Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie
2014-01-01
Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Directory of Open Access Journals (Sweden)
Dong-Hai Liu
Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Directory of Open Access Journals (Sweden)
Jader Santos Cruz
2012-10-01
Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.
Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process
Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.
1988-08-01
Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.
Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes
DEFF Research Database (Denmark)
Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R
2006-01-01
Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....
Energy Technology Data Exchange (ETDEWEB)
Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)
2015-06-15
We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.
Blockade of voltage-gated K+ currents in rat mesenteric arterial smooth muscle cells by MK801
Directory of Open Access Journals (Sweden)
Jeong Min Kim
2015-01-01
Full Text Available MK801 (dizocilpine, a phencyclidine (PCP derivative, is a potent noncompetitive antagonist of the N-Methyl-D-aspartate receptor (NMDAr. Another PCP derivative, ketamine, was reported to block voltage-gated K+ (Kv channels, which was independent of NMDAr function. Kv currents are major regulators of the membrane potential (Em and excitability of muscles and neurons. Here, we investigated the effect of MK801 on the Kv channels and Em in rat mesenteric arterial smooth muscle cells (RMASMCs. We used the whole-cell patch clamp technique to analyze the effect of MK801 enantiomers on Kv channels and Em. (+MK801 inhibited Kv channels in a concentration-dependent manner (IC50 of 89.1 ± 13.1 μM, Hill coefficient of 1.05 ± 0.08. The inhibition was voltage- and state- independent. (+MK801 didn't influence steady-state activation and inactivation of Kv channels. (+MK801 treatment depolarized Em in a concentration-dependent manner and concomitantly decreased membrane conductance. (−MK801 also similarly inhibited the Kv channels (IC50 of 134.0 ± 17.5 μM, Hill coefficient of 0.87 ± 0.09. These results indicate that MK801 directly inhibits the Kv channel in a state-independent manner in RMASMCs. This MK801-mediated inhibition of Kv channels should be considered when assessing the various pharmacological effects produced by MK801, such as schizophrenia, neuroprotection, and hypertension.
BMP signaling regulates satellite cell-dependent postnatal muscle growth.
Stantzou, Amalia; Schirwis, Elija; Swist, Sandra; Alonso-Martin, Sonia; Polydorou, Ioanna; Zarrouki, Faouzi; Mouisel, Etienne; Beley, Cyriaque; Julien, Anaïs; Le Grand, Fabien; Garcia, Luis; Colnot, Céline; Birchmeier, Carmen; Braun, Thomas; Schuelke, Markus; Relaix, Frédéric; Amthor, Helge
2017-08-01
Postnatal growth of skeletal muscle largely depends on the expansion and differentiation of resident stem cells, the so-called satellite cells. Here, we demonstrate that postnatal satellite cells express components of the bone morphogenetic protein (BMP) signaling machinery. Overexpression of noggin in postnatal mice (to antagonize BMP ligands), satellite cell-specific knockout of Alk3 (the gene encoding the BMP transmembrane receptor) or overexpression of inhibitory SMAD6 decreased satellite cell proliferation and accretion during myofiber growth, and ultimately retarded muscle growth. Moreover, reduced BMP signaling diminished the adult satellite cell pool. Abrogation of BMP signaling in satellite cell-derived primary myoblasts strongly diminished cell proliferation and upregulated the expression of cell cycle inhibitors p21 and p57 In conclusion, these results show that BMP signaling defines postnatal muscle development by regulating satellite cell-dependent myofiber growth and the generation of the adult muscle stem cell pool. © 2017. Published by The Company of Biologists Ltd.
Hernández-Ochoa, Erick O.; Schneider, Martin F.
2012-01-01
Skeletal muscle excitation-contraction (E-C)1 coupling is a process composed of multiple sequential stages, by which an action potential triggers sarcoplasmic reticulum (SR)2 Ca2+ release and subsequent contractile activation. The various steps in the E-C coupling process in skeletal muscle can be studied using different techniques. The simultaneous recordings of sarcolemmal electrical signals and the accompanying elevation in myoplasmic Ca2+, due to depolarization-initiated SR Ca2+ release in skeletal muscle fibres, have been useful to obtain a better understanding of muscle function. In studying the origin and mechanism of voltage dependency of E-C coupling a variety of different techniques have been used to control the voltage in adult skeletal fibres. Pioneering work in muscles isolated from amphibians or crustaceans used microelectrodes or ‘high resistance gap’ techniques to manipulate the voltage in the muscle fibres. The development of the patch clamp technique and its variant, the whole-cell clamp configuration that facilitates the manipulation of the intracellular environment, allowed the use of the voltage clamp techniques in different cell types, including skeletal muscle fibres. The aim of this article is to present an historical perspective of the voltage clamp methods used to study skeletal muscle E-C coupling as well as to describe the current status of using the whole-cell patch clamp technique in studies in which the electrical and Ca2+ signalling properties of mouse skeletal muscle membranes are being investigated. PMID:22306655
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2000-01-01
In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....
Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.
2018-04-01
Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.
Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica
2012-01-01
Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134
DEFF Research Database (Denmark)
Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D
2001-01-01
The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...
Worley, Jennings F.; Deitmer, Joachim W.; Nelson, Mark T.
1986-08-01
Single smooth muscle cells were enzymatically isolated from the rabbit mesenteric artery. At physiological levels of external Ca, these cells were relaxed and contracted on exposure to norepinephrine, caffeine, or high levels of potassium. The patch-clamp technique was used to measure unitary currents through single channels in the isolated cells. Single channels were selective for divalent cations and exhibited two conductance levels, 8 pS and 15 pS. Both types of channels were voltage-dependent, and channel activity occurred at potentials positive to -40 mV. The activity of both channel types was almost completely inhibited by 50 nM nisoldipine. These channels appear to be the pathways for voltage-dependent Ca influx in vascular smooth muscle and may be the targets of the clinically used dihydropyridines.
Directory of Open Access Journals (Sweden)
Mesbahus Saleheen
2016-05-01
Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.
Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel
International Nuclear Information System (INIS)
Barchi, R.L.; Tanaka, J.C.
1984-01-01
In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Randolph, Matthew E.; Pavlath, Grace K.
2015-01-01
The human body contains approximately 640 individual skeletal muscles. Despite the fact that all of these muscles are composed of striated muscle tissue, the biology of these muscles and their associated muscle stem cell populations are quite diverse. Skeletal muscles are affected differentially by various muscular dystrophies (MDs), such that certain genetic mutations specifically alter muscle function in only a subset of muscles. Additionally, defective muscle stem cells have been implicated in the pathology of some MDs. The biology of muscle stem cells varies depending on the muscles with which they are associated. Here we review the biology of skeletal muscle stem cell populations of eight different muscle groups. Understanding the biological variation of skeletal muscles and their resident stem cells could provide valuable insight into mechanisms underlying the susceptibility of certain muscles to myopathic disease. PMID:26500547
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.
Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio
2016-11-17
Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.
Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells
International Nuclear Information System (INIS)
Diserbo, M.; Barbier, M.; Quignard, J.F.
1998-01-01
Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)
Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating
Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar
2012-01-01
The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342
Veklich, T O; Mazur, Iu Iu; Kosterin, S O
2015-01-01
Tight control of cytoplasm Ca2+ concentration is essential in cell functioning. Changing of Ca2+ concentration is thorough in smooth muscle cells, because it determines relaxation/constraint process. One of key proteins which control Ca2+ concentration in cytoplasm is Mg2+, ATP-dependent plasma membrane calcium pump. Thus, it is important to find compoumds which allowed one to change Mg2+, ATP-dependent plasma membrane calcium pump activity, as long as this topic is of current interest in biochemical research which regards energy and pharmacomechanical coupling mechanism of muscle excitation and contraction. In this article we generalized literatute and own data about properties of smooth muscle cell plasma membrane Ca(2+)-pump. Stuctural oganization, kinetical properties and molecular biology are considered.
Brun, Juliane; Lutz, Katrin A; Neumayer, Katharina M H; Klein, Gerd; Seeger, Tanja; Uynuk-Ool, Tatiana; Wörgötter, Katharina; Schmid, Sandra; Kraushaar, Udo; Guenther, Elke; Rolauffs, Bernd; Aicher, Wilhelm K; Hart, Melanie L
2015-01-01
The use of mesenchymal stromal cells (MSCs) differentiated toward a smooth muscle cell (SMC) phenotype may provide an alternative for investigators interested in regenerating urinary tract organs such as the bladder where autologous smooth muscle cells cannot be used or are unavailable. In this study we measured the effects of good manufacturing practice (GMP)-compliant expansion followed by myogenic differentiation of human MSCs on the expression of a range of contractile (from early to late) myogenic markers in relation to the electrophysiological parameters to assess the functional role of the differentiated MSCs and found that differentiation of MSCs associated with electrophysiological competence comparable to bladder SMCs. Within 1-2 weeks of myogenic differentiation, differentiating MSCs significantly expressed alpha smooth muscle actin (αSMA; ACTA2), transgelin (TAGLN), calponin (CNN1), and smooth muscle myosin heavy chain (SM-MHC; MYH11) according to qRT-PCR and/or immunofluorescence and Western blot. Voltage-gated Na+ current levels also increased within the same time period following myogenic differentiation. In contrast to undifferentiated MSCs, differentiated MSCs and bladder SMCs exhibited elevated cytosolic Ca2+ transients in response to K+-induced depolarization and contracted in response to K+ indicating functional maturation of differentiated MSCs. Depolarization was suppressed by Cd2+, an inhibitor of voltage-gated Ca2+-channels. The expression of Na+-channels was pharmacologically identified as the Nav1.4 subtype, while the K+ and Ca2+ ion channels were identified by gene expression of KCNMA1, CACNA1C and CACNA1H which encode for the large conductance Ca2+-activated K+ channel BKCa channels, Cav1.2 L-type Ca2+ channels and Cav3.2 T-type Ca2+ channels, respectively. This protocol may be used to differentiate adult MSCs into smooth muscle-like cells with an intermediate-to-late SMC contractile phenotype exhibiting voltage-gated ion channel
Directory of Open Access Journals (Sweden)
Juliane Brun
Full Text Available The use of mesenchymal stromal cells (MSCs differentiated toward a smooth muscle cell (SMC phenotype may provide an alternative for investigators interested in regenerating urinary tract organs such as the bladder where autologous smooth muscle cells cannot be used or are unavailable. In this study we measured the effects of good manufacturing practice (GMP-compliant expansion followed by myogenic differentiation of human MSCs on the expression of a range of contractile (from early to late myogenic markers in relation to the electrophysiological parameters to assess the functional role of the differentiated MSCs and found that differentiation of MSCs associated with electrophysiological competence comparable to bladder SMCs. Within 1-2 weeks of myogenic differentiation, differentiating MSCs significantly expressed alpha smooth muscle actin (αSMA; ACTA2, transgelin (TAGLN, calponin (CNN1, and smooth muscle myosin heavy chain (SM-MHC; MYH11 according to qRT-PCR and/or immunofluorescence and Western blot. Voltage-gated Na+ current levels also increased within the same time period following myogenic differentiation. In contrast to undifferentiated MSCs, differentiated MSCs and bladder SMCs exhibited elevated cytosolic Ca2+ transients in response to K+-induced depolarization and contracted in response to K+ indicating functional maturation of differentiated MSCs. Depolarization was suppressed by Cd2+, an inhibitor of voltage-gated Ca2+-channels. The expression of Na+-channels was pharmacologically identified as the Nav1.4 subtype, while the K+ and Ca2+ ion channels were identified by gene expression of KCNMA1, CACNA1C and CACNA1H which encode for the large conductance Ca2+-activated K+ channel BKCa channels, Cav1.2 L-type Ca2+ channels and Cav3.2 T-type Ca2+ channels, respectively. This protocol may be used to differentiate adult MSCs into smooth muscle-like cells with an intermediate-to-late SMC contractile phenotype exhibiting voltage-gated ion
Simulation of forward dark current voltage characteristics of tandem solar cells
International Nuclear Information System (INIS)
Rubinelli, F.A.
2012-01-01
The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the
Device for monitoring cell voltage
Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE
2012-08-21
A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.
Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle
International Nuclear Information System (INIS)
Sherman, S.J.
1985-01-01
The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik
2018-05-01
Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely
MASTR directs MyoD-dependent satellite cell differentiation during skeletal muscle regeneration
Mokalled, Mayssa H.; Johnson, Aaron N.; Creemers, Esther E.; Olson, Eric N.
2012-01-01
Muscle repair is regulated by satellite cells, adult skeletal muscle stem cells that control muscle regeneration by proliferating and fusing with injured myofibers. MyoD is required for muscle regeneration; however, the mechanisms regulating MyoD expression in satellite cells are unclear. In this study, Olson and colleagues have demonstrated that deletion of MASTR and MRTF-A, two members of the Myocardin family of transcription factors, leads to skeletal muscle regeneration defects and down-r...
Directory of Open Access Journals (Sweden)
Salvador Valle-Reyes
2018-05-01
Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.
Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.
Masetto, S; Weng, T; Valli, P; Correia, M J
1999-06-23
Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Fuel Cell/Electrochemical Cell Voltage Monitor
Vasquez, Arturo
2012-01-01
A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.
DEFF Research Database (Denmark)
Bennekou, P.; Barksmann, T. L.; Christophersen, P.
2006-01-01
The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...
Potassium Chloride Versus Voltage Clamp Contractures in Ventricular Muscle
Morad, M.; Reeck, S.; Rao, M.
1981-01-01
In frog ventricle, developed tension was markedly larger in response to depolarization caused by a voltage clamp step than to depolarization induced by high concentrations of potassium chloride. Measurement of extracellular potassium activity at the surface and at the depth of muscle during the development of contractures showed that the diffusion of potassium is much slower than the spread of depolarization through the cross section of muscle. These two observations suggest that competition between the depolarizing and the negative inotropic effects of an increase in the extracellular potassium ion concentration may determine the time course and magnitude of contractile tension in heart muscle.
Directory of Open Access Journals (Sweden)
Rajeev Gupta
2017-06-01
Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Oxygen dependence of respiration in rat spinotrapezius muscle in situ
Pittman, Roland N.
2012-01-01
The oxygen dependence of respiration in striated muscle in situ was studied by measuring the rate of decrease of interstitial Po2 [oxygen disappearance curve (ODC)] following rapid arrest of blood flow by pneumatic tissue compression, which ejected red blood cells from the muscle vessels and made the ODC independent from oxygen bound to hemoglobin. After the contribution of photo-consumption of oxygen by the method was evaluated and accounted for, the corrected ODCs were converted into the Po2 dependence of oxygen consumption, V̇o2, proportional to the rate of Po2 decrease. Fitting equations obtained from a model of heterogeneous intracellular Po2 were applied to recover the parameters describing respiration in muscle fibers, with a predicted sigmoidal shape for the dependence of V̇o2 on Po2. This curve consists of two regions connected by the point for critical Po2 of the cell (i.e., Po2 at the sarcolemma when the center of the cell becomes anoxic). The critical Po2 was below the Po2 for half-maximal respiratory rate (P50) for the cells. In six muscles at rest, the rate of oxygen consumption was 139 ± 6 nl O2/cm3·s and mitochondrial P50 was k = 10.5 ± 0.8 mmHg. The range of Po2 values inside the muscle fibers was found to be 4–5 mmHg at the critical Po2. The oxygen dependence of respiration can be studied in thin muscles under different experimental conditions. In resting muscle, the critical Po2 was substantially lower than the interstitial Po2 of 53 ± 2 mmHg, a finding that indicates that V̇o2 under this circumstance is independent of oxygen supply and is discordant with the conventional hypothesis of metabolic regulation of the oxygen supply to tissue. PMID:22523254
MASTR directs MyoD-dependent satellite cell differentiation during skeletal muscle regeneration
Mokalled, Mayssa H.; Johnson, Aaron N.; Creemers, Esther E.; Olson, Eric N.
2012-01-01
In response to skeletal muscle injury, satellite cells, which function as a myogenic stem cell population, become activated, expand through proliferation, and ultimately fuse with each other and with damaged myofibers to promote muscle regeneration. Here, we show that members of the Myocardin family of transcriptional coactivators, MASTR and MRTF-A, are up-regulated in satellite cells in response to skeletal muscle injury and muscular dystrophy. Global and satellite cell-specific deletion of MASTR in mice impairs skeletal muscle regeneration. This impairment is substantially greater when MRTF-A is also deleted and is due to aberrant differentiation and excessive proliferation of satellite cells. These abnormalities mimic those associated with genetic deletion of MyoD, a master regulator of myogenesis, which is down-regulated in the absence of MASTR and MRTF-A. Consistent with an essential role of MASTR in transcriptional regulation of MyoD expression, MASTR activates a muscle-specific postnatal MyoD enhancer through associations with MEF2 and members of the Myocardin family. Our results provide new insights into the genetic circuitry of muscle regeneration and identify MASTR as a central regulator of this process. PMID:22279050
The muscle stem cell niche : regulation of satellite cells during regeneration
Boonen, K.J.M.; Post, M.J.
2008-01-01
Satellite cells are considered to be adult skeletal muscle stem cells. Their ability to regenerate large muscle defects is highly dependent on their specific niche. When these cells are cultured in vitro, the loss of this niche leads to a loss of proliferative capacity and defective regeneration
Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing
2014-07-01
Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.
International Nuclear Information System (INIS)
Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming
2013-01-01
Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
Energy Technology Data Exchange (ETDEWEB)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.
MASTR directs MyoD-dependent satellite cell differentiation during skeletal muscle regeneration
Mokalled, Mayssa H.; Johnson, Aaron N.; Creemers, Esther E.; Olson, Eric N.
2012-01-01
In response to skeletal muscle injury, satellite cells, which function as a myogenic stem cell population, become activated, expand through proliferation, and ultimately fuse with each other and with damaged myofibers to promote muscle regeneration. Here, we show that members of the Myocardin family
Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W
2016-02-01
Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.
Rojas, Alejandra; Torres, Mónica; Rojas, J Isela; Feregrino, Angélica; Heimer-de la Cotera, Edgar P
2002-06-01
In the present paper, we describe the results obtained from a preliminary pharmacological and biochemical study of the fire coral Millepora complanata, a regular component of coral reefs in the Mexican Caribbean. The protein-containing crude extract obtained from M. complanata (tested from 0.001 to 1000 microg protein/ml) caused a concentration-dependent stimulation of spontaneous contractions of the guinea pig ileum. The extract (EC(50)=11.55+/-2.36 microg/ml) was approximately 12-fold less potent than ionomycin (EC(50)=0.876+/-0.25 microg/ml) and its maximum induced contraction (1mg protein/ml) was equivalent to 68% of the response to 60mM KCl. FPLC size exclusion chromatography of the M. complanta extract afforded 12 primary fractions, of which only FV (containing proteins with molecular weights ranging from 17 to 44 kDa) and FVIII (consisting of peptides with molecular weights lesser than 1.8k Da) elicited an excitatory effect when tested at the EC(50) of the original extract. After incubation in Ca(2+)-free medium, the ileal response to FV and FVIII was significantly reduced. Blockage of L-type Ca(2+) channels with nifedipine (1 microM) inhibited FV and FVIII-evoked contractions. Cd(2+) (10 microM), an unspecific blocker of voltage-activated calcium channels, also antagonized FV and FVIII-induced effects, whereas the Na(+) channel blocker tetrodotoxin (10nM) did not significantly affect FV and FVIII responses. These results suggest that the contractions induced by the bioactive fractions obtained from the crude extract of M. complanata are caused mainly by a direct action on smooth muscle cells, via an increase in Ca(2+) permeability that occurs, at least partly, through L-type voltage-dependent Ca(2+) channels found in the cell membrane of smooth muscle. Copright 2002 Elsevier Science Ltd.
Induced voltage due to time-dependent magnetisation textures
International Nuclear Information System (INIS)
Kudtarkar, Santosh Kumar; Dhadwal, Renu
2010-01-01
We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
Directory of Open Access Journals (Sweden)
RuiCai Gu
2018-03-01
Full Text Available Background/Aims: Whether calcium/calmodulin-dependent protein kinase IV (CaMKIV plays a role in regulating immunologic features of muscle cells in inflammatory environment, as it does for immune cells, remains mostly unknown. In this study, we investigated the influence of endogenous CaMKIV on the immunological characteristics of myoblasts and myotubes received IFN-γ stimulation. Methods: C2C12 and murine myogenic precursor cells (MPCs were cultured and differentiated in vitro, in the presence of pro-inflammatory IFN-γ. CaMKIV shRNA lentivirus transfection was performed to knockdown CaMKIV gene in C2C12 cells. pEGFP-N1-CaMKIV plasmid was delivered into knockout cells for recovering intracellular CaMKIV gene level. CREB1 antagonist KG-501 was used to block CREB signal. qPCR, immunoblot analysis, or immunofluorescence was used to detect mRNA and protein levels of CaMKIV, immuno-molecules, or pro-inflammatory cytokines and chemokines. Co-stimulatory molecules expression was assessed by FACS analysis. Results: IFN-γ induces the expression or up-regulation of MHC-I/II and TLR3, and the up-regulation of CaMKIV level in muscle cells. In contrast, CaMKIV knockdown in myoblasts and myotubes leads to expression inhibition of the above immuno-molecules. As well, CaMKIV knockdown selectively inhibits pro-inflammatory cytokines/chemokines, and co-stimulatory molecules expression in IFN-γ treated myoblasts and myotubes. Finally, CaMKIV knockdown abolishes IFN-γ induced CREB pathway molecules accumulation in differentiated myotubes. Conclusions: CaMKIV can be induced to up-regulate in muscle cells under inflammatory condition, and positively mediates intrinsic immune behaviors of muscle cells triggered by IFN-γ.
International Nuclear Information System (INIS)
Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.
1994-01-01
In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.
Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer
2013-09-01
Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.
The role of Six1 in muscle progenitor cells and the establishment of fast-twitch muscle fibres
Nord, Hanna
2014-01-01
Myogenesis is the process of skeletal muscle tissue formation where committed muscle progenitor cells differentiate into skeletal muscle fibres. Depending on the instructive cues the muscle progenitor cells receive they will differentiate into specific fibre types with different properties. The skeletal muscle fibres can be broadly classified as fast-twitch fibres or slow-twitch fibres, based on their contractile speed. However, subgroups of fast- and slow-twitch fibres with different metabol...
Bone Marrow Stromal Cells Generate Muscle Cells and Repair Muscle Degeneration
Dezawa, Mari; Ishikawa, Hiroto; Itokazu, Yutaka; Yoshihara, Tomoyuki; Hoshino, Mikio; Takeda, Shin-ichi; Ide, Chizuka; Nabeshima, Yo-ichi
2005-07-01
Bone marrow stromal cells (MSCs) have great potential as therapeutic agents. We report a method for inducing skeletal muscle lineage cells from human and rat general adherent MSCs with an efficiency of 89%. Induced cells differentiated into muscle fibers upon transplantation into degenerated muscles of rats and mdx-nude mice. The induced population contained Pax7-positive cells that contributed to subsequent regeneration of muscle upon repetitive damage without additional transplantation of cells. These MSCs represent a more ready supply of myogenic cells than do the rare myogenic stem cells normally found in muscle and bone marrow.
López López, José Ramón; Fernández Mariño, Ana Isabel; Cidad, Pilar; Zafra, Delia; Nocito, Laura; Domínguez, Jorge; Oliván Viguera, Aida; Köhler, Ralf; Pérez García, María Teresa; Valverde, Miguel Ángel; Guinovart, Joan J.; Fernández Fernández, José Manuel
2015-01-01
Producción Científica Despite the substantial knowledge on the antidiabetic, antiobesity and antihypertensive actions of tungstate, information on its primary target/s is scarce. Tungstate activates both the ERK1/2 pathway and the vascular voltage- and Ca2+-dependent large-conductance BKαβ1 potassium channel, which modulates vascular smooth muscle cell (VSMC) proliferation and function, respectively. Here, we have assessed the possible involvement of BKαβ1 channels in the tungstate-induced...
Cloning and functional expression of a plant voltage-dependent chloride channel.
Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C
1996-01-01
Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442
Mg(2+,ATP-dependent plasma membrane calcium pump of smooth muscle cells. ІІ. Regulation of activity
Directory of Open Access Journals (Sweden)
T. О. Veklich
2015-04-01
Full Text Available Plasma membrane Ca2+-pump is one of key proteins, which takes part in Ca2+ exchange in smooth muscle cells. It has a lot of diverse functions from control of basal cytoplasmal Ca2+ concentration to regulation of proteins involved in Ca2+-dependent signal pathway. Ca2+ pump function is often dependent on the isoform or even form of alternative splicing. Allowing for a variety of Ca2+-pump functions and properties, which were reviewed in detail in the first part of our review article cycle (Ukr. Biochem. J., 2015; 87(1, the precise control of the mentioned pump activity is very important for cell functioning. The other part of this article is dedicated to different regulation factors of smooth muscle plasma membrane Ca2+-pump activity: endogenous and exogenous, biotic and abiotic factors. Special attention is given to literature data and own results about design and the search of selective plasma membrane Ca2+-pump inhibitor which would allow examining its functioning in smooth muscle cells more meticulously.
Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.
Held, Katharina; Voets, Thomas; Vriens, Joris
2016-01-01
Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.
Skeletal muscle Kv7 (KCNQ) channels in myoblast differentiation and proliferation
International Nuclear Information System (INIS)
Roura-Ferrer, Meritxell; Sole, Laura; Martinez-Marmol, Ramon; Villalonga, Nuria; Felipe, Antonio
2008-01-01
Voltage-dependent K + channels (Kv) are involved in myocyte proliferation and differentiation by triggering changes in membrane potential and regulating cell volume. Since Kv7 channels may participate in these events, the purpose of this study was to investigate whether skeletal muscle Kv7.1 and Kv7.5 were involved during proliferation and myogenesis. Here we report that, while myotube formation did not regulate Kv7 channels, Kv7.5 was up-regulated during cell cycle progression. Although, Kv7.1 mRNA also increased during the G 1 -phase, pharmacological evidence mainly involves Kv7.5 in myoblast growth. Our results indicate that the cell cycle-dependent expression of Kv7.5 is involved in skeletal muscle cell proliferation
Quercetin inhibits adipogenesis of muscle progenitor cells in vitro
Directory of Open Access Journals (Sweden)
Tomoko Funakoshi
2018-03-01
Full Text Available Muscle satellite cells are committed myogenic progenitors capable of contributing to myogenesis to maintain adult muscle mass and function. Several experiments have demonstrated that muscle satellite cells can differentiate into adipocytes in vitro, supporting the mesenchymal differentiation potential of these cells. Moreover, muscle satellite cells may be a source of ectopic muscle adipocytes, explaining the lipid accumulation often observed in aged skeletal muscle (sarcopenia and in muscles of patients` with diabetes. Quercetin, a polyphenol, is one of the most abundant flavonoids distributed in edible plants, such as onions and apples, and possesses antioxidant, anticancer, and anti-inflammatory properties. In this study, we examined whether quercetin inhibited the adipogenesis of muscle satellite cells in vitro with primary cells from rat limbs by culture in the presence of quercetin under adipogenic conditions. Morphological observations, Oil Red-O staining results, triglyceride content analysis, and quantitative reverse transcription polymerase chain reaction revealed that quercetin was capable of inhibiting the adipogenic induction of muscle satellite cells into adipocytes in a dose-dependent manner by suppressing the transcript levels of adipogenic markers, such as peroxisome proliferator-activated receptor-γ and fatty acid binding protein 4. Our results suggested that quercetin inhibited the adipogenesis of muscle satellite cells in vitro by suppressing the transcription of adipogenic markers. Keywords: Quercetin, Muscle satellite cell, Differentiation, Intramuscular lipid
Directory of Open Access Journals (Sweden)
Sameera Dharia
2011-02-01
Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Dharia, Sameera; Rabbitt, Richard D
2011-02-28
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.
Robson, L; Hunter, M
1999-01-01
The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159
Charge movement and depolarization-contraction coupling in arthropod vs. vertebrate skeletal muscle.
Scheuer, T; Gilly, W F
1986-01-01
Voltage-dependent charge movement has been characterized in arthropod skeletal muscle. Charge movement in scorpion (Centuroides sculpturatus) muscle is distinguishable from that in vertebrate skeletal muscle by criteria of kinetics, voltage dependence, and pharmacology. The function of scorpion charge movement is gating of calcium channels in the sarcolemma, and depolarization-contraction coupling relies on calcium influx through these channels.
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Injectable biomimetic liquid crystalline scaffolds enhance muscle stem cell transplantation
Sleep, Eduard; McClendon, Mark T.; Preslar, Adam T.; Chen, Charlotte H.; Sangji, M. Hussain; Pérez, Charles M. Rubert; Haynes, Russell D.; Meade, Thomas J.; Blau, Helen M.; Stupp, Samuel I.
2017-01-01
Muscle stem cells are a potent cell population dedicated to efficacious skeletal muscle regeneration, but their therapeutic utility is currently limited by mode of delivery. We developed a cell delivery strategy based on a supramolecular liquid crystal formed by peptide amphiphiles (PAs) that encapsulates cells and growth factors within a muscle-like unidirectionally ordered environment of nanofibers. The stiffness of the PA scaffolds, dependent on amino acid sequence, was found to determine the macroscopic degree of cell alignment templated by the nanofibers in vitro. Furthermore, these PA scaffolds support myogenic progenitor cell survival and proliferation and they can be optimized to induce cell differentiation and maturation. We engineered an in vivo delivery system to assemble scaffolds by injection of a PA solution that enabled coalignment of scaffold nanofibers with endogenous myofibers. These scaffolds locally retained growth factors, displayed degradation rates matching the time course of muscle tissue regeneration, and markedly enhanced the engraftment of muscle stem cells in injured and noninjured muscles in mice. PMID:28874575
Directory of Open Access Journals (Sweden)
Seok-Yong Lee
2009-03-01
Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
Dirja, Bayu Tirta; Yoshie, Susumu; Ikeda, Masakazu; Imaizumi, Mitsuyoshi; Nakamura, Ryosuke; Otsuki, Koshi; Nomoto, Yukio; Wada, Ikuo; Hazama, Akihiro; Omori, Koichi
2016-01-01
Conclusion Induced pluripotent stem (iPS) cells may be a new potential cell source for laryngeal muscle regeneration in the treatment of vocal fold atrophy after recurrent laryngeal nerve paralysis. Objectives Unilateral vocal fold paralysis can lead to degeneration, atrophy, and loss of force of the thyroarytenoid muscle. At present, there are some treatments such as thyroplasty, arytenoid adduction, and vocal fold injection. However, such treatments cannot restore reduced mass of the thyroarytenoid muscle. iPS cells have been recognized as supplying a potential resource for cell transplantation. The aim of this study was to assess the effectiveness of the use of iPS cells for the regeneration of laryngeal muscle through the evaluation of both in vitro and in vivo experiments. Methods Skeletal muscle cells were generated from tdTomato-labeled iPS cells using embryoid body formation. Differentiation into skeletal muscle cells was analyzed by gene expression and immunocytochemistry. The tdTomato-labeled iPS cell-derived skeletal muscle cells were transplanted into the left atrophied thyroarytenoid muscle. To evaluate the engraftment of these cells after transplantation, immunohistochemistry was performed. Results The tdTomato-labeled iPS cells were successfully differentiated into skeletal muscle cells through an in vitro experiment. These cells survived in the atrophied thyroarytenoid muscle after transplantation.
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-01-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact
Effective fiber hypertrophy in satellite cell-depleted skeletal muscle
McCarthy, John J.; Mula, Jyothi; Miyazaki, Mitsunori; Erfani, Rod; Garrison, Kelcye; Farooqui, Amreen B.; Srikuea, Ratchakrit; Lawson, Benjamin A.; Grimes, Barry; Keller, Charles; Van Zant, Gary; Campbell, Kenneth S.; Esser, Karyn A.; Dupont-Versteegden, Esther E.; Peterson, Charlotte A.
2011-01-01
An important unresolved question in skeletal muscle plasticity is whether satellite cells are necessary for muscle fiber hypertrophy. To address this issue, a novel mouse strain (Pax7-DTA) was created which enabled the conditional ablation of >90% of satellite cells in mature skeletal muscle following tamoxifen administration. To test the hypothesis that satellite cells are necessary for skeletal muscle hypertrophy, the plantaris muscle of adult Pax7-DTA mice was subjected to mechanical overload by surgical removal of the synergist muscle. Following two weeks of overload, satellite cell-depleted muscle showed the same increases in muscle mass (approximately twofold) and fiber cross-sectional area with hypertrophy as observed in the vehicle-treated group. The typical increase in myonuclei with hypertrophy was absent in satellite cell-depleted fibers, resulting in expansion of the myonuclear domain. Consistent with lack of nuclear addition to enlarged fibers, long-term BrdU labeling showed a significant reduction in the number of BrdU-positive myonuclei in satellite cell-depleted muscle compared with vehicle-treated muscle. Single fiber functional analyses showed no difference in specific force, Ca2+ sensitivity, rate of cross-bridge cycling and cooperativity between hypertrophied fibers from vehicle and tamoxifen-treated groups. Although a small component of the hypertrophic response, both fiber hyperplasia and regeneration were significantly blunted following satellite cell depletion, indicating a distinct requirement for satellite cells during these processes. These results provide convincing evidence that skeletal muscle fibers are capable of mounting a robust hypertrophic response to mechanical overload that is not dependent on satellite cells. PMID:21828094
Brachial artery protected by wrapped latissimus dorsi muscle flap in high voltage electrical injury
Gencel, E.; Eser, C.; Kokacya, O.; Kesiktas, E.; Yavuz, M.
2016-01-01
Summary High voltage electrical injury can disrupt the vascular system and lead to extremity amputations. It is important to protect main vessels from progressive burn necrosis in order to salvage a limb. The brachial artery should be totally isolated from the burned area by a muscle flap to prevent vessel disruption. In this study, we report the use of a wrap-around latissimus dorsi muscle flap to protect a skeletonized brachial artery in a high voltage electrical injury in order to salvage the upper extremity and restore function. The flap wrapped around the exposed brachial artery segment and luminal status of the artery was assessed using magnetic resonance angiography. No vascular intervention was required. The flap survived completely with good elbow function. Extremity amputation was not encountered. This method using a latissimus dorsi flap allows the surgeon to protect the main upper extremity artery and reconstruct arm defects, which contributes to restoring arm function in high voltage electrical injury. PMID:28149236
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Olivera, J Fernando; Pizarro, Gonzalo
2016-10-01
Raising the intracellular [Ca 2+ ] ([Ca 2+ ] i ) was previously found to produce uncoupling between the electrical depolarization of the transverse tubules and contraction in skinned muscle fibers. Here we study the effect of elevated [Ca 2+ ] i in voltage clamped cut fibers of frog skeletal muscle to establish how the charge movement, a measure of the activation of the dihydropyridine receptors (DHPR)-voltage sensors, and Ca 2+ release, a consequence of the opening of the ryanodine receptor (RyR)-release channels, were affected. [Ca 2+ ] i was raised by various procedures (pharmacological release from the sarcoplasmic reticulum, application of high [Ca 2+ ] i intracellular solution, permeabilization of the plasma membrane by a Ca 2+ ionophore) all of which produced impairment of excitation-contraction coupling. The charge movement was reduced from 20.2 ± 1.24 to 9.9 ± 0.94 nC/μF meanwhile the Ca 2+ release flux was reduced from 13.5 + 0.7 to 2.2 ± 0.3 μM/ms (n = 33). This suggests that a significant fraction of the DHPRs that remained functional, could not activate RyRs, and were therefore presumably disconnected. These results are broadly consistent with the original reports in skinned fibers. Uncoupling was prevented by the addition to the intracellular solution of the protease inhibitor leupeptin. In approximately 40 % of the uncoupled cells we observed that the [Ca 2+ ] i transient continued to rise after the voltage clamp pulse was turned off. This loss of control by membrane voltage suggests that the uncoupled release channels might have another mechanism of activation, likely by Ca 2+ .
Dharia, Sameera; Rabbitt, Richard D.
2011-01-01
Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...
Regulation of KV channel voltage-dependent activation by transmembrane β subunits
Directory of Open Access Journals (Sweden)
Xiaohui eSun
2012-04-01
Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.
Energy Technology Data Exchange (ETDEWEB)
Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)
2010-12-15
We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)
Akt1 deficiency diminishes skeletal muscle hypertrophy by reducing satellite cell proliferation.
Moriya, Nobuki; Miyazaki, Mitsunori
2018-02-14
Skeletal muscle mass is determined by the net dynamic balance between protein synthesis and degradation. Although the Akt/mechanistic target of rapamycin (mTOR)-dependent pathway plays an important role in promoting protein synthesis and subsequent skeletal muscle hypertrophy, the precise molecular regulation of mTOR activity by the upstream protein kinase Akt is largely unknown. In addition, the activation of satellite cells has been indicated as a key regulator of muscle mass. However, the requirement of satellite cells for load-induced skeletal muscle hypertrophy is still under intense debate. In this study, female germline Akt1 knockout (KO) mice were used to examine whether Akt1 deficiency attenuates load-induced skeletal muscle hypertrophy through suppressing mTOR-dependent signaling and satellite cell proliferation. Akt1 KO mice showed a blunted hypertrophic response of skeletal muscle, with a diminished rate of satellite cell proliferation following mechanical overload. In contrast, Akt1 deficiency did not affect the load-induced activation of mTOR signaling and the subsequent enhanced rate of protein synthesis in skeletal muscle. These observations suggest that the load-induced activation of mTOR signaling occurs independently of Akt1 regulation and that Akt1 plays a critical role in regulating satellite cell proliferation during load-induced muscle hypertrophy.
Inherent rhythm of smooth muscle cells in rat mesenteric arterioles: An eigensystem formulation
Ho, I. Lin; Moshkforoush, Arash; Hong, Kwangseok; Meininger, Gerald A.; Hill, Michael A.; Tsoukias, Nikolaos M.; Kuo, Watson
2016-04-01
On the basis of experimental data and mathematical equations in the literature, we remodel the ionic dynamics of smooth muscle cells (SMCs) as an eigensystem formulation, which is valid for investigating finite variations of variables from the equilibrium such as in common experimental operations. This algorithm provides an alternate viewpoint from frequency-domain analysis and enables one to probe functionalities of SMCs' rhythm by means of a resonance-related mechanism. Numerical results show three types of calcium oscillations of SMCs in mesenteric arterioles: spontaneous calcium oscillation, agonist-dependent calcium oscillation, and agonist-dependent calcium spike. For simple single and double SMCs, we demonstrate properties of synchronization among complex signals related to calcium oscillations, and show different correlation relations between calcium and voltage signals for various synchronization and resonance conditions. For practical cell clusters, our analyses indicate that the rhythm of SMCs could (1) benefit enhancements of signal communications among remote cells, (2) respond to a significant calcium peaking against transient stimulations for triggering globally oscillating modes, and (3) characterize the globally oscillating modes via frog-leap (non-molecular-diffusion) calcium waves across inhomogeneous SMCs.
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Autonomous Voltage Oscillations in a Direct Methanol Fuel Cell
International Nuclear Information System (INIS)
Nogueira, Jéssica A.; Peña Arias, Ivonne K.; Hanke-Rauschenbach, Richard; Vidakovic-Koch, Tanja; Varela, Hamilton; Sundmacher, Kai
2016-01-01
Proton exchange membrane fuel cells fed with H_2/CO mixtures at the anode have a considerably lower performance than fuel cells fed with pure hydrogen. However, when operated in an autonomous oscillatory regime, the overall voltage loss decreases due to a self-cleaning mechanism. Another molecule, also widely used as feed in the fuel cell and susceptible to kinetic instabilities, is methanol. To the best of our knowledge, there are no reports on autonomous voltage oscillations in the direct methanol fuel cell (DMFC). The purpose of this work was to explore if such instabilities also occur in the DMFC system. Initially, half-cell experiments with a gas diffusion electrode were performed. Then, a DMFC was operated under current control and studied by means of electrochemical impedance spectroscopy. The half-cell measurements revealed that the induction period for oscillations depends on the mass transfer conditions, where on stagnant electrode the induction time was shorter than in the case of forced convection. The DMFC showed also autonomous voltage oscillations above a certain threshold current. The results obtained by electrochemical impedance spectroscopy give evidence of a negative differential resistance in the fuel cell, hitherto not described in the literature, which can be related to the appearance of oscillations during galvanostatic methanol electro-oxidation. These results open the possibility to evaluate the performance of low-temperature fuel cells fed with carbon-containing fuels under oscillatory operating conditions.
Zhang, Rong; Jack, Gregory S; Rao, Nagesh; Zuk, Patricia; Ignarro, Louis J; Wu, Benjamin; Rodríguez, Larissa V
2012-03-01
Human adipose-derived stem cells hASC have been isolated and were shown to have multilineage differentiation capacity. Although both plasticity and cell fusion have been suggested as mechanisms for cell differentiation in vivo, the effect of the local in vivo environment on the differentiation of adipose-derived stem cells has not been evaluated. We previously reported the in vitro capacity of smooth muscle differentiation of these cells. In this study, we evaluate the effect of an in vivo smooth muscle environment in the differentiation of hASC. We studied this by two experimental designs: (a) in vivo evaluation of smooth muscle differentiation of hASC injected into a smooth muscle environment and (b) in vitro evaluation of smooth muscle differentiation capacity of hASC exposed to bladder smooth muscle cells. Our results indicate a time-dependent differentiation of hASC into mature smooth muscle cells when these cells are injected into the smooth musculature of the urinary bladder. Similar findings were seen when the cells were cocultured in vitro with primary bladder smooth muscle cells. Chromosomal analysis demonstrated that microenvironment cues rather than nuclear fusion are responsible for this differentiation. We conclude that cell plasticity is present in hASCs, and their differentiation is accomplished in the absence of nuclear fusion. Copyright © 2011 AlphaMed Press.
Hanke, Nina; Scheibe, Renate J; Manukjan, Georgi; Ewers, David; Umeda, Patrick K; Chang, Kin-Chow; Kubis, Hans-Peter; Gros, Gerolf; Meissner, Joachim D
2011-03-01
Adaptations in the oxidative capacity of skeletal muscle cells can occur under several physiological or pathological conditions. We investigated the effect of increasing extracellular glucose concentration on the expression of markers of energy metabolism in primary skeletal muscle cells and the C2C12 muscle cell line. Growth of myotubes in 25mM glucose (high glucose, HG) compared with 5.55mM led to increases in the expression and activity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a marker of glycolytic energy metabolism, while oxidative markers peroxisome proliferator-activated receptor γ coactivator 1α and citrate synthase decreased. HG induced metabolic adaptations as are seen during a slow-to-fast fiber transformation. Furthermore, HG increased fast myosin heavy chain (MHC) IId/x but did not change slow MHCI/β expression. Protein phosphatase 2A (PP2A) was shown to mediate the effects of HG on GAPDH and MHCIId/x. Carbohydrate response element-binding protein (ChREBP), a glucose-dependent transcription factor downstream of PP2A, partially mediated the effects of glucose on metabolic markers. The glucose-induced increase in PP2A activity was associated with an increase in p38 mitogen-activated protein kinase activity, which presumably mediates the increase in MHCIId/x promoter activity. Liver X receptor, another possible mediator of glucose effects, induced only an incomplete metabolic shift, mainly increasing the expression of the glycolytic marker. Taken together, HG induces a partial slow-to-fast transformation comprising metabolic enzymes together with an increased expression of MHCIId/x. This work demonstrates a functional role for ChREBP in determining the metabolic type of muscle fibers and highlights the importance of glucose as a signaling molecule in muscle. Copyright © 2011 Elsevier B.V. All rights reserved.
Site-dependent distribution of macrophages in normal human extraocular muscles
Schmidt, E. D.; van der Gaag, R.; Mourits, M. P.; Koornneef, L.
1993-01-01
PURPOSE: Clinical data indicate that extraocular muscles have different susceptibilities for some orbital immune disorders depending on their anatomic location. The resident immunocompetent cells may be important mediators in the local pathogenesis of such disorders so the distribution of these
Oxygen dependence of respiration in rat spinotrapezius muscle in situ
Golub, Aleksander S.; Pittman, Roland N.
2012-01-01
The oxygen dependence of respiration in striated muscle in situ was studied by measuring the rate of decrease of interstitial Po2 [oxygen disappearance curve (ODC)] following rapid arrest of blood flow by pneumatic tissue compression, which ejected red blood cells from the muscle vessels and made the ODC independent from oxygen bound to hemoglobin. After the contribution of photo-consumption of oxygen by the method was evaluated and accounted for, the corrected ODCs were converted into the Po...
Energy Technology Data Exchange (ETDEWEB)
Lee, Nam Woo [Fuel Cell Technology Development Team, Eco-Technology Center, Hyundai-Kia Motors, Yongin (Korea, Republic of); Kim, Young Sang; Kim, Min Soo [Dept. of Mechanical and Aerospace Engineering, Seoul National University, Seoul (Korea, Republic of); Kim, Min Sung [School of Energy Systems Engineering, Chung-Ang University, Seoul (Korea, Republic of)
2016-09-15
Decreasing the voltage of a fuel cell through hydrogen mixing or using low-air stoichiometry ratio is beneficial to remove condensed water inside GDL under flooding condition. In this study, the effect of voltage level of a fuel cell on water distribution in GDL under flooding condition was numerically analyzed. Water content in GDL was dependent on the voltage level of a fuel cell, that is, the water content was low when the cell voltage was maintained low. The effect of voltage change under flooding condition was also simulated. The flow rate of condensed water inside GDL considerably increased immediately after decreasing the cell voltage. The oxygen concentration in the catalyst layer was increased by decreasing the voltage of the fuel cell. Consequently, the cell voltage was recovered. Therefore, decreasing cell voltage under flooding condition can facilitate removal of condensed water in GDL.
Directory of Open Access Journals (Sweden)
Stefanie eKnappe
2015-08-01
Full Text Available Muscle regeneration in vertebrates occurs by the activation of quiescent progenitor cells that express pax7 and replace and repair damaged fibers. We have developed a mechanical injury paradigm in zebrafish to determine whether developmental stage and injury size affect the regeneration dynamics of damaged muscle. We found that both small, focal injuries and large injuries affecting the entire myotome lead to the expression of myf5 and myogenin. Their expression was prolonged in older larvae, indicating a slower process of regeneration. We characterized the endogenous behavior of a population of muscle-resident Pax7-expressing cells using a pax7a:eGFP transgenic line and found that GFP+ cell migration in the myotome dramatically declined between 5 and 7 days post fertilization (dpf. Following a small injury, we observed that GFP+ cells responded by extending processes, before migrating to the injured fibers. Furthermore, these cells responded more rapidly to injury in 4dpf larvae compared to 7dpf. Interestingly, we did not see GFP+ fibers after repair of small injuries, indicating that pax7a-expressing cells did not contribute to fiber formation in this injury context. On the contrary, numerous GFP+ fibers could be observed after a large single myotome injury. Both injury models were accompanied by an increased number of proliferating GFP+ cells, which was more pronounced in larvae injured at 4dpf than 7dpf, This indicates intriguing developmental differences, even at these relatively early ages. Our data also suggests an interesting disparity in the role that pax7a-expressing muscle progenitor cells play during muscle regeneration, which may reflect the extent of muscle damage.
Fernandez, Fernando R.; Malerba, Paola; White, John A.
2015-01-01
The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971
Energy Technology Data Exchange (ETDEWEB)
Boix, Pablo P.; Guerrero, Antonio; Garcia-Belmonte, Germa; Bisquert, Juan [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain); Marchesi, Luis F. [Laboratorio Interdisciplinar de, Eletroquimica e Ceramica (LIEC), Universidade Federal de Sao Carlos (Brazil); Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain)
2011-11-15
A connection is established between recombination and series resistances extracted from impedance spectroscopy and current-voltage curves of polythiophene:fullerene organic solar cells. Recombination is shown to depend exclusively on the (Fermi level) voltage, which allows construction of the current-voltage characteristics in any required conditions based on a restricted set of measurements. The analysis highlights carrier recombination current as the determining mechanism of organic solar cell performance. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
β-adrenergic relaxation of smooth muscle: differences between cells and tissues
International Nuclear Information System (INIS)
Scheid, C.R.
1987-01-01
The present studies were carried out in an attempt to resolve the controversy about the Na + dependence of β-adrenergic relaxation in smooth muscle. Previous studies on isolated smooth muscle cells from the toad stomach had suggested that at least some of the actions of β-adrenergic agents, including a stimulatory effect on 45 Ca efflux, were dependent on the presence of a normal transmembrane Na + gradient. Studies by other investigators using tissues derived from mammalian sources had suggested that the relaxing effect of β-adrenergic agents was Na + independent. Uncertainty remained as to whether these discrepancies reflected differences between cells and tissues or differences between species. Thus, in the present studies, the authors utilized both tissues and cells from the same source, the stomach muscle of the toad Bufo marinus, and assessed the Na + dependence of β-adrenergic relaxation. They found that elimination of a normal Na + gradient abolished β-adrenergic relaxation of isolated cells. In tissues, however, similar manipulations had no effect on relaxation. The reasons for this discrepancy are unclear but do not appear to be attributable to changes in smooth muscle function following enzymatic dispersion. Thus the controversy concerning the mechanisms of β-adrenergic relaxation may reflect inherent differences between tissues and cells
DEFF Research Database (Denmark)
André, F M; Gehl, J; Sersa, G
2008-01-01
Gene electrotransfer is gaining momentum as an efficient methodology for nonviral gene transfer. In skeletal muscle, data suggest that electric pulses play two roles: structurally permeabilizing the muscle fibers and electrophoretically supporting the migration of DNA toward or across the permeab......Gene electrotransfer is gaining momentum as an efficient methodology for nonviral gene transfer. In skeletal muscle, data suggest that electric pulses play two roles: structurally permeabilizing the muscle fibers and electrophoretically supporting the migration of DNA toward or across...... the permeabilized membrane. To investigate this further, combinations of permeabilizing short high-voltage pulses (HV; hundreds of V/cm) and mainly electrophoretic long low-voltage pulses (LV; tens of V/cm) were investigated in muscle, liver, tumor, and skin in rodent models. The following observations were made......, but not to liver; and (4) efficient gene electrotransfer was achieved with HV field strengths below the detectability thresholds for permeabilization; and (5) the lag time interval between the HV and LV pulses decreased sensitivity to the HV pulses, enabling a wider HV amplitude range. In conclusion, HV plus LV...
Satellite Cells and the Muscle Stem Cell Niche
Yin, Hang; Price, Feodor
2013-01-01
Adult skeletal muscle in mammals is a stable tissue under normal circumstances but has remarkable ability to repair after injury. Skeletal muscle regeneration is a highly orchestrated process involving the activation of various cellular and molecular responses. As skeletal muscle stem cells, satellite cells play an indispensible role in this process. The self-renewing proliferation of satellite cells not only maintains the stem cell population but also provides numerous myogenic cells, which proliferate, differentiate, fuse, and lead to new myofiber formation and reconstitution of a functional contractile apparatus. The complex behavior of satellite cells during skeletal muscle regeneration is tightly regulated through the dynamic interplay between intrinsic factors within satellite cells and extrinsic factors constituting the muscle stem cell niche/microenvironment. For the last half century, the advance of molecular biology, cell biology, and genetics has greatly improved our understanding of skeletal muscle biology. Here, we review some recent advances, with focuses on functions of satellite cells and their niche during the process of skeletal muscle regeneration. PMID:23303905
Skeletal Muscle Cell Induction from Pluripotent Stem Cells
Directory of Open Access Journals (Sweden)
Yusaku Kodaka
2017-01-01
Full Text Available Embryonic stem cells (ESCs and induced pluripotent stem cells (iPSCs have the potential to differentiate into various types of cells including skeletal muscle cells. The approach of converting ESCs/iPSCs into skeletal muscle cells offers hope for patients afflicted with the skeletal muscle diseases such as the Duchenne muscular dystrophy (DMD. Patient-derived iPSCs are an especially ideal cell source to obtain an unlimited number of myogenic cells that escape immune rejection after engraftment. Currently, there are several approaches to induce differentiation of ESCs and iPSCs to skeletal muscle. A key to the generation of skeletal muscle cells from ESCs/iPSCs is the mimicking of embryonic mesodermal induction followed by myogenic induction. Thus, current approaches of skeletal muscle cell induction of ESCs/iPSCs utilize techniques including overexpression of myogenic transcription factors such as MyoD or Pax3, using small molecules to induce mesodermal cells followed by myogenic progenitor cells, and utilizing epigenetic myogenic memory existing in muscle cell-derived iPSCs. This review summarizes the current methods used in myogenic differentiation and highlights areas of recent improvement.
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Directory of Open Access Journals (Sweden)
Daniel J Ham
Full Text Available Dietary L-citrulline is thought to modulate muscle protein turnover by increasing L-arginine availability. To date, the direct effects of increased L-citrulline concentrations in muscle have been completely neglected. Therefore, we determined the role of L-citrulline in regulating cell size during catabolic conditions by depriving mature C2C12 myotubes of growth factors (serum free; SF or growth factors and nutrients (HEPES buffered saline; HBS. Cells were treated with L-citrulline or equimolar concentrations of L-arginine (positive control or L-alanine (negative control and changes in cell size and protein turnover were assessed. In myotubes incubated in HBS or SF media, L-citrulline improved rates of protein synthesis (HBS: +63%, SF: +37% and myotube diameter (HBS: +18%, SF: +29%. L-citrulline treatment substantially increased iNOS mRNA expression (SF: 350%, HBS: 750%. The general NOS inhibitor L-NAME and the iNOS specific inhibitor aminoguanidine prevented these effects in both models. Depriving myotubes in SF media of L-arginine or L-leucine, exacerbated wasting which was not attenuated by L-citrulline. The increased iNOS mRNA expression was temporally associated with increases in mRNA of the endogenous antioxidants SOD1, SOD3 and catalase. Furthermore, L-citrulline prevented inflammation (LPS and oxidative stress (H2O2 induced muscle cell wasting. In conclusion, we demonstrate a novel direct protective effect of L-citrulline on skeletal muscle cell size independent of L-arginine that is mediated through induction of the inducible NOS (iNOS isoform. This discovery of a nutritional modulator of iNOS mRNA expression in skeletal muscle cells could have substantial implications for the treatment of muscle wasting conditions.
Nanosecond electric pulses modulate skeletal muscle calcium dynamics and contraction
Valdez, Chris; Jirjis, Michael B.; Roth, Caleb C.; Barnes, Ronald A.; Ibey, Bennett L.
2017-02-01
Irreversible electroporation therapy is utilized to remove cancerous tissues thru the delivery of rapid (250Hz) and high voltage (V) (1,500V/cm) electric pulses across microsecond durations. Clinical research demonstrated that bipolar (BP) high voltage microsecond pulses opposed to monophasic waveforms relieve muscle contraction during electroporation treatment. Our group along with others discovered that nanosecond electric pulses (nsEP) can activate second messenger cascades, induce cytoskeletal rearrangement, and depending on the nsEP duration and frequency, initiate apoptotic pathways. Of high interest across in vivo and in vitro applications, is how nsEP affects muscle physiology, and if nuances exist in comparison to longer duration electroporation applications. To this end, we exposed mature skeletal muscle cells to monopolar (MP) and BP nsEP stimulation across a wide range of electric field amplitudes (1-20 kV/cm). From live confocal microscopy, we simultaneously monitored intracellular calcium dynamics along with nsEP-induced muscle movement on a single cell level. In addition, we also evaluated membrane permeability with Yo-PRO-1 and Propidium Iodide (PI) across various nsEP parameters. The results from our findings suggest that skeletal muscle calcium dynamics, and nsEP-induced contraction exhibit exclusive responses to both MP and BP nsEP exposure. Overall the results suggest in vivo nsEP application may elicit unique physiology and field applications compared to longer pulse duration electroporation.
Increased voltage photovoltaic cell
Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)
1985-01-01
A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.
Wide Operating Voltage Range Fuel Cell Battery Charger
DEFF Research Database (Denmark)
Hernandez Botella, Juan Carlos; Mira Albert, Maria del Carmen; Sen, Gokhan
2014-01-01
DC-DC converters for fuel cell applications require wide voltage range operation due to the unique fuel cell characteristic curve. Primary parallel isolated boost converter (PPIBC) is a boost derived topology for low voltage high current applications reaching an efficiency figure up to 98...... by two the converter input-to-output voltage gain. This allows covering the conditions when the fuel cell stack operates in the activation region (maximum output voltage) and increases the degrees of freedom for converter optimization. The transition between operating modes is studied because represents...
Yang, Jinjuan; Liu, Hao; Wang, Kunfu; Li, Lu; Yuan, Hongyi; Liu, Xueting; Liu, Yingjie; Guan, Weijun
2017-12-01
Skeletal muscle has a huge regenerative potential for postnatal muscle growth and repair, which mainly depends on a kind of muscle progenitor cell population, called satellite cell. Nowadays, the majority of satellite cells were obtained from human, mouse, rat and other animals but rarely from pig. In this article, the porcine skeletal muscle satellite cells were isolated and cultured in vitro. The expression of surface markers of satellite cells was detected by immunofluorescence and RT-PCR assays. The differentiation capacity was assessed by inducing satellite cells into adipocytes, myoblasts and osteoblasts. The results showed that satellite cells isolated from porcine tibialis anterior were subcultured up to 12 passages and were positive for Pax7, Myod, c-Met, desmin, PCNA and NANOG but were negative for Myogenin. Satellite cells were also induced to differentiate into adipocytes, osteoblasts and myoblasts, respectively. These findings indicated that porcine satellite cells possess similar biological characteristics of stem cells, which may provide theoretical basis and experimental evidence for potential therapeutic application in the treatment of dystrophic muscle and other muscle injuries.
Carrasco, Dario I; Vincent, Jacob A; Cope, Timothy C
2017-04-01
Knowledge of the molecular mechanisms underlying signaling of mechanical stimuli by muscle spindles remains incomplete. In particular, the ionic conductances that sustain tonic firing during static muscle stretch are unknown. We hypothesized that tonic firing by spindle afferents depends on sodium persistent inward current (INaP) and tested for the necessary presence of the appropriate voltage-gated sodium (NaV) channels in primary sensory endings. The NaV 1.6 isoform was selected for both its capacity to produce INaP and for its presence in other mechanosensors that fire tonically. The present study shows that NaV 1.6 immunoreactivity (IR) is concentrated in heminodes, presumably where tonic firing is generated, and we were surprised to find NaV 1.6 IR strongly expressed also in the sensory terminals, where mechanotransduction occurs. This spatial pattern of NaV 1.6 IR distribution was consistent for three mammalian species (rat, cat, and mouse), as was tonic firing by primary spindle afferents. These findings meet some of the conditions needed to establish participation of INaP in tonic firing by primary sensory endings. The study was extended to two additional NaV isoforms, selected for their sensitivity to TTX, excluding TTX-resistant NaV channels, which alone are insufficient to support firing by primary spindle endings. Positive immunoreactivity was found for NaV 1.1 , predominantly in sensory terminals together with NaV 1.6 and for NaV 1.7 , mainly in preterminal axons. Differential distribution in primary sensory endings suggests specialized roles for these three NaV isoforms in the process of mechanosensory signaling by muscle spindles. NEW & NOTEWORTHY The molecular mechanisms underlying mechanosensory signaling responsible for proprioceptive functions are not completely elucidated. This study provides the first evidence that voltage-gated sodium channels (NaVs) are expressed in the spindle primary sensory ending, where NaVs are found at every site
Vector spin modeling for magnetic tunnel junctions with voltage dependent effects
International Nuclear Information System (INIS)
Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.
2014-01-01
Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors
Directory of Open Access Journals (Sweden)
Salmela Iikka
2012-08-01
Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.
Muscle Satellite Cell Protein Teneurin‐4 Regulates Differentiation During Muscle Regeneration
Ishii, Kana; Suzuki, Nobuharu; Mabuchi, Yo; Ito, Naoki; Kikura, Naomi; Fukada, So‐ichiro; Okano, Hideyuki; Takeda, Shin'ichi
2015-01-01
Abstract Satellite cells are maintained in an undifferentiated quiescent state, but during muscle regeneration they acquire an activated stage, and initiate to proliferate and differentiate as myoblasts. The transmembrane protein teneurin‐4 (Ten‐4) is specifically expressed in the quiescent satellite cells; however, its cellular and molecular functions remain unknown. We therefore aimed to elucidate the function of Ten‐4 in muscle satellite cells. In the tibialis anterior (TA) muscle of Ten‐4‐deficient mice, the number and the size of myofibers, as well as the population of satellite cells, were reduced with/without induction of muscle regeneration. Furthermore, we found an accelerated activation of satellite cells in the regenerated Ten‐4‐deficient TA muscle. The cell culture analysis using primary satellite cells showed that Ten‐4 suppressed the progression of myogenic differentiation. Together, our findings revealed that Ten‐4 functions as a crucial player in maintaining the quiescence of muscle satellite cells. Stem Cells 2015;33:3017–3027 PMID:26013034
Czech Academy of Sciences Publication Activity Database
Rubio Ayala, M.; Syrovets, T.; Hafner, S.; Zablotskyy, Vitaliy A.; Dejneka, Alexandr; Simmet, T.
2018-01-01
Roč. 163, May (2018), s. 174-184 ISSN 0142-9612 Institutional support: RVO:68378271 Keywords : alternating magnetic field * skeletal muscle * cytosolic calcium * modeling * eddy current * voltage-gated sodium channels Subject RIV: BO - Biophysics OBOR OECD: Biophysics Impact factor: 8.402, year: 2016
Gizard, Florence; Nomiyama, Takashi; Zhao, Yue; Findeisen, Hannes M.; Heywood, Elizabeth B.; Jones, Karrie L.; Staels, Bart; Bruemmer, Dennis
2009-01-01
Peroxisome Proliferator-Activated Receptor (PPAR) α, the molecular target for fibrates used to treat dyslipidemia, exerts pleiotropic effects on vascular cells. In vascular smooth muscle cells (VSMCs), we have previously demonstrated that PPARα activation suppresses G1→S cell cycle progression by targeting the cyclin-dependent kinase inhibitor p16INK4a (p16). In the present study, we demonstrate that this inhibition of VSMC proliferation by PPARα is mediated through a p16-dependent suppression of telomerase activity, which has been implicated in key cellular functions including proliferation. PPARα activation inhibited mitogen-induced telomerase activity by repressing the catalytic subunit telomerase reverse transcriptase (TERT) through negative cross-talk with an E2F-1-dependent trans-activation of the TERT promoter. This trans-repression involved the recruitment of the retinoblastoma (RB) family proteins p107 and p130 to the TERT promoter resulting in impaired E2F-1 binding, an effect which was dependent on p16. The inhibition of cell proliferation by PPARα activation was lost in VSMC following TERT overexpression or knock-down, pointing to a key role of telomerase as a target for the antiproliferative effects of PPARα. Finally, we demonstrate that PPARα agonists suppress telomerase activation during the proliferative response following vascular injury indicating that these findings are applicable in vivo. In concert, these results demonstrate that the anti-proliferative effects of PPARα in VSMCs depend on the suppression of telomerase activity by targeting the p16/RB/E2F transcriptional cascade. PMID:18818403
Muscle satellite cell heterogeneity and self-renewal
Motohashi, Norio; Asakura, Atsushi
2014-01-01
Adult skeletal muscle possesses extraordinary regeneration capacities. After muscle injury or exercise, large numbers of newly formed muscle fibers are generated within a week as a result of expansion and differentiation of a self-renewing pool of muscle stem cells termed muscle satellite cells. Normally, satellite cells are mitotically quiescent and reside beneath the basal lamina of muscle fibers. Upon regeneration, satellite cells are activated, and give rise to daughter myogenic precursor cells. After several rounds of proliferation, these myogenic precursor cells contribute to the formation of new muscle fibers. During cell division, a minor population of myogenic precursor cells returns to quiescent satellite cells as a self-renewal process. Currently, accumulating evidence has revealed the essential roles of satellite cells in muscle regeneration and the regulatory mechanisms, while it still remains to be elucidated how satellite cell self-renewal is molecularly regulated and how satellite cells are important in aging and diseased muscle. The number of satellite cells is decreased due to the changing niche during ageing, resulting in attenuation of muscle regeneration capacity. Additionally, in Duchenne muscular dystrophy (DMD) patients, the loss of satellite cell regenerative capacity and decreased satellite cell number due to continuous needs for satellite cells lead to progressive muscle weakness with chronic degeneration. Thus, it is necessary to replenish muscle satellite cells continuously. This review outlines recent findings regarding satellite cell heterogeneity, asymmetric division and molecular mechanisms in satellite cell self-renewal which is crucial for maintenance of satellite cells as a muscle stem cell pool throughout life. In addition, we discuss roles in the stem cell niche for satellite cell maintenance, as well as related cell therapies for approaching treatment of DMD. PMID:25364710
Muscle Satellite Cell Heterogeneity and Self-Renewal
Directory of Open Access Journals (Sweden)
Norio eMotohashi
2014-01-01
Full Text Available Adult skeletal muscle possesses extraordinary regeneration capacities. After muscle injury or exercise, large numbers of newly formed muscle fibers are generated within a week as a result of expansion and differentiation of a self-renewing pool of muscle stem cells termed muscle satellite cells. Normally, satellite cells are mitotically quiescent and reside beneath the basal lamina of muscle fibers. Upon regeneration, satellite cells are activated, and give rise to daughter myogenic precursor cells. After several rounds of proliferation, these myogenic precursor cells contribute to the formation of new muscle fibers. During cell division, a minor population of myogenic precursor cells returns to quiescent satellite cells as a self-renewal process. Currently, accumulating evidence has revealed the essential roles of satellite cells in muscle regeneration and the regulatory mechanisms, while it still remains to be elucidated how satellite cell self-renewal is molecularly regulated and how satellite cells are important in aging and diseased muscle. The number of satellite cells is decreased due to the changing niche during ageing, resulting in attenuation of muscle regeneration capacity. Additionally, in Duchenne muscular dystrophy (DMD patients, the loss of satellite cell regenerative capacity and decreased satellite cell number due to continuous needs for satellite cells lead to progressive muscle weakness with chronic degeneration. Thus, it is necessary to replenish muscle satellite cells continuously. This review outlines recent findings regarding satellite cell heterogeneity, asymmetric division and molecular mechanisms in satellite cell self-renewal which is crucial for maintenance of satellite cells as a muscle stem cell pool throughout life. In addition, we discuss roles in the stem cell niche for satellite cell maintenance, as well as related cell therapies for approaching treatment of DMD.
Design & Fabrication of a High-Voltage Photovoltaic Cell
Energy Technology Data Exchange (ETDEWEB)
Felder, Jennifer; /North Carolina State U. /SLAC
2012-09-05
Silicon photovoltaic (PV) cells are alternative energy sources that are important in sustainable power generation. Currently, applications of PV cells are limited by the low output voltage and somewhat low efficiency of such devices. In light of this fact, this project investigates the possibility of fabricating high-voltage PV cells on float-zone silicon wafers having output voltages ranging from 50 V to 2000 V. Three designs with different geometries of diffusion layers were simulated and compared in terms of metal coverage, recombination, built-in potential, and conduction current density. One design was then chosen and optimized to be implemented in the final device design. The results of the simulation serve as a feasibility test for the design concept and provide supportive evidence of the effectiveness of silicon PV cells as high-voltage power supplies.
X-radiation effects on muscle cell membrane electrical parameters
International Nuclear Information System (INIS)
Portela, A.; Vaccari, J.G.; Llobera, O.; Campi, M.; Delbue, M.A.; Perez, J.C.; Stewart, P.A.; Gosztonyi, A.E.; Brown Univ., Providence, R.I.
1975-01-01
Early effects of 100 Kilorads of X-rays on muscle cell membrane properties have been measured in sartorius muscles from Leptodactylus ocellatus. Threshold strength for rectangular current pulses increased 10% after irradiation, and action potential propagation velocity decreased 10%. Passive membrane parameters were calculated from potential responses to sub-threshold current pulses, assuming conventional cable theory. Specific membrane conductance increased to 18% after irradiation, membrane capacitance increased 14%, and length constant decreased 10% but membrane time constant was unchanged. Cell diameter decreased 5%, and resting membrane potential decreased 8%. Membrane parameters during an action potential were also evaluated by the phase-plane and current-voltage plot techniques. Irradiation significantly decreased the action potential amplitude, the excitation potential, and the maximum rates of rise and fall of membrane potential. Increases were observed in dynamic sodium and potassium conductances, peak sodium current, and net charge accumulation per action potential. This X-ray dose also produced signficant changes in the timing of peak events during the action potential; in general the whole action potential process is slower after irradiation
International Nuclear Information System (INIS)
Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka
2014-01-01
Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Muscle Satellite Cell Protein Teneurin-4 Regulates Differentiation During Muscle Regeneration.
Ishii, Kana; Suzuki, Nobuharu; Mabuchi, Yo; Ito, Naoki; Kikura, Naomi; Fukada, So-Ichiro; Okano, Hideyuki; Takeda, Shin'ichi; Akazawa, Chihiro
2015-10-01
Satellite cells are maintained in an undifferentiated quiescent state, but during muscle regeneration they acquire an activated stage, and initiate to proliferate and differentiate as myoblasts. The transmembrane protein teneurin-4 (Ten-4) is specifically expressed in the quiescent satellite cells; however, its cellular and molecular functions remain unknown. We therefore aimed to elucidate the function of Ten-4 in muscle satellite cells. In the tibialis anterior (TA) muscle of Ten-4-deficient mice, the number and the size of myofibers, as well as the population of satellite cells, were reduced with/without induction of muscle regeneration. Furthermore, we found an accelerated activation of satellite cells in the regenerated Ten-4-deficient TA muscle. The cell culture analysis using primary satellite cells showed that Ten-4 suppressed the progression of myogenic differentiation. Together, our findings revealed that Ten-4 functions as a crucial player in maintaining the quiescence of muscle satellite cells. © 2015 The Authors STEM CELLS published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.
Directory of Open Access Journals (Sweden)
Simon Hauerslev
Full Text Available Muscular dystrophies comprise a large group of inherited disorders that lead to progressive muscle wasting. We wanted to investigate if targeting satellite cells can enhance muscle regeneration and thus increase muscle mass. We treated mice with hepatocyte growth factor and leukemia inhibitory factor under three conditions: normoxia, hypoxia and during myostatin deficiency. We found that hepatocyte growth factor treatment led to activation of the Akt/mTOR/p70S6K protein synthesis pathway, up-regulation of the myognic transcription factors MyoD and myogenin, and subsequently the negative growth control factor, myostatin and atrophy markers MAFbx and MuRF1. Hypoxia-induced atrophy was partially restored by hepatocyte growth factor combined with leukemia inhibitory factor treatment. Dividing satellite cells were three-fold increased in the treatment group compared to control. Finally, we demonstrated that myostatin regulates satellite cell activation and myogenesis in vivo following treatment, consistent with previous findings in vitro. Our results suggest, not only a novel in vivo pharmacological treatment directed specifically at activating the satellite cells, but also a myostatin dependent mechanism that may contribute to the progressive muscle wasting seen in severely affected patients with muscular dystrophy and significant on-going regeneration. This treatment could potentially be applied to many conditions that feature muscle wasting to increase muscle bulk and strength.
Hsiao, Amy Y; Okitsu, Teru; Onoe, Hiroaki; Kiyosawa, Mahiro; Teramae, Hiroki; Iwanaga, Shintaroh; Kazama, Tomohiko; Matsumoto, Taro; Takeuchi, Shoji
2015-01-01
The proper functioning of many organs and tissues containing smooth muscles greatly depends on the intricate organization of the smooth muscle cells oriented in appropriate directions. Consequently controlling the cellular orientation in three-dimensional (3D) cellular constructs is an important issue in engineering tissues of smooth muscles. However, the ability to precisely control the cellular orientation at the microscale cannot be achieved by various commonly used 3D tissue engineering building blocks such as spheroids. This paper presents the formation of coiled spring-shaped 3D cellular constructs containing circumferentially oriented smooth muscle-like cells differentiated from dedifferentiated fat (DFAT) cells. By using the cell fiber technology, DFAT cells suspended in a mixture of extracellular proteins possessing an optimized stiffness were encapsulated in the core region of alginate shell microfibers and uniformly aligned to the longitudinal direction. Upon differentiation induction to the smooth muscle lineage, DFAT cell fibers self-assembled to coiled spring structures where the cells became circumferentially oriented. By changing the initial core-shell microfiber diameter, we demonstrated that the spring pitch and diameter could be controlled. 21 days after differentiation induction, the cell fibers contained high percentages of ASMA-positive and calponin-positive cells. Our technology to create these smooth muscle-like spring constructs enabled precise control of cellular alignment and orientation in 3D. These constructs can further serve as tissue engineering building blocks for larger organs and cellular implants used in clinical treatments.
The Skeletal Muscle Satellite Cell
2011-01-01
The skeletal muscle satellite cell was first described and named based on its anatomic location between the myofiber plasma and basement membranes. In 1961, two independent studies by Alexander Mauro and Bernard Katz provided the first electron microscopic descriptions of satellite cells in frog and rat muscles. These cells were soon detected in other vertebrates and acquired candidacy as the source of myogenic cells needed for myofiber growth and repair throughout life. Cultures of isolated myofibers and, subsequently, transplantation of single myofibers demonstrated that satellite cells were myogenic progenitors. More recently, satellite cells were redefined as myogenic stem cells given their ability to self-renew in addition to producing differentiated progeny. Identification of distinctively expressed molecular markers, in particular Pax7, has facilitated detection of satellite cells using light microscopy. Notwithstanding the remarkable progress made since the discovery of satellite cells, researchers have looked for alternative cells with myogenic capacity that can potentially be used for whole body cell-based therapy of skeletal muscle. Yet, new studies show that inducible ablation of satellite cells in adult muscle impairs myofiber regeneration. Thus, on the 50th anniversary since its discovery, the satellite cell’s indispensable role in muscle repair has been reaffirmed. PMID:22147605
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Contraction induced secretion of VEGF from skeletal muscle cells is mediated by adenosine
DEFF Research Database (Denmark)
Høier, Birgitte; Olsen, Karina; Nyberg, Michael Permin
2010-01-01
and that the contraction induced secretion of VEGF is partially mediated via adenosine acting on A(2B) adenosine receptors. Moreover, the contraction induced secretion of VEGF protein from muscle is dependent on both PKA and MAPK activation, but only the MAPK pathway appears to be adenosine dependent.......The role of adenosine and contraction for secretion of VEGF in skeletal muscle was investigated in human subjects and rat primary skeletal muscle cells. Microdialysis probes were inserted into the thigh muscle of seven male subjects and dialysate was collected at rest, during infusion of adenosine...... and contraction caused secretion of VEGF (pcontraction induced secretion of VEGF protein was abolished by the A(2B) antagonist enprofyllin and markedly reduced by inhibition of PKA or MAPK. The results demonstrate that adenosine causes secretion of VEGF from human skeletal muscle cells...
Muscle glycogen and cell function - Location, location, location
DEFF Research Database (Denmark)
Ørtenblad, N; Nielsen, Joachim
2015-01-01
The importance of glycogen, as a fuel during exercise, is a fundamental concept in exercise physiology. The use of electron microscopy has revealed that glycogen is not evenly distributed in skeletal muscle fibers, but rather localized in distinct pools. In this review, we present the available...... evidence regarding the subcellular localization of glycogen in skeletal muscle and discuss this from the perspective of skeletal muscle fiber function. The distribution of glycogen in the defined pools within the skeletal muscle varies depending on exercise intensity, fiber phenotype, training status......, and immobilization. Furthermore, these defined pools may serve specific functions in the cell. Specifically, reduced levels of these pools of glycogen are associated with reduced SR Ca(2+) release, muscle relaxation rate, and membrane excitability. Collectively, the available literature strongly demonstrates...
Extracellular creatine regulates creatine transport in rat and human muscle cells.
Loike, J D; Zalutsky, D L; Kaback, E; Miranda, A F; Silverstein, S C
1988-01-01
Muscle cells do not synthesize creatine; they take up exogenous creatine by specific Na+-dependent plasma membrane transporters. We found that extracellular creatine regulates the level of expression of these creatine transporters in L6 rat muscle cells. L6 myoblasts maintained for 24 hr in medium containing 1 mM creatine exhibited 1/3rd of the creatine transport activity of cells maintained for 24 hr in medium without creatine. Down-regulation of creatine transport was partially reversed whe...
Berthier, Christine; Kutchukian, Candice; Bouvard, Clément; Okamura, Yasushi; Jacquemond, Vincent
2015-04-01
Phosphoinositides act as signaling molecules in numerous cellular transduction processes, and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) regulates the function of several types of plasma membrane ion channels. We investigated the potential role of PtdIns(4,5)P2 in Ca(2+) homeostasis and excitation-contraction (E-C) coupling of mouse muscle fibers using in vivo expression of the voltage-sensing phosphatases (VSPs) Ciona intestinalis VSP (Ci-VSP) or Danio rerio VSP (Dr-VSP). Confocal images of enhanced green fluorescent protein-tagged Dr-VSP revealed a banded pattern consistent with VSP localization within the transverse tubule membrane. Rhod-2 Ca(2+) transients generated by 0.5-s-long voltage-clamp depolarizing pulses sufficient to elicit Ca(2+) release from the sarcoplasmic reticulum (SR) but below the range at which VSPs are activated were unaffected by the presence of the VSPs. However, in Ci-VSP-expressing fibers challenged by 5-s-long depolarizing pulses, the Ca(2+) level late in the pulse (3 s after initiation) was significantly lower at 120 mV than at 20 mV. Furthermore, Ci-VSP-expressing fibers showed a reversible depression of Ca(2+) release during trains, with the peak Ca(2+) transient being reduced by ∼30% after the application of 10 200-ms-long pulses to 100 mV. A similar depression was observed in Dr-VSP-expressing fibers. Cav1.1 Ca(2+) channel-mediated current was unaffected by Ci-VSP activation. In fibers expressing Ci-VSP and a pleckstrin homology domain fused with monomeric red fluorescent protein (PLCδ1PH-mRFP), depolarizing pulses elicited transient changes in mRFP fluorescence consistent with release of transverse tubule-bound PLCδ1PH domain into the cytosol; the voltage sensitivity of these changes was consistent with that of Ci-VSP activation, and recovery occurred with a time constant in the 10-s range. Our results indicate that the PtdIns(4,5)P2 level is tightly maintained in the transverse tubule membrane of the muscle fibers
Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.
Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf
2006-03-01
We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.
Mg(2+),ATP-dependent plasma membrane calcium pump of smooth muscle cells. ІІ. Regulation of activity
T. О. Veklich; Iu. Iu. Mazur; S. О. Kosterin
2015-01-01
Plasma membrane Ca2+-pump is one of key proteins, which takes part in Ca2+ exchange in smooth muscle cells. It has a lot of diverse functions from control of basal cytoplasmal Ca2+ concentration to regulation of proteins involved in Ca2+-dependent signal pathway. Ca2+ pump function is often dependent on the isoform or even form of alternative splicing. Allowing for a variety of Ca2+-pump functions and properties, which were reviewed in detail in the first part of our review article cycle (U...
Time- and dose-dependent effects of total-body ionizing radiation on muscle stem cells
Masuda, Shinya; Hisamatsu, Tsubasa; Seko, Daiki; Urata, Yoshishige; Goto, Shinji; Li, Tao-Sheng; Ono, Yusuke
2015-01-01
Exposure to high levels of genotoxic stress, such as high-dose ionizing radiation, increases both cancer and noncancer risks. However, it remains debatable whether low-dose ionizing radiation reduces cellular function, or rather induces hormetic health benefits. Here, we investigated the effects of total-body γ-ray radiation on muscle stem cells, called satellite cells. Adult C57BL/6 mice were exposed to γ-radiation at low- to high-dose rates (low, 2 or 10 mGy/day; moderate, 50 mGy/day; high, 250 mGy/day) for 30 days. No hormetic responses in proliferation, differentiation, or self-renewal of satellite cells were observed in low-dose radiation-exposed mice at the acute phase. However, at the chronic phase, population expansion of satellite cell-derived progeny was slightly decreased in mice exposed to low-dose radiation. Taken together, low-dose ionizing irradiation may suppress satellite cell function, rather than induce hormetic health benefits, in skeletal muscle in adult mice. PMID:25869487
Ca2+ sparks act as potent regulators of excitation-contraction coupling in airway smooth muscle.
Zhuge, Ronghua; Bao, Rongfeng; Fogarty, Kevin E; Lifshitz, Lawrence M
2010-01-15
Ca2+ sparks are short lived and localized Ca2+ transients resulting from the opening of ryanodine receptors in sarcoplasmic reticulum. These events relax certain types of smooth muscle by activating big conductance Ca2+-activated K+ channels to produce spontaneous transient outward currents (STOCs) and the resultant closure of voltage-dependent Ca2+ channels. But in many smooth muscles from a variety of organs, Ca2+ sparks can additionally activate Ca2+-activated Cl(-) channels to generate spontaneous transient inward current (STICs). To date, the physiological roles of Ca2+ sparks in this latter group of smooth muscle remain elusive. Here, we show that in airway smooth muscle, Ca2+ sparks under physiological conditions, activating STOCs and STICs, induce biphasic membrane potential transients (BiMPTs), leading to membrane potential oscillations. Paradoxically, BiMPTs stabilize the membrane potential by clamping it within a negative range and prevent the generation of action potentials. Moreover, blocking either Ca2+ sparks or hyperpolarization components of BiMPTs activates voltage-dependent Ca2+ channels, resulting in an increase in global [Ca2+](i) and cell contraction. Therefore, Ca2+ sparks in smooth muscle presenting both STICs and STOCs act as a stabilizer of membrane potential, and altering the balance can profoundly alter the status of excitability and contractility. These results reveal a novel mechanism underlying the control of excitability and contractility in smooth muscle.
Fujii, Koki; Nomura, Fumimasa; Kaneko, Tomoyuki
2018-03-01
To investigate the optimal conditions for electrical stimulation, communities of lined-up chick embryonic cardiomyocytes were evaluated in terms of their threshold voltage for pacing (PVMin) and the half-maximum paced frequency (PF50), with a focus on the following factors: (1) the orientation of the major axis of cell communities to the electric field (EF) direction as the external factor; (2) the number of cells in a cell community, the length of the cell community, and the mean length of cells comprising the community as the internal factors. Firstly, PVMin decreased with increasing length of the cell network oriented parallel to the EF. PVMin was approximately 0.041 ± 0.025 V/mm when the community was sufficiently long. On the other hand, PVMin in the orthogonal orientation was constant at 1.7 ± 0.047 V/mm with no dependence on the length of the cell network. Secondly, we found that PF50 increased with increasing length of the cell network or the number of cells in the network; the PF50 values were 2.03 ± 0.05 and 3.39 ± 0.05 Hz when the respective cell network lengths were 100 µm (n = 43) and more than 300 µm (n = 6) and the cells were oriented parallel to the EF. These findings indicate that it is important to suppress ventricular fibrillation with minimal efficient stimulation by considering the EF direction with respect to the orientation of cardiomyocytes. Furthermore, expanded cells showed the loss of ability to respond to stimulation at higher frequencies. Cardiomyocytes combined with seeded fibroblasts as a cell network at a low density are a possible model of a ventricular remodeling heart.
DEFF Research Database (Denmark)
Matchkov, Vladimir; Aalkjær, Christian; Nilsson, Holger
2004-01-01
We have previously demonstrated the presence of a cyclic GMP (cGMP)-dependent calcium-activated inward current in vascular smooth-muscle cells, and suggested this to be of importance in synchronizing smooth-muscle contraction. Here we demonstrate the characteristics of this current. Using......M) in the pipette solution. The current was found to be a calcium-activated chloride current with an absolute requirement for cyclic GMP (EC50 6.4 microM). The current could be activated by the constitutively active subunit of PKG. Current activation was blocked by the protein kinase G antagonist Rp-8-Br-PET-cGMP...... differed from those of the calcium-activated chloride current in pulmonary myocytes, which was cGMP-independent, exhibited a high sensitivity to inhibition by niflumic acid, was unaffected by zinc ions, and showed outward current rectification as has previously been reported for this current. Under...
Lozanoska-Ochser, Biliana; Benedetti, Anna; Rizzo, Giuseppe; Marrocco, Valeria; Di Maggio, Rosanna; Fiore, Piera; Bouche, Marina
2018-03-01
Chronic muscle inflammation is a critical feature of Duchenne muscular dystrophy and contributes to muscle fibre injury and disease progression. Although previous studies have implicated T cells in the development of muscle fibrosis, little is known about their role during the early stages of muscular dystrophy. Here, we show that T cells are among the first cells to infiltrate mdx mouse dystrophic muscle, prior to the onset of necrosis, suggesting an important role in early disease pathogenesis. Based on our comprehensive analysis of the kinetics of the immune response, we further identify the early pre-necrotic stage of muscular dystrophy as the relevant time frame for T-cell-based interventions. We focused on protein kinase C θ (PKCθ, encoded by Prkcq), a critical regulator of effector T-cell activation, as a potential target to inhibit T-cell activity in dystrophic muscle. Lack of PKCθ not only reduced the frequency and number of infiltrating T cells but also led to quantitative and qualitative changes in the innate immune cell infiltrate in mdx/Prkcq -/- muscle. These changes were due to the inhibition of T cells, since PKCθ was necessary for T-cell but not for myeloid cell infiltration of acutely injured muscle. Targeting T cells with a PKCθ inhibitor early in the disease process markedly diminished the size of the inflammatory cell infiltrate and resulted in reduced muscle damage. Moreover, diaphragm necrosis and fibrosis were also reduced following treatment. Overall, our findings identify the early T-cell infiltrate as a therapeutic target and highlight the potential of PKCθ inhibition as a therapeutic approach to muscular dystrophy. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A
2018-02-21
Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.
Directory of Open Access Journals (Sweden)
Natalia González
Full Text Available Skeletal muscle regeneration and long term maintenance is directly link to the balance between self-renewal and differentiation of resident adult stem cells known as satellite cells. In turn, satellite cell fate is influenced by a functional interaction between the transcription factor Pax7 and members of the MyoD family of muscle regulatory factors. Thus, changes in the Pax7-to-MyoD protein ratio may act as a molecular rheostat fine-tuning acquisition of lineage identity while preventing precocious terminal differentiation. Pax7 is expressed in quiescent and proliferating satellite cells, while its levels decrease sharply in differentiating progenitors Pax7 is maintained in cells (reacquiring quiescence. While the mechanisms regulating Pax7 levels based on differentiation status are not well understood, we have recently described that Pax7 levels are directly regulated by the ubiquitin-ligase Nedd4, thus promoting proteasome-dependent Pax7 degradation in differentiating satellite cells. Here we show that Pax7 levels are maintained in proliferating muscle progenitors by a mechanism involving casein kinase 2-dependent Pax7 phosphorylation at S201. Point mutations preventing S201 phosphorylation or casein kinase 2 inhibition result in decreased Pax7 protein in proliferating muscle progenitors. Accordingly, this correlates directly with increased Pax7 ubiquitination. Finally, Pax7 down regulation induced by casein kinase 2 inhibition results in precocious myogenic induction, indicating early commitment to terminal differentiation. These observations highlight the critical role of post translational regulation of Pax7 as a molecular switch controlling muscle progenitor fate.
Satellite cells in human skeletal muscle plasticity
Directory of Open Access Journals (Sweden)
Tim eSnijders
2015-10-01
Full Text Available Skeletal muscle satellite cells are considered to play a crucial role in muscle fiber maintenance, repair and remodelling. Our knowledge of the role of satellite cells in muscle fiber adaptation has traditionally relied on in vitro cell and in vivo animal models. Over the past decade, a genuine effort has been made to translate these results to humans under physiological conditions. Findings from in vivo human studies suggest that satellite cells play a key role in skeletal muscle fiber repair/remodelling in response to exercise. Mounting evidence indicates that aging has a profound impact on the regulation of satellite cells in human skeletal muscle. Yet, the precise role of satellite cells in the development of muscle fiber atrophy with age remains unresolved. This review seeks to integrate recent results from in vivo human studies on satellite cell function in muscle fiber repair/remodelling in the wider context of satellite cell biology whose literature is largely based on animal and cell models.
Satellite cells in human skeletal muscle plasticity.
Snijders, Tim; Nederveen, Joshua P; McKay, Bryon R; Joanisse, Sophie; Verdijk, Lex B; van Loon, Luc J C; Parise, Gianni
2015-01-01
Skeletal muscle satellite cells are considered to play a crucial role in muscle fiber maintenance, repair and remodeling. Our knowledge of the role of satellite cells in muscle fiber adaptation has traditionally relied on in vitro cell and in vivo animal models. Over the past decade, a genuine effort has been made to translate these results to humans under physiological conditions. Findings from in vivo human studies suggest that satellite cells play a key role in skeletal muscle fiber repair/remodeling in response to exercise. Mounting evidence indicates that aging has a profound impact on the regulation of satellite cells in human skeletal muscle. Yet, the precise role of satellite cells in the development of muscle fiber atrophy with age remains unresolved. This review seeks to integrate recent results from in vivo human studies on satellite cell function in muscle fiber repair/remodeling in the wider context of satellite cell biology whose literature is largely based on animal and cell models.
Ultra-Low Voltage Class AB Switched Current Memory Cell
DEFF Research Database (Denmark)
Igor, Mucha
1996-01-01
This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with thr......This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process...... with threshold voltages of 0.9V. Both hand calculations and PSPICE simulations showed that the cells designed allowed a maximum signal range better than +/-13 micoamp, with a supply voltage down to 1V and a quiescent bias current of 1 microamp, resulting in a very high current efficiency and effective power...
Regulatory T cells and skeletal muscle regeneration.
Schiaffino, Stefano; Pereira, Marcelo G; Ciciliot, Stefano; Rovere-Querini, Patrizia
2017-02-01
Skeletal muscle regeneration results from the activation and differentiation of myogenic stem cells, called satellite cells, located beneath the basal lamina of the muscle fibers. Inflammatory and immune cells have a crucial role in the regeneration process. Acute muscle injury causes an immediate transient wave of neutrophils followed by a more persistent infiltration of M1 (proinflammatory) and M2 (anti-inflammatory/proregenerative) macrophages. New studies show that injured muscle is also infiltrated by a specialized population of regulatory T (Treg) cells, which control both the inflammatory response, by promoting the M1-to-M2 switch, and the activation of satellite cells. Treg cells accumulate in injured muscle in response to specific cytokines, such as IL-33, and promote muscle growth by releasing growth factors, such as amphiregulin. Muscle repair during aging is impaired due to reduced number of Treg cells and can be enhanced by IL-33 supplementation. Migration of Treg cells could also contribute to explain the effect of heterochronic parabiosis, whereby muscle regeneration of aged mice can be improved by a parabiotically linked young partners. In mdx dystrophin-deficient mice, a model of human Duchenne muscular dystrophy, muscle injury, and inflammation is mitigated by expansion of the Treg-cell population but exacerbated by Treg-cell depletion. These findings support the notion that immunological mechanisms are not only essential in the response to pathogenic microbes and tumor cells but also have a wider homeostatic role in tissue repair, and open new perspectives for boosting muscle growth in chronic muscle disease and during aging. © 2016 Federation of European Biochemical Societies.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Low density lipoprotein uptake by an endothelial-smooth muscle cell bilayer
International Nuclear Information System (INIS)
Alexander, J.J.; Miguel, R.; Graham, D.
1991-01-01
To study the interaction of endothelial and smooth muscle cells, and the means by which such interaction may affect lipid permeability of the arterial wall, cell bilayers were established by use of a transwell culture system. After confluent growth of both cell types had been achieved, iodine 125 bound to low-density lipoprotein (10 ng protein/ml) was added to the media of the upper well. After a 3-hour incubation period, the iodine 125-bound low-density lipoprotein content of the upper and lower media demonstrated an impedance to lipoprotein movement across the endothelial cell monolayer as compared to the bare porous polycarbonate filter of the transwell (p less than 10(-6)). The presence of smooth muscle cells in the bottom well significantly enhanced the permeability of the endothelial cell layer (p less than 10(-60)). This effect remained unchanged over a 9-day time course. Membrane binding and cellular uptake of low-density lipoprotein by endothelial cells was not altered by smooth muscle cells, indicating that this change in permeability could not be easily attributed to changes in receptor-mediated transport or transcytosis. Membrane binding (p less than 0.02) and cellular uptake (p less than 10(-6)) of low-density lipoprotein by smooth muscle cells in the bilayer, when adjusted for counts available in the smooth muscle cell media, were both reduced in the early incubation period as compared to isolated smooth muscle cells. The disproportionate reduction in uptake as compared to binding would suggest that this was not entirely a receptor-dependent process
Energy Technology Data Exchange (ETDEWEB)
Yanagisawa, Michiko [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 35 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan); Aging Research, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya, Aichi 466-8550 (Japan); Mukai, Atsushi; Shiomi, Kosuke [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 35 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan); Song, Si-Yong [Institute of Neuroscience, Faculty of Pharmaceutical Sciences at Kagawa, Tokushima Bunri University, 1314-1 Shido, Sanuki-shi, Kagawa 769-2193 (Japan); Hashimoto, Naohiro, E-mail: nao@ncgg.go.jp [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 35 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan)
2011-01-15
A high concentration of bone morphogenetic proteins (BMPs) stimulates myogenic progenitor cells to undergo heterotopic osteogenic differentiation. However, the physiological role of the Smad signaling pathway during terminal muscle differentiation has not been resolved. We report here that Smad1/5/8 was phosphorylated and activated in undifferentiated growing mouse myogenic progenitor Ric10 cells without exposure to any exogenous BMPs. The amount of phosphorylated Smad1/5/8 was severely reduced during precocious myogenic differentiation under the high cell density culture condition even in growth medium supplemented with a high concentration of serum. Inhibition of the Smad signaling pathway by dorsomorphin, an inhibitor of Smad activation, or noggin, a specific antagonist of BMP, induced precocious terminal differentiation of myogenic progenitor cells in a cell density-dependent fashion even in growth medium. In addition, Smad1/5/8 was transiently activated in proliferating myogenic progenitor cells during muscle regeneration in rats. The present results indicate that the Smad signaling pathway is involved in a critical switch between growth and differentiation of myogenic progenitor cells both in vitro and in vivo. Furthermore, precocious cell density-dependent myogenic differentiation suggests that a community effect triggers the terminal muscle differentiation of myogenic cells by quenching the Smad signaling.
International Nuclear Information System (INIS)
Yanagisawa, Michiko; Mukai, Atsushi; Shiomi, Kosuke; Song, Si-Yong; Hashimoto, Naohiro
2011-01-01
A high concentration of bone morphogenetic proteins (BMPs) stimulates myogenic progenitor cells to undergo heterotopic osteogenic differentiation. However, the physiological role of the Smad signaling pathway during terminal muscle differentiation has not been resolved. We report here that Smad1/5/8 was phosphorylated and activated in undifferentiated growing mouse myogenic progenitor Ric10 cells without exposure to any exogenous BMPs. The amount of phosphorylated Smad1/5/8 was severely reduced during precocious myogenic differentiation under the high cell density culture condition even in growth medium supplemented with a high concentration of serum. Inhibition of the Smad signaling pathway by dorsomorphin, an inhibitor of Smad activation, or noggin, a specific antagonist of BMP, induced precocious terminal differentiation of myogenic progenitor cells in a cell density-dependent fashion even in growth medium. In addition, Smad1/5/8 was transiently activated in proliferating myogenic progenitor cells during muscle regeneration in rats. The present results indicate that the Smad signaling pathway is involved in a critical switch between growth and differentiation of myogenic progenitor cells both in vitro and in vivo. Furthermore, precocious cell density-dependent myogenic differentiation suggests that a community effect triggers the terminal muscle differentiation of myogenic cells by quenching the Smad signaling.
Thaller, Lawrence H.; Quinzio, Michael V.
1997-01-01
The investigation of an aberrant cell voltage during the filling of a large lithium thionyl chloride cell summary is at: an aberrant voltage trace was noted during the review of cell filling data; incident was traced to an interruption during filling; experimentation suggested oxidizable sites within the carbon electrode were responsible for the drop in voltage; the voltage anomaly could be reproduced by interrupting the filling of similar cells; and anomalous voltage dip was not due to a short.
Pisconti, Addolorata; Banks, Glen B; Babaeijandaghi, Farshad; Betta, Nicole Dalla; Rossi, Fabio M V; Chamberlain, Jeffrey S; Olwin, Bradley B
2016-01-01
The skeletal muscle stem cell niche provides an environment that maintains quiescent satellite cells, required for skeletal muscle homeostasis and regeneration. Syndecan-3, a transmembrane proteoglycan expressed in satellite cells, supports communication with the niche, providing cell interactions and signals to maintain quiescent satellite cells. Syndecan-3 ablation unexpectedly improves regeneration in repeatedly injured muscle and in dystrophic mice, accompanied by the persistence of sublaminar and interstitial, proliferating myoblasts. Additionally, muscle aging is improved in syndecan-3 null mice. Since syndecan-3 null myofiber-associated satellite cells downregulate Pax7 and migrate away from the niche more readily than wild type cells, syxndecan-3 appears to regulate satellite cell homeostasis and satellite cell homing to the niche. Manipulating syndecan-3 provides a promising target for development of therapies to enhance muscle regeneration in muscular dystrophies and in aged muscle.
Functional dysregulation of stem cells during aging: a focus on skeletal muscle stem cells.
García-Prat, Laura; Sousa-Victor, Pedro; Muñoz-Cánoves, Pura
2013-09-01
Aging of an organism is associated with the functional decline of tissues and organs, as well as a sharp decline in the regenerative capacity of stem cells. A prevailing view holds that the aging rate of an individual depends on the ratio of tissue attrition to tissue regeneration. Therefore, manipulations that favor the balance towards regeneration may prevent or delay aging. Skeletal muscle is a specialized tissue composed of postmitotic myofibers that contract to generate force. Satellite cells are the adult stem cells responsible for skeletal muscle regeneration. Recent studies on the biology of skeletal muscle and satellite cells in aging have uncovered the critical impact of systemic and niche factors on stem cell functionality and demonstrated the capacity of aged satellite cells to rejuvenate and increase their regenerative potential when exposed to a youthful environment. Here we review the current literature on the coordinated relationship between cell extrinsic and intrinsic factors that regulate the function of satellite cells, and ultimately determine tissue homeostasis and repair during aging, and which encourage the search for new anti-aging strategies. © 2013 The Authors Journal compilation © 2013 FEBS.
Oral Gingival Cell Cigarette Smoke Exposure Induces Muscle Cell Metabolic Disruption
Directory of Open Access Journals (Sweden)
Andrea C. Baeder
2016-01-01
Full Text Available Cigarette smoke exposure compromises health through damaging multiple physiological systems, including disrupting metabolic function. The purpose of this study was to determine the role of oral gingiva in mediating the deleterious metabolic effects of cigarette smoke exposure on skeletal muscle metabolic function. Using an in vitro conditioned medium cell model, skeletal muscle cells were incubated with medium from gingival cells treated with normal medium or medium containing suspended cigarette smoke extract (CSE. Following incubation of muscle cells with gingival cell conditioned medium, muscle cell mitochondrial respiration and insulin signaling and action were determined as an indication of overall muscle metabolic health. Skeletal muscle cells incubated with conditioned medium of CSE-treated gingival cells had a profound reduction in mitochondrial respiration and respiratory control. Furthermore, skeletal muscle cells had a greatly reduced response in insulin-stimulated Akt phosphorylation and glycogen synthesis. Altogether, these results provide a novel perspective on the mechanism whereby cigarette smoke affects systemic metabolic function. In conclusion, we found that oral gingival cells treated with CSE create an altered milieu that is sufficient to both disrupted skeletal muscle cell mitochondrial function and insulin sensitivity.
Energy Technology Data Exchange (ETDEWEB)
Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)
2016-07-11
Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.
Intercellular adhesion molecule-1 expression by skeletal muscle cells augments myogenesis
International Nuclear Information System (INIS)
Goh, Qingnian; Dearth, Christopher L.; Corbett, Jacob T.; Pierre, Philippe; Chadee, Deborah N.; Pizza, Francis X.
2015-01-01
We previously demonstrated that the expression of intercellular adhesion molecule-1 (ICAM-1) by skeletal muscle cells after muscle overload contributes to ensuing regenerative and hypertrophic processes in skeletal muscle. The objective of the present study is to reveal mechanisms through which skeletal muscle cell expression of ICAM-1 augments regenerative and hypertrophic processes of myogenesis. This was accomplished by genetically engineering C2C12 myoblasts to stably express ICAM-1, and by inhibiting the adhesive and signaling functions of ICAM-1 through the use of a neutralizing antibody or cell penetrating peptide, respectively. Expression of ICAM-1 by cultured skeletal muscle cells augmented myoblast–myoblast adhesion, myotube formation, myonuclear number, myotube alignment, myotube–myotube fusion, and myotube size without influencing the ability of myoblasts to proliferate or differentiate. ICAM-1 augmented myotube formation, myonuclear accretion, and myotube alignment through a mechanism involving adhesion-induced activation of ICAM-1 signaling, as these dependent measures were reduced via antibody and peptide inhibition of ICAM-1. The adhesive and signaling functions of ICAM-1 also facilitated myotube hypertrophy through a mechanism involving myotube–myotube fusion, protein synthesis, and Akt/p70s6k signaling. Our findings demonstrate that ICAM-1 expression by skeletal muscle cells augments myogenesis, and establish a novel mechanism through which the inflammatory response facilitates growth processes in skeletal muscle. - Highlights: • We examined mechanisms through which skeletal muscle cell expression of ICAM-1 facilitates events of in vitro myogenesis. • Expression of ICAM-1 by cultured myoblasts did not influence their ability to proliferate or differentiate. • Skeletal muscle cell expression of ICAM-1 augmented myoblast fusion, myotube alignment, myotube–myotube fusion, and myotube size. • ICAM-1 augmented myogenic processes through
Intercellular adhesion molecule-1 expression by skeletal muscle cells augments myogenesis
Energy Technology Data Exchange (ETDEWEB)
Goh, Qingnian; Dearth, Christopher L.; Corbett, Jacob T. [Department of Kinesiology, The University of Toledo, Toledo, OH (United States); Pierre, Philippe [Centre d’Immunologie de Marseille-Luminy U2M, Aix-Marseille Université, Marseille (France); INSERM U631, Institut National de la Santé et Recherche Médicale, Marseille (France); CNRS UMR6102, Centre National de la Recherche Scientifique, Marseille (France); Chadee, Deborah N. [Department of Biological Sciences, The University of Toledo, Toledo, OH (United States); Pizza, Francis X., E-mail: Francis.Pizza@utoledo.edu [Department of Kinesiology, The University of Toledo, Toledo, OH (United States)
2015-02-15
We previously demonstrated that the expression of intercellular adhesion molecule-1 (ICAM-1) by skeletal muscle cells after muscle overload contributes to ensuing regenerative and hypertrophic processes in skeletal muscle. The objective of the present study is to reveal mechanisms through which skeletal muscle cell expression of ICAM-1 augments regenerative and hypertrophic processes of myogenesis. This was accomplished by genetically engineering C2C12 myoblasts to stably express ICAM-1, and by inhibiting the adhesive and signaling functions of ICAM-1 through the use of a neutralizing antibody or cell penetrating peptide, respectively. Expression of ICAM-1 by cultured skeletal muscle cells augmented myoblast–myoblast adhesion, myotube formation, myonuclear number, myotube alignment, myotube–myotube fusion, and myotube size without influencing the ability of myoblasts to proliferate or differentiate. ICAM-1 augmented myotube formation, myonuclear accretion, and myotube alignment through a mechanism involving adhesion-induced activation of ICAM-1 signaling, as these dependent measures were reduced via antibody and peptide inhibition of ICAM-1. The adhesive and signaling functions of ICAM-1 also facilitated myotube hypertrophy through a mechanism involving myotube–myotube fusion, protein synthesis, and Akt/p70s6k signaling. Our findings demonstrate that ICAM-1 expression by skeletal muscle cells augments myogenesis, and establish a novel mechanism through which the inflammatory response facilitates growth processes in skeletal muscle. - Highlights: • We examined mechanisms through which skeletal muscle cell expression of ICAM-1 facilitates events of in vitro myogenesis. • Expression of ICAM-1 by cultured myoblasts did not influence their ability to proliferate or differentiate. • Skeletal muscle cell expression of ICAM-1 augmented myoblast fusion, myotube alignment, myotube–myotube fusion, and myotube size. • ICAM-1 augmented myogenic processes through
Murach, Kevin A; White, Sarah H; Wen, Yuan; Ho, Angel; Dupont-Versteegden, Esther E; McCarthy, John J; Peterson, Charlotte A
2017-07-10
Pax7+ satellite cells are required for skeletal muscle fiber growth during post-natal development in mice. Satellite cell-mediated myonuclear accretion also appears to persist into early adulthood. Given the important role of satellite cells during muscle development, we hypothesized that the necessity of satellite cells for adaptation to an imposed hypertrophic stimulus depends on maturational age. Pax7 CreER -R26R DTA mice were treated for 5 days with vehicle (satellite cell-replete, SC+) or tamoxifen (satellite cell-depleted, SC-) at 2 months (young) and 4 months (mature) of age. Following a 2-week washout, mice were subjected to sham surgery or 10 day synergist ablation overload of the plantaris (n = 6-9 per group). The surgical approach minimized regeneration, de novo fiber formation, and fiber splitting while promoting muscle fiber growth. Satellite cell density (Pax7+ cells/fiber), embryonic myosin heavy chain expression (eMyHC), and muscle fiber cross sectional area (CSA) were evaluated via immunohistochemistry. Myonuclei (myonuclei/100 mm) were counted on isolated single muscle fibers. Tamoxifen treatment depleted satellite cells by ≥90% and prevented myonuclear accretion with overload in young and mature mice (p overload. Average muscle fiber CSA increased ~20% in young SC+ (p = 0.07), mature SC+ (p overload (p overload-induced hypertrophy is dependent on maturational age, and global responses to overload differ in young versus mature mice.
KCl cotransport regulation and protein kinase G in cultured vascular smooth muscle cells.
Adragna, N C; Zhang, J; Di Fulvio, M; Lincoln, T M; Lauf, P K
2002-05-15
K-Cl cotransport is activated by vasodilators in erythrocytes and vascular smooth muscle cells and its regulation involves putative kinase/phosphatase cascades. N-ethylmaleimide (NEM) activates the system presumably by inhibiting a protein kinase. Nitrovasodilators relax smooth muscle via cGMP-dependent activation of protein kinase G (PKG), a regulator of membrane channels and transporters. We investigated whether PKG regulates K-Cl cotransport activity or mRNA expression in normal, PKG-deficient-vector-only-transfected (PKG-) and PKG-catalytic-domain-transfected (PKG+) rat aortic smooth muscle cells. K-Cl cotransport was calculated as the Cl-dependent Rb influx, and mRNA was determined by semiquantitative RT-PCR. Baseline K-Cl cotransport was higher in PKG+ than in PKG- cells (p <0.01). At 0.5 mM, NEM stimulated K-Cl cotransport by 5-fold in PKG- but not in PKG+ cells. However, NEM was more potent although less effective to activate K-Cl cotransport in normal (passage 1-3) and PKG+ than in PKG- cells. In PKG- cells, [(dihydroindenyl) oxy] alkanoic acid (300 mM) but not furosemide (1 mM) inhibited K-Cl cotransport. Furthermore, no difference in K-Cl cotransport mRNA expression was observed between these cells. In conclusion, this study shows that manipulation of PKG expression in vascular smooth muscle cells affects K-Cl cotransport activity and its activation by NEM.
PGC-1α regulates alanine metabolism in muscle cells.
Hatazawa, Yukino; Qian, Kun; Gong, Da-Wei; Kamei, Yasutomi
2018-01-01
The skeletal muscle is the largest organ in the human body, depositing energy as protein/amino acids, which are degraded in catabolic conditions such as fasting. Alanine is synthesized and secreted from the skeletal muscle that is used as substrates of gluconeogenesis in the liver. During fasting, the expression of PGC-1α, a transcriptional coactivator of nuclear receptors, is increased in the liver and regulates gluconeogenesis. In the present study, we observed increased mRNA expression of PGC-1α and alanine aminotransferase 2 (ALT2) in the skeletal muscle during fasting. In C2C12 myoblast cells overexpressing PGC-1α, ALT2 expression was increased concomitant with an increased alanine level in the cells and medium. In addition, PGC-1α, along with nuclear receptor ERR, dose-dependently enhanced the ALT2 promoter activity in reporter assay using C2C12 cells. In the absence of glucose in the culture medium, mRNA levels of PGC-1α and ALT2 increased. Endogenous PGC-1α knockdown in C2C12 cells reduced ALT2 gene expression level, induced by the no-glucose medium. Taken together, in the skeletal muscle, PGC-1α activates ALT2 gene expression, and alanine production may play roles in adaptation to fasting.
The role of satellite cells in muscle hypertrophy.
Blaauw, Bert; Reggiani, Carlo
2014-02-01
The role of satellite cells in muscle hypertrophy has long been a debated issue. In the late 1980s it was shown that proteins remain close to the myonucleus responsible for its synthesis, giving rise to the idea of a nuclear domain. This, together with the observation that during various models of muscle hypertrophy there is an activation of the muscle stem cells, i.e. satellite cells, lead to the idea that satellite cell activation is required for muscle hypertrophy. Thus, satellite cells are not only responsible for muscle repair and regeneration, but also for hypertrophic growth. Further support for this line of thinking was obtained after studies showing that irradiation of skeletal muscle, and therefore elimination of all satellite cells, completely prevented overload-induced hypertrophy. Recently however, using different transgenic approaches, it has become clear that muscle hypertrophy can occur without a contribution of satellite cells, even though in most situations of muscle hypertrophy satellite cells are activated. In this review we will discuss the contribution of satellite cells, and other muscle-resident stem cells, to muscle hypertrophy both in mice as well as in humans.
Chemotherapy inhibits skeletal muscle ubiquitin-proteasome-dependent proteolysis.
Tilignac, Thomas; Temparis, Sandrine; Combaret, Lydie; Taillandier, Daniel; Pouch, Marie-Noëlle; Cervek, Matjaz; Cardenas, Diana M; Le Bricon, Thierry; Debiton, Eric; Samuels, Susan E; Madelmont, Jean-Claude; Attaix, Didier
2002-05-15
Chemotherapy has cachectic effects, but it is unknown whether cytostatic agents alter skeletal muscle proteolysis. We hypothesized that chemotherapy-induced alterations in protein synthesis should result in the increased incidence of abnormal proteins, which in turn should stimulate ubiquitin-proteasome-dependent proteolysis. The effects of the nitrosourea cystemustine were investigated in skeletal muscles from both healthy and colon 26 adenocarcinoma-bearing mice, an appropriate model for testing the impact of cytostatic agents. Muscle wasting was seen in both groups of mice 4 days after a single cystemustine injection, and the drug further increased the loss of muscle proteins already apparent in tumor-bearing animals. Cystemustine cured the tumor-bearing mice with 100% efficacy. Surprisingly, within 11 days of treatment, rates of muscle proteolysis progressively decreased below basal levels observed in healthy control mice and contributed to the cessation of muscle wasting. Proteasome-dependent proteolysis was inhibited by mechanisms that include reduced mRNA levels for 20S and 26S proteasome subunits, decreased protein levels of 20S proteasome subunits and the S14 non-ATPase subunit of the 26S proteasome, and impaired chymotrypsin- and trypsin-like activities of the enzyme. A combination of cisplatin and ifosfamide, two drugs that are widely used in the treatment of cancer patients, also depressed the expression of proteasomal subunits in muscles from rats bearing the MatB adenocarcinoma below basal levels. Thus, a down-regulation of ubiquitin-proteasome-dependent proteolysis is observed with various cytostatic agents and contributes to reverse the chemotherapy-induced muscle wasting.
Polymer solar cells with enhanced open-circuit voltage and efficiency
Chen, Hsiang-Yu; Hou, Jianhui; Zhang, Shaoqing; Liang, Yongye; Yang, Guanwen; Yang, Yang; Yu, Luping; Wu, Yue; Li, Gang
2009-11-01
Following the development of the bulk heterojunction structure, recent years have seen a dramatic improvement in the efficiency of polymer solar cells. Maximizing the open-circuit voltage in a low-bandgap polymer is one of the critical factors towards enabling high-efficiency solar cells. Study of the relation between open-circuit voltage and the energy levels of the donor/acceptor in bulk heterojunction polymer solar cells has stimulated interest in modifying the open-circuit voltage by tuning the energy levels of polymers. Here, we show that the open-circuit voltage of polymer solar cells constructed based on the structure of a low-bandgap polymer, PBDTTT, can be tuned, step by step, using different functional groups, to achieve values as high as 0.76 V. This increased open-circuit voltage combined with a high short-circuit current density results in a polymer solar cell with a power conversion efficiency as high as 6.77%, as certified by the National Renewable Energy Laboratory.
Muscle Stem Cells: A Model System for Adult Stem Cell Biology.
Cornelison, Ddw; Perdiguero, Eusebio
2017-01-01
Skeletal muscle stem cells, originally termed satellite cells for their position adjacent to differentiated muscle fibers, are absolutely required for the process of skeletal muscle repair and regeneration. In the last decade, satellite cells have become one of the most studied adult stem cell systems and have emerged as a standard model not only in the field of stem cell-driven tissue regeneration but also in stem cell dysfunction and aging. Here, we provide background in the field and discuss recent advances in our understanding of muscle stem cell function and dysfunction, particularly in the case of aging, and the potential involvement of muscle stem cells in genetic diseases such as the muscular dystrophies.
Transient HIF2A inhibition promotes satellite cell proliferation and muscle regeneration.
Xie, Liwei; Yin, Amelia; Nichenko, Anna S; Beedle, Aaron M; Call, Jarrod A; Yin, Hang
2018-03-13
The remarkable regeneration capability of skeletal muscle depends on coordinated proliferation and differentiation of satellite cells. The self-renewal of satellite cells is critical for long-term maintenance of muscle regeneration potential. Hypoxia profoundly affects the proliferation, differentiation, and self-renewal of cultured myoblasts. However, the physiological relevance of hypoxia and hypoxia signaling in satellite cells in vivo remains largely unknown. Here, we report that satellite cells are in an intrinsic hypoxic state in vivo and express hypoxia-inducible factor 2A (HIF2A). HIF2A promotes the stemness and long-term homeostatic maintenance of satellite cells by maintaining the quiescence, increasing the self-renewal and blocking the myogenic differentiation of satellite cells. HIF2A stabilization in satellite cells cultured under normoxia augmented their engraftment potential in regenerative muscle. Reversely, HIF2A ablation led to the depletion of satellite cells and the consequent regenerative failure in the long-term. In contrast, transient pharmacological inhibition of HIF2A accelerated muscle regeneration by increasing satellite cell proliferation and differentiation. Mechanistically, HIF2A induces the quiescence/self-renewal of satellite cells by binding the promoter of Spry1 gene and activating Spry1 expression. These findings suggest that HIF2A is a pivotal mediator of hypoxia signaling in satellite cells and may be therapeutically targeted to improve muscle regeneration.
Hanft, Laurin M; McDonald, Kerry S
2010-08-01
According to the Frank-Starling relationship, increased ventricular volume increases cardiac output, which helps match cardiac output to peripheral circulatory demand. The cellular basis for this relationship is in large part the myofilament length-tension relationship. Length-tension relationships in maximally calcium activated preparations are relatively shallow and similar between cardiac myocytes and skeletal muscle fibres. During twitch activations length-tension relationships become steeper in both cardiac and skeletal muscle; however, it remains unclear whether length dependence of tension differs between striated muscle cell types during submaximal activations. The purpose of this study was to compare sarcomere length-tension relationships and the sarcomere length dependence of force development between rat skinned left ventricular cardiac myocytes and fast-twitch and slow-twitch skeletal muscle fibres. Muscle cell preparations were calcium activated to yield 50% maximal force, after which isometric force and rate constants (k(tr)) of force development were measured over a range of sarcomere lengths. Myofilament length-tension relationships were considerably steeper in fast-twitch fibres compared to slow-twitch fibres. Interestingly, cardiac myocyte preparations exhibited two populations of length-tension relationships, one steeper than fast-twitch fibres and the other similar to slow-twitch fibres. Moreover, myocytes with shallow length-tension relationships were converted to steeper length-tension relationships by protein kinase A (PKA)-induced myofilament phosphorylation. Sarcomere length-k(tr) relationships were distinct between all three cell types and exhibited patterns markedly different from Ca(2+) activation-dependent k(tr) relationships. Overall, these findings indicate cardiac myocytes exhibit varied length-tension relationships and sarcomere length appears a dominant modulator of force development rates. Importantly, cardiac myocyte length
Muscle glycogen and cell function--Location, location, location.
Ørtenblad, N; Nielsen, J
2015-12-01
The importance of glycogen, as a fuel during exercise, is a fundamental concept in exercise physiology. The use of electron microscopy has revealed that glycogen is not evenly distributed in skeletal muscle fibers, but rather localized in distinct pools. In this review, we present the available evidence regarding the subcellular localization of glycogen in skeletal muscle and discuss this from the perspective of skeletal muscle fiber function. The distribution of glycogen in the defined pools within the skeletal muscle varies depending on exercise intensity, fiber phenotype, training status, and immobilization. Furthermore, these defined pools may serve specific functions in the cell. Specifically, reduced levels of these pools of glycogen are associated with reduced SR Ca(2+) release, muscle relaxation rate, and membrane excitability. Collectively, the available literature strongly demonstrates that the subcellular localization of glycogen has to be considered to fully understand the role of glycogen metabolism and signaling in skeletal muscle function. Here, we propose that the effect of low muscle glycogen on excitation-contraction coupling may serve as a built-in mechanism, which links the energetic state of the muscle fiber to energy utilization. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Matchkov, Vladimir; Larsen, Per; Bouzinova, Elena V.
2008-01-01
have recently characterized a cGMP-dependent Ca(2+)-activated Cl(-) current with unique characteristics in smooth muscle cells. This novel current has been shown to coexist with a "classic" (cGMP-independent) Ca(2+)-activated Cl(-) current and to have characteristics distinct from those previously...... known for Ca(2+)-activated Cl(-) currents. Here, we suggest that a bestrophin, a product of the Best gene family, is responsible for the cGMP-dependent Ca(2+)-activated Cl(-) current based on similarities between the membrane currents produced by heterologous expressions of bestrophins and the cGMP......-dependent Ca(2+)-activated Cl(-) current. This is supported by similarities in the distribution pattern of the cGMP-dependent Ca(2+)-activated Cl(-) current and bestrophin-3 (the product of Best-3 gene) expression in different smooth muscle. Furthermore, downregulation of Best-3 gene expression with small...
Iptakalim inhibits PDGF-BB-induced human airway smooth muscle cells proliferation and migration
Energy Technology Data Exchange (ETDEWEB)
Liu, Wenrui; Kong, Hui; Zeng, Xiaoning; Wang, Jingjing; Wang, Zailiang; Yan, Xiaopei; Wang, Yanli; Xie, Weiping, E-mail: wpxie@njmu.edu.cn; Wang, Hong, E-mail: hongwang@njmu.edu.cn
2015-08-15
Chronic airway diseases are characterized by airway remodeling which is attributed partly to the proliferation and migration of airway smooth muscle cells (ASMCs). ATP-sensitive potassium (K{sub ATP}) channels have been identified in ASMCs. Mount evidence has suggested that K{sub ATP} channel openers can reduce airway hyperresponsiveness and alleviate airway remodeling. Opening K{sup +} channels triggers K{sup +} efflux, which leading to membrane hyperpolarization, preventing Ca{sup 2+}entry through closing voltage-operated Ca{sup 2+} channels. Intracellular Ca{sup 2+} is the most important regulator of muscle contraction, cell proliferation and migration. K{sup +} efflux decreases Ca{sup 2+} influx, which consequently influences ASMCs proliferation and migration. As a K{sub ATP} channel opener, iptakalim (Ipt) has been reported to restrain the proliferation of pulmonary arterial smooth muscle cells (PASMCs) involved in vascular remodeling, while little is known about its impact on ASMCs. The present study was designed to investigate the effects of Ipt on human ASMCs and the mechanisms underlying. Results obtained from cell counting kit-8 (CCK-8), flow cytometry and 5-ethynyl-2′-deoxyuridine (EdU) incorporation showed that Ipt significantly inhibited platelet-derived growth factor (PDGF)-BB-induced ASMCs proliferation. ASMCs migration induced by PDGF-BB was also suppressed by Ipt in transwell migration and scratch assay. Besides, the phosphorylation of Ca{sup 2+}/calmodulin-dependent kinase II (CaMKII), extracellular regulated protein kinases 1/2 (ERK1/2), protein kinase B (Akt), and cyclic adenosine monophosphate (cAMP) response element binding protein (CREB) were as well alleviated by Ipt administration. Furthermore, we found that the inhibition of Ipt on the PDGF-BB-induced proliferation and migration in human ASMCs was blocked by glibenclamide (Gli), a selective K{sub ATP} channel antagonist. These findings provide a strong evidence to support that Ipt
Extracellular matrix components direct porcine muscle stem cell behavior
International Nuclear Information System (INIS)
Wilschut, Karlijn J.; Haagsman, Henk P.; Roelen, Bernard A.J.
2010-01-01
In muscle tissue, extracellular matrix proteins, together with the vasculature system, muscle-residence cells and muscle fibers, create the niche for muscle stem cells. The niche is important in controlling proliferation and directing differentiation of muscle stem cells to sustain muscle tissue. Mimicking the extracellular muscle environment improves tools exploring the behavior of primary muscle cells. Optimizing cell culture conditions to maintain muscle commitment is important in stem cell-based studies concerning toxicology screening, ex vivo skeletal muscle tissue engineering and in the enhancement of clinical efficiency. We used the muscle extracellular matrix proteins collagen type I, fibronectin, laminin, and also gelatin and Matrigel as surface coatings of tissue culture plastic to resemble the muscle extracellular matrix. Several important factors that determine myogenic commitment of the primary muscle cells were characterized by quantitative real-time RT-PCR and immunofluorescence. Adhesion of high PAX7 expressing satellite cells was improved if the cells were cultured on fibronectin or laminin coatings. Cells cultured on Matrigel and laminin coatings showed dominant integrin expression levels and exhibited an activated Wnt pathway. Under these conditions both stem cell proliferation and myogenic differentiation capacity were superior if compared to cells cultured on collagen type I, fibronectin and gelatin. In conclusion, Matrigel and laminin are the preferred coatings to sustain the proliferation and myogenic differentiation capacity of the primary porcine muscle stem cells, when cells are removed from their natural environment for in vitro culture.
Extracellular matrix components direct porcine muscle stem cell behavior
Energy Technology Data Exchange (ETDEWEB)
Wilschut, Karlijn J. [Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, 3584 CM, Utrecht (Netherlands); Haagsman, Henk P. [Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1, 3584 CL, Utrecht (Netherlands); Roelen, Bernard A.J., E-mail: b.a.j.roelen@uu.nl [Department of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, 3584 CM, Utrecht (Netherlands)
2010-02-01
In muscle tissue, extracellular matrix proteins, together with the vasculature system, muscle-residence cells and muscle fibers, create the niche for muscle stem cells. The niche is important in controlling proliferation and directing differentiation of muscle stem cells to sustain muscle tissue. Mimicking the extracellular muscle environment improves tools exploring the behavior of primary muscle cells. Optimizing cell culture conditions to maintain muscle commitment is important in stem cell-based studies concerning toxicology screening, ex vivo skeletal muscle tissue engineering and in the enhancement of clinical efficiency. We used the muscle extracellular matrix proteins collagen type I, fibronectin, laminin, and also gelatin and Matrigel as surface coatings of tissue culture plastic to resemble the muscle extracellular matrix. Several important factors that determine myogenic commitment of the primary muscle cells were characterized by quantitative real-time RT-PCR and immunofluorescence. Adhesion of high PAX7 expressing satellite cells was improved if the cells were cultured on fibronectin or laminin coatings. Cells cultured on Matrigel and laminin coatings showed dominant integrin expression levels and exhibited an activated Wnt pathway. Under these conditions both stem cell proliferation and myogenic differentiation capacity were superior if compared to cells cultured on collagen type I, fibronectin and gelatin. In conclusion, Matrigel and laminin are the preferred coatings to sustain the proliferation and myogenic differentiation capacity of the primary porcine muscle stem cells, when cells are removed from their natural environment for in vitro culture.
Catechins activate muscle stem cells by Myf5 induction and stimulate muscle regeneration.
Kim, A Rum; Kim, Kyung Min; Byun, Mi Ran; Hwang, Jun-Ha; Park, Jung Il; Oh, Ho Taek; Kim, Hyo Kyeong; Jeong, Mi Gyeong; Hwang, Eun Sook; Hong, Jeong-Ho
2017-07-22
Muscle weakness is one of the most common symptoms in aged individuals and increases risk of mortality. Thus, maintenance of muscle mass is important for inhibiting aging. In this study, we investigated the effect of catechins, polyphenol compounds in green tea, on muscle regeneration. We found that (-)-epicatechin gallate (ECG) and (-)-epigallocatechin-3-gallate (EGCG) activate satellite cells by induction of Myf5 transcription factors. For satellite cell activation, Akt kinase was significantly induced after ECG treatment and ECG-induced satellite cell activation was blocked in the presence of Akt inhibitor. ECG also promotes myogenic differentiation through the induction of myogenic markers, including Myogenin and Muscle creatine kinase (MCK), in satellite and C2C12 myoblast cells. Finally, EGCG administration to mice significantly increased muscle fiber size for regeneration. Taken together, the results suggest that catechins stimulate muscle stem cell activation and differentiation for muscle regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.
Dong, Jiangling; Dong, Yanjun; Chen, Zihong; Mitch, William E; Zhang, Liping
2017-01-01
Fibrosis in skeletal muscle develops after injury or in response to chronic kidney disease (CKD), but the origin of cells becoming fibrous tissue and the initiating and sustaining mechanisms causing muscle fibrosis are unclear. We identified muscle fibro/adipogenic progenitor cells (FAPs) that potentially differentiate into adipose tissues or fibrosis. We also demonstrated that CKD stimulates myostatin production in muscle. Therefore, we tested whether CKD induces myostatin, which stimulates fibrotic differentiation of FAPs leading to fibrosis in skeletal muscles. We isolated FAPs from mouse muscles and found that myostatin stimulates their proliferation and conversion into fibrocytes. In vivo, FAPs isolated from EGFP-transgenic mice (FAPs-EGFP) were transplanted into muscles of mice with CKD or into mouse muscles that were treated with myostatin. CKD or myostatin stimulated FAPs-EGFP proliferation in muscle and increased α-smooth muscle actin expression in FAP-EGFP cells. When myostatin was inhibited with a neutralizing peptibody (a chimeric peptide-Fc fusion protein), the FAP proliferation and muscle fibrosis induced by CKD were both suppressed. Knocking down Smad3 in cultured FAPs interrupted their conversion into fibrocytes, indicating that myostatin directly converts FAPs into fibrocytes. Thus, counteracting myostatin may be a strategy for preventing the development of fibrosis in skeletal muscles of patients with CKD. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
Functional heterogeneity of side population cells in skeletal muscle
International Nuclear Information System (INIS)
Uezumi, Akiyoshi; Ojima, Koichi; Fukada, So-ichiro; Ikemoto, Madoka; Masuda, Satoru; Miyagoe-Suzuki, Yuko; Takeda, Shin'ichi
2006-01-01
Skeletal muscle regeneration has been exclusively attributed to myogenic precursors, satellite cells. A stem cell-rich fraction referred to as side population (SP) cells also resides in skeletal muscle, but its roles in muscle regeneration remain unclear. We found that muscle SP cells could be subdivided into three sub-fractions using CD31 and CD45 markers. The majority of SP cells in normal non-regenerating muscle expressed CD31 and had endothelial characteristics. However, CD31 - CD45 - SP cells, which are a minor subpopulation in normal muscle, actively proliferated upon muscle injury and expressed not only several regulatory genes for muscle regeneration but also some mesenchymal lineage markers. CD31 - CD45 - SP cells showed the greatest myogenic potential among three SP sub-fractions, but indeed revealed mesenchymal potentials in vitro. These SP cells preferentially differentiated into myofibers after intramuscular transplantation in vivo. Our results revealed the heterogeneity of muscle SP cells and suggest that CD31 - CD45 - SP cells participate in muscle regeneration
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Monitoring operating temperature and supply voltage in achieving high system dependability
Khan, M.A.; Kerkhoff, Hans G.
2013-01-01
System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability
Process engineering of high voltage alginate encapsulation of mesenchymal stem cells
International Nuclear Information System (INIS)
Gryshkov, Oleksandr; Pogozhykh, Denys; Zernetsch, Holger; Hofmann, Nicola; Mueller, Thomas; Glasmacher, Birgit
2014-01-01
Encapsulation of stem cells in alginate beads is promising as a sophisticated drug delivery system in treatment of a wide range of acute and chronic diseases. However, common use of air flow encapsulation of cells in alginate beads fails to produce beads with narrow size distribution, intact spherical structure and controllable sizes that can be scaled up. Here we show that high voltage encapsulation (≥ 15 kV) can be used to reproducibly generate spherical alginate beads (200–400 μm) with narrow size distribution (± 5–7%) in a controlled manner under optimized process parameters. Flow rate of alginate solution ranged from 0.5 to 10 ml/h allowed producing alginate beads with a size of 320 and 350 μm respectively, suggesting that this approach can be scaled up. Moreover, we found that applied voltages (15–25 kV) did not alter the viability and proliferation of encapsulated mesenchymal stem cells post-encapsulation and cryopreservation as compared to air flow. We are the first who employed a comparative analysis of electro-spraying and air flow encapsulation to study the effect of high voltage on alginate encapsulated cells. This report provides background in application of high voltage to encapsulate living cells for further medical purposes. Long-term comparison and work on alginate–cell interaction within these structures will be forthcoming. - Highlights: • High voltage alginate encapsulation of mesenchymal stem cells (MSCs) was designed. • Reproducible and spherical alginate beads were generated via high voltage. • Air flow encapsulation was utilized as a comparative approach to high voltage. • High voltage did not alter the viability and proliferation of encapsulated MSCs. • High voltage encapsulation can be scaled up and applied in cell-based therapy
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
Chen, I-Wen Peter; Yang, Ming-Chia; Yang, Chia-Hui; Zhong, Dai-Xuan; Hsu, Ming-Chun; Chen, YiWen
2017-02-15
This is a study on the development of carbon nanotube-based composite actuators using a new ionic liquid-doped electroactive ionic polymer. For scalable production purposes, a simple hot-pressing method was used. Carbon nanotube/ionic liquid-Nafion/carbon nanotube composite films were fabricated that exhibited a large output blocking force and a stable cycling life with low alternating voltage stimuli in air. Of particular interest and importance, a blocking force of 1.5 N was achieved at an applied voltage of 6 V. Operational durability was confirmed by testing in air for over 30 000 cycles (or 43 h). The superior actuation performance of the carbon nanotube/ionic liquid-Nafion/carbon nanotube composite, coupled with easy manufacturability, low driving voltage, and reliable operation, promises great potential for artificial muscle and biomimetic applications.
Chen, Xiankai
2017-12-18
The large voltage losses usually encountered in organic solar cells significantly limit the power conversion efficiencies (PCEs) of these devices, with the result that the current highest PCE values in single-junction organic photovoltaic remain smaller than for other solar cell technologies, such as crystalline silicon or perovskite solar cells. In particular, the nonradiative recombinations to the electronic ground state from the lowest-energy charge-transfer (CT) states at the donor-acceptor interfaces in the active layer of organic devices, are responsible for a significant part of the voltage losses. Here, to better comprehend the nonradiative voltage loss mechanisms, a fully quantum-mechanical rate formula is employed within the framework of time-dependent perturbation theory, combined with density functional theory. The objective is to uncover the specific contributions of intramolecular vibrations to the CT-state nonradiative recombinations in several model systems, which include small-molecule and polymer donors as well as fullerene and nonfullerene acceptors.
Yue, Feng; Bi, Pengpeng; Wang, Chao; Li, Jie; Liu, Xiaoqi; Kuang, Shihuan
2016-11-22
Skeletal muscle stem cells (satellite cells [SCs]) are normally maintained in a quiescent (G 0 ) state. Muscle injury not only activates SCs locally, but also alerts SCs in distant uninjured muscles via circulating factors. The resulting G Alert SCs are adapted to regenerative cues and regenerate injured muscles more efficiently, but whether they provide any long-term benefits to SCs is unknown. Here, we report that embryonic myogenic progenitors lacking the phosphatase and tensin homolog (Pten) exhibit enhanced proliferation and differentiation, resulting in muscle hypertrophy but fewer SCs in adult muscles. Interestingly, Pten null SCs are predominantly in the G Alert state, even in the absence of an injury. The G Alert SCs are deficient in self-renewal and subjected to accelerated depletion during regeneration and aging and fail to repair muscle injury in old mice. Our findings demonstrate a key requirement of Pten in G 0 entry of SCs and provide functional evidence that prolonged G Alert leads to stem cell depletion and regenerative failure. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Dayal, Anamika; Bhat, Vinayakumar; Franzini-Armstrong, Clara; Grabner, Manfred
2013-04-30
The dihydropyridine receptor (DHPR) β1a subunit is crucial for enhancement of DHPR triad expression, assembly of DHPRs in tetrads, and elicitation of DHPRα1S charge movement--the three prerequisites of skeletal muscle excitation-contraction coupling. Despite the ability to fully target α1S into triadic junctions and tetradic arrays, the neuronal isoform β3 was unable to restore considerable charge movement (measure of α1S voltage sensing) upon expression in β1-null zebrafish relaxed myotubes, unlike the other three vertebrate β-isoforms (β1a, β2a, and β4). Thus, we used β3 for chimerization with β1a to investigate whether any of the five distinct molecular regions of β1a is dominantly involved in inducing the voltage-sensing function of α1S. Surprisingly, systematic domain swapping between β1a and β3 revealed a pivotal role of the src homology 3 (SH3) domain and C terminus of β1a in charge movement restoration. More interestingly, β1a SH3 domain and C terminus, when simultaneously engineered into β3 sequence background, were able to fully restore charge movement together with proper intracellular Ca(2+) release, suggesting cooperativity of these two domains in induction of the α1S voltage-sensing function in skeletal muscle excitation-contraction coupling. Furthermore, substitution of a proline by alanine in the putative SH3-binding polyproline motif in the proximal C terminus of β1a (also of β2a and β4) fully obstructed α1S charge movement. Consequently, we postulate a model according to which β subunits, probably via the SH3-C-terminal polyproline interaction, adapt a discrete conformation required to modify the α1S conformation apt for voltage sensing in skeletal muscle.
Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh
2016-08-10
This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.
Directory of Open Access Journals (Sweden)
Wen-Jeng Ho
2016-08-01
Full Text Available This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs and an indium-tin-oxide (ITO electrode with periodic holes (perforations under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.
Tuluc, Petronel; Flucher, Bernhard E
2011-12-01
Voltage-gated calcium channels are multi-subunit protein complexes that specifically allow calcium ions to enter the cell in response to membrane depolarization. But, for many years it seemed that the skeletal muscle calcium channel Ca(V)1.1 is the exception. The classical splice variant Ca(V)1.1a activates slowly, has a very small current amplitude and poor voltage sensitivity. In fact adult muscle fibers work perfectly well even in the absence of calcium influx. Recently a new splice variant of the skeletal muscle calcium channel Ca(V)1.1e has been characterized. The lack of the 19 amino acid exon 29 in this splice variant results in a rapidly activating calcium channel with high current amplitude and good voltage sensitivity. Ca(V)1.1e is the dominant channel in embryonic muscle, where the expression of this high calcium-conducting Ca(V)1.1 isoform readily explains developmental processes depending on L-type calcium currents. Moreover, the availability of these two structurally similar but functionally distinct channel variants facilitates the analysis of the molecular mechanisms underlying the unique current properties of the classical Ca(V)1.1a channel.
Gurriarán-Rodríguez, Uxía; Santos-Zas, Icía; González-Sánchez, Jessica; Beiroa, Daniel; Moresi, Viviana; Mosteiro, Carlos S; Lin, Wei; Viñuela, Juan E; Señarís, José; García-Caballero, Tomás; Casanueva, Felipe F; Nogueiras, Rubén; Gallego, Rosalía; Renaud, Jean-Marc; Adamo, Sergio; Pazos, Yolanda; Camiña, Jesús P
2015-01-01
The development of therapeutic strategies for skeletal muscle diseases, such as physical injuries and myopathies, depends on the knowledge of regulatory signals that control the myogenic process. The obestatin/GPR39 system operates as an autocrine signal in the regulation of skeletal myogenesis. Using a mouse model of skeletal muscle regeneration after injury and several cellular strategies, we explored the potential use of obestatin as a therapeutic agent for the treatment of trauma-induced muscle injuries. Our results evidenced that the overexpression of the preproghrelin, and thus obestatin, and GPR39 in skeletal muscle increased regeneration after muscle injury. More importantly, the intramuscular injection of obestatin significantly enhanced muscle regeneration by simulating satellite stem cell expansion as well as myofiber hypertrophy through a kinase hierarchy. Added to the myogenic action, the obestatin administration resulted in an increased expression of vascular endothelial growth factor (VEGF)/vascular endothelial growth factor receptor 2 (VEGFR2) and the consequent microvascularization, with no effect on collagen deposition in skeletal muscle. Furthermore, the potential inhibition of myostatin during obestatin treatment might contribute to its myogenic action improving muscle growth and regeneration. Overall, our data demonstrate successful improvement of muscle regeneration, indicating obestatin is a potential therapeutic agent for skeletal muscle injury and would benefit other myopathies related to muscle regeneration. PMID:25762009
Energy Technology Data Exchange (ETDEWEB)
Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)
2014-02-21
Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.
Zeng, Ping; Han, Wanhong; Li, Changyin; Li, Hu; Zhu, Dahai; Zhang, Yong; Liu, Xiaohong
2016-09-01
Skeletal muscle mass and homeostasis during postnatal muscle development and regeneration largely depend on adult muscle stem cells (satellite cells). We recently showed that global overexpression of miR-378 significantly reduced skeletal muscle mass in mice. In the current study, we used miR-378 transgenic (Tg) mice to assess the in vivo functional effects of miR-378 on skeletal muscle growth and regeneration. Cross-sectional analysis of skeletal muscle tissues showed that the number and size of myofibers were significantly lower in miR-378 Tg mice than in wild-type mice. Attenuated cardiotoxin-induced muscle regeneration in miR-378 Tg mice was found to be associated with delayed satellite cell activation and differentiation. Mechanistically, miR-378 was found to directly target Igf1r in muscle cells both in vitro and in vivo These miR-378 Tg mice may provide a model for investigating the physiological and pathological roles of skeletal muscle in muscle-associated diseases in humans, particularly in sarcopenia. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Vitamin K2 improves proliferation and migration of bovine skeletal muscle cells in vitro.
Rønning, Sissel Beate; Pedersen, Mona Elisabeth; Berg, Ragnhild Stenberg; Kirkhus, Bente; Rødbotten, Rune
2018-01-01
Skeletal muscle function is highly dependent on the ability to regenerate, however, during ageing or disease, the proliferative capacity is reduced, leading to loss of muscle function. We have previously demonstrated the presence of vitamin K2 in bovine skeletal muscles, but whether vitamin K has a role in muscle regulation and function is unknown. In this study, we used primary bovine skeletal muscle cells, cultured in monolayers in vitro, to assess a potential effect of vitamin K2 (MK-4) during myogenesis of muscle cells. Cell viability experiments demonstrate that the amount of ATP produced by the cells was unchanged when MK-4 was added, indicating viable cells. Cytotoxicity analysis show that MK-4 reduced the lactate dehydrogenase (LDH) released into the media, suggesting that MK-4 was beneficial to the muscle cells. Cell migration, proliferation and differentiation was characterised after MK-4 incubation using wound scratch analysis, immunocytochemistry and real-time PCR analysis. Adding MK-4 to the cells led to an increased muscle proliferation, increased gene expression of the myogenic transcription factor myod as well as increased cell migration. In addition, we observed a reduction in the fusion index and relative gene expression of muscle differentiation markers, with fewer complex myotubes formed in MK-4 stimulated cells compared to control cells, indicating that the MK-4 plays a significant role during the early phases of muscle proliferation. Likewise, we see the same pattern for the relative gene expression of collagen 1A, showing increased gene expression in proliferating cells, and reduced expression in differentiating cells. Our results also suggest that MK-4 incubation affect low density lipoprotein receptor-related protein 1 (LRP1) and the low-density lipoprotein receptor (LDLR) with a peak in gene expression after 45 min of MK-4 incubation. Altogether, our experiments show that MK-4 has a positive effect on muscle cell migration and
Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma
Directory of Open Access Journals (Sweden)
Wei Wang
2014-01-01
Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.
Fry, Christopher S; Kirby, Tyler J; Kosmac, Kate; McCarthy, John J; Peterson, Charlotte A
2017-01-05
Satellite cells, the predominant stem cell population in adult skeletal muscle, are activated in response to hypertrophic stimuli and give rise to myogenic progenitor cells (MPCs) within the extracellular matrix (ECM) that surrounds myofibers. This ECM is composed largely of collagens secreted by interstitial fibrogenic cells, which influence satellite cell activity and muscle repair during hypertrophy and aging. Here we show that MPCs interact with interstitial fibrogenic cells to ensure proper ECM deposition and optimal muscle remodeling in response to hypertrophic stimuli. MPC-dependent ECM remodeling during the first week of a growth stimulus is sufficient to ensure long-term myofiber hypertrophy. MPCs secrete exosomes containing miR-206, which represses Rrbp1, a master regulator of collagen biosynthesis, in fibrogenic cells to prevent excessive ECM deposition. These findings provide insights into how skeletal stem and progenitor cells interact with other cell types to actively regulate their extracellular environments for tissue maintenance and adaptation. Copyright © 2017 Elsevier Inc. All rights reserved.
Single-nanowire, low-bandgap hot carrier solar cells with tunable open-circuit voltage
Limpert, Steven; Burke, Adam; Chen, I.-Ju; Anttu, Nicklas; Lehmann, Sebastian; Fahlvik, Sofia; Bremner, Stephen; Conibeer, Gavin; Thelander, Claes; Pistol, Mats-Erik; Linke, Heiner
2017-10-01
Compared to traditional pn-junction photovoltaics, hot carrier solar cells offer potentially higher efficiency by extracting work from the kinetic energy of photogenerated ‘hot carriers’ before they cool to the lattice temperature. Hot carrier solar cells have been demonstrated in high-bandgap ferroelectric insulators and GaAs/AlGaAs heterostructures, but so far not in low-bandgap materials, where the potential efficiency gain is highest. Recently, a high open-circuit voltage was demonstrated in an illuminated wurtzite InAs nanowire with a low bandgap of 0.39 eV, and was interpreted in terms of a photothermoelectric effect. Here, we point out that this device is a hot carrier solar cell and discuss its performance in those terms. In the demonstrated devices, InP heterostructures are used as energy filters in order to thermoelectrically harvest the energy of hot electrons photogenerated in InAs absorber segments. The obtained photovoltage depends on the heterostructure design of the energy filter and is therefore tunable. By using a high-resistance, thermionic barrier, an open-circuit voltage is obtained that is in excess of the Shockley-Queisser limit. These results provide generalizable insight into how to realize high voltage hot carrier solar cells in low-bandgap materials, and therefore are a step towards the demonstration of higher efficiency hot carrier solar cells.
Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation
Energy Technology Data Exchange (ETDEWEB)
Nagata, Yosuke, E-mail: cynagata@mail.ecc.u-tokyo.ac.jp; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi
2014-08-01
Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its
Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation
International Nuclear Information System (INIS)
Nagata, Yosuke; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi
2014-01-01
Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its
DEFF Research Database (Denmark)
Garau, Gianpiero; Magotti, Paola; Heine, Martin
2015-01-01
Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...
Voltage-gated sodium channels in taste bud cells
Directory of Open Access Journals (Sweden)
Williams Mark E
2009-03-01
Full Text Available Abstract Background Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. Results We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. Conclusion SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.
Voltage-gated sodium channels in taste bud cells.
Gao, Na; Lu, Min; Echeverri, Fernando; Laita, Bianca; Kalabat, Dalia; Williams, Mark E; Hevezi, Peter; Zlotnik, Albert; Moyer, Bryan D
2009-03-12
Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.
Directory of Open Access Journals (Sweden)
Erin K Purcell
Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.
Nih, Lina R; Deroide, Nicolas; Leré-Déan, Carole; Lerouet, Dominique; Soustrat, Mathieu; Levy, Bernard I; Silvestre, Jean-Sébastien; Merkulova-Rainon, Tatiana; Pocard, Marc; Margaill, Isabelle; Kubis, Nathalie
2012-04-01
Pro-angiogenic cell-based therapies constitute an interesting and attractive approach to enhancing post-stroke neurogenesis and decreasing neurological deficit. However, most new stroke-induced neurons die during the first few weeks after ischemia, thus impairing total recovery. Although the neovascularization process involves different cell types and various growth factors, most cell therapy protocols are based on the biological effects of single-cell-type populations or on the administration of heterogeneous populations of progenitors, namely human cord blood-derived CD34(+) cells, with scarce vascular progenitor cells. Tight cooperation between endothelial cells and smooth muscle cells/pericytes is critical for the development of functional neovessels. We hypothesized that neuroblast survival in stroke brain depends on mature vascular network formation. In this study, we injected a combination of endothelial progenitor cells (EPCs) and smooth muscle progenitor cells (SMPCs), isolated from human umbilical cord blood, into a murine model of permanent focal ischemia induced by middle cerebral artery occlusion. The co-administration of SMPCs and EPCs induced enhanced angiogenesis and vascular remodeling in the peri-infarct and infarct areas, where vessels exhibited a more mature phenotype. This activation of vessel growth resulted in the maintenance of neurogenesis and neuroblast migration to the peri-ischemic cortex. Our data suggest that a mature vascular network is essential for neuroblast survival after cerebral ischemia, and that co-administration of EPCs and SMPCs may constitute a novel therapeutic strategy for improving the treatment of stroke. © 2012 The Authors. European Journal of Neuroscience © 2012 Federation of European Neuroscience Societies and Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Jolene Atia
2016-04-01
Full Text Available Uterine smooth muscle cells remain quiescent throughout most of gestation, only generating spontaneous action potentials immediately prior to, and during, labor. This study presents a method that combines transcriptomics with biophysical recordings to characterise the conductance repertoire of these cells, the 'conductance repertoire' being the total complement of ion channels and transporters expressed by an electrically active cell. Transcriptomic analysis provides a set of potential electrogenic entities, of which the conductance repertoire is a subset. Each entity within the conductance repertoire was modeled independently and its gating parameter values were fixed using the available biophysical data. The only remaining free parameters were the surface densities for each entity. We characterise the space of combinations of surface densities (density vectors consistent with experimentally observed membrane potential and calcium waveforms. This yields insights on the functional redundancy of the system as well as its behavioral versatility. Our approach couples high-throughput transcriptomic data with physiological behaviors in health and disease, and provides a formal method to link genotype to phenotype in excitable systems. We accurately predict current densities and chart functional redundancy. For example, we find that to evoke the observed voltage waveform, the BK channel is functionally redundant whereas hERG is essential. Furthermore, our analysis suggests that activation of calcium-activated chloride conductances by intracellular calcium release is the key factor underlying spontaneous depolarisations.
Differentiation of Human Adipose Derived Stem Cells into Smooth Muscle Cells Is Modulated by CaMKIIγ
Directory of Open Access Journals (Sweden)
Kaisaier Aji
2016-01-01
Full Text Available The multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII is known to participate in maintenance and switches of smooth muscle cell (SMC phenotypes. However, which isoform of CaMKII is involved in differentiation of adult mesenchymal stem cells into contractile SMCs remains unclear. In the present study, we detected γ isoform of CaMKII in differentiation of human adipose derived stem cells (hASCs into SMCs that resulted from treatment with TGF-β1 and BMP4 in combination for 7 days. The results showed that CaMKIIγ increased gradually during differentiation of hASCs as determined by real-time PCR and western blot analysis. The siRNA-mediated knockdown of CaMKIIγ decreased the protein levels and transcriptional levels of smooth muscle contractile markers (a-SMA, SM22a, calponin, and SM-MHC, while CaMKIIγ overexpression increases the transcriptional and protein levels of smooth muscle contractile markers. These results suggested that γ isoform of CaMKII plays a significant role in smooth muscle differentiation of hASCs.
Pavlath, G K; Thaloor, D; Rando, T A; Cheong, M; English, A W; Zheng, B
1998-08-01
Skeletal muscle has a remarkable capacity to regenerate after injury, although studies of muscle regeneration have heretofore been limited almost exclusively to limb musculature. Muscle precursor cells in skeletal muscle are responsible for the repair of damaged muscle. Heterogeneity exists in the growth and differentiation properties of muscle precursor cell (myoblast) populations throughout limb development but whether the muscle precursor cells differ among adult skeletal muscles is unknown. Such heterogeneity among myoblasts in the adult may give rise to skeletal muscles with different regenerative capacities. Here we compare the regenerative response of a masticatory muscle, the masseter, to that of limb muscles. After exogenous trauma (freeze or crush injuries), masseter muscle regenerated much less effectively than limb muscle. In limb muscle, normal architecture was restored 12 days after injury, whereas in masseter muscle, minimal regeneration occurred during the same time period. Indeed, at late time points, masseter muscles exhibited increased fibrous connective tissue in the region of damage, evidence of ineffective muscle regeneration. Similarly, in response to endogenous muscle injury due to a muscular dystrophy, widespread evidence of impaired regeneration was present in masseter muscle but not in limb muscle. To explore the cellular basis of these different regenerative capacities, we analyzed the myoblast populations of limb and masseter muscles both in vivo and in vitro. From in vivo analyses, the number of myoblasts in regenerating muscle was less in masseter compared with limb muscle. Assessment of population growth in vitro indicated that masseter myoblasts grow more slowly than limb myoblasts under identical conditions. We conclude that the impaired regeneration in masseter muscles is due to differences in the intrinsic myoblast populations compared to limb muscles.
Pervasive satellite cell contribution to uninjured adult muscle fibers.
Pawlikowski, Bradley; Pulliam, Crystal; Betta, Nicole Dalla; Kardon, Gabrielle; Olwin, Bradley B
2015-01-01
Adult skeletal muscle adapts to functional needs, maintaining consistent numbers of myonuclei and stem cells. Although resident muscle stem cells or satellite cells are required for muscle growth and repair, in uninjured muscle, these cells appear quiescent and metabolically inactive. To investigate the satellite cell contribution to myofibers in adult uninjured skeletal muscle, we labeled satellite cells by inducing a recombination of LSL-tdTomato in Pax7(CreER) mice and scoring tdTomato+ myofibers as an indicator of satellite cell fusion. Satellite cell fusion into myofibers plateaus postnatally between 8 and 12 weeks of age, reaching a steady state in hindlimb muscles, but in extra ocular or diaphragm muscles, satellite cell fusion is maintained at postnatal levels irrespective of the age assayed. Upon recombination and following a 2-week chase in 6-month-old mice, tdTomato-labeled satellite cells fused into myofibers as 20, 50, and 80 % of hindlimb, extra ocular, and diaphragm myofibers, respectively, were tdTomato+. Satellite cells contribute to uninjured myofibers either following a cell division or directly without an intervening cell division. The frequency of satellite cell fusion into the skeletal muscle fibers is greater than previously estimated, suggesting an important functional role for satellite cell fusion into adult myofibers and a requirement for active maintenance of satellite cell numbers in uninjured skeletal muscle.
Directory of Open Access Journals (Sweden)
Ana Isabel Fernández-Mariño
Full Text Available Despite the substantial knowledge on the antidiabetic, antiobesity and antihypertensive actions of tungstate, information on its primary target/s is scarce. Tungstate activates both the ERK1/2 pathway and the vascular voltage- and Ca2+-dependent large-conductance BKαβ1 potassium channel, which modulates vascular smooth muscle cell (VSMC proliferation and function, respectively. Here, we have assessed the possible involvement of BKαβ1 channels in the tungstate-induced ERK phosphorylation and its relevance for VSMC proliferation. Western blot analysis in HEK cell lines showed that expression of vascular BKαβ1 channels potentiates the tungstate-induced ERK1/2 phosphorylation in a Gi/o protein-dependent manner. Tungstate activated BKαβ1 channels upstream of G proteins as channel activation was not altered by the inhibition of G proteins with GDPβS or pertussis toxin. Moreover, analysis of Gi/o protein activation measuring the FRET among heterologously expressed Gi protein subunits suggested that tungstate-targeting of BKαβ1 channels promotes G protein activation. Single channel recordings on VSMCs from wild-type and β1-knockout mice indicated that the presence of the regulatory β1 subunit was essential for the tungstate-mediated activation of BK channels in VSMCs. Moreover, the specific BK channel blocker iberiotoxin lowered tungstate-induced ERK phosphorylation by 55% and partially reverted (by 51% the tungstate-produced reduction of platelet-derived growth factor (PDGF-induced proliferation in human VSMCs. Our observations indicate that tungstate-targeting of BKαβ1 channels promotes activation of PTX-sensitive Gi proteins to enhance the tungstate-induced phosphorylation of ERK, and inhibits PDGF-stimulated cell proliferation in human vascular smooth muscle.
Study of muscle cell dedifferentiation after skeletal muscle injury of mice with a Cre-Lox system.
Mu, Xiaodong; Peng, Hairong; Pan, Haiying; Huard, Johnny; Li, Yong
2011-02-03
Dedifferentiation of muscle cells in the tissue of mammals has yet to be observed. One of the challenges facing the study of skeletal muscle cell dedifferentiation is the availability of a reliable model that can confidentially distinguish differentiated cell populations of myotubes and non-fused mononuclear cells, including stem cells that can coexist within the population of cells being studied. In the current study, we created a Cre/Lox-β-galactosidase system, which can specifically tag differentiated multinuclear myotubes and myotube-generated mononuclear cells based on the activation of the marker gene, β-galactosidase. By using this system in an adult mouse model, we found that β-galactosidase positive mononuclear cells were generated from β-galactosidase positive multinuclear myofibers upon muscle injury. We also demonstrated that these mononuclear cells can develop into a variety of different muscle cell lineages, i.e., myoblasts, satellite cells, and muscle derived stem cells. These novel findings demonstrated, for the first time, that cellular dedifferentiation of skeletal muscle cells actually occurs in mammalian skeletal muscle following traumatic injury in vivo.
Liu, Jinxu; Tu, Huiyin; Zhang, Dongze; Zheng, Hong; Li, Yu-Long
2012-10-25
The generation of action potential is required for stimulus-evoked neurotransmitter release in most neurons. Although various voltage-gated ion channels are involved in action potential production, the initiation of the action potential is mainly mediated by voltage-gated Na+ channels. In the present study, differentiation-induced changes of mRNA and protein expression of Na+ channels, Na+ currents, and cell membrane excitability were investigated in NG108-15 cells. Whole-cell patch-clamp results showed that differentiation (9 days) didn't change cell membrane excitability, compared to undifferentiated state. But differentiation (21 days) induced the action potential generation in 45.5% of NG108-15 cells (25/55 cells). In 9-day-differentiated cells, Na+ currents were mildly increased, which was also found in 21-day differentiated cells without action potential. In 21-day differentiated cells with action potential, Na+ currents were significantly enhanced. Western blot data showed that the expression of Na+ channels was increased with differentiated-time dependent manner. Single-cell real-time PCR data demonstrated that the expression of Na+ channel mRNA was increased by 21 days of differentiation in NG108-15 cells. More importantly, the mRNA level of Na+ channels in cells with action potential was higher than that in cells without action potential. Differentiation induces expression of voltage-gated Na+ channels and action potential generation in NG108-15 cells. A high level of the Na+ channel density is required for differentiation-triggered action potential generation.
Tissue-specific stem cells: Lessons from the skeletal muscle satellite cell
Brack, Andrew S.; Rando, Thomas A.
2012-01-01
In 1961, the satellite cell was first identified when electron microscopic examination of skeletal muscle demonstrated a cell wedged between the plasma membrane of the muscle fiber and the basement membrane. In recent years it has been conclusively demonstrated that the satellite cell is the primary cellular source for muscle regeneration and is equipped with the potential to self renew, thus functioning as a bone fide skeletal muscle stem cell (MuSC). As we move past the 50th anniversary of the satellite cell, we take this opportunity to discuss the current state of the art and dissect the unknowns in the MuSC field. PMID:22560074
A new Zero-Voltage-Transition PWM switching cell
Energy Technology Data Exchange (ETDEWEB)
Grigore, V. [Electronics and Telecommunications Faculty `Politebuica` University Bucharest (Romania); Kyyrae, J. [Helsinki University of Technology, Otaniemi (Finland): Institute of Intelligent Power Electronics
1997-12-31
In this paper a new Zero-Voltage-Transition (ZVT) PWM switching cell is presented. The proposed switching cell is composed of the normal hard-switched PWM cell (consisting of one active switch and one passive switch), plus an auxiliary circuit (consisting of one active switch and some reactive components). The auxiliary circuit is inactive during the ON and OFF intervals of the switches in the normal PWM switch. However, the transitions between the two states are controlled by the auxiliary circuit. Prior to turn-on, the voltage across the active switch in the PWM cell is forced to zero, thus the turn-on losses of the active switch are practically eliminated. At turn-off the auxiliary circuit behaves like a non-dissipative passive snubber reducing the turn-off losses to a great extent. Zero-Voltage-Transition switching technique almost eliminates switching losses. The active switch operates under ZVT conditions, the passive switch (diode) has a controlled reverse recovery, and the switch in the auxiliary circuit operates under Zero-Current-Switching (ZCS) conditions. (orig.) 6 refs.
Yamaguchi, Shinji; Kurokawa, Tatsuki; Taira, Ikuko; Aoki, Naoya; Sakata, Souhei; Okamura, Yasushi; Homma, Koichi J
2014-04-01
Voltage-sensing phosphatase, VSP, consists of the transmembrane domain, operating as the voltage sensor, and the cytoplasmic domain with phosphoinositide-phosphatase activities. The voltage sensor tightly couples with the cytoplasmic phosphatase and membrane depolarization induces dephosphorylation of several species of phosphoinositides. VSP gene is conserved from urochordate to human. There are some diversities among VSP ortholog proteins; range of voltage of voltage sensor motions as well as substrate selectivity. In contrast with recent understandings of biophysical mechanisms of VSPs, little is known about its physiological roles. Here we report that chick ortholog of VSP (designated as Gg-VSP) induces morphological feature of cell process outgrowths with round cell body in DF-1 fibroblasts upon its forced expression. Expression of the voltage sensor mutant, Gg-VSPR153Q with shifted voltage dependence to a lower voltage led to more frequent changes of cell morphology than the wild-type protein. Coexpression of PTEN that dephosphorylates PI(3,4)P2 suppressed this effect by Gg-VSP, indicating that the increase of PI(3,4)P2 leads to changes of cell shape. In addition, visualization of PI(3,4)P2 with the fluorescent protein fused with the TAPP1-derived pleckstrin homology (PH) domain suggested that Gg-VSP influenced the distribution of PI(3,4)P2 . These findings raise a possibility that one of the VSP's functions could be to regulate cell morphology through voltage-sensitive tuning of phosphoinositide profile. © 2013 Wiley Periodicals, Inc.
Voltage-dependent amplification of synaptic inputs in respiratory motoneurones
Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A
2012-01-01
The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582
DEFF Research Database (Denmark)
Saclier, Marielle; Yacoub-Youssef, Houda; Mackey, Abigail
2013-01-01
, we explored both in vitro and in vivo, in human, the interactions of differentially activated MPs with myogenic precursor cells (MPCs) during adult myogenesis and skeletal muscle regeneration. We showed in vitro that through the differential secretion of cytokines and growth factors, proinflammatory...... anti-inflammatory markers. These data demonstrate for the first time in human that MPs sequentially orchestrate adult myogenesis during regeneration of damaged skeletal muscle. These results support the emerging concept that inflammation, through MP activation, controls stem cell fate and coordinates......Macrophages (MPs) exert either beneficial or deleterious effects on tissue repair, depending on their activation/polarization state. They are crucial for adult skeletal muscle repair, notably by acting on myogenic precursor cells. However, these interactions have not been fully characterized. Here...
Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites
Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.
2000-01-01
We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...
International Nuclear Information System (INIS)
Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika
2006-01-01
An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)
Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R
2003-03-01
The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.
Engineered matrices for skeletal muscle satellite cell engraftment and function.
Han, Woojin M; Jang, Young C; García, Andrés J
2017-07-01
Regeneration of traumatically injured skeletal muscles is severely limited. Moreover, the regenerative capacity of skeletal muscle declines with aging, further exacerbating the problem. Recent evidence supports that delivery of muscle satellite cells to the injured muscles enhances muscle regeneration and reverses features of aging, including reduction in muscle mass and regenerative capacity. However, direct delivery of satellite cells presents a challenge at a translational level due to inflammation and donor cell death, motivating the need to develop engineered matrices for muscle satellite cell delivery. This review will highlight important aspects of satellite cell and their niche biology in the context of muscle regeneration, and examine recent progresses in the development of engineered cell delivery matrices designed for skeletal muscle regeneration. Understanding the interactions of muscle satellite cells and their niche in both native and engineered systems is crucial to developing muscle pathology-specific cell- and biomaterial-based therapies. Copyright © 2016 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
Caffeine and length dependence of staircase potentiation in skeletal muscle.
Rassier, D E; Tubman, L A; MacIntosh, B R
1998-01-01
Skeletal muscle sensitivity to Ca2+ is greater at long lengths, and this results in an optimal length for twitch contractions that is longer than optimal length for tetanic contractions. Caffeine abolishes this length dependence of Ca2+ sensitivity. Muscle length (ML) also affects the degree of staircase potentiation. Since staircase potentiation is apparently caused by an increased Ca2+ sensitivity of the myofilaments, we tested the hypothesis that caffeine depresses the length dependence of staircase potentiation. In situ isometric twitch contractions of rat gastrocnemius muscle before and after 10 s of 10-Hz stimulation were analyzed at seven different lengths to evaluate the length dependence of staircase potentiation. In the absence of caffeine, length dependence of Ca2+ sensitivity was observed, and the degree of potentiation after 10-Hz stimulation showed a linear decrease with increased length (DT = 1.47 - 0.05 ML, r2 = 0.95, where DT is developed tension). Length dependence of Ca2+ sensitivity was decreased by caffeine when caffeine was administered in amounts estimated to result in 0.5 and 0.75 mM concentrations. Furthermore, the negative slope of the relationship between staircase potentiation and muscle length was diminished at the lower caffeine dose, and the slope was not different from zero after the higher dose (DT = 1.53 - 0.009 ML, r2 = 0.43). Our study shows that length dependence of Ca2+ sensitivity in intact skeletal muscle is diminished by caffeine. Caffeine also suppressed the length dependence of staircase potentiation, suggesting that the mechanism of this length dependence may be closely related to the mechanism for length dependence of Ca2+ sensitivity.
International Nuclear Information System (INIS)
Yamacli, Serhan; Avci, Mutlu
2009-01-01
In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.
Brain and muscle Arnt-like 1 promotes skeletal muscle regeneration through satellite cell expansion
Energy Technology Data Exchange (ETDEWEB)
Chatterjee, Somik [Center for Diabetes Research, Department of Medicine, Houston Methodist Research Institute, Houston, TX 77030 (United States); Yin, Hongshan [Center for Diabetes Research, Department of Medicine, Houston Methodist Research Institute, Houston, TX 77030 (United States); Department of Cardiovascular Medicine, Third Affiliated Hospital, Hebei Medical University, Shijiazhuang 050051, Hebei (China); Nam, Deokhwa [Center for Diabetes Research, Department of Medicine, Houston Methodist Research Institute, Houston, TX 77030 (United States); Li, Yong [Department of Pediatric Surgery, Center for Stem Cell Research and Regenerative Medicine, University of Texas Health Science Center at Houston, Houston, TX 77030 (United States); Ma, Ke, E-mail: kma@houstonmethodist.org [Center for Diabetes Research, Department of Medicine, Houston Methodist Research Institute, Houston, TX 77030 (United States)
2015-02-01
Circadian clock is an evolutionarily conserved timing mechanism governing diverse biological processes and the skeletal muscle possesses intrinsic functional clocks. Interestingly, although the essential clock transcription activator, Brain and muscle Arnt-like 1 (Bmal1), participates in maintenance of muscle mass, little is known regarding its role in muscle growth and repair. In this report, we investigate the in vivo function of Bmal1 in skeletal muscle regeneration using two muscle injury models. Bmal1 is highly up-regulated by cardiotoxin injury, and its genetic ablation significantly impairs regeneration with markedly suppressed new myofiber formation and attenuated myogenic induction. A similarly defective regenerative response is observed in Bmal1-null mice as compared to wild-type controls upon freeze injury. Lack of satellite cell expansion accounts for the regeneration defect, as Bmal1{sup −/−} mice display significantly lower satellite cell number with nearly abolished induction of the satellite cell marker, Pax7. Furthermore, satellite cell-derived primary myoblasts devoid of Bmal1 display reduced growth and proliferation ex vivo. Collectively, our results demonstrate, for the first time, that Bmal1 is an integral component of the pro-myogenic response that is required for muscle repair. This mechanism may underlie its role in preserving adult muscle mass and could be targeted therapeutically to prevent muscle-wasting diseases. - Highlights: • Bmal1 is highly inducible by muscle injury and myogenic stimuli. • Genetic ablation of Bmal1 significantly impairs muscle regeneration. • Bmal1 promotes satellite cell expansion during muscle regeneration. • Bmal1-deficient primary myoblasts display attenuated growth and proliferation.
Brain and muscle Arnt-like 1 promotes skeletal muscle regeneration through satellite cell expansion
International Nuclear Information System (INIS)
Chatterjee, Somik; Yin, Hongshan; Nam, Deokhwa; Li, Yong; Ma, Ke
2015-01-01
Circadian clock is an evolutionarily conserved timing mechanism governing diverse biological processes and the skeletal muscle possesses intrinsic functional clocks. Interestingly, although the essential clock transcription activator, Brain and muscle Arnt-like 1 (Bmal1), participates in maintenance of muscle mass, little is known regarding its role in muscle growth and repair. In this report, we investigate the in vivo function of Bmal1 in skeletal muscle regeneration using two muscle injury models. Bmal1 is highly up-regulated by cardiotoxin injury, and its genetic ablation significantly impairs regeneration with markedly suppressed new myofiber formation and attenuated myogenic induction. A similarly defective regenerative response is observed in Bmal1-null mice as compared to wild-type controls upon freeze injury. Lack of satellite cell expansion accounts for the regeneration defect, as Bmal1 −/− mice display significantly lower satellite cell number with nearly abolished induction of the satellite cell marker, Pax7. Furthermore, satellite cell-derived primary myoblasts devoid of Bmal1 display reduced growth and proliferation ex vivo. Collectively, our results demonstrate, for the first time, that Bmal1 is an integral component of the pro-myogenic response that is required for muscle repair. This mechanism may underlie its role in preserving adult muscle mass and could be targeted therapeutically to prevent muscle-wasting diseases. - Highlights: • Bmal1 is highly inducible by muscle injury and myogenic stimuli. • Genetic ablation of Bmal1 significantly impairs muscle regeneration. • Bmal1 promotes satellite cell expansion during muscle regeneration. • Bmal1-deficient primary myoblasts display attenuated growth and proliferation
Directory of Open Access Journals (Sweden)
Ae-Rang Hwang
Full Text Available Advanced glycation endproduct (AGE-induced vascular smooth muscle cell (VSMC proliferation and reactive oxygen species (ROS production are emerging as important mechanisms of diabetic vasculopathy, but little is known about the molecular mechanism responsible for the antioxidative effects of statins on AGEs. It has been reported that statins exert pleiotropic effects on the cardiovascular system due to decreases in AGE-induced cell proliferation, migration, and vascular inflammation. Thus, in the present study, the authors investigated the molecular mechanism by which statins decrease AGE-induced cell proliferation and VSMC migration. In cultured VSMCs, statins upregulated Nrf2-related antioxidant gene, NQO1 and HO-1, via an ERK5-dependent Nrf2 pathway. Inhibition of ERK5 by siRNA or BIX02189 (a specific ERK5 inhibitor reduced the statin-induced upregulations of Nrf2, NQO1, and HO-1. Furthermore, fluvastatin was found to significantly increase ARE promoter activity through ERK5 signaling, and to inhibit AGE-induced VSMC proliferation and migration as determined by MTT assay, cell counting, FACS analysis, a wound scratch assay, and a migration chamber assay. In addition, AGE-induced proliferation was diminished in the presence of Ad-CA-MEK5α encoding a constitutively active mutant form of MEK5α (an upstream kinase of ERK5, whereas depletion of Nrf2 restored statin-mediated reduction of AGE-induced cell proliferation. Moreover, fluvastatin suppressed the protein expressions of cyclin D1 and Cdk4, but induced p27, and blocked VSMC proliferation by regulating cell cycle. These results suggest statin-induced activation of an ERK5-dependent Nrf2 pathway reduces VSMC proliferation and migration induced by AGEs, and that the ERK5-Nrf2 signal module be viewed as a potential therapeutic target of vasculopathy in patients with diabetes and complications of the disease.
DEFF Research Database (Denmark)
Hellsten, Ylva; Frandsen, Ulrik
1997-01-01
1. The present study examined the capacity for adenosine formation, uptake and metabolism in contracting primary rat muscle cells and in microvascular endothelial cells in culture. 2. Strong and moderate electrical simulation of skeletal muscle cells led to a significantly greater increase....... 3. Addition of microvascular endothelial cells to the cultured skeletal muscle cells enhanced the contraction-induced accumulation of extracellular adenosine (P Skeletal muscle cells were...... in the extracellular adenosine concentration (421 +/- 91 and 235 +/- 30 nmol (g protein)-1, respectively; P muscle cells (161 +/- 20 nmol (g protein)-1). The ATP concentration was lower (18%; P contracted, but not in the moderately contracted muscle cells...
Dechraoui, Marie-Yasmine Bottein; Wacksman, Jeremy J; Ramsdell, John S
2006-11-01
Brevetoxins (PbTxs) and ciguatoxins (CTXs) are two suites of dinoflagellate derived marine polyether neurotoxins that target the voltage gated sodium channel (VGSC). PbTxs are commonly responsible for massive fish kills and unusual mortalities in marine mammals. CTXs, more often noted for human intoxication, are suspected causes of fish and marine mammal intoxication, although this has never been reported in the field. VGSCs, present in the membrane of all excitable cells including those found in skeletal muscle, nervous and heart tissues, are found as isoforms with differential expression within species and tissues. To investigate the tissue and species susceptibility to these biotoxins, we determined the relative affinity of PbTx-2 and -3 and P-CTX-1 to native VGSCs in the brain, heart, and skeletal muscle of rat and the marine teleost fish Centropristis striata by competitive binding in the presence of [(3)H]PbTx-3. No differences between rat and fish were observed in the binding of PbTxs and CTX to either brain or skeletal muscle. However, [(3)H]PbTx-3 showed substantial lower affinity to rat heart tissue while in the fish it bound with the same affinity to heart than to brain or skeletal muscle. These new insights into PbTxs and CTXs binding in fish and mammalian excitable tissues indicate a species related resistance of heart VGSC in the rat; yet, with comparable sensitivity between the species for brain and skeletal muscle.
Freund-Michel, Véronique; Frossard, Nelly
2008-10-01
Trafficking of the TrkA receptor after stimulation by NGF is of emerging importance in structural cells in the context of airway inflammatory diseases. We have recently reported the expression of functional TrkA receptors in human airway smooth muscle cells (HASMC). We have here studied the TrkA trafficking mechanisms in these cells. TrkA disappearance from the cell membrane was induced within 5 min of NGF (3pM) stimulation. Co-immunoprecipitation of clathrin-TrkA was revealed, and TrkA internalisation inhibited either by clathrin inhibitors or by siRNA inducing downregulation of endogenous clathrin. TrkA internalised receptors were totally degraded in lysosomes, with no recycling phenomenon. Newly synthesized TrkA receptors were thereafter re-expressed at the cell membrane within 10 h. TrkA re-synthesis was inhibited by blockade of clathrin-dependent internalisation, but not of TrkA receptors lysosomal degradation. Finally, we observed that NGF multiple stimulations progressively increased TrkA expression in HASMC, which was associated with an increase in NGF/TrkA-dependent proliferation. In conclusion, we show here the occurrence of clathrin-dependent TrkA internalisation and lysosomal degradation in the airway smooth muscle, followed by upregulated re-synthesis of functional TrkA receptors and increased proliferative effect in the human airway smooth muscle. This may have pathophysiological consequences in airway inflammatory diseases.
Hamster thecal cells express muscle characteristics
International Nuclear Information System (INIS)
Self, D.A.; Schroeder, P.C.; Gown, A.M.
1988-01-01
Contraction of the follicular wall about the time of ovulation appears to be a coordinated event; however, the cells that mediate it remain poorly studied. We examined the theca externa cells in the wall of hamster follicles for the presence of a functional actomyosin system, both in developing follicles and in culture. We used a monoclonal antibody (HHF35) that recognizes the alpha and gamma isoelectric variants of actin normally found in muscle, but not the beta variant associated with non-muscle sources, to evaluate large preovulatory follicles for actin content and composition. Antibody staining of sectioned ovaries showed intense circumferential reactivity in the outermost wall of developing follicles. Immunoblots from two-dimensional gels of theca externa lysates demonstrated the presence of the two muscle-specific isozymes of actin. Immunofluorescence of cultured follicular cells pulse-labeled with [3H] thymidine (for autoradiographic detection of DNA replication) revealed the presence, in many dividing cells, of actin filaments aligned primarily along the longitudinal axis of the cells. In cultures exposed to the calcium ionophore A23187 (10(-4) M) for varying periods (5 min to 1 h), contraction of many individual muscle-actin-positive cells was observed. Immunofluorescence of these cells, fixed immediately after ionophore-induced contraction, revealed compaction of the actin filaments. Our findings demonstrate that the cells of the theca externa contain muscle actins from an early stage and that these cells are capable of contraction even while proliferating in subconfluent cultures. They suggest that follicular growth may include a naturally occurring developmental sequence in which a contractile cell type proliferates in the differentiated state
Menezes-Rodrigues, Francisco Sandro; Pires-Oliveira, Marcelo; Duarte, Thiago; Paredes-Gamero, Edgar Julian; Chiavegatti, Tiago; Godinho, Rosely Oliveira
2013-11-15
Skeletal muscle contraction is triggered by acetylcholine induced release of Ca(2+) from sarcoplasmic reticulum. Although this signaling pathway is independent of extracellular Ca(2+), L-type voltage-gated calcium channel (Cav) blockers have inotropic effects on frog skeletal muscles which occur by an unknown mechanism. Taking into account that skeletal muscle fiber expresses Ca(+2)-sensitive adenylyl cyclase (AC) isoforms and that cAMP is able to increase skeletal muscle contraction force, we investigated the role of Ca(2+) influx on mouse skeletal muscle contraction and the putative crosstalk between extracellular Ca(2+) and intracellular cAMP signaling pathways. The effects of Cav blockers (verapamil and nifedipine) and extracellular Ca(2+) chelator EGTA were evaluated on isometric contractility of mouse diaphragm muscle under direct electrical stimulus (supramaximal voltage, 2 ms, 0.1 Hz). Production of cAMP was evaluated by radiometric assay while Ca(2+) transients were assessed by confocal microscopy using L6 cells loaded with fluo-4/AM. Ca(2+) channel blockers verapamil and nifedipine had positive inotropic effect, which was mimicked by removal of extracellular Ca(+2) with EGTA or Ca(2+)-free Tyrode. While phosphodiesterase inhibitor IBMX potentiates verapamil positive inotropic effect, it was abolished by AC inhibitors SQ22536 and NYK80. Finally, the inotropic effect of verapamil was associated with increased intracellular cAMP content and mobilization of intracellular Ca(2+), indicating that positive inotropic effects of Ca(2+) blockers depend on cAMP formation. Together, our results show that extracellular Ca(2+) modulates skeletal muscle contraction, through inhibition of Ca(2+)-sensitive AC. The cross-talk between extracellular calcium and cAMP-dependent signaling pathways appears to regulate the extent of skeletal muscle contraction responses. © 2013 Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Floriane Lacour
2017-03-01
Full Text Available Wnt-mediated signals are involved in many important steps in mammalian regeneration. In multiple cell types, the R-spondin (Rspo family of secreted proteins potently activates the canonical Wnt/β-catenin pathway. Here, we identify Rspo1 as a mediator of skeletal muscle tissue repair. First, we show that deletion of Rspo1 results in global alteration of muscle regeneration kinetics following acute injury. We find that muscle progenitor cells lacking Rspo1 show delayed differentiation due to reduced activation of Wnt/β-catenin target genes. Furthermore, muscle cells lacking Rspo1 have a fusion phenotype leading to larger myotubes containing supernumerary nuclei both in vitro and in vivo. The increase in muscle fusion was dependent on downregulation of Wnt/β-catenin and upregulation of non-canonical Wnt7a/Fzd7/Rac1 signaling. We conclude that reciprocal control of antagonistic Wnt signaling pathways by Rspo1 in muscle stem cell progeny is a key step ensuring normal tissue architecture restoration following acute damage.
Zhang, Teng; Marinescu, Monica; O'Neill, Laura; Wild, Mark; Offer, Gregory
2015-09-21
Understanding of the complex electrochemical, transport, and phase-change phenomena in Li-S cells requires experimental characterization in tandem with mechanistic modeling. However, existing Li-S models currently contradict some key features of experimental findings, particularly the evolution of cell resistance during discharge. We demonstrate that, by introducing a concentration-dependent electrolyte conductivity, the correct trends in voltage drop due to electrolyte resistance and activation overpotentials are retrieved. In addition, we reveal the existence of an often overlooked potential drop mechanism in the low voltage-plateau which originates from the limited rate of Li2S precipitation.
Energy Technology Data Exchange (ETDEWEB)
Guo, Xiaoxia [Department of Cardiology, People' s Hospital, Peking University, No. 11 South Avenue, Xi Zhi Men Xicheng District, Beijing 100044 (China); Zhou, Chunyan, E-mail: chunyanzhou@bjmu.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan Road, Haidian District, Beijing 100191 (China); Sun, Ningling, E-mail: nlsun@263.net [Department of Cardiology, People' s Hospital, Peking University, No. 11 South Avenue, Xi Zhi Men Xicheng District, Beijing 100044 (China)
2011-04-22
Highlights: {yields} Catestatin stimulates proliferation of vascular smooth muscle cells in a dose-dependent manner. {yields} Catestatin provokes sustained increase in intracellular Ca{sup 2+}. {yields} Catestatin produces increased activation of calcineurin and promotes NFATc1 translocation into the nucleus. -- Abstract: The Chromogranin A-derived neuropeptide catestatin is an endogenous nicotinic cholinergic antagonist that acts as a pleiotropic hormone. Since catestatin shares several functions with other members derived from the chromogranin/secretogranin protein family and other neuropeptides which exert proliferative effects on vascular smooth muscle cells (VSMCs), we therefore hypothesized that catestatin would regulate VSMC proliferation. The present study demonstrates that catestatin caused a dose-dependent induction of proliferation in rat aortic smooth muscle cells and furthermore evoked a sustained increase in intracellular calcium. This subsequently leaded to enhanced activation of the Ca{sup 2+}/calmodulin-dependent phosphatase, calcineurin and resulted in an activation of the Ca{sup 2+}-dependent transcription factor, nuclear factor of activated T cells (NFAT), initiating transcription of proliferative genes. In addition, cyclosporin A (CsA), a potent inhibitor of calcineurin, abrogated catestatin-mediated effect on VSMCs, indicating that the calcineurin-NFAT signaling is strongly required for catestatin-induced growth of VSMCs. The present study establishes catestatin as a novel proliferative cytokine on vascular smooth muscle cells and this effect is mediated by the Ca{sup 2+}-calcineurin-NFAT signaling pathway.
Alterations of cAMP-dependent signaling in dystrophic skeletal muscle
Directory of Open Access Journals (Sweden)
Rüdiger eRudolf
2013-10-01
Full Text Available Autonomic regulation processes in striated muscles are largely mediated by cAMP/PKA-signaling. In order to achieve specificity of signaling its spatial-temporal compartmentation plays a critical role. We discuss here how specificity of cAMP/PKA-signaling can be achieved in skeletal muscle by spatio-temporal compartmentation. While a microdomain containing PKA type I in the region of the neuromuscular junction is important for post-synaptic, activity-dependent stabilization of the nicotinic acetylcholine receptor, PKA type I and II microdomains in the sarcomeric part of skeletal muscle are likely to play different roles, including the regulation of muscle homeostasis. These microdomains are due to specific A-kinase anchoring proteins, like rapsyn and myospryn. Importantly, recent evidence indicates that compartmentation of the cAMP/PKA-dependent signaling pathway and pharmacological activation of cAMP production are aberrant in different skeletal muscles disorders. Thus, we discuss here their potential as targets for palliative treatment of certain forms of dystrophy and myasthenia. Under physiological conditions, the neuropeptide, α-calcitonin-related peptide, as well as beta-adrenergic agonists are the most-mentioned natural triggers for activating cAMP/PKA signaling in skeletal muscle. While the precise domains and functions of these first messengers are still under investigation, agonists of β2-adrenoceptors clearly exhibit anabolic activity under normal conditions and reduce protein degradation during atrophic periods. Past and recent studies suggest direct sympathetic innervation of skeletal muscle fibers. In summary, the organization and roles of cAMP-dependent signaling in skeletal muscle are increasingly understood, revealing crucial functions in processes like nerve-muscle interaction and muscle trophicity.
International Nuclear Information System (INIS)
Arsic, Nikola; Mamaeva, Daria; Lamb, Ned J.; Fernandez, Anne
2008-01-01
Stem cells with the ability to differentiate in specialized cell types can be extracted from a wide array of adult tissues including skeletal muscle. Here we have analyzed a population of cells isolated from skeletal muscle on the basis of their poor adherence on uncoated or collagen-coated dishes that show multi-lineage differentiation in vitro. When analysed under proliferative conditions, these cells express stem cell surface markers Sca-1 (65%) and Bcrp-1 (80%) but also MyoD (15%), Neuronal β III-tubulin (25%), GFAP (30%) or Nkx2.5 (1%). Although capable of growing as non-attached spheres for months, when given an appropriate matrix, these cells adhere giving rise to skeletal muscle, neuronal and cardiac muscle cell lineages. A similar cell population could not be isolated from either bone marrow or cardiac tissue suggesting their specificity to skeletal muscle. When injected into damaged muscle, these non-adherent muscle-derived cells are retrieved expressing Pax7, in a sublaminar position characterizing satellite cells and participate in forming new myofibers. These data show that a non-adherent stem cell population can be specifically isolated and expanded from skeletal muscle and upon attachment to a matrix spontaneously differentiate into muscle, cardiac and neuronal lineages in vitro. Although competing with resident satellite cells, these cells are shown to significantly contribute to repair of injured muscle in vivo supporting that a similar muscle-derived non-adherent cell population from human muscle may be useful in treatment of neuromuscular disorders
Arsic, Nikola; Mamaeva, Daria; Lamb, Ned J; Fernandez, Anne
2008-04-01
Stem cells with the ability to differentiate in specialized cell types can be extracted from a wide array of adult tissues including skeletal muscle. Here we have analyzed a population of cells isolated from skeletal muscle on the basis of their poor adherence on uncoated or collagen-coated dishes that show multi-lineage differentiation in vitro. When analysed under proliferative conditions, these cells express stem cell surface markers Sca-1 (65%) and Bcrp-1 (80%) but also MyoD (15%), Neuronal beta III-tubulin (25%), GFAP (30%) or Nkx2.5 (1%). Although capable of growing as non-attached spheres for months, when given an appropriate matrix, these cells adhere giving rise to skeletal muscle, neuronal and cardiac muscle cell lineages. A similar cell population could not be isolated from either bone marrow or cardiac tissue suggesting their specificity to skeletal muscle. When injected into damaged muscle, these non-adherent muscle-derived cells are retrieved expressing Pax7, in a sublaminar position characterizing satellite cells and participate in forming new myofibers. These data show that a non-adherent stem cell population can be specifically isolated and expanded from skeletal muscle and upon attachment to a matrix spontaneously differentiate into muscle, cardiac and neuronal lineages in vitro. Although competing with resident satellite cells, these cells are shown to significantly contribute to repair of injured muscle in vivo supporting that a similar muscle-derived non-adherent cell population from human muscle may be useful in treatment of neuromuscular disorders.
Cai, B.; Spencer, M. J.; Nakamura, G.; Tseng-Ong, L.; Tidball, J. G.
2000-01-01
Previous investigations have shown that cytotoxic T lymphocytes (CTLs) contribute to muscle pathology in the dystrophin-null mutant mouse (mdx) model of Duchenne muscular dystrophy through perforin-dependent and perforin-independent mechanisms. We have assessed whether the CTL-mediated pathology includes the promotion of eosinophilia in dystrophic muscle, and thereby provides a secondary mechanism through which CTLs contribute to muscular dystrophy. Quantitative immunohistochemistry confirmed that eosinophilia is a component of the mdx dystrophy. In addition, electron microscopic observations show that eosinophils traverse the basement membrane of mdx muscle fibers and display sites of close apposition of eosinophil and muscle membranes. The close membrane apposition is characterized by impingement of eosinophilic rods of major basic protein into the muscle cell membrane. Transfer of mdx splenocytes and mdx muscle extracts to irradiated C57 mice by intraperitoneal injection resulted in muscle eosinophilia in the recipient mice. Double-mutant mice lacking dystrophin and perforin showed less eosinophilia than was displayed by mdx mice that expressed perforin. Finally, administration of prednisolone, which has been shown previously to reduce the concentration of CTLs in dystrophic muscle, produced a significant reduction in eosinophilia. These findings indicate that eosinophilia is a component of the mdx pathology that is promoted by perforin-dependent cytotoxicity of effector T cells. However, some eosinophilia of mdx muscle is independent of perforin-mediated processes.
Wing, S. S.; Goldberg, A. L.; Goldberger, A. L. (Principal Investigator)
1993-01-01
Glucocorticoids are essential for the increase in protein breakdown in skeletal muscle normally seen during fasting. To determine which proteolytic pathway(s) are activated upon fasting, leg muscles from fed and fasted normal rats were incubated under conditions that block or activate different proteolytic systems. After food deprivation (1 day), the nonlysosomal ATP-dependent process increased by 250%, as shown in experiments involving depletion of muscle ATP. Also, the maximal capacity of the lysosomal process increased 60-100%, but no changes occurred in the Ca(2+)-dependent or the residual energy-independent proteolytic processes. In muscles from fasted normal and adrenalectomized (ADX) rats, the protein breakdown sensitive to inhibitors of the lysosomal or Ca(2+)-dependent pathways did not differ. However, the ATP-dependent process was 30% slower in muscles from fasted ADX rats. Administering dexamethasone to these animals or incubating their muscles with dexamethasone reversed this defect. During fasting, when the ATP-dependent process rises, muscles show a two- to threefold increase in levels of ubiquitin (Ub) mRNA. However, muscles of ADX animals failed to show this response. Injecting dexamethasone into the fasted ADX animals increased muscle Ub mRNA within 6 h. Thus glucocorticoids activate the ATP-Ub-dependent proteolytic pathway in fasting apparently by enhancing the expression of components of this system such as Ub.
Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B
2017-09-20
Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In
Wolf, M.; Noel, G. T.; Stirn, R. J.
1977-01-01
Difficulties in relating observed current-voltage characteristics of individual silicon solar cells to their physical and material parameters were underscored by the unexpected large changes in the current-voltage characteristics telemetered back from solar cells on the ATS-1 spacecraft during their first year in synchronous orbit. Depletion region recombination was studied in cells exhibiting a clear double-exponential dark characteristic by subjecting the cells to proton irradiation. A significant change in the saturation current, an effect included in the Sah, Noyce, Shockley formulation of diode current resulting from recombination in the depletion region, was caused by the introduction of shallow levels in the depletion region by the proton irradiation. This saturation current is not attributable only to diffusion current from outside the depletion region and only its temperature dependence can clarify its origin. The current associated with the introduction of deep-lying levels did not change significantly in these experiments.
Consciousness can reduce the voltage of the output signal of solar cell
Cao, Dayong
2010-10-01
When the sun's light radiate on the solar cell, the solar cell can produce the output signal as the photocurrent. We use the Data Acquisition Modules to record the voltage of the output signals. The v1 is voltage of the output signal of solar cell1; The v2 is the one of solar cell2. And these two solar cells stay side by side. When we record the voltage of the output signal from the morning to the noon, the voltage of the output signals will go up, and the v1 is bigger than the v2 during this time. But when the experimenter use consciousness to reduce the voltage of the output signals. That is to say: not only natural light ratiade on two solar cells, but also consciousness act on two solar cells. Not only I can use consciousness to reduce the growth voltage of the output signals, but also can change the v1 to be littler than the v2. The experiment was conducted on Sep. 2010. There is the physical system of the mass, energy, space and time-MEST; There is the spirited system of the mind, consciousness, emotion and desire-MECD; the information system is the code system. We can use them to develop photoelectric principle, life technology and Nanotech of semiconductor for consciousness effect.
Subunit Stoichiometry of Human Muscle Chloride Channels
Fahlke, Christoph; Knittle, Timothy; Gurnett, Christina A.; Campbell, Kevin P.; George, Alfred L.
1997-01-01
Voltage-gated Cl? channels belonging to the ClC family appear to function as homomultimers, but the number of subunits needed to form a functional channel is controversial. To determine subunit stoichiometry, we constructed dimeric human skeletal muscle Cl? channels in which one subunit was tagged by a mutation (D136G) that causes profound changes in voltage-dependent gating. Sucrose-density gradient centrifugation experiments indicate that both monomeric and dimeric hClC-1 channels in their ...
Chaillou, Thomas; Lanner, Johanna T
2016-12-01
Reduced oxygen (O 2 ) levels (hypoxia) are present during embryogenesis and exposure to altitude and in pathologic conditions. During embryogenesis, myogenic progenitor cells reside in a hypoxic microenvironment, which may regulate their activity. Satellite cells are myogenic progenitor cells localized in a local environment, suggesting that the O 2 level could affect their activity during muscle regeneration. In this review, we present the idea that O 2 levels regulate myogenesis and muscle regeneration, we elucidate the molecular mechanisms underlying myogenesis and muscle regeneration in hypoxia and depict therapeutic strategies using changes in O 2 levels to promote muscle regeneration. Severe hypoxia (≤1% O 2 ) appears detrimental for myogenic differentiation in vitro, whereas a 3-6% O 2 level could promote myogenesis. Hypoxia impairs the regenerative capacity of injured muscles. Although it remains to be explored, hypoxia may contribute to the muscle damage observed in patients with pathologies associated with hypoxia (chronic obstructive pulmonary disease, and peripheral arterial disease). Hypoxia affects satellite cell activity and myogenesis through mechanisms dependent and independent of hypoxia-inducible factor-1α. Finally, hyperbaric oxygen therapy and transplantation of hypoxia-conditioned myoblasts are beneficial procedures to enhance muscle regeneration in animals. These therapies may be clinically relevant to treatment of patients with severe muscle damage.-Chaillou, T. Lanner, J. T. Regulation of myogenesis and skeletal muscle regeneration: effects of oxygen levels on satellite cell activity. © FASEB.
Gimpel, Petra; Lee, Yin Loon; Sobota, Radoslaw M; Calvi, Alessandra; Koullourou, Victoria; Patel, Rutti; Mamchaoui, Kamel; Nédélec, François; Shackleton, Sue; Schmoranzer, Jan; Burke, Brian; Cadot, Bruno; Gomes, Edgar R
2017-10-09
The nucleus is the main microtubule-organizing center (MTOC) in muscle cells due to the accumulation of centrosomal proteins and microtubule (MT) nucleation activity at the nuclear envelope (NE) [1-4]. The relocalization of centrosomal proteins, including Pericentrin, Pcm1, and γ-tubulin, depends on Nesprin-1, an outer nuclear membrane (ONM) protein that connects the nucleus to the cytoskeleton via its N-terminal region [5-7]. Nesprins are also involved in the recruitment of kinesin to the NE and play a role in nuclear positioning in skeletal muscle cells [8-12]. However, a function for MT nucleation from the NE in nuclear positioning has not been established. Using the proximity-dependent biotin identification (BioID) method [13, 14], we found several centrosomal proteins, including Akap450, Pcm1, and Pericentrin, whose association with Nesprin-1α is increased in differentiated myotubes. We show that Nesprin-1α recruits Akap450 to the NE independently of kinesin and that Akap450, but not other centrosomal proteins, is required for MT nucleation from the NE. Furthermore, we demonstrate that this mechanism is disrupted in congenital muscular dystrophy patient myotubes carrying a nonsense mutation within the SYNE1 gene (23560 G>T) encoding Nesprin-1 [15, 16]. Finally, using computer simulation and cell culture systems, we provide evidence for a role of MT nucleation from the NE on nuclear spreading in myotubes. Our data thus reveal a novel function for Nesprin-1α/Nesprin-1 in nuclear positioning through recruitment of Akap450-mediated MT nucleation activity to the NE. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Bone marrow mesenchymal cells improve muscle function in a skeletal muscle re-injury model.
Directory of Open Access Journals (Sweden)
Bruno M Andrade
Full Text Available Skeletal muscle injury is the most common problem in orthopedic and sports medicine, and severe injury leads to fibrosis and muscle dysfunction. Conventional treatment for successive muscle injury is currently controversial, although new therapies, like cell therapy, seem to be promise. We developed a model of successive injuries in rat to evaluate the therapeutic potential of bone marrow mesenchymal cells (BMMC injected directly into the injured muscle. Functional and histological assays were performed 14 and 28 days after the injury protocol by isometric tension recording and picrosirius/Hematoxilin & Eosin staining, respectively. We also evaluated the presence and the fate of BMMC on treated muscles; and muscle fiber regeneration. BMMC treatment increased maximal skeletal muscle contraction 14 and 28 days after muscle injury compared to non-treated group (4.5 ± 1.7 vs 2.5 ± 0.98 N/cm2, p<0.05 and 8.4 ± 2.3 vs. 5.7 ± 1.3 N/cm2, p<0.05 respectively. Furthermore, BMMC treatment increased muscle fiber cross-sectional area and the presence of mature muscle fiber 28 days after muscle injury. However, there was no difference in collagen deposition between groups. Immunoassays for cytoskeleton markers of skeletal and smooth muscle cells revealed an apparent integration of the BMMC within the muscle. These data suggest that BMMC transplantation accelerates and improves muscle function recovery in our extensive muscle re-injury model.
Effects of extracts of denervated muscles on the morphology of cultured muscle cells
Hooisma, J.; Krijger, J.de; Groot, D.M.G. de
1981-01-01
Previously tropic effects of extracts from whole chick embryos and from innervated muscles on cultured muscle cells were described. The present study demonstrated similar effects of extracts from 10-days denervated chick muscles. Extracts from innervated as well as from denervated muscles
Marsh, K. A.; Hill, S. J.
1992-01-01
1. Bovine tracheal smooth muscle cells were established in culture to study agonist-induced phosphoinositide (PI) hydrolysis in this tissue. 2. Bradykinin (0.1 nM-10 microM) evoked a concentration-dependent increase (log EC50 (M) = -9.4 +/- 0.2; n = 8) in the accumulation of total [3H]-inositol phosphates in cultured tracheal smooth muscle cells whereas the selective B1 receptor agonist des-Arg9-bradykinin (10 microM) was significantly less effective (16% of bradykinin maximal response; relat...
Directory of Open Access Journals (Sweden)
Thomas R Whitesell
Full Text Available Mural cells of the vascular system include vascular smooth muscle cells (SMCs and pericytes whose role is to stabilize and/or provide contractility to blood vessels. One of the earliest markers of mural cell development in vertebrates is α smooth muscle actin (acta2; αsma, which is expressed by pericytes and SMCs. In vivo models of vascular mural cell development in zebrafish are currently lacking, therefore we developed two transgenic zebrafish lines driving expression of GFP or mCherry in acta2-expressing cells. These transgenic fish were used to trace the live development of mural cells in embryonic and larval transgenic zebrafish. acta2:EGFP transgenic animals show expression that largely mirrors native acta2 expression, with early pan-muscle expression starting at 24 hpf in the heart muscle, followed by skeletal and visceral muscle. At 3.5 dpf, expression in the bulbus arteriosus and ventral aorta marks the first expression in vascular smooth muscle. Over the next 10 days of development, the number of acta2:EGFP positive cells and the number of types of blood vessels associated with mural cells increases. Interestingly, the mural cells are not motile and remain in the same position once they express the acta2:EGFP transgene. Taken together, our data suggests that zebrafish mural cells develop relatively late, and have little mobility once they associate with vessels.
New Role of P/Q-type Voltage-gated Calcium Channels
DEFF Research Database (Denmark)
Hansen, Pernille B L
2015-01-01
Voltage-gated calcium channels are important for the depolarization-evoked contraction of vascular smooth muscle cells (SMCs), with L-type channels being the classical channel involved in this mechanism. However, it has been demonstrated that the CaV2.1 subunit, which encodes a neuronal isoform...... of the voltage-gated calcium channels (P/Q-type), is also expressed and contributes functionally to contraction of renal blood vessels in both mice and humans. Furthermore, preglomerular vascular SMCs and aortic SMCs coexpress L-, P-, and Q-type calcium channels within the same cell. Calcium channel blockers...... are widely used as pharmacological treatments. However, calcium channel antagonists vary in their selectivity for the various calcium channel subtypes, and the functional contribution from P/Q-type channels as compared with L-type should be considered. Confirming the presence of P/Q-type voltage...
Stem Cells for Skeletal Muscle Tissue Engineering.
Pantelic, Molly N; Larkin, Lisa M
2018-04-19
Volumetric muscle loss (VML) is a debilitating condition wherein muscle loss overwhelms the body's normal physiological repair mechanism. VML is particularly common among military service members who have sustained war injuries. Because of the high social and medical cost associated with VML and suboptimal current surgical treatments, there is great interest in developing better VML therapies. Skeletal muscle tissue engineering (SMTE) is a promising alternative to traditional VML surgical treatments that use autogenic tissue grafts, and rather uses isolated stem cells with myogenic potential to generate de novo skeletal muscle tissues to treat VML. Satellite cells are the native precursors to skeletal muscle tissue, and are thus the most commonly studied starting source for SMTE. However, satellite cells are difficult to isolate and purify, and it is presently unknown whether they would be a practical source in clinical SMTE applications. Alternative myogenic stem cells, including adipose-derived stem cells, bone marrow-derived mesenchymal stem cells, perivascular stem cells, umbilical cord mesenchymal stem cells, induced pluripotent stem cells, and embryonic stem cells, each have myogenic potential and have been identified as possible starting sources for SMTE, although they have yet to be studied in detail for this purpose. These alternative stem cell varieties offer unique advantages and disadvantages that are worth exploring further to advance the SMTE field toward highly functional, safe, and practical VML treatments. The following review summarizes the current state of satellite cell-based SMTE, details the properties and practical advantages of alternative myogenic stem cells, and offers guidance to tissue engineers on how alternative myogenic stem cells can be incorporated into SMTE research.
Elzenga, J.T.M.; van Volkenburgh, E.
Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The
Effect of solar-cell junction geometry on open-circuit voltage
Weizer, V. G.; Godlewski, M. P.
1985-01-01
Simple analytical models have been found that adequately describe the voltage behavior of both the stripe junction and dot junction grating cells as a function of junction area. While the voltage in the former case is found to be insensitive to junction area reduction, significant voltage increases are shown to be possible for the dot junction cell. With regard to cells in which the junction area has been increased in a quest for better performance, it was found that (1) texturation does not affect the average saturation current density J0, indicating that the texturation process is equivalent to a simple extension of junction area by a factor of square root of 3 and (2) the vertical junction cell geometry produces a sizable decrease in J0 that, unfortunately, is more than offset by the effects of attendant areal increases.
Human lung mast cells modulate the functions of airway smooth muscle cells in asthma.
Alkhouri, H; Hollins, F; Moir, L M; Brightling, C E; Armour, C L; Hughes, J M
2011-09-01
Activated mast cell densities are increased on the airway smooth muscle in asthma where they may modulate muscle functions and thus contribute to airway inflammation, remodelling and airflow obstruction. To determine the effects of human lung mast cells on the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Freshly isolated human lung mast cells were stimulated with IgE/anti-IgE. Culture supernatants were collected after 2 and 24 h and the mast cells lysed. The supernatants/lysates were added to serum-deprived, subconfluent airway smooth muscle cells for up to 48 h. Released chemokines and extracellular matrix were measured by ELISA, proliferation was quantified by [(3) H]-thymidine incorporation and cell counting, and intracellular signalling by phospho-arrays. Mast cell 2-h supernatants reduced CCL11 and increased CXCL8 and fibronectin production from both asthmatic and nonasthmatic muscle cells. Leupeptin reversed these effects. Mast cell 24-h supernatants and lysates reduced CCL11 release from both muscle cell types but increased CXCL8 release by nonasthmatic cells. The 24-h supernatants also reduced asthmatic, but not nonasthmatic, muscle cell DNA synthesis and asthmatic cell numbers over 5 days through inhibiting extracellular signal-regulated kinase (ERK) and phosphatidylinositol (PI3)-kinase pathways. However, prostaglandins, thromboxanes, IL-4 and IL-13 were not involved in reducing the proliferation. Mast cell proteases and newly synthesized products differentially modulated the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Thus, mast cells may modulate their own recruitment and airway smooth muscle functions locally in asthma. © 2011 John Wiley & Sons A/S.
Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid
Directory of Open Access Journals (Sweden)
Galyna Maleeva
2017-05-01
Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.
DEFF Research Database (Denmark)
Coomber, S J; Bartels, E M; Elliott, G F
2011-01-01
contracts and breaks the microelectrode. Therefore the rigor state was studied. There is no reason to suppose a priori that a similar voltage switch does not occur during contraction, however. Calcium dependence is still apparent in muscles stretched beyond overlap (sarcomere length>3.8 μm) and is also seen...... in the gap filaments between the A- and I-band ends; further stretching abolishes the dependence. These experiments strongly suggest that calcium dependence is controlled initially by the titin component, and that this control is lost when titin filaments break. We suppose that that effect is mediated...
Akirin1 (Mighty), a novel promyogenic factor regulates muscle regeneration and cell chemotaxis
Energy Technology Data Exchange (ETDEWEB)
Salerno, Monica Senna; Dyer, Kelly; Bracegirdle, Jeremy; Platt, Leanne; Thomas, Mark; Siriett, Victoria [Functional Muscle Genomics, AgResearch, Hamilton (New Zealand); Kambadur, Ravi [Functional Muscle Genomics, AgResearch, Hamilton (New Zealand); School of Biological Sciences, Nanyang Technological University, Singapore (Singapore); Sharma, Mridula, E-mail: bchmridu@nus.edu.sg [Functional Muscle Genomics, AgResearch, Hamilton (New Zealand)
2009-07-15
Akirin1 (Mighty) is a downstream target gene of myostatin and has been shown to be a promyogenic factor. Although expressed in many tissues, akirin1 is negatively regulated by myostatin specifically in skeletal muscle tissue. In this manuscript we have characterized the possible function of akirin1 in postnatal muscle growth. Molecular and immunohistological analyses indicated that while low levels of akirin1 are associated with quiescent satellite cells (SC), higher levels of akirin1 are detected in activated proliferating SC indicating that akirin1 could be associated with satellite cell activation. In addition to SC, macrophages also express akirin1, and increased expression of akirin1 resulted in more efficient chemotaxis of both macrophages and myoblasts. Akirin1 appears to regulate chemotaxis of both macrophages and myoblasts by reorganising actin cytoskeleton, leading to more efficient lamellipodia formation via a PI3 kinase dependent pathway. Expression analysis during muscle regeneration also indicated that akirin1 expression is detected very early (day 2) in regenerating muscle, and expression gradually peaks to coincide the nascent myotube formation stage of muscle regeneration. Based on these results we propose that akirin1 could be acting as a transducer of early signals of muscle regeneration. Thus, we speculate that myostatin regulates key steps of muscle regeneration including chemotaxis of inflammatory cells, SC activation and migration through akirin1.
Akirin1 (Mighty), a novel promyogenic factor regulates muscle regeneration and cell chemotaxis
International Nuclear Information System (INIS)
Salerno, Monica Senna; Dyer, Kelly; Bracegirdle, Jeremy; Platt, Leanne; Thomas, Mark; Siriett, Victoria; Kambadur, Ravi; Sharma, Mridula
2009-01-01
Akirin1 (Mighty) is a downstream target gene of myostatin and has been shown to be a promyogenic factor. Although expressed in many tissues, akirin1 is negatively regulated by myostatin specifically in skeletal muscle tissue. In this manuscript we have characterized the possible function of akirin1 in postnatal muscle growth. Molecular and immunohistological analyses indicated that while low levels of akirin1 are associated with quiescent satellite cells (SC), higher levels of akirin1 are detected in activated proliferating SC indicating that akirin1 could be associated with satellite cell activation. In addition to SC, macrophages also express akirin1, and increased expression of akirin1 resulted in more efficient chemotaxis of both macrophages and myoblasts. Akirin1 appears to regulate chemotaxis of both macrophages and myoblasts by reorganising actin cytoskeleton, leading to more efficient lamellipodia formation via a PI3 kinase dependent pathway. Expression analysis during muscle regeneration also indicated that akirin1 expression is detected very early (day 2) in regenerating muscle, and expression gradually peaks to coincide the nascent myotube formation stage of muscle regeneration. Based on these results we propose that akirin1 could be acting as a transducer of early signals of muscle regeneration. Thus, we speculate that myostatin regulates key steps of muscle regeneration including chemotaxis of inflammatory cells, SC activation and migration through akirin1.
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
Ho, Tsung-Chuan; Chiang, Yi-Pin; Chuang, Chih-Kuang; Chen, Show-Li; Hsieh, Jui-Wen; Lan, Yu-Wen; Tsao, Yeou-Ping
2015-08-01
In response injury, intrinsic repair mechanisms are activated in skeletal muscle to replace the damaged muscle fibers with new muscle fibers. The regeneration process starts with the proliferation of satellite cells to give rise to myoblasts, which subsequently differentiate terminally into myofibers. Here, we investigated the promotion effect of pigment epithelial-derived factor (PEDF) on muscle regeneration. We report that PEDF and a synthetic PEDF-derived short peptide (PSP; residues Ser(93)-Leu(112)) induce satellite cell proliferation in vitro and promote muscle regeneration in vivo. Extensively, soleus muscle necrosis was induced in rats by bupivacaine, and an injectable alginate gel was used to release the PSP in the injured muscle. PSP delivery was found to stimulate satellite cell proliferation in damaged muscle and enhance the growth of regenerating myofibers, with complete regeneration of normal muscle mass by 2 wk. In cell culture, PEDF/PSP stimulated C2C12 myoblast proliferation, together with a rise in cyclin D1 expression. PEDF induced the phosphorylation of ERK1/2, Akt, and STAT3 in C2C12 myoblasts. Blocking the activity of ERK, Akt, or STAT3 with pharmacological inhibitors attenuated the effects of PEDF/PSP on the induction of C2C12 cell proliferation and cyclin D1 expression. Moreover, 5-bromo-2'-deoxyuridine pulse-labeling demonstrated that PEDF/PSP stimulated primary rat satellite cell proliferation in myofibers in vitro. In summary, we report for the first time that PSP is capable of promoting the regeneration of skeletal muscle. The signaling mechanism involves the ERK, AKT, and STAT3 pathways. These results show the potential utility of this PEDF peptide for muscle regeneration. Copyright © 2015 the American Physiological Society.
Time-dependent gene expression analysis after mouse skeletal muscle contusion
Directory of Open Access Journals (Sweden)
Weihua Xiao
2016-03-01
Conclusion: The sequence of immune cells invaded after muscle contusion was neutrophils, M1 macrophages and M2 macrophages. Some CC (CCL2, CCL3, and CCL4 and CXC (CXCL10 chemokines may be involved in the chemotaxis of these immune cells. HGF may be the primary factor to activate the satellite cells after muscle contusion. Moreover, 2 weeks are needed to recover when acute contusion happens as used in this study.
Continuous Release of Tumor-Derived Factors Improves the Modeling of Cachexia in Muscle Cell Culture
Directory of Open Access Journals (Sweden)
Robert W. Jackman
2017-09-01
Full Text Available Cachexia is strongly associated with a poor prognosis in cancer patients but the biological trigger is unknown and therefore no therapeutics exist. The loss of skeletal muscle is the most deleterious aspect of cachexia and it appears to depend on secretions from tumor cells. Models for studying wasting in cell culture consist of experiments where skeletal muscle cells are incubated with medium conditioned by tumor cells. This has led to candidates for cachectic factors but some of the features of cachexia in vivo are not yet well-modeled in cell culture experiments. Mouse myotube atrophy measured by myotube diameter in response to medium conditioned by mouse colon carcinoma cells (C26 is consistently less than what is seen in muscles of mice bearing C26 tumors with moderate to severe cachexia. One possible reason for this discrepancy is that in vivo the C26 tumor and skeletal muscle share a circulatory system exposing the muscle to tumor factors in a constant and increasing way. We have applied Transwell®-adapted cell culture conditions to more closely simulate conditions found in vivo where muscle is exposed to the ongoing kinetics of constant tumor secretion of active factors. C26 cells were incubated on a microporous membrane (a Transwell® insert that constitutes the upper compartment of wells containing plated myotubes. In this model, myotubes are exposed to a constant supply of cancer cell secretions in the medium but without direct contact with the cancer cells, analogous to a shared circulation of muscle and cancer cells in tumor-bearing animals. The results for myotube diameter support the idea that the use of Transwell® inserts serves as a more physiological model of the muscle wasting associated with cancer cachexia than the bolus addition of cancer cell conditioned medium. The Transwell® model supports the notion that the dose and kinetics of cachectic factor delivery to muscle play a significant role in the extent of pathology.
Tsai, Wen-Chung; Yu, Tung-Yang; Lin, Li-Ping; Lin, Mioa-Sui; Tsai, Ting-Ta; Pang, Jong-Hwei S
2017-11-01
Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal muscle cells. Skeletal muscle cells intrinsic to Sprague-Dawley rats were treated with PRP. The cell migration was evaluated by transwell filter migration assay and electric cell-substrate impedance sensing. The spreading of cells was evaluated microscopically. The formation of filamentous actin (F-actin) cytoskeleton was assessed by immunofluorescence staining. The protein expressions of paxillin and focal adhesion kinase (FAK) were assessed by Western blot analysis. Transfection of paxillin small-interfering RNA (siRNAs) to muscle cells was performed to validate the role of paxillin in PRP-mediated promotion of cell migration. Dose-dependently PRP promotes migration of and spreading and muscle cells. Protein expressions of paxillin and FAK were up-regulated dose-dependently. F-actin formation was also enhanced by PRP treatment. Furthermore, the knockdown of paxillin expression impaired the effect of PRP to promote cell migration. It was concluded that PRP promoting migration of muscle cells is associated with up-regulation of proteins expression of paxillin and FAK as well as increasing F-actin formation. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2506-2512, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Von Roos, O.
1981-01-01
The photo voltage decay (PVD) method for the measurement of minority carrier lifetimes in P-N junction solar cells with cell thickness comparable to or even less than the minority carrier diffusion length is examined. The method involves the generation of free carriers in the quasi-neutral bulk material by flashes of light and the monitoring of the subsequent decay of the induced open-circuit voltages as the carriers recombine, which is dependent on minority carrier recombination lifetime. It is shown that the voltage versus time curve for an ordinary solar cell (N(+)-P junction) is proportional to the inverse minority carrier lifetime plus a factor expressing the ratio of diffusion length to cell thickness. In the case of an ideal back-surface-field cell (N(+)-P-P(+) junction) however, the slope is directly proportional to the inverse minority carrier lifetime. It is noted that since most BSF cells are not ideal, possessing a sizable back surface recombination velocity, the PVD measurements must be treated with caution and supplemented with other nonstationary methods.
Advancements in stem cells treatment of skeletal muscle wasting
Directory of Open Access Journals (Sweden)
mirella emeregalli
2014-02-01
Full Text Available Muscular dystrophies (MDs are a heterogeneous group of inherited disorders, in which progressive muscle wasting and weakness is often associated with exhaustion of muscle regeneration potential. Although physiological properties of skeletal muscle tissue are now well known, no treatments are effective for these diseases. Muscle regeneration was attempted by means transplantation of myogenic cells (from myoblast to embryonic stem cells and also by interfering with the malignant processes that originate in pathological tissues, such as uncontrolled fibrosis and inflammation. Taking into account the advances in the isolation of new subpopulation of stem cells and in the creation of artificial stem cell niches, we discuss how these emerging technologies offer great promises for therapeutic approaches to muscle diseases and muscle wasting associated with aging.
Meng, Jinhong; Muntoni, Francesco; Morgan, Jennifer
2018-05-12
Cell-mediated gene therapy is a possible means to treat muscular dystrophies like Duchenne muscular dystrophy. Autologous patient stem cells can be genetically-corrected and transplanted back into the patient, without causing immunorejection problems. Regenerated muscle fibres derived from these cells will express the missing dystrophin protein, thus improving muscle function. CD133+ cells derived from normal human skeletal muscle contribute to regenerated muscle fibres and form muscle stem cells after their intra-muscular transplantation into an immunodeficient mouse model. But it is not known whether CD133+ cells derived from DMD patient muscles have compromised muscle regenerative function. To test this, we compared CD133+ cells derived from DMD and normal human muscles. DMD CD133+ cells had a reduced capacity to undergo myogenic differentiation in vitro compared with CD133+ cells derived from normal muscle. In contrast to CD133+ cells derived from normal human muscle, those derived from DMD muscle formed no satellite cells and gave rise to significantly fewer muscle fibres of donor origin, after their intra-muscular transplantation into an immunodeficient, non-dystrophic, mouse muscle. DMD CD133+ cells gave rise to more clones of smaller size and more clones that were less myogenic than did CD133+ cells derived from normal muscle. The heterogeneity of the progeny of CD133+ cells, combined with the reduced proliferation and myogenicity of DMD compared to normal CD133+ cells, may explain the reduced regenerative capacity of DMD CD133+ cells. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Archer, Stephen L; Wu, Xi-Chen; Thébaud, Bernard; Nsair, Ali; Bonnet, Sebastien; Tyrrell, Ben; McMurtry, M Sean; Hashimoto, Kyoko; Harry, Gwyneth; Michelakis, Evangelos D
2004-08-06
Hypoxic pulmonary vasoconstriction (HPV) is initiated by inhibition of O2-sensitive, voltage-gated (Kv) channels in pulmonary arterial smooth muscle cells (PASMCs). Kv inhibition depolarizes membrane potential (E(M)), thereby activating Ca2+ influx via voltage-gated Ca2+ channels. HPV is weak in extrapulmonary, conduit pulmonary arteries (PA) and strong in precapillary resistance arteries. We hypothesized that regional heterogeneity in HPV reflects a longitudinal gradient in the function/expression of PASMC O2-sensitive Kv channels. In adult male Sprague Dawley rats, constrictions to hypoxia, the Kv blocker 4-aminopyridine (4-AP), and correolide, a Kv1.x channel inhibitor, were endothelium-independent and greater in resistance versus conduit PAs. Moreover, HPV was dependent on Kv-inhibition, being completely inhibited by pretreatment with 4-AP. Kv1.2, 1.5, Kv2.1, Kv3.1b, Kv4.3, and Kv9.3. mRNA increased as arterial caliber decreased; however, only Kv1.5 protein expression was greater in resistance PAs. Resistance PASMCs had greater K+ current (I(K)) and a more hyperpolarized E(M) and were uniquely O2- and correolide-sensitive. The O2-sensitive current (active at -65 mV) was resistant to iberiotoxin, with minimal tityustoxin sensitivity. In resistance PASMCs, 4-AP and hypoxia inhibited I(K) 57% and 49%, respectively, versus 34% for correolide. Intracellular administration of anti-Kv1.5 antibodies inhibited correolide's effects. The hypoxia-sensitive, correolide-insensitive I(K) (15%) was conducted by Kv2.1. Anti-Kv1.5 and anti-Kv2.1 caused additive depolarization in resistance PASMCs (Kv1.5>Kv2.1) and inhibited hypoxic depolarization. Heterologously expressed human PASMC Kv1.5 generated an O2- and correolide-sensitive I(K) like that in resistance PASMCs. In conclusion, Kv1.5 and Kv2.1 account for virtually all the O2-sensitive current. HPV occurs in a Kv-enriched resistance zone because resistance PASMCs preferentially express O2-sensitive Kv-channels.
Essential role of TGF-beta/Smad pathway on statin dependent vascular smooth muscle cell regulation.
Directory of Open Access Journals (Sweden)
Juan Rodríguez-Vita
Full Text Available BACKGROUND: The 3-hydroxy-3-methylglutaryl CoA reductase inhibitors (also called statins exert proven beneficial effects on cardiovascular diseases. Recent data suggest a protective role for Transforming Growth Factor-beta (TGF-beta in atherosclerosis by regulating the balance between inflammation and extracellular matrix accumulation. However, there are no studies about the effect of statins on TGF-beta/Smad pathway in atherosclerosis and vascular cells. METHODOLOGY: In cultured vascular smooth muscle cells (VSMCs statins enhanced Smad pathway activation caused by TGF-beta. In addition, statins upregulated TGF-beta receptor type II (TRII, and increased TGF-beta synthesis and TGF-beta/Smad-dependent actions. In this sense, statins, through Smad activation, render VSMCs more susceptible to TGF-beta induced apoptosis and increased TGF-beta-mediated ECM production. It is well documented that high doses of statins induce apoptosis in cultured VSMC in the presence of serum; however the precise mechanism of this effect remains to be elucidated. We have found that statins-induced apoptosis was mediated by TGF-beta/Smad pathway. Finally, we have described that RhoA inhibition is a common intracellular mechanisms involved in statins effects. The in vivo relevance of these findings was assessed in an experimental model of atherosclerosis in apolipoprotein E deficient mice: Treatment with Atorvastatin increased Smad3 phosphorylation and TRII overexpression, associated to elevated ECM deposition in the VSMCs within atheroma plaques, while apoptosis was not detected. CONCLUSIONS: Statins enhance TGF-beta/Smad pathway, regulating ligand levels, receptor, main signaling pathway and cellular responses of VSMC, including apoptosis and ECM accumulation. Our findings show that TGF-beta/Smad pathway is essential for statins-dependent actions in VSMCs.
Directory of Open Access Journals (Sweden)
Kenneth C Loh
Full Text Available Sphingosine-1-phosphate (S1P activates a widely expressed family of G protein-coupled receptors, serves as a muscle trophic factor and activates muscle stem cells called satellite cells (SCs through unknown mechanisms. Here we show that muscle injury induces dynamic changes in S1P signaling and metabolism in vivo. These changes include early and profound induction of the gene encoding the S1P biosynthetic enzyme SphK1, followed by induction of the catabolic enzyme sphingosine phosphate lyase (SPL 3 days later. These changes correlate with a transient increase in circulating S1P levels after muscle injury. We show a specific requirement for SphK1 to support efficient muscle regeneration and SC proliferation and differentiation. Mdx mice, which serve as a model for muscular dystrophy (MD, were found to be S1P-deficient and exhibited muscle SPL upregulation, suggesting that S1P catabolism is enhanced in dystrophic muscle. Pharmacological SPL inhibition increased muscle S1P levels, improved mdx muscle regeneration and enhanced SC proliferation via S1P receptor 2 (S1PR2-dependent inhibition of Rac1, thereby activating Signal Transducer and Activator of Transcription 3 (STAT3, a central player in inflammatory signaling. STAT3 activation resulted in p21 and p27 downregulation in a S1PR2-dependent fashion in myoblasts. Our findings suggest that S1P promotes SC progression through the cell cycle by repression of cell cycle inhibitors via S1PR2/STAT3-dependent signaling and that SPL inhibition may provide a therapeutic strategy for MD.
Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.
2002-01-01
Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes
Electrical stimulation as a biomimicry tool for regulating muscle cell behavior.
Ahadian, Samad; Ostrovidov, Serge; Hosseini, Vahid; Kaji, Hirokazu; Ramalingam, Murugan; Bae, Hojae; Khademhosseini, Ali
2013-01-01
There is a growing need to understand muscle cell behaviors and to engineer muscle tissues to replace defective tissues in the body. Despite a long history of the clinical use of electric fields for muscle tissues in vivo, electrical stimulation (ES) has recently gained significant attention as a powerful tool for regulating muscle cell behaviors in vitro. ES aims to mimic the electrical environment of electroactive muscle cells (e.g., cardiac or skeletal muscle cells) by helping to regulate cell-cell and cell-extracellular matrix (ECM) interactions. As a result, it can be used to enhance the alignment and differentiation of skeletal or cardiac muscle cells and to aid in engineering of functional muscle tissues. Additionally, ES can be used to control and monitor force generation and electrophysiological activity of muscle tissues for bio-actuation and drug-screening applications in a simple, high-throughput, and reproducible manner. In this review paper, we briefly describe the importance of ES in regulating muscle cell behaviors in vitro, as well as the major challenges and prospective potential associated with ES in the context of muscle tissue engineering.
α-smooth muscle actin is not a marker of fibrogenic cell activity in skeletal muscle fibrosis.
Directory of Open Access Journals (Sweden)
Wanming Zhao
Full Text Available α-Smooth muscle actin (α-SMA is used as a marker for a subset of activated fibrogenic cells, myofibroblasts, which are regarded as important effector cells of tissue fibrogenesis. We address whether α-SMA-expressing myofibroblasts are detectable in fibrotic muscles of mdx5cv mice, a mouse model for Duchenne muscular dystrophy (DMD, and whether the α-SMA expression correlates with the fibrogenic function of intramuscular fibrogenic cells. α-SMA immunostaining signal was not detected in collagen I (GFP-expressing cells in fibrotic muscles of ColI-GFP/mdx5cv mice, but it was readily detected in smooth muscle cells lining intramuscular blood vessel walls. α-SMA expression was detected by quantitative RT-PCR and Western blot in fibrogenic cells sorted from diaphragm and quadriceps muscles of the ColI-GFP/mdx5cv mice. Consistent with the more severe fibrosis in the ColI-GFP/mdx5cv diaphragm, the fibrogenic cells in the diaphragm exerted a stronger fibrogenic function than the fibrogenic cells in the quadriceps as gauged by their extracellular matrix gene expression. However, both gene and protein expression of α-SMA was lower in the diaphragm fibrogenic cells than in the quadriceps fibrogenic cells in the ColI-GFP/mdx5cv mice. We conclude that myofibroblasts are present in fibrotic skeletal muscles, but their expression of α-SMA is not detectable by immunostaining. The level of α-SMA expression by intramuscular fibrogenic cells does not correlate positively with the level of collagen gene expression or the severity of skeletal muscle fibrosis in the mdx5cv mice. α-SMA is not a functional marker of fibrogenic cells in skeletal muscle fibrosis associated with muscular dystrophy.
Energy Technology Data Exchange (ETDEWEB)
Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)
2014-03-31
This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.
Application of cell co-culture system to study fat and muscle cells.
Pandurangan, Muthuraman; Hwang, Inho
2014-09-01
Animal cell culture is a highly complex process, in which cells are grown under specific conditions. The growth and development of these cells is a highly unnatural process in vitro condition. Cells are removed from animal tissues and artificially cultured in various culture vessels. Vitamins, minerals, and serum growth factors are supplied to maintain cell viability. Obtaining result homogeneity of in vitro and in vivo experiments is rare, because their structure and function are different. Living tissues have highly ordered complex architecture and are three-dimensional (3D) in structure. The interaction between adjacent cell types is quite distinct from the in vitro cell culture, which is usually two-dimensional (2D). Co-culture systems are studied to analyze the interactions between the two different cell types. The muscle and fat co-culture system is useful in addressing several questions related to muscle modeling, muscle degeneration, apoptosis, and muscle regeneration. Co-culture of C2C12 and 3T3-L1 cells could be a useful diagnostic tool to understand the muscle and fat formation in animals. Even though, co-culture systems have certain limitations, they provide a more realistic 3D view and information than the individual cell culture system. It is suggested that co-culture systems are useful in evaluating the intercellular communication and composition of two different cell types.
Energy Technology Data Exchange (ETDEWEB)
Chen, Ming; Lv, Zhiqiang; Huang, Linjie [Department of Respiratory Medicine, Sun Yat-Sen Memorial Hospital, Institute for Respiratory disease of Sun Yat-sen University, Sun Yat-sen University, Guangzhou, Guangdong Province 510120 (China); Zhang, Wei [Department of Geratology, the Second People' s Hospital of Shenzhen, Shenzhen 518000 (China); Lin, Xiaoling; Shi, Jianting; Zhang, Wei; Liang, Ruiyun [Department of Respiratory Medicine, Sun Yat-Sen Memorial Hospital, Institute for Respiratory disease of Sun Yat-sen University, Sun Yat-sen University, Guangzhou, Guangdong Province 510120 (China); Jiang, Shanping, E-mail: shanpingjiang@126.com [Department of Respiratory Medicine, Sun Yat-Sen Memorial Hospital, Institute for Respiratory disease of Sun Yat-sen University, Sun Yat-sen University, Guangzhou, Guangdong Province 510120 (China)
2015-02-15
Background: We have reported that triptolide can inhibit airway remodeling in a murine model of asthma via TGF-β1/Smad signaling. In the present study, we aimed to investigate the effect of triptolide on airway smooth muscle cells (ASMCs) proliferation and the possible mechanism. Methods: Rat airway smooth muscle cells were cultured and made synchronized, then pretreated with different concentration of triptolide before stimulated by TGF-β1. Cell proliferation was evaluated by MTT assay. Flow cytometry was used to study the influence of triptolide on cell cycle and apoptosis. Signal proteins (Smad2, Smad3 and Smad7) were detected by western blotting analysis. Results: Triptolide significantly inhibited TGF-β1-induced ASMC proliferation (P<0.05). The cell cycle was blocked at G1/S-interphase by triptolide dose dependently. No pro-apoptotic effects were detected under the concentration of triptolide we used. Western blotting analysis showed TGF-β1 induced Smad2 and Smad3 phosphorylation was inhibited by triptolide pretreatment, and the level of Smad7 was increased by triptolide pretreatment. Conclusions: Triptolide may function as an inhibitor of asthma airway remodeling by suppressing ASMCs proliferation via negative regulation of Smad signaling pathway. - Highlights: • In this study, rat airway smooth muscle cells were cultured and made synchronized. • Triptolide inhibited TGF-β1-induced airway smooth muscle cells proliferation. • Triptolide inhibited ASMCs proliferation via negative regulation of Smad signaling pathway.
[3H]QNB binding and contraction of rabbit colonic smooth muscle cells
International Nuclear Information System (INIS)
Ringer, M.J.; Hyman, P.E.; Kao, H.W.; Hsu, C.T.; Tomomasa, T.; Snape, W.J. Jr.
1987-01-01
The authors used radioligand binding and studies of cell contraction to characterize muscarinic receptors on dispersed smooth muscle cells from rabbit proximal and distal colon. Cells obtained after serial incubations in collagenase were used to measure binding of tritiated quinuclidinyl benzilate ([ 3 H]QNB). At 37 degree C, specific [ 3 H]QNB binding was saturable and linearly related to cell number. Nonlinear regression analysis was used to determine the affinity of [ 3 H]QNB for its receptor. The IC 50 for the muscarinic agonists bethanechol and oxotremorine were 80 and 0.57 μM, respectively. Hill coefficients were 0.67 for both, suggesting more complex interaction involving receptors of different affinities. In studies of cell contraction, bethanechol stimulated a dose-dependent decrease in cell length with half the maximal contraction occurring at 100 pM. These results suggest that (1) contraction is mediated by binding of bethanechol to M 2 -muscarinic receptors and that (2) there are a large number of spare receptors in colonic smooth muscle
Stem Cell Antigen-1 in Skeletal Muscle Function
Bernstein, Harold S.; Samad, Tahmina; Cholsiripunlert, Sompob; Khalifian, Saami; Gong, Wenhui; Ritner, Carissa; Aurigui, Julian; Ling, Vivian; Wilschut, Karlijn J.; Bennett, Stephen; Hoffman, Julien; Oishi, Peter
2013-01-01
Stem cell antigen-1 (Sca-1) is a member of the Ly-6 multigene family encoding highly homologous, glycosyl-phosphatidylinositol-anchored membrane proteins. Sca-1 is expressed on muscle-derived stem cells and myogenic precursors recruited to sites of muscle injury. We previously reported that inhibition of Sca-1 expression stimulated myoblast proliferation in vitro and regulated the tempo of muscle repair in vivo. Despite its function in myoblast expansion during muscle repair, a role for Sca-1...
Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal
Kim, Younggy
2011-01-01
Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie
2018-05-01
Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.
International Nuclear Information System (INIS)
Hahlbohm, H.D.; Luebbig, H.; Luther, H.
1975-01-01
Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)
Dissemination of Walker 256 carcinoma cells to rat skeletal muscle
International Nuclear Information System (INIS)
Ueoka, H.; Hayashi, K.; Namba, T.; Grob, D.
1986-01-01
After injection of 10 6 Walker 256 carcinoma cells labelled with 125 I-5-iodo-2'-deoxyuridine into the tail vein, peak concentration in skeletal muscle was 46 cells/g at 60 minutes, which was lower than 169202, 1665, 555, 198 and 133 cells/g, respectively, at 30 or 60 minutes in lung, liver, spleen, kidney and heart. Because skeletal muscle constitutes 37.4% of body weight, the total number of tumor cells was 2323 cells, which was much greater than in spleen, kidney and heart with 238, 271, and 85 cells, respectively, and only less than in lung and liver, at 222857 and 11700 cells, respectively. The total number in skeletal muscle became greater than in liver at 4 hours and than in lung at 24 hours. Ten minutes after injection of 7.5 x 10 6 Walker 256 carcinoma cells into the abdominal aorta of rats, a mean of 31 colony-forming cells were recovered from the gastrocnemius, while 106 cells were recovered from the lung after injection into the tail vein. These results indicate that a large number of viable tumor cells can be arrested in skeletal muscle through circulation. The rare remote metastasis of malignancies into skeletal muscle despite constantly circulating tumor cells does not appear to be due to poor dissemination of tumor cells into muscle but due to unhospitable environment of skeletal muscle
Aihara, Taketo; Tayagaki, Takeshi; Nagato, Yuki; Okano, Yoshinobu; Sugaya, Takeyoshi
2018-04-01
To analyze the open-circuit voltage (V oc) in intermediate-band solar cells, we investigated the current-voltage characteristics in wide-bandgap InGaP-based InP quantum dot (QD) solar cells. From the temperature dependence of the current-voltage curves, we show that the V oc in InP QD solar cells increases with decreasing temperature. We use a simple diode model to extract V oc at the zero-temperature limit, V 0, and the temperature coefficient C of the solar cells. Our results show that, while the C of InP QD solar cells is slightly larger than that of the reference InGaP solar cells, V 0 significantly decreases and coincides with the bandgap energy of the InP QDs rather than that of the InGaP host. This V 0 indicates that the V oc reduction in the InP QD solar cells is primarily caused by the breaking of the Fermi energy separation between the QDs and the host semiconductor in intermediate-band solar cells, rather than by enhanced carrier recombination.
Generation of skeletal muscle from transplanted embryonic stem cells in dystrophic mice
International Nuclear Information System (INIS)
Bhagavati, Satyakam; Xu Weimin
2005-01-01
Embryonic stem (ES) cells have great therapeutic potential because of their capacity to proliferate extensively and to form any fully differentiated cell of the body, including skeletal muscle cells. Successful generation of skeletal muscle in vivo, however, requires selective induction of the skeletal muscle lineage in cultures of ES cells and following transplantation, integration of appropriately differentiated skeletal muscle cells with recipient muscle. Duchenne muscular dystrophy (DMD), a severe progressive muscle wasting disease due to a mutation in the dystrophin gene and the mdx mouse, an animal model for DMD, are characterized by the absence of the muscle membrane associated protein, dystrophin. Here, we show that co-culturing mouse ES cells with a preparation from mouse muscle enriched for myogenic stem and precursor cells, followed by injection into mdx mice, results occasionally in the formation of normal, vascularized skeletal muscle derived from the transplanted ES cells. Study of this phenomenon should provide valuable insights into skeletal muscle development in vivo from transplanted ES cells
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms
Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi
2017-11-01
A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.
Charge Movement in a Fast Twitch Skeletal Muscle from Rat
Simon, B. J.; Beam, K. G.
1983-01-01
Voltage-dependent charge movement in the rat omohyoid muscle was investigated using the three microelectrode voltage clamp technique. The charge that moved during a depolarization from the holding potential (-90 mV) to the test potential, V, increased with increasing V, saturating around 0 mV. The charge vs. voltage relationship was well fitted by Q = Qmax/{1 + exp[-(V - V)/k]}, with Qmax = 28.5 nC/μF, V = -34.2 mV, and k = 8.7 mV. Repolarization of the fiber from the test potential back to t...
Passive Muscle-Tendon Unit Gearing is Joint Dependent in Human Medial Gastrocnemius
Directory of Open Access Journals (Sweden)
Emma F Hodson-Tole
2016-03-01
Full Text Available Skeletal muscles change length and develop force both passively and actively. Gearing allows muscle fibre length changes to be uncoupled from those of the whole muscle-tendon unit. During active contractions this process allows muscles to operate at mechanically favorable conditions for power or economical force production. Here we ask whether gearing is constant in passive muscle; determining the relationship between fascicle and muscle-tendon unit length change in the bi-articular medial gastrocnemius and investigating the influence of whether motion occurs at the knee or ankle joint. Specifically, the same muscle-tendon unit length changes were elicited by rotating either the ankle or knee joint whilst simultaneously measuring fascicle lengths in proximal and distal muscle regions using B-mode ultrasound. In both the proximal and distal muscle region, passive gearing values differed depending on whether ankle or knee motion occurred. Fascicle length changes were greater with ankle motion, likely reflecting anatomical differences in proximal and distal passive tendinous tissues, as well as shape changes of the adjacent mono-articular soleus. This suggests that there is joint-dependent dissociation between the mechanical behaviour of muscle fibres and the muscle-tendon unit during passive joint motions that may be important to consider when developing accurate models of bi-articular muscles.
Muscle Stem Cell Fate Is Controlled by the Cell-Polarity Protein Scrib
Directory of Open Access Journals (Sweden)
Yusuke Ono
2015-02-01
Full Text Available Satellite cells are resident skeletal muscle stem cells that supply myonuclei for homeostasis, hypertrophy, and repair in adult muscle. Scrib is one of the major cell-polarity proteins, acting as a potent tumor suppressor in epithelial cells. Here, we show that Scrib also controls satellite-cell-fate decisions in adult mice. Scrib is undetectable in quiescent cells but becomes expressed during activation. Scrib is asymmetrically distributed in dividing daughter cells, with robust accumulation in cells committed to myogenic differentiation. Low Scrib expression is associated with the proliferative state and preventing self-renewal, whereas high Scrib levels reduce satellite cell proliferation. Satellite-cell-specific knockout of Scrib in mice causes a drastic and insurmountable defect in muscle regeneration. Thus, Scrib is a regulator of tissue stem cells, controlling population expansion and self-renewal with Scrib expression dynamics directing satellite cell fate.
Stimulation of aortic smooth muscle cell mitogenesis by serotonin
International Nuclear Information System (INIS)
Nemecek, G.M.; Coughlin, S.R.; Handley, D.A.; Moskowitz, M.A.
1986-01-01
Bovine aortic smooth muscle cells in vitro responded to 1 nM to 10 μM serotonin with increased incorporation of [ 3 H]thymidine into DNA. The mitogenic effect of serotonin was half-maximal at 80 nM and maximal above 1 μM. At a concentration of 1 μM, serotonin stimulated smooth muscle cell mitogenesis to the same extent as human platelet-derived growth factor (PDGF) at 12 ng/ml. Tryptamine was ≅ 1/10th as potent as serotonin as a mitogen for smooth muscle cells. Other indoles that are structurally related to serotonin (D- and L-tryptophan, 5-hydroxy-L-tryptophan, N-acetyl-5-hydroxytryptamine, melatonin, 5-hydroxyindoleacetic acid, and 5-hydroxytryptophol) and quipazine were inactive. The stimulatory effect of serotonin on smooth muscle cell DNA synthesis required prolonged (20-24 hr) exposure to the agonist and was attenuated in the presence of serotonin D receptor antagonists. When smooth muscle cells were incubated with submaximal concentrations of serotonin and PDGF, synergistic rather than additive mitogenic responses were observed. These data indicate that serotonin has a significant mitogenic effect on smooth muscle cells in vitro, which appears to be mediated by specific plasma membrane receptors
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Consciousness can reduce the voltage of the output signal of solar cell
Cao, Dayong
2011-03-01
When the sun's light radiate on the solar cell, it can produce the output signal as the pho- tocurrent. We use the Data Acquisition Modules to record the voltage of the output signals. The v1 is voltage of the photocurrent of solar cell1; The v2 is the one of solar cell2. And these two solar cells stay side by side. When we record the voltages from the morning to the noon, the voltages will go up, and the v1 is bigger than the v2 during this time. But in other experi- menter, not only sun's light ratiade on two solar cells, but also consciousness act on two solar cells. Not only I can use consciousness to reduce the growth voltage of the output signals, but also can change the v1 to be littler than the v2. The experiment was conducted on Sep. 2010. When light of lamp radiate on two solar cells, I can reduce v1, at the same time, can augment v2. These experiments had been finished in Los Angeles, Oct. 26th. And the experiment show that the consciousness active function differ from the passive function of conditioned reflex (of Pavlov). There is the physical system of the mass, energy, space and time-MEST; There is the spirited system of the mind, consciousness, emotion and desire-MECD; the information system is the code system. We can use the consciousness change the electron-structure of solar cell by the interaction of the information.
Voltage controlled nano-injection system for single-cell surgery
Seger, R. Adam; Actis, Paolo; Penfold, Catherine; Maalouf, Michelle; Vilozny, Boaz; Pourmand, Nader
2015-01-01
Manipulation and analysis of single cells is the next frontier in understanding processes that control the function and fate of cells. Herein we describe a single-cell injection platform based on nanopipettes. The system uses scanning microscopy techniques to detect cell surfaces, and voltage pulses to deliver molecules into individual cells. As a proof of concept, we injected adherent mammalian cells with fluorescent dyes. PMID:22899383
Adipogenic Differentiation of Muscle Derived Cells is Repressed by Inhibition of GSK-3 Activity
Directory of Open Access Journals (Sweden)
Zoe Redshaw
2018-06-01
Full Text Available Intramuscular fat is important in large animal livestock species in regard to meat quality and in humans is of clinical significance in particular in relation to insulin resistance. The canonical Wnt signalling pathway has been implicated at a whole body level in regulating relative levels of adiposity versus lean body mass. Previously we have shown that pig muscle cells can undergo adipogenic differentiation to a degree that is dependent upon the specific muscle source. In this work we examine the role of the canonical Wnt pathway which acts through inactivation of glycogen synthase kinase-3 (GSK-3 in the regulation of adipogenic differentiation in muscle cells derived from the pig semimembranosus muscle.The application of lithium chloride to muscle derived cells significantly increased the phosphorylation of GSK-3β and thus inhibited its activity thus mimicking Wnt signaling. This was associated with a significant decrease in the expression of the adipogenic transcription factor PPARγ and an almost complete inhibition of adipogenesis in the cells. The data also suggest that GSK-3α plays, at most, a small role in this process.Studies in vivo have suggested that the Wnt pathway is a major regulator of whole body adiposity. In this study we have shown that the ability of cells derived from porcine skeletal muscle to differentiate along an adipogenic lineage, in vitro, is severely impaired by mimicking the action of this pathway. This was done by inactivation of GSK-3β by the use of Lithium Chloride.
Fetal stem cells and skeletal muscle regeneration: a therapeutic approach
Directory of Open Access Journals (Sweden)
Michela ePozzobon
2014-08-01
Full Text Available More than 40% of the body mass is represented by muscle tissue, which possesses the innate ability to regenerate after damage through the activation of muscle specific stem cell, namely satellite cells. Muscle diseases, in particular chronic degenerative state of skeletal muscle such as dystrophies, lead to a perturbation of the regenerative process, which causes the premature exhaustion of satellite cell reservoir due to continue cycles of degeneration/regeneration. Nowadays, the research is focused on different therapeutic approaches, ranging from gene and cell to pharmacological therapy, but still there is not a definitive cure in particular for genetic muscle disease. Taking this in mind, in this article we will give special consideration to muscle diseases and the use of fetal derived stem cells as new approach for therapy. Cells of fetal origin, from cord blood to placenta and amniotic fluid, can be easily obtained without ethical concern, expanded and differentiated in culture, and possess immunemodulatory properties. The in vivo approach in animal models can be helpful to study the mechanism underneath the operating principle of the stem cell reservoir, namely the niche, which holds great potential to understand the onset of muscle pathologies.
Zong, Baoyu
2014-01-01
Organic hybrid solar cells with a large open-circuit voltage, up to above that of 1.5 V standard battery voltage, were demonstrated using blends of polypyrrole: Fe2O3·ZnO nanoparticles as active-layers. The cell active-layers were readily coated in open air from relatively stable liquid dark-color polypyrrole-based dispersions, which were synthesized using appropriate surfactants during the in situ polymerization of pyrrole with FeCl3 or both H2O2 and FeCl3 as the oxidizers. The performance of the cells depends largely on the synthesized blend phase, which is determined by the surfactants, oxidizers, as well as the reactant ratio. Only the solar cells fabricated from the stable dispersions can produce both a high open-circuit voltage (>1.0 V) and short-circuit current (up to 7.5 mA cm-2) due to the relatively uniform porous network nanomorphology and higher shunt to series resistance ratio of the active-layers. The cells also display a relatively high power-conversion efficiency of up to ∼3.8%. This journal is
A high voltage ratio and low ripple interleaved DC-DC converter for fuel cell applications.
Chang, Long-Yi; Chao, Kuei-Hsiang; Chang, Tsang-Chih
2012-01-01
This paper proposes a high voltage ratio and low ripple interleaved boost DC-DC converter, which can be used to reduce the output voltage ripple. This converter transfers the low DC voltage of fuel cell to high DC voltage in DC link. The structure of the converter is parallel with two voltage-doubler boost converters by interleaving their output voltages to reduce the voltage ripple ratio. Besides, it can lower the current stress for the switches and inductors in the system. First, the PSIM software was used to establish a proton exchange membrane fuel cell and a converter circuit model. The simulated and measured results of the fuel cell output characteristic curve are made to verify the correctness of the established simulation model. In addition, some experimental results are made to validate the effectiveness in improving output voltage ripple of the proposed high voltage ratio interleaved boost DC-DC converters.
Young, R. B.; Vaughn, J. R.; Bridge, K. Y.; Smith, C. K.
1998-01-01
Analogies of epinephrine are known to cause hypertrophy of skeletal muscle when fed to animals. These compounds presumably exert their physiological action through interaction with the P-adrenergic receptor. Since the intracellular signal generated by the Beta-adrenergic receptor is cyclic AMP (cAMP), experiments were initiated in cell culture to determine if artificial elevation of cAMP by treatment with forskolin would alter muscle protein metabolism and P-adrenergic receptor expression. Chicken skeletal muscle cells after 7 days in culture were treated with 0.2-30 micrometers forskolin for a total of three days. At the end of the treatment period, both the concentration of cAMP and the quantity of myosin heavy chain (MHC) were measured. Concentration of cAMP in forskolin-treated cells increased up to 10-fold in a dose dependent manner. In contrast, the quantity of MHC was increased approximately 50% above control cells at 0.2 micrometers forskolin, but exhibited a gradual decline at higher levels of forskolin so that the quantity of MHC in cells treated with 30 micrometers forskolin was not significantly different from controls. Curiously, the intracellular concentration of cAMP which elicited the maximum increase in the quantity of MHC was only 40% higher than cAMP concentration in control cells.
In Situ Immunofluorescent Staining of Autophagy in Muscle Stem Cells
Castagnetti, Francesco
2017-06-13
Increasing evidence points to autophagy as a crucial regulatory process to preserve tissue homeostasis. It is known that autophagy is involved in skeletal muscle development and regeneration, and the autophagic process has been described in several muscular pathologies and agerelated muscle disorders. A recently described block of the autophagic process that correlates with the functional exhaustion of satellite cells during muscle repair supports the notion that active autophagy is coupled with productive muscle regeneration. These data uncover the crucial role of autophagy in satellite cell activation during muscle regeneration in both normal and pathological conditions, such as muscular dystrophies. Here, we provide a protocol to monitor the autophagic process in the adult Muscle Stem Cell (MuSC) compartment during muscle regenerative conditions. This protocol describes the setup methodology to perform in situ immunofluorescence imaging of LC3, an autophagy marker, and MyoD, a myogenic lineage marker, in muscle tissue sections from control and injured mice. The methodology reported allows for monitoring the autophagic process in one specific cell compartment, the MuSC compartment, which plays a central role in orchestrating muscle regeneration.
Down-regulation of lipoprotein lipase increases glucose uptake in L6 muscle cells
Energy Technology Data Exchange (ETDEWEB)
Lopez, Veronica; Saraff, Kumuda [Department of Chemistry and Biochemistry, California State University Northridge, Northridge, CA 91330-8262 (United States); Medh, Jheem D., E-mail: jheem.medh@csun.edu [Department of Chemistry and Biochemistry, California State University Northridge, Northridge, CA 91330-8262 (United States)
2009-11-06
Thiazolidinediones (TZDs) are synthetic hypoglycemic agents used to treat type 2 diabetes. TZDs target the peroxisome proliferator activated receptor-gamma (PPAR-{gamma}) and improve systemic insulin sensitivity. The contributions of specific tissues to TZD action, or the downstream effects of PPAR-{gamma} activation, are not very clear. We have used a rat skeletal muscle cell line (L6 cells) to demonstrate that TZDs directly target PPAR-{gamma} in muscle cells. TZD treatment resulted in a significant repression of lipoprotein lipase (LPL) expression in L6 cells. This repression correlated with an increase in glucose uptake. Down-regulation of LPL message and protein levels using siRNA resulted in a similar increase in insulin-dependent glucose uptake. Thus, LPL down-regulation improved insulin sensitivity independent of TZDs. This finding provides a novel method for the management of insulin resistance.
Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP
Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.
2010-01-01
In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128
Battery Cell Voltage Sensing and Balancing Using Addressable Transformers
Davies, Francis
2009-01-01
A document discusses the use of saturating transformers in a matrix arrangement to address individual cells in a high voltage battery. This arrangement is able to monitor and charge individual cells while limiting the complexity of circuitry in the battery. The arrangement has inherent galvanic isolation, low cell leakage currents, and allows a single bad cell in a battery of several hundred cells to be easily spotted.
Dextromethorphan inhibition of voltage-gated proton currents in BV2 microglial cells.
Song, Jin-Ho; Yeh, Jay Z
2012-05-10
Dextromethorphan, an antitussive drug, has a neuroprotective property as evidenced by its inhibition of microglial production of pro-inflammatory cytokines and reactive oxygen species. The microglial activation requires NADPH oxidase activity, which is sustained by voltage-gated proton channels in microglia as they dissipate an intracellular acid buildup. In the present study, we examined the effect of dextromethorphan on proton currents in microglial BV2 cells. Dextromethorphan reversibly inhibited proton currents with an IC(50) value of 51.7 μM at an intracellular/extracellular pH gradient of 5.5/7.3. Dextromethorphan did not change the reversal potential or the voltage dependence of the gating. Dextrorphan and 3-hydroxymorphinan, major metabolites of dextromethorphan, and dextromethorphan methiodide were ineffective in inhibiting proton currents. The results indicate that dextromethorphan inhibition of proton currents would suppress NADPH oxidase activity and, eventually, microglial activation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current
DEFF Research Database (Denmark)
Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten
2002-01-01
The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....
Directory of Open Access Journals (Sweden)
Mohamad Khairul Anuar
2017-01-01
Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.
Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel
DEFF Research Database (Denmark)
Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle
2012-01-01
The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...
Masetto, Sergio; Zampini, Valeria; Zucca, Giampiero; Valli, Paolo
2005-11-01
Type I and Type II hair cells, and Type II hair cells located in different zones of the semicircular canal crista, express different patterns of voltage-dependent K channels, each one specifically shaping the hair cell receptor potential. We report here that, close to hatching, chicken embryo semicircular canal Type I and Type II hair cells express a similar voltage-dependent L-type calcium current (I(Ca)), whose main features are: activation above -60 mV, fast activation kinetics, and scarce inactivation. I(Ca) should be already active at rest in Zone 1 Type II hair cells, whose resting membrane potential was on average slightly less negative than -60 mV. Conversely, I(Ca) would not be active at rest in Type II hair cells from Zone 2 and 3, nor in Type I hair cells, since their resting membrane potential was significantly more negative than -60 mV. However, even small depolarising currents would activate I(Ca) steadily in Zone 2 and 3 Type II hair cells, but not in Type I hair cells because of the robust repolarising action of their specific array of K(+) currents. The implications of the present findings in the afferent discharge are discussed.
Automatic voltage imbalance detector
Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.
1984-01-01
A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.
Direct evidence of fiber type-dependent GLUT-4 expression in human skeletal muscle
DEFF Research Database (Denmark)
Gaster, M; Poulsen, P; Handberg, A
2000-01-01
GLUT-4 expression in individual fibers of human skeletal muscles in younger and older adults was studied. Furthermore, the dependency of insulin-stimulated glucose uptake on fiber type distribution was investigated. Fiber type distribution was determined in cryosections of muscle biopsies from 8...... of slow fibers in the young (r = -0.45, P > 0.25) or in the elderly (r = 0. 11, P > 0.75) subjects. In conclusion, in human skeletal muscle, GLUT-4 expression is fiber type dependent and decreases with age, particularly in fast muscle fibers....
Akt1/PKB upregulation leads to vascular smooth muscle cell hypertrophy and polyploidization
Hixon, Mary L.; Muro-Cacho, Carlos; Wagner, Mark W.; Obejero-Paz, Carlos; Millie, Elise; Fujio, Yasushi; Kureishi, Yasuko; Hassold, Terry; Walsh, Kenneth; Gualberto, Antonio
2000-01-01
Vascular smooth muscle cells (VSMCs) at capacitance arteries of hypertensive individuals and animals undergo marked age- and blood pressure–dependent polyploidization and hypertrophy. We show here that VSMCs at capacitance arteries of rat models of hypertension display high levels of Akt1/PKB protein and activity. Gene transfer of Akt1 to VSMCs isolated from a normotensive rat strain was sufficient to abrogate the activity of the mitotic spindle cell–cycle checkpoint, promoting polyploidization and hypertrophy. Furthermore, the hypertrophic agent angiotensin II induced VSMC polyploidization in an Akt1-dependent manner. These results demonstrate that Akt1 regulates ploidy levels in VSMCs and contributes to vascular smooth muscle polyploidization and hypertrophy during hypertension. PMID:11032861
Nahlé, Zaher; Hsieh, Michael; Pietka, Terri; Coburn, Chris T.; Grimaldi, Paul A.; Zhang, Michael Q.; Das, Debopriya; Abumrad, Nada A.
2008-01-01
The transcription factor FoxO1 contributes to the metabolic adaptation to fasting by suppressing muscle oxidation of glucose, sparing it for glucose-dependent tissues. Previously, we reported that FoxO1 activation in C2C12 muscle cells recruits the fatty acid translocase CD36 to the plasma membrane and increases fatty acid uptake and oxidation. This, together with FoxO1 induction of lipoprotein lipase, would promote the reliance on fatty acid utilization characteristic of the fasted muscle. H...
Requirement of myomaker-mediated stem cell fusion for skeletal muscle hypertrophy.
Goh, Qingnian; Millay, Douglas P
2017-02-10
Fusion of skeletal muscle stem/progenitor cells is required for proper development and regeneration, however the significance of this process during adult muscle hypertrophy has not been explored. In response to muscle overload after synergist ablation in mice, we show that myomaker, a muscle specific membrane protein essential for myoblast fusion, is activated mainly in muscle progenitors and not myofibers. We rendered muscle progenitors fusion-incompetent through genetic deletion of myomaker in muscle stem cells and observed a complete reduction of overload-induced hypertrophy. This blunted hypertrophic response was associated with a reduction in Akt and p70s6k signaling and protein synthesis, suggesting a link between myonuclear accretion and activation of pro-hypertrophic pathways. Furthermore, fusion-incompetent muscle exhibited increased fibrosis after muscle overload, indicating a protective role for normal stem cell activity in reducing myofiber strain associated with hypertrophy. These findings reveal an essential contribution of myomaker-mediated stem cell fusion during physiological adult muscle hypertrophy.
Skeletal muscle stem cells from animals I. Basic cell biology
Skeletal muscle stem cells from food-producing animals have been of interest to agricultural life scientists seeking to develop a better understanding of the molecular regulation of lean tissue (skeletal muscle protein hypertrophy) and intramuscular fat (marbling) development. Enhanced understanding...
Molecular aging and rejuvenation of human muscle stem cells
DEFF Research Database (Denmark)
Carlson, Morgan E; Suetta, Charlotte; Conboy, Michael J
2009-01-01
. Our findings establish key evolutionarily conserved mechanisms of human stem cell aging. We find that satellite cells are maintained in aged human skeletal muscle, but fail to activate in response to muscle attrition, due to diminished activation of Notch compounded by elevated transforming growth...... factor beta (TGF-beta)/phospho Smad3 (pSmad3). Furthermore, this work reveals that mitogen-activated protein kinase (MAPK)/phosphate extracellular signal-regulated kinase (pERK) signalling declines in human muscle with age, and is important for activating Notch in human muscle stem cells. This molecular......Very little remains known about the regulation of human organ stem cells (in general, and during the aging process), and most previous data were collected in short-lived rodents. We examined whether stem cell aging in rodents could be extrapolated to genetically and environmentally variable humans...
Internal voltage control of hydrogen-oxygen fuel cells: Feasibility study
Prokopius, P. R.
1975-01-01
An experimental study was conducted to assess the feasibility of internal voltage regulation of fuel cell systems. Two methods were tested. In one, reactant partial pressure was used as the voltage control parameter and in the other reactant total pressure was used for control. Both techniques were breadboarded and tested on a single alkaline-electrolyte fuel cell. Both methods were found to be possible forms of regulation, however, of the two the total pressure technique would be more efficient, simpler to apply and would provide better transient characteristics.
Mathematical modeling of electrical activity of uterine muscle cells.
Rihana, Sandy; Terrien, Jeremy; Germain, Guy; Marque, Catherine
2009-06-01
The uterine electrical activity is an efficient parameter to study the uterine contractility. In order to understand the ionic mechanisms responsible for its generation, we aimed at building a mathematical model of the uterine cell electrical activity based upon the physiological mechanisms. First, based on the voltage clamp experiments found in the literature, we focus on the principal ionic channels and their cognate currents involved in the generation of this electrical activity. Second, we provide the methodology of formulations of uterine ionic currents derived from a wide range of electrophysiological data. The model is validated step by step by comparing simulated voltage-clamp results with the experimental ones. The model reproduces successfully the generation of single spikes or trains of action potentials that fit with the experimental data. It allows analyzing ionic channels implications. Likewise, the calcium-dependent conductance influences significantly the cellular oscillatory behavior.
Directory of Open Access Journals (Sweden)
Anette I Öberg
Full Text Available BACKGROUND: There is considerable interest in identifying compounds that can improve glucose homeostasis. Skeletal muscle, due to its large mass, is the principal organ for glucose disposal in the body and we have investigated here if shikonin, a naphthoquinone derived from the Chinese plant Lithospermum erythrorhizon, increases glucose uptake in skeletal muscle cells. METHODOLOGY/PRINCIPAL FINDINGS: Shikonin increases glucose uptake in L6 skeletal muscle myotubes, but does not phosphorylate Akt, indicating that in skeletal muscle cells its effect is medaited via a pathway distinct from that used for insulin-stimulated uptake. Furthermore we find no evidence for the involvement of AMP-activated protein kinase in shikonin induced glucose uptake. Shikonin increases the intracellular levels of calcium in these cells and this increase is necessary for shikonin-mediated glucose uptake. Furthermore, we found that shikonin stimulated the translocation of GLUT4 from intracellular vesicles to the cell surface in L6 myoblasts. The beneficial effect of shikonin on glucose uptake was investigated in vivo by measuring plasma glucose levels and insulin sensitivity in spontaneously diabetic Goto-Kakizaki rats. Treatment with shikonin (10 mg/kg intraperitoneally once daily for 4 days significantly decreased plasma glucose levels. In an insulin sensitivity test (s.c. injection of 0.5 U/kg insulin, plasma glucose levels were significantly lower in the shikonin-treated rats. In conclusion, shikonin increases glucose uptake in muscle cells via an insulin-independent pathway dependent on calcium. CONCLUSIONS/SIGNIFICANCE: Shikonin increases glucose uptake in skeletal muscle cells via an insulin-independent pathway dependent on calcium. The beneficial effects of shikonin on glucose metabolism, both in vitro and in vivo, show that the compound possesses properties that make it of considerable interest for developing novel treatment of type 2 diabetes.
Directory of Open Access Journals (Sweden)
Jin Yipeng
2017-07-01
Full Text Available Smooth muscle differentiated human adipose derived stem cells (hADSCs provide a crucial stem cell source for urinary tissue engineering, but the induction of hADSCs for smooth muscle differentiation still has several issues to overcome, including a relatively long induction time and equipment dependence, which limits access to abundant stem cells within a short period of time for further application. Three-dimensional (3D bioprinting holds great promise in regenerative medicine due to its controllable construction of a designed 3D structure. When evenly mixed with bioink, stem cells can be spatially distributed within a bioprinted 3D structure, thus avoiding drawbacks such as, stem cell detachment in a conventional cell-scaffold strategy. Notwithstanding the advantages mentioned above, cell viability is often compromised during 3D bioprinting, which is often due to pressure during the bioprinting process. The objective of our study was to improve the efficiency of hADSC smooth muscle differentiation and cell viability of a 3D bioprinted structure. Here, we employed the hanging-drop method to generate hADSC microtissues in a smooth muscle inductive medium containing human transforming growth factor β1 and bioprinted the induced microtissues onto a 3D structure. After 3 days of smooth muscle induction, the expression of α-smooth muscle actin and smoothelin was higher in microtissues than in their counterpart monolayer cultured hADSCs, as confirmed by immunofluorescence and western blotting analysis. The semi-quantitative assay showed that the expression of α-smooth muscle actin (α-SMA was 0.218 ± 0.077 in MTs and 0.082 ± 0.007 in Controls; smoothelin expression was 0.319 ± 0.02 in MTs and 0.178 ± 0.06 in Controls. Induced MTs maintained their phenotype after the bioprinting process. Live/dead and cell count kit 8 assays showed that cell viability and cell proliferation in the 3D structure printed with microtissues were higher at all time
Ultra Low Voltage Class AB Switched Current Memory Cells Based on Floating Gate Transistors
DEFF Research Database (Denmark)
Mucha, Igor
1999-01-01
current memory cells were designed using a CMOS process with threshold voltages V-T0n = \\V-T0p\\ = 0.9 V for the n- and p-channel devices. Both hand calculations and PSPICE simulations showed that the designed example switched current memory cell allowed a maximum signal range better than +/-18 mu......A proposal for a class AB switched current memory cell, suitable for ultra-low-voltage applications is presented. The proposal employs transistors with floating gates, allowing to build analog building blocks for ultralow supply voltage operation also in CMOS processes with high threshold voltages....... This paper presents the theoretical basis for the design of "floating-gate'' switched current memory cells by giving a detailed description and analysis of the most important impacts degrading the performance of the cells. To support the theoretical assumptions circuits based on "floating-gate'' switched...
Protein Availability and Satellite Cell Dynamics in Skeletal Muscle.
Shamim, Baubak; Hawley, John A; Camera, Donny M
2018-06-01
Human skeletal muscle satellite cells are activated in response to both resistance and endurance exercise. It was initially proposed that satellite cell proliferation and differentiation were only required to support resistance exercise-induced hypertrophy. However, satellite cells may also play a role in muscle fibre remodelling after endurance-based exercise and extracellular matrix regulation. Given the importance of dietary protein, particularly branched chain amino acids, in supporting myofibrillar and mitochondrial adaptations to both resistance and endurance-based training, a greater understanding of how protein intake impacts satellite cell activity would provide further insight into the mechanisms governing skeletal muscle remodelling with exercise. While many studies have investigated the capacity for protein ingestion to increase post-exercise rates of muscle protein synthesis, few investigations have examined the role for protein ingestion to modulate satellite cell activity. Here we review the molecular mechanisms controlling the activation of satellite cells in response to mechanical stress and protein intake in both in vitro and in vivo models. We provide a mechanistic framework that describes how protein ingestion may enhance satellite activity and promote exercise adaptations in human skeletal muscle.
Tian, Zhi-Ling; Jiang, Shu-Kun; Zhang, Miao; Wang, Meng; Li, Jiao-Yong; Zhao, Rui; Wang, Lin-Lin; Li, Shan-Shan; Liu, Min; Zhang, Meng-Zhou; Guan, Da-Wei
2016-01-01
The study was focused on time-dependent expressions of paired-box transcription factor 7 (Pax7) and myoblast determination protein (MyoD) during skeletal muscle wound healing. An animal model of skeletal muscle contusion was established in 40 Sprague-Dawley male rats. Samples were taken at 1, 3, 5, 7, 9, 13, 17, and 21 days after injury, respectively (five rats in each posttraumatic interval). Five rats were employed as control. By morphometric analysis, the data based on the number of Pax7(+)/MyoD(-), Pax7(+)/MyoD(+), and Pax7(-)/MyoD(+) cells were highly correlated with the wound age. Pax7 and MyoD expressions were upregulated after injury by Western blot and quantitative real-time PCR assays. The relative quantity of Pax7 protein peaked at 5 days after injury, which was >1.13, and decreased thereafter. Similarly, the relative quantity of MyoD mRNA expression peaked at 3 days after injury, which was >2.59. The relative quantity of Pax7 protein >0.73 or mRNA expression >2.38 or the relative quantity of MyoD protein >1.33 suggested a wound age of 3 to 7 days. The relative quantity of MyoD mRNA expression >2.02 suggested a wound age of 1 to 7 days post-injury. In conclusion, the expressions of Pax7 and MyoD are upregulated in a time-dependent manner during skeletal muscle wound healing, suggesting that Pax7 and MyoD may be potential markers for wound age estimation in skeletal muscle.
DEFF Research Database (Denmark)
Isa, Adiba; Nehlin, Jan; Sabir, Hardee Jawad
2010-01-01
HLA class-I expression is weak in embryonic stem cells but increases rapidly during lineage progression. It is unknown whether all three classical HLA class-I antigens follow the same developmental program. In the present study, we investigated allele-specific expression of HLA-A, -B, and -C...... at the mRNA and protein levels on human mesenchymal stem cells from bone marrow and adipose tissue as well as striated muscle satellite cells and lymphocytes. Using multicolour flow cytometry, we found high cell surface expression of HLA-A on all stem cells and PBMC examined. Surprisingly, HLA-B was either...... undetectable or very weakly expressed on all stem cells protecting them from complement-dependent cytotoxicity (CDC) using relevant human anti-B and anti-Cw sera. IFNgamma stimulation for 48-72 h was required to induce full HLA-B protein expression. Quantitative real-time RT-PCR showed that IFNgamma induced...
Sturiale, A.; Li, H. B. T.; Rath, J.K.; Schropp, R.E.I.; Rubinelli, F.A.
2009-01-01
The transport mechanisms controlling the forward dark current-voltage characteristic of the silicon micromorph tandem solar cell were investigated with numerical modeling techniques. The dark current-voltage characteristics of the micromorph tandem structure at forward voltages show three regions:
Directory of Open Access Journals (Sweden)
Zhixin Lin
Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.
Electrothermal Feedback and Absorption-Induced Open-Circuit-Voltage Turnover in Solar Cells
Ullbrich, Sascha; Fischer, Axel; Tang, Zheng; Ávila, Jorge; Bolink, Henk J.; Reineke, Sebastian; Vandewal, Koen
2018-05-01
Solar panels easily heat up upon intense solar radiation due to excess energy dissipation of the absorbed photons or by nonradiative recombination of charge carriers. Still, photoinduced self-heating is often ignored when characterizing lab-sized samples. For light-intensity-dependent measurements of the open-circuit voltage (Suns-VO C ), allowing us to characterize the recombination mechanism, sample heating is often not considered, although almost 100% of the absorbed energy is converted into heat. Here, we show that the frequently observed stagnation or even decrease in VOC at increasingly high light intensities can be explained by considering an effective electrothermal feedback between the recombination current and the open-circuit voltage. Our analytical model fully explains the experimental data for various solar-cell technologies, comprising conventional inorganic semiconductors as well as organic and perovskite materials. Furthermore, the model can be exploited to determine the ideality factor, the effective gap, and the temperature rise from a single Suns-VOC measurement at ambient conditions.
Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing
Zhang, Yu
2017-10-17
Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid–liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the “sensing channel” can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.
Liquid-Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing.
Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni
2017-11-08
Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid-liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the "sensing channel" can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.
Communication between functional and denervated muscles using radiofrequency.
Jacob, Doreen K; Stefko, Susan Tonya; Hackworth, Steven A; Lovell, Michael R; Mickle, Marlin H
2006-05-01
This article focuses on establishing communication between a functional muscle and a denervated muscle using a radiofrequency communications link. The ultimate objective of the project is to restore the eye blink in patients with facial nerve paralysis. Two sets of experiments were conducted using the gastrocnemius leg muscles of Sprague-Dawley rats. In the initial tests, varying magnitudes of voltages ranging from 0.85 to 2.5 V were applied directly to a denervated muscle to determine the voltage required to produce visible contraction. The second set of experiments was then conducted to determine the voltage output from an in vivo muscle contraction that could be sensed and used to coordinate a signal for actuation of a muscle in a separate limb. After designing the appropriate external communication circuitry, a third experiment was performed to verify that a signal between a functional and a denervated muscle can be generated and used as a stimulus. Voltages below 2 V at a 10-millisecond pulse width elicited a gentle, controlled contraction of the denervated muscle in vivo. It was also observed that with longer pulse widths, higher stimulation voltages were required to produce sufficient contractions. It is possible to detect contraction of a muscle, use this to generate a signal to an external base station, and subsequently cause a separate, denervated muscle to contract in response to the signal. This demonstration in vivo of a signaling system for pacing of electrical stimulation of 1 muscle to spontaneous contraction of another, separate muscle, using radiofrequency communication without direct connection, may be used in numerous ways to overcome nerve damage.
International Nuclear Information System (INIS)
Bradley, P.; Van Duzer, T.
1985-01-01
A destructive read-out (DRO) memory cell using three Josephson junctions has been devised whose operation depends only on the ratio of critical currents and application of the proper read/write voltages. The effects of run-to-run and across-thewafer variations in I /SUB c/ are minimized since all three junctions for a given cell are quite close to each other. Additional advantages are: immunity from flux trapping, high circuit density, and fast switching. Since destructive read-out is generally undesirable, a self-rewriting scheme is necessary. Rows and columns of cells with drivers and sense circuits, as well as small memory arrays and decoders have been simulated on SPICE. Power dissipation of cells and bias circuits for a 1K-bit RAM is estimated at about 2 mW. Inclusion of peripheral circuitry raises this by as much as a factor of five depending on the driving scheme and speed desired. Estimated access time is appreciably less than a nanosecond. Preliminary experimental investigations are reported
Sarcomere length-dependence of activity-dependent twitch potentiation in mouse skeletal muscle
Directory of Open Access Journals (Sweden)
MacIntosh Brian R
2002-12-01
Full Text Available Abstract Background It has been reported that potentiation of a skeletal muscle twitch response is proportional to muscle length with a negative slope during staircase, and a positive slope during posttetanic potentiation. This study was done to directly compare staircase and posttetanic responses with measurement of sarcomere length to compare their length-dependence. Methods Mouse extensor digitorum longus (EDL muscles were dissected to small bundles of fibers, which permit measurement of sarcomere length (SL, by laser diffraction. In vitro fixed-end contractions of EDL fiber bundles were elicited at 22°C and 35°C at sarcomere lengths ranging from 2.35 μm to 3.85 μm. Twitch contractions were assessed before and after 1.5 s of 75 Hz stimulation at 22°C or during 10 s of 10 Hz stimulation at 22°C or 35°C. Results Staircase potentiation was greater at 35°C than 22°C, and the relative magnitude of the twitch contraction (Pt*/Pt was proportional to sarcomere length with a negative slope, over the range 2.3 μm – 3.7 μm. Linear regression yielded the following: Pt*/Pt = -0.59·SL+3.27 (r2 = 0.74; Pt*/Pt = -0.39·SL+2.34 (r2 = 0.48; and Pt*/Pt = -0.50·SL+2.45 (r2 = 0.80 for staircase at 35°C, and 22°C and posttetanic response respectively. Posttetanic depression rather than potentiation was present at long SL. This indicates that there may be two processes operating in these muscles to modulate the force: one that enhances and a second that depresses the force. Either or both of these processes may have a length-dependence of its mechanism. Conclusion There is no evidence that posttetanic potentiation is fundamentally different from staircase in these muscles.
Directory of Open Access Journals (Sweden)
John J. Lemasters
2017-12-01
Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.
Expression of uncoupling protein 1 in bovine muscle cells.
Abd Eldaim, M A; Hashimoto, O; Ohtsuki, H; Yamada, T; Murakami, M; Onda, K; Sato, R; Kanamori, Y; Qiao, Y; Tomonaga, S; Matsui, T; Funaba, M
2016-12-01
Uncoupling protein 1 (Ucp1) is predominantly expressed in brown/beige adipocytes in mammals. Although myogenic cells have been suggested to commit to a brown adipocyte lineage through the induction of Prdm16 expression, Prdm16 is also expressed in skeletal muscle. Thus, we examined expression of Ucp1 in bovine myogenic cells. Considering that Ucp1 is a principle molecule that induces energy expenditure in brown/beige adipocytes, expression of Ucp1 is not preferable in beef cattle because of potential decrease in energy (fattening) efficiency. The RT-PCR analyses revealed the expression of Ucp1 in the skeletal muscle of cattle; expression levels were markedly lower than those in the brown fat of calves. Immunohistochemical analyses showed that Ucp1 surrounded muscle fibers, but not adipocytes residing in skeletal muscle. Myosatellite cells cultured in myogenic medium showed an increase in the expression levels of myogenic regulatory factors ( levels were greater in cells after myogenic culture for 12 d than in those after myogenic culture for 6 d ( bovine skeletal muscle, which suggests the necessity for further studies on Ucp1-mediated energy expenditure in bovine skeletal muscle.
Asakura, Atsushi
2012-01-01
For postnatal growth and regeneration of skeletal muscle, satellite cells, a self-renewing pool of muscle stem cells, give rise to daughter myogenic precursor cells that contribute to the formation of new muscle fibers. In addition to this key myogenic cell class, adult skeletal muscle also contains hematopoietic stem cell and progenitor cell populations which can be purified as a side population (SP) fraction or as a hematopoietic marker CD45-positive cell population. These muscle-derived he...
Stem cell antigen-1 in skeletal muscle function.
Bernstein, Harold S; Samad, Tahmina; Cholsiripunlert, Sompob; Khalifian, Saami; Gong, Wenhui; Ritner, Carissa; Aurigui, Julian; Ling, Vivian; Wilschut, Karlijn J; Bennett, Stephen; Hoffman, Julien; Oishi, Peter
2013-08-15
Stem cell antigen-1 (Sca-1) is a member of the Ly-6 multigene family encoding highly homologous, glycosyl-phosphatidylinositol-anchored membrane proteins. Sca-1 is expressed on muscle-derived stem cells and myogenic precursors recruited to sites of muscle injury. We previously reported that inhibition of Sca-1 expression stimulated myoblast proliferation in vitro and regulated the tempo of muscle repair in vivo. Despite its function in myoblast expansion during muscle repair, a role for Sca-1 in normal, post-natal muscle has not been thoroughly investigated. We systematically compared Sca-1-/- (KO) and Sca-1+/+ (WT) mice and hindlimb muscles to elucidate the tissue, contractile, and functional effects of Sca-1 in young and aging animals. Comparison of muscle volume, fibrosis, myofiber cross-sectional area, and Pax7+ myoblast number showed little differences between ages or genotypes. Exercise protocols, however, demonstrated decreased stamina in KO versus WT mice, with young KO mice achieving results similar to aging WT animals. In addition, KO mice did not improve with practice, while WT animals demonstrated conditioning over time. Surprisingly, myomechanical analysis of isolated muscles showed that KO young muscle generated more force and experienced less fatigue. However, KO muscle also demonstrated incomplete relaxation with fatigue. These findings suggest that Sca-1 is necessary for muscle conditioning with exercise, and that deficient conditioning in Sca-1 KO animals becomes more pronounced with age.
Directory of Open Access Journals (Sweden)
Gurney Alison M
2005-10-01
Full Text Available Abstract Background Uridine 5'-triphosphate (UTP and uridine 5'-diphosphate (UDP act via P2Y receptors to evoke contraction of rat pulmonary arteries, whilst adenosine 5'-triphosphate (ATP acts via P2X and P2Y receptors. Pharmacological characterisation of these receptors in intact arteries is complicated by release and extracellular metabolism of nucleotides, so the aim of this study was to characterise the P2Y receptors under conditions that minimise these problems. Methods The perforated-patch clamp technique was used to record the Ca2+-dependent, Cl- current (ICl,Ca activated by P2Y receptor agonists in acutely dissociated smooth muscle cells of rat small (SPA and large (LPA intrapulmonary arteries, held at -50 mV. Contractions to ATP were measured in isolated muscle rings. Data were compared by Student's t test or one way ANOVA. Results ATP, UTP and UDP (10-4M evoked oscillating, inward currents (peak = 13–727 pA in 71–93% of cells. The first current was usually the largest and in the SPA the response to ATP was significantly greater than those to UTP or UDP (P -1 and changed little during agonist application. The non-selective P2 receptor antagonist suramin (10-4M abolished currents evoked by ATP in SPA (n = 4 and LPA (n = 4, but pyridoxalphosphate-6-azophenyl-2',4'-disulphonic acid (PPADS (10-4M, also a non-selective P2 antagonist, had no effect (n = 4, 5 respectively. Currents elicited by UTP (n = 37 or UDP (n = 14 were unaffected by either antagonist. Contractions of SPA evoked by ATP were partially inhibited by PPADS (n = 4 and abolished by suramin (n = 5. Both antagonists abolished the contractions in LPA. Conclusion At least two P2Y subtypes couple to ICl,Ca in smooth muscle cells of rat SPA and LPA, with no apparent regional variation in their distribution. The suramin-sensitive, PPADS-resistant site activated by ATP most resembles the P2Y11 receptor. However, the suramin- and PPADS-insensitive receptor activated by UTP and UDP
Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification
Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo
2013-01-01
In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...
Directory of Open Access Journals (Sweden)
Abhishek Ghosh
2014-10-01
Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.
New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.
Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy
2004-10-01
We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.
Apoptosis in differentiating C2C12 muscle cells selectively targets Bcl-2-deficient myotubes
Schoneich, Christian; Dremina, Elena; Galeva, Nadezhda; Sharov, Victor
2014-01-01
Muscle cell apoptosis accompanies normal muscle development and regeneration, as well as degenerative diseases and aging. C2C12 murine myoblast cells represent a common model to study muscle differentiation. Though it was already shown that myogenic differentiation of C2C12 cells is accompanied by enhanced apoptosis in a fraction of cells, either the cell population sensitive to apoptosis or regulatory mechanisms for the apoptotic response are unclear so far. In the current study we characterize apoptotic phenotypes of different types of C2C12 cells at all stages of differentiation, and report here that myotubes of differentiated C2C12 cells with low levels of anti-apoptotic Bcl-2 expression are particularly vulnerable to apoptosis even though they are displaying low levels of pro-apoptotic proteins Bax, Bak and Bad. In contrast, reserve cells exhibit higher levels of Bcl-2 and high resistance to apoptosis. The transfection of proliferating myoblasts with Bcl-2 prior to differentiation did not protect against spontaneous apoptosis accompanying differentiation of C2C12 cell but led to Bcl-2 overexpression in myotubes and to significant protection from apoptotic cell loss caused by exposure to hydrogen peroxide. Overall, our data advocate for a Bcl-2-dependent mechanism of apoptosis in differentiated muscle cells. However, downstream processes for spontaneous and hydrogen peroxide induced apoptosis are not completely similar. Apoptosis in differentiating myoblasts and myotubes is regulated not through interaction of Bcl-2 with pro-apoptotic Bcl-2 family proteins such as Bax, Bak, and Bad. PMID:24129924
Reducing burn-in voltage loss in polymer solar cells by increasing the polymer crystallinity
Heumueller, Thomas
2014-08-01
In order to commercialize polymer solar cells, the fast initial performance losses present in many high efficiency materials will have to be managed. This burn-in degradation is caused by light-induced traps and its characteristics depend on which polymer is used. We show that the light-induced traps are in the bulk of the active layer and we find a direct correlation between their presence and the open-circuit voltage loss in devices made with amorphous polymers. Solar cells made with crystalline polymers do not show characteristic open circuit voltage losses, even though light-induced traps are also present in these devices. This indicates that crystalline materials are more resistant against the influence of traps on device performance. Recent work on crystalline materials has shown there is an energetic driving force for charge carriers to leave amorphous, mixed regions of bulk heterojunctions, and charges are dominantly transported in pure, ordered phases. This energetic landscape allows efficient charge generation as well as extraction and also may benefit the stability against light-induced traps. This journal is © the Partner Organisations 2014.
Satellite cell depletion prevents fiber hypertrophy in skeletal muscle.
Egner, Ingrid M; Bruusgaard, Jo C; Gundersen, Kristian
2016-08-15
The largest mammalian cells are the muscle fibers, and they have multiple nuclei to support their large cytoplasmic volumes. During hypertrophic growth, new myonuclei are recruited from satellite stem cells into the fiber syncytia, but it was recently suggested that such recruitment is not obligatory: overload hypertrophy after synergist ablation of the plantaris muscle appeared normal in transgenic mice in which most of the satellite cells were abolished. When we essentially repeated these experiments analyzing the muscles by immunohistochemistry and in vivo and ex vivo imaging, we found that overload hypertrophy was prevented in the satellite cell-deficient mice, in both the plantaris and the extensor digitorum longus muscles. We attribute the previous findings to a reliance on muscle mass as a proxy for fiber hypertrophy, and to the inclusion of a significant number of regenerating fibers in the analysis. We discuss that there is currently no model in which functional, sustainable hypertrophy has been unequivocally demonstrated in the absence of satellite cells; an exception is re-growth, which can occur using previously recruited myonuclei without addition of new myonuclei. © 2016. Published by The Company of Biologists Ltd.
Exercise dependence and muscle dysmorphia in novice and experienced female bodybuilders.
Hale, Bruce D; Diehl, Danielle; Weaver, Krista; Briggs, Michael
2013-12-01
Extensive research has shown that male bodybuilders are at high risk for exercise dependence, but few studies have measured these variables in female bodybuilders. Prior research has postulated that muscular dysmorphia was more prevalent in men than women, but several qualitative studies of female bodybuilders have indicated that female bodybuilders show the same body image concerns. Only one study has compared female bodybuilders with control recreational female lifters on eating behaviors, body image, shape pre-occupation, body dissatisfaction, and steroid use. The purpose of this study was to compare exercise dependence and muscle dysmorphia measures between groups of female weight lifters. Seventy-four female lifters were classified into three lifting types (26 expert bodybuilders, 10 or more competitions; 29 novice bodybuilders, 3 or less competitions; and 19 fitness lifters, at least 6 months prior lifting) who each completed a demographic questionnaire, the Exercise Dependence Scale (EDS), the Drive for Thinness scale (DFT) of the Eating Disorder Inventory-2, the Bodybuilding Dependence Scale (BDS), and the Muscle Dysmorphia Inventory (MDI). Female bodybuilders scored higher than fitness lifters for EDS Total, BDS Training and Social Dependence, and on Supplement Use, Dietary Behavior, Exercise Dependence, and Size Symmetry scales of the MDI. Female bodybuilders seem to be more at risk for exercise dependence and muscle dysmorphia symptoms than female recreational weight lifters.
Listening to membrane potential: photoacoustic voltage-sensitive dye recording
Zhang, Haichong K.; Yan, Ping; Kang, Jeeun; Abou, Diane S.; Le, Hanh N. D.; Jha, Abhinav K.; Thorek, Daniel L. J.; Kang, Jin U.; Rahmim, Arman; Wong, Dean F.; Boctor, Emad M.; Loew, Leslie M.
2017-04-01
Voltage-sensitive dyes (VSDs) are designed to monitor membrane potential by detecting fluorescence changes in response to neuronal or muscle electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. By contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near-infrared light excitation and ultrasound detection. Here, we show that voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. We synthesized a near-infrared photoacoustic VSD (PA-VSD), whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. A theoretical model accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate PA voltage sensing but also emphasize the interplay of both fluorescence and absorbance properties in the design of optimized PA probes. Together, our results demonstrate PA sensing as a potential new modality for recording and external imaging of electrophysiological and neurochemical events in the brain.
Attia, Mohamed; Maurer, Marie; Robinet, Marieke; Le Grand, Fabien; Fadel, Elie; Le Panse, Rozen; Butler-Browne, Gillian; Berrih-Aknin, Sonia
2017-12-01
Myasthenia gravis (MG) is a neuromuscular disease caused in most cases by anti-acetyl-choline receptor (AChR) autoantibodies that impair neuromuscular signal transmission and affect skeletal muscle homeostasis. Myogenesis is carried out by muscle stem cells called satellite cells (SCs). However, myogenesis in MG had never been explored. The aim of this study was to characterise the functional properties of myasthenic SCs as well as their abilities in muscle regeneration. SCs were isolated from muscle biopsies of MG patients and age-matched controls. We first showed that the number of Pax7+ SCs was increased in muscle sections from MG and its experimental autoimmune myasthenia gravis (EAMG) mouse model. Myoblasts isolated from MG muscles proliferate and differentiate more actively than myoblasts from control muscles. MyoD and MyoG were expressed at a higher level in MG myoblasts as well as in MG muscle biopsies compared to controls. We found that treatment of control myoblasts with MG sera or monoclonal anti-AChR antibodies increased the differentiation and MyoG mRNA expression compared to control sera. To investigate the functional ability of SCs from MG muscle to regenerate, we induced muscle regeneration using acute cardiotoxin injury in the EAMG mouse model. We observed a delay in maturation evidenced by a decrease in fibre size and MyoG mRNA expression as well as an increase in fibre number and embryonic myosin heavy-chain mRNA expression. These findings demonstrate for the first time the altered function of SCs from MG compared to control muscles. These alterations could be due to the anti-AChR antibodies via the modulation of myogenic markers resulting in muscle regeneration impairment. In conclusion, the autoimmune attack in MG appears to have unsuspected pathogenic effects on SCs and muscle regeneration, with potential consequences on myogenic signalling pathways, and subsequently on clinical outcome, especially in the case of muscle stress.
Cell fate determination in zebrafish embryonic and adult muscle development
Tee, J.M.
2010-01-01
We are interested in how the genetic basis of muscle precursor cells determines the outcome of the muscle cell fate, and thus leading to disruption in muscle formation and maintenance. We utilized the zebrafish carrying mutations in both Axin1 and Apc1, resulting in overactivation of the
Constraints on voltage sensor movement in the shaker K+ channel.
Darman, Rachel B; Ivy, Allison A; Ketty, Vina; Blaustein, Robert O
2006-12-01
In nerve and muscle cells, the voltage-gated opening and closing of cation-selective ion channels is accompanied by the translocation of 12-14 elementary charges across the membrane's electric field. Although most of these charges are carried by residues in the S4 helix of the gating module of these channels, the precise nature of their physical movement is currently the topic of spirited debate. Broadly speaking, two classes of models have emerged: those that suggest that small-scale motions can account for the extensive charge displacement, and those that invoke a much larger physical movement. In the most recent incarnation of the latter type of model, which is based on structural and functional data from the archaebacterial K(+) channel KvAP, a "voltage-sensor paddle" comprising a helix-turn-helix of S3-S4 translocates approximately 20 A through the bilayer during the gating cycle (Jiang, Y., A. Lee, J. Chen, V. Ruta, M. Cadene, B.T. Chait, and R. MacKinnon. 2003. Nature. 423:33-41; Jiang, Y., V. Ruta, J. Chen, A. Lee, and R. MacKinnon. 2003. Nature. 423:42-48.; Ruta, V., J. Chen, and R. MacKinnon. 2005. Cell. 123:463-475). We used two methods to test for analogous motions in the Shaker K(+) channel, each examining the aqueous exposure of residues near S3. In the first, we employed a pore-blocking maleimide reagent (Blaustein, R.O., P.A. Cole, C. Williams, and C. Miller. 2000. Nat. Struct. Biol. 7:309-311) to probe for state-dependent changes in the chemical reactivity of substituted cysteines; in the second, we tested the state-dependent accessibility of a tethered biotin to external streptavidin (Qiu, X.Q., K.S. Jakes, A. Finkelstein, and S.L. Slatin. 1994. J. Biol. Chem. 269:7483-7488; Slatin, S.L., X.Q. Qiu, K.S. Jakes, and A. Finkelstein. 1994. Nature. 371:158-161). In both types of experiments, residues predicted to lie near the top of S3 did not exhibit any change in aqueous exposure during the gating cycle. This lack of state dependence argues against
Skeletal muscle to pancreatic β-cell cross-talk
DEFF Research Database (Denmark)
Christensen, Camilla S; P. Christensen, Dan; Lundh, Morten
2015-01-01
CONTEXT: Mechanisms explaining exercise-induced β-cell health are unknown. OBJECTIVE: To define the role of muscle contraction and acute exercise-derived soluble humoral mediators on β-cell health. DESIGN: In vitro models. SETTING: University. PARTICIPANTS: Healthy subjects. INTERVENTION...... insulin secretion in the absence of IL-1β+IFN-γ. CONCLUSIONS: Unidentified circulating humoral mediators released during exercise prevent proinflammatory cytokine-induced β-cell apoptosis. Muscle-derived mediators released during exercise suppress β-cell insulin secretion. Furthermore, muscle-derived IL-6...
Epidermal growth factor-mediated effects on equine vascular smooth muscle cells
International Nuclear Information System (INIS)
Grosenbaugh, D.A.; Amoss, M.S.; Hood, D.M.; Morgan, S.J.; Williams, J.D.
1988-01-01
Epidermal growth factor (EGF) receptor binding kinetics and EGF-mediated stimulation of DNA synthesis and cellular proliferation were studied in cultured vascular smooth muscle cells (VSMC) from the equine thoracic aorta. Binding studies, using murine 125 I-labeled EGF, indicate the presence of a single class of high-affinity binding sites, with an estimated maximal binding capacity of 5,800 sites/cells. EGF stimulated [ 3 H]thymidine uptake in confluent quiescent monolayers in a dose-dependent fashion, half-maximal stimulation occurring at 7.5 x 10 -11 M. Likewise, EGF-mediated cellular proliferation was dose dependent under reduced serum concentrations. Equine VSMC contain specific receptors for EGF, and EGF can stimulate DNA synthesis and proliferation in these cultured cells, which suggests that EGF may participate in the proliferative changes observed in equine distal digital peripheral vascular disease
International Nuclear Information System (INIS)
Wei, Yan; Li, Yuan; Chen, Chao; Stoelzel, Katharina; Kaufmann, Andreas M.; Albers, Andreas E.
2011-01-01
Human skeletal muscle contains an accessible adult stem-cell compartment in which differentiated myofibers are maintained and replaced by a self-renewing stem cell pool. Previously, studies using mouse models have established a critical role for resident stem cells in skeletal muscle, but little is known about this paradigm in human muscle. Here, we report the reproducible isolation of a population of cells from human skeletal muscle that is able to proliferate for extended periods of time as floating clusters of rounded cells, termed 'myospheres' or myosphere-derived progenitor cells (MDPCs). The phenotypic characteristics and functional properties of these cells were determined using reverse transcription-polymerase chain reaction (RT-PCR), flow cytometry and immunocytochemistry. Our results showed that these cells are clonogenic, express skeletal progenitor cell markers Pax7, ALDH1, Myod, and Desmin and the stem cell markers Nanog, Sox2, and Oct3/4 significantly elevated over controls. They could be maintained proliferatively active in vitro for more than 20 weeks and passaged at least 18 times, despite an average donor-age of 63 years. Individual clones (4.2%) derived from single cells were successfully expanded showing clonogenic potential and sustained proliferation of a subpopulation in the myospheres. Myosphere-derived cells were capable of spontaneous differentiation into myotubes in differentiation media and into other mesodermal cell lineages in induction media. We demonstrate here that direct culture and expansion of stem cells from human skeletal muscle is straightforward and reproducible with the appropriate technique. These cells may provide a viable resource of adult stem cells for future therapies of disease affecting skeletal muscle or mesenchymal lineage derived cell types.
Overcharge Protection And Cell Voltage Monitoring For Lithium-Ion Batteries
Altemose, George; Salim, Abbas
2011-10-01
This paper describes a new Battery Interface and Electronics (BIE) assembly used to monitor battery and cell voltages, as well as provide overvoltage (overcharge) protection for Lithium Ion batteries with up to 8-cells in series. The BIE performs accurate measurement of the individual cell voltages, the total battery voltage, and the individual cell temperatures. In addition, the BIE provides an independent over-charge protection (OCP) circuit that terminates the charging process by isolating the battery from the charging source in the event that the voltage of any cell exceeds a preset limit of +4.500V. The OCP circuit utilizes dual redundancy, and is immune to single-point failures in the sense that no single-point failure can cause the battery to become isolated inadvertently. A typical application of the BIE in a spacecraft electrical power subsystem is shown in Figure 1. The BIE circuits have been designed with Chip On Board (COB) technology. Using this technology, integrated circuit die, Field Effect Transistors (FETs) and diodes are mounted and wired directly on a multi-layer printed wiring board (PWB). For those applications where long term reliability can be achieved without hermeticity, COB technology provides many benefits such as size and weight reduction while lowering production costs. The BIE was designed, fabricated and tested to meet the specifications provided by Orbital Sciences Corporation (OSC) for use with Lithium-Ion batteries in the Commercial Orbital Transportation System (COTS). COTS will be used to deliver cargo to the International Space Station at low earth orbit (LEO). Aeroflex has completed the electrical and mechanical design of the BIE and fabricated and tested the Engineering Model (EM), as well as the Engineering Qualification Model (EQM). Flight units have also been fabricated, tested and delivered to OSC.
Directory of Open Access Journals (Sweden)
Zhang Hong-Yu
2010-11-01
Full Text Available Abstract Background The ability of skeletal muscle to grow and regenerate is dependent on resident stem cells called satellite cells. It has been shown that chronic hindlimb unloading downregulates the satellite cell activity. This study investigated the role of low-frequency electrical stimulation on satellite cell activity during a 28 d hindlimb suspension in rats. Results Mechanical unloading resulted in a 44% reduction in the myofiber cross-sectional area as well as a 29% and 34% reduction in the number of myonuclei and myonuclear domains, respectively, in the soleus muscles (P vs the weight-bearing control. The number of quiescent (M-cadherin+, proliferating (BrdU+ and myoD+, and differentiated (myogenin+ satellite cells was also reduced by 48-57% compared to the weight-bearing animals (P P Conclusion This study shows that electrical stimulation partially attenuated the decrease in muscle size and satellite cells during hindlimb unloading. The causal relationship between satellite cell activation and electrical stimulation remain to be established.
The quasi-parallel lives of satellite cells and atrophying muscle
Directory of Open Access Journals (Sweden)
Stefano eBiressi
2015-07-01
Full Text Available Skeletal muscle atrophy or wasting accompanies various chronic illnesses and the aging process, thereby reducing muscle function. One of the most important components contributing to effective muscle repair in postnatal organisms, the satellite cells, have recently become the focus of several studies examining factors participating in the atrophic process. We critically examine here the experimental evidence linking satellite cell function with muscle loss in connection with various diseases as well as aging, and in the subsequent recovery process. Several recent reports have investigated the changes in satellite cells in terms of their differentiation and proliferative capacity in response to various atrophic stimuli. In this regard, we review the molecular changes within satellite cells that contribute to their dysfunctional status in atrophy, with the intention of shedding light on novel potential pharmacological targets to counteract the loss of muscle mass.
Pavolucci, Lucia; Giannini, Giulia; Giannoccaro, Maria Pia; Foschini, Maria Pia; Lang, Bethan; Avoni, Patrizia; Tinuper, Paolo; Vincent, Angela; Liguori, Rocco
2017-11-01
Merkel cell carcinoma is a rare cutaneous, aggressive tumor. Although it shares many neuroendocrine features with small cell lung carcinoma, it has only occasionally been reported with paraneoplastic neurological syndromes. A healthy 67-year-old man developed acute ataxia, vertigo, and nausea. Subsequently he also developed dysarthria, diplopia, xerostomia, fatigability and progressive anorexia. He underwent a full diagnostic workup and was found to have a high titer of voltage-gated calcium channel antibodies in serum and cerebrospinal fluid, neurophysiological findings compatible with Lambert-Eaton myasthenia and neurological signs compatible with cerebellar degeneration. A positron emission tomography study revealed a hypermetabolic lesion in the axilla, subsequently biopsied and consistent with Merkel cell carcinoma. In most previous reports, neurological symptoms preceded the Merkel cell carcinoma diagnosis, and the primary localization was in lymph nodes. This tumor should be considered in patients with paraneoplastic syndrome, and particularly Lambert-Eaton myasthenia after exclusion of small cell lung carcinoma. Muscle Nerve 56: 998-1000, 2017. © 2016 Wiley Periodicals, Inc.
Vinpocetine Attenuates the Osteoblastic Differentiation of Vascular Smooth Muscle Cells.
Directory of Open Access Journals (Sweden)
Yun-Yun Ma
Full Text Available Vascular calcification is an active process of osteoblastic differentiation of vascular smooth muscle cells; however, its definite mechanism remains unknown. Vinpocetine, a derivative of the alkaloid vincamine, has been demonstrated to inhibit the high glucose-induced proliferation of vascular smooth muscle cells; however, it remains unknown whether vinpocetine can affect the osteoblastic differentiation of vascular smooth muscle cells. We hereby investigated the effect of vinpocetine on vascular calcification using a beta-glycerophosphate-induced cell model. Our results showed that vinpocetine significantly reduced the osteoblast-like phenotypes of vascular smooth muscle cells including ALP activity, osteocalcin, collagen type I, Runx2 and BMP-2 expression as well as the formation of mineralized nodule. Vinpocetine, binding to translocation protein, induced phosphorylation of extracellular signal-related kinase and Akt and thus inhibited the translocation of nuclear factor-kappa B into the nucleus. Silencing of translocator protein significantly attenuated the inhibitory effect of vinpocetine on osteoblastic differentiation of vascular smooth muscle cells. Taken together, vinpocetine may be a promising candidate for the clinical therapy of vascular calcification.
LRP1 in brain vascular smooth muscle cells mediates local clearance of Alzheimer's amyloid-β.
Kanekiyo, Takahisa; Liu, Chia-Chen; Shinohara, Mitsuru; Li, Jie; Bu, Guojun
2012-11-14
Impaired clearance of amyloid-β (Aβ) is a major pathogenic event for Alzheimer's disease (AD). Aβ depositions in brain parenchyma as senile plaques and along cerebrovasculature as cerebral amyloid angiopathy (CAA) are hallmarks of AD. A major pathway that mediates brain Aβ clearance is the cerebrovascular system where Aβ is eliminated through the blood-brain barrier (BBB) and/or degraded by cerebrovascular cells along the interstitial fluid drainage pathway. An Aβ clearance receptor, the low-density lipoprotein receptor-related protein 1 (LRP1), is abundantly expressed in cerebrovasculature, in particular in vascular smooth muscle cells. Previous studies have indicated a role of LRP1 in endothelial cells in transcytosing Aβ out of the brain across the BBB; however, whether this represents a significant pathway for brain Aβ clearance remains controversial. Here, we demonstrate that Aβ can be cleared locally in the cerebrovasculature by an LRP1-dependent endocytic pathway in smooth muscle cells. The uptake and degradation of both endogenous and exogenous Aβ were significantly reduced in LRP1-suppressed human brain vascular smooth muscle cells. Conditional deletion of Lrp1 in vascular smooth muscle cell in amyloid model APP/PS1 mice accelerated brain Aβ accumulation and exacerbated Aβ deposition as amyloid plaques and CAA without affecting Aβ production. Our results demonstrate that LRP1 is a major Aβ clearance receptor in cerebral vascular smooth muscle cell and a disturbance of this pathway contributes to Aβ accumulation. These studies establish critical functions of the cerebrovasculature system in Aβ metabolism and identify a new pathway involved in the pathogenesis of both AD and CAA.
Role of cyclic GMP in cells with the properties of smooth muscle cultured from the rat myometrium
International Nuclear Information System (INIS)
Krall, J.F.; Morin, A.
1986-01-01
Cells growing in culture with previously described properties of rat uterine smooth muscle accumulated 45 Ca 2+ from the medium. Ca 2+ uptake by these cells was stimulated by the addition to the medium of 8-bromo-cGMP but not by 8-bromo-cAMP. Ca 2+ uptake was also stimulated by carbachol and by the nitro-vasodilator nitroprusside. Although cholinergic agonists have been shown previously to stimulate contraction but not cGMP synthesis in the rat myometrium, both carbachol and nitroprusside stimulated cGMP production by the cultured cells. These results suggested the cells had cholinergic receptor-medicated functions that reflected some neurotransmitter-sensitive properties of uterine smooth muscle in situ. When determined by a specific radioligand binding assay, subcellular fractions of the cultured cells bound muscarinic cholinergic agonists and antagonists with affinities expected of the muscarinic receptor. The cells were also sensitive to the β-adrenergic catecholamine agonist isoproterenol, which stimulated cAMP production but not Ca 2+ uptake. Carbachol failed to inhibit isoproterenol-dependent cAMP production, which is an important property of the cholinergic receptor in uterine smooth muscle in situ. These results suggest some but not all acetylcholine-sensitive properties of uterine smooth muscle may be retained in cell culture
Oyarbide, E.; Bernal, C.; Molina, P.; Jiménez, L. A.; Gálvez, R.; Martínez, A.
2016-01-01
Ultracapacitors are low voltage devices and therefore, for practical applications, they need to be used in modules of series-connected cells. Because of the inherent manufacturing tolerance of the capacitance parameter of each cell, and as the maximum voltage value cannot be exceeded, the module requires inter-cell voltage equalization. If the intended application suffers repeated fast charging/discharging cycles, active equalization circuits must be rated to full power, and thus the module becomes expensive. Previous work shows that a series connection of several sets of paralleled ultracapacitors minimizes the dispersion of equivalent capacitance values, and also the voltage differences between capacitors. Thus the overall life expectancy is improved. This paper proposes a method to distribute ultracapacitors with a number partitioning-based strategy to reduce the dispersion between equivalent submodule capacitances. Thereafter, the total amount of stored energy and/or the life expectancy of the device can be considerably improved.
Finnerty, Celeste C; McKenna, Colleen F; Cambias, Lauren A; Brightwell, Camille R; Prasai, Anesh; Wang, Ye; El Ayadi, Amina; Herndon, David N; Suman, Oscar E; Fry, Christopher S
2017-11-01
Severe burns result in significant skeletal muscle cachexia that impedes recovery. Activity of satellite cells, skeletal muscle stem cells, is altered following a burn injury and likely hinders regrowth of muscle. Severe burn injury induces satellite cell proliferation and fusion into myofibres with greater activity in muscles proximal to the injury site. Conditional depletion of satellite cells attenuates recovery of myofibre area and volume following a scald burn injury in mice. Skeletal muscle regrowth following a burn injury requires satellite cell activity, underscoring the therapeutic potential of satellite cells in the prevention of prolonged frailty in burn survivors. Severe burns result in profound skeletal muscle atrophy; persistent muscle atrophy and weakness are major complications that hamper recovery from burn injury. Many factors contribute to the erosion of muscle mass following burn trauma, and we have previously shown concurrent activation and apoptosis of muscle satellite cells following a burn injury in paediatric patients. To determine the necessity of satellite cells during muscle recovery following a burn injury, we utilized a genetically modified mouse model (Pax7 CreER -DTA) that allows for the conditional depletion of satellite cells in skeletal muscle. Additionally, mice were provided 5-ethynyl-2'-deoxyuridine to determine satellite cell proliferation, activation and fusion. Juvenile satellite cell-wild-type (SC-WT) and satellite cell-depleted (SC-Dep) mice (8 weeks of age) were randomized to sham or burn injury consisting of a dorsal scald burn injury covering 30% of total body surface area. Both hindlimb and dorsal muscles were studied at 7, 14 and 21 days post-burn. SC-Dep mice had >93% depletion of satellite cells compared to SC-WT (P satellite cell proliferation and fusion. Depletion of satellite cells impaired post-burn recovery of both muscle fibre cross-sectional area and volume (P satellite cells in the aetiology of lean
Voltage-gated calcium flux mediates Escherichia coli mechanosensation.
Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M
2017-08-29
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
DEFF Research Database (Denmark)
Timmermann, D B; Lund, Trine Meldgaard; Belhage, B
2001-01-01
The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...
Skeletal muscle aging: stem cell function and tissue homeostasis
Victor, Pedro Sousa
2012-01-01
Muscle aging, in particular, is characterized by the reduction of tissue mass and function, which are particularly prominent in geriatric individuals undergoing sarcopenia. The age-associated muscle wasting is also associated with a decline in regenerative ability and a reduction in resident muscle stem cell (satellite cell) number and function. Although sarcopenia is one of the major contributors to the general loss of physiological function, the mechanisms involved in age-related loss of mu...
Reed, Kent M; Mendoza, Kristelle M; Abrahante, Juan E; Barnes, Natalie E; Velleman, Sandra G; Strasburg, Gale M
2017-05-06
Climate change poses a multi-dimensional threat to food and agricultural systems as a result of increased risk to animal growth, development, health, and food product quality. This study was designed to characterize transcriptional changes induced in turkey muscle satellite cells cultured under cold or hot thermal challenge to better define molecular mechanisms by which thermal stress alters breast muscle ultrastructure. Satellite cells isolated from the pectoralis major muscle of 7-weeks-old male turkeys from two breeding lines (16 weeks body weight-selected and it's randombred control) were proliferated in culture at 33 °C, 38 °C or 43 °C for 72 h. Total RNA was isolated and 12 libraries subjected to RNAseq analysis. Statistically significant differences in gene expression were observed among treatments and between turkey lines with a greater number of genes altered by cold treatment than by hot and fewer differences observed between lines than between temperatures. Pathway analysis found that cold treatment resulted in an overrepresentation of genes involved in cell signaling/signal transduction and cell communication/cell signaling as compared to control (38 °C). Heat-treated muscle satellite cells showed greater tendency towards expression of genes related to muscle system development and differentiation. This study demonstrates significant transcriptome effects on turkey skeletal muscle satellite cells exposed to thermal challenge. Additional effects on gene expression could be attributed to genetic selection for 16 weeks body weight (muscle mass). New targets are identified for further research on the differential control of satellite cell proliferation in poultry.
Muscle Stem Cell Therapy for the Treatment of DMD Associated Cardiomyopathy
2013-10-01
SUBTITLE Muscle Stem Cell Therapy for the Treatment of DMD Associated Cardiomyopathy 5a. CONTRACT NUMBER Subproject 1: Muscle Stem Cell Therapy...various muscle diseases, including Duchenne muscular dystrophy (DMD), develop progressive cardiomyopathy. Cellular cardiomyoplasty, which involves the
Regulation of the muscle fiber microenvironment by activated satellite cells during hypertrophy
Fry, Christopher S.; Lee, Jonah D.; Jackson, Janna R.; Kirby, Tyler J.; Stasko, Shawn A.; Liu, Honglu; Dupont-Versteegden, Esther E.; McCarthy, John J.; Peterson, Charlotte A.
2014-01-01
Our aim in the current study was to determine the necessity of satellite cells for long-term muscle growth and maintenance. We utilized a transgenic Pax7-DTA mouse model, allowing for the conditional depletion of > 90% of satellite cells with tamoxifen treatment. Synergist ablation surgery, where removal of synergist muscles places functional overload on the plantaris, was used to stimulate robust hypertrophy. Following 8 wk of overload, satellite cell-depleted muscle demonstrated an accumulation of extracellular matrix (ECM) and fibroblast expansion that resulted in reduced specific force of the plantaris. Although the early growth response was normal, an attenuation of hypertrophy measured by both muscle wet weight and fiber cross-sectional area occurred in satellite cell-depleted muscle. Isolated primary myogenic progenitor cells (MPCs) negatively regulated fibroblast ECM mRNA expression in vitro, suggesting a novel role for activated satellite cells/MPCs in muscle adaptation. These results provide evidence that satellite cells regulate the muscle environment during growth.—Fry, C. S., Lee, J. D., Jackson, J. R., Kirby, T. J., Stasko, S. A., Liu, H., Dupont-Versteegden, E. E., McCarthy, J. J., Peterson, C. A. Regulation of the muscle fiber microenvironment by activated satellite cells during hypertrophy. PMID:24376025
International Nuclear Information System (INIS)
Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A
2010-01-01
Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway
Satellite Cells CD44 Positive Drive Muscle Regeneration in Osteoarthritis Patients
Scimeca, Manuel; Bonanno, Elena; Piccirilli, Eleonora; Baldi, Jacopo; Mauriello, Alessandro; Orlandi, Augusto; Tancredi, Virginia; Gasbarra, Elena; Tarantino, Umberto
2015-01-01
Age-related bone diseases, such as osteoarthritis and osteoporosis, are strongly associated with sarcopenia and muscle fiber atrophy. In this study, we analyzed muscle biopsies in order to demonstrate that, in osteoarthritis patients, both osteophytes formation and regenerative properties of muscle stem cells are related to the same factors. In particular, thanks to immunohistochemistry, transmission electron microscopy, and immunogold labeling we investigated the role of BMP-2 in muscle stem cells activity. In patients with osteoarthritis both immunohistochemistry and transmission electron microscopy allowed us to note a higher number of CD44 positive satellite muscle cells forming syncytium. Moreover, the perinuclear and cytoplasmic expression of BMP-2 assessed by in situ molecular characterization of satellite cells syncytia suggest a very strict correlation between BMP-2 expression and muscle regeneration capability. Summing up, the higher BMP-2 expression in osteoarthritic patients could explain the increased bone mineral density as well as decreased muscle atrophy in osteoarthrosic patients. In conclusion, our results suggest that the control of physiological BMP-2 balance between bone and muscle tissues may be considered as a potential pharmacological target in bone-muscle related pathology. PMID:26101529
Satellite Cells CD44 Positive Drive Muscle Regeneration in Osteoarthritis Patients
Directory of Open Access Journals (Sweden)
Manuel Scimeca
2015-01-01
Full Text Available Age-related bone diseases, such as osteoarthritis and osteoporosis, are strongly associated with sarcopenia and muscle fiber atrophy. In this study, we analyzed muscle biopsies in order to demonstrate that, in osteoarthritis patients, both osteophytes formation and regenerative properties of muscle stem cells are related to the same factors. In particular, thanks to immunohistochemistry, transmission electron microscopy, and immunogold labeling we investigated the role of BMP-2 in muscle stem cells activity. In patients with osteoarthritis both immunohistochemistry and transmission electron microscopy allowed us to note a higher number of CD44 positive satellite muscle cells forming syncytium. Moreover, the perinuclear and cytoplasmic expression of BMP-2 assessed by in situ molecular characterization of satellite cells syncytia suggest a very strict correlation between BMP-2 expression and muscle regeneration capability. Summing up, the higher BMP-2 expression in osteoarthritic patients could explain the increased bone mineral density as well as decreased muscle atrophy in osteoarthrosic patients. In conclusion, our results suggest that the control of physiological BMP-2 balance between bone and muscle tissues may be considered as a potential pharmacological target in bone-muscle related pathology.
DEFF Research Database (Denmark)
Green, Charlotte J; Henriksen, Tora I; Pedersen, Bente K
2012-01-01
Glucagon like peptide-1 (GLP-1) stimulates insulin secretion from the pancreas but also has extra-pancreatic effects. GLP-1 may stimulate glucose uptake in cultured muscle cells but the mechanism is not clearly defined. Furthermore, while the pancreatic effects of GLP-1 are glucose-dependent, the......Glucagon like peptide-1 (GLP-1) stimulates insulin secretion from the pancreas but also has extra-pancreatic effects. GLP-1 may stimulate glucose uptake in cultured muscle cells but the mechanism is not clearly defined. Furthermore, while the pancreatic effects of GLP-1 are glucose...
E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.
Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej
2018-04-17
E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.
A Low-Power and Low-Voltage Power Management Strategy for On-Chip Micro Solar Cells
Directory of Open Access Journals (Sweden)
Ismail Cevik
2015-01-01
Full Text Available Fundamental characteristics of on-chip micro solar cell (MSC structures were investigated in this study. Several MSC structures using different layers in three different CMOS processes were designed and fabricated. Effects of PN junction structure and process technology on solar cell performance were measured. Parameters for low-power and low-voltage implementation of power management strategy and boost converter based circuits utilizing fractional voltage maximum power point tracking (FVMPPT algorithm were determined. The FVMPPT algorithm works based on the fraction between the maximum power point operation voltage and the open circuit voltage of the solar cell structure. This ratio is typically between 0.72 and 0.78 for commercially available poly crystalline silicon solar cells that produce several watts of power under typical daylight illumination. Measurements showed that the fractional voltage ratio is much higher and fairly constant between 0.82 and 0.85 for on-chip mono crystalline silicon micro solar cell structures that produce micro watts of power. Mono crystalline silicon solar cell structures were observed to result in better power fill factor (PFF that is higher than 74% indicating a higher energy harvesting efficiency.
Dorfmann, A. Luis; Woods, William A; Trimmer, Barry A
2007-01-01
Experimental data on the passive mechanical properties of the ventral interior lateral muscle of the tobacco hornworm caterpillar, Manduca sexta, are reported. The stress–deformation response of the Manduca muscle is shown to be nonlinear pseudo-elastic, capable of large deformations and subject to stress softening during initial loading cycles. The muscle passive mechanical properties also depend on multiple time-dependent processes. In particular, we show new experimental data from cyclic l...
Farrell, E. R.; Fernandes, J.; Keshishian, H.
1996-01-01
In many organisms muscle formation depends on specialized cells that prefigure the pattern of the musculature and serve as templates for myoblast organization and fusion. These include muscle pioneers in insects and muscle organizing cells in leech. In Drosophila, muscle founder cells have been proposed to play a similar role in organizing larval muscle development during embryogenesis. During metamorphosis in Drosophila, following histolysis of most of the larval musculature, there is a second round of myogenesis that gives rise to the adult muscles. It is not known whether muscle founder cells organize the development of these muscles. However, in the thorax specific larval muscle fibers do not histolyze at the onset of metamorphosis, but instead serve as templates for the formation of a subset of adult muscles, the dorsal longitudinal flight muscles (DLMs). Because these persistent larval muscle fibers appear to be functioning in many respects like muscle founder cells, we investigated whether they were necessary for DLM development by using a microbeam laser to ablate them singly and in combination. We found that, in the absence of the larval muscle fibers, DLMs nonetheless develop. Our results show that the persistent larval muscle fibers are not required to initiate myoblast fusion, to determine DLM identity, to locate the DLMs in the thorax, or to specify the total DLM fiber volume. However, they are required to regulate the number of DLM fibers generated. Thus, while the persistent larval muscle fibers are not obligatory for DLM fiber formation and differentiation, they are necessary to ensure the development of the correct number of fibers.
Muscle force depends on the amount of transversal muscle loading.
Siebert, Tobias; Till, Olaf; Stutzig, Norman; Günther, Michael; Blickhan, Reinhard
2014-06-03
Skeletal muscles are embedded in an environment of other muscles, connective tissue, and bones, which may transfer transversal forces to the muscle tissue, thereby compressing it. In a recent study we demonstrated that transversal loading of a muscle with 1.3Ncm(-2) reduces maximum isometric force (Fim) and rate of force development by approximately 5% and 25%, respectively. The aim of the present study was to examine the influence of increasing transversal muscle loading on contraction dynamics. Therefore, we performed isometric experiments on rat M. gastrocnemius medialis (n=9) without and with five different transversal loads corresponding to increasing pressures of 1.3Ncm(-2) to 5.3Ncm(-2) at the contact area between muscle and load. Muscle loading was induced by a custom-made plunger which was able to move in transversal direction. Increasing transversal muscle loading resulted in an almost linear decrease in muscle force from 4.8±1.8% to 12.8±2% Fim. Compared to an unloaded isometric contraction, rate of force development decreased from 20.2±4.0% at 1.3Ncm(-2) muscle loading to 34.6±5.7% at 5.3Ncm(-2). Experimental observation of the impact of transversal muscle loading on contraction dynamics may help to better understand muscle tissue properties. Moreover, applying transversal loads to muscles opens a window to analyze three-dimensional muscle force generation. Data presented in this study may be important to develop and validate muscle models which enable simulation of muscle contractions under compression and enlighten the mechanisms behind. Copyright © 2014 Elsevier Ltd. All rights reserved.
Aging, metabolism and stem cells: Spotlight on muscle stem cells.
García-Prat, Laura; Muñoz-Cánoves, Pura
2017-04-15
All tissues and organs undergo a progressive regenerative decline as they age. This decline has been mainly attributed to loss of stem cell number and/or function, and both stem cell-intrinsic changes and alterations in local niches and/or systemic environment over time are known to contribute to the stem cell aging phenotype. Advancing in the molecular understanding of the deterioration of stem cell cells with aging is key for targeting the specific causes of tissue regenerative dysfunction at advanced stages of life. Here, we revise exciting recent findings on why stem cells age and the consequences on tissue regeneration, with a special focus on regeneration of skeletal muscle. We also highlight newly identified common molecular pathways affecting diverse types of aging stem cells, such as altered proteostasis, metabolism, or senescence entry, and discuss the questions raised by these findings. Finally, we comment on emerging stem cell rejuvenation strategies, principally emanating from studies on muscle stem cells, which will surely burst tissue regeneration research for future benefit of the increasing human aging population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Laura A Villalobos
2016-12-01
Full Text Available Background and aims: Targeting inflammation is nowadays considered as a challenging pharmacological strategy to prevent or delay the development of vascular diseases. Angiotensin-(1-7 is a member of the renin-angiotensin system (RAS that binds Mas receptors and has gained growing attention in the last years as a regulator of vascular homeostasis. Here, we explored the capacity of Ang-(1-7 to counteract human aortic smooth muscle cell (HASMC inflammation triggered by RAS-dependent and –independent stimuli, such as Ang II or interleukin (IL-1.Methods and Results: In cultured HASMC, the expression of iNOS and the release of nitric oxide were stimulated by both Ang II and IL-1, as determined by Western blot and indirect immunofluorescence or the Griess method, respectively. iNOS induction was inhibited by Ang-(1-7 in a concentration-dependent manner. This effect was equally blocked by two different Mas receptor antagonists, A779 and D-Pro7-Ang-(1-7, suggesting the participation of a unique Mas receptor subtype. Using pharmacological inhibitors, the induction of iNOS was proven to rely on the consecutive upstream activation of NADPH oxidase and NF-B. Indeed, Ang-(1-7 markedly inhibited the activation of the NADPH oxidase and subsequently of NF-B, as determined by lucigenin-derived chemiluminiscence and electromobility shift assay, respectively.Conclusion: Ang-(1-7 can act as a counter-regulator of the inflammation of vascular smooth muscle cells triggered by Ang II, but also by other stimuli beyond the RAS. Activating or mimicking the Ang-(1-7/Mas axis may represent a pharmacological opportunity to attenuate the pro-inflammatory environment that promotes and sustains the development of vascular diseases.
Narinyan, Lilia; Ayrapetyan, Sinerik
2017-01-01
Previously, we have suggested that cell hydration is a universal and extra-sensitive sensor for the structural changes of cell aqua medium caused by the impact of weak chemical and physical factors. The aim of present work is to elucidate the nature of the metabolic messenger through which physiological solution (PS) treated by non-thermal (NT) microwaves (MW) could modulate heart muscle hydration of rats. For this purpose, the effects of NT MW-treated PS on heart muscle hydration, [ 3 H]-ouabain binding with cell membrane, 45 Ca 2+ uptake and intracellular cyclic nucleotides contents in vivo and in vitro experiments were studied. It is shown that intraperitoneal injections of both Sham-treated PS and NT MW-treated PS elevate heart muscle hydration. However, the effect of NT MW-treated PS on muscle hydration is more pronounced than the effect of Sham-treated PS. In vitro experiments NT MW-treated PS has dehydration effect on muscle, which is not changed by decreasing Na + gradients on membrane. Intraperitoneal injection of Sham- and NT MW-treated PS containing 45 Ca 2+ have similar dehydration effect on muscle, while NT MW-treated PS has activation effect on Na + /Ca 2+ exchange in reverse mode. The intraperitoneal injection of NT MW-treated PS depresses [ 3 H]-ouabain binding with its high-affinity membrane receptors, elevates intracellular cAMP and decreases cGMP contents. Based on the obtained data, it is suggested that cAMP-dependent signaling system serves as a primary metabolic target for NT MW effect on heart muscle hydration.
Chiral Orientation of Skeletal Muscle Cells Requires Rigid Substrate
Directory of Open Access Journals (Sweden)
Ninghao Zhu
2017-06-01
Full Text Available Reconstitution of tissue morphology with inherent left–right (LR asymmetry is essential for tissue/organ functions. For skeletal muscle, the largest tissue in mammalian organisms, successful myogenesis requires the regulation of the LR asymmetry to form the appropriate muscle alignment. However, the key factor for reproducing the LR asymmetry of skeletal tissues in a controllable, engineering context remains largely unknown. Recent reports indicate that cell chirality may underlie the LR development in tissue morphogenesis. Here, we report that a rigid substrate is required for the chirality of skeletal muscle cells. By using alternating micropatterned cell-adherent and cell-repellent stripes on a rigid substrate, we found that C2C12 skeletal muscle myoblasts exhibited a unidirectional tilted orientation with respect to the stripe boundary. Importantly, such chiral orientation was reduced when soft substrates were used instead. In addition, we demonstrated the key role of actin stress fibers in the formation of the chiral orientation. This study reveals that a rigid substrate is required for the chiral pattern of myoblasts, paving the way for reconstructing damaged muscle tissue with inherent LR asymmetry in the future.
Directory of Open Access Journals (Sweden)
Swarnali Acharyya
2010-08-01
Full Text Available Classical NF-kappaB signaling functions as a negative regulator of skeletal myogenesis through potentially multiple mechanisms. The inhibitory actions of TNFalpha on skeletal muscle differentiation are mediated in part through sustained NF-kappaB activity. In dystrophic muscles, NF-kappaB activity is compartmentalized to myofibers to inhibit regeneration by limiting the number of myogenic progenitor cells. This regulation coincides with elevated levels of muscle derived TNFalpha that is also under IKKbeta and NF-kappaB control.Based on these findings we speculated that in DMD, TNFalpha secreted from myotubes inhibits regeneration by directly acting on satellite cells. Analysis of several satellite cell regulators revealed that TNFalpha is capable of inhibiting Notch-1 in satellite cells and C2C12 myoblasts, which was also found to be dependent on NF-kappaB. Notch-1 inhibition occurred at the mRNA level suggesting a transcriptional repression mechanism. Unlike its classical mode of action, TNFalpha stimulated the recruitment of Ezh2 and Dnmt-3b to coordinate histone and DNA methylation, respectively. Dnmt-3b recruitment was dependent on Ezh2.We propose that in dystrophic muscles, elevated levels of TNFalpha and NF-kappaB inhibit the regenerative potential of satellite cells via epigenetic silencing of the Notch-1 gene.
Intrinsic non-radiative voltage losses in fullerene-based organic solar cells
Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Fan, Yeli; Tropiano, Manuel; McGarry, Kathryn A.; Zeika, Olaf; Riede, Moritz K.; Douglas, Christopher J.; Barlow, Stephen; Marder, Seth R.; Neher, Dieter; Spoltore, Donato; Vandewal, Koen
2017-06-01
Organic solar cells demonstrate external quantum efficiencies and fill factors approaching those of conventional photovoltaic technologies. However, as compared with the optical gap of the absorber materials, their open-circuit voltage is much lower, largely due to the presence of significant non-radiative recombination. Here, we study a large data set of published and new material combinations and find that non-radiative voltage losses decrease with increasing charge-transfer-state energies. This observation is explained by considering non-radiative charge-transfer-state decay as electron transfer in the Marcus inverted regime, being facilitated by a common skeletal molecular vibrational mode. Our results suggest an intrinsic link between non-radiative voltage losses and electron-vibration coupling, indicating that these losses are unavoidable. Accordingly, the theoretical upper limit for the power conversion efficiency of single-junction organic solar cells would be reduced to about 25.5% and the optimal optical gap increases to 1.45-1.65 eV, that is, 0.2-0.3 eV higher than for technologies with minimized non-radiative voltage losses.
Cellular location of rat muscle ferritins and their preferential loss during cell isolation.
Linder, M C; Roboz, M; McKown, M J; Pardridge, W M; Zak, R
1984-04-10
Heart and other muscles of the rat contain two forms of ferritin separable in polyacrylamide gel electrophoresis. The cellular location of the fast- and slow-migrating ferritins was investigated using primary cultures of hindlimb skeletal muscle, and isolated myocardial cell populations. Muscle and non-muscle cells were isolated in good yield from hearts of adult rats pretreated with large doses of iron to increase their ferritin content. In virtually all cases, the isolated muscle cells contained traces only of the fast-migrating species and the non-muscle cells contained small amounts of the slow-migrating ferritin. During cell isolation, 90-100% of both ferritins was lost and could be recovered in the perfusates and solutions employed, while one third of the total tissue protein, and a larger percentage of creatine phosphokinase, was recovered in the isolated cells. Primary cultures of thigh muscle from adult rats which had differentiated into multi-nucleated myotubes, were incubated for 1-3 days with chelated iron. These cells contained substantial amounts of the electrophoretically fast migrating ferritin, with its characteristic larger Stokes' radius (determined by quantitative polyacrylamide gel electrophoresis). None of the slow-migrating ferritin species was detected, although hindlimb muscle from iron-treated rats contained both forms. It is concluded that the fast-migrating ferritin of muscle, which is much larger and more asymmetric than other ferritins, is confined to the muscle cell population, while the other form is predominantly or exclusively in the non-muscle cells. Both ferritins are lost preferentially over other proteins during procedures which injure muscle tissue.
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
Serially Connected Micro Amorphous Silicon Solar Cells for Compact High-Voltage Sources
Directory of Open Access Journals (Sweden)
Jiyoon Nam
2016-01-01
Full Text Available We demonstrate a compact amorphous silicon (a-Si solar module to be used as high-voltage power supply. In comparison with the organic solar module, the main advantages of the a-Si solar module are its compatibility with photolithography techniques and relatively high power conversion efficiency. The open circuit voltage of a-Si solar cells can be easily controlled by serially interconnecting a-Si solar cells. Moreover, the a-Si solar module can be easily patterned by photolithography in any desired shapes with high areal densities. Using the photolithographic technique, we fabricate a compact a-Si solar module with noticeable photovoltaic characteristics as compared with the reported values for high-voltage power supplies.
Increased Stiffness in Aged Skeletal Muscle Impairs Muscle Progenitor Cell Proliferative Activity.
Directory of Open Access Journals (Sweden)
Grégory Lacraz
Full Text Available Skeletal muscle aging is associated with a decreased regenerative potential due to the loss of function of endogenous stem cells or myogenic progenitor cells (MPCs. Aged skeletal muscle is characterized by the deposition of extracellular matrix (ECM, which in turn influences the biomechanical properties of myofibers by increasing their stiffness. Since the stiffness of the MPC microenvironment directly impacts MPC function, we hypothesized that the increase in muscle stiffness that occurs with aging impairs the behavior of MPCs, ultimately leading to a decrease in regenerative potential.We showed that freshly isolated individual myofibers from aged mouse muscles contain fewer MPCs overall than myofibers from adult muscles, with fewer quiescent MPCs and more proliferative and differentiating MPCs. We observed alterations in cultured MPC behavior in aged animals, where the proliferation and differentiation of MPCs were lower and higher, respectively. These alterations were not linked to the intrinsic properties of aged myofibers, as shown by the similar values for the cumulative population-doubling values and fusion indexes. However, atomic force microscopy (AFM indentation experiments revealed a nearly 4-fold increase in the stiffness of the MPC microenvironment. We further showed that the increase in stiffness is associated with alterations to muscle ECM, including the accumulation of collagen, which was correlated with higher hydroxyproline and advanced glycation end-product content. Lastly, we recapitulated the impaired MPC behavior observed in aging using a hydrogel substrate that mimics the stiffness of myofibers.These findings provide novel evidence that the low regenerative potential of aged skeletal muscle is independent of intrinsic MPC properties but is related to the increase in the stiffness of the MPC microenvironment.
International Nuclear Information System (INIS)
Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi
2009-01-01
Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms
File list: His.Emb.20.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available His.Emb.20.AllAg.Muscle_cells dm3 Histone Embryo Muscle cells SRX110783,SRX110777,S...RX110779,SRX110778,SRX110776 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Emb.20.AllAg.Muscle_cells.bed ...
File list: His.Emb.50.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available His.Emb.50.AllAg.Muscle_cells dm3 Histone Embryo Muscle cells SRX110783,SRX110777,S...RX110778,SRX110776,SRX110779 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Emb.50.AllAg.Muscle_cells.bed ...
File list: His.Emb.05.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available His.Emb.05.AllAg.Muscle_cells dm3 Histone Embryo Muscle cells SRX110776,SRX110778,S...RX110777,SRX110779,SRX110783 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Emb.05.AllAg.Muscle_cells.bed ...
File list: His.Emb.10.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available His.Emb.10.AllAg.Muscle_cells dm3 Histone Embryo Muscle cells SRX110776,SRX110777,S...RX110783,SRX110778,SRX110779 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Emb.10.AllAg.Muscle_cells.bed ...
Dual patch voltage clamp study of low membrane resistance astrocytes in situ.
Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min
2014-03-17
Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.
Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.
Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J
2012-07-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.
Effects of the activin A-myostatin-follistatin system on aging bone and muscle progenitor cells
Bowser, Matthew; Herberg, Samuel; Arounleut, Phonepasong; Shi, Xingming; Fulzele, Sadanand; Hill, William D.; Isales, Carlos M.; Hamrick, Mark W.
2013-01-01
The activin A-myostatin-follistatin system is thought to play an important role in the regulation of muscle and bone mass throughout growth, development, and aging; however, the effects of these ligands on progenitor cell proliferation and differentiation in muscle and bone are not well understood. In addition, age-associated changes in the relative expression of these factors in musculoskeletal tissues have not been described. We therefore examined changes in protein levels of activin A, follistatin, and myostatin (GDF-8) in both muscle and bone with age in C57BL6 mice using ELISA. We then investigated the effects of activin A, myostatin and follistatin on the proliferation and differentiation of primary myoblasts and mouse bone marrow stromal cells (BMSCs) in vitro. Myostatin levels and the myostatin:follistatin ratio increased with age in the primarily slow-twitch mouse soleus muscle, whereas the pattern was reversed with age in the fast-twitch extensor digitorum longus muscle. Myostatin levels and the myostatin: follistatin ratio increased significantly (+75%) in mouse bone marrow with age, as did activin A levels (+17%). Follistatin increased the proliferation of primary myoblasts from both young and aged mice, whereas myostatin increased proliferation of younger myoblasts but decreased proliferation of older myoblasts. Myostatin reduced proliferation of both young and aged BMSCs in a dose-dependent fashion, and activin A increased mineralization in both young and aged BMSCs. Together these data suggest that aging in mice is accompanied by changes in the expression of activin A and myostatin, as well as changes in the response of bone and muscle progenitor cells to these factors. Myostatin appears to play a particularly important role in the impaired proliferative capacity of muscle and bone progenitor cells from aged mice. PMID:23178301
Muscle channelopathies and electrophysiological approach
Directory of Open Access Journals (Sweden)
Cherian Ajith
2008-01-01
Full Text Available Myotonic syndromes and periodic paralyses are rare disorders of skeletal muscle characterized mainly by muscle stiffness or episodic attacks of weakness. Familial forms are caused by mutation in genes coding for skeletal muscle voltage ionic channels. Familial periodic paralysis and nondystrophic myotonias are disorders of skeletal muscle excitability caused by mutations in genes coding for voltage-gated ion channels. These diseases are characterized by episodic failure of motor activity due to muscle weakness (paralysis or stiffness (myotonia. Clinical studies have identified two forms of periodic paralyses: hypokalemic periodic paralysis (hypoKPP and hyperkalemic periodic paralysis (hyperKPP, based on changes in serum potassium levels during the attacks, and three distinct forms of myotonias: paramyotonia congenita (PC, potassium-aggravated myotonia (PAM, and myotonia congenita (MC. PC and PAM have been linked to missense mutations in the SCN4A gene, which encodes α subunit of the voltage-gated sodium channel, whereas MC is caused by mutations in the chloride channel gene (CLCN1. Exercise is known to trigger, aggravate, or relieve symptoms. Therefore, exercise can be used as a functional test in electromyography to improve the diagnosis of these muscle disorders. Abnormal changes in the compound muscle action potential can be disclosed using different exercise tests. Five electromyographic (EMG patterns (I-V that may be used in clinical practice as guides for molecular diagnosis are discussed.
Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.
Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R
2018-03-24
Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to
File list: Pol.Emb.20.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.20.AllAg.Muscle_cells dm3 RNA polymerase Embryo Muscle cells SRX110760,SRX1...X110758,SRX110765,SRX110766,SRX110769 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.20.AllAg.Muscle_cells.bed ...
File list: ALL.Emb.50.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ALL.Emb.50.AllAg.Muscle_cells dm3 All antigens Embryo Muscle cells SRX110783,SRX110...X110785,SRX110779,SRX110790,SRX110794 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Emb.50.AllAg.Muscle_cells.bed ...
File list: Pol.Emb.05.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.05.AllAg.Muscle_cells dm3 RNA polymerase Embryo Muscle cells SRX110762,SRX1...X110759,SRX110770,SRX110768,SRX110763 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.05.AllAg.Muscle_cells.bed ...
File list: Pol.Emb.50.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Pol.Emb.50.AllAg.Muscle_cells dm3 RNA polymerase Embryo Muscle cells SRX110760,SRX1...X110765,SRX110769,SRX110766,SRX110758 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.50.AllAg.Muscle_cells.bed ...
File list: ALL.Emb.05.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ALL.Emb.05.AllAg.Muscle_cells dm3 All antigens Embryo Muscle cells SRX110776,SRX110...X110768,SRX110763,SRX110790,SRX066244 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Emb.05.AllAg.Muscle_cells.bed ...
File list: ALL.Emb.10.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available ALL.Emb.10.AllAg.Muscle_cells dm3 All antigens Embryo Muscle cells SRX110776,SRX110...X110790,SRX066244,SRX110778,SRX110779 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Emb.10.AllAg.Muscle_cells.bed ...
Directory of Open Access Journals (Sweden)
Zhenguo Dong
2015-01-01
Full Text Available Our previous study reported that muscle cell enhancement factor 2C (MEF2C was fully activated after inhibition of the phosphorylation activity of integrin-linked kinase (ILK in the skeletal muscle cells of goats. It enhanced the binding of promoter or enhancer of transcription factor related to proliferation of muscle cells and then regulated the expression of these genes. In the present investigation, we explored whether ILK activation depended on PI3K to regulate the phosphorylation and transcriptional activity of MEF2C during C2C12 cell proliferation. We inhibited PI3K activity in C2C12 with LY294002 and then found that ILK phosphorylation levels and MEF2C phosphorylation were decreased and that MCK mRNA expression was suppressed significantly. After inhibiting ILK phosphorylation activity with Cpd22 and ILK-shRNA, we found MEF2C phosphorylation activity and MCK mRNA expression were increased extremely significantly. In the presence of Cpd22, PI3K activity inhibition increased MEF2C phosphorylation and MCK mRNA expression indistinctively. We conclude that ILK negatively and independently of PI3K regulated MEF2C phosphorylation activity and MCK mRNA expression in C2C12 cells. The results provide new ideas for the study of classical signaling pathway of PI3K-ILK-related proteins and transcription factors.
Directory of Open Access Journals (Sweden)
Wei Xia
2015-01-01
Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.
A complicated complex: Ion channels, voltage sensing, cell membranes and peptide inhibitors.
Zhang, Alan H; Sharma, Gagan; Undheim, Eivind A B; Jia, Xinying; Mobli, Mehdi
2018-04-21
Voltage-gated ion channels (VGICs) are specialised ion channels that have a voltage dependent mode of action, where ion conduction, or gating, is controlled by a voltage-sensing mechanism. VGICs are critical for electrical signalling and are therefore important pharmacological targets. Among these, voltage-gated sodium channels (Na V s) have attracted particular attention as potential analgesic targets. Na V s, however, comprise several structurally similar subtypes with unique localisations and distinct functions, ranging from amplification of action potentials in nociception (e.g. Na V 1.7) to controlling electrical signalling in cardiac function (Na V 1.5). Understanding the structural basis of Na V function is therefore of great significance, both to our knowledge of electrical signalling and in development of subtype and state selective drugs. An important tool in this pursuit has been the use of peptides from animal venoms as selective Na V modulators. In this review, we look at peptides, particularly from spider venoms, that inhibit Na V s by binding to the voltage sensing domain (VSD) of this channel, known as gating modifier toxins (GMT). In the first part of the review, we look at the structural determinants of voltage sensing in VGICs, the gating cycle and the conformational changes that accompany VSD movement. Next, the modulation of the analgesic target Na V 1.7 by GMTs is reviewed to develop bioinformatic tools that, based on sequence information alone, can identify toxins that are likely to inhibit this channel. The same approach is also used to define VSD sequences, other than that from Na V 1.7, which are likely to be sensitive to this class of toxins. The final section of the review focuses on the important role of the cellular membrane in channel modulation and also how the lipid composition affects measurements of peptide-channel interactions both in binding kinetics measurements in solution and in cell-based functional assays. Copyright © 2018
Lsd1 regulates skeletal muscle regeneration and directs the fate of satellite cells.
Tosic, Milica; Allen, Anita; Willmann, Dominica; Lepper, Christoph; Kim, Johnny; Duteil, Delphine; Schüle, Roland
2018-01-25
Satellite cells are muscle stem cells required for muscle regeneration upon damage. Of note, satellite cells are bipotent and have the capacity to differentiate not only into skeletal myocytes, but also into brown adipocytes. Epigenetic mechanisms regulating fate decision and differentiation of satellite cells during muscle regeneration are not yet fully understood. Here, we show that elevated levels of lysine-specific demethylase 1 (Kdm1a, also known as Lsd1) have a beneficial effect on muscle regeneration and recovery after injury, since Lsd1 directly regulates key myogenic transcription factor genes. Importantly, selective Lsd1 ablation or inhibition in Pax7-positive satellite cells, not only delays muscle regeneration, but changes cell fate towards brown adipocytes. Lsd1 prevents brown adipocyte differentiation of satellite cells by repressing expression of the novel pro-adipogenic transcription factor Glis1. Together, downregulation of Glis1 and upregulation of the muscle-specific transcription program ensure physiological muscle regeneration.
DNA Methylation in Skeletal Muscle Stem Cell Specification, Proliferation, and Differentiation
Directory of Open Access Journals (Sweden)
Rhianna C. Laker
2016-01-01
Full Text Available An unresolved and critically important question in skeletal muscle biology is how muscle stem cells initiate and regulate the genetic program during muscle development. Epigenetic dynamics are essential for cellular development and organogenesis in early life and it is becoming increasingly clear that epigenetic remodeling may also be responsible for the cellular adaptations that occur in later life. DNA methylation of cytosine bases within CpG dinucleotide pairs is an important epigenetic modification that reduces gene expression when located within a promoter or enhancer region. Recent advances in the field suggest that epigenetic regulation is essential for skeletal muscle stem cell identity and subsequent cell development. This review summarizes what is currently known about how skeletal muscle stem cells regulate the myogenic program through DNA methylation, discusses a novel role for metabolism in this process, and addresses DNA methylation dynamics in adult skeletal muscle in response to physical activity.
Hartveit, Espen; Veruki, Margaret Lin
2010-03-15
Accurate measurement of the junctional conductance (G(j)) between electrically coupled cells can provide important information about the functional properties of coupling. With the development of tight-seal, whole-cell recording, it became possible to use dual, single-electrode voltage-clamp recording from pairs of small cells to measure G(j). Experiments that require reduced perturbation of the intracellular environment can be performed with high-resistance pipettes or the perforated-patch technique, but an accompanying increase in series resistance (R(s)) compromises voltage-clamp control and reduces the accuracy of G(j) measurements. Here, we present a detailed analysis of methodologies available for accurate determination of steady-state G(j) and related parameters under conditions of high R(s), using continuous or discontinuous single-electrode voltage-clamp (CSEVC or DSEVC) amplifiers to quantify the parameters of different equivalent electrical circuit model cells. Both types of amplifiers can provide accurate measurements of G(j), with errors less than 5% for a wide range of R(s) and G(j) values. However, CSEVC amplifiers need to be combined with R(s)-compensation or mathematical correction for the effects of nonzero R(s) and finite membrane resistance (R(m)). R(s)-compensation is difficult for higher values of R(s) and leads to instability that can damage the recorded cells. Mathematical correction for R(s) and R(m) yields highly accurate results, but depends on accurate estimates of R(s) throughout an experiment. DSEVC amplifiers display very accurate measurements over a larger range of R(s) values than CSEVC amplifiers and have the advantage that knowledge of R(s) is unnecessary, suggesting that they are preferable for long-duration experiments and/or recordings with high R(s). Copyright (c) 2009 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Shinoda, S; Shimizu, A; Yano, K; Kasuga, M [Yamanashi University, Yamanashi (Japan). Faculty of Engineering
1997-11-25
Although metal(or semiconductor)-semiconductor solar cells, SnO2-nSi solar cell for example, are superior in cost and efficiency, its barrier height and open-circuit voltage V(oc) are lower than those of p-n junctions. To improve these defects, study was made on the dependence of V(oc) on oxidation temperature and surface orientation using various solar cells prepared from (100)Si and (111)Si under various oxidation conditions. As a result, the density of surface states increases with a decrease in oxidation temperature of Si substrates, resulting in an increase in diode factor and V(oc). In this case, since oxide films are extremely thin and contribution of non-terminated bonds is large in the initial oxidation stage, the quantity of dangling bonds is larger in (100) plane than (111) plane, resulting in an increase in diode factor and V(oc). Since the surface energy level (the degree of electrons dominated by acceptor-like surface state from this level to the top of a valence band) of (100) Si is lower than that of (111) Si, the effective barrier height and V(oc) increase. 28 refs., 6 figs., 2 tabs.
International Nuclear Information System (INIS)
Ojima, Koichi; Uezumi, Akiyoshi; Miyoshi, Hiroyuki; Masuda, Satoru; Morita, Yohei; Fukase, Akiko; Hattori, Akihito; Nakauchi, Hiromitsu; Miyagoe-Suzuki, Yuko; Takeda, Shin'ichi
2004-01-01
Recent studies have shown that bone marrow (BM) cells, including the BM side population (BM-SP) cells that enrich hematopoietic stem cells (HSCs), are incorporated into skeletal muscle during regeneration, but it is not clear how and what kinds of BM cells contribute to muscle fiber regeneration. We found that a large number of SP cells migrated from BM to muscles following injury in BM-transplanted mice. These BM-derived SP cells in regenerating muscles expressed different surface markers from those of HSCs and could not reconstitute the mouse blood system. BM-derived SP/Mac-1 low cells increased in number in regenerating muscles following injury. Importantly, our co-culture studies with activated satellite cells revealed that this fraction carried significant potential for myogenic differentiation. By contrast, mature inflammatory (Mac-1 high ) cells showed negligible myogenic activities. Further, these BM-derived SP/Mac-1 low cells gave rise to mononucleate myocytes, indicating that their myogenesis was not caused by stochastic fusion with host myogenic cells, although they required cell-to-cell contact with myogenic cells for muscle differentiation. Taken together, our data suggest that neither HSCs nor mature inflammatory cells, but Mac-1 low early myeloid cells in the BM-derived SP fraction, play an important role in regenerating skeletal muscles
Neuhaus, Jochen; Oberbach, Andreas; Schwalenberg, Thilo; Stolzenburg, Jens-Uwe
2006-05-01
To compare histamine receptor expression in cultured smooth muscle cells from the human detrusor and internal sphincter using receptor-specific agonists. Smooth muscle cells from the bladder dome and internal sphincter were cultured from 5 male patients undergoing cystectomy for bladder cancer therapy. Calcium transients in cells stimulated with carbachol, histamine, histamine receptor 1 (H1R)-specific heptanecarboxamide (HTMT), dimaprit (H2R), and R-(alpha)-methylhistamine (H3R) were measured by calcium imaging. Histamine receptor proteins were detected by Western blot analysis and immunocytochemistry. H1R, H2R, and H3R expression was found in tissue and cultured cells. Carbachol stimulated equal numbers of detrusor and sphincter cells (60% and 51%, respectively). Histamine stimulated significantly more cells than carbachol in detrusor (100%) and sphincter (99.34%) cells. Calcium responses to carbachol in detrusor and sphincter cells were comparable and did not differ from those to histamine in detrusor cells. However, histamine and specific agonists stimulated more sphincter cells than did carbachol (P <0.001), and the calcium increase was greater in sphincter cells than in detrusor cells. Single cell analysis revealed comparable H2R responses in detrusor and sphincter cells, but H1R and H3R-mediated calcium reactions were significantly greater in sphincter cells. Histamine very effectively induces calcium release in smooth muscle cells. In sphincter cells, histamine is even more effective than carbachol regarding the number of reacting cells and the intracellular calcium increase. Some of the variability in the outcome of antihistaminic interstitial cystitis therapies might be caused by the ineffectiveness of the chosen antihistaminic or unintentional weakening of sphincteric function.
Local myogenic pulp-derived cell injection enhances craniofacial muscle regeneration in vivo.
Jung, J E; Song, M J; Shin, S; Choi, Y J; Kim, K H; Chung, C J
2017-02-01
To enhance myogenic differentiation in pulp cells isolated from extracted premolars by epigenetic modification using a DNA demethylation agent, 5-aza-2'-deoxycytidine (5-Aza), and to evaluate the potent stimulatory effect of 5-Aza-treated pulp cell injection for craniofacial muscle regeneration in vivo. Pulp cells were isolated from premolars extracted for orthodontic purposes from four adults (age range, 18-22.1 years). Levels of myogenic differentiation and functional contraction response in vitro were compared between pulp cells with or without pre-treatment of 5-Aza. Changes in muscle regeneration in response to green fluorescent protein (GFP)-labelled myogenic pulp cell injection in vivo were evaluated using a cardiotoxin (CTX)-induced muscle injury model of the gastrocnemius as well as the masseter muscle in mice. Pre-treatment of 5-Aza in pulp cells stimulated myotube formation, myogenic differentiation in terms of desmin and myogenin expression, and the level of collagen gel contraction. The local injection of 5-Aza pre-treated myogenic pulp cells was engrafted into the host tissue and indicated signs of enhanced muscle regeneration in both the gastrocnemius and the masseter muscles. The epigenetic modification of pulp cells from extracted premolars and the local injection of myogenic pulp cells may stimulate craniofacial muscles regeneration in vivo. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Dense-body aggregates as plastic structures supporting tension in smooth muscle cells.
Zhang, Jie; Herrera, Ana M; Paré, Peter D; Seow, Chun Y
2010-11-01
The wall of hollow organs of vertebrates is a unique structure able to generate active tension and maintain a nearly constant passive stiffness over a large volume range. These properties are predominantly attributable to the smooth muscle cells that line the organ wall. Although smooth muscle is known to possess plasticity (i.e., the ability to adapt to large changes in cell length through structural remodeling of contractile apparatus and cytoskeleton), the detailed structural basis for the plasticity is largely unknown. Dense bodies, one of the most prominent structures in smooth muscle cells, have been regarded as the anchoring sites for actin filaments, similar to the Z-disks in striated muscle. Here, we show that the dense bodies and intermediate filaments formed cable-like structures inside airway smooth muscle cells and were able to adjust the cable length according to cell length and tension. Stretching the muscle cell bundle in the relaxed state caused the cables to straighten, indicating that these intracellular structures were connected to the extracellular matrix and could support passive tension. These plastic structures may be responsible for the ability of smooth muscle to maintain a nearly constant tensile stiffness over a large length range. The finding suggests that the structural plasticity of hollow organs may originate from the dense-body cables within the smooth muscle cells.
Cell-type-dependent action potentials and voltage-gated currents in mouse fungiform taste buds.
Kimura, Kenji; Ohtubo, Yoshitaka; Tateno, Katsumi; Takeuchi, Keita; Kumazawa, Takashi; Yoshii, Kiyonori
2014-01-01
Taste receptor cells fire action potentials in response to taste substances to trigger non-exocytotic neurotransmitter release in type II cells and exocytotic release in type III cells. We investigated possible differences between these action potentials fired by mouse taste receptor cells using in situ whole-cell recordings, and subsequently we identified their cell types immunologically with cell-type markers, an IP3 receptor (IP3 R3) for type II cells and a SNARE protein (SNAP-25) for type III cells. Cells not immunoreactive to these antibodies were examined as non-IRCs. Here, we show that type II cells and type III cells fire action potentials using different ionic mechanisms, and that non-IRCs also fire action potentials with either of the ionic mechanisms. The width of action potentials was significantly narrower and their afterhyperpolarization was deeper in type III cells than in type II cells. Na(+) current density was similar in type II cells and type III cells, but it was significantly smaller in non-IRCs than in the others. Although outwardly rectifying current density was similar between type II cells and type III cells, tetraethylammonium (TEA) preferentially suppressed the density in type III cells and the majority of non-IRCs. Our mathematical model revealed that the shape of action potentials depended on the ratio of TEA-sensitive current density and TEA-insensitive current one. The action potentials of type II cells and type III cells under physiological conditions are discussed. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Barbara Bartolini
Full Text Available Aortic smooth muscle cells produce chondroitin/dermatan sulfate (CS/DS proteoglycans that regulate extracellular matrix organization and cell behavior in normal and pathological conditions. A unique feature of CS/DS proteoglycans is the presence of iduronic acid (IdoA, catalyzed by two DS epimerases. Functional ablation of DS-epi1, the main epimerase in these cells, resulted in a major reduction of IdoA both on cell surface and in secreted CS/DS proteoglycans. Downregulation of IdoA led to delayed ability to re-populate wounded areas due to loss of directional persistence of migration. DS-epi1-/- aortic smooth muscle cells, however, had not lost the general property of migration showing even increased speed of movement compared to wild type cells. Where the cell membrane adheres to the substratum, stress fibers were denser whereas focal adhesion sites were fewer. Total cellular expression of focal adhesion kinase (FAK and phospho-FAK (pFAK was decreased in mutant cells compared to control cells. As many pathological conditions are dependent on migration, modulation of IdoA content may point to therapeutic strategies for diseases such as cancer and atherosclerosis.
Ficus Deltoidea Enhance Glucose Uptake Activity in Cultured Muscle Cells
International Nuclear Information System (INIS)
Zainah Adam; Shafii Khamis; Amin Ismail; Muhajir Hamid
2015-01-01
Ficus deltoidea or locally known as Mas cotek is one of the common medicinal plants used in Malaysia. Our previous studies showed that this plant have blood glucose lowering effect. Glucose uptake into muscle and adipocytes cells is one of the known mechanisms of blood glucose lowering effect. This study was performed to evaluate the effect of Ficus deltoidea on glucose uptake activity into muscle cells. The cells were incubated with Ficus deltoidea extracts either alone or combination with insulin. Amount of glucose uptake by L6 myotubes was determined using glucose tracer, 2-deoxy-(1- 3 H 1 )-glucose. The results showed that Ficus deltoidea extracts at particular doses enhanced basal or insulin-mediated glucose uptake into muscle cells significantly. Hot aqueous extract enhanced glucose uptake at the low concentration (10 μg/ ml) whereas methanolic extract enhanced glucose uptake at low and high concentrations. Methanolic extract also mimicked insulin activity during enhancing glucose uptake into L^ muscle cells. Glucose uptake activity of Ficus deltoidea could be attributed by the phenolic compound presence in the plant. This study had shown that Ficus deltoidea has the ability to enhance glucose uptake into muscle cells which is partly contributed the antidiabetic activity of this plant. (author)
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain
Directory of Open Access Journals (Sweden)
Yukiko eMishina
2014-09-01
Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
PGC-1α and exercise intensity dependent adaptations in mouse skeletal muscle
DEFF Research Database (Denmark)
Brandt, Nina; Dethlefsen, Maja Munk; Bangsbo, Jens
2017-01-01
The aim of the present study was to examine the role of PGC-1α in intensity dependent exercise and exercise training-induced metabolic adaptations in mouse skeletal muscle. Whole body PGC-1α knockout (KO) and littermate wildtype (WT) mice performed a single treadmill running bout at either low...... intensity dependent increases in LC3I and LC3II protein and intensity independent decrease in p62 protein in skeletal muscle late in recovery and increased LC3II with exercise training independent of exercise intensity and volume in WT mice. Furthermore, acute exercise and exercise training did not increase...... LC3I and LC3II protein in PGC-1α KO. In addition, exercise-induced mRNA responses of PGC-1α isoforms were intensity dependent. In conclusion, these findings indicate that exercise intensity affected autophagy markers differently in skeletal muscle and suggest that PGC-1α regulates both acute...
Gorman, Jennifer L.; Liu, Sammy T. K.; Slopack, Dara; Shariati, Khashayar; Hasanee, Adam; Olenich, Sara; Olfert, I. Mark; Haas, Tara L.
2014-01-01
Skeletal muscle overload induces the expression of angiogenic factors such as vascular endothelial growth factor (VEGF) and matrix metalloproteinase (MMP)-2, leading to new capillary growth. We found that the overload-induced increase in angiogenesis, as well as increases in VEGF, MMP-2 and MT1-MMP transcripts were abrogated in muscle VEGF KO mice, highlighting the critical role of myocyte-derived VEGF in controlling this process. The upstream mediators that contribute to overload-induced expression of VEGF have yet to be ascertained. We found that muscle overload increased angiotensinogen expression, a precursor of angiotensin (Ang) II, and that Ang II signaling played an important role in basal VEGF production in C2C12 cells. Furthermore, matrix-bound VEGF released from myoblasts induced the activation of endothelial cells, as evidenced by elevated endothelial cell phospho-p38 levels. We also found that exogenous Ang II elevates VEGF expression, as well as MMP-2 transcript levels in C2C12 myotubes. Interestingly, these responses also were observed in skeletal muscle endothelial cells in response to Ang II treatment, indicating that these cells also can respond directly to the stimulus. The involvement of Ang II in muscle overload-induced angiogenesis was assessed. We found that blockade of AT1R-dependent Ang II signaling using losartan did not attenuate capillary growth. Surprisingly, increased levels of VEGF protein were detected in overloaded muscle from losartan-treated rats. Similarly, we observed elevated VEGF production in cultured endothelial cells treated with losartan alone or in combination with Ang II. These studies conclusively establish the requirement for muscle derived VEGF in overload-induced angiogenesis and highlight a role for Ang II in basal VEGF production in skeletal muscle. However, while Ang II signaling is activated following overload and plays a role in muscle VEGF production, inhibition of this pathway is not sufficient to halt overload
Effects of voluntary wheel running on satellite cells in the rat plantaris muscle.
Kurosaka, Mitsutoshi; Naito, Hisashi; Ogura, Yuji; Kojima, Atsushi; Goto, Katsumasa; Katamoto, Shizuo
2009-01-01
This study investigated the effects of voluntary wheel running on satellite cells in the rat plantaris muscle. Seventeen 5-week-old male Wistar rats were assigned to a control (n = 5) or training (n = 12) group. Each rat in the training group ran voluntarily in a running-wheel cage for 8 weeks. After the training period, the animals were anesthetized, and the plantaris muscles were removed, weighed, and analyzed immunohistochemically and biochemically. Although there were no significant differences in muscle weight or fiber area between the groups, the numbers of satellite cells and myonuclei per muscle fiber, percentage of satellite cells, and citrate synthase activity were significantly higher in the training group compared with the control group (p run in the training group (r = 0.61, p running can induce an increase in the number of satellite cells without changing the mean fiber area in the rat plantaris muscle; this increase in satellite cell content is a function of distance run. Key pointsThere is no study about the effect of voluntary running on satellite cells in the rat plantaris muscle.Voluntary running training causes an increase of citrate synthase activity in the rat plantaris muscle but does not affect muscle weight and mean fiber area in the rat plantaris muscle.Voluntary running can induce an increase in the number of satellite cells without hypertrophy of the rat plantaris muscle.
Directory of Open Access Journals (Sweden)
Lei Zhu
Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.
Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L
1993-03-01
The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.
Directory of Open Access Journals (Sweden)
Kent M. Reed
2017-11-01
Full Text Available Background: Exposure of poultry to extreme temperatures during the critical period of post-hatch growth can seriously affect muscle development and thus compromise subsequent meat quality. This study was designed to characterize transcriptional changes induced in turkey muscle satellite cells by thermal challenge during differentiation. Our goal is to better define how thermal stress alters breast muscle ultrastructure and subsequent development.Results: Skeletal muscle satellite cells previously isolated from the Pectoralis major muscle of 7-wk-old male turkeys (Meleagris gallopavo from two breeding lines: the F-line (16 wk body weight-selected and RBC2 (randombred control line were used in this study. Cultured cells were induced to differentiate at 38°C (control or thermal challenge temperatures of 33 or 43°C. After 48 h of differentiation, cells were harvested and total RNA was isolated for RNAseq analysis. Analysis of 39.9 Gb of sequence found 89% mapped to the turkey genome (UMD5.0, annotation 101 with average expression of 18,917 genes per library. In the cultured satellite cells, slow/cardiac muscle isoforms are generally present in greater abundance than fast skeletal isoforms. Statistically significant differences in gene expression were observed among treatments and between turkey lines, with a greater number of genes affected in the F-line cells following cold treatment whereas more differentially expressed (DE genes were observed in the RBC2 cells following heat treatment. Many of the most significant pathways involved signaling, consistent with ongoing cellular differentiation. Regulation of Ca2+ homeostasis appears to be significantly affected by temperature treatment, particularly cold treatment.Conclusions: Satellite cell differentiation is directly influenced by temperature at the level of gene transcription with greater effects attributed to selection for fast growth. At lower temperature, muscle-associated genes in the
Vaccaro, S. R.
2011-09-01
The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.
Angiotensin II induced catabolic effect and muscle atrophy are redox dependent
Semprun-Prieto, Laura C.; Sukhanov, Sergiy; Yoshida, Tadashi; Rezk, Bashir M.; Gonzalez-Villalobos, Romer A.; Vaughn, Charlotte; Tabony, A. Michael; Delafontaine, Patrice
2011-01-01
Angiotensin II (Ang II) causes skeletal muscle wasting via an increase in muscle catabolism. To determine whether the wasting effects of Ang II were related to its ability to increase NADPH oxidase-derived reactive oxygen species (ROS) we infused wild-type C57BL/6J or p47phox−/− mice with vehicle or Ang II for 7 days. Superoxide production was increased 2.4 fold in the skeletal muscle of Ang II infused mice, and this increase was prevented in p47phox−/− mice. Apocynin treatment prevented Ang II-induced superoxide production in skeletal muscle, consistent with Ang II increasing NADPH oxidase derived ROS. Ang II induced loss of body and skeletal muscle weight in C57BL/6J mice, whereas the reduction was significantly attenuated in p47phox−/− animals. The reduction of skeletal muscle weight caused by Ang II was associated with an increase of proteasome activity, and this increase was completely prevented in the skeletal muscle of p47phox−/− mice. In conclusion, Ang II-induced skeletal muscle wasting is in part dependent on NADPH oxidase derived ROS. PMID:21570954
Acharyya, Swarnali; Sharma, Sudarshana M.; Cheng, Alfred S.; Ladner, Katherine J.; He, Wei; Kline, William; Wang, Huating; Ostrowski, Michael C.; Huang, Tim H.; Guttridge, Denis C.
2010-01-01
Background Classical NF-κB signaling functions as a negative regulator of skeletal myogenesis through potentially multiple mechanisms. The inhibitory actions of TNFα on skeletal muscle differentiation are mediated in part through sustained NF-κB activity. In dystrophic muscles, NF-κB activity is compartmentalized to myofibers to inhibit regeneration by limiting the number of myogenic progenitor cells. This regulation coincides with elevated levels of muscle derived TNFα that is also under IKKβ and NF-κB control. Methodology/Principal Findings Based on these findings we speculated that in DMD, TNFα secreted from myotubes inhibits regeneration by directly acting on satellite cells. Analysis of several satellite cell regulators revealed that TNFα is capable of inhibiting Notch-1 in satellite cells and C2C12 myoblasts, which was also found to be dependent on NF-κB. Notch-1 inhibition occurred at the mRNA level suggesting a transcriptional repression mechanism. Unlike its classical mode of action, TNFα stimulated the recruitment of Ezh2 and Dnmt-3b to coordinate histone and DNA methylation, respectively. Dnmt-3b recruitment was dependent on Ezh2. Conclusions/Significance We propose that in dystrophic muscles, elevated levels of TNFα and NF-κB inhibit the regenerative potential of satellite cells via epigenetic silencing of the Notch-1 gene. PMID:20814569
Ureter smooth muscle cell orientation in rat is predominantly longitudinal.
Directory of Open Access Journals (Sweden)
Bart Spronck
Full Text Available In ureter peristalsis, the orientation of the contracting smooth muscle cells is essential, yet current descriptions of orientation and composition of the smooth muscle layer in human as well as in rat ureter are inconsistent. The present study aims to improve quantification of smooth muscle orientation in rat ureters as a basis for mechanistic understanding of peristalsis. A crucial step in our approach is to use two-photon laser scanning microscopy and image analysis providing objective, quantitative data on smooth muscle cell orientation in intact ureters, avoiding the usual sectioning artifacts. In 36 rat ureter segments, originating from a proximal, middle or distal site and from a left or right ureter, we found close to the adventitia a well-defined longitudinal smooth muscle orientation. Towards the lamina propria, the orientation gradually became slightly more disperse, yet the main orientation remained longitudinal. We conclude that smooth muscle cell orientation in rat ureter is predominantly longitudinal, though the orientation gradually becomes more disperse towards the proprial side. These findings do not support identification of separate layers. The observed longitudinal orientation suggests that smooth muscle contraction would rather cause local shortening of the ureter, than cause luminal constriction. However, the net-like connective tissue of the ureter wall may translate local longitudinal shortening into co-local luminal constriction, facilitating peristalsis. Our quantitative, minimally invasive approach is a crucial step towards more mechanistic insight into ureter peristalsis, and may also be used to study smooth muscle cell orientation in other tube-like structures like gut and blood vessels.
Ureter smooth muscle cell orientation in rat is predominantly longitudinal.
Spronck, Bart; Merken, Jort J; Reesink, Koen D; Kroon, Wilco; Delhaas, Tammo
2014-01-01
In ureter peristalsis, the orientation of the contracting smooth muscle cells is essential, yet current descriptions of orientation and composition of the smooth muscle layer in human as well as in rat ureter are inconsistent. The present study aims to improve quantification of smooth muscle orientation in rat ureters as a basis for mechanistic understanding of peristalsis. A crucial step in our approach is to use two-photon laser scanning microscopy and image analysis providing objective, quantitative data on smooth muscle cell orientation in intact ureters, avoiding the usual sectioning artifacts. In 36 rat ureter segments, originating from a proximal, middle or distal site and from a left or right ureter, we found close to the adventitia a well-defined longitudinal smooth muscle orientation. Towards the lamina propria, the orientation gradually became slightly more disperse, yet the main orientation remained longitudinal. We conclude that smooth muscle cell orientation in rat ureter is predominantly longitudinal, though the orientation gradually becomes more disperse towards the proprial side. These findings do not support identification of separate layers. The observed longitudinal orientation suggests that smooth muscle contraction would rather cause local shortening of the ureter, than cause luminal constriction. However, the net-like connective tissue of the ureter wall may translate local longitudinal shortening into co-local luminal constriction, facilitating peristalsis. Our quantitative, minimally invasive approach is a crucial step towards more mechanistic insight into ureter peristalsis, and may also be used to study smooth muscle cell orientation in other tube-like structures like gut and blood vessels.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.
2008-01-01
External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J
2008-11-01
External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.
Joanisse, Sophie; Nederveen, Joshua P; Snijders, Tim; McKay, Bryon R; Parise, Gianni
2017-01-01
Sarcopenia is the age-related loss of skeletal muscle mass and strength. Ultimately, sarcopenia results in the loss of independence, which imposes a large financial burden on healthcare systems worldwide. A critical facet of sarcopenia is the diminished ability for aged muscle to regenerate, repair and remodel. Over the years, research has focused on elucidating underlying mechanisms of sarcopenia and the impaired ability of muscle to respond to stimuli with aging. Muscle-specific stem cells, termed satellite cells (SC), play an important role in maintaining muscle health throughout the lifespan. It is well established that SC are essential in skeletal muscle regeneration, and it has been hypothesized that a reduction and/or dysregulation of the SC pool, may contribute to accelerated loss of skeletal muscle mass that is observed with advancing age. The preservation of skeletal muscle tissue and its ability to respond to stimuli may be impacted by reduced SC content and impaired function observed with aging. Aging is also associated with a reduction in capillarization of skeletal muscle. We have recently demonstrated that the distance between type II fibre-associated SC and capillaries is greater in older compared to younger adults. The greater distance between SC and capillaries in older adults may contribute to the dysregulation in SC activation ultimately impairing muscle's ability to remodel and, in extreme circumstances, regenerate. This viewpoint will highlight the importance of optimal SC activation in addition to skeletal muscle capillarization to maximize the regenerative potential of skeletal muscle in older adults. © 2016 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Cuce, Erdem; Cuce, Pinar Mert; Bali, Tulin
2013-01-01
Highlights: • R sh is rather sensitive to the variations in T c . • For higher G values, G ∗ is not affected from the variations in light intensity. • Ideality factor decreases linearly with increasing T c . • A linear decrease of R s and R sh has been observed with increasing T c . • Fill factor increases exponentially with G while it decreases linearly with T c . - Abstract: It is well known that accurate knowledge of photovoltaic cell parameters from the measured current–voltage characteristics is of vital importance for the quality control and the performance assessment of photovoltaic cells/modules. Although many attempts have been made so far for a thorough analysis of cell parameters, there are still significant discrepancies between the previously published results. In this regard, a detailed investigation of cell parameters through a comprehensive experimental and statistical work is important to elucidate the aforementioned contradictions. Therefore in the present work, effects of two main environmental factors on performance parameters of mono-crystalline and poly-crystalline silicon photovoltaic modules have been experimentally investigated. The experiments have been carried out under a calibrated solar simulator for various intensity levels and cell temperatures in the range 200–500 W/m 2 and 15–60 °C, respectively. The results indicated that light intensity has a dominant effect on current parameters. Photocurrent, short circuit current and maximum current increase linearly with increasing intensity level. A new term, solar intensity coefficient, has been defined first time to characterize the solar radiation dependency of current parameters. On the other hand, it has been observed that cell temperature has a dramatic effect on voltage parameters. Open circuit voltage and maximum voltage considerably decrease with increasing cell temperature. Temperature coefficients of voltage parameters have been calculated for each case. Shunt
Establishment of bipotent progenitor cell clone from rat skeletal muscle.
Murakami, Yousuke; Yada, Erica; Nakano, Shin-ichi; Miyagoe-Suzuki, Yuko; Hosoyama, Tohru; Matsuwaki, Takashi; Yamanouchi, Keitaro; Nishihara, Masugi
2011-12-01
The present study describes the isolation, cloning and characterization of adipogenic progenitor cells from rat skeletal muscle. Among the obtained 10 clones, the most highly adipogenic progenitor, 2G11 cells, were further characterized. In addition to their adipogenicity, 2G11 cells retain myogenic potential as revealed by formation of multinucleated myotubes when co-cultured with myoblasts. 2G11 cells were resistant to an inhibitory effect of basic fibroblast growth factor on adipogenesis, while adipogenesis of widely used preadipogenic cell line, 3T3-L1 cells, was suppressed almost completely by the same treatment. In vivo transplantation experiments revealed that 2G11 cells are able to possess both adipogenicity and myogenicity in vivo. These results indicate the presence of bipotent progenitor cells in rat skeletal muscle, and suggest that such cells may contribute to ectopic fat formation in skeletal muscle. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Plasticity of the Muscle Stem Cell Microenvironment.
Dinulovic, Ivana; Furrer, Regula; Handschin, Christoph
2017-01-01
Satellite cells (SCs) are adult muscle stem cells capable of repairing damaged and creating new muscle tissue throughout life. Their functionality is tightly controlled by a microenvironment composed of a wide variety of factors, such as numerous secreted molecules and different cell types, including blood vessels, oxygen, hormones, motor neurons, immune cells, cytokines, fibroblasts, growth factors, myofibers, myofiber metabolism, the extracellular matrix and tissue stiffness. This complex niche controls SC biology-quiescence, activation, proliferation, differentiation or renewal and return to quiescence. In this review, we attempt to give a brief overview of the most important players in the niche and their mutual interaction with SCs. We address the importance of the niche to SC behavior under physiological and pathological conditions, and finally survey the significance of an artificial niche both for basic and translational research purposes.
Directory of Open Access Journals (Sweden)
Jacquelyn Gerhart
Full Text Available Posterior capsule opacification (PCO is a vision impairing condition that arises in some patients following cataract surgery. The fibrotic form of PCO is caused by myofibroblasts that may emerge in the lens years after surgery. In the chick embryo lens, myofibroblasts are derived from Myo/Nog cells that are identified by their expression of the skeletal muscle specific transcription factor MyoD, the bone morphogenetic protein inhibitor Noggin, and the epitope recognized by the G8 monoclonal antibody. The goal of this study was to test the hypothesis that depletion of Myo/Nog cells will prevent the accumulation of myofibroblasts in human lens tissue. Myo/Nog cells were present in anterior, equatorial and bow regions of the human lens, cornea and ciliary processes. In anterior lens tissue removed by capsulorhexis, Myo/Nog cells had synthesized myofibroblast and skeletal muscle proteins, including vimentin, MyoD and sarcomeric myosin. Alpha smooth muscle actin (α-SMA was detected in a subpopulation of Myo/Nog cells. Areas of the capsule denuded of epithelial cells were surrounded by Myo/Nog cells. Some of these cell free areas contained a wrinkle in the capsule. Depletion of Myo/Nog cells eliminated cells expressing skeletal muscle proteins in 5-day cultures but did not affect cells immunoreactive for beaded filament proteins that accumulate in differentiating lens epithelial cells. Transforming growth factor-betas 1 and 2 that mediate an epithelial-mesenchymal transition, did not induce the expression of skeletal muscle proteins in lens cells following Myo/Nog cell depletion. This study demonstrates that Myo/Nog cells in anterior lens tissue removed from cataract patients have undergone a partial differentiation to skeletal muscle. Myo/Nog cells appear to be the source of skeletal muscle-like cells in explants of human lens tissue. Targeting Myo/Nog cells with the G8 antibody during cataract surgery may reduce the incidence of PCO.
Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.
2005-03-01
Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.
Vessel-associated stem cells from skeletal muscle: From biology to future uses in cell therapy.
Sancricca, Cristina; Mirabella, Massimiliano; Gliubizzi, Carla; Broccolini, Aldobrando; Gidaro, Teresa; Morosetti, Roberta
2010-06-26
Over the last years, the existence of different stem cells with myogenic potential has been widely investigated. Besides the classical skeletal muscle progenitors represented by satellite cells, numerous multipotent and embryologically unrelated progenitors with a potential role in muscle differentiation and repair have been identified. In order to conceive a therapeutic approach for degenerative muscle disorders, it is of primary importance to identify an ideal stem cell endowed with all the features for a possible use in vivo. Among all emerging populations, vessel-associated stem cells are a novel and promising class of multipotent progenitors of mesodermal origin and with high myogenic potential which seem to best fit all the requirements for a possible cell therapy. In vitro and in vivostudies have already tested the effectiveness and safety of vessel-associated stem cells in animal models. This leads to the concrete possibility in the future to start pilot human clinical trials, hopefully opening the way to a turning point in the treatment of genetic and acquired muscle disorders.
Epiblast cells that express MyoD recruit pluripotent cells to the skeletal muscle lineage
Gerhart, Jacquelyn; Neely, Christine; Stewart, Benjamin; Perlman, Jordanna; Beckmann, David; Wallon, Margaretha; Knudsen, Karen; George-Weinstein, Mindy
2004-01-01
Embryonic stem cells are derived from the epiblast. A subpopulation of epiblast cells expresses MyoD mRNA and the G8 antigen in vivo. G8 positive (G8pos) and G8 negative (G8neg) populations were isolated by magnetic cell sorting. Nearly all G8pos cells switched from E- to N-cadherin and differentiated into skeletal muscle in culture. G8neg cells were impaired in their ability to switch cadherins and few formed skeletal muscle. Medium conditioned by G8pos cells stimulated skeletal myogenesis and N-cadherin synthesis in G8neg cultures. The effect of conditioned medium from G8pos cultures was inhibited by bone morphogenetic protein (BMP) 4. Treatment of G8neg cells with a soluble form of the BMP receptor-IA or Noggin promoted N-cadherin synthesis and skeletal myogenesis. These results demonstrate that MyoD-positive epiblast cells recruit pluripotent cells to the skeletal muscle lineage. The mechanism of recruitment involves blocking the BMP signaling pathway. PMID:14981095
Directory of Open Access Journals (Sweden)
Bo Hyung Lee
2014-01-01
Full Text Available The KCNQ gene family, whose members encode Kv7 channels, belongs to the voltage-gated potassium (Kv channel group. The roles of this gene family have been widely investigated in nerve and muscle cells. In the present study, we investigated several characteristics of Kv7.5, which is strongly expressed in the canine osteosarcoma cell line, CCL-183. Serum starvation upregulated Kv7.5 expression, and the Kv7 channel opener, flupirtine, attenuated cell proliferation by arresting cells in the G0/G1 phase. We also showed that Kv7.5 knockdown helps CCL-183 cells to proliferate. In an effort to find an endogenous regulator of Kv7.5, we used mithramycin A to reduce the level of the transcription factor Sp1, and it strongly inhibited the induction of Kv7.5 in CCL-183 cells. These results suggest that the activation of Kv7.5 by flupirtine may exert an anti-proliferative effect in canine osteosarcoma. Therefore, Kv7.5 is a possible molecular target for canine osteosarcoma therapy.
Tamura, Yuki; Matsunaga, Yutaka; Kitaoka, Yu; Hatta, Hideo
2017-03-01
Mitochondrial and endoplasmic reticulum (ER) stress, and subsequently activated responses (mitochondrial/ER unfolded protein responses; UPRmt/UPRER), are involved in the pathogenesis of sarcopenia. To extend both basic and translational knowledge, we examined (i) whether age-induced mitochondrial and ER stress depend on skeletal muscle type in mice and (ii) whether heat stress treatment, a suggested strategy for sarcopenia, improves age-induced mitochondrial and ER stress. Aged (21-month-old) mice showed more severe mitochondrial stress and UPRmt than young (12-week-old) mice, based on increased oxidative stress, mitochondrial proteases, and mitochondrial E3 ubiquitin ligase. The aged mice also showed ER stress and UPRER, based on decreased ER enzymes and increased ER stress-related cell death. These changes were much more evident in soleus muscle than in gastrocnemius and plantaris muscles. After daily heat stress treatment (40 °C chamber for 30 minutes per day) for 4 weeks, mice showed remarkable improvements in age-related changes in soleus muscle. Heat stress had only minor effects in gastrocnemius and plantaris muscles. Based on these findings, age-associated mitochondrial stress, ER stress, and UPRmt/ER vary qualitatively with skeletal muscle type. Our results suggest a molecular basis for the beneficial effects of heat stress on muscle atrophy with age in soleus muscle. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Nakamura, Seiji; Hayashi, Ken'ichiro; Iwasaki, Kazuhiro; Fujioka, Tomoaki; Egusa, Hiroshi; Yatani, Hirofumi; Sobue, Kenji
2010-11-26
Myocardin (Mycd), which is essential for the differentiation of the smooth muscle cell lineage, is constitutively located in the nucleus, although its family members, myocardin-related transcription factors A and B (MRTF-A/B), mostly reside in the cytoplasm and translocate to the nucleus in response to Rho signaling. The mechanism for their nuclear import is unclear. Here we investigated the mechanism for the nuclear import of Mycd family members and demonstrated any correlation between such mechanism and the phenotype of vascular smooth muscle cells (VSMCs). In cultured VSMCs, the knockdown of importin β1 inhibited the nuclear import of Mycd and MRTF-A/B. Their NH(2)-terminal basic domain was identified as a binding site for importin α/β1 by in vitro analyses. However, Mycd had a higher affinity for importin α/β1 than did MRTF-A/B, even in the absence of G-actin, and Mycd affinity for importin α1/β1 was stronger than for any other importin α/β1 heterodimers. The binding of Mycd to importin α/β1 was insensitive to G-actin, whereas that of MRTF-A/B was differently inhibited by G-actin. In dedifferentiated VSMCs, the levels of importins α1 and β1 were reduced concomitant with down-regulation of Mycd, serum response factor, and smooth muscle cell markers. By contrast, in differentiated VSMCs, their expressions were up-regulated. Thus, the nuclear import of Mycd family members in VSMCs depends on importin α/β1, and their relative affinities for importin α/β1 heterodimers determine Mycd nuclear import. The expression of Mycd nuclear import machineries is related to the expression levels of VSMC phenotype-dependent smooth muscle cell markers.
Simulation and resolution of voltage reversal in microbial fuel cell stack.
Sugnaux, Marc; Savy, Cyrille; Cachelin, Christian Pierre; Hugenin, Gérald; Fischer, Fabian
2017-08-01
To understand the biotic and non-biotic contributions of voltage reversals in microbial fuel cell stacks (MFC) they were simulated with an electronic MFC-Stack mimic. The simulation was then compared with results from a real 3L triple MFC-Stack with shared anolyte. It showed that voltage reversals originate from the variability of biofilms, but also the external load plays a role. When similar biofilm properties were created on all anodes the likelihood of voltage reversals was largely reduced. Homogenous biofilms on all anodes were created by electrical circuit alternation and electrostimulation. Conversely, anolyte recirculation, or increased nutriment supply, postponed reversals and unfavourable voltage asymmetries on anodes persisted. In conclusion, voltage reversals are often a negative event but occur also in close to best MFC-Stack performance. They were manageable and this with a simplified MFC architecture in which multiple anodes share the same anolyte. Copyright © 2017 Elsevier Ltd. All rights reserved.
Trajano, L. A. S. N.; Trajano, E. T. L.; Thomé, A. M. C.; Sergio, L. P. S.; Mencalha, A. L.; Stumbo, A. C.; Fonseca, A. S.
2017-10-01
Satellite cells are present in skeletal muscle functioning in the repair and regeneration of muscle injury. Activation of these cells depends on the expression of myogenic factor 5 (Myf5), myogenic determination factor 1(MyoD), myogenic regulatory factor 4 (MRF4), myogenin (MyoG), paired box transcription factors 3 (Pax3), and 7 (Pax7). Low-level laser irradiation accelerates the repair of muscle injuries. However, data from the expression of myogenic factors have been controversial. Furthermore, the effects of different laser beam powers on the repair of muscle injuries have been not evaluated. The aim of this study was to evaluate the effects of low-level infrared laser at different powers and in pulsed emission mode on the expression of myogenic regulatory factors and on Pax3 and Pax7 in injured skeletal muscle from Wistar rats. Animals that underwent cryoinjury were divided into three groups: injury, injury laser 25 Mw, and injury laser 75 mW. Low-level infrared laser irradiation (904 nm, 3 J cm-2, 5 kHz) was carried out at 25 and 75 mW. After euthanasia, skeletal muscle samples were withdrawn and the total RNA was extracted for the evaluation of mRNA levels from the MyoD, MyoG, MRF4, Myf5, Pax3, and Pax7 gene. Pax 7 mRNA levels did not alter, but Pax3 mRNA levels increased in the injured and laser-irradiated group at 25 mW. MyoD, MyoG, and MYf5 mRNA levels increased in the injured and laser-irradiated animals at both powers, and MRF4 mRNA levels decreased in the injured and laser-irradiated group at 75 mW. In conclusion, exposure to pulsed low-level infrared laser, by power-dependent effect, could accelerate the muscle repair process altering mRNA levels from paired box transcription factors and myogenic regulatory factors.
Thermocleavable Materials for Polymer Solar Cells with High Open Circuit Voltage-A Comparative Study
DEFF Research Database (Denmark)
Tromholt, Thomas; Gevorgyan, Suren; Jørgensen, Mikkel
2009-01-01
The search for polymer solar cells giving a high open circuit voltage was conducted through a comparative study of four types of bulk-heterojunction solar cells employing different photoactive layers. As electron donors the thermo-cleavable polymer poly-(3-(2-methylhexyloxycarbonyl)dithiophene) (P3......MHOCT) and unsubstituted polythiophene (PT) were used, the latter of which results from thermo cleaving the former at 310 °C. As reference, P3HT solar cells were built in parallel. As electron acceptors, either PCBM or bis-[60]PCBM were used. In excess of 300 solar cells were produced under as identical...... conditions as possible, varying only the material combination of the photo active layer. It was observed that on replacing PCBM with bis[60]PCBM, the open circuit voltage on average increased by 100 mV for P3MHOCT and 200 mV for PT solar cells. Open circuit voltages approaching 1 V were observed for the PT:bis...
Myogenic Precursors from iPS Cells for Skeletal Muscle Cell Replacement Therapy
Directory of Open Access Journals (Sweden)
Isart Roca
2015-01-01
Full Text Available The use of adult myogenic stem cells as a cell therapy for skeletal muscle regeneration has been attempted for decades, with only moderate success. Myogenic progenitors (MP made from induced pluripotent stem cells (iPSCs are promising candidates for stem cell therapy to regenerate skeletal muscle since they allow allogenic transplantation, can be produced in large quantities, and, as compared to adult myoblasts, present more embryonic-like features and more proliferative capacity in vitro, which indicates a potential for more self-renewal and regenerative capacity in vivo. Different approaches have been described to make myogenic progenitors either by gene overexpression or by directed differentiation through culture conditions, and several myopathies have already been modeled using iPSC-MP. However, even though results in animal models have shown improvement from previous work with isolated adult myoblasts, major challenges regarding host response have to be addressed and clinically relevant transplantation protocols are lacking. Despite these challenges we are closer than we think to bringing iPSC-MP towards clinical use for treating human muscle disease and sporting injuries.
Satellite cell proliferation in adult skeletal muscle
Booth, Frank W. (Inventor); Thomason, Donald B. (Inventor); Morrison, Paul R. (Inventor); Stancel, George M. (Inventor)
1995-01-01
Novel methods of retroviral-mediated gene transfer for the in vivo corporation and stable expression of eukaryotic or prokaryotic foreign genes in tissues of living animals is described. More specifically, methods of incorporating foreign genes into mitotically active cells are disclosed. The constitutive and stable expression of E. coli .beta.-galactosidase gene under the promoter control of the Moloney murine leukemia virus long terminal repeat is employed as a particularly preferred embodiment, by way of example, establishes the model upon which the incorporation of a foreign gene into a mitotically-active living eukaryotic tissue is based. Use of the described methods in therapeutic treatments for genetic diseases, such as those muscular degenerative diseases, is also presented. In muscle tissue, the described processes result in genetically-altered satellite cells which proliferate daughter myoblasts which preferentially fuse to form a single undamaged muscle fiber replacing damaged muscle tissue in a treated animal. The retroviral vector, by way of example, includes a dystrophin gene construct for use in treating muscular dystrophy. The present invention also comprises an experimental model utilizable in the study of the physiological regulation of skeletal muscle gene expression in intact animals.
File list: InP.Emb.10.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available InP.Emb.10.AllAg.Muscle_cells dm3 Input control Embryo Muscle cells SRX110786,SRX11...0794,SRX110789,SRX110785,SRX110790 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Emb.10.AllAg.Muscle_cells.bed ...
File list: InP.Emb.20.AllAg.Muscle_cells [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available InP.Emb.20.AllAg.Muscle_cells dm3 Input control Embryo Muscle cells SRX110789,SRX11...0794,SRX110786,SRX110790,SRX110785 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Emb.20.AllAg.Muscle_cells.bed ...
International Nuclear Information System (INIS)
Stepanov, Yu.V.; Gordienko, D.V.; Preobrazhenskaya, T.D.; Stepanova, L.I.; Vojtsitskij, V.M.
1994-01-01
A comparative investigation of transmembrane ion currents and caffeine-induced responses of single smooth muscle cells isolated from the circular layer of rat small intestine was curried out by the method of 'patch-clamp'. No reliable difference in potential-dependent and amplitude-kinetic characteristics of transmembrane ion currents in cells of intact and irradiated with dose of 3 Gy rats was revealed. In cells of irradiated animals external application of caffeine (4 mM) was not accompanied by strong quick-inactivated transient Ca 2+ -dependent potassium current as in control
Todman, M G; Baines, R A; Stebbings, L A; Davies, J A; Bacon, J P
1999-01-01
Recent experiments have demonstrated that a family of proteins, known as the innexins, are structural components of invertebrate gap junctions. The shaking-B (shak-B) locus of Drosophila encodes two members of this emerging family, Shak-B(lethal) and Shak-B(neural). This study focuses on the role of Shak-B gap junctions in the development of embryonic and larval muscle. During embryogenesis, shak-B transcripts are expressed in a subset of the somatic muscles; expression is strong in ventral oblique muscles (VO4-6) but only weak in ventral longitudinals (VL3 and 4). Carboxyfluorescein injected into VO4 of wild-type early stage 16 embryos spreads, via gap junctions, to label adjacent muscles, including VL3 and 4. In shak-B2 embryos (in which the shak-B(neural) function is disrupted), dye injected into VO4 fails to spread into other muscles. In the first instar larva, when dye coupling between muscles is no longer present, another effect of the shak-B2 mutation is revealed by whole-cell voltage clamp. In a calcium-free saline, only two voltage-activated potassium currents are present in wild-type muscles; a fast IA and a slow IK current. In shak-B2 larvae, these two currents are significantly reduced in magnitude in VO4 and 5, but remain normal in VL3. Expression of shak-B(neural) in a shak-B2 background fully rescues both dye coupling in embryonic muscle and whole-cell currents in first instar VO4 and 5. Our observations show that Shak-B(neural) is one of a set of embryonic gap-junction proteins, and that it is required for the normal temporal development of potassium currents in some larval muscles.
Directory of Open Access Journals (Sweden)
JA DeQuach
2012-06-01
Full Text Available Peripheral artery disease (PAD currently affects approximately 27 million patients in Europe and North America, and if untreated, may progress to the stage of critical limb ischemia (CLI, which has implications for amputation and potential mortality. Unfortunately, few therapies exist for treating the ischemic skeletal muscle in these conditions. Biomaterials have been used to increase cell transplant survival as well as deliver growth factors to treat limb ischemia; however, existing materials do not mimic the native skeletal muscle microenvironment they are intended to treat. Furthermore, no therapies involving biomaterials alone have been examined. The goal of this study was to develop a clinically relevant injectable hydrogel derived from decellularized skeletal muscle extracellular matrix and examine its potential for treating PAD as a stand-alone therapy by studying the material in a rat hindlimb ischemia model. We tested the mitogenic activity of the scaffold’s degradation products using an in vitro assay and measured increased proliferation rates of smooth muscle cells and skeletal myoblasts compared to collagen. In a rat hindlimb ischemia model, the femoral artery was ligated and resected, followed by injection of 150 µL of skeletal muscle matrix or collagen 1 week post-injury. We demonstrate that the skeletal muscle matrix increased arteriole and capillary density, as well as recruited more desmin-positive and MyoD-positive cells compared to collagen. Our results indicate that this tissue-specific injectable hydrogel may be a potential therapy for treating ischemia related to PAD, as well as have potential beneficial effects on restoring muscle mass that is typically lost in CLI.
Voltage balancing strategies for serial connection of microbial fuel cells
Khaled, Firas; Ondel, Olivier; Allard, Bruno; Buret, François
2015-07-01
The microbial fuel cell (MFC) converts electrochemically organic matter into electricity by means of metabolisms of bacteria. The MFC power output is limited by low voltage and low current characteristics in the range of microwatts or milliwatts per litre. In order to produce a sufficient voltage level (>1.5 V) and sufficient power to supply real applications such as autonomous sensors, it is necessary to either scale-up one single unit or to connect multiple units together. Many topologies of connection are possible as the serial association to improve the output voltage, or the parallel connection to improve the output current or the series/parallel connection to step-up both voltage and current. The association of MFCs in series is a solution to increase the voltage to an acceptable value and to mutualize the unit's output power. The serial association of a large number of MFCs presents several issues. The first one is the hydraulic coupling among MFCs when they share the same substrate. The second one is the dispersion between generators that lead to a non-optimal stack efficiency because the maximum power point (MPP) operation of all MFCs is not permitted. Voltage balancing is a solution to compensate non-uniformities towards MPP. This paper presents solutions to improve the efficiency of a stack of serially connected MFCs through a voltage-balancing circuit. Contribution to the topical issue "Electrical Engineering Symposium (SGE 2014)", edited by Adel Razek
Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo
2018-04-01
The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.
DEFF Research Database (Denmark)
Farup, Jean; Rahbek, Stine Klejs; Riis, Simon
2014-01-01
-specific association between emergence of satellite cells (SCs), muscle growth, and remodeling in response to 12 wk unilateral resistance training performed as eccentric (Ecc) or concentric (Conc) resistance training ± whey protein (Whey, 19.5 g protein + 19.5 g glucose) or placebo (Placebo, 39 g glucose......Skeletal muscle satellite cells (SCs) are involved in remodeling and hypertrophy processes of skeletal muscle. However, little knowledge exists on extrinsic factors that influence the content of SCs in skeletal muscle. In a comparative human study, we investigated the muscle fiber type......) supplementation. Muscle biopsies (vastus lateralis) were analyzed for fiber type-specific SCs, myonuclei, and fiber cross-sectional area (CSA). Following training, SCs increased with Conc in both type I and type II fibers (P
DEFF Research Database (Denmark)
Wewer, U M; Iba, K; Durkin, M E
1998-01-01
differentiation in vitro. We find that tetranectin expression coincides with muscle differentiation and maturation in the second half of gestation and further that tetranectin is enriched at the myotendinous and myofascial junctions. The tetranectin immunostaining declines after birth and no immunostaining...... cells in dystrophic mdx mice. Murine C2C12 myogenic cells and pluripotent embryonic stem cells can undergo muscle cell differentiation in vitro. Tetranectin is not expressed in the undifferentiated myogenic cells, but during the progression of muscle differentiation, tetranectin mRNA is induced...... that in some tissues, such as the limbs, tetranectin may function locally, whereas in other tissues, such as the lung, tetranectin production may be destined for body fluids. In summary, these results suggest that tetranectin is a matricellular protein and plays a role in myogenesis....
ATP-sensitive K(+-channels in muscle cells: features and physiological role
Directory of Open Access Journals (Sweden)
O. B. Vadzyuk
2014-08-01
Full Text Available ATP-sensitive K+-channels of plasma membranes belong to the inward rectifier potassium channels type. They are involved in coupling of electrical activity of muscle cell with its metabolic state. These channels are heterooctameric and consist of two types of subunits: four poreforming (Kir 6.х and four regulatory (SUR, sulfonylurea receptor. The Kir subunits contain highly selective K+ filter and provide for high-velocity K+ currents. The SUR subunits contain binding sites for activators and blockers and have metabolic sensor, which enables channel activation under conditions of metabolic stress. ATP blocks K+ currents through the ATP-sensitive K+-channels in the most types of muscle cells. However, functional activity of these channels does not depend on absolute concentration of ATP but on the АТР/ADP ratio and presence of Mg2+. Physiologically active substances, such as phosphatidylinositol bisphosphate and fatty acid esters can regulate the activity of these structures in muscle cells. Activation of these channels under ischemic conditions underlies their cytoprotective action, which results in prevention of Ca2+ overload in cytosol. In contrast to ATP-sensitive K+-channels of plasma membranes, the data regarding the structure and function of ATP-sensitive K+-channels of mitochondrial membrane are contradictory. Pore-forming subunits of this channel have not been firmly identified yet. ATP-sensitive K+ transport through the mitochondrial membrane is easily tested by different methods, which are briefly reviewed in this paper. Interaction of mitoKATP with physiological and pharmacological ligands is discussed as well.
Acrolein relaxes mouse isolated tracheal smooth muscle via a TRPA1-dependent mechanism.
Cheah, Esther Y; Burcham, Philip C; Mann, Tracy S; Henry, Peter J
2014-05-01
Airway sensory C-fibres express TRPA1 channels which have recently been identified as a key chemosensory receptor for acrolein, a toxic and highly prevalent component of smoke. TRPA1 likely plays an intermediary role in eliciting a range of effects induced by acrolein including cough and neurogenic inflammation. Currently, it is not known whether acrolein-induced activation of TRPA1 produces other airway effects including relaxation of mouse airway smooth muscle. The aims of this study were to examine the effects of acrolein on airway smooth muscle tone in mouse isolated trachea, and to characterise the cellular and molecular mechanisms underpinning the effects of acrolein. Isometric tension recording studies were conducted on mouse isolated tracheal segments to characterise acrolein-induced relaxation responses. Release of the relaxant PGE₂ was measured by EIA to examine its role in the response. Use of selective antagonists/inhibitors permitted pharmacological characterisation of the molecular and cellular mechanisms underlying this relaxation response. Acrolein induced dose-dependent relaxation responses in mouse isolated tracheal segments. Importantly, these relaxation responses were significantly inhibited by the TRPA1 antagonists AP-18 and HC-030031, an NK₁ receptor antagonist RP-67580, and the EP₂ receptor antagonist PF-04418948, whilst completely abolished by the non-selective COX inhibitor indomethacin. Acrolein also caused rapid PGE₂ release which was suppressed by HC-030031. In summary, acrolein induced a novel bronchodilator response in mouse airways. Pharmacologic studies indicate that acrolein-induced relaxation likely involves interplay between TRPA1-expressing airway sensory C-fibres, NK₁ receptor-expressing epithelial cells, and EP₂-receptor expressing airway smooth muscle cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Moretti, Alessandra; Caron, Leslie; Nakano, Atsushi; Lam, Jason T; Bernshausen, Alexandra; Chen, Yinhong; Qyang, Yibing; Bu, Lei; Sasaki, Mika; Martin-Puig, Silvia; Sun, Yunfu; Evans, Sylvia M; Laugwitz, Karl-Ludwig; Chien, Kenneth R
2006-12-15
Cardiogenesis requires the generation of endothelial, cardiac, and smooth muscle cells, thought to arise from distinct embryonic precursors. We use genetic fate-mapping studies to document that isl1(+) precursors from the second heart field can generate each of these diverse cardiovascular cell types in vivo. Utilizing embryonic stem (ES) cells, we clonally amplified a cellular hierarchy of isl1(+) cardiovascular progenitors, which resemble the developmental precursors in the embryonic heart. The transcriptional signature of isl1(+)/Nkx2.5(+)/flk1(+) defines a multipotent cardiovascular progenitor, which can give rise to cells of all three lineages. These studies document a developmental paradigm for cardiogenesis, where muscle and endothelial lineage diversification arises from a single cell-level decision of a multipotent isl1(+) cardiovascular progenitor cell (MICP). The discovery of ES cell-derived MICPs suggests a strategy for cardiovascular tissue regeneration via their isolation, renewal, and directed differentiation into specific mature cardiac, pacemaker, smooth muscle, and endothelial cell types.
HEXIM1 controls satellite cell expansion after injury to regulate skeletal muscle regeneration
Hong, Peng; Chen, Kang; Huang, Bihui; Liu, Min; Cui, Miao; Rozenberg, Inna; Chaqour, Brahim; Pan, Xiaoyue; Barton, Elisabeth R.; Jiang, Xian-Cheng; Siddiqui, M.A.Q.
2012-01-01
The native capacity of adult skeletal muscles to regenerate is vital to the recovery from physical injuries and dystrophic diseases. Currently, the development of therapeutic interventions has been hindered by the complex regulatory network underlying the process of muscle regeneration. Using a mouse model of skeletal muscle regeneration after injury, we identified hexamethylene bisacetamide inducible 1 (HEXIM1, also referred to as CLP-1), the inhibitory component of the positive transcription elongation factor b (P-TEFb) complex, as a pivotal regulator of skeletal muscle regeneration. Hexim1-haplodeficient muscles exhibited greater mass and preserved function compared with those of WT muscles after injury, as a result of enhanced expansion of satellite cells. Transplanted Hexim1-haplodeficient satellite cells expanded and improved muscle regeneration more effectively than WT satellite cells. Conversely, HEXIM1 overexpression restrained satellite cell proliferation and impeded muscle regeneration. Mechanistically, dissociation of HEXIM1 from P-TEFb and subsequent activation of P-TEFb are required for satellite cell proliferation and the prevention of early myogenic differentiation. These findings suggest a crucial role for the HEXIM1/P-TEFb pathway in the regulation of satellite cell–mediated muscle regeneration and identify HEXIM1 as a potential therapeutic target for degenerative muscular diseases. PMID:23023707
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Subcell Light Current-Voltage Characterization of Irradiated Multijunction Solar Cell
Directory of Open Access Journals (Sweden)
Walker Don
2017-01-01
Full Text Available The degradation of individual subcell J-V parameters, such as short circuit current, open circuit voltage, fill factor, and power of a GaInP/GaInAs/Ge triple junction solar cell by 1 MeV electrons were derived utilizing the spectral reciprocity relation between electroluminescence and external quantum efficiency. After exposure to a fluence of 1 × 1015 1 MeV electrons, it was observed that up to 67% of the voltage loss is from the middle, GaInAs subcell. Also, the dark saturation current of the Ge and GaInAs subcells increased but a simultaneous decrease in ideality factor caused a reduction of the open circuit voltage. The reduced ideality factor further indicates a change in the primary recombination mechanism.
Using a Voltage Domain Programmable Technique for Low-Power Management Cell-Based Design
Directory of Open Access Journals (Sweden)
Ching-Hwa Cheng
2011-09-01
Full Text Available The Multi-voltage technique is an effective way to reduce power consumption. In the proposed cell-based voltage domain programmable (VDP technique, the high and low voltages applied to logic gates are programmable. The flexible voltage domain reassignment allows the chip performance and power consumption to be dynamically adjusted. In the proposed technique, the power switches possess the feature of flexible programming after chip manufacturing. This VDP method does not use an external voltage regulator to regulate the supply voltage level from outside of the chip but can be easily integrated within the design. This novel technique is proven by use of a video decoder test chip, which shows 55% and 61% power reductions compared to conventional single-Vdd and low-voltage designs, respectively. This power-aware performance adjusting mechanism shows great power reduction with a good power-performance management mechanism.
Osteogenic differentiation capacity of human skeletal muscle-derived progenitor cells.
Directory of Open Access Journals (Sweden)
Teruyo Oishi
Full Text Available Heterotopic ossification (HO is defined as the formation of ectopic bone in soft tissue outside the skeletal tissue. HO is thought to result from aberrant differentiation of osteogenic progenitors within skeletal muscle. However, the precise origin of HO is still unclear. Skeletal muscle contains two kinds of progenitor cells, myogenic progenitors and mesenchymal progenitors. Myogenic and mesenchymal progenitors in human skeletal muscle can be identified as CD56(+ and PDGFRα(+ cells, respectively. The purpose of this study was to investigate the osteogenic differentiation potential of human skeletal muscle-derived progenitors. Both CD56(+ cells and PDGFRα(+ cells showed comparable osteogenic differentiation potential in vitro. However, in an in vivo ectopic bone formation model, PDGFRα(+ cells formed bone-like tissue and showed successful engraftment, while CD56(+ cells did not form bone-like tissue and did not adapt to an osteogenic environment. Immunohistological analysis of human HO sample revealed that many PDGFRα(+ cells were localized in proximity to ectopic bone formed in skeletal muscle. MicroRNAs (miRNAs are known to regulate many biological processes including osteogenic differentiation. We investigated the participation of miRNAs in the osteogenic differentiation of PDGFRα(+ cells by using microarray. We identified miRNAs that had not been known to be involved in osteogenesis but showed dramatic changes during osteogenic differentiation of PDGFRα(+ cells. Upregulation of miR-146b-5p and -424 and downregulation of miR-7 during osteogenic differentiation of PDGFRα(+ cells were confirmed by quantitative real-time RT-PCR. Inhibition of upregulated miRNAs, miR-146b-5p and -424, resulted in the suppression of osteocyte maturation, suggesting that these two miRNAs have the positive role in the osteogenesis of PDGFRα(+ cells. Our results suggest that PDGFRα(+ cells may be the major source of HO and that the newly identified mi
Directory of Open Access Journals (Sweden)
A.R.M. Sabbatini
2011-02-01
Full Text Available Histidine-rich glycoprotein (HRG is synthesized by liver and is present at relatively high concentration in the plasma of vertebrates. We have previously described the association of a HRG-like molecule to purified rabbit skeletal muscle AMP deaminase (AMPD. We also provided the first evidence for the presence of a HRG-like protein in human skeletal muscle where a positive correlation between HRG content and total determined AMPD activity has been shown. In the present paper we investigate the origin of skeletal muscle HRG. The screening of a human skeletal muscle cDNA expression library using an anti-HRG antibody failed to reveal any positive clone. The RT-PCR analysis, performed on human skeletal muscle RNA as well as on RNA from the rhabdomyosarcoma (RD cell line, failed to show any mRNA specific for the plasma HRG or for the putative muscle variant. When the RD cells were incubated with human plasma HRG, a time-dependent increase of the HRG immunoreactivity was detected both at the plasma membrane level and intracellularly. The internalisation of HRG was inhibited by the addition of heparin. The above data strongly suggest that skeletal muscle cells do not synthesize the muscle variant of HRG but instead can actively internalise it from plasma.
Myostatin induces mitochondrial metabolic alteration and typical apoptosis in cancer cells
Liu, Y; Cheng, H; Zhou, Y; Zhu, Y; Bian, R; Chen, Y; Li, C; Ma, Q; Zheng, Q; Zhang, Y; Jin, H; Wang, X; Chen, Q; Zhu, D
2013-01-01
Myostatin, a member of the transforming growth factor-β superfamily, regulates the glucose metabolism of muscle cells, while dysregulated myostatin activity is associated with a number of metabolic disorders, including muscle cachexia, obesity and type II diabetes. We observed that myostatin induced significant mitochondrial metabolic alterations and prolonged exposure of myostatin induced mitochondria-dependent apoptosis in cancer cells addicted to glycolysis. To address the underlying mechanism, we found that the protein levels of Hexokinase II (HKII) and voltage-dependent anion channel 1 (VDAC1), two key regulators of glucose metabolisms as well as metabolic stress-induced apoptosis, were negatively correlated. In particular, VDAC1 was dramatically upregulated in cells that are sensitive to myostatin treatment whereas HKII was downregulated and dissociated from mitochondria. Myostatin promoted the translocation of Bax from cytosol to mitochondria, and knockdown of VDAC1 inhibited myostatin-induced Bax translocation and apoptosis. These apoptotic changes can be partially rescued by repletion of ATP, or by ectopic expression of HKII, suggesting that perturbation of mitochondrial metabolism is causally linked with subsequent apoptosis. Our findings reveal novel function of myostatin in regulating mitochondrial metabolism and apoptosis in cancer cells. PMID:23412387
Rodríguez-Bies, Elizabeth; Navas, Plácido; López-Lluch, Guillermo
2015-01-01
Aging affects many biochemical, cellular, and physiological processes in the organisms. Accumulation of damage based on oxidized macromolecules is found in many age-associated diseases. Coenzyme Q (Q) is one of the main molecules involved in metabolic and antioxidant activities in cells. Q-dependent antioxidant activities are importantly involved on the protection of cell membranes against oxidation. Many studies indicate that Q decay in most of the organs during aging. In our study, no changes in Q levels were found in old animals in comparison with young animals. On the other hand, the interventions, caloric restriction based on every-other-day feeding procedure, and physical exercise were able to increase Q levels in muscle, but only in old and not in young animals. Probably, this effect prevented the increase in lipid peroxidation found in aged animals and also protein carbonylation. Further, Q-dependent antioxidant activities such as NADH-cytochrome b5 reductase and NAD(P)H-quinone oxidoreductase 1 are also modulated by both exercise and every other day feeding. Taken together, we demonstrate that exercise and dietary restriction as every-other-day procedure can regulate endogenous synthesized Q levels and Q-dependent antioxidant activities in muscle, preventing oxidative damage in aged muscle. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Amit Modgil
Full Text Available Apelin-13 causes vasoconstriction by acting directly on APJ receptors in vascular smooth muscle (VSM cells; however, the ionic mechanisms underlying this action at the cellular level remain unclear. Large-conductance Ca(2+-activated K(+ (BKCa channels in VSM cells are critical regulators of membrane potential and vascular tone. In the present study, we examined the effect of apelin-13 on BK(Ca channel activity in VSM cells, freshly isolated from rat middle cerebral arteries. In whole-cell patch clamp mode, apelin-13 (0.001-1 μM caused concentration-dependent inhibition of BK(Ca in VSM cells. Apelin-13 (0.1 µM significantly decreased BK(Ca current density from 71.25 ± 8.14 pA/pF to 44.52 ± 7.10 pA/pF (n=14 cells, P<0.05. This inhibitory effect of apelin-13 was confirmed by single channel recording in cell-attached patches, in which extracellular application of apelin-13 (0.1 µM decreased the open-state probability (NPo of BK(Ca channels in freshly isolated VSM cells. However, in inside-out patches, extracellular application of apelin-13 (0.1 µM did not alter the NPo of BK(Ca channels, suggesting that the inhibitory effect of apelin-13 on BKCa is not mediated by a direct action on BK(Ca. In whole cell patches, pretreatment of VSM cells with LY-294002, a PI3-kinase inhibitor, markedly attenuated the apelin-13-induced decrease in BK(Ca current density. In addition, treatment of arteries with apelin-13 (0.1 µM significantly increased the ratio of phosphorylated-Akt/total Akt, indicating that apelin-13 significantly increases PI3-kinase activity. Taken together, the data suggest that apelin-13 inhibits BK(Ca channel via a PI3-kinase-dependent signaling pathway in cerebral artery VSM cells, which may contribute to its regulatory action in the control of vascular tone.
Directory of Open Access Journals (Sweden)
Giovanna Distefano
Full Text Available Cellular therapy is a potential approach to improve the regenerative capacity of damaged or diseased skeletal muscle. However, its clinical use has often been limited by impaired donor cell survival, proliferation and differentiation following transplantation. Additionally, functional improvements after transplantation are all-too-often negligible. Because the host microenvironment plays an important role in the fate of transplanted cells, methods to modulate the microenvironment and guide donor cell behavior are warranted. The purpose of this study was to investigate whether the use of neuromuscular electrical stimulation (NMES for 1 or 4 weeks following muscle-derived stem cell (MDSC transplantation into dystrophic skeletal muscle can modulate the fate of donor cells and enhance their contribution to muscle regeneration and functional improvements. Animals submitted to 4 weeks of NMES after transplantation demonstrated a 2-fold increase in the number of dystrophin+ myofibers as compared to control transplanted muscles. These findings were concomitant with an increased vascularity in the MDSC+NMES group when compared to non-stimulated counterparts. Additionally, animals subjected to NMES (with or without MDSC transplantation presented an increased maximal specific tetanic force when compared to controls. Although cell transplantation and/or the use of NMES resulted in no changes in fatigue resistance, the combination of both MDSC transplantation and NMES resulted in a faster recovery from fatigue, when compared to non-injected and non-stimulated counterparts. We conclude that NMES is a viable method to improve MDSC engraftment, enhance dystrophic muscle strength, and, in combination with MDSC transplantation, improve recovery from fatigue. These findings suggest that NMES may be a clinically-relevant adjunct approach for cell transplantation into skeletal muscle.
Rac1 signalling towards GLUT4/glucose uptake in skeletal muscle
DEFF Research Database (Denmark)
Chiu, Tim T; Jensen, Thomas Elbenhardt; Sylow, Lykke
2011-01-01
Small Rho family GTPases are important regulators of cellular traffic. Emerging evidence now implicates Rac1 and Rac-dependent actin reorganisation in insulin-induced recruitment of glucose transporter-4 (GLUT4) to the cell surface of muscle cells and mature skeletal muscle. This review summarises...... the current thinking on the regulation of Rac1 by insulin, the role of Rac-dependent cortical actin remodelling in GLUT4 traffic, and the impact of Rac1 towards insulin resistance in skeletal muscle....
Directory of Open Access Journals (Sweden)
Fang Wang
2018-02-01
Full Text Available Smooth muscle differentiated adipose tissue-derived stem cells are a valuable resource for regeneration of gastrointestinal tissues, such as the gut and sphincters. Hypoxia has been shown to promote adipose tissue-derived stem cells proliferation and maintenance of pluripotency, but the influence of hypoxia on their smooth myogenic differentiation remains unexplored. This study investigated the phenotype and contractility of adipose-derived stem cells differentiated toward the smooth myogenic lineage under hypoxic conditions. Oxygen concentrations of 2%, 5%, 10%, and 20% were used during differentiation of adipose tissue-derived stem cells. Real time reverse transcription polymerase chain reaction and immunofluorescence staining were used to detect the expression of smooth muscle cells-specific markers, including early marker smooth muscle alpha actin, middle markers calponin, caldesmon, and late marker smooth muscle myosin heavy chain. The specific contractile properties of cells were verified with both a single cell contraction assay and a gel contraction assay. Five percent oxygen concentration significantly increased the expression levels of α-smooth muscle actin, calponin, and myosin heavy chain in adipose-derived stem cell cultures after 2 weeks of induction (p < 0.01. Cells differentiated in 5% oxygen conditions showed greater contraction effect (p < 0.01. Hypoxia influences differentiation of smooth muscle cells from adipose stem cells and 5% oxygen was the optimal condition to generate smooth muscle cells that contract from adipose stem cells.
Energy Technology Data Exchange (ETDEWEB)
Arora, N D
1987-05-01
A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.
The extraocular muscle stem cell niche is resistant to ageing and disease
Directory of Open Access Journals (Sweden)
Luigi eFormicola
2014-12-01
Full Text Available Specific muscles are spared in many degenerative myopathies. Most notably, the extraocular muscles (EOMs do not show clinical signs of late stage myopathies including the accumulation of fibrosis and fat. It has been proposed that an altered stem cell niche underlies the resistance of EOMs in these pathologies, however, to date, no reports have provided a detailed characterization of the EOM stem cell niche. PW1/Peg3 is expressed in progenitor cells in all adult tissues including satellite cells and a subset of interstitial non-satellite cell progenitors in muscle. These PW1-positive interstitial cells (PICs include a fibroadipogenic progenitor population (FAPs that give rise to fat and fibrosis in late stage myopathies. PICs/FAPs are mobilized following injury and FAPs exert a promyogenic role upon myoblasts in vitro but require the presence of a minimal population of satellite cells in vivo. We and others recently described that FAPs express promyogenic factors while satellite cells express antimyogenic factors suggesting that PICs/FAPs act as support niche cells in skeletal muscle through paracrine interactions. We analyzed the EOM stem cell niche in young adult and aged wild-type mice and found that the balance between PICs and satellite cells within the EOM stem cell niche is maintained throughout life. Moreover, in the adult mdx mouse model for Duchenne muscular dystrophy, the EOM stem cell niche is unperturbed compared to normal mice, in contrast to Tibialis Anterior (TA muscle, which displays signs of ongoing degeneration/regeneration. Regenerating mdx TA shows increased levels of both PICs and satellite cells, comparable to normal unaffected EOMs. We propose that the increase in PICs that we observe in normal EOMs contributes to preserving the integrity of the myofibers and satellite cells. Our data suggest that molecular cues regulating muscle regeneration are intrinsic properties of EOMs.
Tenascin-Y, a component of distinctive connective tissues, supports muscle cell growth.
Hagios, C; Brown-Luedi, M; Chiquet-Ehrismann, R
1999-12-15
Chicken tenascin-Y is an extracellular matrix protein most closely related to the mammalian tenascin-X. It is highly expressed in the connective tissue of skeletal muscle (C. Hagios, M. Koch, J. Spring, M. Chiquet, and R. Chiquet-Ehrismann, 1996, J. Cell Biol. 134, 1499-1512). Here we demonstrate the presence of tenascin-Y in specific areas of the connective tissues in developing lung, kidney, and skin. In skin tenascin-Y shows a complementary expression pattern to tenascin-C, whereas in the lung and kidney the sites of expression are partly overlapping. Tenascin-Y is also present in embryonic skeletal muscle where it is expressed in the developing connective tissue in between the muscle fibers. This connective tissue is also the major site of alpha5 integrin expression. We purified recombinantly expressed tenascin-Y and tested its effect on cell adhesion and its influence on muscle cell growth and differentiation. C2C12 myoblasts were able to adhere to tenascin-Y and showed extensive formation of actin-rich processes without generation of stress fibers. Furthermore, we found that tenascin-Y influenced cell morphology of chick embryo fibroblasts over prolonged times in culture and that it supports primary muscle cell growth and restricts muscle cell differentiation. Copyright 1999 Academic Press.
Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells
Directory of Open Access Journals (Sweden)
Donna M D'Souza
2013-12-01
Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.
Optimizing abdominal CT dose and image quality with respect to x-ray tube voltage
Huda, Walter; Ogden, Kent M.
2004-05-01
The objective of this study was to identify the x-ray tube voltage that results in optimum performance for abdominal CT imaging for a range of imaging tasks and patient sizes. Theoretical calculations were performed of the contrast to noise ratio (CNR) for disk shaped lesions of muscle, fat, bone and iodine embedded in a uniform water background. Lesion contrast was the mean Hounsfield Unit value at the effective photon energy, and image noise was determined from the total radiation intensity incident on the CT x-ray detector. Patient size ranging from young infants (10 kg) to oversized adults (120 kg), with CNR values obtained for x-ray tube voltages ranging from 80 to 140 kV. Patients of varying sizes were modeled as an equivalent cylinder of water, and the mean section dose (D) was determined for each selected x-ray tube kV value at a constant mAs. For each patient size and lesion type, we identified an optimal kV as the x-ray tube voltage that yields a maximum value of the figure of merit (CNR2/D). Increasing the x-ray tube voltage from 80 to 140 kV reduced lesion contrast by 11% for muscle, 21% for fat, 35% for bone and 52% for iodine, and these reductions were approximately independent of patient size. Increasing the x-ray tube voltage from 80 to 140 kV increased a muscle lesion CNR relative to a uniform water background by a factor of 2.6, with similar trends observed for fat (2.3), bone (1.9) and iodine (1.4). The improvement in lesion CNR with increasing x-ray tube voltage was highest for the largest sized patients. Increasing the x-ray tube voltage from 80 to 140 kV increased the patient dose by a factor of between 5.0 and 6.2 depending on the patient size. For small sized patients (10 and 30 kg) and muscle lesions, best performance is obtained at 80 kV; however, for adults (70 kg) and oversized adults (120 kg), the best performance would be obtained at 140 kV. Imaging fat lesions was best performed at 80 kV for all patients except for oversized adults
Control of hybrid fuel cell/energy storage distributed generation system against voltage sag
Energy Technology Data Exchange (ETDEWEB)
Hajizadeh, Amin; Golkar, Masoud Aliakbar [Electrical Engineering Department, K.N. Toosi University of Technology, Seyedkhandan, Dr. Shariati Ave, P.O. Box 16315-1355, Tehran (Iran)
2010-06-15
Fuel cell (FC) and energy storage (ES) based hybrid distributed power generation systems appear to be very promising for satisfying high energy and high power requirements of power quality problems in distributed generation (DG) systems. In this study, design of control strategy for hybrid fuel cell/energy storage distributed power generation system during voltage sag has been presented. The proposed control strategy allows hybrid distributed generation system works properly when a voltage disturbance occurs in distribution system and hybrid system stays connected to the main grid. Hence, modeling, controller design, and simulation study of a hybrid distributed generation system are investigated. The physical model of the fuel cell stack, energy storage and the models of power conditioning units are described. Then the control design methodology for each component of the hybrid system is proposed. Simulation results are given to show the overall system performance including active power control and voltage sag ride-through capability of the hybrid distributed generation system. (author)
Sato, Aki; Sakai, Naoko; Shinbo, Junsuke; Hashidate, Hideki; Igarashi, Shuichi; Kakita, Akiyoshi; Yamazaki, Motoyoshi
2014-01-01
The patient was a 55-year-old male who had prominent fasciculation and muscle cramps. Muscle weakness and atrophy of the trunk, respiratory system, and extremities gradually progressed. On the basis of these features, we diagnosed this patient as having amyotrophic lateral sclerosis (ALS), however, the upper motor neuron signs were not significant. Following the detection of the anti-voltage gated potassium channel (VGKC) complex antibody at 907.5 pM (normal VGKC complex antibody in the development of cramp-fasciculation syndrome has been speculated. In this ALS patient, the antibodies might be associated with pathomechanisms underlying the characteristic symptoms.
In-situ monitoring of internal local temperature and voltage of proton exchange membrane fuel cells.
Lee, Chi-Yuan; Fan, Wei-Yuan; Hsieh, Wei-Jung
2010-01-01
The distribution of temperature and voltage of a fuel cell are key factors that influence performance. Conventional sensors are normally large, and are also useful only for making external measurements of fuel cells. Centimeter-scale sensors for making invasive measurements are frequently unable to accurately measure the interior changes of a fuel cell. This work focuses mainly on fabricating flexible multi-functional microsensors (for temperature and voltage) to measure variations in the local temperature and voltage of proton exchange membrane fuel cells (PEMFC) that are based on micro-electro-mechanical systems (MEMS). The power density at 0.5 V without a sensor is 450 mW/cm(2), and that with a sensor is 426 mW/cm(2). Since the reaction area of a fuel cell with a sensor is approximately 12% smaller than that without a sensor, but the performance of the former is only 5% worse.
Koide, Masashi; Hagiwara, Yoshihiro; Tsuchiya, Masahiro; Kanzaki, Makoto; Hatakeyama, Hiroyasu; Tanaka, Yukinori; Minowa, Takashi; Takemura, Taro; Ando, Akira; Sekiguchi, Takuya; Yabe, Yutaka; Itoi, Eiji
2018-01-01
Rotator cuff tears (RCTs) are a common shoulder problem in the elderly that can lead to both muscle atrophy and fatty infiltration due to less physical load. Satellite cells, quiescent cells under the basal lamina of skeletal muscle fibers, play a major role in muscle regeneration. However, the myogenic potency of human satellite cells in muscles with fatty infiltration is unclear due to the difficulty in isolating from small samples, and the mechanism of the progression of fatty infiltration has not been elucidated. The purpose of this study was to analyze the population of myogenic and adipogenic cells in disused supraspinatus (SSP) and intact subscapularis (SSC) muscles of the RCTs from the same patients using fluorescence-activated cell sorting. The microstructure of the muscle with fatty infiltration was observed as a whole mount condition under multi-photon microscopy. Myogenic differentiation potential and gene expression were evaluated in satellite cells. The results showed that the SSP muscle with greater fatty infiltration surrounded by collagen fibers compared with the SSC muscle under multi-photon microscopy. A positive correlation was observed between the ratio of muscle volume to fat volume and the ratio of myogenic precursor to adipogenic precursor. Although no difference was observed in the myogenic potential between the two groups in cell culture, satellite cells in the disused SSP muscle showed higher intrinsic myogenic gene expression than those in the intact SSC muscle. Our results indicate that satellite cells from the disused SSP retain sufficient potential of muscle growth despite the fatty infiltration.
Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models
Marquette, Michele L.; Sognier, Marguerite A.
2013-01-01
An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.
Sway‐dependent changes in standing ankle stiffness caused by muscle thixotropy
Sakanaka, Tania E.; Lakie, Martin
2016-01-01
Key points The passive stiffness of the calf muscles contributes to standing balance, although the properties of muscle tissue are highly labile.We investigated the effect of sway history upon intrinsic ankle stiffness and demonstrated reductions in stiffness of up to 43% during conditions of increased baseline sway.This sway dependence was most apparent when using low amplitude stiffness‐measuring perturbations, and the short‐range stiffness component was smaller during periods of high sway.These characteristics are consistent with the thixotropic properties of the calf muscles causing the observed changes in ankle stiffness.Periods of increased sway impair the passive stabilization of standing, demanding more active neural control of balance. Abstract Quiet standing is achieved through a combination of active and passive mechanisms, consisting of neural control and intrinsic mechanical stiffness of the ankle joint, respectively. The mechanical stiffness is partly determined by the calf muscles. However, the viscoelastic properties of muscle are highly labile, exhibiting a strong dependence on movement history. By measuring the effect of sway history upon ankle stiffness, the present study determines whether this lability has consequences for the passive stabilization of human standing. Ten subjects stood quietly on a rotating platform whose axis was collinear with the ankle joint. Ankle sway was increased by slowly tilting this platform in a random fashion, or decreased by fixing the body to a board. Ankle stiffness was measured by using the same platform to simultaneously apply small, brief perturbations (ankle stiffness by up to 43% compared to the body‐fixed condition. Normal quiet stance was associated with intermediate values. The effect was most apparent when using smaller perturbation amplitudes to measure stiffness (0.1 vs. 0.6 deg). Furthermore, torque responses exhibited a biphasic pattern, consisting of an initial steep rise followed by a
Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells
Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.
2013-01-01
In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…
International Nuclear Information System (INIS)
McCarthy, L.; Van Halen, R.G.; St Denny, I.H.; Glinka, K.G.; Handley, D.A.; Stuetz, A.; Nemecek, G.M.
1987-01-01
Terbinafine (T; (E)-N-(6,6-dimethyl-2-hepten-4-ynyl)-N-methyl-1-naphthalenemethanamine), an antimycotic agent with antimitogenic activity in fibroblasts, was examined for its effects on platelet-derived growth factor (PDGF)-stimulated aortic smooth muscle cell DNA synthesis in vitro and myointimal proliferation in vivo. Exposure of smooth muscle cells to 1-25 μM T resulted in a concentration-dependent inhibition of PDGF-induced mitogenesis as determined by [ 3 H]thymidine incorporation or cell number. The IC 50 for T was approximately 5 μM. The inhibitory effect of terbinafine persisted in the presence of 0.4-8.0 μg/ml cholesterol or 130 μg/ml mevalonate. Administration of T to rats for 2 d before and 14 d after balloon catheter carotid injury resulted in a 40% decrease in lesion area. These observations indicate that T is both a potent in vitro antagonist of the smooth muscle cell mitogenic response to PDGF and an effective, well-tolerated, orally active inhibitor of myointimal proliferation in vivo
Energy Technology Data Exchange (ETDEWEB)
McCarthy, L.; Van Halen, R.G.; St. Denny, I.H.; Glinka, K.G.; Handley, D.A.; Stuetz, A.; Nemecek, G.M.
1987-05-01
Terbinafine (T; (E)-N-(6,6-dimethyl-2-hepten-4-ynyl)-N-methyl-1-naphthalenemethanamine), an antimycotic agent with antimitogenic activity in fibroblasts, was examined for its effects on platelet-derived growth factor (PDGF)-stimulated aortic smooth muscle cell DNA synthesis in vitro and myointimal proliferation in vivo. Exposure of smooth muscle cells to 1-25 ..mu..M T resulted in a concentration-dependent inhibition of PDGF-induced mitogenesis as determined by (/sup 3/H)thymidine incorporation or cell number. The IC/sub 50/ for T was approximately 5 ..mu..M. The inhibitory effect of terbinafine persisted in the presence of 0.4-8.0 ..mu..g/ml cholesterol or 130 ..mu..g/ml mevalonate. Administration of T to rats for 2 d before and 14 d after balloon catheter carotid injury resulted in a 40% decrease in lesion area. These observations indicate that T is both a potent in vitro antagonist of the smooth muscle cell mitogenic response to PDGF and an effective, well-tolerated, orally active inhibitor of myointimal proliferation in vivo.
Film size-dependent voltage-modulated magnetism in multiferroic heterostructures
Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.
2014-01-01
The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375
Exercise-induced muscle-derived cytokines inhibit mammary cancer cell growth.
Hojman, Pernille; Dethlefsen, Christine; Brandt, Claus; Hansen, Jakob; Pedersen, Line; Pedersen, Bente Klarlund
2011-09-01
Regular physical activity protects against the development of breast and colon cancer, since it reduces the risk of developing these by 25-30%. During exercise, humoral factors are released from the working muscles for endocrinal signaling to other organs. We hypothesized that these myokines mediate some of the inhibitory effects of exercise on mammary cancer cell proliferation. Serum and muscles were collected from mice after an exercise bout. Incubation with exercise-conditioned serum inhibited MCF-7 cell proliferation by 52% and increased caspase activity by 54%. A similar increase in caspase activity was found after incubation of MCF-7 cells with conditioned media from electrically stimulated myotubes. PCR array analysis (CAPM-0838E; SABiosciences) revealed that seven genes were upregulated in the muscles after exercise, and of these oncostatin M (OSM) proved to inhibit MCF-7 proliferation by 42%, increase caspase activity by 46%, and induce apoptosis. Blocking OSM signaling with anti-OSM antibodies reduced the induction of caspase activity by 51%. To verify that OSM was a myokine, we showed that it was significantly upregulated in serum and in three muscles, tibialis cranialis, gastronemius, and soleus, after an exercise bout. In contrast, OSM expression remained unchanged in subcutaneous and visceral adipose tissue, liver, and spleen (mononuclear cells). We conclude that postexercise serum inhibits mammary cancer cell proliferation and induces apoptosis of these cells. We suggest that one or more myokines secreted from working muscles may be mediating this effect and that OSM is a possible candidate. These findings emphasize that role of physical activity in cancer treatment, showing a direct link between exercise-induced humoral factors and decreased tumor cell growth.
Meiler, M.; Andre, D.; Schmid, O.; Hofer, E. P.
Intelligent energy management is a cost-effective key path to realize efficient automotive drive trains [R. O'Hayre, S.W. Cha, W. Colella, F.B. Prinz. Fuel Cell Fundamentals, John Wiley & Sons, Hoboken, 2006]. To develop operating strategy in fuel cell drive trains, precise and computational efficient models of all system components, especially the fuel cell stack, are needed. Should these models further be used in diagnostic or control applications, then some major requirements must be fulfilled. First, the model must predict the mean fuel cell voltage very precisely in all possible operating conditions, even during transients. The model output should be as smooth as possible to support best efficient optimization strategies of the complete system. At least, the model must be computational efficient. For most applications, a difference between real fuel cell voltage and model output of less than 10 mV and 1000 calculations per second will be sufficient. In general, empirical models based on system identification offer a better accuracy and consume less calculation resources than detailed models derived from theoretical considerations [J. Larminie, A. Dicks. Fuel Cell Systems Explained, John Wiley & Sons, West Sussex, 2003]. In this contribution, the dynamic behaviour of the mean cell voltage of a polymer-electrolyte-membrane fuel cell (PEMFC) stack due to variations in humidity of cell's reactant gases is investigated. The validity of the overall model structure, a so-called general Hammerstein model (or Uryson model), was introduced recently in [M. Meiler, O. Schmid, M. Schudy, E.P. Hofer. Dynamic fuel cell stack model for real-time simulation based on system identification, J. Power Sources 176 (2007) 523-528]. Fuel cell mean voltage is calculated as the sum of a stationary and a dynamic voltage component. The stationary component of cell voltage is represented by a lookup-table and the dynamic voltage by a parallel placed, nonlinear transfer function. A
Monitoring voltage-sensitive membrane impedance change using radio frequency interrogation.
Dharia, Sameera; Rabbitt, Richard D
2010-01-01
Here we present a new technique to monitor dynamic conformational changes in voltage-sensitive membrane-bound proteins using radio frequency (RF) impedance measurements. Xenopus oocytes were transfected to express ShakerB-IR K(+) ion channels, and step changes in membrane potential were applied using two-electrode voltage clamp (TEVC). Simultaneously, bipolar extracellular electrodes were used to measure the RF electrical impedance across the cell (300 kHz - 1 MHz). RF current will either pass through the media, around the cell, or displace charge across the cell membrane. The change in displacement current in the cell membrane during voltage clamp resulted in measurable RF impedance change. RF impedance change during DC membrane depolarization was significantly greater in ShakerB-IR expressing oocytes than in endogenous controls at 300 kHz, 500 kHz and, to a lesser extent, 1 MHz. Since the RF were too high to modulate ShakerB-IR protein conformational state (e.g. open channel probability), impedance changes are interpreted as reflections of voltage-dependent protein conformation and associated biophysics such as ion-channel dipole interactions, fluctuations in bound water, or charged lipid head-group rotations.
Human induced pluripotent stem cell-derived vascular smooth muscle cells
DEFF Research Database (Denmark)
Ayoubi, Sohrab; Sheikh, Søren P; Eskildsen, Tilde V
2017-01-01
. To this end, human induced pluripotent stem cells (hiPSCs) have generated great enthusiasm, and have been a driving force for development of novel strategies in drug discovery and regenerative cell-therapy for the last decade. Hence, investigating the mechanisms underlying the differentiation of hi......PSCs into specialized cell types such as cardiomyocytes, endothelial cells, and vascular smooth muscle cells (VSMCs) may lead to a better understanding of developmental cardiovascular processes and potentiate progress of safe autologous regenerative therapies in pathological conditions. In this review, we summarize...
Age-related effect of cell death on fiber morphology and number in tongue muscle.
Kletzien, Heidi; Hare, Allison J; Leverson, Glen; Connor, Nadine P
2018-01-01
Multiple pathways may exist for age-related tongue muscle degeneration. Cell death is one mechanism contributing to muscle atrophy and decreased function. We hypothesized with aging, apoptosis, and apoptotic regulators would be increased, and muscle fiber size and number would be reduced in extrinsic tongue muscles. Cell death indices, expression of caspase-3 and Bcl-2, and measures of muscle morphology and number were determined in extrinsic tongue muscles of young and old rats. Significant increases in cell death, caspase-3, and Bcl-2 were observed in all extrinsic tongue muscles along with reductions in muscle fiber number in old rats. We demonstrated that apoptosis indices increase with age in lingual muscles and that alterations in apoptotic regulators may be associated with age-related degeneration in muscle fiber size and number. These observed apoptotic processes may be detrimental to muscle function, and may contribute to degradation of cranial functions with age. Muscle Nerve 57: E29-E37, 2018. © 2017 Wiley Periodicals, Inc.
IL-1β-Induced Accumulation of Amyloid: Macroautophagy in Skeletal Muscle Depends on ERK
Directory of Open Access Journals (Sweden)
Karsten Schmidt
2017-01-01
Full Text Available The pathology of inclusion body myositis (IBM involves an inflammatory response and β-amyloid deposits in muscle fibres. It is believed that MAP kinases such as the ERK signalling pathway mediate the inflammatory signalling in cells. Further, there is evidence that autophagic activity plays a crucial role in the pathogenesis of IBM. Using a well established in vitro model of IBM, the autophagic pathway, MAP kinases, and accumulation of β-amyloid were examined. We demonstrate that stimulation of muscle cells with IL-1β and IFN-γ led to an increased phosphorylation of ERK. The ERK inhibitor PD98059 diminished the expression of proinflammatory markers as well as the accumulation of β-amyloid. In addition, IL-1β and IFN-γ led to an increase of autophagic activity, upregulation of APP, and subsequent accumulation of β-sheet aggregates. Taken together, the data demonstrate that the ERK pathway contributes to formation of β-amyloid and regulation of autophagic activity in muscle cells exposed to proinflammatory cell stress. This suggests that ERK serves as an important mediator between inflammatory mechanisms and protein deposition in skeletal muscle and is a crucial element of the pathology of IBM.
Cell death induced by gamma irradiation of developing skeletal muscle
International Nuclear Information System (INIS)
Olive, M.; Blanco, R.; Rivera, R.; Cinos, C.; Ferrer, I.
1995-01-01
Newborn Sprague-Dawley rats were exposed to a single dose of 2 Gy gamma rays and killed from 6 h to 5 d later. Increased numbers of dying cells, characterised by their extreme chromatin condensation and often nuclear fragmentation were seen in skeletal muscle 6 h after irradiation. Dying cells decreased to nearly normal values 48 h later. In situ labelling of nuclear DNA fragmentation identified individual cells bearing fragmented DNA. The effects of gamma rays were suppressed following cycloheximide i.p. at a dose of 1 μg/g body weight given at the time of irradiation. Taken together, the present morphological and pharmacological results suggest that gamma ray induced cell death in skeletal muscle is apoptotic, and that the process is associated with protein synthesis. Finally, proliferating cell nuclear antigen-immunoreactive cells, which were abundant in control rats, decreased in number 48 h after irradiation. However, a marked increase significantly above normal age values was observed at the 5th day, thus suggesting that regeneration occurs following irradiation-induced cell death in developing muscle. (author)
The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.
Directory of Open Access Journals (Sweden)
Ting-Feng Lin
Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.
Gabapentin Modulates HCN4 Channel Voltage-Dependence
Directory of Open Access Journals (Sweden)
Han-Shen Tae
2017-08-01
Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.
DEFF Research Database (Denmark)
Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia
2016-01-01
This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...
Directory of Open Access Journals (Sweden)
Matthew P Krause
Full Text Available Systemic elevations in PAI-1 suppress the fibrinolytic pathway leading to poor collagen remodelling and delayed regeneration of tibialis anterior (TA muscles in type-1 diabetic Akita mice. However, how impaired collagen remodelling was specifically attenuating regeneration in Akita mice remained unknown. Furthermore, given intrinsic differences between muscle groups, it was unclear if the reparative responses between muscle groups were different.Here we reveal that diabetic Akita muscles display differential regenerative responses with the TA and gastrocnemius muscles exhibiting reduced regenerating myofiber area compared to wild-type mice, while soleus muscles displayed no difference between animal groups following injury. Collagen levels in TA and gastrocnemius, but not soleus, were significantly increased post-injury versus controls. At 5 days post-injury, when degenerating/necrotic regions were present in both animal groups, Akita TA and gastrocnemius muscles displayed reduced macrophage and satellite cell infiltration and poor myofiber formation. By 10 days post-injury, necrotic regions were absent in wild-type TA but persisted in Akita TA. In contrast, Akita soleus exhibited no impairment in any of these measures compared to wild-type soleus. In an effort to define how impaired collagen turnover was attenuating regeneration in Akita TA, a PAI-1 inhibitor (PAI-039 was orally administered to Akita mice following cardiotoxin injury. PAI-039 administration promoted macrophage and satellite cell infiltration into necrotic areas of the TA and gastrocnemius. Importantly, soleus muscles exhibit the highest inducible expression of MMP-9 following injury, providing a mechanism for normative collagen degradation and injury recovery in this muscle despite systemically elevated PAI-1.Our findings suggest the mechanism underlying how impaired collagen remodelling in type-1 diabetes results in delayed regeneration is an impairment in macrophage
Directory of Open Access Journals (Sweden)
Yogita Mistry
2013-01-01
Full Text Available Mitochondria are a major source of cellular oxidants and have been implicated in aging and associated pathologies, notably cardiovascular diseases. Vascular cell senescence is observed in experimental and human cardiovascular pathologies. Our previous data highlighted a role for angiotensin II in the induction of telomere-dependent and -independent premature senescence of human vascular smooth muscle cells and suggested this was due to production of superoxide by NADPH oxidase. However, since a role for mitochondrial oxidants was not ruled out we hypothesise that angiotensin II mediates senescence by mitochondrial superoxide generation and suggest that inhibition of superoxide may prevent vascular smooth muscle cell aging in vitro. Cellular senescence was induced using a stress-induced premature senescence protocol consisting of three successive once-daily exposure of cells to 1×10−8 mol/L angiotensin II and was dependent upon the type-1 angiotensin II receptor. Angiotensin stimulated NADPH-dependent superoxide production as estimated using lucigenin chemiluminescence in cell lysates and this was attenuated by the mitochondrial electron transport chain inhibitor, rotenone. Angiotensin also resulted in an increase in mitoSOX fluorescence indicating stimulation of mitochondrial superoxide. Significantly, the induction of senescence by angiotensin II was abrogated by rotenone and by the mitochondria-targeted superoxide dismutase mimetic, mitoTEMPO. These data suggest that mitochondrial superoxide is necessary for the induction of stress-induced premature senescence by angiotensin II and taken together with other data suggest that mitochondrial cross-talk with NADPH oxidases, via as yet unidentified signalling pathways, is likely to play a key role.
Reinl, Erin L; Cabeza, Rafael; Gregory, Ismail A; Cahill, Alison G; England, Sarah K
2015-10-01
Uterine contractions are tightly regulated by the electrical activity of myometrial smooth muscle cells (MSMCs). These cells require a depolarizing current to initiate Ca(2+) influx and induce contraction. Cationic leak channels, which permit a steady flow of cations into a cell, are known to cause membrane depolarization in many tissue types. Previously, a Gd(3+)-sensitive, Na(+)-dependent leak current was identified in the rat myometrium, but the presence of such a current in human MSMCs and the specific ion channel conducting this current was unknown. Here, we report the presence of a Na(+)-dependent leak current in human myometrium and demonstrate that the Na(+)-leak channel, NALCN, contributes to this current. We performed whole-cell voltage-clamp on fresh and cultured MSMCs from uterine biopsies of term, non-laboring women and isolated the leak currents by using Ca(2+) and K(+) channel blockers in the bath solution. Ohmic leak currents were identified in freshly isolated and cultured MSMCs with normalized conductances of 14.6 pS/pF and 10.0 pS/pF, respectively. The myometrial leak current was significantly reduced (P < 0.01) by treating cells with 10 μM Gd(3+) or by superfusing the cells with a Na(+)-free extracellular solution. Reverse transcriptase PCR and immunoblot analysis of uterine biopsies from term, non-laboring women revealed NALCN messenger RNA and protein expression in the myometrium. Notably, ∼90% knockdown of NALCN protein expression with lentivirus-delivered shRNA reduced the Gd(3+)-sensitive leak current density by 42% (P < 0.05). Our results reveal that NALCN, in part, generates the leak current in MSMCs and provide the basis for future research assessing NALCN as a potential molecular target for modulating uterine excitability. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Timothy J. Mead
2018-04-01
Full Text Available Summary: Focal adhesions anchor cells to extracellular matrix (ECM and direct assembly of a pre-stressed actin cytoskeleton. They act as a cellular sensor and regulator, linking ECM to the nucleus. Here, we identify proteolytic turnover of the anti-adhesive proteoglycan versican as a requirement for maintenance of smooth muscle cell (SMC focal adhesions. Using conditional deletion in mice, we show that ADAMTS9, a secreted metalloprotease, is required for myometrial activation during late gestation and for parturition. Through knockdown of ADAMTS9 in uterine SMC, and manipulation of pericellular versican via knockdown or proteolysis, we demonstrate that regulated pericellular matrix dynamics is essential for focal adhesion maintenance. By influencing focal adhesion formation, pericellular versican acts upstream of cytoskeletal assembly and SMC differentiation. Thus, pericellular versican proteolysis by ADAMTS9 balances pro- and anti-adhesive forces to maintain an SMC phenotype, providing a concrete example of the dynamic reciprocity of cells and their ECM. : Mead et al. identify a proteolytic mechanism that actively maintains a pericellular microenvironment conducive to uterine smooth muscle activation prior to parturition. They show that pericellular matrix proteolysis by the secreted metalloprotease ADAMTS9 is crucial for maintenance of focal adhesions in uterine smooth muscle cells, and its absence impairs parturition. Keywords: metalloprotease, extracellular matrix, smooth muscle, proteoglycan, myometrium, parturition, uterus, focal adhesion, proteolysis, interference reflection microscopy
Tan, Xiahui; Khalil, Najwa; Tesarik, Candice; Vanapalli, Karunasri; Yaputra, Viki; Alkhouri, Hatem; Oliver, Brian G G; Armour, Carol L; Hughes, J Margaret
2012-04-01
In asthma, airway smooth muscle (ASM) chemokine secretion can induce mast cell recruitment into the airways. The functions of the mast cell chemoattractant CXCL10, and other chemokines, are regulated by binding to heparan sulphates such as syndecan-4. This study is the first demonstration that airway smooth muscle cells (ASMC) from people with and without asthma express and shed syndecan-4 under basal conditions. Syndecan-4 shedding was enhanced by stimulation for 24 h with the Th1 cytokines interleukin-1β (IL-1β) or tumor necrosis factor-α (TNF-α), but not interferon-γ (IFNγ), nor the Th2 cytokines IL-4 and IL-13. ASMC stimulation with IL-1β, TNF-α, and IFNγ (cytomix) induced the highest level of syndecan-4 shedding. Nonasthmatic and asthmatic ASM cell-associated syndecan-4 protein expression was also increased by TNF-α or cytomix at 4-8 h, with the highest levels detected in cytomix-stimulated asthmatic cells. Cell-associated syndecan-4 levels were decreased by 24 h, whereas shedding remained elevated at 24 h, consistent with newly synthesized syndecan-4 being shed. Inhibition of ASMC matrix metalloproteinase-2 did not prevent syndecan-4 shedding, whereas inhibition of ERK MAPK activation reduced shedding from cytomix-stimulated ASMC. Although ERK inhibition had no effect on syndecan-4 mRNA levels stimulated by cytomix, it did cause an increase in cell-associated syndecan-4 levels, consistent with the shedding being inhibited. In conclusion, ASMC produce and shed syndecan-4 and although this is increased by the Th1 cytokines, the MAPK ERK only regulates shedding. ASMC syndecan-4 production during Th1 inflammatory conditions may regulate chemokine activity and mast cell recruitment to the ASM in asthma.
Establishment and cryopreservation of a giant panda skeletal muscle-derived cell line.
Yu, Fang-Jian; Zeng, Chang-Jun; Zhang, Yan; Wang, Cheng-Dong; Xiong, Tie-Yi; Fang, Sheng-Guo; Zhang, He-Min
2015-06-01
The giant panda Ailuropoda melanoleuca is an endangered species and is a symbol for wildlife conservation. Although efforts have been made to protect this rare and endangered species through breeding and conservative biology, the long-term preservation of giant panda genome resources (gametes, tissues, organs, genomic libraries, etc.) is still a practical option. In this study, the giant panda skeletal muscle-derived cell line was successfully established via primary explants culture and cryopreservation techniques. The population doubling time of giant panda skeletal cells was approximately 33.8 h, and this population maintained a high cell viability before and after cryopreservation (95.6% and 90.7%, respectively). The two skeletal muscle-specific genes SMYD1 and MYF6 were expressed and detected by RT-PCR in the giant panda skeletal muscle-derived cell line. Karyotyping analysis revealed that the frequencies of giant panda skeletal muscle cells showing a chromosome number of 2n=42 ranged from 90.6∼94.2%. Thus, the giant panda skeletal muscle-derived cell line provides a vital resource and material platform for further studies and is likely to be useful for the protection of this rare and endangered species.
Muscle satellite cells are activated after exercise to exhaustion in Thoroughbred horses.
Kawai, M; Aida, H; Hiraga, A; Miyata, H
2013-07-01
Although satellite cells are well known as muscle stem cells capable of adding myonuclei during muscle repair and hypertrophy, the response of satellite cells in horse muscles to a run to exhaustion is still unknown. To investigate the time course of satellite cell activation in Thoroughbred horse muscle after running to exhaustion. We hypothesised that this type of intense exercise would induce satellite cell activation in skeletal muscle similar to a resistance exercise. Nine de-trained Thoroughbred horses (6 geldings and 3 mares) aged 3-6 years were studied. Biopsy samples were taken from the gluteus medius muscle of the horses before and 1 min, 3 h, 1 day, 3 days, 1 week and 2 weeks after a treadmill run to exhaustion. The numbers of satellite cells for each fibre type were determined by using immunofluorescence staining. Total RNA was extracted from these samples, and the expressions of interleukin (IL)-6, paired box transcriptional factor (Pax) 7, myogenic differentiation 1 (MyoD), myogenin, proliferating cell nuclear antigen (PCNA), insulin-like growth factor (IGF)-I and hepatocyte growth factor (HGF) mRNA were analysed using real-time reverse transcription-PCR. The numbers of satellite cells were significantly increased in type I and IIa fibres at 1 week and in type IIa/x fibre at 2 weeks post exercise. The expression of IL-6 mRNA increased significantly by 3 h post exercise. The expression of PCNA mRNA also increased by 1 day after running, indicating that running can initiate satellite cell proliferation. The expression of Pax7, MyoD, myogenin, IGF-I and HGF mRNA peaked at 1 week post exercise. Satellite cell activation and proliferation could be enhanced after a run to exhaustion without detectable injury as assessed by the histochemical analysis. Understanding the response of satellite cell activation to running exercise provides fundamental information about the skeletal muscle adaptation in Thoroughbred horses. © 2012 EVJ Ltd.
Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors
Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.
2013-11-01
This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.
In-situ Monitoring of Internal Local Temperature and Voltage of Proton Exchange Membrane Fuel Cells
Directory of Open Access Journals (Sweden)
Chi-Yuan Lee
2010-06-01
Full Text Available The distribution of temperature and voltage of a fuel cell are key factors that influence performance. Conventional sensors are normally large, and are also useful only for making external measurements of fuel cells. Centimeter-scale sensors for making invasive measurements are frequently unable to accurately measure the interior changes of a fuel cell. This work focuses mainly on fabricating flexible multi-functional microsensors (for temperature and voltage to measure variations in the local temperature and voltage of proton exchange membrane fuel cells (PEMFC that are based on micro-electro-mechanical systems (MEMS. The power density at 0.5 V without a sensor is 450 mW/cm2, and that with a sensor is 426 mW/cm2. Since the reaction area of a fuel cell with a sensor is approximately 12% smaller than that without a sensor, but the performance of the former is only 5% worse.
International Nuclear Information System (INIS)
Nath, Madhumita; Roca i Cabarrocas, P.; Johnson, E.V.; Abramov, A.; Chatterjee, P.
2008-01-01
We have used a detailed electrical-optical computer model (ASDMP) in conjunction with the experimental characterization of microcrystalline silicon thin-film solar cells of different degrees of crystallinity (but having identical P- and N-layers) to understand the observed decrease of the open-circuit voltage with increasing crystalline fraction. In order to model all aspects of the experimental current density-voltage and quantum efficiency characteristics of cells having low (∼ 75%) and high (over 90%) crystalline fraction, we had to assume both a higher mobility gap defect density and a lower band gap for the more crystallized material. The former fact is widely known to bring down the open-circuit voltage. Our calculations also reveal that the proximity of the quasi-Fermi levels to the energy bands in the cell based on highly crystallized (and assumed to have a lower band gap) microcrystalline silicon results in higher free and trapped carrier densities in this device. The trapped hole population is particularly high at and close to the P/I interface on account of the higher inherent defect density in this region and the fact that the hole quasi-Fermi level is close to the valence band edge here. This fact results in a strong interface field, a collapse of the field in the volume, and hence a lower open-circuit voltage. Thus a combination of higher mobility gap defects and a lower band gap is probably the reason for the lower open-circuit voltage in cells based on highly crystallized microcrystalline silicon
Bias-dependent high saturation solar LBIC scanning of solar cells
Energy Technology Data Exchange (ETDEWEB)
Vorster, F.J.; van Dyk, E.E. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa)
2007-06-15
A light beam-induced current measurement system that uses concentrated solar radiation as a beam probe to map spatially distributed defects on a solar cell has been developed and tested [F.J. Vorster, E.E. van Dyk, Rev. Sci. Instrum., submitted for review]. The induced current response from a flat plate EFG Si solar cell was mapped as a function of surface position and cell bias by using a solar light beam induced current (S-LBIC) mapping system while at the same time dynamically biasing the whole cell with an external voltage. This paper examines the issues relating to transient capacitive effects as well as the electrical behaviour of typical solar cell defect mechanisms under spot illumination. By examining the bias dependence of the S-LBIC maps, various defect mechanisms of photovoltaic (PV) cells under concentrated solar irradiance may be identified. The techniques employed to interpret the spatially distributed IV curves as well as initial results are discussed. (author)
Regulation of collagen biosynthesis in cultured bovine aortic smooth muscle cells
International Nuclear Information System (INIS)
Stepp, M.A.
1986-01-01
Aortic smooth muscles cells have been implicated in the etiology of lesions which occur in atherosclerosis and hypertension. Both diseases involve proliferation of smooth muscle cells and accumulation of excessive amounts of extracellular matrix proteins, including collagen type I and type III produced by the smooth muscle cells. To better understand the sites of regulation of collagen biosynthesis and to correlate these with the growth rate of the cells, cultured bovine aortic smooth muscle cells were studied as a function of the number of days (3 to 14) in second passage. Cells grew rapidly up to day 6 when confluence was reached. The total incorporation of [ 3 H]-proline into proteins was highest at day 3 and decreased to a constant level after the cultures reached confluence. In contrast, collagen protein production was lowest before confluence and continued to increase over the entire time course of the experiments. cDNA clones for the α1 and α2 chains of type I and the α1 chain of type III collagen were used to quantitate the steady state level of collagen mRNAs. RNA was tested in a cell-free translation system. Changes in the translational activity of collagen mRNAs parallelled the observed increases in collagen protein production. Thus, at later time points, collagen mRNAs are more active in directing synthesis of preprocollagens, even though less collagen mRNA is present. The conclusion is that the site of regulation of the expression of collagen genes is a function of the growth rate of cultured smooth muscle cells
Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H
2012-10-01
A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.
Muscle Progenitor Cell Regenerative Capacity in the Torn Rotator Cuff
Meyer, Gretchen A.; Farris, Ashley L.; Sato, Eugene; Gibbons, Michael; Lane, John G.; Ward, Samuel R.; Engler, Adam J.
2014-01-01
Chronic rotator cuff (RC) tears affect a large portion of the population and result in substantial upper extremity impairment, shoulder weakness, pain and limited range of motion. Regardless of surgical or conservative treatment, persistent atrophic muscle changes limit functional restoration and may contribute to surgical failure. We hypothesized that deficits in the skeletal muscle progenitor (SMP) cell pool could contribute to poor muscle recovery following tendon repair. Biopsies were obtained from patients undergoing arthroscopic RC surgery. The SMP population was quantified, isolated and assayed in culture for its ability to proliferate and fuse in-vitro and in-vivo. The SMP population was larger in muscles from cuffs with partial tears compared with no tears or full thickness tears. However, SMPs from muscles in the partial tear group also exhibited reduced proliferative ability. Cells from all cuff states were able to fuse robustly in culture and engraft when injected into injured mouse muscle, suggesting that when given the correct signals, SMPs are capable of contributing to muscle hypertrophy and regeneration regardless of tear severity. The fact that this does not appear to happen in-vivo helps focus future therapeutic targets for promoting muscle recovery following rotator cuff repairs and may help improve clinical outcomes. PMID:25410765
Garg, Koyal; Boppart, Marni D
2016-11-01
Skeletal muscle is endowed with a remarkable capacity for regeneration, primarily due to the reserve pool of muscle resident satellite cells. The satellite cell is the physiologically quiescent muscle stem cell that resides beneath the basal lamina and adjacent to the sarcolemma. The anatomic location of satellite cells is in close proximity to vasculature where they interact with other muscle resident stem/stromal cells (e.g., mesenchymal stem cells and pericytes) through paracrine mechanisms. This mini-review describes the components of the muscle stem cell niche, as well as the influence of exercise and aging on the muscle stem cell niche. Although exercise promotes ECM reorganization and stem cell accumulation, aging is associated with dense ECM deposition and loss of stem cell function resulting in reduced regenerative capacity and strength. An improved understanding of the niche elements will be valuable to inform the development of therapeutic interventions aimed at improving skeletal muscle regeneration and adaptation over the life span. Copyright © 2016 the American Physiological Society.
A novel paradigm links mitochondrial dysfunction with muscle stem cell impairment in sepsis.
Chatre, Laurent; Verdonk, Franck; Rocheteau, Pierre; Crochemore, Clément; Chrétien, Fabrice; Ricchetti, Miria
2017-10-01
Sepsis is an acute systemic inflammatory response of the body to microbial infection and a life threatening condition associated with multiple organ failure. Survivors may display long-term disability with muscle weakness that remains poorly understood. Recent data suggest that long-term myopathy in sepsis survivors is due to failure of skeletal muscle stem cells (satellite cells) to regenerate the muscle. Satellite cells impairment in the acute phase of sepsis is linked to unusual mitochondrial dysfunctions, characterized by a dramatic reduction of the mitochondrial mass and hyperactivity of residual organelles. Survivors maintain the impairment of satellite cells, including alterations of the mitochondrial DNA (mtDNA), in the long-term. This condition can be rescued by treatment with mesenchymal stem cells (MSCs) that restore mtDNA alterations and mitochondrial function in satellite cells, and in fine their regenerative potential. Injection of MSCs in turn increases the force of isolated muscle fibers and of the whole animal, and improves the survival rate. These effects occur in the context of reduced inflammation markers that also raised during sepsis. Targeting muscle stem cells mitochondria, in a context of reduced inflammation, may represent a valuable strategy to reduce morbidity and long-term impairment of the muscle upon sepsis. Copyright © 2017 Elsevier B.V. All rights reserved.
Akt1/PKB upregulation leads to vascular smooth muscle cell hypertrophy and polyploidization
Hixon, Mary L.; Muro-Cacho, Carlos; Wagner, Mark W.; Obejero-Paz, Carlos; Millie, Elise; Fujio, Yasushi; Kureishi, Yasuko; Hassold, Terry; Walsh, Kenneth; Gualberto, Antonio
2000-01-01
Vascular smooth muscle cells (VSMCs) at capacitance arteries of hypertensive individuals and animals undergo marked age- and blood pressure–dependent polyploidization and hypertrophy. We show here that VSMCs at capacitance arteries of rat models of hypertension display high levels of Akt1/PKB protein and activity. Gene transfer of Akt1 to VSMCs isolated from a normotensive rat strain was sufficient to abrogate the activity of the mitotic spindle cell–cycle checkpoint, promoting polyploidizati...