simone Parola

2017-10-01

Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

Effects of Crude Oil and Oil Products on Growth of Some Edible ...

African Journals Online (AJOL)

The vegetative growth response of three local edible mushrooms: Pleurotus pulmonarius (Pp), Pleurotus tuber-regium (Pt) and Lentinus squarrosulus (Ls) on different concentrations of Crude oil (COIL), Automotive Gasoline Oil (AGO), Fresh Engine Oil (ENGOIL) and Spent Engine Oil (SENGOIL) was investigated. The result ...

Elucidation of the regio- and chemoselectivity of enzymatic allylic oxidations with Pleurotus sapidus – conversion of selected spirocyclic terpenoids and computational analysis

Directory of Open Access Journals (Sweden)

Verena Weidmann

2013-10-01

Full Text Available Allylic oxidations of olefins to enones allow the efficient synthesis of value-added products from simple olefinic precursors like terpenes or terpenoids. Biocatalytic variants have a large potential for industrial applications, particularly in the pharmaceutical and food industry. Herein we report efficient biocatalytic allylic oxidations of spirocyclic terpenoids by a lyophilisate of the edible fungus Pleurotus sapidus. This ‘’mushroom catalysis’’ is operationally simple and allows the conversion of various unsaturated spirocyclic terpenoids. A number of new spirocyclic enones have thus been obtained with good regio- and chemoselectivity and chiral separation protocols for enantiomeric mixtures have been developed. The oxidations follow a radical mechanism and the regioselectivity of the reaction is mainly determined by bond-dissociation energies of the available allylic CH-bonds and steric accessibility of the oxidation site.

Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

Science.gov (United States)

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-05-01

One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

Directory of Open Access Journals (Sweden)

Simon James

2011-05-01

Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Kátia Maria Gomes Machado

2006-12-01

Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

[Hallucinogenic mushrooms].

Science.gov (United States)

Reingardiene, Dagmara; Vilcinskaite, Jolita; Lazauskas, Robertas

2005-01-01

The group of hallucinogenic mushrooms (species of the genera Conocybe, Gymnopilus, Panaeolus, Pluteus, Psilocybe, and Stropharia) is psilocybin-containing mushrooms. These "magic", psychoactive fungi have the serotonergic hallucinogen psilocybin. Toxicity of these mushrooms is substantial because of the popularity of hallucinogens. Psilocybin and its active metabolite psilocin are similar to lysergic acid diethylamide. These hallucinogens affect the central nervous system rapidly (within 0.5-1 hour after ingestion), producing ataxia, hyperkinesis, and hallucinations. In this review article there are discussed about history of use of hallucinogenic mushrooms and epidemiology; pharmacology, pharmacodynamics, somatic effects and pharmacokinetics of psilocybin, the clinical effects of psilocybin and psilocin, signs and symptoms of ingestion of hallucinogenic mushrooms, treatment and prognosis.

Mushrooms

Science.gov (United States)

... these mushrooms have effects similar to the drug LSD . Sometimes Called: shrooms, magic mushrooms How It's Used: ... this topic for: Teens Drugs: What to Know LSD Dealing With Addiction Marijuana Bath Salts Depressants GHB ...

High protein complementation with high fiber substrates for oyster ...

African Journals Online (AJOL)

Agricultural residues have been world widely accepted for oyster mushroom culture. In this study, we used wheat straw, barley straw, maize stem residue, and lawn residue as substrates coupled with wheat bran, rice bran and soybean powder as complements for the growth of Pleurotus florida and Pleurotus ostreatus as ...

Cultivation of Pleurotus sajor-caju on banana stalk and Bahia grass based substrates Cultivo de Pleurotus sajor-caju em substratos a base de grama batatais e engaço de bananeira

Directory of Open Access Journals (Sweden)

Félix G de Siqueira

2011-06-01

Full Text Available Banana stalks and Bahia grass were utilized as basic starting materials for the production of the mushroom Pleurotus sajor-caju. Banana stalks were combined with other waste or supplement products (wheat bran, coast-cross hay, bean straw and cotton textile mill to obtain different nitrogen concentrations. Since Bahia grass is relatively rich in protein, it was combined with other substrates (banana stalk, coast-cross hay and bean straw to maintain a substrate nitrogen concentration of about 1.5%. Banana stalks and Bahia grass were both more efficient in the production of the mushroom P. sajor-caju when utilized without the addition of other substrates, with biological efficiencies of 74.4% and 74.12%, respectively. When combined with other substrates or grasses, there was a drop in biological efficiency, independent of the concentration of nitrogen. Furthermore, the addition of protein-rich waste to banana stalks resulted in a decrease or absence of fructification, which indicates that high concentrations of nitrogen in the cultivation substrate may hinder the cultivation of this mushroom. On the other hand, results reveal that the ideal concentration of nitrogen may depend on other physicochemical factors and these factors may determine the success in cultivating P. sajor-caju. Therefore, we conclude that P. sajor-caju may be cultivated on banana stalk and Bahia grass as pure substrates, not being necessary their supplementation or combine them with another substrates.O engaço de bananeira e a grama batatais foram utilizados como matérias-primas básicas para a produção do substrato de cultivo do cogumelo Pleurotus sajor-caju. O engaço de bananeira foi combinado com outros resíduos (farelo de trigo, capim "Coast-cross", palha de feijão e resíduo de lixadeira de algodão, com o objetivo de se obter substratos com diferentes concentrações de nitrogênio. Como a grama batatais é relativamente rica em proteína, a mesma foi combinada com

The Edible Mushroom Book

DEFF Research Database (Denmark)

Conte, Anna Del; Læssøe, Thomas

A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats.......A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats....

Gamma radiation in increasing productivity of Agaricus bisporus and Pleurotus sajor-caju and enhancing storage life of P. sajor-caju

International Nuclear Information System (INIS)

Roy, M.K.; Chatterjee, S.R.; Bahukhandi, D.; Sharma, R.; Philips, A.S.

2000-01-01

Gamma radiation of spawn of Agaricus bisporus and pleurotus sajor-caju at doses of 0.1 to 0.3 kGy and 0.1 to 0.25 kGy respectively, reduced the mycelial spawn run time and exerted a stimulatory effect on the growth of these two mushrooms. Irradiation also increased yield of these mushrooms. In all cases of the former, the highest yield of 2.57g was recorded from spawn irradiated at 0.3 kGy, while with the latter, best yield of 1119 g was recorded from spawn treated with 0.25 kGy. The control (non-irradiated) spawns of A. bisporus and P. sajor-caju gave yields of 2.03 g and 565 g respectively. Thus, a major boost in yields could be achieved using this technology. The shelf life of P. sajor-caju could be extended up to 9 days by 0.5 kGy of radiation, when the treated fruit bodies were held at 15 deg C as against the un-irradiated ones which had a shelf-life of 6 days. This dose neither adversely affected the browning of the fruit bodies at 45 deg C, nor lowered their protein (protein + free amino acids) and carbohydrate contents. Irradiation, however, at all the doses from 0.1 to 0.75 kGy enhanced the rehydration ratio and total free amino acid contents. The rehydration ratio of 0.62 was the maximum, reached with a dose of 0.25 kGy as against the control, which showed a value of 5.0. Dehydration along with gamma radiation treatment could play an important role for long term storage of mushrooms. Weight loss of un-dehydrated fruit bodies also decreased as a result of irradiation. (author)

Edible mushroom Pleurotus sajor-caju production on washed and supplemented sugarcane bagasse Produção do cogumelo comestível Pleurotus sajor-caju em bagaço de cana-de-açúcar lavado e suplementado

Directory of Open Access Journals (Sweden)

Evelise Moncaio Moda

2005-04-01

Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com �

Effects of different substrates on the yield and protein content of ...

African Journals Online (AJOL)

The effects of seven substrates for the cultivation, yield and protein content of the mushroom, Pleurotus tuberregium (Fries) Singer were investigated. The experimental design used was completely randomized design (CRD) of 7 treatments and 10 replicates. The highest fresh weight yield was obtained from mushrooms ...

A dioxygenase of Pleurotus sapidus transforms (+)-valencene regio-specifically to (+)-nootkatone via a stereo-specific allylic hydroperoxidation.

Science.gov (United States)

Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G

2010-01-01

A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Neurite outgrowth stimulatory effects of culinary-medicinal mushrooms and their toxicity assessment using differentiating Neuro-2a and embryonic fibroblast BALB/3T3

Science.gov (United States)

2013-01-01

Background Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. Methods The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Results Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p < 0.05) promoted the neurite outgrowth in N2a cells by 38.4 ± 4.2%, 38.1 ± 2.6%, 33.4 ± 4.6%, 33.7 ± 1.5%, and 35.8 ± 3.4%; respectively. The IC50 values obtained from tetrazolium (MTT), neutral red uptake (NRU) and lactate dehydrogenase (LDH) release assays showed no toxic effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Conclusion Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health. PMID:24119256

Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

Science.gov (United States)

Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

2014-11-01

Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

Science.gov (United States)

Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

2014-01-01

The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

Pleurotus ostreatus

African Journals Online (AJOL)

badr

2011-11-07

Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

Science.gov (United States)

Suseem, S R; Saral, Mary

2015-07-01

To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

Pleurotus giganteus (Berk. Karun & Hyde), the giant oyster mushroom inhibits NO production in LPS/H2O2 stimulated RAW 264.7 cells via STAT 3 and COX-2 pathways.

Science.gov (United States)

Baskaran, Asweni; Chua, Kek Heng; Sabaratnam, Vikineswary; Ravishankar Ram, Mani; Kuppusamy, Umah Rani

2017-01-13

Pleurotus giganteus (Berk. Karunarathna and K.D. Hyde), has been used as a culinary mushroom and is known to have medicinal properties but its potential as an anti-inflammatory agent to mitigate inflammation triggered diseases is untapped. In this study, the molecular mechanism underlying the protective effect of ethanol extract of P. giganteus (EPG) against lipopolysaccharide (LPS) and combination of LPS and hydrogen peroxide (H 2 O 2 )-induced inflammation on RAW 264.7 macrophages was investigated. The effect of EPG on nitric oxide (NO) production as an indicator of inflammation in RAW 264.7 macrophages was estimated based on Griess reaction that measures nitrite level. The expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), NF-kB activating protein (NKAP), signal transducer and activator of transcription 3 protein (STAT 3) and glutathione peroxidase (GPx) genes were assessed using real time reverse transcription polymerase chain reaction (RT-PCR) approach. EPG (10 μg/ml) showed the highest reduction in the LPS-induced NO production in RAW 264.7 macrophages and significantly suppressed (p < 0.05) the expression iNOS, STAT 3 and COX-2. There was a significant increase (p < 0.05) in combination of LPS and H 2 O 2 - induced iNOS production when compared to the LPS-induced iNOS production in RAW 264.7 macrophages and this concurred with the NO production which was attenuated by EPG at 10 μg/ml. A significant (p < 0.05) down regulation was observed in the combination of LPS and H 2 O 2 -induced iNOS and GPx expression by EPG. Our data suggest that the anti-inflammatory activity of EPG is mediated via the suppression of the STAT 3 and COX-2 pathways and can serve as potential endogenous antioxidant stimulant.

The use of residual geothermal energy in an edible mushroom production plant, Los Humeros geothermal fields (Mexico): Achievements and alternatives; El uso de la energia geotermica residual en la planta productora de hongos comestibles del campo geotermico Los Humeros (Mexico): Logros y alternativas

Energy Technology Data Exchange (ETDEWEB)

Rangel Rangel, Maria Elena [Proteccion ambiental, Puebla (Mexico)

2000-12-01

A plant for raising edible mushrooms with residual geothermal energy is a project of the Comision Federal de Electricidad (CFE). The results reflect important achievements in the development of technology for the productions of wholesome and available food with geothermal heat instead of conventional energy sources. The installations have an enormous technological and commercial potential- demonstrated by the cultivation of oyster mushrooms (Pleurotus ostreatus), which success has awakened the interest of research institutions. The Instituto of Ecologia, A.C., has begun a joint project with CFE cultivating shiitake mushrooms (Lentinula edodes) with geothermal energy. These achievements mark a clear trend toward the integral use of facilities, the establishment of a crop with greater economic advantages, and the diffusion of this project. [Spanish] La planta productora de hongos comestibles es un proyecto de la Comision Federal de Electricidad (CFE) para dar un uso alterno a la energia geotermica residual. Los resultados obtenidos hasta el momento reflejan logros importantes en la generacion de tecnologia propia para la produccion de un alimento sano y accesible, sustituyendo la energia proveniente de combustibles convencionales por calor geotermico. Las instalaciones creadas cuentan con un enorme potencial tecnologico y comercial demostrando con el cultivo de las setas (Pleurotus ostreatus) con un exito tal que ha despertado el interes de instituciones dedicadas a la investigacion. Tal es el caso de Instituto de Ecologia, A.C que acualmente se encuentra involucrado en un proyecto conjunto sobre el cultivo del hongo Lentinula edodes (shiitake) utilizando energia geotermica en su proceso productivo. Con lo anterior, se esta marcando una clara tendencia hacia el aprovechamiento integral de las instalaciones, el establecimiento de un cultivo con mayores ventajas economicas y la difusion de este proyecto.

Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

Directory of Open Access Journals (Sweden)

Miriam HAIDUKOWSKI

2017-05-01

Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

Distribution of radionuclides in different parts of a mushroom: Influence of the degree of maturity

Energy Technology Data Exchange (ETDEWEB)

Baeza, Antonio [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain)]. E-mail: ymiralle@unex.es; Guillen, Fco. Javier [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Salas, Alejandro [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Manjon, Jose Luis [Department of Plant Biology, Faculty of Sciences, University of Alcala, 28871 Alcala de Henares, Madrid (Spain)

2006-04-15

Mushrooms are known to be bioaccumulators of radionuclides, but little is known about their distribution within the fruiting bodies or the influence of the degree of maturity on uptake. We carried out a series of cultures of the species Pleurotus eryngii under controlled laboratory conditions to analyze these variables. The maximal uptake of {sup 134}Cs and {sup 85}Sr was found to occur in mature fruiting bodies, and with the growth of the mushroom the distribution of radionuclides within the fruiting bodies became inhomogeneous. In particular, there was an exponential increase in the percentage of the total activity of {sup 134}Cs, {sup 85}Sr, and {sup 6}Co in the cap + gills as the fruiting bodies matured, accompanied by a complementary decrease in the stem. Radiocaesium, potassium, calcium, {sup 239+24}Pu, {sup 234,238}U, {sup 228,230,232}Th, and {sup 226}Ra were assayed in the cap, gills, and stem of fruiting bodies of Tricholoma equestre collected in a natural ecosystem and cultured P. eryngii. Potassium and radiocaesium were mainly located in the cap + gills, and {sup 226}Ra in the gills. There was a disequilibrium between {sup 230,232}Th and {sup 228}Th in the different parts of the fungi, probably due to uptake of {sup 228}Ra and subsequent decay to {sup 228}Th. Finally, the distribution pattern of{sup 239+24}Pu, {sup 234,238}U, and {sup 230,232}Th seemed to be species dependent.

FUNGI: A REVIEW ON MUSHROOMS

OpenAIRE

Abulude, F. Olawale; Ndamitso, M. Muhammed

2017-01-01

This paper reviews a fungus – mushrooms. In this paper, identification, cultivation, uses, side effects, nutritional and medicinal values, storage, marketing and other uses of mushrooms were discussed. From the review too it was observed that its usefulness surpasses the side effects. These side effects could be eliminated if proper ‘processing’ could be employed. Due to advances in both basic knowledge and practical technology relevant to mushroom farming, mushroom products and mushroom bior...

Radioactive cesium in Finnish mushrooms

International Nuclear Information System (INIS)

Kostiainen, E.; Ylipieti, J.

2010-02-01

Surveillance of radioactive cesium in Finnish mushrooms was started in 1986 at STUK. Results of the surveillance programs carried out in Lapland and other parts of Finland are given in this report. More than 2000 samples of edible mushrooms have been analysed during 1986-2008. The 137 Cs detected in the mushrooms mainly originates from the 137 Cs deposition due to the accident at the Chernobyl nuclear power plant in 1986. The 137 Cs concentrations of mushrooms in the end of 1970s and in the beginning of 1980s varied from some ten to two hundred becquerels per kilogram originating from the nuclear weapon test period. The uneven division of the Chernobyl fallout is seen in the areal variation of 137 Cs concentrations of mushrooms, the 137 Cs concentrations being about tenfold in the areas with the highest deposition compared to those where the deposition was lowest. After the Chernobyl accident the maximum values in the 137 Cs concentrations were reached during 1987-88 among most species of mushrooms. The 137 Cs concentrations have decreased slowly, being in 2008 about 40 per cent of the maximum values. The 137 Cs concentrations may be tenfold in the mushroom species with high uptake of cesium (Rozites caperatus, Hygrophorus camarophyllus, Lactarius trivialis) compared to the species with low uptake (Albatrellus ovinus, Leccinum sp.) picked in the same area. The 137 Cs contents in certain species of commercial mushrooms in Finland still exceed the maximum permitted level, 600 Bq/kg, recommended to be respected when placing wild game, wild berries, wild mushrooms and lake fish on the market (Commission recommendation 2003/274/Euratom). Therefore, the 137 Cs concentrations of mushrooms should be measured before placing them on the market in the areas of the highest 137 Cs deposition, except for Albatrellus ovinus, Boletus sp. and Cantharellus cibarius. The 137 Cs concentrations of common commercial mushroom species, Cantharellus tubaeformis and Craterellus

Hepatoprotective Effects of Mushrooms

Directory of Open Access Journals (Sweden)

Rosane Marina Peralta

2013-07-01

Full Text Available The particular characteristics of growth and development of mushrooms in nature result in the accumulation of a variety of secondary metabolites such as phenolic compounds, terpenes and steroids and essential cell wall components such as polysaccharides, b-glucans and proteins, several of them with biological activities. The present article outlines and discusses the available information about the protective effects of mushroom extracts against liver damage induced by exogenous compounds. Among mushrooms, Ganoderma lucidum is indubitably the most widely studied species. In this review, however, emphasis was given to studies using other mushrooms, especially those presenting efforts of attributing hepatoprotective activities to specific chemical components usually present in the mushroom extracts.

The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

Science.gov (United States)

Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

2015-12-01

Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

Science.gov (United States)

Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

2016-11-01

This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Functional foods from mushroom

Science.gov (United States)

Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

Characterization of the rcsA Gene from Pantoea sp. Strain PPE7 and Its Influence on Extracellular Polysaccharide Production and Virulence on Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Min Keun Kim

2017-06-01

Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.

Are mushrooms radioactive?

International Nuclear Information System (INIS)

Randa, Z.; Benada, J.; Singert, M.; Horyna, J.

1988-01-01

Tabulated is the content of 137 Cs in dry matter of higher mushrooms collected in the years 1986 to 1987. The radioactive level of mushrooms collected in Czechoslovakia such as Boletus badius and B. chrysenteron reached 20 to 50 kBq/kg of dry matter. The individual dose at mean consumption of these mushrooms was estimated at 0.2 to 0.3 mSv/year which amounted to 20 to 30% of the dose from the natural background. (J.B.). 1 tab

In Vitro and In Vivo Antidiabetic Evaluation of Selected Culinary-Medicinal Mushrooms (Agaricomycetes).

Science.gov (United States)

Singh, Varinder; Bedi, Gurleen Kaur; Shri, Richa

2017-01-01

Management of type 2 diabetes by delaying or preventing glucose absorption using natural products is gaining significant attention. Edible mushrooms are well documented for their nutritional and medicinal properties. This investigation was designed to evaluate the antidiabetic activity of aqueous extracts of selected culinary-medicinal mushrooms, namely, Pleurotus ostreatus, Calocybe indica, and Volvariella volvacea, using in vitro models (α-amylase inhibition assay, glucose uptake by yeast cells, and glucose adsorption capacity). The most active extract was subsequently examined in vivo using the oral starch tolerance test in mice. All prepared extracts showed dose-dependent inhibition of α-amylase and an increase in glucose transport across yeast cells. C. indica extract was the most active α-amylase inhibitor (half-maximal inhibitory concentration, 18.07 ± 0.75 mg/mL) and exhibited maximum glucose uptake by yeast cells (77.53 ± 0.97% at 35 mg/mL). All extracts demonstrated weak glucose adsorption ability. The positive in vitro tests for C. indica paved the way for in vivo studies. C. indica extract (200 and 400 mg/kg) significantly (P < 0.05) reduced postprandial blood glucose peaks in mice challenged with starch. The extract (400 mg/kg) and acarbose normalized blood glucose levels at 180 minutes, when they were statistically similar to values in normal mice. Thus, it may be concluded that the antidiabetic effect of C. indica is mediated by inhibition of starch metabolism (α-amylase inhibition), increased glucose uptake by peripheral cells (promotion of glucose uptake by yeast cells), and mild entrapment (adsorption) of glucose. Hence, C. indica can be developed as antidiabetic drug after detailed pharmacological studies.

Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Rosa María Espinosa-Valdemar

2015-05-01

Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

Selenium in edible mushrooms.

Science.gov (United States)

Falandysz, Jerzy

2008-01-01

Selenium is vital to human health. This article is a compendium of virtually all the published data on total selenium concentrations, its distribution in fruitbody, bioconcentration factors, and chemical forms in wild-grown, cultivated, and selenium-enriched mushrooms worldwide. Of the 190 species reviewed (belonging to 21 families and 56 genera), most are considered edible, and a few selected data relate to inedible mushrooms. Most of edible mushroom species examined until now are selenium-poor (cesarea, A. campestris, A. edulis, A. macrosporus, and A. silvaticus. A particularly rich source of selenium could be obtained from selenium-enriched mushrooms that are cultivated on a substrate fortified with selenium (as inorganic salt or selenized-yeast). The Se-enriched Champignon Mushroom could contain up to 30 or 110 microg Se/g dw, while the Varnished Polypore (Ganoderma lucidum) could contain up to 72 microg Se/g dw. An increasingly growing database on chemical forms of selenium of mushrooms indicates that the seleno-compounds identified in carpophore include selenocysteine, selenomethionine, Se-methylselenocysteine, selenite, and several unidentified seleno-compounds; their proportions vary widely. Some aspects of environmental selenium occurrence and human body pharmacokinetics and nutritional needs will also be briefly discussed in this review.

nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

African Journals Online (AJOL)

DJFLEX

The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

Directory of Open Access Journals (Sweden)

Maura Téllez-Téllez

2016-03-01

Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

African Journals Online (AJOL)

The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

Mushrooms, trees, and money: value estimates of commercial mushrooms and timber in the pacific northwest.

Science.gov (United States)

Alexander, Susan J; Pilz, David; Weber, Nancy S; Brown, Ed; Rockwell, Victoria A

2002-07-01

Wild edible mushrooms are harvested in the forests of the Pacific Northwest, where both trees and mushrooms grow in the same landscape. Although there has been some discussion about the value of trees and mushrooms individually, little information exists about the joint production of, and value for, these two forest products. Through four case studies, the information needed to determine production and value for three wild mushroom species in different forests of the Pacific Northwest is described, and present values for several different forest management scenarios are presented. The values for timber and for mushrooms are site- and species-specific. On the Olympic Peninsula in Washington, timber is highly valued and chanterelles are a low-value product by weight; timber has a soil expectation value (SEV) 12 to 200 times higher than chanterelles. In south-central Oregon, timber and American matsutake mushrooms have the potential to have about the same SEV. In eastern Oregon, timber is worth 20 to 110 times as much as the morels that grow in the forest. Production economics is concerned with choices about how much and what to produce with what resources. The choices are influenced by changes in technical and economic circumstances. Through our description and analysis of the necessary definitions and assumptions to assess value in joint production of timber and wild mushrooms, we found that values are sensitive to assumptions about changes in forest management, yields for mushrooms and trees, and costs.

Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

Science.gov (United States)

Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

2018-03-01

As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

Temperature Control System for Mushroom Dryer

Science.gov (United States)

Wibowo, I. A.; Indah, Nur; Sebayang, D.; Adam, N. H.

2018-03-01

The main problem in mushroom cultivation is the handling after the harvest. Drying is one technique to preserve the mushrooms. Traditionally, mushrooms are dried by sunshine which depends on the weather. This affects the quality of the dried mushrooms. Therefore, this paper proposes a system to provide an artificial drying for mushrooms in order to maintain their quality. The objective of the system is to control the mushroom drying process to be faster compared to the natural drying at an accurate and right temperature. A model of the mushroom dryer has been designed, built, and tested. The system comprises a chamber, heater, blower, temperature sensor and electronic control circuit. A microcontroller is used as the controller which is programmed to implement a bang-bang control that regulates the temperature of the chamber. A desired temperature is inputted as a set point of the control system. Temperature of 45 °C is chosen as the operational drying temperature. Several tests have been carried out to examine the performance of the system including drying speed, the effects of ambient conditions, and the effects of mushroom size. The results show that the system can satisfy the objective.

Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

Science.gov (United States)

Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

2016-03-01

Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

Directory of Open Access Journals (Sweden)

W.A. Tapie

2016-08-01

Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation

Directory of Open Access Journals (Sweden)

Gian Luigi Rana

2013-03-01

Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.

Browse Title Index - AJOL

African Journals Online (AJOL)

Items 7451 - 7500 of 11090 ... ... Listeria monocytogenes- A high risk food pathogen by multiplex PCR, Abstract PDF ... and molecular characterization of Oyster mushroom (Pleurotus spp.) ... Vol 14, No 15 (2015), Morphological and RAPD-marker ...

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

Anticancer potential evoked by Pleurotus florida and Calocybe ...

African Journals Online (AJOL)

Jane

2011-07-20

Jul 20, 2011 ... Actually, world trade in mushrooms is as big as the trade in coffee. Mushroom polysaccharides support some or all of the major systems of the body, including nervous, hormonal and immune systems as well as regulatory functions. ..... mechanistic description of dead and dying eukaryotic cells. Infection.

Antioxidants of Edible Mushrooms

Directory of Open Access Journals (Sweden)

Maja Kozarski

2015-10-01

Full Text Available Oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS lead to a range of health disorders in humans. Our endogenous antioxidant defense mechanisms and our dietary intake of antioxidants potentially regulate our oxidative homeostasis. Numerous synthetic antioxidants can effectively improve defense mechanisms, but because of their adverse toxic effects under certain conditions, preference is given to natural compounds. Consequently, the requirements for natural, alternative sources of antioxidant foods identified in edible mushrooms, as well as the mechanistic action involved in their antioxidant properties, have increased rapidly. Chemical composition and antioxidant potential of mushrooms have been intensively studied. Edible mushrooms might be used directly in enhancement of antioxidant defenses through dietary supplementation to reduce the level of oxidative stress. Wild or cultivated, they have been related to significant antioxidant properties due to their bioactive compounds, such as polyphenols, polysaccharides, vitamins, carotenoids and minerals. Antioxidant and health benefits, observed in edible mushrooms, seem an additional reason for their traditional use as a popular delicacy food. This review discusses the consumption of edible mushrooms as a powerful instrument in maintaining health, longevity and life quality.

Improving the feeding value of straws with Pleurotus ostreatus

NARCIS (Netherlands)

Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

2015-01-01

The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

Additive effects of CuSO4 and aromatic compounds on laccase production by Pleurotus sajor-caju PS-2001 using sucrose as a carbon source

Directory of Open Access Journals (Sweden)

F. Bettin

2014-06-01

Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.

Nutritional composition of bioproducts generated from semi-solid ...

African Journals Online (AJOL)

sunny t

2016-03-23

Mar 23, 2016 ... Culturas DPUA –UFAM. Av. General Rodrigo ... in the pineapple peel and in the bioproducts generated from pineapple peel and mycelium of Pleurotus albidus ..... mushrooms consumed by the ethnic tribes of India. Detailed ...

Wild growing mushrooms for the Edible City? Cadmium and lead content in edible mushrooms harvested within the urban agglomeration of Berlin, Germany

International Nuclear Information System (INIS)

Schlecht, Martin Thomas; Säumel, Ina

2015-01-01

Health effects by consuming urban garden products are discussed controversially due to high urban pollution loads. We sampled wild edible mushrooms of different habitats and commercial mushroom cultivars exposed to high traffic areas within Berlin, Germany. We determined the content of cadmium and lead in the fruiting bodies and analysed how the local setting shaped the concentration patterns. EU standards for cultivated mushrooms were exceeded by 86% of the wild mushroom samples for lead and by 54% for cadmium but not by mushroom cultures. We revealed significant differences in trace metal content depending on species, trophic status, habitat and local traffic burden. Higher overall traffic burden increased trace metal content in the biomass of wild mushrooms, whereas cultivated mushrooms exposed to inner city high traffic areas had significantly lower trace metal contents. Based on these we discuss the consequences for the consumption of mushrooms originating from urban areas. - Highlights: • Popular edible mushrooms display large variations in Cd and Pb content. • Low accumulating species are Sparassis crispa, Boletus luridus, or Boletus badius. • High accumulating species are Agaricus ssp., Russula vesca, or Calvatia gigantea. • Cd and Pb content in wild growing edible mushrooms were mostly above EU limits for cultivated mushrooms. • Cd and Pb content in commercial mushrooms cultures were regularly below EU limits for cultivated mushrooms. - Commercial mushroom cultures can be integrated into ‘Edible City’ approaches, but majority of wild growing mushroom samples highly accumulate trace metals

Preliminary investigation into the use of Pleurotus tuber-regium ...

African Journals Online (AJOL)

The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

Radiation damage to mushrooms

International Nuclear Information System (INIS)

Sattler, P.W.

1986-01-01

This document contains newspaper cuttings and correspondence with various ministries in Hessen on the subject of radiation damage to mushrooms from the Odenwald area. The reader is given, amongst other things, detailed information on radiation damage to different types of mushroom in 1986. (MG) [de

INTENSIFICATION OF JELLY MUSHROOM CULTIVATION IN PAKEM SLEMAN

Directory of Open Access Journals (Sweden)

Sulistiya

2015-01-01

Full Text Available Mushroom cultivation is long enough to be a source of income for some people in Pakem, Sleman. However, cultivation techniques that do not yet meet the standards for technical, so that productivity is still low. Marketing mushrooms are limited to the traditional market. Waste mushroom has not been used well, so potentially to pollute the environment mushroom. This service activities include the provision of mushroom cultivation equipment, such as water pumps and termohygrometer and nozzle, and education and training bookkeeping, marketing, and processing waste into mushroom compost. The results showed an increase in the production of mushroom seen from the Biological Conversion Efficiency (BCE are in the top 30 percent. Partners also has a business bookkeeping and have Blog to market the mushroom by on-line. Partners also have the skills to process the manure (compost made from the waste of mushroom which can be used to help fertilize their crops.

Application of SRAP in the genetic diversity of Tricholoma matsutake ...

African Journals Online (AJOL)

GREGORY

2010-09-20

Sep 20, 2010 ... intergenic spacer; PCR, polymerase chain reaction; FST, mean level of ... been developed for any of the matsutake mushrooms, ... SRAP was similar to RAPD, but it was a prefe- ..... belonging to the taxa Pleurotus eryngii (DC.

Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

OpenAIRE

Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

2007-01-01

Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

Effect of Pleurotus ostreatus fermentation on cocoa pod husk ...

African Journals Online (AJOL)

Cocoa pod husk (CPH) is a major agro-industrial residue in Ghana with a potential value as a low-cost unconventional feedstuff for livestock. However, its effective use is limited by poor nutrient composition, mainly due to its high lignocellulose or fibre and also low protein levels. White–rot fungi such as Pleurotus species ...

Performance of different strains of Pleurotus species under ...

African Journals Online (AJOL)

P. citrinopileatus strain PCB did not produce any fruiting bodies during the period of study. Significant differences (P<0.05) in yield of the different species of mushrooms were recorded. Keywords: Mushrooms, flushes, biological efficiency. J Food Tech in Africa (2002) 7, 98-100. http://dx.doi.org/10.4314/jfta.v7i3.19240.

Economic assessment of mushroom project commercialisation

International Nuclear Information System (INIS)

Mat Rasol Awang; Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Meswan Maskom

2010-01-01

The market value of mushroom is worth US $45 billion comprising: US $28-30 billion from food, US $9-10 billion from medicinal products and US $3.5-4 billion from wild mushroom. Malaysian import deficit of mushroom over the year 2001-2007 was 40,933 metric ton that worth of RM 187.7 million. The existing local market is lucrative and the potential world market is very large. Having cultivation technology in placed, understanding key value chains of cultivation technology processes, this paper assesses the case study of project economic of mushroom commercialization. (author)

Hypersensitivity pneumonitis associated with mushroom worker's lung: an update on the clinical significance of the importation of exotic mushroom varieties.

Science.gov (United States)

Moore, John E; Convery, Rory P; Millar, B Cherie; Rao, Juluri R; Elborn, J Stuart

2005-01-01

Hypersensitivity pneumonitis remains an important industrial disease in mushroom workers. It has a significant morbidity, and early diagnosis and removal from exposure to the antigen are critically important in its management. Recently, several new allergens have been described, particularly those from mushroom species originating in the Far East, which are of clinical significance to workers occupationally exposed to such allergens in cultivation, picking, and packing of commercial mushroom crops. Importing of exotic mushrooms including Shiitake is common in EU countries, and some of the exotic species of mushrooms are cultivated for local markets. This practice may contribute to an increase in clinical cases of mushroom hypersensitivity pneumonitis. This update reviews the recent literature and examines changing trends of mushroom worker's lung, with increased movement of commercial product and labour markets worldwide.

[Effect of substrate of edible mushroom on continuously cropping obstacle of Rehmannia glutinosa].

Science.gov (United States)

Ru, Rui-Hong; Li, Xuan-Zhen; Hunag, Xiao-Shu; Gao, Feng; Wang, Jian-Ming; Li, Ben-Yin; Zhang, Zhong-Yi

2014-08-01

The continuous cultivation of Rehmannia glutinosa causes the accumulation of phenolic acids in soil. It is supposed to be the reason of the so called "continuously cropping obstacle". In this study, phenolic acids (hydroxybenzoic acid, vanillic acid, eugenol, vanillin and ferulic acid) were degraded by the extracta of all the tested spent mushroom substrate (SMS) and the maximal degradation rate was 75.3%, contributed by extraction of SMS of Pleurotus eryngii. Pot experiment indicated that hydroxybenzoic acid and vanillin in soil were also degraded effectively by SMS of P. eryngii. The employment of SMS enhanced ecophysiology index to near the normal levels, such as crown width, leaves number, leaf length, leaf width and height. At the same time, the fresh and dry weight and total catalpol concentration of tuberous root weight of R. glutinosa was increased to 2.70, 3.66, 2.25 times by employment of SMS, respectively. The increase of bacteria, fungi and actinomycetes numbers in rhizosphere soil were observed after the employment of SMS by microbial counts. The employment of SMS also enhanced the enzyme activity in soils, such as sucrase, cellulase, phosphalase, urease and catelase. These results indicated that the employment of SMS alleviated the continuously cropping obstacle of R. glutinosa in some extent.

INTENSIFICATION OF JELLY MUSHROOM CULTIVATION IN PAKEM SLEMAN

OpenAIRE

Sulistiya; Retno Lantarsih; Titop Dwiwinarno*

2015-01-01

Mushroom cultivation is long enough to be a source of income for some people in Pakem, Sleman. However, cultivation techniques that do not yet meet the standards for technical, so that productivity is still low. Marketing mushrooms are limited to the traditional market. Waste mushroom has not been used well, so potentially to pollute the environment mushroom. This service activities include the provision of mushroom cultivation equipment, such as water pumps and termohygrome...

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis for Crossbreeding

Directory of Open Access Journals (Sweden)

Yueting Dai

2017-11-01

Full Text Available Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu. However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species.

Development of Novel Polymorphic EST-SSR Markers in Bailinggu (Pleurotus tuoliensis) for Crossbreeding

Science.gov (United States)

Dai, Yueting; Su, Wenying; Song, Bing; Li, Yu; Fu, Yongping

2017-01-01

Identification of monokaryons and their mating types and discrimination of hybrid offspring are key steps for the crossbreeding of Pleurotus tuoliensis (Bailinggu). However, conventional crossbreeding methods are troublesome and time consuming. Using RNA-seq technology, we developed new expressed sequence tag-simple sequence repeat (EST-SSR) markers for Bailinggu to easily and rapidly identify monokaryons and their mating types, genetic diversity and hybrid offspring. We identified 1110 potential EST-based SSR loci from a newly-sequenced Bailinggu transcriptome and then randomly selected 100 EST-SSRs for further validation. Results showed that 39, 43 and 34 novel EST-SSR markers successfully identified monokaryons from their parent dikaryons, differentiated two different mating types and discriminated F1 and F2 hybrid offspring, respectively. Furthermore, a total of 86 alleles were detected in 37 monokaryons using 18 highly informative EST-SSRs. The observed number of alleles per locus ranged from three to seven. Cluster analysis revealed that these monokaryons have a relatively high level of genetic diversity. Transfer rates of the EST-SSRs in the monokaryons of closely-related species Pleurotus eryngii var. ferulae and Pleurotus ostreatus were 72% and 64%, respectively. Therefore, our study provides new SSR markers and an efficient method to enhance the crossbreeding of Bailinggu and closely-related species. PMID:29149037

Current Overview of Mushroom Production in the World

NARCIS (Netherlands)

Royse, Daniel J.; Baars, J.J.P.; Tan, Qi

2017-01-01

Edible, medicinal, and wild mushrooms are the three major components of the global mushroom industry. World production of cultivated, edible mushrooms has increased more than 30‐fold since 1978. China is the main producer of cultivated, edible mushrooms. Lentinus edodes is now the world's leading

Commercial Scale Production of Mushroom Liquid Seeds

International Nuclear Information System (INIS)

Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Mohd Meswan Maskom; Khairuddin Abdul Rahim

2015-01-01

Mushroom liquid seed production technology was developed by Malaysian Nuclear Agency (Nuclear Malaysia) in the late 1990s. Initially, the liquid seeds were used mainly in the solid state fermentation process for converting oil palm empty fruit bunch fibres into ruminant feed. Considering widespread problems encountered by mushroom growers from use of solid seeds, especially in cases of contaminant agents infecting cultivated bags and inconsistencies in yield, we diverted our focus to utilising liquid seeds as alternative inocula for mushroom cultivation. These problems provide us opportunities to look into the issues and address the problems faced by mushroom growers. However, the technology of producing liquid seed at laboratory scale needs to be primed for commercial production. This paper discusses developmental aspects of mushroom liquid seed at commercial scale for the advancement of the country's mushroom industry. (author)

Effectiveness of Training Programme on Mushroom Cultivation

OpenAIRE

Rahman, Md. Sazzadur; Hossain, Kh. Zulfikar; Ali, Md. Sekender; Afroz, Fauzia

2017-01-01

Effectiveness is one of the key parameters to assess success of any programs. However, the effectiveness of training programme on mushroom cultivation was not well addressed. The purposes of this study were to investigate the effectiveness of training programme on mushroom cultivation and to explore the relationships of each of the selected characteristics of the trained mushroom farmers with their effectiveness of training programme. Data were collected from the trained mushroom farmers of s...

Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii.

Science.gov (United States)

Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

2014-01-01

Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.

Cultivo de Lentinus sajor-caju (Fr.) Fr. [= Pleurotus sajor-caju (Fr.) Singer] e Pleurotus spp. em diferentes substratos

OpenAIRE

Albuquerque, Margeli Pereira de

2010-01-01

As espécies de Pleurotus, popularmente conhecidas por cogumelos ostra, são decompositoras primárias de madeira e outros resíduos vegetais biodegradáveis. Estes fungos apresentam propriedades nutricionais com elevados teores de proteínas aminoácidos essenciais, ácidos graxos insaturados, vitaminas e minerais, por isso estão tornando-se cada vez mais importantes como um recurso alimentar. A identificação de substratos que permitam o rápido desenvolvimento do micélio fúngico é uma...

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter, carbon and ...

Contamination of mushrooms with radionuclides

International Nuclear Information System (INIS)

Benova, K.

2013-01-01

There is 27 years after the Chernobyl nuclear accident and the half-life of 137 Cs is 30 years. The radioactive cloud hit both former Czechoslovakia, but also very distant cities throughout Europe. In this work, author focused on recovery of radiocesium content in mushrooms from various sites in Slovakia, Poland and England. Author evaluated 28 samples of dried mushrooms. 137 Cs was measured by gamma spectrometry (Canberra). Elevated levels have been reported occasionally in mushroom not only in Slovakia but also in distant England. The values obtained are lower than recommended standard (author)

Microcontroller based automatic temperature control for oyster mushroom plants

Science.gov (United States)

Sihombing, P.; Astuti, T. P.; Herriyance; Sitompul, D.

2018-03-01

In the cultivation of Oyster Mushrooms need special treatment because oyster mushrooms are susceptible to disease. Mushroom growth will be inhibited if the temperature and humidity are not well controlled because temperature and inertia can affect mold growth. Oyster mushroom growth usually will be optimal at temperatures around 22-28°C and humidity around 70-90%. This problem is often encountered in the cultivation of oyster mushrooms. Therefore it is very important to control the temperature and humidity of the room of oyster mushroom cultivation. In this paper, we developed an automatic temperature monitoring tool in the cultivation of oyster mushroom-based Arduino Uno microcontroller. We have designed a tool that will control the temperature and humidity automatically by Android Smartphone. If the temperature increased more than 28°C in the room of mushroom plants, then this tool will turn on the pump automatically to run water in order to lower the room temperature. And if the room temperature of mushroom plants below of 22°C, then the light will be turned on in order to heat the room. Thus the temperature in the room oyster mushrooms will remain stable so that the growth of oyster mushrooms can grow with good quality.

Wild and domesticated mushroom consumption in Nigeria ...

African Journals Online (AJOL)

African Crop Science Journal ... On the other hand, if nutrition analysis reveals different nutrition parameters for both types of mushrooms, 43.3% opted for cultivated mushroom, 42.2%, wild; 12.2% both; while 2.2% would eat ... Keywords: Consumption pattern, Lentinus squarrosulus, nutrition, perception, wild mushroom ...

Investigation on Possibility of Transferring OysterMushroom (Pleurotusostreatus Manganese Peroxidase Gene (mnp to the White Button Mushroom (Agaricusbisporus

Directory of Open Access Journals (Sweden)

Mojgan Parvandi

2017-12-01

Full Text Available Introduction: The white button mushroom does not produce remarkable yield in the third flash. Nutritional deficiency and the inability of this mushroom to efficient use of compost are mentioned as its reasons. Basically, compost includes two major food components, lignocellulose and microbial biomass. But this microbial biomass provides just 10% of button mushroom food needs. According to research studies, differentenzymes in both white button mushroom and oyster mushroom are responsible for decomposition of lignin compounds in compost media, from begin of mycelium grows to the end of fruiting. Lacasse, manganese peroxidase, lignin peroxidase, glyoxal oxidase enzymes contribute to degradation of lignin compounds in degradation mushroom has proven by researchers however itis dependent on mushroom types. Manganese peroxidase enzyme (EC. 1.11.1.13 is an extracellular parser lignin enzyme that has a central peroxidase core. Manganese peroxidase enzyme oxidizesMn2+ to Mn3+ and then Mn3+ oxidizes phenolic structure to fonoxile radical. Produced Mn3+ is very active and makes complex by chelating organic acids that is produced by mushrooms such as oxalate or malate. Mn3+ ions become stable by helping of these chelates and it can penetrate through materials such as wood. On the other hand, in recent years, plant biotechnology provides new solutions for old problems such as use of microorganisms, particularly using bacteria for gene transfer and improvement of superlatives. For a sample of this method, Agrobacterium-mediated transformation system can be noted. In addition, the use of suitable promoters for heterologous genes expression in suitable hosts is an important strategy in functional biotechnology that has been raised in edible mushroom genetic engineering. The lack of efficient and sufficient use of compost, low power of white button mushroom in competition with other rivals, lack of yield per area unit due to production costs, pests and diseases

Identification of medicinal and poisonous mushroom from Khorramabad, Iran

Directory of Open Access Journals (Sweden)

seyede zahra Hosseini

2010-03-01

Full Text Available Mushrooms grow in a very wide range of ecological conditions, however their growth vary in different conditions. Mushrooms are a valuable source for antibiotics and they are known as drugs in traditional medicine. Identification and characterization of mushrooms is the first step of their exploitations in drug industry. There are many poisonous species of mushrooms, so their identification is essential for better health of societies and also a good indication for physicians in identification of mushroom poisonings and their cure. Material and Method: In this research the samples of mushroom were collected in Khorramabad district during spring and fall of 2008 and 2009. The macroscopic and microscopic characters of collected mushrooms were observed in field and laboratory and these criteria aligned to the species characters in scientific resources. Results: eight mushroom species namely Collybia maculate coprinus atramentarius three species of Boletus (B. luridus, B. felleus and B. satanas two species of Lactarius (L. piperatus and L. vellereus and Hypholoma capnoides were identified . Discussions: Based on the results of biodiversity of mushrooms in khorramabad district found in the present research, it is concluded that there are valuable resources of mushrooms for medicinal purposes in this area.

Analysis of Major Nutritional Components of Pleurotus pulmonarius During the Cultivation in Different Indoor Environmental Conditions on Sawdust

Directory of Open Access Journals (Sweden)

Tariqul Islam

2017-03-01

Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.

7 CFR 1209.11 - Mushrooms.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Mushrooms. 1209.11 Section 1209.11 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209...

Bioremediation of engine-oil polluted soil by Pleurotus tuber-regium ...

African Journals Online (AJOL)

SERVER

2008-01-04

Jan 4, 2008 ... White-rot fungi have been used in various parts of the world for bioremediation of polluted sites. Pleurotus tuber-regium was noted to have the ability to increase nutrient contents in soils polluted with. 1 - 40% engine-oil concentration after six months of incubation. P. tuber-regium increased organic matter ...

Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Gabriel, Jiří

2002-01-01

Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

The effect of repair inhibitor on radiation damages of pleurotus ostreatus

International Nuclear Information System (INIS)

Yang Zongqu; Wang Bonan; Li Xuzhao

1996-01-01

The growth rate and enzyme activities significantly decreased when dikaryotic hypha of Pleurotus ostreatus were irradiated with γ-rays and subsequently treated with either caffeine or Na 2 -EDTA in comparison with γ-rays treatment alone. The inhibition effect of treatment with either caffeine or Na 2 -EDTA before irradiation was more obvious than that after irradiation. Treatment with either caffeine or Na 2 -EDTA could cause biological damages on hypha when the concentrations of caffeine and Na 2 -EDTA were up to 0.5 and 1.0 mg/ml respectively. It is suggested that either caffeine or Na 2 -EDTA be used to suppress the repair of radiation damage in order to increase mutation efficiency of Pleurotus ostreatus and that 0.2 mg/ml caffeine and 0.5 mg/ml Na 2 -EDTA might be the proper concentrations of treatment both before and after irradiation. The effect of caffeine is better than that of Na 2 -EDTA

Global collection of mushroom pathogens

NARCIS (Netherlands)

Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.; Korsten, L.

2013-01-01

In many places in the world, increasingly less chemical crop protection agents are available for use in mushroom cultivation. As a consequence, mushroom cultivation will loose the ability to use crop protection agents. As a consequence, good hygiene management, early detection and monitoring of

Mushroom immunomodulators: unique molecules with unlimited applications.

Science.gov (United States)

El Enshasy, Hesham A; Hatti-Kaul, Rajni

2013-12-01

For centuries, mushrooms have been used as food and medicine in different cultures. More recently, many bioactive compounds have been isolated from different types of mushrooms. Among these, immunomodulators have gained much interest based on the increasing growth of the immunotherapy sector. Mushroom immunomodulators are classified under four categories based on their chemical nature as: lectins, terpenoids, proteins, and polysaccharides. These compounds are produced naturally in mushrooms cultivated in greenhouses. For effective industrial production, cultivation is carried out in submerged culture to increase the bioactive compound yield, decrease the production time, and reduce the cost of downstream processing. This review provides a comprehensive overview on mushroom immunomodulators in terms of chemistry, industrial production, and applications in medical and nonmedical sectors. Copyright © 2013 Elsevier Ltd. All rights reserved.

Mushroom flora and associated insect fauna in Nsukka Urban ...

African Journals Online (AJOL)

The mushroom flora and associated insect pests of mushrooms in Nsukka urban was studied. The abundance of mushrooms from sampled communites is indicaed with the family, Agaricaceae predominating “out of home” environment yielded more mushrooms (4.62) than the homestead environment (3.26). Insect pests ...

Dung-associated, Potentially Hallucinogenic Mushrooms from Taiwan

OpenAIRE

Yen-Wen Wang; Shean-Shong Tzean

2015-01-01

To identify potentially hallucinogenic mushrooms, dung-associated mushrooms collected from Qingtiangang, Yangmingshan National Park were subjected to a detailed morphological investigation and phylogentic analysis. The investigation identified four taxa: a recorded species (Panaeolus antillarum); a new combination (Conocybe nitrophila); and two new species (Psilocybe angulospora, Protostropharia ovalispora). Morphological and molecular characteristics of the collected mushrooms were compared ...

Performance of mushroom fruiting for large scale commercial production

International Nuclear Information System (INIS)

Mat Rosol Awang; Rosnani Abdul Rashid; Hassan Hamdani Mutaat; Mohd Meswan Maskom

2012-01-01

The paper described the determination of mushroom fruiting yield, which is vital to economics of mushroom production. Consistency in mushroom yields enabling an estimation to be made for revenues and hence profitability could be predicted. It has been reported by many growers, there are a large variation in mushroom yields over different times of production. To assess such claims we have run four batches of mushroom fruiting and the performance fruiting body productions are presented. (author)

Phenylhydrazines in the cultivated mushroom (Agaricus bisporus)

DEFF Research Database (Denmark)

Andersson, H. C.; Gry, Jørn

2004-01-01

In 1991, the Nordic Working Group on Food Toxicology and Risk Evaluation (NNT) reviewed the available data on phenylhydrazines naturally occurring in the cultivated mushroom. It was concluded that the mushroom may contain about 500 mg of the hydrazine derivatives per kg fresh weight. The hydrazine...... derivatives as well as extracts of the cultivated mushroom were mutagenic to a variable degree in most of the reported short-term tests. The raw mushroom and several of the hydrazines induced tumours when administered to Swiss mice as reported by American scientists. However, reservations were expressed...... as to the design of the studies. Based on this review, and due to the concern expressed, a Nordic project (coordinated by Jørn Gry, Danish Veterinary and Food Administration) was initiated dealing with toxicological and chemical studies on the cultivated mushroom and its phenylhydrazine derivatives in order...

Selective adhesion of wastewater bacteria to Pleurotus ostreatus mycelium in a trickle-bed bioreactor

Czech Academy of Sciences Publication Activity Database

Svobodová, Kateřina; Petráčková, Denisa; Szabad, Hana; Novotný, Čeněk

2016-01-01

Roč. 3, č. 3 (2016), s. 395-407 ISSN 2372-0344 Institutional support: RVO:61388971 Keywords : Pleurotus ostreatus * activated sludge * fungal/bacterial co-cultur Subject RIV: EE - Microbiology, Virology

PROSES PENGELOLAHAN MENINGKATKAN AKTIVITAS HIPOLIPIDEMIK JAMUR TIRAM (PLEUROTUS OSTREATUS PADA TIKUS (RATTUS NORVEGICUS SPRGUE-DAWLEY HIPERKOLESTEROL

Directory of Open Access Journals (Sweden)

Eni Harmayani, Deera Army Pramana, Sri Anggrahini dan Sutikarini

2012-12-01

Full Text Available Oyster mushroom is considered to have hypocholesterolemic and hypolipidemic activities. Therefore, it is classifiedas functional food. Prior to serving and consumption, oyster mushroom can be processed in various ways. Thisresearch studied the effect of three kinds of processing commonly used in cooking oyster mushroom; boiling,frying, and roasting. Thirty Sprague-Dawley male rats, 8 weeks old, were acclimated to laboratory condition,and then induced with high lipid diet. The rats were divided into five experiment groups; high-lipid diet (K,high-lipid diet + raw oyster mushroom (M, high-lipid diet + fried oyster mushroom (G, high-lipid diet + roastedoyster mushroom (P, and high-lipid diet + boiled oyster mushroom (R. Blood samples were obtained from orbitalplexus after acclimation, hypercholesterolemic induction, and 21 days of feeding. The blood serum was examinedfor total cholesterol (TC, triglyceride (TG, low-density lipoprotein cholesterol (LDL-c, dan high-densitylipoprotein cholesterol (HDL-c. The result showed that cooked oyster mushroom had better hypocholesterolemicand hypolipidemic activity than raw oyster mushroom. Among the three, the roasted oyster mushroom reduced thetotal cholesterol the most, while boiled oyster mushroom reduced triglyceride the most.

Submerged cultivation of medicinal mushrooms: bioprocesses and products (review).

Science.gov (United States)

Elisashvili, Vladimir

2012-01-01

Medicinal mushrooms belonging to higher Basidiomycetes are an immensely rich yet largely untapped resource of useful, easily accessible, natural compounds with various biological activities that may promote human well-being. The medicinal properties are found in various cellular components and secondary metabolites (polysaccharides, proteins and their complexes, phenolic compounds, polyketides, triterpenoids, steroids, alkaloids, nucleotides, etc.), which have been isolated and identified from the fruiting bodies, culture mycelium, and culture broth of mushrooms. Some of these compounds have cholesterol-lowering, anti-diabetic, antioxidant, antitumor, immunomodulating, antimicrobial, and antiviral activities ready for industrial trials and further commercialization, while others are in various stages of development. Recently, the submerged cultivation of medicinal mushrooms has received a great deal of attention as a promising and reproducible alternative for the efficient production of mushroom mycelium and metabolites. Submerged cultivation of mushrooms has significant industrial potential, but its success on a commercial scale depends on increasing product yields and development of novel production systems that address the problems associated with this technique of mushroom cultivation. In spite of many researchers' efforts for the production of bioactive metabolites by mushrooms, the physiological and engineering aspects of submerged cultures are still far from being thoroughly studied. The vast majority of studies have focused on polysaccharide and ganoderic acid production in submerged cultivation of medicinal mushrooms, and very little has been written so far on the antioxidant and hemagglutinating activity of submerged mushroom cultures. The purpose of this review is to provide an update of the present state of the art and future prospects of submerged cultivation of medicinal mushrooms to produce mycelium and bioactive metabolites, and to make a

Bacteria associated with compost used for cultivation of Nigerian ...

African Journals Online (AJOL)

The bacteria involved in an outdoor single phase composting using sawdust and wheat bran as substrates for cultivation of Pleurotus tuber-regium (Fr.) Singer, and Lentinus squarrosulus (Berk.), two Nigerian edible mushrooms were identified. Composting was carried out for 2 weeks. The highest core and peripheral ...

Cesium fixation in mushrooms

International Nuclear Information System (INIS)

Keller, C.

1990-01-01

It has been found that the various mushroom species accumulate Cs-137 in very different quantities. Whereas specimens of the species Xeromus badius always contained high amounts of Cs-137, analyses of specimens of the related species Boletus edulis showed only weak accumulation of the radionuclide. It is assumed that this general difference in accumulation of Cs-137 is due to a difference in the organic constituents of the mushrooms. (orig.) [de

ROS-dependent mitochondria molecular mechanisms underlying antitumor activity of Pleurotus abalonus acidic polysaccharides in human breast cancer MCF-7 cells.

Directory of Open Access Journals (Sweden)

Xiaolong Shi

Full Text Available BACKGROUND: A greater reduction in cancer risk associated with mushroom diet rich in fungus polysaccharides is generally accepted. Meanwhile, edible Pleurotus abalonus as a member of Abalone mushroom family is a popular nutritional supplement that purportedly prevents cancer occurrence. However, these anecdotal claims are supported by limited studies describing tumor-inhibitory responses to the promising polysaccharides, and the molecular mechanisms underlying these properties have not yet been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: We here fractionated the crude polysaccharide preparation from the fruiting bodies of P. abalonus into three fractions, namely PAP-1, PAP-2 and PAP-3, and tested these fractions for antiproliferative activity in human breast cancer MCF-7 cells. The largest PAP-3, an acidic polysaccharide fraction with a molecular mass of 3.68×10(5 Da, was the most active in inhibiting MCF-7 cancer cells with an IC50 of 193 µg/mL. The changes in cell normal morphology were observed by DAPI staining and the PAP-3-induced apoptosis was confirmed by annexin V/propidium iodide staining. The apoptosis was involved in mitochondria-mediated pathway including the loss of mitochondrial membrane potential (Δψm, the increase of Bax/Bcl-2 ratio, caspase-9/3 activation, and poly(ADP-ribose polymerase (PARP degradation, as well as intracellular ROS production. PAP-3 also induced up-regulation of p53, and cell cycle arrest at the S phase. The incubation of MCF-7 cells with antioxidant superoxide dismutase (SOD and N-acetylcysteine (NAC significantly attenuated the ROS generation and apoptosis caused by PAP-3, indicating that intracellular ROS plays a pivotal role in cell death. CONCLUSIONS/SIGNIFICANCE: These findings suggest that the polysaccharides, especially acidic PAP-3, are very important nutritional ingredients responsible for, at least in part, the anticancer health benefits of P. abalonus via ROS-mediated mitochondrial apoptotic

Dung-associated, Potentially Hallucinogenic Mushrooms from Taiwan

Directory of Open Access Journals (Sweden)

Yen-Wen Wang

2015-12-01

Full Text Available To identify potentially hallucinogenic mushrooms, dung-associated mushrooms collected from Qingtiangang, Yangmingshan National Park were subjected to a detailed morphological investigation and phylogentic analysis. The investigation identified four taxa: a recorded species (Panaeolus antillarum; a new combination (Conocybe nitrophila; and two new species (Psilocybe angulospora, Protostropharia ovalispora. Morphological and molecular characteristics of the collected mushrooms were compared with allied fungal taxa.

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

International Nuclear Information System (INIS)

Migliore, Luciana; Fiori, Maurizio; Spadoni, Anna; Galli, Emanuela

2012-01-01

Highlights: ► Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. ► The role of extracellular laccase in degradation was evaluated. ► The almost complete OTC removal was obtained. ► A possible degradation product was identified in mycelia (ADOTC). ► The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Biodegradation of oxytetracycline by Pleurotus ostreatus mycelium: a mycoremediation technique

Energy Technology Data Exchange (ETDEWEB)

Migliore, Luciana [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Fiori, Maurizio [Dept. Veterinary Public Health and Food Safety, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Spadoni, Anna [Dept. Biology, Tor Vergata University, Via della Ricerca Scientifica, 00133 Rome (Italy); Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy); Galli, Emanuela [Institute of Agro-Environment and Forest Biology, National Research Council, Research Area Rome 1, Via Salaria km 29.300, 00015 Monterotondo Rome (Italy)

2012-05-15

Highlights: Black-Right-Pointing-Pointer Oxytetracycline uptake and degradation by Pleurotus ostreatus mycelium were measured. Black-Right-Pointing-Pointer The role of extracellular laccase in degradation was evaluated. Black-Right-Pointing-Pointer The almost complete OTC removal was obtained. Black-Right-Pointing-Pointer A possible degradation product was identified in mycelia (ADOTC). Black-Right-Pointing-Pointer The system can be considered the first step of an useful mycoremediation technique. - Abstract: Oxytetracycline (OTC) is administered in high doses to livestocks and enters the environmental compartments as a consequence of animal waste disposal. As a first step in setting up a useful mycoremediation technique, an OTC lab degradation test was performed in liquid medium using the ligninolytic fungus Pleurotus ostreatus. OTC disappearance in culture medium was clearly evident as early as the third day of exposure onwards, with an almost complete removal after 14 d. The drug removal was mediated by fungal absorption in the mycelia, where the OTC molecule underwent a degradation step, as demonstrated by mass spectrometry analyses. A putative degradation product, ADOTC (2-acetyl-2-decarboxamido-oxytetracycline) is proposed. Experimental conditions excluded OTC abiotic degradation; the degradation by extracellular laccase was also experimentally discarded.

Decolorization of Synthetic Dyes by Pleurotus ostreatus Isolates Differing in Ligninolytic Properties

Czech Academy of Sciences Publication Activity Database

Eichlerová, Ivana; Homolka, Ladislav; Nerud, František

2002-01-01

Roč. 47, č. 6 (2002), s. 691-695 ISSN 0015-5632 R&D Projects: GA MŠk LN00B030 Institutional research plan: CEZ:AV0Z5020903 Keywords : pleurotus ostreatus * ligninolytic properties Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

Investigation on Pleurotus ferulae potential for the sorption of Pb(II ...

African Journals Online (AJOL)

Pleurotus ferulae obtained from rotten tree was collected, washed, dried, ground and sieved to appropriate particle size. Infra-red spectrometry was used to determine functional groups on the biomass while biosorption of Pb(II) from aqueous solution was studied using the biomass in a batch system. The effect of pH (1-7.5), ...

Vitamin D-fortified chitosan films from mushroom waste

Science.gov (United States)

Brown mushroom (Agaricus bisporus) stalk bases from mushroom waste were treated with UV-B light to rapidly increase vitamin D2 content. Chitin was also recovered from this waste and converted into chitosan by N-deacetylation. FTIR spectra showed that the mushroom chitosan were similar to chitosan fr...

Biodegradation of toxic chemicals by Pleurotus eryngii in submerged fermentation and solid-state fermentation.

Science.gov (United States)

Chang, Bea-Ven; Chang, Yi-Ming

2016-04-01

The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.

Medicinal mushroom science: Current perspectives, advances, evidences, and challenges

Directory of Open Access Journals (Sweden)

Solomon P Wasser

2014-12-01

Full Text Available The main target of the present review is to draw attention to the current perspectives, advances, evidences, challenges, and future development of medicinal mushroom science in the 21 st century. Medicinal mushrooms and fungi are thought to possess approximately 130 medicinal functions, including antitumor, immunomodulating, antioxidant, radical scavenging, cardiovascular, anti-hypercholesterolemic, antiviral, antibacterial, anti-parasitic, antifungal, detoxification, hepatoprotective, and antidiabetic effects. Many, if not all, higher Basidiomycetes mushrooms contain biologically active compounds in fruit bodies, cultured mycelium, and cultured broth. Special attention is paid to mushroom polysaccharides. The data on mushroom polysaccharides and different secondary metabolites are summarized for approximately 700 species of higher hetero- and homobasidiomycetes. Numerous bioactive polysaccharides or polysaccharide-protein complexes from the medicinal mushrooms described appear to enhance innate and cell-mediated immune responses, and exhibit antitumor activities in animals and humans. Whilst the mechanism of their antitumor actions is still not completely understood, stimulation and modulation of key host immune responses by these mushroom compounds appear central. Polysaccharides and low-molecular-weight secondary metabolites are particularly important due to their antitumor and immunostimulating properties. Several of the mushroom compounds have been subjected to Phase I, II, and III clinical trials, and are used extensively and successfully in Asia to treat various cancers and other diseases. Special attention is given to many important unsolved problems in the study of medicinal mushrooms.

Heavy metal and proximate composition associated with the ...

African Journals Online (AJOL)

Changes in the heavy metal content and proximate composition during the 28 day composting of cassava peels used in the cultivation of the oyster mushrooms Pleurotus ostreatus strain EM-1 was studied. Significant dry weight variations of cellulose, hemicellulose and fat contents were observed from day 0 to 12.

Household methods to reduce 137Cs contents of mushrooms

International Nuclear Information System (INIS)

Kostiainen, E.

2005-01-01

High radiocaesium contents in different species of mushrooms have been observed in areas contaminated by radiocaesium deposition after the Chernobyl accident in 1986. There has been no significant reduction in the 137 Cs contents of mushrooms during the past ten years, besides via radioactive decay. The internal radiation dose received via mushrooms can be reduced by processing mushrooms before consumption. Various household methods were studied to find out their efficiency to reduce 137 Cs contents of mushrooms. The methods tested were the same as normally used in cooking. The tests were made for the species of edible mushrooms widely consumed. The retention factors for the treatments tested were in most cases 0.2-0.3. The efficiency of treatments in reducing the 137 Cs contents increased with larger water volumes and prolonged treatment times

Mushroom cultivation in Brazil: challenges and potential for growth

OpenAIRE

Dias,Eustáquio Souza

2010-01-01

Mushroom cultivation is rapidly expanding in Brazil because Brazilians have discovered the medicinal and culinary value of mushrooms and their economic situation has improved. However, the horticultural technology for cultivating mushrooms under Brazilian conditions is lacking. For many years, the mushroom cultivation technology used in Brazil was adapted from developed countries whose materials and climate were different from those of Brazil. In order to exploit the Brazilian potential for m...

Accuracy of sampling during mushroom cultivation

NARCIS (Netherlands)

Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.

2015-01-01

Experiments described in this report were performed to increase the accuracy of the analysis of the biological efficiency of Agaricus bisporus strains. Biological efficiency is a measure of the efficiency with which the mushroom strains use dry matter in the compost to produce mushrooms (expressed

Edible Mushrooms: Improving Human Health and Promoting Quality Life

Directory of Open Access Journals (Sweden)

María Elena Valverde

2015-01-01

Full Text Available Mushrooms have been consumed since earliest history; ancient Greeks believed that mushrooms provided strength for warriors in battle, and the Romans perceived them as the “Food of the Gods.” For centuries, the Chinese culture has treasured mushrooms as a health food, an “elixir of life.” They have been part of the human culture for thousands of years and have considerable interest in the most important civilizations in history because of their sensory characteristics; they have been recognized for their attractive culinary attributes. Nowadays, mushrooms are popular valuable foods because they are low in calories, carbohydrates, fat, and sodium: also, they are cholesterol-free. Besides, mushrooms provide important nutrients, including selenium, potassium, riboflavin, niacin, vitamin D, proteins, and fiber. All together with a long history as food source, mushrooms are important for their healing capacities and properties in traditional medicine. It has reported beneficial effects for health and treatment of some diseases. Many nutraceutical properties are described in mushrooms, such as prevention or treatment of Parkinson, Alzheimer, hypertension, and high risk of stroke. They are also utilized to reduce the likelihood of cancer invasion and metastasis due to antitumoral attributes. Mushrooms act as antibacterial, immune system enhancer and cholesterol lowering agents; additionally, they are important sources of bioactive compounds. As a result of these properties, some mushroom extracts are used to promote human health and are found as dietary supplements.

Selenium content of mushrooms.

Science.gov (United States)

Stijve, T

1977-07-29

The selenium contents of 83 species of wild mushrooms were determined by oxygen combustion of the sample, followed by conversion of selenite to bromopiazselenol and final estimation by electron capture gas-liquid chromatography. Selenium concentration were found to range from 0.012-20.0 mg/kg dry weight. Selenium content was species-dependent. High concentrations were found in Agaricaceae and in certain Boletaceae of the genus Tubiporus, whereas in Russulaceae, Amanitaceae and Cantharellaceae selenium-rich species were absent or rare. Ascomycetes and all mushrooms growing on wood had a very low selenium content. The highest selenium concentrations (up to 20 ppm) were found in Boletus (Tubiporus) edulis, a most popular edible mushroom. Analyses of various parts of carpophores of B. edulis, Suillus luteus and Amanita muscaria indicate that in all three species the stalk contains less selenium than the fleshy part of the cap. In Boletus and Suillus the highest selenium content was found in the tubes.

Cultivation experiments on uptake of radionuclides by mushrooms

International Nuclear Information System (INIS)

Ban-nai, Tadaaki; Yoshida, Satoshi; Muramatsu, Yasuyuki

1994-01-01

After the Chernobyl accident, high concentrations of radiocesium in mushrooms were found in Europe. In our previous studies, we found that 137 Cs concentrations in mushrooms were markedly higher than autotrophic plants. In order to study radionuclide uptake by mushrooms, cultivation experiments in flasks were carried out using radiotracers, 137 Cs, 85 Sr, 60 Co, 54 Mn and 65 Zn. Three mushroom species Hebeloma vinosophyllum, Flammulina velutipes and Coprinus phlyctidosporus were used. In addition, a plant sample, Medicago sativa, was also tested. We found mushrooms tended to accumulate Cs, although there was a large difference between mushroom species. The concentration ratio, which was defined as 'activity of radionuclide in mushroom (Bq/g, wet wt.)' divided by 'activity of radionuclide in medium (Bq/g, wet wt.)', had the highest value of 21 for Cs in H. vinosophyllum. The value was much higher than that in the plant sample. The present findings agreed with previous observations in which Hebeloma species collected in forests contained large amount of 137 Cs. Considerable accumulations were not found for Sr and Co. The concentration ratio of Mn for the mushrooms was about 10, while the ratio of Zn ranged from 15 to 30. The effects of stable elements in the medium on the accumulations were investigated and was found the concentration ratios of Cs, Sr and Co were not influenced highly by coexisting stable elements in the medium. But the concentration ratio of Mn decreased as the amount of coexisting stable elements in the medium was increased. (author)

Mushroom as a product and their role in mycoremediation

OpenAIRE

Kulshreshtha, Shweta; Mathur, Nupur; Bhatnagar, Pradeep

2014-01-01

Mushroom has been used for consumption as product for a long time due to their flavor and richness in protein. Mushrooms are also known as mycoremediation tool because of their use in remediation of different types of pollutants. Mycoremediation relies on the efficient enzymes, produced by mushroom, for the degradation of various types of substrate and pollutants. Besides waste degradation, mushroom produced a vendible product for consumption. However, sometimes they absorb the pollutant in t...

Proximate and mineral composition of four edible mushroom species

African Journals Online (AJOL)

Owner

Key words: Edible mushrooms; food composition. INTRODUCTION. Mushrooms are saprophytes. ... riboflavin, biotin and thiamine (Chang and Buswell,. 1996). Ogundana and Fagade (1981) indicated that ... Four edible mushroom species were analyzed for food composition according to the Association of Official Analytical ...

Accumulation of elements by edible mushroom species: part I. Problem of trace element toxicity in mushrooms.

Science.gov (United States)

Mleczek, Mirosław; Siwulski, Marek; Stuper-Szablewska, Kinga; Rissmann, Iwona; Sobieralski, Krzysztof; Goliński, Piotr

2013-01-01

The aim of this study was to evaluate Cd, Co, Cu, Hg, Ni, Pb, Sr and Zn accumulation in six edible mushroom species and to assess their risk and benefits to human consumers. Mushrooms (Leccinium aurantiacum, Xerocomus badius, Lactarius deliciosus, Boletus edulis, Cantharellus cibarius and Suillus luteus) were collected from selected regions of Poland during 1990-2010. The highest diversity between studied mushroom species was observed in terms of Cu and Zn accumulation. Significant differences in the accumulation efficiency were found among the six mushroom species examined. The most efficient were Boletus edulis (Cd and Hg), Suillus luteus (Cu and Sr), and Lactarius deliciosus (Pb and Zn). In the case of Co and Ni, the most effective were Xerocomus badius and Leccinium aurantiacum, respectively. The calculated bioconcentration factor (BCF) values of Cd, Cu, Hg, Sr and Zn were > 1 for all species in this study while Co, Ni and Pb usually were bioexcluded (BCF luteus collected in Poland is safe and this finding largely agrees with results from recent studies by other authors.

Investigations on Mushroom Storage and Quality Parameters

Directory of Open Access Journals (Sweden)

Ömür Dündar

2016-03-01

Full Text Available In this study, researchers on storage and quality properties of mushrooms cultivated in the world and Turkey have been investigated. Mushrooms contain some important minerals and vitamins such as iron, calcium, phosphorus, potassium, copper and folate, thiamine, riboflavin, niacin, vitamin B, C, D and also they are a good source of carbohydrate and protein. After harvest, to extend the shelf life of mushrooms, some applications such as pre-cooling, storage in appropriate temperature, use of different types of polyethylene packaging, modified atmosphere packaging, nitric oxide and UV light applications were done on mushrooms. The effects of these applications on physical and chemical features such as like weight loss, firmness, cap opening rate, cap diameter, stem diameter, browning, colour, respiration rate, enzymatic reactions, total phenols, total sugars, aminoacid content were investigated.

Shake flask decolourization of direct dye solar golden yellow R by pleurotus ostreatus

International Nuclear Information System (INIS)

Jilani, K.; Asghar, M.; Bhatti, H.N.; Mushtaq, Z.

2011-01-01

Different on site treatment technologies are in practice for industrial wastewaters but bioremediation using white rot fungi is the most attractive option due to complete degradation of the pollutants to non toxic end products. Three direct dyes (Solar golden yellow R, Solar brilliant red BA and Solar orange RSN) were decolourized using white rot fungus (WRF) Pleurotus ostreatus. The best decolourized dye Solar golden yellow R was selected for subsequent optimization studies for decolourization. Under optimum conditions Pleurotus ostreatus caused 90.32 % decolourization of 0.01 % Solar golden yellow R solution within two days of shake flask incubation at pH 3.5 and 30 deg. C temperature in Kirk's basal nutrient medium with added 1 % starch and 0.01 % ammonium sulphate as carbon and nitrogen sources, respectively. Ligninolytic enzyme activities were correlated to dye decolourization and maximum laccase activity of 356.23 U/ml was also noted in the maximally decolourized medium. (author)

Mushroom refinement endeavor auspicate non green revolution in the offing

Directory of Open Access Journals (Sweden)

SHAUKET AHMED PALA

2014-11-01

Full Text Available Pala SA, Wani AH, Boda RH, Wani BA. 2014. Mushroom refinement endeavor auspicate non green revolution in the offing. Nusantara Bioscience 6: 173-185. Mushroom can serve as food, tonic, and as medicine thus make people healthier, fitter and happier. They have a cracking potential for generating great socioeconomic impact in human welfare at local, national and international level. With the help of allied mushroom farming we can easily tackle the problem of food for growing world population; reduce environmental pollution by bioconversion of huge organic wastes into mushrooms; recycle huge quantity of organic wastes to mushroom crops, biofertilizers, and biogas; restore damaged environment by mushroom mycelia through mycoforestry, mycoremediation, mycofiltration and mycopesticides in a zero emission fashion. They can be used to degrade radioactive industrial biocide wastes in an eco-friendly fashion. Since mushroom cultivation is an indoor agribusiness, it could have great economic impact by generating employment, income and functional food requirements for rural people especially in developing countries. How far mushroom cultivation can meet the functional food requirements; address the domestic food challenges, rising food prices and crisis vis a vis environmental sustainability will be thrust areas of this communication.

UTILIZACIÓN DE CHONTADURO (Bactris gasipaes ENRIQUECIDA CON Pleurotus ostreatus EN POLLOS

Directory of Open Access Journals (Sweden)

JOSE MIGUEL CAMPO GAVIRIA

2017-12-01

Full Text Available In commercial poultry production, 70% of the production costs are related to feeding, this is a limiting factor affecting the profitability. This study aimed to evaluate the inclusion of chontaduro peel (Bactris gasipaes, enriched with the (Pleurotus ostreatus fungus, in the feeding of broilers; using a completely randomized design, with five treatments and three repetitions per treatment, with inclusion levels of 0,10% and 20% of chontaduro fruit peel, and 10 and 20% of chontaduro fruit peel enriched with the fungus (Pleurotus ostreatus. The productive behavior of the lot was determined by the feed intake, weight gain, feed conversion, skin pigmentation and cost benefit ratio of the portions. In this regard, no statistical differences (p <0,05 between treatments for all production variables evaluated were found, except for pigmentation, which was higher with levels of 20% of inclusion; as well as the positive effect in economic terms where the addition of a 20% of chontaduro peel flour enriched with the fungus is favorable because of the better cost-benefit ratio, without significantly affectingthe productive behavior.

Author Details - African Journals Online

African Journals Online (AJOL)

Shan, L. Vol 6, No 23 (2007) - Articles Seasonal and spatial root biomass and water use efficiency of four forage legumes in semiarid northwest China Abstract PDF · Vol 10, No 46 (2011) - Articles Extension of the shelf-life of fresh oyster mushrooms (Pleurotus ostreatus) by modified atmosphere packaging with chemical ...

Author Details

African Journals Online (AJOL)

Onyeke, CC. Vol 6, No 2 (2008) - Articles Studies on the Effects of Media on Growth and Nutritional Composition of Pleurotus Tuber-regium (Fries) Singer Mushroom Abstract. ISSN: 1596-7409. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

The Economic Empowerment of Women in Uganda Through Mushroom Production

Directory of Open Access Journals (Sweden)

Ibarahim Mayanja

2017-11-01

Full Text Available This study focuses on empowering women both in peri-urban and rural areas through mushroom production. It was conducted in Kampala Metropolitan area-Uganda, during October 2016. It focused on estimating profits, conducting benefit-cost analysis/ratio (BCR and return on investment (ROI, finding reasons as to why women involved in the mushroom production and identifying the constraints of mushroom farming from the perspective of women as well as the possible solutions to the constraints. 29 women were interviewed face to face through the use of the questionnaires. The study revealed an average net profit of 3,464.28 US dollars, BCR of 3.84 and ROI of 2.84 per farm in a period of three months. Our study revealed that mushroom production is a profitable enterprise for women. The major reason for women to involve in mushroom was to earn income. However, a range of other reasons was given such as fast maturity of mushrooms, availability of market, healthy benefits of mushrooms, etc. were the most important reasons. The problems faced by women farmers were ranked from the most pressing problem to the least pressing problem in this order; Low market prices per kilogram of mushroom, scarcity of cotton during some seasons, poor quality mushroom spawn supplied to farmers by breeders, inadequate extension, and advisory services were the most observed problems among others. The suggested solutions were organizing farmers into groups or cooperatives in order to negotiate for better markets locally and abroad together with the help of government, researchers to carry out more research on the suitability of other substrates like bagasse other than relying on only cotton, ensuring that mushroom spawn breeders conform to the set standards of quality spawn production and re-equipping local extension workers with knowledge regarding mushroom production among others.

Reducing Shrinkage in Canned and Frozen Mushrooms

OpenAIRE

Gormley, T. R. (Thomas Ronan); Walshe, P.E.

1982-01-01

The process involving a preliminary soaking of the mushrooms in water for 20 min followed by a chill storage period followed by a further water soak for 2 hr, and known as the 3S process, gave a considerable reduction in total shrinkage in both brown and white strain canned mushrooms compared with the control samples. Water uptake by the mushrooms in the 3S process was greatest when the soaking water temperature was between 20 and 30°C and had a pH of 8. Citric acid in the blanch water enhanc...

Radioisotopes of the U, Th, Pu, Am in the mushrooms

International Nuclear Information System (INIS)

Galanda, D.; Matel, L.

2001-01-01

The present work is devoted the estimation of the data about radioactive contamination in different species of mushrooms with the aim to analyzing the influence of soil properties. The radioactive plutonium, uranium, thorium and americium was assayed in the dried mushrooms collected in areas of East and West Slovakia in 1998 -2000, and examined the effectiveness of this mushroom as a possible indicator of radioactive contamination of environment due to nuclear contamination of biosphere. Were determined the mushrooms of canes: Suillus, Leccinum, Baletus, Armillariella, Xerocomus and Craterellus. The mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by α-barrier spectrometry. The results of specific activity of plutonium, thorium, uranium and americium in the mushrooms and the layers of forest litter were summarized. (authors)

Dietary fibers from mushroom sclerotia: 3. In vitro fermentability using human fecal microflora.

Science.gov (United States)

Wong, Ka-Hing; Wong, King-Yee; Kwan, Hoi-Shan; Cheung, Peter C K

2005-11-30

The in vitro fermentability of three novel dietary fibers (DFs) prepared from mushroom sclerotia, namely, Pleurotus tuber-regium, Polyporous rhinocerus, and Wolfiporia cocos, was investigated and compared with that of the cellulose control. All DF samples (0.5 g each) were fermented in vitro with a human fecal homogenate (10 mL) in a batch system (total volume, 50 mL) under strictly anaerobic conditions (using oxygen reducing enzyme and under argon atmosphere) at 37 degrees C for 24 h. All three novel sclerotial DFs exhibited notably higher dry matter disappearance (P. tuber-regium, 8.56%; P. rhinocerus, 13.5%; and W. cocos, 53.4%) and organic matter disappearance (P. tuber-regium, 9.82%; P. rhinocerus, 14.6%; and W. cocos, 57.4%) when compared with those of the cellulose control. Nevertheless, only the W. cocos DF was remarkably degraded to produce considerable amounts of total short chain fatty acids (SCFAs) (5.23 mmol/g DF on organic matter basis, with a relatively higher molar ratio of propionate) that lowered the pH of its nonfermented residue to a slightly acidic level (5.89). Variations on the in vitro fermentability among the three sclerotial DFs might mainly be attributed to their different amounts of interwoven hyphae present (different amounts of enzyme inaccessible cell wall components) as well as the possible different structural arrangement (linkage and degree of branching) of their beta-glucans.

Cobweb, a serious pathology in mushroom crops: A review

Directory of Open Access Journals (Sweden)

Jaime Carrasco

2017-07-01

Full Text Available Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

Cobweb, a serious pathology in mushroom crops: A review

International Nuclear Information System (INIS)

Carrasco, J.; Navarro, M.J.; Gea, F.

2017-01-01

Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

Cobweb, a serious pathology in mushroom crops: A review

Energy Technology Data Exchange (ETDEWEB)

Carrasco, J.; Navarro, M.J.; Gea, F.

2017-07-01

Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

Household methods to reduce {sup 137}Cs contents of mushrooms

Energy Technology Data Exchange (ETDEWEB)

Kostiainen, E. [Radiation and Nuclear Safety Authority - STUK, Helsinki (Finland)

2005-09-15

High radiocaesium contents in different species of mushrooms have been observed in areas contaminated by radiocaesium deposition after the Chernobyl accident in 1986. There has been no significant reduction in the {sup 137}Cs contents of mushrooms during the past ten years, besides via radioactive decay. The internal radiation dose received via mushrooms can be reduced by processing mushrooms before consumption. Various household methods were studied to find out their efficiency to reduce {sup 137}Cs contents of mushrooms. The methods tested were the same as normally used in cooking. The tests were made for the species of edible mushrooms widely consumed. The retention factors for the treatments tested were in most cases 0.2-0.3. The efficiency of treatments in reducing the {sup 137}Cs contents increased with larger water volumes and prolonged treatment times.

Biodegradation of 2,4 dichlorophenol by Pleurotus ostreatus DSM 1833

Directory of Open Access Journals (Sweden)

Heloisa Helena Batista da Silva

2009-12-01

Full Text Available This work aimed to investigate the capacity of Pleurotus ostreatus DSM 1833 to degrade 2,4-dichlorophenol, important pollutant found in the wastewaters of the paper and cellulose industry. Using a factorial design 2², the concentrations of glucose and 2,4-dichlorophenol varied between 0 and 10g.L-1 and 5 and 30mg.L-1, respectively. The best global biodegradation rate was obtained using 30 mg.L-1 of 2,4- dichlorophenol in the absence of glucose. This culture medium was used for scaling up the process, resulting in a global biodegradation rate of 0.47mg.L-1.h-1. A comparative test between an inoculated medium and an abiotic control demonstrated that 54.1% of 2,4- dichlorophenol degradation could be attributed to the presence of P. ostreatus.A indústria de papel e celulose contribui para a contaminação ambiental devido aos resíduos gerados, especialmente, no processo de branqueamento da polpa Kraft, realizada com cloro. Basideomicetos saprófitas têm a capacidade de degradar compostos organoclorados como cloroligninas e clorofenóis. Este trabalho teve como objetivo investigar a capacidade de Pleurotus ostreatus DSM 1833 em degradar 2,4-diclorofenol, importante poluente encontrado nos efluentes da indústria de papel e celulose. Utilizando um planejamento fatorial 2², as concentrações de glicose e de 2,4-diclorofenol variaram entre 0 e 10 g.L-1 e 5 e 30 mg.L-1, respectivamente. A melhor taxa global de degradação foi obtida usando-se 30 mg.L-1 de 2,4-diclorofenol na ausência de glicose. Este meio de cultura foi utilizado para a ampliação da escala do processo, resultando em uma taxa global de biodegradação de 0,47 mg.L-1.h-1. Um teste comparativo entre o meio inoculado e o controle abiótico demonstrou que 54,1% da degradação do 2,4-diclorofenol pode ser atribuída à presença de Pleurotus ostreatus.

Fresh-keeping of mushroom by irradiation

International Nuclear Information System (INIS)

Liu Chao; Xu Hongqing; Wang Hong; Cai Jian

2003-01-01

The effect of 60 Co γ irradiation on the preservation of Agaricus bisporus were studied. The results showed that after irradiation the mushroom had lower rates of membrane split, opening of pilei, browning, decomposition and lose of fresh weight. The fresh keeping period of mushroom irradiated with 1.2 kGy and stored at 4 degree C was prolonged to 30 days

Caracterización de la lacasa obtenida por dos métodos de producción con Pleurotus ostreatus Characterising laccase obtained by two production methods using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Martínez César

2003-12-01

Full Text Available El objetivo de este trabajo fue caracterizar y evaluar diferentes métodos de purificación y separación cromatográfica de un caldo rico en enzima lacasa, producida por una variedad del basidiomycete Pleurotus ostreatus. Se llevaron a cabo dos procesos de producción, a saber: a FES (Fermentación en Estado Sólido; b fermentación en sumergido. El proceso de FES se basó en la producción de un extracto de caldo crudo rico en enzima lacasa a partir del crecimiento micelial sobre salvado con vinaza en relación 1:1 w/v duran te 20 días. Se obtuvo un caldo crudo con una actividad promedio de 20 U/ml. En el caso del proceso de fermentación en sumergido, se trabajó con el medio reportado por Hublick y Schinner (2000 con algunas modificaciones, y se obtuvo un crecimiento del hongo en forma de pellets, en un período de 15 días, con actividad promedio de 10 U/ml en el caldo crudo. Las isoenzimas aisladas en los procesos cromatográficos se caracterizaron de acuerdo a sus propiedades moleculares y cinéticas, se determinó su peso molecular por electroforesis de placa vertical (SDS-PAGE y sus parámetros cinéticos, por ejemplo estabilidad, en un rango de temperatura y pH. Palabras clave: lacasa; Pleurotus ostreatus; fermentación en estado sólido (FES; fermentación en sumergido; isoenzimas; laccase; Pleurotus ostreatus; Solid State Fermentation (SSF; Submerged Fermentation; isoenzymesThis project was designed for characterising and evaluating different methods of chromatographic separation and purification regarding a laccase enzyme-rich broth produced by Pleurotus ostreatus, a variety of basidiomycetes. SSF (Solid State Fermentation and Submerged Fermentation production processes were employed. The SSF process was based on producing a raw broth rich in laccase enzyme from mycelium grown on bran with 1:1 vinasse w/v for 20 days. A raw broth was obtained having an average 20 U/ml activity. The medium reported by Hublick and Schinner (2000

Mushroom cultivation, processing and value added products: a patent based review.

Science.gov (United States)

Singhal, Somya; Rasane, Prasad; Kaur, Sawinder; Garba, Umar; Singh, Jyoti; Raj, Nishant; Gupta, Neeru

2018-06-03

Edible mushrooms are an abundant source of carbohydrates, proteins, and multiple antioxidants and phytonutrients. This paper presents a general overview on the edible fungus describing the inventions made in the field of its cultivation, equipment and value added products. To understand and review the innovations and nutraceutical benefits of mushrooms as well as to develop interest regarding the edible mushrooms. Information provided in this review is based on the available research investigations and patents. Mushrooms are an edible source of a wide variety of antioxidants and phytonutrients with a number of nutraceutical properties including anti-tumor and anti-carcinogenic. Thus, several investigations are made for cultivation and improvement of the yield of mushrooms through improvisation of growth substrates and equipment used for mushroom processing. The mushroom has been processed into various products to increase its consumption, providing the health and nutritional benefit to mankind. This paper summarizes the cultivation practices of mushroom, its processing equipments, methods of preservation, value added based products, and its nutraceutical properties. The review also highlights the various scientific feats achieved in terms of patents and research publications promoting mushroom as a wholesome food. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Biochemical and microstructural Ccharacteristics of insoluble and soluble dietary fiber prepared from mushroom sclerotia of Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos.

Science.gov (United States)

Wong, Ka-Hing; Cheung, Peter C K; Wu, Jin-Zhong

2003-11-19

The proximate composition of sclerotia of Pleurotus tuber-regium, Polyporus rhinoceros, and Wolfiporia cocos, together with the yield, purity, monosaccharide profile, and microstructure of their insoluble dietary fiber (IDF) and soluble dietary fiber (SDF) fractions prepared from AOAC enzymatic-gravimetric methods were investigated and compared. All three sclerotia were typical carbohydrate rich sclerotia [ranging from 90.5 to 98.1% dry matter (DM)] with an exceptionally low amount of crude lipid content (ranging from 0.02 to 0.14% DM). Besides, all three sclerotia possessed substantial amounts of IDF (ranging from 77.4 to 94.6% DM) with notably high levels of nonstarch polysaccharides (NSP) (89.9-92.2% DM) in which glucose was the predominant sugar residue (90.6-97.2% of NSP DM). On the contrary, both the yield (only ranging from 1.45 to 2.50% DM) and the amount of NSP (ranging from 22.4 to 29.6% DM) of the three sclerotial SDF fractions were very low. Scanning electron micrographs showed fragments of interwoven hyphae and insoluble materials in the three sclerotial IDF fractions, but only an amorphous structure of soluble materials was observed in the SDF fractions. The potential use of these fiber preparations was discussed.

Oyster Mushroom

African Journals Online (AJOL)

The pastoralists have been hopelessly trying to get rid of the bush through ... mushroom cultivation the mentioned problems can be solved yielding nutritious ..... Mean values within the same column with no common superscript letter differ at the 95% confidence level and the .... Encroachment in the Borana Low Land.

[Knowledge of students of tourism and recreation Academy of Physical Education on wild mushrooms].

Science.gov (United States)

Chwaluk, Paweł; Parnicki, Florian

2011-01-01

Prophylaxis of acute poisoning with mushrooms is justified because of the relatively high risk of death associated with these intoxications. Mushrooming in Poland has a long tradition and knowledge about mushrooms is usually passed on in families. In recent years the mushrooming becomes an organized form of recreation. Graduates of tourism and recreation should have a minimum of reliable knowledge about mushrooms, to ensure the safety of persons entrusted to their care. The knowledge of wild mushrooms among students of tourism and recreation was tested by means of questionnaire. Mushrooms gathered 108 out of 125 respondents. The primary source of knowledge about mushrooms for 84% of the mushrooms pickers were the parents. Up to 70% of respondents considered at least one of irrational methods useful to distinguish edible mushrooms from the poisonous. Thirteen percent of those polled believed that by simple means mushrooms may be deprived of their toxic properties. Knowledge of the only one deadly poisonous mushrooms growing in Poland was 53%. The tourism and recreation students must pass basic knowledge about mushrooms and identify reliable sources of knowledge in this field.

The Evaluation of Pediatric Cases with Mushroom Poisoning

Directory of Open Access Journals (Sweden)

Selda Hizel

2007-10-01

Full Text Available Mushroom poisonings are intoxications with high mortality. Toxic wild mushrooms usually grow up in spring and autmn and the intoxications of these mushrooms occur mostly in these seasons. The symptoms, the initial time of the symptoms, the arrival time to the hospital, the physical examination findings, laboratory datas, treatments that were applied, the time kept in the hospital and the prognoses of the cases with mushroom intoxication diagnosis in the pediatry department were recorded between 1 October and 31 November 2006. During the time described above, a total of 24 cases with mushroom poisoning were determined. 8 of the cases (33.3 % were refered to another hospital, 16 of them (66.7 % were hospitalizated and observed. Gastrointestinal complaints was the symptom determined in every patient at the application time to the hospital whereas only 3 patients (12.5 % had neurologic symptoms. Symptoms occured within 6 hours of consumption of mushrooms in 7 cases (29.2 %. Elevated liver enzymes was determined in 4 patients (16.6 % whereas renal functions were normal in all of the cases. 16 cases who were hospitalizated, completely recovered and were discharged. However, 2 patients (8.3 % who were refered, died. Mushroom poisoning is an important health problem because of its high mortality and the best treatment is to make the public conscious of this problem. Therefore alerting the public, informing them about the symptoms and making them resort to hospitals with the first detected initial symptoms, by improving and strengthening the public education projects will reduce the mortality. [TAF Prev Med Bull. 2007; 6(5: 341-344

The Evaluation of Pediatric Cases with Mushroom Poisoning

Directory of Open Access Journals (Sweden)

Selda Hizel

2007-10-01

Full Text Available Mushroom poisonings are intoxications with high mortality. Toxic wild mushrooms usually grow up in spring and autmn and the intoxications of these mushrooms occur mostly in these seasons. The symptoms, the initial time of the symptoms, the arrival time to the hospital, the physical examination findings, laboratory datas, treatments that were applied, the time kept in the hospital and the prognoses of the cases with mushroom intoxication diagnosis in the pediatry department were recorded between 1 October and 31 November 2006. During the time described above, a total of 24 cases with mushroom poisoning were determined. 8 of the cases (33.3 % were refered to another hospital, 16 of them (66.7 % were hospitalizated and observed. Gastrointestinal complaints was the symptom determined in every patient at the application time to the hospital whereas only 3 patients (12.5 % had neurologic symptoms. Symptoms occured within 6 hours of consumption of mushrooms in 7 cases (29.2 %. Elevated liver enzymes was determined in 4 patients (16.6 % whereas renal functions were normal in all of the cases. 16 cases who were hospitalizated, completely recovered and were discharged. However, 2 patients (8.3 % who were refered, died. Mushroom poisoning is an important health problem because of its high mortality and the best treatment is to make the public conscious of this problem. Therefore alerting the public, informing them about the symptoms and making them resort to hospitals with the first detected initial symptoms, by improving and strengthening the public education projects will reduce the mortality. [TAF Prev Med Bull 2007; 6(5.000: 341-344

Radiocaesium and natural gamma emitters in mushrooms collected in Spain

Energy Technology Data Exchange (ETDEWEB)

Baeza, Antonio; Guillen, Fco. Javier [Department of Physics, Faculty of Veterinary, University of Extremadura, Avda de la Universidad s/n, Caceres 10071 (Spain); Hernandez, Santiago [Department of Techniques, Means and Elements of Construction, Polytechnical School, University de Extremadura, Avda de la Universidad s/n, Caceres 10071 (Spain); Moreno, Gabriel; Manjon, Jose Luis [Department of Plant Biology, Faculty of Sciences, University of Alcala, Alcala de Henares, Madrid 28871 (Spain); Pascual, Rosario [Department of Zootechnics, Faculty of Veterinary, University of Extremadura, Avda de la Universidad s/n, Caceres 10071 (Spain)

2004-01-05

Mushrooms can accumulate heavy metals in general, including radionuclides found in the nature. However, little attention has been paid to the radioactive content of mushrooms collected in Spain and the dose for the population due to their ingestion. To address this, we analysed the contents of {sup 137}Cs, {sup 40}K, {sup 226}Ra and {sup 7}Be present in different species of mushrooms, according to their genus and nutritional mechanism. We observed that mycorrhizal mushrooms accumulate {sup 137}Cs more than saprophytes, and vice versa for {sup 7}Be. {sup 40}K and {sup 226}Ra are accumulated to the same degree by the two groups of mushrooms. We estimated the dose due to ingestion of mushrooms in Spain to be 2 {mu}Sv/year, and the contribution of {sup 40}K and {sup 226}Ra to be generally greater than that of {sup 137}Cs. The contribution of {sup 137}Cs to the dose was calculated by taking into account the results of an experiment carried out under the controlled laboratory conditions, which showed that approximately 98% of {sup 134}Cs was associated with the readily digestible fraction of the mushrooms.

Antifatigue Functions and Mechanisms of Edible and Medicinal Mushrooms

Directory of Open Access Journals (Sweden)

Ping Geng

2017-01-01

Full Text Available Fatigue is the symptom of tiredness caused by physical and/or psychological stresses. As fatigue is becoming a serious problem in the modern society affecting human health, work efficiency, and quality of life, effective antifatigue remedies other than pharmacological drugs or therapies are highly needed. Mushrooms have been widely used as health foods, because of their various bioactive constituents such as polysaccharides, proteins, vitamins, minerals, and dietary fiber. This paper reviews the major findings from previous studies on the antifatigue effects, the active components of mushrooms, and the possible mechanisms. Many studies have demonstrated the antifatigue effects of edible and medicinal mushrooms. These mushrooms probably mitigate human fatigue through effects on the functional systems, including the muscular, cardiovascular, hormone, and immune system. The bioactive constituents that contribute to the antifatigue effects of mushrooms may include polysaccharides, peptides, nucleosides, phenolic compounds, and triterpenoids. Further research is still needed to identify the active ingredients and to investigate their mechanism of action on the antifatigue effects. Since most previous studies have been carried out in animal models, more human trials should be performed to verify the antifatigue function of edible and medicinal mushrooms.

A resource efficiency assessment of the industrial mushroom production chain

NARCIS (Netherlands)

Zisopoulos, Filippos K.; Becerra Ramírez, Henry A.; Goot, van der Atze Jan; Boom, Remko M.

2016-01-01

We compare the exergetic performance of a conventional industrial mushroom production chain with a mushroom production chain where part of the compost waste is recycled and reused as raw material. The critical exergy loss points (CEPs) identified are the cooking-out process of the spent mushroom

Antioxidant properties of mushroom mycelia obtained by batch cultivation and tocopherol content affected by extraction procedures.

Science.gov (United States)

Vamanu, Emanuel

2014-01-01

The determination of the antioxidant potential of lyophilized mushroom mycelia from 5 strains of the species Pleurotus ostreatus and Coprinus comatus (obtained by submerged cultivation in batch system) was analyzed as ethanolic extracts by evaluating ABTS and the hydroxyl scavenging activity, FRAP method, the chelating capacity, the inhibition of human erythrocyte hemolysis, and the inhibition of xanthine oxidase activity. The main compounds present in all extracts were determined by HPLC chromatography. Overall, results demonstrated that the biologically active substances content is modulated by the extraction method used. The most beneficial extract, characterized by determining the EC50 value, was that of C. comatus M8102, followed by P. ostreatus PQMZ91109. Significant amount of α-tocopherol (179.51 ± 1.51 mg/100 g extract) was determined as well as flavones such as rutin and apigenin. In the P. ostreatus PQMZ91109 extract, 4.8 ± 0.05 mg/100 g extract of tocopherol acetate known to play a significant role as an antioxidant in skin protection against oxidative stress generated by UV rays was determined. The various correlations (r (2) = 0.7665-0.9426 for tocopherol content) assessed and the composition of extracts in fluidized bed from the mycelia of the tested species depicted a significant pharmacological potential as well as the possibility of usage in the development of new functional products.

Production of ligninolytic enzymes by solid state fermentation using Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Seyma Ozcirak Ergun

2017-06-01

Full Text Available Solid state fermentation (SSF stands out in the production of lignocellulolytic and other industrially important enzymes. SSF, an alternative culture method, has several advantages over the conventional submerged ones, like higher yields of enzymes. The production of ligninolytic enzymes, such as laccase (Lac, manganese peroxidase (MnP, lignin peroxidase (LiP and aryl alcohol oxidase (AAO by Pleurotus ostreatus (Jacq. Pleurotus Kumm. (MCC16 was investigated under SSF, which was performed using a support-substrate from potato peel waste (PPW. PPW as dry and fresh was pretreated with base to neutralize organic acids and distilled water. Chemical content of PPW was investigated. Ligninolytic enzyme production patterns were investigated during the growth of the organism for a period of 23 days at 25 °C in the stationary SSF using pretreated PPW. The highest Lac and MnP activities were determined in dry PPW, pretreated with distilled water as 6708.3 ± 75 U/L and 2503.6 ± 50 U/L on day 17, respectively. In addition, amylase and protease enzyme activities were detected under same conditions. According to the results, PPW has a potential as supports for ligninolytic enzyme production by P. ostreatus under SSF.

The role of Drosophila mushroom body signaling in olfactory memory.

Science.gov (United States)

McGuire, S E; Le, P T; Davis, R L

2001-08-17

The mushroom bodies of the Drosophila brain are important for olfactory learning and memory. To investigate the requirement for mushroom body signaling during the different phases of memory processing, we transiently inactivated neurotransmission through this region of the brain by expressing a temperature-sensitive allele of the shibire dynamin guanosine triphosphatase, which is required for synaptic transmission. Inactivation of mushroom body signaling through alpha/beta neurons during different phases of memory processing revealed a requirement for mushroom body signaling during memory retrieval, but not during acquisition or consolidation.

Uptake and transfer factors of 137Cs by mushrooms

International Nuclear Information System (INIS)

Heinrich, G.

1991-01-01

The 137 Cs content of 118 species (668 samples) of higher fungi collected in the period from August 1984 to October 1989 at three different locations in Styria, Austria, was determined by gamma-spectrometry. The Cs-content of most mushrooms has been increasing since September 1986. In order to find out which factors determine the 137 Cs-contamination of mushrooms and the transfer-value soil to mushroom, the concentration of total and plant-available radiocesium in soils as well as the pH-value, the content of humus, clay, silt, sand, exchangeable cations, the composition of the clay minerals, and the particle size distribution of the soils of two different locations were examined. The higher the 137 Cs contamination of the soil, the thicker the layer of humus and the higher the content of humus, the lower the pH-value, and the lower the amount of essential cations, especially of K + , the higher the amount of 137 Cs plant-available will be. Therefore, the contamination of the mushrooms in the coniferous forest of Koralpenblick (1000 m) is higher than in the mixed forest at the Rosenberg around Graz at approx. 500 m height. Of 26 different species of mushrooms measured at both sites, only 61% show the highest TF-values soil to mushrooms also at the Koralpenblick. In the spruce forest at Koralpenblick there are many species of mushrooms with high 137 Cs-contamination which were not found at the Rosenberg. However, the properties of the species to which a mushroom belongs are more important than environmental conditions and soil properties. The transfer values of 40 K stay within narrow bounds, whereas those of 137 Cs differ widely. (orig.)

Accumulation of radiocesium and trace elements in mushrooms collected from Japanese forests

International Nuclear Information System (INIS)

Yoshida, S.; Muramatsu, Y.; Ban-Nai, T.

1996-01-01

Concentrations of 137 Cs, 134 Cs and 40 K for 124 mushroom species (284 samples) collected from Japanese forests during 1989 to 1991 were studied. The levels of 137 Cs m mushrooms varied very widely ranging from 40 K were relatively constant. The median concentrations of 137 Cs and 40 K were 53 and 1180 Bq/kg (dry wt), respectively. The 134 Cs discharged through the Chernobyl accident was detected only in 33 mushroom samples. The proportions of 137 Cs originating from the Chernobyl accident m these mushrooms were in the range 137 Cs concentrations in mycorrhizal fungi tended to be higher than those in saprophytes. The concentrations in many mushrooms reflected the layers m which their mycelia were growing. In addition to the radionuclides, many stable elements including stable Cs in mushroom and soil samples were determined. A good correlation between 137 Cs and stable Cs was observed for 33 mushrooms collected from a pine forest on sandy soil near coast in Tokai-mura, Ibaraki, indicating that mushroom available Cs is recycling in the pine forest with the constant 137 Cs/stable Cs ratio. Accumulations from soil to mushrooms were observed for Cd, Rb, Zn, Cu. Cs, K, Mg, Mn, Ni and Tl. Through cultivation experiments in flasks using radiotracers, 137 Cs, 65 Zn and 54 Mn were observed to be accumulated in mushrooms. (author)

Comparison of Different Drying Methods for Recovery of Mushroom DNA.

Science.gov (United States)

Wang, Shouxian; Liu, Yu; Xu, Jianping

2017-06-07

Several methods have been reported for drying mushroom specimens for population genetic, taxonomic, and phylogenetic studies. However, most methods have not been directly compared for their effectiveness in preserving mushroom DNA. In this study, we compared silica gel drying at ambient temperature and oven drying at seven different temperatures. Two mushroom species representing two types of fruiting bodies were examined: the fleshy button mushroom Agaricus bisporus and the leathery shelf fungus Trametes versicolor. For each species dried with the eight methods, we assessed the mushroom water loss rate, the quality and quantity of extracted DNA, and the effectiveness of using the extracted DNA as a template for PCR amplification of two DNA fragments (ITS and a single copy gene). Dried specimens from all tested methods yielded sufficient DNA for PCR amplification of the two genes in both species. However, differences among the methods for the two species were found in: (i) the time required by different drying methods for the fresh mushroom tissue to reach a stable weight; and (ii) the relative quality and quantity of the extracted genomic DNA. Among these methods, oven drying at 70 °C for 3-4 h seemed the most efficient for preserving field mushroom samples for subsequent molecular work.

Use of modified atmosphere packaging to preserve mushroom quality during storage.

Science.gov (United States)

Palacios, Irene; Moro, Carlos; Lozano, Miguel; D'Arrigo, Matilde; Guillamón, Eva; García-Lafuente, Ana; Villares, Ana

2011-09-01

Mushrooms have attracted much attention due to their excellent nutritional and sensory properties. However, they are highly perishable and rapidly lose their organoleptic characteristics. Many methods have been employed for mushroom storage, such as packaging, blanching, canning, or freeze drying. Among them, modified atmosphere packaging (MAP) has been widely employed for preserving fresh mushrooms. MAP provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. Several factors, including optimum CO2 and O2 partial pressures, permeability, package material, thickness, or product weight, must be considered in order to design a suitable modified atmosphere package for mushrooms. Thus, different strategies are available to preserve mushroom quality after harvest. The article presents some promising patents on use of modified atmosphere packaging to preserve mushroom quality during storage.

Chernobyl is still haunting us. Radionuclides in Estonian mushrooms

International Nuclear Information System (INIS)

Martin, J.; Vilde, R.; Martin, L.; Aaspollu, J.; Tekko, S.

1993-01-01

The disaster that happened at the Chernobyl nuclear power station in 1986 caused a sharp rise in radioactive pollution over an extensive area in the region of the Baltic Sea. To estimate the distribution and the concentration of Cs-137 and Sr-90 in Estonian ecosystems, samples of mushrooms, mosses, lichens and the upper horizons of soil were gathered from 63 test sites during 1991. We were particularly interested in the amounts of radionuclides in mushrooms because these are used as food by people. Dangerously high radionuclide concentrations were found in mushrooms gathered in North-East Estonia. Heightened concentrations were registered here and there all over the territory of Estonia, especially in mushrooms gathered in Central and South-Western Estonia. The Cs-137 content in mushrooms depends on its content in other components of the ecosystems, first and foremost on the concentrations of radiocaesium in mosses and litter, which, therefore, can be used as indicators in prognostication the radioactive pollution of mushrooms in a certain region. As Cs-137 migrates between various ecosystem components, it is necessary to check the radioactivity of the forest products used for food for still a number of years to come. The Sr-90 level was low in all the ecosystem components examined. (author). 3 figs., 10 refs

wild and domesticated mushroom consumption in nigeria abstract

African Journals Online (AJOL)

USER

of awareness, consumption history, wild or ... 15.6% were students and 11.1% business ... 1.1. N/A. 5. 5.6. NA = Not applicable mushrooms for over 10 years; whereas 13.3% ... Consumption history of wild and cultivated mushrooms in Nigeria.

Amanitin and phallotoxin concentration in Amanita phalloides var. alba mushroom.

Science.gov (United States)

Kaya, Ertugrul; Yilmaz, Ismail; Sinirlioglu, Zeynep Aydin; Karahan, Selim; Bayram, Recep; Yaykasli, Kursat Oguz; Colakoglu, Serdar; Saritas, Ayhan; Severoglu, Zeki

2013-12-15

Although rarely seen, Amanita phalloides var. alba, a variety of A. phalloides type mushrooms, causes mushroom poisoning resulting in death. Since it is frequently confused with some edible mushrooms due to its white colored cap and macroscopic appearance, it becomes important in toxicological terms. Knowledge of the toxin amount contained in this mushroom type is invaluable in the treatment of cases involving poisoning. In this study, we examined the toxin levels of various parts of the A. phalloides var. alba mushroom growing Duzce region of Turkey. Toxin analyses were carried out for A. phalloides var. alba, which were collected from the forests Duzce region of Turkey in 2011, as a whole and also separately in its spore, pileus, gills, stipe and volva parts. The alpha amanitin, beta amanitin, gamma amanitin, phalloidin and phallacidine analyses of the mushrooms were carried out using the RP-HPLC method. A genetic analysis of the mushroom showed that it had similar genetic characteristics as A. phalloides and was a variety of it. The lowest toxins quantity was detected in spores, volva and stipe among all parts of the mushroom. The maximum amount of amatoxins was measured in the gills. The pileus also contained a high amount of amatoxins. Generally, amatoxins and phallotoxin concentrations were lower as compared to A. phalloides, but interestingly all toxins other than gamma toxin were higher in the spores of A. phalloides var. alba. The amount of toxin in all of its parts had sufficient concentrations to cause death. With this study, the amatoxin and phallotoxin concentrations in A. phalloides var. alba mushroom and in its parts have been revealed in detail for the first time. Copyright © 2013 Elsevier Ltd. All rights reserved.

Symbiosis and synergy: Can mushrooms and timber be managed together?

Science.gov (United States)

Sally. Duncan

2000-01-01

Recreational and tribal use of mushrooms has been historically important, and during the last two decades, commercial demand for mushrooms has burgeoned. A large nontimber forest product market in the Pacific Northwest is for various species of wild edible mushrooms. Many of these species grow symbiotically with forest trees by forming nutrient exchange structures...

DESIGN OF OYSTER (PLEUROTUS OSTREATUS PRODUCTION UNIT TAKING INTO ACCOUNT ITS AGROTECHNIC OF GROWIGN AND QUALITY AND QUANTITY OF ITS PRODUCTION

Directory of Open Access Journals (Sweden)

Marcel Golian

2015-02-01

Full Text Available According to influence of population increasing followed by agricultural soils decreasing there is noticed a necessity of individual food commodities production intensification. There is also needed to think about some new unconventional and alternative sort of food-stuff. An edible mushroom growing is one of the relatively new agricultural branches, whereby on a large scale there are grown species which belong to saprophytic group. The aim of task was the building – technological and equipment – technological proposal of oyster (Pleurotus ostreatus, Jacq. P. Kumm production unit with taking account to its specific agro technical requirements and valid legislative. In the next part of task there were evaluated and compared qualitative and quantitative parameters of sporocarps from two variants which were collected in the first growth wave and accuracy of the proposed oyster production unit. In case of variant A there were used sacks with substrates, which have been exposed to cold shock by 6°C temperature for 4 days and in variant B were used substrates without cold shock. According to reached results the cold shock had almost neither influence on production quantity. There was found out an important fact that crop height from first growth wave wasn´t identical with well-known literature sources. The low crop is connected with high CO2 content in oyster production unit room, according to our opinion. Other equipment aimed to air humidity regulation, air temperature regulation and room lights was designed correctly.

Antiproliferative and Antioxidant Activities of Wild Boletales Mushrooms from France.

Science.gov (United States)

Morel, Sylvie; Arnould, Stéphanie; Vitou, Manon; Boudard, Frédéric; Guzman, Caroline; Poucheret, Patrick; Fons, Françoise; Rapior, Sylvie

2018-01-01

We selected edible and inedible mushrooms growing in the Mediterranean area of France to screen their biological activity: Caloboletus calopus, Rubroboletus lupinus, R. pulchrotinctus, R. satanas, Gyroporus castaneus, Suillus luteus, and Omphalotus olearius. Mushrooms were sequentially extracted using cyclohexane, chloroform, ethanol, and water. The antiproliferative activity against the HCT116 colon adenocarcinoma cell line and the antioxidant properties (DPPH radical scavenging assay, Folin-Ciocalteu assay, and oxygen radical absorbance capacity) of the Boletales extracts were evaluated and compared. Among the 28 mushroom extracts evaluated, 11 presented antiproliferative activity against HCT116 cells. These activities were not linked to antioxidant capacity. Among the antioxidant extracts, most were aqueous extracts in the oxygen radical absorbance capacity assay, whereas the highest values on the Folin-Ciocalteu and DPPH assays were noted for chloroform, ethanol, or aqueous extracts, depending on the mushroom species. Further studies are necessary to identify bioactive compounds and to valorize the mushrooms-for edible species, directly as health foods, or, for inedible mushrooms, as ingredients in the pharmaceutical and food industries.

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

Directory of Open Access Journals (Sweden)

Ricardo Sposina S. Teixeira

2010-01-01

Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

Comparative study of wild edible mushrooms as sources of antioxidants.

Science.gov (United States)

Witkowska, Anna M; Zujko, Małgorzata E; Mirończuk-Chodakowska, Iwona

2011-01-01

The purpose of the study was to explore sixteen of the most popular edible species of wild-growing mushrooms as potential sources of antioxidants. Among the mushrooms tested, the highest total polyphenol contents, exceeding 100 mg/100 g fresh mass, were found in five mushrooms: Boletus chrysenteron, B. edulis, Leccinum scabrum, L. aurantiacum, and Macrolepiota procera. Antioxidant activity was measured with the FRAP, TEAC, DPPH scavenging ability and ferrous ions chelating ability assays. Results of the study show that wild mushrooms vary according to their antioxidant properties. The highest FRAP potentials, exceeding 1 mmol/100 g, were found in five species ofBoletales: Boletus edulis, B. chrysenteron, Leccinum scabrum, L. aurantiacum, and Suillus grevillei. TEAC values were from 1.07 to 4.01 mmol/100 g fresh mass. High TEAC values (>2.3 mmol/100 g) were found in Leccinum scabrum, L. aurantiacum, Macrolepiota procera, Boletus chrysenteron, and B. edulis. The DPPH radical scavenging effectiveness of mushroom extracts, expressed as EC50 values, was in range 2.91-13.86 mg/mL. Scavenging ability was the highest for B. edulis and B. chrysenteron. The metal chelating ability of mushroom extracts expressed as ECso values of chelating ability on ferrous ions were from 8.02 mg/mL in Cantharellus cibarius to 12.10 mg/mL in Suillus luteus. Among the mushrooms tested, Boletus chrysenteron and B. edulis were characterized by high scores of polyphenol contents and antioxidant activity in the FRAP, TEAC, and DPPH assays. These results place these culinary species of wild-growing mushrooms among products with considerable antioxidant potential.

Accumulation of mercury and methylmercury by mushrooms and earthworms from forest soils

International Nuclear Information System (INIS)

Rieder, Stephan R.; Brunner, Ivano; Horvat, Milena; Jacobs, Anna; Frey, Beat

2011-01-01

Accumulation of total and methyl-Hg by mushrooms and earthworms was studied in thirty-four natural forest soils strongly varying in soil physico-chemical characteristics. Tissue Hg concentrations of both receptors did hardly correlate with Hg concentrations in soil. Both total and methyl-Hg concentrations in tissues were species-specific and dependent on the ecological groups of receptor. Methyl-Hg was low accounting for less than 5 and 8% of total Hg in tissues of mushrooms and earthworms, respectively, but with four times higher concentrations in earthworms than mushrooms. Total Hg concentrations in mushrooms averaged 0.96 mg Hg kg -1 dw whereas litter decomposing mushrooms showed highest total Hg and methyl-Hg concentrations. Earthworms contained similar Hg concentrations (1.04 mg Hg kg -1 dw) whereas endogeic earthworms accumulated highest amounts of Hg and methyl-Hg. - Highlights: → Hg and MeHg concentrations in mushrooms and earthworms at unpolluted forest soils. → Mushrooms and earthworms contained similar Hg concentrations. → MeHg was present in traces but four times higher in earthworms than in mushrooms. → Ecophysiological group influenced Hg and MeHg concentration in both receptors. - Accumulation of Hg and methyl-Hg by mushrooms and earthworms is species- and ecophysiological group dependent.

Accumulation of mercury and methylmercury by mushrooms and earthworms from forest soils

Energy Technology Data Exchange (ETDEWEB)

Rieder, Stephan R. [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland); Institute for Biogeochemistry and Pollutant Dynamics, ETH Zuerich, 8092 Zuerich (Switzerland); Brunner, Ivano [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland); Horvat, Milena [Jozef Stefan Institute, 1001 Ljubliana (Slovenia); Jacobs, Anna [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland); Department of Environmental Chemistry, University of Kassel, 37213 Witzenhausen (Germany); Frey, Beat, E-mail: beat.frey@wsl.ch [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland)

2011-10-15

Accumulation of total and methyl-Hg by mushrooms and earthworms was studied in thirty-four natural forest soils strongly varying in soil physico-chemical characteristics. Tissue Hg concentrations of both receptors did hardly correlate with Hg concentrations in soil. Both total and methyl-Hg concentrations in tissues were species-specific and dependent on the ecological groups of receptor. Methyl-Hg was low accounting for less than 5 and 8% of total Hg in tissues of mushrooms and earthworms, respectively, but with four times higher concentrations in earthworms than mushrooms. Total Hg concentrations in mushrooms averaged 0.96 mg Hg kg{sup -1} dw whereas litter decomposing mushrooms showed highest total Hg and methyl-Hg concentrations. Earthworms contained similar Hg concentrations (1.04 mg Hg kg{sup -1} dw) whereas endogeic earthworms accumulated highest amounts of Hg and methyl-Hg. - Highlights: > Hg and MeHg concentrations in mushrooms and earthworms at unpolluted forest soils. > Mushrooms and earthworms contained similar Hg concentrations. > MeHg was present in traces but four times higher in earthworms than in mushrooms. > Ecophysiological group influenced Hg and MeHg concentration in both receptors. - Accumulation of Hg and methyl-Hg by mushrooms and earthworms is species- and ecophysiological group dependent.

Arsenic and Other Elemental Concentrations in Mushrooms from Bangladesh: Health Risks

Directory of Open Access Journals (Sweden)

Md Harunur Rashid

2018-05-01

Full Text Available Mushroom cultivation has been increasing rapidly in Bangladesh. Arsenic (As toxicity is widespread in the world and Bangladesh faces the greatest havoc due to this calamity. Rice is the staple food in Bangladesh and among all the crops grown, it is considered to be the main cause of As poisoning to its population after drinking water. Consequently, rice straw, an important growing medium of mushrooms in Bangladesh, is known to have high As content. The objective of this study was, therefore, to determine the concentrations of As in mushrooms cultivated in Bangladesh and to assess the health risk as well. It also considered other elements, including Cd, Cr, Co, Cu, Pb, Mn, Hg, Ni, and Zn concentrations in mushrooms from Bangladesh. The mean concentrations (mg/kg of As, Cd, Cr, Co, Cu, Pb, Mn, Hg, Ni, and Zn in mushrooms were 0.51, 0.38, 0.28, 0.01, 13.7, 0.31, 11.7, 0.12, 0.28, and 53.5, respectively. Based on the dietary intake of mushrooms, the weekly intakes of As, Cd, Cr, Co, Cu, Pb, Mn, Hg, Ni, and Zn from mushrooms for adults were 0.0042, 0.0030, 0.0024, 0.0001, 0.1125, 0.0019, 0.1116, 0.0011, 0.0023, and 0.4734 mg, respectively. Due to the low concentrations of As and other trace elements observed in mushrooms from Bangladesh, as well as relatively lower consumption of this food in people’s diet, it can be inferred that consumption of the species of mushrooms analysed will cause no toxicological risk.

DRYING CHARACTERISTICS OF CAP AND STEM OF MUSHROOM

African Journals Online (AJOL)

Administrator

mushrooms are not immediately processed. Drying is the most commonly used method of preservation of mushrooms. Dehydrated mush- rooms are used as an important ingredient in several food formulations including instant soups, pasta salads, snack seasonings, stuffing, casseroles, and meat and rice dishes (Tuley,.

75 FR 3756 - Preserved Mushrooms from Chile, China, India, and Indonesia

Science.gov (United States)

2010-01-22

...)] Preserved Mushrooms from Chile, China, India, and Indonesia AGENCY: United States International Trade... preserved mushrooms from Chile, China, India, and Indonesia. SUMMARY: The Commission hereby gives notice of... mushrooms from Chile, China, India, and Indonesia would be likely to lead to continuation or recurrence of...

Wild mushrooms in Ethiopia: A review and synthesis for future perspective

International Nuclear Information System (INIS)

Dejene, T.; Oria-de-Rueda, J.A.; Martín-Pinto, P.

2017-01-01

Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

Effect of ionizing radiations on some organoleptic characteristics of edible mushroom

International Nuclear Information System (INIS)

Kovacs, E.; Vas, K.

1974-01-01

Organoleptic characteristics - colour, odour, flavour and texture - of edible mushrooms (Agaricus bisporus) in different stages of ripeness (half-ripe, ripe) were examined as a function of radiation dose, storage time as well as storage temperature, and humidity (3-5 0 C, 70-90% RH; 16 0 C, 65-75% RH). Immediately after irradiation the mushrooms assumed a slight brownish hue which, however, did not change on further storage. The brown discoloration of untreated mushroom progressed in the course of storage. The colour of the irradiated mushroom scarcely changed with storage time, tested on the 6th, 11th or 13th day. Other properties examined (odour, flavour, texture) were not affected by irradiation, either immediately upon treatment or during further storage. Ionizing radiation was found to exert favourable influence upon the organoleptic properties of picked mushrooms, and to delay the deterioration of these properties. Radiation treatment was found to preserve the characteristic mushroom odour and this is considered an advantage in canning. (F.J.)

Wild mushrooms in Ethiopia: A review and synthesis for future perspective

Energy Technology Data Exchange (ETDEWEB)

Dejene, T.; Oria-de-Rueda, J.A.; Martín-Pinto, P.

2017-11-01

Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

Wild mushrooms in Ethiopia: A review and synthesis for future perspective

Directory of Open Access Journals (Sweden)

Tatek Dejene

2017-05-01

Full Text Available Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

[Mercury content in edible mushrooms in the Wyzyna Wieluńska region].

Science.gov (United States)

Falandysz, J; Hałaczkiewicz, J

1999-01-01

Mercury concentration was determined in the caps and stalks of nine species of edible mushrooms collected at the area of Wieluńska Upland in district of Czestochowa in 1995-96. The mushroom species examined were such as: yellow-cracking bolete Xerocomus subtomentosus, brown birch scaber stalk Leccinum scabrum, slippery Jack Suillus luteus, larch bolete Suillus grevillei, gray knight-cap Tricholoma terreum, parasol mushroom Macrolepiota procera, horse mushroom Agaricus arvensis, fennel funnel cap Clitocybe odora, fairy-ring mushroom Marasmius oreades and tacky green brittle gills Russula aereuginea. The method of mercury measurement was cold-vapour atomic absorption spectroscopy (CV-AAS) after wet digestion of the samples with concentrated nitric acid in a whole glass system. The parasol mushroom and horse mushroom showed a highest mercury concentrations and contained, respectively, 4500 +/- 1700 and 4400 +/- 2400 ng/g dry wt in caps, and 2800 +/- 1300 and 2800 +/- 2100 ng/g dry wt in stalks. In the case of fennel funnel cap and fairy-ring mushroom the mean total mercury concentrations in caps was above 500 ng/g dry wt, and for other species were between 150 +/- 50 and 500 +/- 230 ng/g dry wt. The stalks of the mushroom species examined in all cases showed lower contamination with mercury than caps. The mean total mercury concentrations noted in caps and stalks of mushrooms examined were usually higher than was reported till now in the same species elsewhere in Poland, while a maximum values found in an individual fruiting bodies are within the range of the concentrations noted in specimens collected from an unpolluted areas.

Increase of the productivity of pleurotus ostreatus and their use in the petroleum biodegradation

International Nuclear Information System (INIS)

Cardona U, Fernando; Restrepo R, Dora Patricia; Nino, Pilar; Gonzalez, Raul

2002-01-01

This work is divided in two phases: in the first one a substrate what help to increase productivity of the white-rot fungi pleurotus ostreatus was looked, this was reached combining different kinds of substrates; in the second phase, the contribution in biodegradation of pleurotus ostreatus into the substrate obtained in the first phase and contaminated with heavy part of Cusiana oil was looked. The quantification in the augmentation of productivity was obtained taking the weight of fungi collected of each substrate and comparing it between the, until finding the best one. To quantify the biodegradation the method of determination of greases, oils, and hydrocarbons of petroleum in solids by Soxhlet method was used. The highest substrate in productivity was the mix of 70% of cotton quinine and 30% of hay with 3- 5% of seed, thiamine and vegetable oil. For the biodegradation study concentration less than 25% were used, at higher concentrations a partial inhibition was detected. When the substrate was contaminated with 10% of Cusiana oil the biodegradation was more efficient

Mushrooms as Efficient Solar Steam-Generation Devices.

Science.gov (United States)

Xu, Ning; Hu, Xiaozhen; Xu, Weichao; Li, Xiuqiang; Zhou, Lin; Zhu, Shining; Zhu, Jia

2017-07-01

Solar steam generation is emerging as a promising technology, for its potential in harvesting solar energy for various applications such as desalination and sterilization. Recent studies have reported a variety of artificial structures that are designed and fabricated to improve energy conversion efficiencies by enhancing solar absorption, heat localization, water supply, and vapor transportation. Mushrooms, as a kind of living organism, are surprisingly found to be efficient solar steam-generation devices for the first time. Natural and carbonized mushrooms can achieve ≈62% and ≈78% conversion efficiencies under 1 sun illumination, respectively. It is found that this capability of high solar steam generation is attributed to the unique natural structure of mushroom, umbrella-shaped black pileus, porous context, and fibrous stipe with a small cross section. These features not only provide efficient light absorption, water supply, and vapor escape, but also suppress three components of heat losses at the same time. These findings not only reveal the hidden talent of mushrooms as low-cost materials for solar steam generation, but also provide inspiration for the future development of high-performance solar thermal conversion devices. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Improving biological efficiency of Oyster mushroom, Pleurotus ...

African Journals Online (AJOL)

International Journal of Biological and Chemical Sciences ... Yield improvement were observed in both pigeon pea and sunflower seed cake supplemented treatments with the highest mycelium vigor (91.65%) and biological ... Keywords: biological efficiency, compost, mycelium vigor, pigeon pea, sunflower seed cake

Flagellate dermatitis following consumption of shiitake mushroom

Directory of Open Access Journals (Sweden)

Hui Voon Loo

2011-10-01

Full Text Available Japanese dermatologists were the first to describe the very characteristic flagellate dermatitis following consumption of under-cooked or raw shiitake mushroom (Lentinus edodes. These similar eruptions were also reported in patients treated with bleomycin, in dermatomyositis and adult onset Still’s disease. We report a case where a 40 year old chinese female developed flagellate dermatitis following ingestion of a bun containing shiitake mushroom.

A Macrosphelide as the Unexpected Product of a Pleurotus ostreatus Strain-Mediated Biotransformation of Halolactones Containing the gem-Dimethylcyclohexane Ring. Part 1

Directory of Open Access Journals (Sweden)

Katarzyna Wińska

2016-06-01

Full Text Available The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3, its own metabolite (3S,9S,15S-(6E,12E-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4. The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+ ions as inductors.

Assessing the potential of mushroom cultivation in improving ...

African Journals Online (AJOL)

Mo

Department of Agricultural Extension Education, Faculty of Agriculture, Makerere University, P.O Box ... requires little land space, earns high income, and provides ... mushroom growing is one of the enterprises that would fit .... Children. 2. 3.30. Relative. 3. 5.00. Table 1. Availability of wild mushrooms now and in the past.

Effect of mushroom diet on pharmacokinetics of gabapentin in healthy Chinese subjects.

Science.gov (United States)

Toh, Dorothy Su Lin; Limenta, Lie Michael George; Yee, Jie Yin; Wang, Ling-Zhi; Goh, Boon-Cher; Murray, Michael; Lee, Edmund Jon Deoon

2014-07-01

This study evaluated the pharmacokinetics of gabapentin in Chinese subjects who received a diet rich in shiitake mushrooms. Shiitake mushrooms have been shown to contain high amount of ergothioneine. In vitro studies have shown that OCTN1-mediated secretion of gabapentin is trans-stimulated by ergothioneine. This study also investigated the concentrations of ergothioneine in plasma at baseline and following mushroom consumption. Ten healthy male subjects were recruited and received a diet containing no mushrooms (treatment A) or a high mushroom diet (treatment B; after at least a 7 day washout period) 1 day prior to administration of a single oral dose of gabapentin 600 mg. Ingestion of shiitake mushrooms produced significant increases in plasma ergothioneine concentrations that were sustained for more than 48 h. A statistically significant but modest increase in the renal clearance (CLR ) of gabapentin occurred after intake of the mushroom diet (91.1 ± 25.1 vs. 76.9 ± 20.6 ml min(-1) , P = 0.031). No significant changes in AUC(0,tlast ) of gabapentin were observed (P = 0.726). Creatinine clearance did not correlate with CLR of gabapentin at baseline (treatment A). After ingestion of the mushroom diet, creatinine clearance accounted for 65.3% of the variance in CLR of gabapentin. These data suggest that diet-drug pharmacokinetic interactions may occur during co-exposure to gabapentin and mushroom constituents. However, as it does not affect the AUC(0,tlast ) of gabapentin, it may not have clinically important consequences. Shiitake mushrooms can also be used as a source of ergothioneine for future clinical studies. © 2013 The British Pharmacological Society.

Radioactive cesium elution speed in dried wild Mushrooms collected in 2015

International Nuclear Information System (INIS)

Yamaguchi, Toshiro; Arai, Hirotsugu; Ohnuma, Tohru; Arai, Hiromu; Takyu, Sodai; Matsuyama, Tetsuo; Ishii, Keizo

2016-01-01

Dried wild mushrooms (12 species, 13 samples) collected in Nagano, Fukushima, and Miyagi Prefectures, Japan, in 2015 were immersed in water for 1,440 min. The elution rate of radioactive cesium (Cs) was calculated based on its radioactivity, which was measured with a high-purity germanium semiconductor detector (GX2018; CANBERRA Industries, Meriden, CT, USA) before and after immersion for each mushroom. Immersion fluid was sampled after 10, 30, 60, 180, 360, and 1,440 min of immersion and dried on aluminum foil. Then, imaging plates (BAS-III, Fujifilm, Tokyo, Japan) exposed to the dried immersion fluid were measured with a Bio-imaging Analyzer System-1800 II (Fujifilm). The 50% elution time of each wild mushroom was calculated based on the photo stimulated luminescence density of the autoradiographs. The radioactive Cs elution rate was > 80% for 11 samples (84% of total) comprising 11 mushroom species. Moreover, the 50% elution time was < 30 min for 9 samples (69% of total) comprising 9 species. This shows that the radioactive Cs elution rate and elution speed were not constant among mushroom species. Based on these results, immersing the mushrooms, which were dried, in water for at least 120 min is an effective method for removing radioactive Cs from wild mushrooms. (author)

Antimicrobial activity and mineral composition of shiitake mushrooms cultivated on agricultural waste

Directory of Open Access Journals (Sweden)

Kérley Braga Pereira Bento Casaril

2011-10-01

Full Text Available The antimicrobial activity and mineral composition of shiitake mushrooms were evaluated in four isolates of Lentinula edodes. Mushrooms were cultivated on artificial logs, based on eucalyptus sawdust enriched with 20% rice, wheat, or soybean bran, or combination of 10% of two of these supplements. The substrates were humidified with a 0.1% mate tea extract or water. Logs of Eucalyptus grandis were also used to cultivate the shiitake mushrooms. The antimicrobial activity of an aqueous extract, corresponding to 40 mg of mushroom dry matter, was in some cases, depending on the isolate, able to inhibit both Bacillus subtilis and Escherichia coli K-12, independent of substrate composition or the growth stage of the mushrooms. Nitrogen, phosphorus, potassium, magnesium and calcium concentrations varied according to the substrate on which the mushrooms were cultivated, being, generally, higher with cultivation on artificial rather than natural eucalyptus logs. It could be concluded that, in addition to the fungal isolate, substrate composition and, processing methods must be considered during the production of antimicrobial substance(s as well as in the mushroom nutritional composition.

137Cs content in edible mushrooms of the Transcarpathian region

Directory of Open Access Journals (Sweden)

O. O. Parlag

2013-03-01

Full Text Available Edible mushrooms (Boletus edulis Bull.: Fr. and Leccinum scabrum (Bull.: Fr. S.F.Gray of Transcarpathian region were analyzed on content of 137Cs. Specific activity of 137Cs in collected mushrooms did not exceed 354 ± 53 Bq/kg (dry substance. Estimation of the contribution into internal exposure dose of population for the condi-tion of 1 kg of mushrooms consumption is carried out.

Characterization of aroma-active compounds in raw and cooked pine-mushrooms (Tricholoma matsutake Sing.).

Science.gov (United States)

Cho, In Hee; Kim, Se Young; Choi, Hyung-Kyoon; Kim, Young-Suk

2006-08-23

The characteristic aroma-active compounds in raw and cooked pine-mushrooms (Tricholoma matsutake Sing.) were investigated by gas chromatography-olfactometry using aroma extract dilution analysis. 1-Octen-3-one (mushroom-like) was the major aroma-active compound in raw pine-mushrooms; this compound had the highest flavor dilution factor, followed by ethyl 2-methylbutyrate (floral and sweet), linalool (citrus-like), methional (boiled potato-like), 3-octanol (mushroom-like and buttery), 1-octen-3-ol (mushroom-like), (E)-2-octen-1-ol (mushroom-like), and 3-octanone (mushroom-like and buttery). By contrast, methional, 2-acetylthiazole (roasted), an unknown compound (chocolate-like), 3-hydroxy-2-butanone (buttery), and phenylacetaldehyde (floral and sweet), which could be formed by diverse thermal reactions during the cooking process, together with C8 compounds, were identified as the major aroma-active compounds in cooked pine-mushrooms.

Advances in Mushroom Research in the Last Decade

Directory of Open Access Journals (Sweden)

Huijuan Pan

2006-01-01

Full Text Available There has been a lot of progress in mushroom science and biotechnology in the last decade. The optimization of PFGE separation of fungal chromosomes allowed the study of the molecular karyotype of mushrooms and the assignment of genes to chromosomes. There are 115 genes encoded from different species of mushrooms. Cross breeding continues to be the principal method, but it is accompanied by the analyses of RAPD or RFLPs methods. The genetic makers are used and introduced into commercial large hybrids via introgression breeding. The complex traits such as yield, resistance to disease and quality characteristics, and quantitative traits more than one quantitative trait locus (QTL are found and used in practice. The transformants or transgenic mutant strains were obtained by Agrobacterium system or particle bombardment. At least 651 species representing 182 genera of hetero- and homobasidiomycetes mushrooms were researched containing antitumor or immunostimulating polysaccharides. Ergosterol in the lipid fraction was identified as one of the most active constituents. New sesquiterpenoid hydroquinones, steroids, oxalic acid, triterpenes, water-soluble lignins, sulfated polysaccharides, protein-bound polysaccharides are researched intensively as antimicrobial or antiviral agents. Many small molecular mass compounds exhibit cytotoxic activities, such as illudins, leaianafulvene, triterpenes (ganoderic acids, acetoxyscirpenediol, ergosterol peroxide, sterols. There are many other compounds or activities found in the mushrooms, such as antioxidative, hypoglycemic action, anti-inflammatory effect, hepatoprotective compounds, psychoactive compounds and activities.

KAJIAN MACAM LIMBAH DAN PENAMBAHAN TEPUNG TONGKOL JAGUNG TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM (Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Agung Setyarini

2016-12-01

Full Text Available One limiting for factor the production of oyster mushrooms was difficult to obtain the raw material of sengon wood sawdust, meanwhile, the production of oyster mushroom necessary need the nutrients in the form of bran or cornmeal. The purpose of this study was to study planting medium, the concentration of corn cob flour, and to find the effective interaction of these two factors on growth and yield of oyster mushroom. This study used a completely randomized design (CRD with two factors, concentration of media and corn cob flour. The media used in this study are sengon sawdust, glugu sawdust, acacia wood sawdust, rice straw and bagasse, while the concentration of corn cob flour was 0% per baglog, 1% per baglog, 2% per baglog, 3% per baglog and 4% per baglog. Data analysis was using F test level 5% and continued with Duncan test. The results of this study showed that sawdvst sengon media generally give better effect to the growth and yield of oyster mushroom, while corn cob flour treatment concentration was not known exactly in enhancing the growth and yield of oyster mushroom. Treatment of media accelerate the deployment of mycelium old, when appearing pin head, increasing the number of fruiting bodies in a single clump and increasing the mushroom fruit body weight. Extra flour treatment corncob accelerate as emerging pin head, increasing the number of fruiting bodies in a clump and increase total body weight of mushrooms.

77 FR 66580 - Certain Preserved Mushrooms From India: Preliminary Results of Antidumping Duty Administrative...

Science.gov (United States)

2012-11-06

... DEPARTMENT OF COMMERCE International Trade Administration [A-533-813] Certain Preserved Mushrooms... preserved mushrooms (mushrooms) from India. The period of review (POR) is February 1, 2011, through January... Preliminary Results of Antidumping Duty Administrative Review: Certain Preserved Mushrooms from India...

More efficient mushroom canning through pinch and exergy analysis

NARCIS (Netherlands)

Paudel, Ekaraj; Sman, van der Ruud G.M.; Westerik, Nieke; Awasthi, Ashutosh; Dewi, Belinda P.C.; Boom, Remko M.

2017-01-01

Conventional production of canned mushrooms involves multiple processing steps as vacuum hydration, blanching, sterilization, etc. that are intensive in energy and water usage. We analyzed the current mushroom processing technique plus three alternative scenarios via pinch and exergy analysis.

Bioactive Mushroom Polysaccharides: A Review on Monosaccharide Composition, Biosynthesis and Regulation.

Science.gov (United States)

Wang, Qiong; Wang, Feng; Xu, Zhenghong; Ding, Zhongyang

2017-06-13

Mushrooms are widely distributed around the world and are heavily consumed because of their nutritional value and medicinal properties. Polysaccharides (PSs) are an important component of mushrooms, a major factor in their bioactive properties, and have been intensively studied during the past two decades. Monosaccharide composition/combinations are important determinants of PS bioactivities. This review summarizes: (i) monosaccharide composition/combinations in various mushroom PSs, and their relationships with PS bioactivities; (ii) possible biosynthetic pathways of mushroom PSs and effects of key enzymes on monosaccharide composition; (iii) regulation strategies in PS biosynthesis, and prospects for controllable biosynthesis of PSs with enhanced bioactivities.

Induction and evaluation of beneficial mutations in Volvariella volvacea mushroom

International Nuclear Information System (INIS)

Borromeo, J.D.

1976-03-01

The present strains of Volvariella volvacea are difficult to grow, hence the need for developing a wild-type mushroom that can be grown without the stringent cultural requirements. This would be suitable for backyard or small-scale production. A vigorous white mushroom that responds to the controlled conditions in mushroom houses is appropriate for large-scale or commercial production. The percentages success in getting the ''first flushes'' has been no more than 30%. There was a certain amount of difficulty in recognizing mutants based on their morphological features in laboratory culture. The first irradiation series utilizing 200 and 400 kR and using the box-type method of cultivation in growing the mushroom have given us the needed information in planning the next irradiation series

Mushroom refinement endeavor auspicate non green revolution in the offing

OpenAIRE

SHAUKET AHMED PALA; ABDUL HAMID WANI; ROUF HAMZA BODA; BILAL AHMAD WANI

2014-01-01

Pala SA, Wani AH, Boda RH, Wani BA. 2014. Mushroom refinement endeavor auspicate non green revolution in the offing. Nusantara Bioscience 6: 173-185. Mushroom can serve as food, tonic, and as medicine thus make people healthier, fitter and happier. They have a cracking potential for generating great socioeconomic impact in human welfare at local, national and international level. With the help of allied mushroom farming we can easily tackle the problem of food for growing world population; re...

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

OpenAIRE

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as su...

Microbial ecology of the Agaricus bisporus mushroom cropping process.

Science.gov (United States)

McGee, Conor F

2018-02-01

Agaricus bisporus is the most widely cultivated mushroom species in the world. Cultivation is commenced by inoculating beds of semi-pasteurised composted organic substrate with a pure spawn of A. bisporus. The A. bisporus mycelium subsequently colonises the composted substrate by degrading the organic material to release nutrients. A layer of peat, often called "casing soil", is laid upon the surface of the composted substrate to induce the development of the mushroom crop and maintain compost environmental conditions. Extensive research has been conducted investigating the biochemistry and genetics of A. bisporus throughout the cultivation process; however, little is currently known about the wider microbial ecology that co-inhabits the composted substrate and casing layers. The compost and casing microbial communities are known to play important roles in the mushroom production process. Microbial species present in the compost and casing are known for (1) being an important source of nitrogen for the A. bisporus mycelium, (2) releasing sugar residues through the degradation of the wheat straw in the composted substrate, (3) playing a critical role in inducing development of the A. bisporus fruiting bodies and (4) acting as pathogens by parasitising the mushroom mycelium/crop. Despite a long history of research into the mushroom cropping process, an extensive review of the microbial communities present in the compost and casing has not as of yet been undertaken. The aim of this review is to provide a comprehensive summary of the literature investigating the compost and casing microbial communities throughout cultivation of the A. bisporus mushroom crop.

Proximate and mineral analysis of some wild edible mushrooms

African Journals Online (AJOL)

israelikk

2012-04-12

Apr 12, 2012 ... Key words: Edible mushroom, mineral composition, proximate analysis. ... than beef, pork and chicken that contain similar nutrients. .... legumes and meat. In earlier studies, Gruen and Wong. (1982) indicated that edible mushrooms were highly nutritional and compared favourably with meat, egg and milk.

Evaluación del crecimiento y producción de biomasa de dos cepas del género Pleurotus spp., cultivadas en un medio agar con diferentes sustratos

Directory of Open Access Journals (Sweden)

Carol Daniela Coello-Loor

2017-12-01

Full Text Available La velocidad de crecimiento radial (VCR (mm.h-1 y la producción de biomasa (PB (g.g-1 de sustrato seco son técnicas que puedan establecer el grado de adaptación y desarrollo de los hongos del género Pleurotus spp., a distintos sustratos que podrían emplearse en una fermentación en medio sólido. Las especies fueron Pleurotus sapidus (Ps y Pleurotus ostreatus IE8 (Po. El medio de cultivo sintético empleado fue el papa dextrosa agar (PDA, con un pH que va de 5.6 a 5.9, ideal para el crecimiento de hongos, tiene todos los componentes nutritivos, y ligera acidez que logran la inhibición del desarrollo de bacterias; diluido en 4 diferentes soluciones preparadas con los materiales residuales (solución cascarilla de arroz CaPDA, solución cáscara de maracuyá CmPDA, solución mezcla 50% Cascarilla de arroz+50% Cáscara de maracuyá CaCmPDA y agua destilada+PDA con el propósito de observar el crecimiento radial cada 24 horas y la producción de biomasa fúngica de estos hongos lignocelulósicos por su periodo de incubación y la adaptación a nivel in vitro. Los tratamientos que presentaron mejor comportamiento VCR fueron el PoCaPDA (0.569 y el PoCaCmPDA (0.549; la cepa que reporto valores más altos en VCR y PB fue el Pleurotus ostreatus y el mejor medio de cultivo fue el CaPDA, en ambas variables; mientras, la mayor producción de biomasa fue en Pleurotus sapidus en CaPDA (0.1727 y el Pleurotus ostreatus IE8 en CmPDA (0.1722, CaPDA (0.1706 y PDA (0.1694.

Linhchi mushrooms as biological monitors for 137Cs pollution

International Nuclear Information System (INIS)

Tran Van, L.; Le Duy, T.

1991-01-01

Radioactivity of Linhchi mushrooms (Ganoderma Lucidum) cultivated in laboratory and production conditions has been measured in the Environmental Laboratory of Nuclear Research Institute (NRI), Dalat, Vietnam. The results showed that Linhchi mushroom has a high radioactive concentration of 137 Cs, which is about 20 Bq kg -1 fresh weight. In addition, the radioactive contents of substrata before and after cultivation were insignificant. This suggested that Linhchi mushroom should only accumulate the 137 Cs radioisotope from the atmosphere, directly. Therefore, it should be considered as a bio-indicator for environmental monitoring. (author) 13 refs.; 3 figs.; 2 tabs

DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

Science.gov (United States)

Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

2007-03-01

Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

Mushroom poisoning in Ireland: the collaboration between the National Poisons Information Centre and expert mycologists.

LENUS (Irish Health Repository)

Cassidy, Nicola

2012-02-01

BACKGROUND: Occasionally, mycologist assistance is requested to reliably identify mushroom species in symptomatic cases where there is a concern that a toxic species is involved. The aim of this study was to describe the epidemiology of mushroom poisoning in Ireland, to describe the working arrangement between the National Poisons Information Centre (NPIC) and professional mycologists and to present a case series detailing the circumstances when mycologists were consulted. METHODS: Computerised records from 1 January 2004 to 31 December 2009 were retrospectively reviewed and data on patient demographics, circumstances, and mushroom species collated. In 1999, the NPIC established a national registry of volunteer professional mycologists who are available 24 h\\/day for mushroom identification. The NPIC staff liaises directly with the mycologist and arranges transport of mushroom material. Digital photographic images are requested if there is likely to be a delay in arranging transportation of mushroom material, and the images are subsequently emailed to a mycologist. Five cases of suspected mushroom poisoning were chosen to demonstrate the inter-professional collaboration between the NPIC and mycologists. RESULTS: From 2004 to 2009, the NPIC was consulted about 70 cases of suspected mushroom exposures. Forty-five children ingested unknown mushrooms, 12 adults and 2 children ingested hallucinogenic mushrooms and 11 adults ingested wild toxic mushrooms that were incorrectly identified or confused with edible species. The mycologists were consulted 10 times since 1999. In this series, Amanita species were identified in two cases. In three cases, the species identified were Clitocybe nebularis, Coprinus comatus and Panaeolina foenisecii, respectively, and serious poisoning was excluded. Incorrect mushroom identification by a health care professional using the Internet occurred in two cases. The mycologists assisted Poisons Information Centres in Northern Ireland and the

Mushroom poisoning in Ireland: The collaboration between the National Poisons Information Centre and expert mycologists.

LENUS (Irish Health Repository)

Cassidy, Nicola

2011-03-01

Background. Occasionally, mycologist assistance is requested to reliably identify mushroom species in symptomatic cases where there is a concern that a toxic species is involved. The aim of this study was to describe the epidemiology of mushroom poisoning in Ireland, to describe the working arrangement between the National Poisons Information Centre (NPIC) and professional mycologists and to present a case series detailing the circumstances when mycologists were consulted. Methods. Computerised records from 1 January 2004 to 31 December 2009 were retrospectively reviewed and data on patient demographics, circumstances, and mushroom species collated. In 1999, the NPIC established a national registry of volunteer professional mycologists who are available 24 h\\/day for mushroom identification. The NPIC staff liaises directly with the mycologist and arranges transport of mushroom material. Digital photographic images are requested if there is likely to be a delay in arranging transportation of mushroom material, and the images are subsequently emailed to a mycologist. Five cases of suspected mushroom poisoning were chosen to demonstrate the inter-professional collaboration between the NPIC and mycologists. Results. From 2004 to 2009, the NPIC was consulted about 70 cases of suspected mushroom exposures. Forty-five children ingested unknown mushrooms, 12 adults and 2 children ingested hallucinogenic mushrooms and 11 adults ingested wild toxic mushrooms that were incorrectly identified or confused with edible species. The mycologists were consulted 10 times since 1999. In this series, Amanita species were identified in two cases. In three cases, the species identified were Clitocybe nebularis, Coprinus comatus and Panaeolina foenisecii, respectively, and serious poisoning was excluded. Incorrect mushroom identification by a health care professional using the Internet occurred in two cases. The mycologists assisted Poisons Information Centres in Northern Ireland

Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

International Nuclear Information System (INIS)

Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook

2003-01-01

A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

Mutation breeding and submerged fermentation of a Pleurotus polysaccharide high-yield strain with low-energy heavy ions implantation

International Nuclear Information System (INIS)

Chen Henglei; Wan Honggui; Lv Changwu; Zeng Xianxian

2010-01-01

Pleurotus polysaccharide high-yield strains were selected through a method of auxotrophic primary screening and Shake-flask fermentation re-screening after low-energy heavy ions (the fluence of 1.2 x 10 16 N + /cm 2 at the energy of 15 keV) stepwise implantation. Two Pleurotus polysaccharide high-yield strains, PFPH-1 and PFPH-2, were selected with stable mycelium polysaccharide yield. The mycelium polysaccharide yield of PFPH-1 and PFPH-2 increased by 46.55% and 75.14%, respectively, compared to the original strain. The accumulation of mycelium biomass and intracellular polysaccharides were monitored in the submerged fermentation of Pleurotus ferulae by supplementation of various carbon and nitrogen sources as well as inorganic salts and pH alteration. The optima1 submerged fermentation medium favoring the accumulation of mycelium biomass and intracellular polysaccharides of PFPH-2 consisted of 1.0% wheat flour, 2.0% sucrose, 2.0% soybean flour, 1.5% bran extract, 0.2% K 2 HPO 4 , and 0.15% MgSO 4 ·7H 2 O, with a fittest pH value of 5.64. The orthogonal combination of the optimal carbon and nitrogen sources with inorganic salts indicates a synergistic effect on the accumulation of mycelium biomass and intracellular polysaccharides in the submerged fermentation of PFPH-2. The yield of mycelium polysaccharides of PFPH-2 increased to 903.73 ± 1.23 mg·L -1 by the end of fermentation. (authors)

Microbial Community Structure of Casing Soil During Mushroom Growth

Institute of Scientific and Technical Information of China (English)

CAI Wei-Ming; YAO Huai-Ying; FENG Wei-Lin; JIN Qun-Li; LIU Yue-Yan; LI Nan-Yi; ZHENG Zhong

2009-01-01

The culturable bacterial population and phospholipid fatty acid (PLFA)profile of casing soil were investigated at different mushroom (Agaricus bisporusI cropping stages.The change in soil bacterial PLFAs was always accompanied by a change in the soil culturable bacterial population in the first flush.Comparatively higher culturable bacterial population and bacterial PLFAs were found in the casing soil at the primordia formation stage of the first flush.There was a significant increase in the ratio of fungal to bacterial PLFAs during mushroom growth.Multivariate analysis of PLFA data demonstrated that the mushroom cropping stage could considerably affect the microbial community structure of the casing soil.The bacterial population increased significantly from casing soil application to the primordia formation stage of the first flush.Casing soil application resulted in an increase in the ratio of gram-negative bacterial PLFAs to gram-positive bacterial PLFAs,suggesting that some gram-negative bacteria might play an important role in mushroom sporophore initiation.

Economic feasibility of small scale button mushroom production in pakistan

International Nuclear Information System (INIS)

Tahir, A.; Hassan, S.

2013-01-01

Abstract:- Mushroom is widely cultivated as a proteineous vegetable in many countries of the world including Pakistan. Its cultivation requires less space, care, equipment and cost compared to many other crops and livestock. The present study was conducted in 2010 to estimate the profitability of small scale button mushroom production at National Agricultural Research Centre (NARC) Islamabad, Pakistan. The cost of production methodology was used for this study. The yield and gross return of mushroom was estimated at 155.6 kg ha and Rs.77,800 ha , respectively. The results indicated the fact that mushroom production is very much remunerative to its producers as it can give maximum net return by reducing their cost of production as its cultivation is dependent on the agricultural raw material which is cheaply available. (author)

Genetic diversity of Dahongjun, the commercially important "Big Red Mushroom" from southern China.

Directory of Open Access Journals (Sweden)

Mochan Li

Full Text Available BACKGROUND: In southern China, a wild ectomycorrhizal mushroom commonly called "Dahongjun" or "Big Red Mushroom" by the local residents, has been harvested, consumed, and/or exported as an exotic food for many years. Although ecologically and economically important, very little is known about this mushroom, including its diversity and population structure. METHODOLOGY AND PRINCIPAL FINDINGS: In this study, we analyzed 122 samples from five local populations representing the known distribution ranges of this mushroom in southern China. We investigated the genetic diversity and geographic structure of this mushroom using sequences from four DNA fragments. Our analyses identified that this mushroom contained at least three divergent lineages: one corresponds to a recently described species Russula griseocarnosa from southern China and the remaining two likely represent two novel species. While these lineages were prominently structured geographically based on ITS sequences, evidence for ancient and/or recent gene flow was also identified within individual lineages. In addition, a local population from Ailaoshan in central Yunnan Province where 85 of our 122 specimens came from showed clear evidence of recombination. CONCLUSION AND SIGNIFICANCE: The ectomycorrhizal mushroom "Dahongjun" from southern China is a species complex with at least three divergent lineages. These lineages are largely geographically structured and there is evidence for recombination in nature. Our results indicate mature Dahongjun mushrooms with abundant basidiospores are important for the reproduction of this mushroom in nature and that individual populations of this species should be managed separately.

Mushrooming Communities: A Field Guide to Mycology in the Community Forests of Portugal

Directory of Open Access Journals (Sweden)

Rita Serra

2017-06-01

Full Text Available Forest community connections are crucial to ensure forest stewardship and sustainability. We explored the potential of mushrooming to enable such connections in contexts where these connections have been historically broken, alienating local people from forests. Taking the case of the recent devolution of a community forest (baldios in central Portugal to the local population, we present a five-year pilot project to rework mycology from a mushroom-centered approach to a mushroom-in-baldios approach. Mushrooms were used as an entry-point to connect the forest ecology with the challenges of governance and community building. The devised activities provided an opportunity for people inside and outside the local community to adventure into the woods and find out more about their socio-ecological history, develop communal and convivial relationships and engage in the responsible gathering of wild mushrooms. However, the hosting of mushroomers to know, value and engage with the community forest recovery has constantly worked against the enclosure of mushrooms to provide marketable forms of leisure. The outcome of these activities depends on the relationships established between mushrooms, mycologists, local administrators, commoners and poachers, all operating within a framework that favors the eradication of resources instead of long-term relationships that sustain places.

Perbandingan Pertumbuhan Jamur Tiram Putih di Kumbung Ciseeng dan Universitas Al-Azhar Indonesia

Directory of Open Access Journals (Sweden)

Putri Kenanga

2016-03-01

Full Text Available White oyster mushroom (Pleurotus ostreatus is one of wood fungi which easy to grow at rotting wood and organic waste. White oyster mushroom is rich in protein, carbohydrates, minerals, and vitamins. Environmental factors affecting the growth of white oyster mushrooms is temperature and humidity. The study aims to compare the growth and production of white oyster mushroom in different location, Ciseeng and University of Al-Azhar Indonesia (UAI. Cultivation in UAI done in a controlled situation using autoclave sterilization, inoculation using enkas and the treatment is watering on gunny sack in the mushroom house regularly. Whereas, cultivation in Ciseeng less controlled by traditional cultivation using steam sterilization and inoculation process at open space. Wet weight, dry weight, and biological efficiency results is higher in UAI than Ciseeng at 7.95%, 14.5%, and 7.34% higher, respectively. Morphological parameter such as number of fruiting body, mushroom cap diameters, and stem lenght also show better in UAI than Ciseeng at 23.67%, 8.75%, 54.96% higher, respectively. Better result of mushroom cultivation at UAI supported by 28.3oC average temperature and 93.95% humidity, meanwhile in Ciseeng average temperature and humidity was 29.25oC and 82.15%.

[Status of termite-mushroom artificial domestication cultivation--a review].

Science.gov (United States)

Zhang, Yujin; Guo, Huachun; Li, Rongchun

2010-10-01

Two models of domestication and cultivation of termite-mushroom were discussed: the cultivation of termitomyces model, which method of woodrotting fungi cultivation was emphasized and the original ecological model, which multiplication of symbiotic termites was focused. The problems and possible solutions during termite-mushroom cultivation were also discussed.

Yield response of mushroom (Agaricus bisporus) on wheat straw ...

African Journals Online (AJOL)

SERVER

2008-01-18

Jan 18, 2008 ... 1Mugla University, Faculty of Technical Education, Kotekli, 48000, Mugla, Turkey. 2Mugla University, Mushroom ..... Hayes WA, Shandilya TR (1977). Casing soil and compost substrates used in the artifical culture of Agaricus bisporus, the cultivated mushroom. Indian J. Mycol. Plant Pathol. 7: 5-10. Lambert ...

ACCUMULATION OF RADIOCESIUM BY MUSHROOMS IN THE ENVIRONMENT: A LITERATURE REVIEW

Energy Technology Data Exchange (ETDEWEB)

Duff, M

2007-05-28

During the last 50 years, a large amount of information on radionuclide accumulators or ''sentinel-type'' organisms in the environment has been published. Much of this work focused on the risks of food-chain transfer of radionuclides to higher organisms such as reindeer and man. However, until the 1980's and 1990's, there has been little published data on the radiocesium ({sup 134}Cs and {sup 137}Cs) accumulation by mushrooms. This presentation will consist of a review of the published data for {sup 134,137}Cs accumulation by mushrooms in nature. This review will discuss the aspects that promote {sup 134,137}Cs uptake by mushrooms and focus on mushrooms that demonstrate a large propensity for use in the environmental biomonitoring of radiocesium contamination. It will also provide descriptions of habitats for many of these mushrooms and discuss on how growth media and other conditions relate to Cs accumulation.

Activity of 137Cs in Forest Mushrooms in Poland in 2000

International Nuclear Information System (INIS)

Grabowski, D.; Kurowski, W.; Muszynski, W.; Rubel, B.; Smagala, G.; Swietochowska, J.

2001-01-01

Full text: The radiocaesium in mushrooms has been monitored in Poland after the Chernobyl accident. The samples of mushrooms were collected all over the territory of Poland during the period 1986-2000. Activity of 137 Cs was much higher than in other foodstuff. This is connected with specific forest ecosystem and tendency to accumulate caesium by some kinds of mushrooms. The significant variations were observed in different species of mushrooms collected at the same area and time. This paper presents the activity of 137 Cs in Xerocomus badius, Boletus edulis and Cantharellus cibarius in Poland in 2000. The samples had been analysed during mushroom-season (June-September). Activities of 137 Cs were measured by gamma spectrometry with HPGe or NaI(Tl) detectors. The activity of 137 Cs was in range 24-472 Bq/kg for Xerocomus badius, 1-678 Bq/kg for Boletus edulis and 1-557 Bq/kg for Cantharellus cibarius. The results were compared to the data from previous years. (author)

Obtaining a Functional Product Through the Exploitation of Mushroom Flour in Pasta

Directory of Open Access Journals (Sweden)

Crina Carmen MURESAN

2017-05-01

Full Text Available The present study focuses on the influence of adding mushroom powder on a certain assortment of pasta. The research comprises two major directions: the study of the raw materials used to produce pasta from a compositional point of view and the quantification of some biologically active compounds of interest; emphasizing the potential of using Boletus edulis mushroom powder in the composition of pasta and evaluating the quality of the product from a nutritional and sensorial point of view. For this purpose, two types of pasta have been created, with different percentages of mushroom, 10% and 20%, but also a blank sample obtained in the same conditions, but without mushroom powder. To achieve the goal the following analyzes were conducted: proteins, total polyphenols, antioxidant activity, fat, humidity, ashes, acidity, increase in volume of the boiled pasta and customers’ preferences. By using sensory analysis has been established that the consumers preferred pasta enriched with 10% mushroom powder. In conclusion, the addition of mushrooms flour assures an enhancement of the nutritional value, as well as of the organoleptic characteristics of the final product.

Indigenous knowledge and utilization of edible mushrooms in parts ...

African Journals Online (AJOL)

Heim and Coprinus disseminatus (Pers.: Fr.) S. F. Gray. Among the local people, names of edible mushrooms are based on the substrates on which they grow, their association with insects, and unrelated taxa are given collective names. Rural people believe mushrooms have medicinal values and can serve as blood tonic, ...

Identification of molecular species of acylglycerols of Philippine wild edible mushroom, Ganoderma lucidum

Science.gov (United States)

Wild edible mushrooms are widely consumed in many countries. We successfully cultivated four edible, medicinal Philippine mushrooms in liquid culture. Recently, we identified the molecular species of acylglycerols in the lipid extract of mushroom G. lucidum NRRL66208. One hundred and three molecular...

Culinary-Medicinal Mushroom Products as a Potential Source of Vitamin D.

Science.gov (United States)

Bernas, Emilia; Jaworska, Grażyna

2017-01-01

The incidence of vitamin D deficiency has increased in recent years, mainly in Europe. The consumption of processed mushrooms may play an important role in preventing diseases associated with vitamin D deficiency. We determined the effects of 2 kinds of freezing (blast, cryogenic), canning (mild and strong brine), and drying (air-drying, freeze-drying) on the retention of vitamin D2 and ergosterol in Agaricus bisporus. Fresh and processed A. bisporus mushrooms can be a good dietary source of vitamin D2. After 12 months of storage, canned mushrooms retained the largest amount of vitamin D2 and ergosterol, whereas the smallest amount was retained in dried mushrooms. Cryogenic freezing resulted in higher levels of vitamin D2, whereas ergosterol levels were higher using air-blast freezing. The drying method had a significant effect only on ergosterol levels, which were higher in the case of freeze-drying. Room temperature gave the best results for storing dried mushrooms. In canned mushrooms, the type of brine had an effect only on levels of vitamin D2; retention was higher using the strong brine. Retention of vitamin D2 was higher at cool temperatures, whereas room temperature resulted in higher retention of ergosterol in the canned products.

Identifying 8-hydroxynaringenin as a suicide substrate of mushroom tyrosinase.

Science.gov (United States)

Chang, Te-Sheng; Lin, Meng-Yi; Lin, Hsuan-Jung

2010-01-01

A biotransformed metabolite of naringenin was isolated from the fermentation broth of Aspergillus oryzae, fed with naringenin, and identified as 8-hydroxynaringenin based on the mass and (1)H- and (13)C-NMR spectral data. The compound showed characteristics of both an irreversible inhibitor and a substrate of mushroom tyrosinase in preincubation and HPLC analysis. These results demonstrate that 8-hydroxynaringenin belongs to a suicide substrate of mushroom tyrosinase. The partition ratio between the compound's molecules in the formation of product and in the inactivation of the enzyme was determined to be 283 +/- 21. The present study's results, together with our previous findings, which proved that both 8-hydroxydaidzein and 8-hydroxygenistein are suicide substrates of mushroom tyrosinase, show that 7,8,4'-trihydroxyl functional groups on flavonoids' skeletons play important roles in producing suicide substrate properties toward mushroom tyrosinase.

Segmentation of Mushroom and Cap width Measurement using Modified K-Means Clustering Algorithm

Directory of Open Access Journals (Sweden)

Eser Sert

2014-01-01

Full Text Available Mushroom is one of the commonly consumed foods. Image processing is one of the effective way for examination of visual features and detecting the size of a mushroom. We developed software for segmentation of a mushroom in a picture and also to measure the cap width of the mushroom. K-Means clustering method is used for the process. K-Means is one of the most successful clustering methods. In our study we customized the algorithm to get the best result and tested the algorithm. In the system, at first mushroom picture is filtered, histograms are balanced and after that segmentation is performed. Results provided that customized algorithm performed better segmentation than classical K-Means algorithm. Tests performed on the designed software showed that segmentation on complex background pictures is performed with high accuracy, and 20 mushrooms caps are measured with 2.281 % relative error.

Plant growth and gas balance in a plant and mushroom cultivation system

Science.gov (United States)

Kitaya, Y.; Tani, A.; Kiyota, M.; Aiga, I.

1994-11-01

In order to obtain basic data for construction of a plant cultivation system incorporating a mushroom cultivation subsystem in the CELSS, plant growth and atmospheric CO2 balance in the system were investigated. The plant growth was promoted by a high level of CO2 which resulted from the respiration of the mushroom mycelium in the system. The atmospheric CO2 concentration inside the system changed significantly due to the slight change in the net photosynthetic rate of plants and/or the respiration rate of the mushroom when the plant cultivation system combined directly with the mushroom cultivation subsystem.

Higher order visual input to the mushroom bodies in the bee, Bombus impatiens.

Science.gov (United States)

Paulk, Angelique C; Gronenberg, Wulfila

2008-11-01

To produce appropriate behaviors based on biologically relevant associations, sensory pathways conveying different modalities are integrated by higher-order central brain structures, such as insect mushroom bodies. To address this function of sensory integration, we characterized the structure and response of optic lobe (OL) neurons projecting to the calyces of the mushroom bodies in bees. Bees are well known for their visual learning and memory capabilities and their brains possess major direct visual input from the optic lobes to the mushroom bodies. To functionally characterize these visual inputs to the mushroom bodies, we recorded intracellularly from neurons in bumblebees (Apidae: Bombus impatiens) and a single neuron in a honeybee (Apidae: Apis mellifera) while presenting color and motion stimuli. All of the mushroom body input neurons were color sensitive while a subset was motion sensitive. Additionally, most of the mushroom body input neurons would respond to the first, but not to subsequent, presentations of repeated stimuli. In general, the medulla or lobula neurons projecting to the calyx signaled specific chromatic, temporal, and motion features of the visual world to the mushroom bodies, which included sensory information required for the biologically relevant associations bees form during foraging tasks.

Detection of irradiated mushrooms by GC/MS analysis of lipid-derived hydrocarbons

International Nuclear Information System (INIS)

Delincee, H.; Koller, W.D.

1993-01-01

A number of methods has been developed for the detection of irradiated foods in recent years, and in the case of mushrooms several methods have been proposed, of which the thermoluminescence (TL) measurements seem to be the most valuable. However, in several cases mineral contamination of fresh mushrooms is so extremely low that not enough minerals can be isolated for TL analysis. In that case an alternative method is needed to detect the radiation treatment of mushrooms. Several methods including TTC (2,3,5-triphenyl-tetrazolium-chloride) staining, kinetin treatment, dropping out of spores and mirco-gel electrophoresis of spores, were tested, but the most promising method was the GC/MS analysis of radiation-induced lipid-derived hydrocarbons in spite of the low fat content - around 0.2-0.3% - of mushrooms. Successful results were achieved by GC/MS analysis of the radiolytic hydrocarbons. Although mushrooms have a low fat content, by extracting a large quantity, in this case 500 g of mushrooms, about 1.2-1.5 g of fat could be obtained. The main fatty acids of mushroom fat and some of their expected cleavage products on irradiation - the c n-1 hydrocarbon which has one C atom less than the parent fatty acid and the C n-2:1 hydrocarbon, which has two C atoms less and an additional double bond in position 1 - are given. (orig./Vhe)

Biomass production of pleurotus sajor-caju by submerged culture fermentation

International Nuclear Information System (INIS)

Kausar, T.; Nasreen, Z.; Nadeem, M.; Baig, S.

2006-01-01

The effect of different carbon sources, namely, sawdust and powder of agro wastes (as such, or water soluble extracts), and inorganic/natural nitrogen sources on the biomass production of Pleurotus sajor-caju by submerged culture fermentation was studied. Supplementation of the fermentation medium with 2% molasses, 2% wheat spike powder, extract of 2% wheat spike powder, and com gluten meal resulted in 12.85, 10.85, 12.35 and 13.92 g/sub l/ biomass production of P. sajor-caju, respectively. The fungal hyphae biomass contained 8.28% moisture, 21.18% crude protein, 1.55% fat, 3.59% ash, 2.32% crude fibre, and 63.48% nitrogen-free extract. (author)

Utilizing Mushrooms to Reduce Overall Sodium in Taco Filling Using Physical and Sensory Evaluation.

Science.gov (United States)

Wong, Kristin M; Decker, Eric A; Autio, Wesley R; Toong, Ken; DiStefano, Garett; Kinchla, Amanda J

2017-10-01

This project investigated the use of integrating mushrooms into beef taco filling as a means to reduce overall sodium for food service applications. Initial product development used physical characterization analysis (moisture, yield, color, and texture) to determine initial threshold of mushroom inclusion with minimal differences against an all-meat control. Increasing mushroom inclusion increased moisture and yield before draining but decreased yield after draining, lightness, redness, and texture. Results showed that inclusion under 50% by weight minimized physical attribute deviation from an all-meat control. Additional physical analysis investigated a variety of other factors (mushroom type, blanching, and particle size) to determine if other attributing mushroom characteristics would yield statistical similarity to the all-meat control. Results showed that a formulation containing up to 45% mushrooms can be integrated into beef fillings using un-blanched, white button mushrooms with small grind (1 to 5 mm), which maximized mushroom usage while minimizing differences from the all-meat control. Additional sodium analysis showed that varying salt level in formulations did not affect physical characteristics and mushroom inclusion could not significantly reduce overall sodium level. Optimized mushroom samples were then fielded in a hedonic sensory study to untrained consumers to evaluate product liking attributes (overall liking, aroma, color, flavor, juiciness, saltiness, and texture). Samples with overall liking scores that closely matched the control were then fielded in a paired-preference test to determine acceptance. Consumers preferred a 45% mushroom with reduced sodium taco filling compared to its full sodium counterpart in a food service fielded paired-preference sensory test. Although diet can significantly reduce the risk of heart disease, American consumers continue to eat detrimental diets high in fat and sodium. Products need to be made that

Radical scavenging potential and DNA damage protection of wild edible mushrooms of Kashmir Himalaya

Directory of Open Access Journals (Sweden)

Nowsheen Shameem

2017-10-01

Full Text Available The edible mushrooms Verpa bohemica and Morchella esculenta are locally used for dietary and antioxidant in tribal areas of Kashmir Himalaya. In the present study, sequences of solvents on the basis of their polarity were used for the extraction from selected mushrooms. The comprehensive antioxidant activity of all edible mushroom extracts was evaluated by seven different methods. V. bohemica exhibited significant inhibitory activity of radicals among all the mushrooms while Morchella extracts protected the DNA damage from OH· radicals. This study provides us the substantiation for the use of these mushrooms as antioxidants besides being already eaten as food.

Using of gamma rays in stimulation and improvement of mushroom spawns plerotus ostreatus

International Nuclear Information System (INIS)

Hussein, O.S.; Atia, A.I.

2009-01-01

The objective of this work was activation and stimulation of plerotus ostreatus growth and increasing their yields by using of gamma rays, in addition to improvement of mushroom quality and shelf life.Exposing plerotus ostreatus to different doses of gamma rays 2.5, 5, 10 and 15 Gy to determine some of the basic composition of mushroom fruits achieved significant increase in yields and basic composition of resulted mushrooms. Also, increase in carbohydrates content, most of amino acids content and fatty acids content, mainly unsaturated fatty acid i.e., (C 16:1) and (C 18:1,2), which are essential for human nutrition as antioxidant. Whereas, there was a significant decrease in the total phenols content of the resulted fruits, which affected the quality and shelf life of mushroom fruits. All gamma rays doses used increased mushroom yield in fresh and dry wt basis. The recommended dose for spawn irradiation was 10 Gy to increase mushroom yields and its chemical components

The pathogenic fungi in mushroom cultivation of Agaricus bisporus (Lange.) Imbach.

OpenAIRE

Agata Tekiela

2012-01-01

The research was conducted in a mushroom growing facility located near Rzeszów, consisting of three production cycles. The number and composition of microorganisms which accompany the mushroom cultivation depended on the healthiness of: the compost, casing and spawn of Agaricus bisporus. The presence of pathogenic fungi in the cultivation halls at the beginning of the production cycle is a serious threat to the cultivation of common mushroom because their rapid development shortens the span o...

Nicotine in dried boletus mushrooms - Causes for contamination must be determined

OpenAIRE

German Federal Institute for Risk Assessment

2009-01-01

Recently, nicotine has been detected in samples of dried boletus mushrooms. In large doses, nicotine is a strong neurotoxin and natural component of the tobacco plant. Yet food supply plants such as potatoes, tomatoes, aubergines and cauliflower also contain very small amounts of the substance. The cause of nicotine contamination in dried boletus mushrooms has thus far not been determined since nicotine has not been established as a naturally occurring component in mushrooms. Whether the nico...

Mushroom Lectins: Specificity, Structure and Bioactivity Relevant to Human Disease

Directory of Open Access Journals (Sweden)

Mohamed Ali Abol Hassan

2015-04-01

Full Text Available Lectins are non-immunoglobulin proteins that bind diverse sugar structures with a high degree of selectivity. Lectins play crucial role in various biological processes such as cellular signaling, scavenging of glycoproteins from the circulatory system, cell–cell interactions in the immune system, differentiation and protein targeting to cellular compartments, as well as in host defence mechanisms, inflammation, and cancer. Among all the sources of lectins, plants have been most extensively studied. However, more recently fungal lectins have attracted considerable attention due to their antitumor, antiproliferative and immunomodulatory activities. Given that only 10% of mushroom species are known and have been taxonomically classified, mushrooms represent an enormous unexplored source of potentially useful and novel lectins. In this review we provide an up-to-date summary on the biochemical, molecular and structural properties of mushroom lectins, as well as their versatile applications specifically focusing on mushroom lectin bioactivity.

Lead accumulation in the straw mushroom, Volvariella volvacea, from lead contaminated rice straw and stubble.

Science.gov (United States)

Kumhomkul, Thapakorn; Panich-pat, Thanawan

2013-08-01

Straw mushrooms were grown on lead contaminated rice straw and stubble. Study materials were dried, acid digested, and analyzed for lead using flame atomic absorption spectrophotometry. The results showed the highest lead concentration in substrate was 445.350 mg kg⁻¹ in Treatment 3 (T3) and the lowest was BD (below detection) in Treatment 1 (T1). The maximum lead content in straw mushrooms was 5.072 mg kg⁻¹ dw in pileus of T3 and the minimum lead content in straw mushrooms was BD in egg and mature (stalk and pileus) stage of T1. The lead concentration in straw mushrooms was affected by the age of the mycelium and the morphology of mushrooms. Mushrooms' lead uptake produced the highest accumulation in the cell wall. Some lead concentrations in straw mushrooms exceeded the EU standard (>3 mg kg⁻¹ dw).

Physicochemical and sensorial characteristics of noodle enriched with oyster mushroom (Pleorotus ostreatus) powder

Science.gov (United States)

Wahyono, A.; Novianti; Bakri, A.; Kasutjianingati

2018-01-01

Oyster Mushroom is a mushroom that can be used for food and medicine. It contains highly nutritious and functional substances such as statins and beta-glucan. A comprehensive evaluation of noodle-enriched with Oyster Mushroom powder has not been performed so far. In this study, we performed a comprehensive evaluation of noodle-enriched with Oyster Mushroom powder. The aim of this study was to assess the effects of enrichment of Oyster Mushroom Powder (OMP) on the quality of noodle. The quality of noodle was evaluated based on physical, chemical and sensorial characteristics. This study was done by substituting wheat flour with OMP at the level of 0 (control); 5; 7.5; 10; 12.5; and 15%. The results showed that OMP significantly affected (Pvalues of noodle.

Cambios en las propiedades físicas de un Inceptisol por la adición de substrato degradado con el hongo Pleurotus ostreatus Changes on physical properties of an Inceptisol influence of the degraded substrate by Pleurotus ostreatus

Directory of Open Access Journals (Sweden)

Herminio Paredes Valencia

2010-01-01

Full Text Available Para evaluar el efecto del substrato orgánico (aserrín de madera y 'estopa' de coco enriquecido con 40% de volúmenes iguales de hojas de plátano (Mussa sp., kudzú tropical (Pueraria phaseoloides y botón de oro (Tithonia diversifolia degradado por el hongo Pleurotus ostreatus (SDP sobre algunas propiedades físicas de un Inceptisol de Buenaventura, Valle del Cauca, Colombia, se incorporaron dosis crecientes de éste (0, 1.25, 2.5, 5, 10, 20, 40 y 80 g/kg en el suelo tamizado en malla de 2 mm. La mezcla se utilizó en materos sembrados con maíz durante 4 meses, momento en el cual se tomaron muestras para determinar los cambios en las propiedades del suelo. Se usó un diseño completamente al azar, con ocho tratamientos, cuatro repeticiones y dos profundidades de muestreo. La correlación entre la cantidad de SDP incorporado y la mayoría de propiedades físicas evaluadas fue altamente significativa. Comparadas con el control (sin SDP, las dosis de 20, 40 y 80 g/kg redujeron significativamente la densidad aparente del suelo, al tiempo que incrementaron la porosidad total, la macroporosidad, la retención de humedad a bajas tensiones y el contenido de materia orgánica. En las dosis de 40 y 80 g/kg se observó una reducción significativa de la susceptibilidad a la compactación, lo mismo que un incremento en el diámetro promedio ponderado de los agregados estables al agua. Los incrementos de la conductividad hidráulica saturada y la permeabilidad al aire no fueron significativos en relación con el control.To evaluate the effect of the degraded substrate by the mushroom Pleurotus ostreatus (DSP on some physical properties of an Inceptisol from Buenaventura, Colombia, different doses of DSP (0, 1.25, 2.5, 5, 10, 20, 40 and 80 g.kg-1 were incorporated in 2 mm-sieved soil. The mixtures were placed in pots and planted with maize during four months in a green house until the sampling time. Complete randomized design, with eight treatments, four

Antioxidative Effects of Phenolic Compounds of Mushroom Mycelia in Simulated Regions of the Human Colon, In Vitro Study

Directory of Open Access Journals (Sweden)

Vamanu Emanuel

2018-03-01

Full Text Available Many compounds in mushrooms are biologically active; however, the in vivo actions of their metabolites are poorly understood. An in vitro system, GIS1, was used to simulate the fermentation action of microbiota in each colon region. We used MycoPo, a natural product obtained from the lyophilized mycelia of different Pleurotus ostreatus species to determine the biological effects in human-colon regions. Controls (Lentinula edodes mycelia; dried basidia of Agaricus brunnescens were chosen to confirm the biological activity of P. ostreatus mycelia in vitro. We measured total antioxidant capacity and ferric ion-reducing antioxidant power (FRAP in simulated colon regions to identify antioxidant compounds, and undertook in vitro gastrointestinal simulation and microbiological analyses. The highest FRAP was found for the ascending colon, and the antioxidant effect was higher when MycoPo was administered. A. brunnescens consumption resulted in low total antioxidant capacity. Polyphenol content was correlated with the antioxidant status and microbial composition of microbiota. Total polyphenolic content was higher after A. brunnescens consumption, and four types of polyphenols were identified by high-performance liquid chromatography. Major phenolic acids were gentisic acid, homogentisic acid, and small amounts of caffeic acid. The Enterobacteriaceae species populations varied greatly across the three parts of the colon. We noted a significant (p0.85. These data suggest a direct relationship between favorable bacterial strains and availability of bioactive compounds, with specificity for each colon region.

Mushroom speleothems: Stromatolites that formed in the absence of phototrophs

Science.gov (United States)

Bontognali, Tomaso; D'Angeli, Ilenia; Tisato, Nicola; Vasconcelos, Crisogono; Bernasconi, Stefano; Gonzales, Esteban; DeWaele, Jo

2016-04-01

Unusual speleothems resembling giant mushrooms occur in Santa Catalina Cave, Cuba. Although these mineral buildups are considered a natural heritage, their composition and formation mechanism remain poorly understood. Here we characterize their morphology and mineralogy and present a model for their genesis. We propose that the mushrooms, which are mainly comprised of calcite and aragonite, formed during four different phases within an evolving cave environment. The stipe of the mushroom is an assemblage of three well-known speleothems: a stalagmite surrounded by calcite rafts that were subsequently encrusted by cave clouds (mammilaries). More peculiar is the cap of the mushroom, which is morphologically similar to cerebroid stromatolites and thrombolites of microbial origin occurring in marine environments. Scanning electron microscopy investigations of this last unit revealed the presence of fossilized extracellular polymeric substances (EPS) - the constituents of biofilms and microbial mats. These organic microstructures are mineralized with Ca-carbonate, suggesting that the mushroom cap formed through a microbially-influenced mineralization process. The existence of cerebroid Ca-carbonate buildups forming in dark caves (i.e., in the absence of phototrophs) has interesting implications for the study of fossil microbialites preserved in ancient rocks, which are today considered as one of the earliest evidence for life on Earth.

Mushroom speleothems: Stromatolites that formed in the absence of phototrophs

Directory of Open Access Journals (Sweden)

Tomaso eBontognali

2016-04-01

Full Text Available Unusual speleothems resembling giant mushrooms occur in Santa Catalina Cave, Cuba. Although these mineral buildups are considered a natural heritage, their composition and formation mechanism remain poorly understood. Here we characterize their morphology and mineralogy and present a model for their genesis. We propose that the mushrooms, which are mainly comprised of calcite and aragonite, formed during four different phases within an evolving cave environment. The stipe of the mushroom is an assemblage of three well-known speleothems: a stalagmite surrounded by calcite rafts that were subsequently encrusted by cave clouds (mammilaries. More peculiar is the cap of the mushroom, which is morphologically similar to cerebroid stromatolites and thrombolites of microbial origin occurring in marine environments. Scanning electron microscopy investigations of this last unit revealed the presence of fossilized extracellular polymeric substances (EPS – the constituents of biofilms and microbial mats. These organic microstructures are mineralized with Ca-carbonate, suggesting that the mushroom cap formed through a microbially-influenced mineralization process. The existence of cerebroid Ca-carbonate buildups forming in dark caves (i.e., in the absence of phototrophs has interesting implications for the study of fossil microbialites preserved in ancient rocks, which are today considered as one of the earliest evidence for life on Earth.

Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

Science.gov (United States)

González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

2001-11-01

The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

Rating of cesium contamination of wild mushrooms

International Nuclear Information System (INIS)

Henrich, E.; Zapletal, M.; Friedrich, M.; Haider, W.

1988-08-01

'Rating' means here a 5-fold scale with the ranges: more than 100 nCi/kg raw weight - 'very high'; 300 - 100; 3 - 30; 1 - 3; less than 1 nCi/kg - 'very low'. A list of some 50 - 60 different kinds of mushrooms are listed and evaluated in this scale, as from 1988 and from a region with a high Chernobyl fallout. As a comparison, contamination values of 12 mushroom sorts from before the Chernobyl accident, coming from atmospheric nuclear weapons tests, are also given. 2 figs., 5 tabs. (qui)

The pathogenic fungi in mushroom cultivation of Agaricus bisporus (Lange. Imbach.

Directory of Open Access Journals (Sweden)

Agata Tekiela

2012-12-01

Full Text Available The research was conducted in a mushroom growing facility located near Rzeszów, consisting of three production cycles. The number and composition of microorganisms which accompany the mushroom cultivation depended on the healthiness of: the compost, casing and spawn of Agaricus bisporus. The presence of pathogenic fungi in the cultivation halls at the beginning of the production cycle is a serious threat to the cultivation of common mushroom because their rapid development shortens the span of fruiting body harvests.

Wild Mushrooms in Nepal: Some Potential Candidates as Antioxidant and ACE-Inhibition Sources

Directory of Open Access Journals (Sweden)

Tran Hai Bang

2014-01-01

Full Text Available Twenty-nine mushrooms collected in the mountainous areas of Nepal were analyzed for antioxidant activity by different methods, including Folin-Ciocalteu, ORAC, ABTS, and DPPH assays. Intracellular H2O2-scavenging activity was also performed on HaCaT cells. The results showed that phenolic compounds are the main antioxidant of the mushrooms. Among studied samples, Inonotus andersonii, and Phellinus gilvus exhibited very high antioxidant activity with the phenolic contents up to 310.8 and 258.7 mg GAE/g extracts, respectively. The H2O2-scavenging assay on cells also revealed the potential of these mushrooms in the prevention of oxidative stress. In term of ACE-inhibition, results showed that Phlebia tremellosa would be a novel and promising candidate for antihypertensive studies. This mushroom exhibited even higher in vitro ACE-inhibition activity than Ganoderma lingzhi, with the IC50 values of the two mushrooms being 32 μg/mL and 2 μg/mL, respectively. This is the first time biological activities of mushrooms collected in Nepal were reported. Information from this study should be a valuable reference for future studies on antioxidant and ACE-inhibitory activities of mushrooms.

Mushroom dehydration in a hybrid-solar dryer

International Nuclear Information System (INIS)

Reyes, Alejandro; Mahn, Andrea; Cubillos, Francisco; Huenulaf, Pedro

2013-01-01

Highlights: ► Mushrooms (Paris variety) were dehydrated in a hybrid solar dryer. ► Effective diffusivity was estimated by the Constant Diffusivity Model. ► Drying kinetics were adjusted by a semi-theoretical and the empirical Page model. ► Temperature, thickness and air recycle significantly affected critical moisture. ► The input of solar energy resulted in 3.5–12.5% electrical energy saving. - Abstract: Mushrooms (Paris variety) were dehydrated in a hybrid solar dryer (HSD) provided with a 3 m 2 solar panel and electric resistances. Mushrooms were cut in 8 mm or 4 mm thickness slices. At the outlet of the tray dryer 80–90% air was recycled and the air temperature was adjusted to the pre-defined levels (50 or 60 °C). At the outlet of the solar panel the air temperature raised between 2 and 20 °C above the ambient temperature, depending mainly of solar radiation level. Temperature, slices thickness and air recycle level had statistically significant effects on critical moisture content (X c ), as well as on the time necessary to reach a moisture content of 0.1 (wb). The color parameters of dehydrated mushroom indicate a notorious darkening, in all runs. Rehydration assays at 35 °C showed that in less than 30 min rehydrated mushrooms reached a moisture content of 0.8 (wb). Effective diffusivity (D eff ) was estimated by the Simplified Constant Diffusivity Model (SCDM), and it ranged between 6E−10 and 40E−10 m 2 /s, with R 2 higher than 0.98, agreeing with literature. The adjustment of experimental drying kinetics with the empirical Page’s model resulted in R 2 higher than 0.997. Finally, the input of solar energy resulted in 3.5–12.5% energy saving. These values could even be improved by increasing the agro-product load in the HSD

75 FR 31426 - Certain Preserved Mushrooms from Indonesia: Notice of Rescission of Antidumping Duty...

Science.gov (United States)

2010-06-03

... DEPARTMENT OF COMMERCE International Trade Administration (A-560-802) Certain Preserved Mushrooms... ``Opportunity to Request Administrative Review'' of the antidumping duty order on certain preserved mushrooms... antidumping duty order on certain preserved mushrooms from Indonesia with respect to these companies. See...

Abundance and distribution of Microdispus lambi (Acari: Microdispidae) in Spanish mushroom crops.

Science.gov (United States)

Navarro, María-Jesús; Gea, Francisco-José; Escudero-Colomar, L Adriana

2010-04-01

The myceliophagous mite Microdispus lambi has become a veritable plague since 1996, when it was first observed in Spanish mushroom crops, and is now causing substantial economic losses, particulary in spring and summer. This study looks at seasonal variation of the pest, its distribution on commercial farms and the population development during the crop cycle of the common white mushroom, Agaricus bisporus. Over a period of 18 months, 24 consecutive mushroom crop cycles were monitored and a total of 24 spawn and 960 substrate samples were analysed. We found that it is usually the substrates in the growing rooms that are infested, most commonly the compost. In many cases, the pest can be detected when the first 'flush'-i.e., mushroom growth surge, with weekly periodicity-is harvested, although damage does not become evident until the third flush. Mites were detected at the back of the mushroom growing room and, to a lesser extent, near the access door.

Mushroom body efferent neurons responsible for aversive olfactory memory retrieval in Drosophila.

Science.gov (United States)

Séjourné, Julien; Plaçais, Pierre-Yves; Aso, Yoshinori; Siwanowicz, Igor; Trannoy, Séverine; Thoma, Vladimiros; Tedjakumala, Stevanus R; Rubin, Gerald M; Tchénio, Paul; Ito, Kei; Isabel, Guillaume; Tanimoto, Hiromu; Preat, Thomas

2011-06-19

Aversive olfactory memory is formed in the mushroom bodies in Drosophila melanogaster. Memory retrieval requires mushroom body output, but the manner in which a memory trace in the mushroom body drives conditioned avoidance of a learned odor remains unknown. To identify neurons that are involved in olfactory memory retrieval, we performed an anatomical and functional screen of defined sets of mushroom body output neurons. We found that MB-V2 neurons were essential for retrieval of both short- and long-lasting memory, but not for memory formation or memory consolidation. MB-V2 neurons are cholinergic efferent neurons that project from the mushroom body vertical lobes to the middle superiormedial protocerebrum and the lateral horn. Notably, the odor response of MB-V2 neurons was modified after conditioning. As the lateral horn has been implicated in innate responses to repellent odorants, we propose that MB-V2 neurons recruit the olfactory pathway involved in innate odor avoidance during memory retrieval.

The cultural significance of wild mushrooms in San Mateo Huexoyucan, Tlaxcala, Mexico

Science.gov (United States)

2014-01-01

Background We performed an ethnomycological study in a community in Tlaxcala, Central Mexico to identify the most important species of wild mushrooms growing in an oak forest, their significance criteria, and to validate the Cultural Significance Index (CSI). Methods Thirty-three mestizo individuals were randomly selected in San Mateo Huexoyucan and were asked seven questions based on criteria established by the CSI. Among the 49 mushroom species collected in the oak forest and open areas, 20 species were mentioned most often and were analyzed in more detail. Ordination and grouping techniques were used to determine the relationship between the cultural significance of the mushroom species, according to a perceived abundance index, frequency of use index, taste score appreciation index, multifunctional food index, knowledge transmission index, and health index. Results The mushrooms with highest CSI values were Agaricus campestris, Ramaria spp., Amanita aff. basii, Russula spp., Ustilago maydis, and Boletus variipes. These species were characterized by their good taste and were considered very nutritional. The species with the lowest cultural significance included Russula mexicana, Lycoperdon perlatum, and Strobylomyces strobilaceus. The ordination and grouping analyses identified four groups of mushrooms by their significance to the people of Huexoyucan. The most important variables that explained the grouping were the taste score appreciation index, health index, the knowledge transmission index, and the frequency of use index. Conclusions A. aff. basii and A. campestris were the most significant wild mushrooms to the people of San Mateo. The diversity of the Russula species and the variety of Amanita and Ramaria species used by these people was outstanding. Environments outside the forest also produced useful resources. The CSI used in Oaxaca was useful for determining the cultural significance of mushrooms in SMH, Tlaxcala. This list of mushrooms can be used in