WorldWideScience

Sample records for multiplexed single-base-extension assay

  1. A 50 SNP-multiplex mass spectrometry assay for human identification

    DEFF Research Database (Denmark)

    Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus

    2008-01-01

    We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...

  2. Development and assessment of multiplex high resolution melting assay as a tool for rapid single-tube identification of five Brucella species.

    Science.gov (United States)

    Gopaul, Krishna K; Sells, Jessica; Lee, Robin; Beckstrom-Sternberg, Stephen M; Foster, Jeffrey T; Whatmore, Adrian M

    2014-12-11

    The zoonosis brucellosis causes economically significant reproductive problems in livestock and potentially debilitating disease of humans. Although the causative agent, organisms from the genus Brucella, can be differentiated into a number of species based on phenotypic characteristics, there are also significant differences in genotype that are concordant with individual species. This paper describes the development of a five target multiplex assay to identify five terrestrial Brucella species using real-time polymerase chain reaction (PCR) and subsequent high resolution melt curve analysis. This technology offers a robust and cost effective alternative to previously described hydrolysis-probe Single Nucleotide Polymorphism (SNP)-based species defining assays. Through the use of Brucella whole genome sequencing five species defining SNPs were identified. Individual HRM assays were developed to these target these changes and, following optimisation of primer concentrations, it was possible to multiplex all five assays in a single tube. In a validation exercise using a panel of 135 Brucella strains of terrestrial and marine origin, it was possible to distinguish the five target species from the other species within this panel. The HRM multiplex offers a number of diagnostic advantages over previously described SNP-based typing approaches. Further, and uniquely for HRM, the successful multiplexing of five assays in a single tube allowing differentiation of five Brucella species in the diagnostic laboratory in a cost-effective and timely manner is described. However there are possible limitations to using this platform on DNA extractions direct from clinical material.

  3. Detection of four important Eimeria species by multiplex PCR in a single assay.

    Science.gov (United States)

    You, Myung-Jo

    2014-06-01

    The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  5. Multiplexing a high-throughput liability assay to leverage efficiencies.

    Science.gov (United States)

    Herbst, John; Anthony, Monique; Stewart, Jeremy; Connors, David; Chen, Taosheng; Banks, Martyn; Petrillo, Edward W; Agler, Michele

    2009-06-01

    In order to identify potential cytochrome P-450 3A4 (drug-metabolizing enzyme) inducers at an early stage of the drug discovery process, a cell-based transactivation high-throughput luciferase reporter assay for the human pregnane X receptor (PXR) in HepG2 cells has been implemented and multiplexed with a viability end point for data interpretation, as part of a Lead Profiling portfolio of assays. As a routine part of Lead Profiling operations, assays are periodically evaluated for utility as well as for potential improvements in technology or process. We used a recent evaluation of our PXR-transactivation assay as a model for the application of Lean Thinking-based process analysis to lab-bench assay optimization and automation. This resulted in the development of a 384-well multiplexed homogeneous assay simultaneously detecting PXR transactivation and HepG2 cell cytotoxicity. In order to multiplex fluorescent and luminescent read-outs, modifications to each assay were necessary, which included optimization of multiple assay parameters such as cell density, plate type, and reagent concentrations. Subsequently, a set of compounds including known cytotoxic compounds and PXR inducers were used to validate the multiplexed assay. Results from the multiplexed assay correlate well with those from the singleplexed assay formats measuring PXR transactivation and viability separately. Implementation of the multiplexed assay for routine compound profiling provides improved data quality, sample conservation, cost savings, and resource efficiencies.

  6. Multiplex real-time PCR assay for Legionella species.

    Science.gov (United States)

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  8. Opportunities and Challenges of Multiplex Assays: A Machine Learning Perspective.

    Science.gov (United States)

    Chen, Junfang; Schwarz, Emanuel

    2017-01-01

    Multiplex assays that allow the simultaneous measurement of multiple analytes in small sample quantities have developed into a widely used technology. Their implementation spans across multiple assay systems and can provide readouts of similar quality as the respective single-plex measures, albeit at far higher throughput. Multiplex assay systems are therefore an important element for biomarker discovery and development strategies but analysis of the derived data can face substantial challenges that may limit the possibility of identifying meaningful biological markers. This chapter gives an overview of opportunities and challenges of multiplexed biomarker analysis, in particular from the perspective of machine learning aimed at identification of predictive biological signatures.

  9. A multiplex branched DNA assay for parallel quantitative gene expression profiling.

    Science.gov (United States)

    Flagella, Michael; Bui, Son; Zheng, Zhi; Nguyen, Cung Tuong; Zhang, Aiguo; Pastor, Larry; Ma, Yunqing; Yang, Wen; Crawford, Kimberly L; McMaster, Gary K; Witney, Frank; Luo, Yuling

    2006-05-01

    We describe a novel method to quantitatively measure messenger RNA (mRNA) expression of multiple genes directly from crude cell lysates and tissue homogenates without the need for RNA purification or target amplification. The multiplex branched DNA (bDNA) assay adapts the bDNA technology to the Luminex fluorescent bead-based platform through the use of cooperative hybridization, which ensures an exceptionally high degree of assay specificity. Using in vitro transcribed RNA as reference standards, we demonstrated that the assay is highly specific, with cross-reactivity less than 0.2%. We also determined that the assay detection sensitivity is 25,000 RNA transcripts with intra- and interplate coefficients of variance of less than 10% and less than 15%, respectively. Using three 10-gene panels designed to measure proinflammatory and apoptosis responses, we demonstrated sensitive and specific multiplex gene expression profiling directly from cell lysates. The gene expression change data demonstrate a high correlation coefficient (R(2)=0.94) compared with measurements obtained using the single-plex bDNA assay. Thus, the multiplex bDNA assay provides a powerful means to quantify the gene expression profile of a defined set of target genes in large sample populations.

  10. Multiplexed detection of DNA sequences using a competitive displacement assay in a microfluidic SERRS-based device.

    Science.gov (United States)

    Yazdi, Soroush H; Giles, Kristen L; White, Ian M

    2013-11-05

    We demonstrate sensitive and multiplexed detection of DNA sequences through a surface enhanced resonance Raman spectroscopy (SERRS)-based competitive displacement assay in an integrated microsystem. The use of the competitive displacement scheme, in which the target DNA sequence displaces a Raman-labeled reporter sequence that has lower affinity for the immobilized probe, enables detection of unlabeled target DNA sequences with a simple single-step procedure. In our implementation, the displacement reaction occurs in a microporous packed column of silica beads prefunctionalized with probe-reporter pairs. The use of a functionalized packed-bead column in a microfluidic channel provides two major advantages: (i) immobilization surface chemistry can be performed as a batch process instead of on a chip-by-chip basis, and (ii) the microporous network eliminates the diffusion limitations of a typical biological assay, which increases the sensitivity. Packed silica beads are also leveraged to improve the SERRS detection of the Raman-labeled reporter. Following displacement, the reporter adsorbs onto aggregated silver nanoparticles in a microfluidic mixer; the nanoparticle-reporter conjugates are then trapped and concentrated in the silica bead matrix, which leads to a significant increase in plasmonic nanoparticles and adsorbed Raman reporters within the detection volume as compared to an open microfluidic channel. The experimental results reported here demonstrate detection down to 100 pM of the target DNA sequence, and the experiments are shown to be specific, repeatable, and quantitative. Furthermore, we illustrate the advantage of using SERRS by demonstrating multiplexed detection. The sensitivity of the assay, combined with the advantages of multiplexed detection and single-step operation with unlabeled target sequences makes this method attractive for practical applications. Importantly, while we illustrate DNA sequence detection, the SERRS-based competitive

  11. Multiplex bio-assay with inductively coupled plasma mass spectrometry: Towards a massively multivariate single-cell technology

    International Nuclear Information System (INIS)

    Tanner, Scott D.; Ornatsky, Olga; Bandura, Dmitry R.; Baranov, Vladimir I.

    2007-01-01

    Recent progress in the development of massively multiplexed bioanalytical assays using element tags with inductively coupled plasma mass spectrometry detection is reviewed. Feasibility results using commercially available secondary immunolabeling reagents for leukemic cell lines are presented. Multiplex analysis of higher order is shown with first generation tag reagents based on functionalized carriers that bind lanthanide ions. DNA quantification using metallointercalation allows for cell enumeration or mitotic state differentiation. In situ hybridization permits the determination of cellular RNA. The results provide a feasibility basis for the development of a multivariate assay tool for individual cell analysis based on inductively coupled plasma mass spectrometry in a cytometer configuration

  12. Multiplex bio-assay with inductively coupled plasma mass spectrometry: Towards a massively multivariate single-cell technology

    Energy Technology Data Exchange (ETDEWEB)

    Tanner, Scott D. [Institute of Biomaterials and Biomedical Engineering, University of Toronto, Room 407, 164 College Street, Toronto, Ontario, M5S 3G9 (Canada)], E-mail: sd.tanner@utoronto.ca; Ornatsky, Olga; Bandura, Dmitry R.; Baranov, Vladimir I. [Institute of Biomaterials and Biomedical Engineering, University of Toronto, Room 407, 164 College Street, Toronto, Ontario, M5S 3G9 (Canada)

    2007-03-15

    Recent progress in the development of massively multiplexed bioanalytical assays using element tags with inductively coupled plasma mass spectrometry detection is reviewed. Feasibility results using commercially available secondary immunolabeling reagents for leukemic cell lines are presented. Multiplex analysis of higher order is shown with first generation tag reagents based on functionalized carriers that bind lanthanide ions. DNA quantification using metallointercalation allows for cell enumeration or mitotic state differentiation. In situ hybridization permits the determination of cellular RNA. The results provide a feasibility basis for the development of a multivariate assay tool for individual cell analysis based on inductively coupled plasma mass spectrometry in a cytometer configuration.

  13. Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

    Energy Technology Data Exchange (ETDEWEB)

    Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

    2007-06-26

    A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

  14. A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection

    Directory of Open Access Journals (Sweden)

    Van Neste Leander

    2012-06-01

    Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.

  15. Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

    Directory of Open Access Journals (Sweden)

    Qing Fan

    Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

  16. Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

    Science.gov (United States)

    Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

    2013-01-01

    Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

  17. On-chip multiplexed solid-phase nucleic acid hybridization assay using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

    Science.gov (United States)

    Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J

    2013-07-25

    A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

    OpenAIRE

    Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

    2003-01-01

    A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

  19. Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis.

    Science.gov (United States)

    Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich

    1996-06-01

    Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments

  20. Evaluation of Multiplexed Foot-and-Mouth Disease Nonstructural Protein Antibody Assay Against Standardized Bovine Serum Panel

    Energy Technology Data Exchange (ETDEWEB)

    Perkins, J; Parida, S; Clavijo, A

    2007-05-14

    Liquid array technology has previously been used to show proof-of-principle of a multiplexed non structural protein serological assay to differentiate foot-and-mouth infected and vaccinated animals. The current multiplexed assay consists of synthetically produced peptide signatures 3A, 3B and 3D and recombinant protein signature 3ABC in combination with four controls. To determine diagnostic specificity of each signature in the multiplex, the assay was evaluated against a naive population (n = 104) and a vaccinated population (n = 94). Subsequently, the multiplexed assay was assessed using a panel of bovine sera generated by the World Reference Laboratory for foot-and-mouth disease in Pirbright, UK. This sera panel has been used to assess the performance of other singleplex ELISA-based non-structural protein antibody assays. The 3ABC signature in the multiplexed assay showed comparative performance to a commercially available non-structural protein 3ABC ELISA (Cedi test{reg_sign}) and additional information pertaining to the relative diagnostic sensitivity of each signature in the multiplex is acquired in one experiment. The encouraging results of the evaluation of the multiplexed assay against a panel of diagnostically relevant samples promotes further assay development and optimization to generate an assay for routine use in foot-and-mouth disease surveillance.

  1. Quantitative and multiplexed detection for blood typing based on quantum dot-magnetic bead assay.

    Science.gov (United States)

    Xu, Ting; Zhang, Qiang; Fan, Ya-Han; Li, Ru-Qing; Lu, Hua; Zhao, Shu-Ming; Jiang, Tian-Lun

    2017-01-01

    Accurate and reliable blood grouping is essential for safe blood transfusion. However, conventional methods are qualitative and use only single-antigen detection. We overcame these limitations by developing a simple, quantitative, and multiplexed detection method for blood grouping using quantum dots (QDs) and magnetic beads. In the QD fluorescence assay (QFA), blood group A and B antigens were quantified using QD labeling and magnetic beads, and the blood groups were identified according to the R value (the value was calculated with the fluorescence intensity from dual QD labeling) of A and B antigens. The optimized performance of QFA was established by blood typing 791 clinical samples. Quantitative and multiplexed detection for blood group antigens can be completed within 35 min with more than 10 5 red blood cells. When conditions are optimized, the assay performance is satisfactory for weak samples. The coefficients of variation between and within days were less than 10% and the reproducibility was good. The ABO blood groups of 791 clinical samples were identified by QFA, and the accuracy obtained was 100% compared with the tube test. Receiver-operating characteristic curves revealed that the QFA has high sensitivity and specificity toward clinical samples, and the cutoff points of the R value of A and B antigens were 1.483 and 1.576, respectively. In this study, we reported a novel quantitative and multiplexed method for the identification of ABO blood groups and presented an effective alternative for quantitative blood typing. This method can be used as an effective tool to improve blood typing and further guarantee clinical transfusion safety.

  2. Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples

    Science.gov (United States)

    Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris

    2002-01-01

    A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951

  3. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    Science.gov (United States)

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  4. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Science.gov (United States)

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  5. Protein Detection Using the Multiplexed Proximity Extension Assay (PEA) from Plasma and Vaginal Fluid Applied to the Indicating FTA Elute Micro Card™

    Science.gov (United States)

    Berggrund, Malin; Ekman, Daniel; Gustavsson, Inger; Sundfeldt, Karin; Olovsson, Matts; Enroth, Stefan; Gyllensten, Ulf

    2016-01-01

    The indicating FTA elute micro card™ has been developed to collect and stabilize the nucleic acid in biological samples and is widely used in human and veterinary medicine and other disciplines. This card is not recommended for protein analyses, since surface treatment may denature proteins. We studied the ability to analyse proteins in human plasma and vaginal fluid as applied to the indicating FTA elute micro card™ using the sensitive proximity extension assay (PEA). Among 92 proteins in the Proseek Multiplex Oncology Iv2 panel, 87 were above the limit of detection (LOD) in liquid plasma and 56 among 92 above LOD in plasma applied to FTA cards. Washing and protein elution protocols were compared to identify an optimal method. Liquid-based cytology samples showed a lower number of proteins above LOD than FTA cards with vaginal fluid samples applied. Our results demonstrate that samples applied to the indicating FTA elute micro card™ are amendable to protein analyses, given that a sensitive protein detection assay is used. The results imply that biological samples applied to FTA cards can be used for DNA, RNA and protein detection. PMID:28936257

  6. Protein Detection Using the Multiplexed Proximity Extension Assay (PEA from Plasma and Vaginal Fluid Applied to the Indicating FTA Elute Micro Card™

    Directory of Open Access Journals (Sweden)

    Malin Berggrund

    2016-01-01

    Full Text Available The indicating FTA elute micro card™ has been developed to collect and stabilize the nucleic acid in biological samples and is widely used in human and veterinary medicine and other disciplines. This card is not recommended for protein analyses, since surface treatment may denature proteins. We studied the ability to analyse proteins in human plasma and vaginal fluid as applied to the indicating FTA elute micro card™ using the sensitive proximity extension assay (PEA. Among 92 proteins in the Proseek Multiplex Oncology Iv2 panel, 87 were above the limit of detection (LOD in liquid plasma and 56 among 92 above LOD in plasma applied to FTA cards. Washing and protein elution protocols were compared to identify an optimal method. Liquid-based cytology samples showed a lower number of proteins above LOD than FTA cards with vaginal fluid samples applied. Our results demonstrate that samples applied to the indicating FTA elute micro card™ are amendable to protein analyses, given that a sensitive protein detection assay is used. The results imply that biological samples applied to FTA cards can be used for DNA, RNA and protein detection.

  7. Protein Detection Using the Multiplexed Proximity Extension Assay (PEA) from Plasma and Vaginal Fluid Applied to the Indicating FTA Elute Micro Card™.

    Science.gov (United States)

    Berggrund, Malin; Ekman, Daniel; Gustavsson, Inger; Sundfeldt, Karin; Olovsson, Matts; Enroth, Stefan; Gyllensten, Ulf

    2016-01-01

    The indicating FTA elute micro card™ has been developed to collect and stabilize the nucleic acid in biological samples and is widely used in human and veterinary medicine and other disciplines. This card is not recommended for protein analyses, since surface treatment may denature proteins. We studied the ability to analyse proteins in human plasma and vaginal fluid as applied to the indicating FTA elute micro card™ using the sensitive proximity extension assay (PEA). Among 92 proteins in the Proseek Multiplex Oncology Iv2 panel, 87 were above the limit of detection (LOD) in liquid plasma and 56 among 92 above LOD in plasma applied to FTA cards. Washing and protein elution protocols were compared to identify an optimal method. Liquid-based cytology samples showed a lower number of proteins above LOD than FTA cards with vaginal fluid samples applied. Our results demonstrate that samples applied to the indicating FTA elute micro card™ are amendable to protein analyses, given that a sensitive protein detection assay is used. The results imply that biological samples applied to FTA cards can be used for DNA, RNA and protein detection.

  8. A multiplex ligation detection assay for the characterization of Salmonella enterica strains

    NARCIS (Netherlands)

    Aarts, H.J.M.; Vos, P.; Larsson, J.T.; Hoek, van A.H.A.M.; Huehn, S.; Weijers, T.; Gronlund, H.A.; Malorny, B.

    2011-01-01

    A proof of principle of a multi-target assay for genotyping Salmonella has been developed targeting 62 genomic marker sequences of Salmonella related to pathogenicity. The assay is based on multiplex ligation detection reaction (LDR) followed by customized ArrayTube (R) microarray detection. The

  9. Multiplexed homogeneous assays of proteolytic activity using a smartphone and quantum dots.

    Science.gov (United States)

    Petryayeva, Eleonora; Algar, W Russ

    2014-03-18

    Semiconductor quantum dot (QD) bioconjugates, with their unique and highly advantageous physicochemical and optical properties, have been extensively utilized as probes for bioanalysis and continue to generate widespread interest for these applications. An important consideration for expanding the utility of QDs and making their use routine is to make assays with QDs more accessible for laboratories that do not specialize in nanomaterials. Here, we show that digital color imaging of QD photoluminescence (PL) with a smartphone camera is a viable, easily accessible readout platform for quantitative, multiplexed, and real-time bioanalyses. Red-, green-, and blue-emitting CdSeS/ZnS QDs were conjugated with peptides that were labeled with a deep-red fluorescent dye, Alexa Fluor 647, and the dark quenchers, QSY9 and QSY35, respectively, to generate Förster resonance energy transfer (FRET) pairs sensitive to proteolytic activity. Changes in QD PL caused by the activity of picomolar to nanomolar concentrations of protease were detected as changes in the red-green-blue (RGB) channel intensities in digital color images. Importantly, measurements of replicate samples made with smartphone imaging and a sophisticated fluorescence plate reader yielded the same quantitative results, including initial proteolytic rates and specificity constants. Homogeneous two-plex and three-plex assays for the activity of trypsin, chymotrypsin, and enterokinase were demonstrated with RGB imaging. Given the ubiquity of smartphones, this work largely removes any instrumental impediments to the adoption of QDs as routine tools for bioanalysis in research laboratories and is a critical step toward the use of QDs for point-of-care diagnostics. This work also adds to the growing utility of smartphones in analytical methods by enabling multiplexed fluorimetric assays within a single sample volume and across multiple samples in parallel.

  10. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    Science.gov (United States)

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  11. Microarray multiplex assay for the simultaneous detection and discrimination of hepatitis B, hepatitis C, and human immunodeficiency type-1 viruses in human blood samples

    International Nuclear Information System (INIS)

    Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.; Selvapandiyan, Angamuthu; Hewlett, Indira; Duncan, Robert; Puri, Raj K.; Nakhasi, Hira L.; Kaplan, Gerardo G.

    2007-01-01

    Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminated the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients

  12. Development and validation of the AmpFℓSTR® Identifiler® Direct PCR Amplification Kit: a multiplex assay for the direct amplification of single-source samples.

    Science.gov (United States)

    Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K

    2011-07-01

    The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. © 2011 American Academy of Forensic Sciences.

  13. A multiplex ligation detection assay for the characterization of Salmonella enterica strains

    DEFF Research Database (Denmark)

    Aarts, Henk J.M.; Vos, Pieter; Larsson, Jonas T.

    2011-01-01

    A proof of principle of a multi-target assay for genotyping Salmonella has been developed targeting 62 genomic marker sequences of Salmonella related to pathogenicity. The assay is based on multiplex ligation detection reaction (LDR) followed by customized ArrayTube® microarray detection. The fea...... assessors that support bio-traceability models....

  14. High-throughput screening of cellulase F mutants from multiplexed plasmid sets using an automated plate assay on a functional proteomic robotic workcell

    Directory of Open Access Journals (Sweden)

    Qureshi Nasib

    2006-05-01

    Full Text Available Abstract Background The field of plasmid-based functional proteomics requires the rapid assay of proteins expressed from plasmid libraries. Automation is essential since large sets of mutant open reading frames are being cloned for evaluation. To date no integrated automated platform is available to carry out the entire process including production of plasmid libraries, expression of cloned genes, and functional testing of expressed proteins. Results We used a functional proteomic assay in a multiplexed setting on an integrated plasmid-based robotic workcell for high-throughput screening of mutants of cellulase F, an endoglucanase from the anaerobic fungus Orpinomyces PC-2. This allowed us to identify plasmids containing optimized clones expressing mutants with improved activity at lower pH. A plasmid library of mutagenized clones of the celF gene with targeted variations in the last four codons was constructed by site-directed PCR mutagenesis and transformed into Escherichia coli. A robotic picker integrated into the workcell was used to inoculate medium in a 96-well deep well plate, combining the transformants into a multiplexed set in each well, and the plate was incubated on the workcell. Plasmids were prepared from the multiplexed culture on the liquid handler component of the workcell and used for in vitro transcription/translation. The multiplexed expressed recombinant proteins were screened for improved activity and stability in an azo-carboxymethylcellulose plate assay. The multiplexed wells containing mutants with improved activity were identified and linked back to the corresponding multiplexed cultures stored in glycerol. Spread plates were prepared from the glycerol stocks and the workcell was used to pick single colonies from the spread plates, prepare plasmid, produce recombinant protein, and assay for activity. The screening assay and subsequent deconvolution of the multiplexed wells resulted in identification of improved Cel

  15. A Multiplexed Assay That Monitors Effects of Multiple Compound Treatment Times Reveals Candidate Immune-Enhancing Compounds.

    Science.gov (United States)

    Zhao, Ziyan; Henowitz, Liza; Zweifach, Adam

    2018-05-01

    We previously developed a flow cytometry assay that monitored lytic granule exocytosis in cytotoxic T lymphocytes stimulated by contacting beads coated with activating anti-CD3 antibodies. That assay was multiplexed in that responses of cells that did or did not receive the activating stimulus were distinguished via changes in light scatter accompanying binding of cells to beads, allowing us to discriminate compounds that activate responses on their own from compounds that enhance responses in cells that received the activating stimulus, all within a single sample. Here we add a second dimension of multiplexing by developing means to assess in a single sample the effects of treating cells with test compounds for different times. Bar-coding cells before adding them to test wells lets us determine compound treatment time while also monitoring activation status and response amplitude at the point of interrogation. This multiplexed assay is suitable for screening 96-well plates. We used it to screen compounds from the National Cancer Institute, identifying several compounds that enhance anti-LAMP1 responses. Multiple-treatment-time (MTT) screening enabled by bar-coding and read via high-throughput flow cytometry may be a generally useful method for facilitating the discovery of compounds of interest.

  16. Comparison of non-magnetic and magnetic beads in bead-based assays

    NARCIS (Netherlands)

    Hansenová Maňásková, S.; van Belkum, A.; Endtz, H.P.; Bikker, F.J.; Veerman, E.C.I.; van Wamel, W.J.B.

    2016-01-01

    Multiplex bead-based flow cytometry is an attractive way for simultaneous, rapid and cost-effective analysis of multiple analytes in a single sample. Previously, we developed various bead-based assays using non-magnetic beads coated with Staphylococcus aureus and Streptococcus pneumoniae antigens

  17. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  18. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Science.gov (United States)

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  19. Development and application of a quantitative multiplexed small GTPase activity assay using targeted proteomics.

    Science.gov (United States)

    Zhang, Cheng-Cheng; Li, Ru; Jiang, Honghui; Lin, Shujun; Rogalski, Jason C; Liu, Kate; Kast, Juergen

    2015-02-06

    Small GTPases are a family of key signaling molecules that are ubiquitously expressed in various types of cells. Their activity is often analyzed by western blot, which is limited by its multiplexing capability, the quality of isoform-specific antibodies, and the accuracy of quantification. To overcome these issues, a quantitative multiplexed small GTPase activity assay has been developed. Using four different binding domains, this assay allows the binding of up to 12 active small GTPase isoforms simultaneously in a single experiment. To accurately quantify the closely related small GTPase isoforms, a targeted proteomic approach, i.e., selected/multiple reaction monitoring, was developed, and its functionality and reproducibility were validated. This assay was successfully applied to human platelets and revealed time-resolved coactivation of multiple small GTPase isoforms in response to agonists and differential activation of these isoforms in response to inhibitor treatment. This widely applicable approach can be used for signaling pathway studies and inhibitor screening in many cellular systems.

  20. Multiplexed homogeneous proximity ligation assays for high throughput protein biomarker research in serological material

    DEFF Research Database (Denmark)

    Lundberg, Martin; Thorsen, Stine Buch; Assarsson, Erika

    2011-01-01

    A high throughput protein biomarker discovery tool has been developed based on multiplexed proximity ligation assays (PLA) in a homogeneous format in the sense of no washing steps. The platform consists of four 24-plex panels profiling 74 putative biomarkers with sub pM sensitivity each consuming...... sequences are united by DNA ligation upon simultaneous target binding forming a PCR amplicon. Multiplex PLA thereby converts multiple target analytes into real-time PCR amplicons that are individually quantificatied using microfluidic high capacity qPCR in nano liter volumes. The assay shows excellent...

  1. Multiplex pyrosequencing assay using AdvISER-MH-PYRO algorithm: a case for rapid and cost-effective genotyping analysis of prostate cancer risk-associated SNPs.

    Science.gov (United States)

    Ambroise, Jérôme; Butoescu, Valentina; Robert, Annie; Tombal, Bertrand; Gala, Jean-Luc

    2015-06-25

    Single Nucleotide Polymorphisms (SNPs) identified in Genome Wide Association Studies (GWAS) have generally moderate association with related complex diseases. Accordingly, Multilocus Genetic Risk Scores (MGRSs) have been computed in previous studies in order to assess the cumulative association of multiple SNPs. When several SNPs have to be genotyped for each patient, using successive uniplex pyrosequencing reactions increases analytical reagent expenses and Turnaround Time (TAT). While a set of several pyrosequencing primers could theoretically be used to analyze multiplex amplicons, this would generate overlapping primer-specific pyro-signals that are visually uninterpretable. In the current study, two multiplex assays were developed consisting of a quadruplex (n=4) and a quintuplex (n=5) polymerase chain reaction (PCR) each followed by multiplex pyrosequencing analysis. The aim was to reliably but rapidly genotype a set of prostate cancer-related SNPs (n=9). The nucleotide dispensation order was selected using SENATOR software. Multiplex pyro-signals were analyzed using the new AdvISER-MH-PYRO software based on a sparse representation of the signal. Using uniplex assays as gold standard, the concordance between multiplex and uniplex assays was assessed on DNA extracted from patient blood samples (n = 10). All genotypes (n=90) generated with the quadruplex and the quintuplex pyroquencing assays were perfectly (100 %) concordant with uniplex pyrosequencing. Using multiplex genotyping approach for analyzing a set of 90 patients allowed reducing TAT by approximately 75 % (i.e., from 2025 to 470 min) while reducing reagent consumption and cost by approximately 70 % (i.e., from ~229 US$ /patient to ~64 US$ /patient). This combination of quadruplex and quintuplex pyrosequencing and PCR assays enabled to reduce the amount of DNA required for multi-SNP analysis, and to lower the global TAT and costs of SNP genotyping while providing results as reliable as uniplex

  2. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Science.gov (United States)

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Multiplex Biosensing Based on Highly Sensitive Magnetic Nanolabel Quantification: Rapid Detection of Botulinum Neurotoxins A, B, and E in Liquids.

    Science.gov (United States)

    Orlov, Alexey V; Znoyko, Sergey L; Cherkasov, Vladimir R; Nikitin, Maxim P; Nikitin, Petr I

    2016-11-01

    We present a multiplex quantitative lateral flow (LF) assay for simultaneous on-site detection of botulinum neurotoxin (BoNT) types A, B, and E in complex matrixes, which is innovative by virtually no sacrifice in performance while transition from the single-plex assays and by characteristics on the level of laboratory quantitative methods. The novel approach to easy multiplexing is realized via joining an on-demand set of single-plex LF strips, which employ magnetic nanolabels, into a miniature cylinder cartridge that mimics LF strip during all assay stages. The cartridge is read out by an original portable multichannel reader based on the magnetic particle quantification technique. The developed reader offers the unmatched 60 zmol detection limit and 7-order linear dynamic range for volumetric registration of magnetic labels inside a cartridge of several millimeters in diameter regardless of its optical transparency. Each of the test strips, developed here as building blocks for the multiplex assay, can be used "as is" for autonomous quantitative single-plex detection with the same measuring setup, exhibiting the limits of detection (LOD) of 0.22, 0.11, and 0.32 ng/mL for BoNT-A, -B, and -E, respectively. The proposed multiplex assay has demonstrated the remarkably similar LOD values of 0.20, 0.12, 0.35 ng/mL under the same conditions. The multiplex assay performance was successfully validated by BoNT detection in milk and apple and orange juices. The developed methods can be extended to other proteins and used for rapid multianalyte tests for point-of-care in vitro diagnostics, food analysis, biosafety and environmental monitoring, forensics, and security, etc.

  4. Toward photostable multiplex analyte detection on a single mode planar optical waveguide

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini [Los Alamos National Laboratory; Xei, Hongshi [Los Alamos National Laboratory; Anderson, Aaron S [Los Alamos National Laboratory; Grace, Wynne K [Los Alamos National Laboratory; Martinez, Jennifer S [NON LANL; Swanson, Basil [Los Alamos National Laboratory

    2009-01-01

    We have developed a waveguide-based optical biosensor for the sensitive and specific detection of biomarkers associated with disease. Our technology combines the superior optical properties of single-mode planar waveguides, the robust nature of functionalized self-assembled monolayer sensing films and the specificity of fluorescence sandwich immunoassays to detect biomarkers in complex biological samples such as serum, urine and sputum. We have previously reported the adaptation of our technology to the detection of biomarkers associated with breast cancer and anthrax. However, these approaches primarily used phospholipid bilayers as the functional film and organic dyes (ex: AlexaFluors) as the fluorescence reporter. Organic dyes are easily photodegraded and are not amenable to multiplexing because of their narrow Stokes' shift. Here we have developed strategies for conjugation of the detector antibodies with quantum dots for use in a multiplex detection platform. We have previously evaluated dihydroxylipoic acid quantum dots for the detection of a breast cancer biomarker. In this manuscript, we investigate the detection of the Bacillus anthracis protective antigen using antibodies conjugated with polymer-coated quantum dots. Kinetics of binding on the waveguide-based biosensor is reported. We compare the sensitivity of quantum dot labeled antibodies to those labeled with AlexaFluor and demonstrate the photostability of the former in our assay platform. In addition, we compare sulfydryl labeling of the antibody in the hinge region to that of nonspecific amine labeling. This is but the first step in developing a multiplex assay for such biomarkers on our waveguide platform.

  5. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  6. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  7. Colloid-based multiplexed method for screening plant biomass-degrading glycoside hydrolase activities in microbial communities

    Energy Technology Data Exchange (ETDEWEB)

    Reindl, W.; Deng, K.; Gladden, J.M.; Cheng, G.; Wong, A.; Singer, S.W.; Singh, S.; Lee, J.-C.; Yao, J.-S.; Hazen, T.C.; Singh, A.K; Simmons, B.A.; Adams, P.D.; Northen, T.R.

    2011-05-01

    The enzymatic hydrolysis of long-chain polysaccharides is a crucial step in the conversion of biomass to lignocellulosic biofuels. The identification and characterization of optimal glycoside hydrolases is dependent on enzyme activity assays, however existing methods are limited in terms of compatibility with a broad range of reaction conditions, sample complexity, and especially multiplexity. The method we present is a multiplexed approach based on Nanostructure-Initiator Mass Spectrometry (NIMS) that allowed studying several glycolytic activities in parallel under diverse assay conditions. Although the substrate analogs carried a highly hydrophobic perfluorinated tag, assays could be performed in aqueous solutions due colloid formation of the substrate molecules. We first validated our method by analyzing known {beta}-glucosidase and {beta}-xylosidase activities in single and parallel assay setups, followed by the identification and characterization of yet unknown glycoside hydrolase activities in microbial communities.

  8. Multiplexed Dosing Assays by Digitally Definable Hydrogel Volumes

    DEFF Research Database (Denmark)

    Faralli, Adele; Melander, Fredrik; Larsen, Esben Kjær Unmack

    2016-01-01

    Stable and low-cost multiplexed drug sensitivity assays using small volumes of cells or tissue are in demand for personalized medicine, including patientspecific combination chemotherapy. Spatially defined projected light photopolymerization of hydrogels with embedded active compounds is introduc...

  9. Detection of serological biomarkers by proximity extension assay for detection of colorectal neoplasias in symptomatic individuals

    DEFF Research Database (Denmark)

    Buch Thorsen, Stine; Lundberg, Martin; Villablanca, Andrea

    2013-01-01

    of biomarkers from the bench to clinical practice we initiated a biomarker study focusing on a novel technique, the proximity extension assay, with multiplexing capability and the possible additive effect obtained from biomarker panels. We performed a screening of 74 different biomarkers in plasma derived from...

  10. Performance of a Multiplex Serological Helicobacter pylori Assay on a Novel Microfluidic Assay Platform

    Directory of Open Access Journals (Sweden)

    Angela Filomena

    2017-10-01

    Full Text Available Infection with Helicobacter pylori (H. pylori occurs in 50% of the world population, and is associated with the development of ulcer and gastric cancer. Serological diagnostic tests indicate an H. pylori infection by detecting antibodies directed against H. pylori proteins. In addition to line blots, multiplex assay platforms provide smart solutions for the simultaneous analysis of antibody responses towards several H. pylori proteins. We used seven H. pylori proteins (FliD, gGT, GroEL, HpaA, CagA, VacA, and HP0231 and an H. pylori lysate for the development of a multiplex serological assay on a novel microfluidic platform. The reaction limited binding regime in the microfluidic channels allows for a short incubation time of 35 min. The developed assay showed very high sensitivity (99% and specificity (100%. Besides sensitivity and specificity, the technical validation (intra-assay CV = 3.7 ± 1.2% and inter-assay CV = 5.5 ± 1.2% demonstrates that our assay is also a robust tool for the analysis of the H. pylori-specific antibody response. The integration of the virulence factors CagA and VacA allow for the assessment of the risk for gastric cancer development. The short assay time and the performance of the platform shows the potential for implementation of such assays in a clinical setting.

  11. Screening for Proteolytic Activities in Snake Venom by Means of a Multiplexing ESI-MS Assay Scheme

    NARCIS (Netherlands)

    Liesener, A.; Perchuc, Anna-Maria; Schöni, Reto; Wilmer, Marianne; Karst, U.

    2005-01-01

    A multiplexed mass spectrometry based assay scheme for the simultaneous determination of five different substrate/product pairs was developed as a tool for screening of proteolytic activities in snake venom fractions from Bothrops moojeni. The assay scheme was employed in the functional

  12. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  13. Recombinant Helicobacter bilis Protein P167 for Mouse Serodiagnosis in a Multiplex Microbead Assay

    OpenAIRE

    Feng, Sunlian; Kendall, Lon V.; Hodzic, Emir; Wong, Scott; Lorenzana, Edward; Freet, Kimberly; Ku, Karin S.; Luciw, Paul A.; Barthold, Stephen W.; Khan, Imran H.

    2004-01-01

    Infection of mice with Helicobacter bilis is widespread in research and commercial mouse colonies. Therefore, sensitive, specific, and high-throughput assays are needed for rapid and accurate testing of mice in large numbers. This report describes a novel multiplex assay, based on fluorescent microbeads, for serodetection of H. bilis infection. The assay requires only a few microliters of serum to perform and is amenable to a high-throughput format. Individual microbead sets were conjugated t...

  14. Ultra-performance liquid chromatography-tandem mass spectrometry-based multiplex enzyme assay for six enzymes associated with hereditary hemolytic anemia.

    Science.gov (United States)

    Park, Chul Min; Lee, Kyunghoon; Jun, Sun-Hee; Song, Sang Hoon; Song, Junghan

    2017-08-15

    Deficiencies in erythrocyte metabolic enzymes are associated with hereditary hemolytic anemia. Here, we report the development of a novel multiplex enzyme assay for six major enzymes, namely glucose-6-phosphate dehydrogenase, pyruvate kinase, pyrimidine 5'-nucleotidase, hexokinase, triosephosphate isomerase, and adenosine deaminase, deficiencies in which are implicated in erythrocyte enzymopathies. To overcome the drawbacks of traditional spectrophotometric enzyme assays, the present assay was based on ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). The products of the six enzymes were directly measured by using ion pairing UPLC-MS/MS, and the precision, linearity, ion suppression, optimal sample amounts, and incubation times were evaluated. Eighty-three normal individuals and 13 patients with suspected enzymopathy were analyzed. The UPLC running time was within 5min. No ion suppression was observed at the retention time for the products or internal standards. We selected an optimal dilution factor and incubation time for each enzyme system. The intra- and inter-assay imprecision values (CVs) were 2.5-12.1% and 2.9-14.3%, respectively. The linearity of each system was good, with R 2 values >0.97. Patient samples showed consistently lower enzyme activities than those from normal individuals. The present ion paring UPLC-MS/MS assay enables facile and reproducible multiplex evaluation of the activity of enzymes implicated in enzymopathy-associated hemolytic anemia. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Multiplexed profiling of GPCR activities by combining split TEV assays and EXT-based barcoded readouts.

    Science.gov (United States)

    Galinski, Sabrina; Wichert, Sven P; Rossner, Moritz J; Wehr, Michael C

    2018-05-25

    G protein-coupled receptors (GPCRs) are the largest class of cell surface receptors and are implicated in the physiological regulation of many biological processes. The high diversity of GPCRs and their physiological functions make them primary targets for therapeutic drugs. For the generation of novel compounds, however, selectivity towards a given target is a critical issue in drug development as structural similarities between members of GPCR subfamilies exist. Therefore, the activities of multiple GPCRs that are both closely and distantly related to assess compound selectivity need to be tested simultaneously. Here, we present a cell-based multiplexed GPCR activity assay, termed GPCRprofiler, which uses a β-arrestin recruitment strategy and combines split TEV protein-protein interaction and EXT-based barcode technologies. This approach enables simultaneous measurements of receptor activities of multiple GPCR-ligand combinations by applying massively parallelized reporter assays. In proof-of-principle experiments covering 19 different GPCRs, both the specificity of endogenous agonists and the polypharmacological effects of two known antipsychotics on GPCR activities were demonstrated. Technically, normalization of barcode reporters across individual assays allows quantitative pharmacological assays in a parallelized manner. In summary, the GPCRprofiler technique constitutes a flexible and scalable approach, which enables simultaneous profiling of compound actions on multiple receptor activities in living cells.

  16. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  17. Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

    Science.gov (United States)

    Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

    2017-09-01

    The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

  18. One-Step Multiplex RT-qPCR Assay for the detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae

    International Nuclear Information System (INIS)

    Settypalli, T.B.K.; Lamien, C.; Spergser, J.; Lelenta, M.; Wade, A.; Gelaye, E.; Loitsch, A.; Minoungou, G.; Thiaucourt, F.; Diallo, A.

    2016-01-01

    Full text: Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%–4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  19. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp. capripneumoniae.

    Directory of Open Access Journals (Sweden)

    Tirumala Bharani Kumar Settypalli

    Full Text Available Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV, Peste de petits ruminants virus (PPRV, Pasteurella multocida (PM and Mycoplasma capricolum ssp. capripneumonia (Mccp in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  20. Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

    Science.gov (United States)

    Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

    2012-11-01

    In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

  1. Multiplexed Microsphere Suspension-Array Assay for Urine Mitochondrial DNA Typing by C-Stretch Length in Hypervariable Regions.

    Science.gov (United States)

    Aoki, Kimiko; Tanaka, Hiroyuki; Kawahara, Takashi

    2018-07-01

    The standard method for personal identification and verification of urine samples in doping control is short tandem repeat (STR) analysis using nuclear DNA (nDNA). The DNA concentration of urine is very low and decreases under most conditions used for sample storage; therefore, the amount of DNA from cryopreserved urine samples may be insufficient for STR analysis. We aimed to establish a multiplexed assay for urine mitochondrial DNA typing containing only trace amounts of DNA, particularly for Japanese populations. A multiplexed suspension-array assay using oligo-tagged microspheres (Luminex MagPlex-TAG) was developed to measure C-stretch length in hypervariable region 1 (HV1) and 2 (HV2), five single nucleotide polymorphisms (SNPs), and one polymorphic indel. Based on these SNPs and the indel, the Japanese population can be classified into five major haplogroups (D4, B, M7a, A, D5). The assay was applied to DNA samples from urine cryopreserved for 1 - 1.5 years (n = 63) and fresh blood (n = 150). The assay with blood DNA enabled Japanese subjects to be categorized into 62 types, exhibiting a discriminatory power of 0.960. The detection limit for cryopreserved urine was 0.005 ng of nDNA. Profiling of blood and urine pairs revealed that 5 of 63 pairs showed different C-stretch patterns in HV1 or HV2. The assay described here yields valuable information in terms of the verification of urine sample sources employing only trace amounts of recovered DNA. However, blood cannot be used as a reference sample.

  2. Real-Time, Fast Neutron Coincidence Assay of Plutonium With a 4-Channel Multiplexed Analyzer and Organic Scintillators

    Science.gov (United States)

    Joyce, Malcolm J.; Gamage, Kelum A. A.; Aspinall, M. D.; Cave, F. D.; Lavietes, A.

    2014-06-01

    The design, principle of operation and the results of measurements made with a four-channel organic scintillator system are described. The system comprises four detectors and a multiplexed analyzer for the real-time parallel processing of fast neutron events. The function of the real-time, digital multiple-channel pulse-shape discrimination analyzer is described together with the results of laboratory-based measurements with 252Cf, 241Am-Li and plutonium. The analyzer is based on a single-board solution with integrated high-voltage supplies and graphical user interface. It has been developed to meet the requirements of nuclear materials assay of relevance to safeguards and security. Data are presented for the real-time coincidence assay of plutonium in terms of doubles count rate versus mass. This includes an assessment of the limiting mass uncertainty for coincidence assay based on a 100 s measurement period and samples in the range 0-50 g. Measurements of count rate versus order of multiplicity for 252Cf and 241Am-Li and combinations of both are also presented.

  3. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  4. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  5. Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (TEC-LAMP Assay for the Detection of Bacterial Meningitis Pathogens

    Directory of Open Access Journals (Sweden)

    Owen Higgins

    2018-02-01

    Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.

  6. Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (TEC-LAMP) Assay for the Detection of Bacterial Meningitis Pathogens

    Science.gov (United States)

    Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert

    2018-01-01

    Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124

  7. Comparison of culture, single and multiplex real-time PCR for detection of Sabin poliovirus shedding in recently vaccinated Indian children.

    Science.gov (United States)

    Giri, Sidhartha; Rajan, Anand K; Kumar, Nirmal; Dhanapal, Pavithra; Venkatesan, Jayalakshmi; Iturriza-Gomara, Miren; Taniuchi, Mami; John, Jacob; Abraham, Asha Mary; Kang, Gagandeep

    2017-08-01

    Although, culture is considered the gold standard for poliovirus detection from stool samples, real-time PCR has emerged as a faster and more sensitive alternative. Detection of poliovirus from the stool of recently vaccinated children by culture, single and multiplex real-time PCR was compared. Of the 80 samples tested, 55 (68.75%) were positive by culture compared to 61 (76.25%) and 60 (75%) samples by the single and one step multiplex real-time PCR assays respectively. Real-time PCR (singleplex and multiplex) is more sensitive than culture for poliovirus detection in stool, although the difference was not statistically significant. © 2017 Wiley Periodicals, Inc.

  8. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  9. A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

    Directory of Open Access Journals (Sweden)

    Diego Cardeñosa

    Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

  10. OzPythonPlex: An optimised forensic STR multiplex assay set for the Australasian carpet python (Morelia spilota).

    Science.gov (United States)

    Ciavaglia, Sherryn; Linacre, Adrian

    2018-05-01

    Reptile species, and in particular snakes, are protected by national and international agreements yet are commonly handled illegally. To aid in the enforcement of such legislation, we report on the development of three 11-plex assays from the genome of the carpet python to type 24 loci of tetra-nucleotide and penta-nucleotide repeat motifs (pure, compound and complex included). The loci range in size between 70 and 550 bp. Seventeen of the loci are newly characterised with the inclusion of seven previously developed loci to facilitate cross-comparison with previous carpet python genotyping studies. Assays were optimised in accordance with human forensic profiling kits using one nanogram template DNA. Three loci are included in all three of the multiplex reactions as quality assurance markers, to ensure sample identity and genotyping accuracy is maintained across the three profiling assays. Allelic ladders have been developed for the three assays to ensure consistent and precise allele designation. A DNA reference database of allele frequencies is presented based on 249 samples collected from throughout the species native range. A small number of validation tests are conducted to demonstrate the utility of these multiplex assays. We suggest further appropriate validation tests that should be conducted prior to the application of the multiplex assays in criminal investigations involving carpet pythons. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats.

    Science.gov (United States)

    Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang

    2003-09-01

    A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.

  12. Multiplex High-Throughput Targeted Proteomic Assay To Identify Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Baud, Anna; Wessely, Frank; Mazzacuva, Francesca; McCormick, James; Camuzeaux, Stephane; Heywood, Wendy E; Little, Daniel; Vowles, Jane; Tuefferd, Marianne; Mosaku, Olukunbi; Lako, Majlinda; Armstrong, Lyle; Webber, Caleb; Cader, M Zameel; Peeters, Pieter; Gissen, Paul; Cowley, Sally A; Mills, Kevin

    2017-02-21

    Induced pluripotent stem cells have great potential as a human model system in regenerative medicine, disease modeling, and drug screening. However, their use in medical research is hampered by laborious reprogramming procedures that yield low numbers of induced pluripotent stem cells. For further applications in research, only the best, competent clones should be used. The standard assays for pluripotency are based on genomic approaches, which take up to 1 week to perform and incur significant cost. Therefore, there is a need for a rapid and cost-effective assay able to distinguish between pluripotent and nonpluripotent cells. Here, we describe a novel multiplexed, high-throughput, and sensitive peptide-based multiple reaction monitoring mass spectrometry assay, allowing for the identification and absolute quantitation of multiple core transcription factors and pluripotency markers. This assay provides simpler and high-throughput classification into either pluripotent or nonpluripotent cells in 7 min analysis while being more cost-effective than conventional genomic tests.

  13. Multiplex Detection and Genotyping of Point Mutations Involved in Charcot-Marie-Tooth Disease Using a Hairpin Microarray-Based Assay

    Directory of Open Access Journals (Sweden)

    Yasser Baaj

    2009-01-01

    Full Text Available We previously developed a highly specific method for detecting SNPs with a microarray-based system using stem-loop probes. In this paper we demonstrate that coupling a multiplexing procedure with our microarray method is possible for the simultaneous detection and genotyping of four point mutations, in three different genes, involved in Charcot-Marie-Tooth disease. DNA from healthy individuals and patients was amplified, labeled with Cy3 by multiplex PCR; and hybridized to microarrays. Spot signal intensities were 18 to 74 times greater for perfect matches than for mismatched target sequences differing by a single nucleotide (discrimination ratio for “homozygous” DNA from healthy individuals. “Heterozygous” mutant DNA samples gave signal intensity ratios close to 1 at the positions of the mutations as expected. Genotyping by this method was therefore reliable. This system now combines the principle of highly specific genotyping based on stem-loop structure probes with the advantages of multiplex analysis.

  14. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Clinical Application of a Multiplex Real-Time PCR Assay for Simultaneous Detection of Legionella Species, Legionella pneumophila, and Legionella pneumophila Serogroup 1

    OpenAIRE

    Benitez, Alvaro J.; Winchell, Jonas M.

    2014-01-01

    We developed a single-tube multiplex real-time PCR assay capable of simultaneously detecting and discriminating Legionella spp., Legionella pneumophila, and Legionella pneumophila serogroup 1 in primary specimens. Evaluation of 21 clinical specimens and 115 clinical isolates demonstrated this assay to be a rapid, high-throughput diagnostic test with 100% specificity that may aid during legionellosis outbreaks and epidemiologic investigations.

  16. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Science.gov (United States)

    Ikten, Cengiz; Ustun, Rustem; Catal, Mursel; Yol, Engin; Uzun, Bulent

    2016-01-01

    Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.). Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  17. Ultrasensitive aptamer-based multiplexed electrochemical detection by coupling distinguishable signal tags with catalytic recycling of DNase I.

    Science.gov (United States)

    Tang, Dianping; Tang, Juan; Li, Qunfang; Su, Biling; Chen, Guonan

    2011-10-01

    This work reports an aptamer-based, disposable, and multiplexed sensing platform for simultaneous electrochemical determination of small molecules, employing adenosine triphosphate (ATP) and cocaine as the model target analytes. The multiplexed sensing strategy is based on target-induced release of distinguishable redox tag-conjugated aptamers from a magnetic graphene platform. The electronic signal of the aptasensors could be further amplified by coupling DNase I with catalytic recycling of self-produced reactants. The assay was based on the change in the current at the various peak potentials in the presence of the corresponding signal tags. Experimental results revealed that the multiplexed electrochemical aptasensor enabled the simultaneous monitoring of ATP and cocaine in a single run with wide working ranges and low detection limits (LODs: 0.1 pM for ATP and 1.5 pM for cocaine). This concept offers promise for rapid, simple, and cost-effective analysis of biological samples.

  18. Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

    Directory of Open Access Journals (Sweden)

    Whyte Paul

    2008-09-01

    Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

  19. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

    2007-04-11

    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  20. Multiplex diagnosis of viral infectious diseases (AIDS, hepatitis C, and hepatitis A) based on point of care lateral flow assay using engineered proteinticles.

    Science.gov (United States)

    Lee, Jong-Hwan; Seo, Hyuk Seong; Kwon, Jung-Hyuk; Kim, Hee-Tae; Kwon, Koo Chul; Sim, Sang Jun; Cha, Young Joo; Lee, Jeewon

    2015-07-15

    Lateral flow assay (LFA) is an attractive method for rapid, simple, and cost-effective point of care diagnosis. For LFA-based multiplex diagnosis of three viral intractable diseases (acquired immune deficiency syndrome and hepatitis C and A), here we developed proteinticle-based 7 different 3D probes that display different viral antigens on their surface, which were synthesized in Escherichia coli by self-assembly of human ferritin heavy chain that was already engineered by genetically linking viral antigens to its C-terminus. Each of the three test lines on LFA strip contains the proteinticle probes to detect disease-specific anti-viral antibodies. Compared to peptide probes, the proteinticle probes were evidently more sensitive, and the proteinticle probe-based LFA successfully diagnosed all the 20 patient sera per each disease without a false negative signal, whereas the diagnostic sensitivities in the peptide probe-based LFAs were 65-90%. Duplex and triplex assays performed with randomly mixed patient sera gave only true positive signals for all the 20 serum mixtures without any false positive signals, indicating 100% sensitivity and 100% specificity. It seems that on the proteinticle surface the antigenic peptides have homogeneous orientation and conformation without inter-peptide clustering and hence lead to the enhanced diagnostic performance with solving the problems of traditional diagnostic probes. Although the multiplex diagnosis of three viral diseases above was demonstrated as proof-of-concept here, the proposed LFA system can be applied to multiplex point of care diagnosis of other intractable diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Analysis of hybrid subcarrier multiplexing of OCDMA based on single photodiode detection

    Directory of Open Access Journals (Sweden)

    Ahmad N. A. A

    2017-01-01

    Full Text Available This paper analyzes the performance of subcarrier multiplexing (SCM of spectral amplitude coding optical code multiple access (SAC-OCDMA by applying Recursive Combinatorial (RC code based on single photodiode detection (SPD. SPD is used in the receiver part to reduce the effect of multiple access interference (MAI which contributes as a dominant noise in incoherent SAC-OCDMA systems. Results indicate that the SCM OCDMA network performance could be improved by using lower data rates and higher number of weight. Total number of users can also be enhanced by adding lower data rates and higher number of subcarriers.

  2. Analysis of hybrid subcarrier multiplexing of OCDMA based on single photodiode detection

    Science.gov (United States)

    Ahmad, N. A. A.; Junita, M. N.; Aljunid, S. A.; Rashidi, C. B. M.; Endut, R.

    2017-11-01

    This paper analyzes the performance of subcarrier multiplexing (SCM) of spectral amplitude coding optical code multiple access (SAC-OCDMA) by applying Recursive Combinatorial (RC) code based on single photodiode detection (SPD). SPD is used in the receiver part to reduce the effect of multiple access interference (MAI) which contributes as a dominant noise in incoherent SAC-OCDMA systems. Results indicate that the SCM OCDMA network performance could be improved by using lower data rates and higher number of weight. Total number of users can also be enhanced by adding lower data rates and higher number of subcarriers.

  3. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  4. Performance Assessment of a Trypanosoma cruzi Chimeric Antigen in Multiplex Liquid Microarray Assays.

    Science.gov (United States)

    Santos, Fred Luciano Neves; Celedon, Paola Alejandra Fiorani; Zanchin, Nilson Ivo Tonin; Leitolis, Amanda; Crestani, Sandra; Foti, Leonardo; de Souza, Wayner Vieira; Gomes, Yara de Miranda; Krieger, Marco Aurélio

    2017-10-01

    Diagnosing chronic Chagas disease (CD) requires antibody-antigen detection methods, which are traditionally based on enzymatic assay techniques whose performance depend on the type and quality of antigen used. Previously, 4 recombinant chimeric proteins from the Instituto de Biologia Molecular do Paraná (IBMP-8.1 to 8.4) comprising immuno-dominant regions of diverse Trypanosoma cruzi antigens showed excellent diagnostic performance in enzyme-linked immunosorbent assays. Considering that next-generation platforms offer improved CD diagnostic accuracy with different T. cruzi -specific recombinant antigens, we assessed the performance of these chimeras in liquid microarrays (LMAs). The chimeric proteins were expressed in Escherichia coli and purified by chromatography. Sera from 653 chagasic and 680 healthy individuals were used to assess the performance of these chimeras in detecting specific anti- T. cruzi antibodies. Accuracies ranged from 98.1 to 99.3%, and diagnostic odds ratio values were 3,548 for IBMP-8.3, 4,826 for IBMP-8.1, 7,882 for IBMP-8.2, and 25,000 for IBMP-8.4. A separate sera bank (851 samples) was employed to assess cross-reactivity with other tropical diseases. Leishmania , a pathogen with high similarity to T. cruzi , showed cross-reactivity rates ranging from 0 to 2.17%. Inconclusive results were negligible (0 to 0.71%). Bland-Altman and Deming regression analysis based on 200 randomly selected CD-positive and negative samples demonstrated interchangeability with respect to CD diagnostic performance in both singleplex and multiplex assays. Our results suggested that these chimeras can potentially replace antigens currently used in commercially available assay kits. Moreover, the use of multiplex platforms, such as LMA assays employing 2 or more IBMP antigens, would abrogate the need for 2 different testing techniques when diagnosing CD. Copyright © 2017 American Society for Microbiology.

  5. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Directory of Open Access Journals (Sweden)

    Cengiz Ikten

    Full Text Available Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.. Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  6. Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.

    Science.gov (United States)

    Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing

    2015-06-15

    Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Fluorescence-Based Multiplex Protein Detection Using Optically Encoded Microbeads

    Directory of Open Access Journals (Sweden)

    Dae Hong Jeong

    2012-03-01

    Full Text Available Potential utilization of proteins for early detection and diagnosis of various diseases has drawn considerable interest in the development of protein-based multiplex detection techniques. Among the various techniques for high-throughput protein screening, optically-encoded beads combined with fluorescence-based target monitoring have great advantages over the planar array-based multiplexing assays. This review discusses recent developments of analytical methods of screening protein molecules on microbead-based platforms. These include various strategies such as barcoded microbeads, molecular beacon-based techniques, and surface-enhanced Raman scattering-based techniques. Their applications for label-free protein detection are also addressed. Especially, the optically-encoded beads such as multilayer fluorescence beads and SERS-encoded beads are successful for generating a large number of coding.

  8. High-Throughput, Multiplex Genotyping Directly from Blood or Dried Blood Spot without DNA Extraction for the Screening of Multiple G6PD Gene Variants at Risk for Drug-Induced Hemolysis.

    Science.gov (United States)

    Tian, Xiaoyi; Zhou, Jun; Zhao, Ye; Cheng, Zhibin; Song, Wenqi; Sun, Yu; Sun, Xiaodong; Zheng, Zhi

    2017-09-01

    Clinical or epidemiologic screening of single-nucleotide polymorphism markers requires large-scale multiplexed genotyping. Available genotyping tools require DNA extraction and multiplex PCR, which may limit throughput and suffer amplification bias. Herein, a novel genotyping approach has been developed, multiplex extension and ligation-based probe amplification (MELPA), which eliminates DNA extraction and achieves uniform PCR amplification. MELPA lyses blood or dried blood spot and directly captures specific target DNA to 96-well plates using tailed probes. Subsequent enzymatic extension and ligation form target single-nucleotide polymorphism-spanning single-stranded templates, which are PCR-amplified using universal primers. Multiplexed genotyping by single-base primer extension is analyzed by mass spectrometry, with a call rate >97%. MELPA was compared with a commercial assay (iPLEX) for detecting 24 G6PD variants known to be at risk for primaquine-induced hemolysis. MELPA provided results that were more reliable than iPLEX, with higher throughput and lower cost. Genotyping archival blood from 106 malaria patients taking primaquine found 10 G6PD-deficient variants, including 1 patient with a hemizygous Mahidol mutation who had hemolysis. Preemptive G6PD genotyping of 438 dried blood spots from a malaria-endemic area identified three variants. MELPA also enabled pooled genotyping without diluting rare alleles, in which undesired common-allele background increased by sample pooling can be repressed by adding specific common allele blockers. Thus, MELPA represents a high-throughput, cost-effective approach to targeted genotyping at the population level. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  9. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.

    Science.gov (United States)

    Rotherham, D; Harbison, S A

    2011-04-15

    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

    Science.gov (United States)

    Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

    2017-09-15

    Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

  11. Photocleavage-based affinity purification of biomarkers from serum: Application to multiplex allergy testing.

    Directory of Open Access Journals (Sweden)

    Zhi Wan

    Full Text Available Multiplex serological immunoassays, such as implemented on microarray or microsphere-based platforms, provide greater information content and higher throughput, while lowering the cost and blood volume required. These features are particularly attractive in pediatric food allergy testing to facilitate high throughput multi-allergen analysis from finger- or heel-stick collected blood. However, the miniaturization and microfluidics necessary for creating multiplex assays make them highly susceptible to the "matrix effect" caused by interference from non-target agents in serum and other biofluids. Such interference can result in lower sensitivity, specificity, reproducibility and quantitative accuracy. These problems have in large part prevented wide-spread implementation of multiplex immunoassays in clinical laboratories. We report the development of a novel method to eliminate the matrix effect by utilizing photocleavable capture antibodies to purify and concentrate blood-based biomarkers (a process termed PC-PURE prior to detection in a multiplex immunoassay. To evaluate this approach, it was applied to blood-based allergy testing. Patient total IgE was purified and enriched using PC-PURE followed by multiplex microsphere-based detection of allergen-specific IgEs (termed the AllerBead assay. AllerBead was formatted to detect the eight most common pediatric food allergens: milk, soy, wheat, egg, peanuts, tree nuts, fin fish and shellfish, which account for >90% of all pediatric food allergies. 205 serum samples obtained from Boston Children's Hospital were evaluated. When PC-PURE was employed with AllerBead, excellent agreement was obtained with the standard, non-multiplex, ImmunoCAP® assay (average sensitivity above published negative predictive cutoffs = 96% and average Pearson r = 0.90; average specificity = 97%. In contrast, poor ImmunoCAP®-correlation was observed when PC-PURE was not utilized (average sensitivity above published negative

  12. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

    Science.gov (United States)

    2013-01-01

    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  13. Tumor specific lung cancer diagnostics with multiplexed FRET immunoassays

    Science.gov (United States)

    Geißler, D.; Hill, D.; Löhmannsröben, H.-G.; Thomas, E.; Lavigne, A.; Darbouret, B.; Bois, E.; Charbonnière, L. J.; Ziessel, R. F.; Hildebrandt, N.

    2010-02-01

    An optical multiplexed homogeneous (liquid phase) immunoassay based on FRET from a terbium complex to eight different fluorescent dyes is presented. We achieved highly sensitive parallel detection of four different lung cancer specific tumor markers (CEA, NSE, SCC and CYFRA21-1) within a single assay and show a proof-of-principle for 5- fold multiplexing. The method is well suited for fast and low-cost miniaturized point-of-care testing as well as for highthroughput screening in a broad range of in-vitro diagnostic applications.

  14. Validation of a single nucleotide polymorphism (SNP) typing assay with 49 SNPs for forensic genetic testing in a laboratory accredited according to the ISO 17025 standard

    DEFF Research Database (Denmark)

    Børsting, Claus; Rockenbauer, Eszter; Morling, Niels

    2009-01-01

    cases and 33 twin cases were typed at least twice for the 49 SNPs. All electropherograms were analysed independently by two expert analysts prior to approval. Based on these results, detailed guidelines for analysis of the SBE products were developed. With these guidelines, the peak height ratio...... of a heterozygous allele call or the signal to noise ratio of a homozygous allele call is compared with previously obtained ratios. A laboratory protocol for analysis of SBE products was developed where allele calls with unusual ratios were highlighted to facilitate the analysis of difficult allele calls......A multiplex assay with 49 autosomal single nucleotide polymorphisms (SNPs) developed for human identification was validated for forensic genetic casework and accredited according to the ISO 17025 standard. The multiplex assay was based on the SNPforID 52plex SNP assay [J.J. Sanchez, C. Phillips, C...

  15. A nuclear DNA-based species determination and DNA quantification assay for common poultry species.

    Science.gov (United States)

    Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S

    2014-12-01

    DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.

  16. Development of a multiplex polymerase chain reaction assay for simultaneous identification of human enterovirus 71 and coxsackievirus A16

    Science.gov (United States)

    Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara

    2010-01-01

    Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857

  17. Comparison between Conventional OCDMA and Subcarrier Multiplexing SAC OCDMA System Based on Single Photodiode Detection

    OpenAIRE

    Ahmad N. A. A; Junita M. N; Aljunid Syed Alwi; Che Beson Mohd Rashidi; Endut Rosdisham

    2017-01-01

    This paper demonstrates the comparison between conventional OCDMA system and subcarrier multiplexing (SCM) SAC-OCDMA system by applying Recursive Combinatorial (RC) code based on single photodiode detection (SPD). SPD is used in the receiver part to reduce the effect of multiple access interference (MAI) which contributes as a dominant noise in incoherent SAC-OCDMA systems. From this analysis, the performance of SCM OCDMA network could be improved by using lower data rates and higher received...

  18. Multiplexed Imaging of Protein Phosphorylation on Membranes Based on Ti(IV) Functionalized Nanopolymers.

    Science.gov (United States)

    Iliuk, Anton; Li, Li; Melesse, Michael; Hall, Mark C; Tao, W Andy

    2016-05-17

    Accurate protein phosphorylation analysis reveals dynamic cellular signaling events not evident from protein expression levels. The most dominant biochemical assay, western blotting, suffers from the inadequate availability and poor quality of phospho-specific antibodies for phosphorylated proteins. Furthermore, multiplexed assays based on antibodies are limited by steric interference between the antibodies. Here we introduce a multifunctionalized nanopolymer for the universal detection of phosphoproteins that, in combination with regular antibodies, allows multiplexed imaging and accurate determination of protein phosphorylation on membranes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

    DEFF Research Database (Denmark)

    Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

    2009-01-01

    methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...

  20. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  1. Evaluation of multiplex assay platforms for detection of influenza hemagglutinin subtype specific antibody responses.

    Science.gov (United States)

    Li, Zhu-Nan; Weber, Kimberly M; Limmer, Rebecca A; Horne, Bobbi J; Stevens, James; Schwerzmann, Joy; Wrammert, Jens; McCausland, Megan; Phipps, Andrew J; Hancock, Kathy; Jernigan, Daniel B; Levine, Min; Katz, Jacqueline M; Miller, Joseph D

    2017-05-01

    Influenza hemagglutination inhibition (HI) and virus microneutralization assays (MN) are widely used for seroprevalence studies. However, these assays have limited field portability and are difficult to fully automate for high throughput laboratory testing. To address these issues, three multiplex influenza subtype-specific antibody detection assays were developed using recombinant hemagglutinin antigens in combination with Chembio, Luminex ® , and ForteBio ® platforms. Assay sensitivity, specificity, and subtype cross-reactivity were evaluated using a panel of well characterized human sera. Compared to the traditional HI, assay sensitivity ranged from 87% to 92% and assay specificity in sera collected from unexposed persons ranged from 65% to 100% across the platforms. High assay specificity (86-100%) for A(H5N1) rHA was achieved for sera from exposed or unexposed to hetorosubtype influenza HAs. In contrast, assay specificity for A(H1N1)pdm09 rHA using sera collected from A/Vietnam/1204/2004 (H5N1) vaccinees in 2008 was low (22-30%) in all platforms. Although cross-reactivity against rHA subtype proteins was observed in each assay platform, the correct subtype specific responses were identified 78%-94% of the time when paired samples were available for analysis. These results show that high throughput and portable multiplex assays that incorporate rHA can be used to identify influenza subtype specific infections. Published by Elsevier B.V.

  2. Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay

    Science.gov (United States)

    Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong

    2015-01-01

    Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification

  3. A multiplex single nucleotide polymorphism typing assay for detecting mutations that result in decreased fluoroquinolone susceptibility in Salmonella enterica serovars Typhi and Paratyphi A.

    LENUS (Irish Health Repository)

    Song, Yajun

    2010-08-01

    OBJECTIVES: Decreased susceptibility to fluoroquinolones has become a major problem for the successful therapy of human infections caused by Salmonella enterica, especially the life-threatening typhoid and paratyphoid fevers. METHODS: By using Luminex xTAG beads, we developed a rapid, reliable and cost-effective multiplexed genotyping assay for simultaneously detecting 11 mutations in gyrA, gyrB and parE of S. enterica serovars Typhi and Paratyphi A that result in nalidixic acid resistance (Nal(R)) and\\/or decreased susceptibility to fluoroquinolones. RESULTS: This assay yielded unambiguous single nucleotide polymorphism calls on extracted DNA from 292 isolates of Salmonella Typhi (Nal(R) = 223 and Nal(S) = 69) and 106 isolates of Salmonella Paratyphi A (Nal(R) = 24 and Nal(S) = 82). All of the 247 Nal(R) Salmonella Typhi and Salmonella Paratyphi A isolates were found to harbour at least one of the target mutations, with GyrA Phe-83 as the most common one (143\\/223 for Salmonella Typhi and 18\\/24 for Salmonella Paratyphi A). We also identified three GyrB mutations in eight Nal(S) Salmonella Typhi isolates (six for GyrB Phe-464, one for GyrB Leu-465 and one for GyrB Asp-466), and mutations GyrB Phe-464 and GyrB Asp-466 seem to be related to the decreased ciprofloxacin susceptibility phenotype in Salmonella Typhi. This assay can also be used directly on boiled single colonies. CONCLUSIONS: The assay presented here would be useful for clinical and reference laboratories to rapidly screen quinolone-resistant isolates of Salmonella Typhi and Salmonella Paratyphi A, and decipher the underlying genetic changes for epidemiological purposes.

  4. A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

    NARCIS (Netherlands)

    Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

    2015-01-01

    A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

  5. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. A Novel Multiplex HRM Assay to Detect Clopidogrel Resistance.

    Science.gov (United States)

    Zhang, Lichen; Ma, Xiaowei; You, Guoling; Zhang, Xiaoqing; Fu, Qihua

    2017-11-22

    Clopidogrel is an antiplatelet medicine used to prevent blood clots in patients who have had a heart attack, stroke, or other symptoms. Variability in the clinical response to clopidogrel treatment has been attributed to genetic factors. In particular, five SNPs of rs4244285, rs4986893, rs12248560, rs662 and rs1045642 have been associated with resistance to clopidogrel therapy in Chinese population. This work involves the development of a multiplex high-resolution melting (HRM) assay to genotype all five of these loci in 2 tubes. Amplicons corresponding to distinct SNPs in a common tube were designed with the aid of uMelt prediction software to have different melting temperatures Tm by addition of a GC-rich tail to the 5' end of the certain primers. Two kinds of commercial methods, Digital Fluorescence Molecular Hybridization (DFMH) and Sanger sequencing, were used as a control. Three hundred sixteen DFMH pretested samples from consecutive acute coronary syndrome patients were used for a blinded study of multiplex HRM. The sensitivity of HRM was 100% and the specificity was 99.93% reflecting detection of variants other than the known resistance SNPs. Multiplex HRM is an effective closed-tube, highly accurate, fast, and inexpensive method for genotyping the 5 clopidogrel resistance associated SNPs.

  7. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM) analysis.

    Science.gov (United States)

    Hanson, Erin K; Ballantyne, Jack

    2013-01-01

    Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA) profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE) or quantitative RT-PCR (qRT-PCR) platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM) assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions), IL1F7 (skin), ALAS2 (blood), MMP10 (menstrual blood), HTN3 (saliva) and TGM4 (semen).  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green). Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively inexpensive

  8. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    Science.gov (United States)

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  9. Paper-based solid-phase multiplexed nucleic acid hybridization assay with tunable dynamic range using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    Science.gov (United States)

    Noor, M Omair; Krull, Ulrich J

    2013-08-06

    A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.

  10. A novel one-step real-time multiplex PCR assay to detect Streptococcus agalactiae presence and serotypes Ia, Ib, and III.

    Science.gov (United States)

    Furfaro, Lucy L; Chang, Barbara J; Payne, Matthew S

    2017-09-01

    Streptococcus agalactiae is the leading cause of early-onset neonatal sepsis. Culture-based screening methods lack the sensitivity of molecular assays and do not indicate serotype; a potentially important virulence marker. We aimed to develop a multiplex PCR to detect S. agalactiae while simultaneously identifying serotypes Ia, Ib, and III; commonly associated with infant disease. Primers were designed to target S. agalactiae serotype-specific cps genes and the dltS gene. The assay was validated with 512 vaginal specimens from pregnant women. 112 (21.9%) were dltS positive, with 14.3%, 0.9%, and 6.3% of these identified as cps Ia, Ib, and III, respectively. Our assay is a specific and sensitive method to simultaneously detect S. agalactiae and serotypes Ia, Ib, and III in a single step. It is of high significance for clinical diagnostic applications and also provides epidemiological data on serotype, information that may be important for vaccine development and other targeted non-antibiotic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  12. Development of a multiplex assay for genus- and species-specific detection of Phytophthora based on differences in mitochondrial gene order

    Science.gov (United States)

    G. J. Bilodeau; F. N. Martin; M. D. Coffey; C. L. Blomquist

    2014-01-01

    A molecular diagnostic assay for Phytophthora spp. that is specific, sensitive, has both genus- and species-specific detection capabilities multiplexed, and can be used to systematically develop markers for detection of a wide range of species would facilitate research and regulatory efforts. To address this need, a marker system was developed...

  13. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  14. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia

    2012-01-01

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  15. A laser ablation ICP-MS based method for multiplexed immunoblot analysis

    DEFF Research Database (Denmark)

    de Bang, Thomas Christian; Petersen, Jørgen; Pedas, Pai Rosager

    2015-01-01

    developed a multiplexed antibody-based assay and analysed selected PSII subunits in barley (Hordeum vulgare L.). A selection of antibodies were labelled with specific lanthanides and immunoreacted with thylakoids exposed to Mn deficiency after western blotting. Subsequently, western blot membranes were...... analysed by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), which allowed selective and relative quantitative analysis via the different lanthanides. The method was evaluated against established liquid chromatography electrospray ionization tandem mass spectrometry (LC...... by more than one technique. The developed method enables a higher number of proteins to be multiplexed in comparison to existing immunoassays. Furthermore, multiplexed protein analysis by LA-ICP-MS provides an analytical platform with high throughput appropriate for screening large collections of plants....

  16. Multiplexed Western Blotting Using Microchip Electrophoresis.

    Science.gov (United States)

    Jin, Shi; Furtaw, Michael D; Chen, Huaxian; Lamb, Don T; Ferguson, Stephen A; Arvin, Natalie E; Dawod, Mohamed; Kennedy, Robert T

    2016-07-05

    Western blotting is a commonly used protein assay that combines the selectivity of electrophoretic separation and immunoassay. The technique is limited by long time, manual operation with mediocre reproducibility, and large sample consumption, typically 10-20 μg per assay. Western blots are also usually used to measure only one protein per assay with an additional housekeeping protein for normalization. Measurement of multiple proteins is possible; however, it requires stripping membranes of antibody and then reprobing with a second antibody. Miniaturized alternatives to Western blot based on microfluidic or capillary electrophoresis have been developed that enable higher-throughput, automation, and greater mass sensitivity. In one approach, proteins are separated by electrophoresis on a microchip that is dragged along a polyvinylidene fluoride membrane so that as proteins exit the chip they are captured on the membrane for immunoassay. In this work, we improve this method to allow multiplexed protein detection. Multiple injections made from the same sample can be deposited in separate tracks so that each is probed with a different antibody. To further enhance multiplexing capability, the electrophoresis channel dimensions were optimized for resolution while keeping separation and blotting times to less than 8 min. Using a 15 μm deep × 50 μm wide × 8.6 cm long channel, it is possible to achieve baseline resolution of proteins that differ by 5% in molecular weight, e.g., ERK1 (44 kDa) from ERK2 (42 kDa). This resolution allows similar proteins detected by cross-reactive antibodies in a single track. We demonstrate detection of 11 proteins from 9 injections from a single Jurkat cell lysate sample consisting of 400 ng of total protein using this procedure. Thus, multiplexed Western blots are possible without cumbersome stripping and reprobing steps.

  17. High throughput multiplex real time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants

    OpenAIRE

    Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.

    2016-01-01

    Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...

  18. Comprehensive genotyping for 18 blood group systems using a multiplex ligation-dependent probe amplification assay shows a high degree of accuracy

    NARCIS (Netherlands)

    Haer-Wigman, Lonneke; Ji, Yanli; Lodén, Martin; de Haas, Masja; van der Schoot, C. Ellen; Veldhuisen, Barbera

    2013-01-01

    In recent years genotyping methods have been implemented in blood banks as alternative to comprehensive serologic typing. We evaluated a newly developed assay for convenient and comprehensive genotyping of blood group alleles based on multiplex ligation-dependent probe amplification (MLPA)

  19. Validation of the performance of a GMO multiplex screening assay based on microarray detection

    NARCIS (Netherlands)

    Leimanis, S.; Hamels, S.; Naze, F.; Mbongolo, G.; Sneyers, M.; Hochegger, R.; Broll, H.; Roth, L.; Dallmann, K.; Micsinai, A.; Dijk, van J.P.; Kok, E.J.

    2008-01-01

    A new screening method for the detection and identification of GMO, based on the use of multiplex PCR followed by microarray, has been developed and is presented. The technology is based on the identification of quite ubiquitous GMO genetic target elements first amplified by PCR, followed by direct

  20. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  1. Development of silicon photonic microring resonator biosensors for multiplexed cytokine assays and in vitro diagnostics

    Science.gov (United States)

    Luchansky, Matthew Sam

    In order to guide critical care therapies that are personalized to a patient's unique disease state, a diagnostic or theranostic medical device must quickly provide a detailed biomolecular understanding of disease onset and progression. This detailed molecular understanding of cellular processes and pathways requires the ability to measure multiple analytes in parallel. Though many traditional sensing technologies for biomarker analysis and fundamental biological studies (i.e. enzyme-linked immunosorbent assays, real-time polymerase chain reaction, etc.) rely on single-parameter measurements, it has become increasingly clear that the inherent complexity of many human illnesses and pathways necessitates quantitative and multiparameter analysis of biological samples. Currently used analytical methods are deficient in that they often provide either highly quantitative data for a single biomarker or qualitative data for many targets, but methods that simultaneously provide highly quantitative analysis of many targets have yet to be adequately developed. Fields such as medical diagnostics and cellular biology would benefit greatly from a technology that enables rapid, quantitative and reproducible assays for many targets within a single sample. In an effort to fill this unmet need, this doctoral dissertation describes the development of a clinically translational biosensing technology based on silicon photonics and developed in the chemistry research laboratory of Ryan C. Bailey. Silicon photonic microring resonators, a class of high-Q optical sensors, represent a promising platform for rapid, multiparameter in vitro measurements. The original device design utilizes 32-ring arrays for real-time biomolecular sensing without fluorescent labels, and these optical biosensors display great potential for more highly multiplexed (100s-1000s) measurements based on the impressive scalability of silicon device fabrication. Though this technology can be used to detect a variety of

  2. Cell Painting, a high-content image-based assay for morphological profiling using multiplexed fluorescent dyes

    Science.gov (United States)

    Bray, Mark-Anthony; Singh, Shantanu; Han, Han; Davis, Chadwick T.; Borgeson, Blake; Hartland, Cathy; Kost-Alimova, Maria; Gustafsdottir, Sigrun M.; Gibson, Christopher C.; Carpenter, Anne E.

    2016-01-01

    In morphological profiling, quantitative data are extracted from microscopy images of cells to identify biologically relevant similarities and differences among samples based on these profiles. This protocol describes the design and execution of experiments using Cell Painting, a morphological profiling assay multiplexing six fluorescent dyes imaged in five channels, to reveal eight broadly relevant cellular components or organelles. Cells are plated in multi-well plates, perturbed with the treatments to be tested, stained, fixed, and imaged on a high-throughput microscope. Then, automated image analysis software identifies individual cells and measures ~1,500 morphological features (various measures of size, shape, texture, intensity, etc.) to produce a rich profile suitable for detecting subtle phenotypes. Profiles of cell populations treated with different experimental perturbations can be compared to suit many goals, such as identifying the phenotypic impact of chemical or genetic perturbations, grouping compounds and/or genes into functional pathways, and identifying signatures of disease. Cell culture and image acquisition takes two weeks; feature extraction and data analysis take an additional 1-2 weeks. PMID:27560178

  3. Fuzzy-logic based strategy for validation of multiplex methods: example with qualitative GMO assays.

    Science.gov (United States)

    Bellocchi, Gianni; Bertholet, Vincent; Hamels, Sandrine; Moens, W; Remacle, José; Van den Eede, Guy

    2010-02-01

    This paper illustrates the advantages that a fuzzy-based aggregation method could bring into the validation of a multiplex method for GMO detection (DualChip GMO kit, Eppendorf). Guidelines for validation of chemical, bio-chemical, pharmaceutical and genetic methods have been developed and ad hoc validation statistics are available and routinely used, for in-house and inter-laboratory testing, and decision-making. Fuzzy logic allows summarising the information obtained by independent validation statistics into one synthetic indicator of overall method performance. The microarray technology, introduced for simultaneous identification of multiple GMOs, poses specific validation issues (patterns of performance for a variety of GMOs at different concentrations). A fuzzy-based indicator for overall evaluation is illustrated in this paper, and applied to validation data for different genetically modified elements. Remarks were drawn on the analytical results. The fuzzy-logic based rules were shown to be applicable to improve interpretation of results and facilitate overall evaluation of the multiplex method.

  4. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

    Science.gov (United States)

    Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

    2013-01-01

    Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

  5. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  6. Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay

    Directory of Open Access Journals (Sweden)

    Dabisch-Ruthe Mareike

    2012-07-01

    Full Text Available Abstract Background A broad spectrum of pathogens is causative for respiratory tract infections, but symptoms are mostly similar. Therefore, the identification of the causative viruses and bacteria is only feasible using multiplex PCR or several monoplex PCR tests in parallel. Methods The analytical sensitivity of three multiplex PCR assays, RespiFinder-19, RespiFinder-SMART-22 and xTAG-Respiratory-Virus-Panel-Fast-Assay (RVP, were compared to monoplex real-time PCR with quantified standardized control material. All assays include the most common respiratory pathogens. Results To compare the analytical sensitivity of the multiplex assays, samples were inoculated with 13 different quantified viruses in the range of 101 to 105 copies/ml. Concordant results were received for rhinovirus, whereas the RVP detected influenzavirus, RSV and hMPV more frequently in low concentrations. The RespiFinder-19 and the RespiFinder-SMART-22 showed a higher analytical sensitivity for adenoviruses and coronaviruses, whereas the RVP was incapable to detect adenovirus and coronavirus in concentrations of 104 copies/ml. The RespiFinder-19 and RespiFinder-SMART-22A did not detect influenzaviruses (104 copies/ml and RSV (103 copies/ml. The detection of all 13 viruses in one sample was only achieved using monoplex PCR. To analyze possible competitive amplification reactions between the different viruses, samples were further inoculated with only 4 different viruses in one sample. Compared to the detection of 13 viruses in parallel, only a few differences were found. The incidence of respiratory viruses was compared in tracheal secretion (TS samples (n = 100 of mechanically ventilated patients in winter (n = 50 and summer (n = 50. In winter, respiratory viruses were detected in 32 TS samples (64% by RespiFinder-19, whereas the detection rate with RVP was only 22%. The most frequent viruses were adenovirus (32% and PIV-2 (20%. Multiple infections were detected

  7. High-throughput multiplex real-time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants.

    Science.gov (United States)

    Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N

    2016-05-01

    To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.

  8. Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO-LiPA HPV Genotyping Extra Assay▿

    OpenAIRE

    Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J.; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.

    2011-01-01

    Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...

  9. Microfluidic platform for multiplexed detection in single cells and methods thereof

    Science.gov (United States)

    Wu, Meiye; Singh, Anup K.

    2018-05-01

    The present invention relates to a microfluidic device and platform configured to conduct multiplexed analysis within the device. In particular, the device allows multiple targets to be detected on a single-cell level. Also provided are methods of performing multiplexed analyses to detect one or more target nucleic acids, proteins, and post-translational modifications.

  10. All Inkjet-Printed Amperometric Multiplexed Biosensors Based on Nanostructured Conductive Hydrogel Electrodes.

    Science.gov (United States)

    Li, Lanlan; Pan, Lijia; Ma, Zhong; Yan, Ke; Cheng, Wen; Shi, Yi; Yu, Guihua

    2018-02-12

    Multiplexing, one of the main trends in biosensors, aims to detect several analytes simultaneously by integrating miniature sensors on a chip. However, precisely depositing electrode materials and selective enzymes on distinct microelectrode arrays remains an obstacle to massively produced multiplexed sensors. Here, we report on a "drop-on-demand" inkjet printing process to fabricate multiplexed biosensors based on nanostructured conductive hydrogels in which the electrode material and several kinds of enzymes were printed on the electrode arrays one by one by employing a multinozzle inkjet system. The whole inkjet printing process can be finished within three rounds of printing and only one round of alignment. For a page of sensor arrays containing 96 working electrodes, the printing process took merely ∼5 min. The multiplexed assays can detect glucose, lactate, and triglycerides in real time with good selectivity and high sensitivity, and the results in phosphate buffer solutions and calibration serum samples are comparable. The inkjet printing process exhibited advantages of high efficiency and accuracy, which opens substantial possibilities for massive fabrication of integrated multiplexed biosensors for human health monitoring.

  11. Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

    Science.gov (United States)

    Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

    2017-10-01

    Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

    Science.gov (United States)

    Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

    2014-07-01

    A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

  13. Molecular beacon probes-base multiplex NASBA Real-time for detection of HIV-1 and HCV.

    Science.gov (United States)

    Mohammadi-Yeganeh, S; Paryan, M; Mirab Samiee, S; Kia, V; Rezvan, H

    2012-06-01

    Developed in 1991, nucleic acid sequence-based amplification (NASBA) has been introduced as a rapid molecular diagnostic technique, where it has been shown to give quicker results than PCR, and it can also be more sensitive. This paper describes the development of a molecular beacon-based multiplex NASBA assay for simultaneous detection of HIV-1 and HCV in plasma samples. A well-conserved region in the HIV-1 pol gene and 5'-NCR of HCV genome were used for primers and molecular beacon design. The performance features of HCV/HIV-1 multiplex NASBA assay including analytical sensitivity and specificity, clinical sensitivity and clinical specificity were evaluated. The analysis of scalar concentrations of the samples indicated that the limit of quantification of the assay was beacon probes detected all HCV genotypes and all major variants of HIV-1. This method may represent a relatively inexpensive isothermal method for detection of HIV-1/HCV co-infection in monitoring of patients.

  14. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Energy Technology Data Exchange (ETDEWEB)

    Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  15. Longitudinal Multiplexed Measurement of Quantitative Proteomic Signatures in Mouse Lymphoma Models Using Magneto-Nanosensors.

    Science.gov (United States)

    Lee, Jung-Rok; Appelmann, Iris; Miething, Cornelius; Shultz, Tyler O; Ruderman, Daniel; Kim, Dokyoon; Mallick, Parag; Lowe, Scott W; Wang, Shan X

    2018-01-01

    Cancer proteomics is the manifestation of relevant biological processes in cancer development. Thus, it reflects the activities of tumor cells, host-tumor interactions, and systemic responses to cancer therapy. To understand the causal effects of tumorigenesis or therapeutic intervention, longitudinal studies are greatly needed. However, most of the conventional mouse experiments are unlikely to accommodate frequent collection of serum samples with a large enough volume for multiple protein assays towards single-object analysis. Here, we present a technique based on magneto-nanosensors to longitudinally monitor the protein profiles in individual mice of lymphoma models using a small volume of a sample for multiplex assays. Methods: Drug-sensitive and -resistant cancer cell lines were used to develop the mouse models that render different outcomes upon the drug treatment. Two groups of mice were inoculated with each cell line, and treated with either cyclophosphamide or vehicle solution. Serum samples taken longitudinally from each mouse in the groups were measured with 6-plex magneto-nanosensor cytokine assays. To find the origin of IL-6, experiments were performed using IL-6 knock-out mice. Results: The differences in serum IL-6 and GCSF levels between the drug-treated and untreated groups were revealed by the magneto-nanosensor measurement on individual mice. Using the multiplex assays and mouse models, we found that IL-6 is secreted by the host in the presence of tumor cells upon the drug treatment. Conclusion: The multiplex magneto-nanosensor assays enable longitudinal proteomic studies on mouse tumor models to understand tumor development and therapy mechanisms more precisely within a single biological object.

  16. A novel, multiplexed, probe-based quantitative PCR assay for the soybean root- and stem-rot pathogen, Phytophthora sojae, utilizes its transposable element.

    Science.gov (United States)

    Haudenshield, James S; Song, Jeong Y; Hartman, Glen L

    2017-01-01

    Phytophthora root rot of soybean [Glycine max (L.) Merr.] is caused by the oomycete Phytophthora sojae (Kaufm. & Gerd.). P. sojae has a narrow host range, consisting primarily of soybean, and it is a serious pathogen worldwide. It exists in root and stem tissues as mycelium, wherein it can form oospores which subsequently germinate to release motile, infectious zoospores. Molecular assays detecting DNA of P. sojae are useful in disease diagnostics, and for determining the presence of the organism in host tissues, soils, and runoff or ponded water from potentially infested fields. Such assays as published have utilized ITS sequences from the nuclear ribosomal RNA genes in conventional PCR or dye-binding quantitative PCR (Q-PCR) but are not amenable to multiplexing, and some of these assays did not utilize control strategies for type I or type II errors. In this study, we describe primers and a bifunctional probe with specificity to a gypsy-like retroelement in the P. sojae genome to create a fluorogenic 5'-exonuclease linear hydrolysis assay, with a multiplexed internal control reaction detecting an exogenous target to validate negative calls, and with uracil-deglycosylase-mediated protection against carryover contamination. The assay specifically detected 13 different P. sojae isolates, and excluded 17 other Phytophthora species along with 20 non-Phytophthora fungal and oomycete species pathogenic on soybean. A diagnostic limit of detection of 34 fg total P. sojae DNA was observed in serial dilutions, equivalent to 0.3 genome, and a practical detection sensitivity of four zoospores per sample was achieved, despite losses during DNA extraction.

  17. A new multiplex assay of 17 autosomal STRs and Amelogenin for forensic application.

    Directory of Open Access Journals (Sweden)

    Suhua Zhang

    Full Text Available This paper describes a newly devised autosomal short tandem repeat (STR multiplex polymerase chain reaction (PCR systems for 17 autosomal loci (D1S1656, D2S441, D3S1358, D3S3045, D6S477, D7S3048, D8S1132, D10S1435, D10S1248, D11S2368, D13S325, D14S608, D15S659, D17S1290, D18S535, D19S253 and D22-GATA198B05 and Amelogenin. Primers for the loci were designed and optimized so that all of the amplicons were distributed from 50 base pairs (bp to less than 500 bp within a five-dye chemistry design with the fifth dye reserved for the sizing standard. Strategies were developed to overcome challenges that encountered in creating the final assay. The limits of the multiplex were tested, resulting in the successful amplification of genomic DNA range from 0.25-4 ng with 30 PCR cycles. A total of 681 individuals from the Chinese Han population were studied and forensic genetic data were present. No significant deviations from Hardy-Weinberg equilibrium were observed. A total of 180 alleles were detected for the 17 autosomal STRs. The cumulative mean exclusion chance in duos (CMECD was 0.999967, and cumulative mean exclusion chance in trios (CMECT was 0.99999995. We conclude that the present 17plex autosomal STRs assay provides an additional powerful tool for forensic applications.

  18. Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods†

    Science.gov (United States)

    Jean, Julie; D'Souza, Doris H.; Jaykus, Lee-Ann

    2004-01-01

    Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10−1 reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 100 to 102 reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods. PMID:15528524

  19. Multiplex nucleic acid sequence-based amplification for simultaneous detection of several enteric viruses in model ready-to-eat foods.

    Science.gov (United States)

    Jean, Julie; D'Souza, Doris H; Jaykus, Lee-Ann

    2004-11-01

    Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10(-1) reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 10(0) to 10(2) reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods.

  20. Polarization-multiplexing ghost imaging

    Science.gov (United States)

    Dongfeng, Shi; Jiamin, Zhang; Jian, Huang; Yingjian, Wang; Kee, Yuan; Kaifa, Cao; Chenbo, Xie; Dong, Liu; Wenyue, Zhu

    2018-03-01

    A novel technique for polarization-multiplexing ghost imaging is proposed to simultaneously obtain multiple polarimetric information by a single detector. Here, polarization-division multiplexing speckles are employed for object illumination. The light reflected from the objects is detected by a single-pixel detector. An iterative reconstruction method is used to restore the fused image containing the different polarimetric information by using the weighted sum of the multiplexed speckles based on the correlation coefficients obtained from the detected intensities. Next, clear images of the different polarimetric information are recovered by demultiplexing the fused image. The results clearly demonstrate that the proposed method is effective.

  1. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    Science.gov (United States)

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  2. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  3. Microsatellite multiplex assay for the coral-eating crown-of-thorns starfish, Acanthaster cf. planci

    KAUST Repository

    Harrison, Hugo B.

    2015-03-20

    Population outbreaks of crown-of-thorns starfish (Acanthaster spp.) represent one of the most significant biological disturbances on Indo-Pacific coral reefs. Here, we combine 15 published and 11 newly isolated polymorphic microsatellite markers from the coral-eating starfish, A. cf. planci and describe their integration into four multiplex PCRs. All markers were polymorphic with a mean of 11.7 ± 1.9 SE alleles per locus and an average observed heterozygosity of 0.619 ± 0.049 SE across 195 genotyped individuals from the Great Barrier Reef. This multiplex assay provides an effective means of investigating the population dynamics of crown-of-thorns starfish and the initiation and spread of population outbreaks.

  4. Microsatellite multiplex assay for the coral-eating crown-of-thorns starfish, Acanthaster cf. planci

    KAUST Repository

    Harrison, Hugo B.; Saenz Agudelo, Pablo; Al-Salamah, Manalle; Messmer, Vanessa; Pratchett, Morgan S.; Berumen, Michael L.

    2015-01-01

    Population outbreaks of crown-of-thorns starfish (Acanthaster spp.) represent one of the most significant biological disturbances on Indo-Pacific coral reefs. Here, we combine 15 published and 11 newly isolated polymorphic microsatellite markers from the coral-eating starfish, A. cf. planci and describe their integration into four multiplex PCRs. All markers were polymorphic with a mean of 11.7 ± 1.9 SE alleles per locus and an average observed heterozygosity of 0.619 ± 0.049 SE across 195 genotyped individuals from the Great Barrier Reef. This multiplex assay provides an effective means of investigating the population dynamics of crown-of-thorns starfish and the initiation and spread of population outbreaks.

  5. Barcoded microchips for biomolecular assays.

    Science.gov (United States)

    Zhang, Yi; Sun, Jiashu; Zou, Yu; Chen, Wenwen; Zhang, Wei; Xi, Jianzhong Jeff; Jiang, Xingyu

    2015-01-20

    Multiplexed assay of analytes is of great importance for clinical diagnostics and other analytical applications. Barcode-based bioassays with the ability to encode and decode may realize this goal in a straightforward and consistent manner. We present here a microfluidic barcoded chip containing several sets of microchannels with different widths, imitating the commonly used barcode. A single barcoded microchip can carry out tens of individual protein/nucleic acid assays (encode) and immediately yield all assay results by a portable barcode reader or a smartphone (decode). The applicability of a barcoded microchip is demonstrated by human immunodeficiency virus (HIV) immunoassays for simultaneous detection of three targets (anti-gp41 antibody, anti-gp120 antibody, and anti-gp36 antibody) from six human serum samples. We can also determine seven pathogen-specific oligonucleotides by a single chip containing both positive and negative controls.

  6. A high-throughput multiplex method adapted for GMO detection.

    Science.gov (United States)

    Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique

    2008-12-24

    A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.

  7. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox

  8. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m

  9. Simulation Performance of Multiple-Input Multiple-Output Systems Employing Single-Carrier Modulation and Orthogonal Frequency Division Multiplexing

    National Research Council Canada - National Science Library

    Saglam, Halil D

    2004-01-01

    ...) systems utilizing Alamouti-based space-time block coding (STBC) technique. The MIMO communication systems using STBC technique employing both single-carrier modulation and orthogonal frequency division multiplexing (OFDM...

  10. Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

    Science.gov (United States)

    Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

    2017-08-17

    Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

  11. Design and numerical optimization of a mode multiplexer based on few-mode fiber couplers

    International Nuclear Information System (INIS)

    Xie, Yiwei; Fu, Songnian; Liu, Hai; Zhang, Hailiang; Tang, Ming; Liu, Deming; Shum, P

    2013-01-01

    Mode division multiplexing (MDM) transmission based on few-mode fibers (FMFs) appears to be an alternative solution for overcoming the capacity limit of single-mode fibers (SMFs). A FMF coupler-based mode division multiplexer/demultiplexer (MMUX/DeMMUX) is proposed and theoretically investigated after the fabricated FMF is characterized. MMUXs/DeMMUXs with a mode contrast ratio (MCR) of more than 20 dB can be obtained for two-mode multiplexing and three-mode multiplexing over a wavelength span of 60 and 10 nm, respectively. We numerically verify the proposed MMUX/DeMMUX which has the advantages of high MCR, easy fabrication and maintenance, and low wavelength dependence. (paper)

  12. Multiplexed single-molecule force spectroscopy using a centrifuge.

    Science.gov (United States)

    Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P

    2016-03-17

    We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.

  13. Rapid focused sequencing: a multiplexed assay for simultaneous detection and strain typing of Bacillus anthracis, Francisella tularensis, and Yersinia pestis.

    Directory of Open Access Journals (Sweden)

    Rosemary S Turingan

    Full Text Available BACKGROUND: The intentional release of Bacillus anthracis in the United States in 2001 has heightened concern about the use of pathogenic microorganisms in bioterrorism attacks. Many of the deadliest bacteria, including the Class A Select Agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis, are highly infectious via the pulmonary route when released in aerosolized form. Hence, rapid, sensitive, and reliable methods for detection of these biothreats and characterization of their potential impact on the exposed population are of critical importance to initiate and support rapid military, public health, and clinical responses. METHODOLOGY/PRINCIPAL FINDINGS: We have developed microfluidic multiplexed PCR and sequencing assays based on the simultaneous interrogation of three pathogens per assay and ten loci per pathogen. Microfluidic separation of amplified fluorescently labeled fragments generated characteristic electrophoretic signatures for identification of each agent. The three sets of primers allowed significant strain typing and discrimination from non-pathogenic closely-related species and environmental background strains based on amplicon sizes alone. Furthermore, sequencing of the 10 amplicons per pathogen, termed "Rapid Focused Sequencing," allowed an even greater degree of strain discrimination and, in some cases, can be used to determine virulence. Both amplification and sequencing assays were performed in microfluidic biochips developed for fast thermal cycling and requiring 7 µL per reaction. The 30-plex sequencing assay resulted in genotypic resolution of 84 representative strains belonging to each of the three biothreat species. CONCLUSIONS/SIGNIFICANCE: The microfluidic multiplexed assays allowed identification and strain differentiation of the biothreat agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis and clear discrimination from closely-related species and several environmental

  14. Multiplex assay (Mikrogen recomBead) for detection of serum IgG and IgM antibodies to 13 recombinant antigens of Borrelia burgdorferi sensu lato in patients with neuroborreliosis

    DEFF Research Database (Denmark)

    Dessau, Ram Benny; Møller, Jens K.; Kolmos, Birte

    2015-01-01

    A multiplex-bead-based assay for the detection of serum antibodies to Borrelia burgdorferi sensu lato was evaluated. The assay contained 13 different antigens in both the IgG and the IgM assay; thus, a total of 26 measurement results were available from each sample. A total of 49 Danish patients......, the construction of a diagnostic score, evaluation of the scoring method using an independent dataset and an assessment of the analytical quality of the multiplex assay. The VlsE IgG had the highest diagnostic value with an AUC (area under the curve) of 96% on the receiver operating characteristic curve. The Osp......C IgM had AUCs just above 80%. All the other antigens had both low quantitative reactivity and lower contrast in the patients with LNB compared to controls. The diagnostic value of the assay may be improved by using a logistic model giving a sensitivity of 90 and 79% for the specificities at 92 and 98...

  15. Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay

    Science.gov (United States)

    Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

    2016-01-01

    The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 104 CFU mL−1 or 105 CFU mL−1 for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R2) of 0.916–0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water. PMID:26884128

  16. A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

    Science.gov (United States)

    Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

    2018-04-01

    Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional

  17. Development of a rapid SNP-typing assay to differentiate Bifidobacterium animalis ssp. lactis strains used in probiotic-supplemented dairy products.

    Science.gov (United States)

    Lomonaco, Sara; Furumoto, Emily J; Loquasto, Joseph R; Morra, Patrizia; Grassi, Ausilia; Roberts, Robert F

    2015-02-01

    Identification at the genus, species, and strain levels is desirable when a probiotic microorganism is added to foods. Strains of Bifidobacterium animalis ssp. lactis (BAL) are commonly used worldwide in dairy products supplemented with probiotic strains. However, strain discrimination is difficult because of the high degree of genome identity (99.975%) between different genomes of this subspecies. Typing of monomorphic species can be carried out efficiently by targeting informative single nucleotide polymorphisms (SNP). Findings from a previous study analyzing both reference and commercial strains of BAL identified SNP that could be used to discriminate common strains into 8 groups. This paper describes development of a minisequencing assay based on the primer extension reaction (PER) targeting multiple SNP that can allow strain differentiation of BAL. Based on previous data, 6 informative SNP were selected for further testing, and a multiplex preliminary PCR was optimized to amplify the DNA regions containing the selected SNP. Extension primers (EP) annealing immediately adjacent to the selected SNP were developed and tested in simplex and multiplex PER to evaluate their performance. Twenty-five strains belonging to 9 distinct genomic clusters of B. animalis ssp. lactis were selected and analyzed using the developed minisequencing assay, simultaneously targeting the 6 selected SNP. Fragment analysis was subsequently carried out in duplicate and demonstrated that the assay yielded 8 specific profiles separating the most commonly used commercial strains. This novel multiplex PER approach provides a simple, rapid, flexible SNP-based subtyping method for proper characterization and identification of commercial probiotic strains of BAL from fermented dairy products. To assess the usefulness of this method, DNA was extracted from yogurt manufactured with and without the addition of B. animalis ssp. lactis BB-12. Extracted DNA was then subjected to the minisequencing

  18. Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

    Science.gov (United States)

    Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

    2015-07-07

    Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

  19. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis

  20. On-chip single photon filtering and multiplexing in hybrid quantum photonic circuits.

    Science.gov (United States)

    Elshaari, Ali W; Zadeh, Iman Esmaeil; Fognini, Andreas; Reimer, Michael E; Dalacu, Dan; Poole, Philip J; Zwiller, Val; Jöns, Klaus D

    2017-08-30

    Quantum light plays a pivotal role in modern science and future photonic applications. Since the advent of integrated quantum nanophotonics different material platforms based on III-V nanostructures-, colour centers-, and nonlinear waveguides as on-chip light sources have been investigated. Each platform has unique advantages and limitations; however, all implementations face major challenges with filtering of individual quantum states, scalable integration, deterministic multiplexing of selected quantum emitters, and on-chip excitation suppression. Here we overcome all of these challenges with a hybrid and scalable approach, where single III-V quantum emitters are positioned and deterministically integrated in a complementary metal-oxide-semiconductor-compatible photonic circuit. We demonstrate reconfigurable on-chip single-photon filtering and wavelength division multiplexing with a foot print one million times smaller than similar table-top approaches, while offering excitation suppression of more than 95 dB and efficient routing of single photons over a bandwidth of 40 nm. Our work marks an important step to harvest quantum optical technologies' full potential.Combining different integration platforms on the same chip is currently one of the main challenges for quantum technologies. Here, Elshaari et al. show III-V Quantum Dots embedded in nanowires operating in a CMOS compatible circuit, with controlled on-chip filtering and tunable routing.

  1. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  2. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus

    NARCIS (Netherlands)

    E. Ghaznavi Rad (Ehsanollah); N.S. Mariana (Nor Shamsudin); Z. Sekawi (Zamberi); A.F. van Belkum (Alex); V. Neela (Vasanthakumari)

    2010-01-01

    textabstractA multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus

  3. A high throughput single nucleotide polymorphism multiplex assay for parentage assignment in New Zealand sheep.

    Directory of Open Access Journals (Sweden)

    Shannon M Clarke

    Full Text Available Accurate pedigree information is critical to animal breeding systems to ensure the highest rate of genetic gain and management of inbreeding. The abundance of available genomic data, together with development of high throughput genotyping platforms, means that single nucleotide polymorphisms (SNPs are now the DNA marker of choice for genomic selection studies. Furthermore the superior qualities of SNPs compared to microsatellite markers allows for standardization between laboratories; a property that is crucial for developing an international set of markers for traceability studies. The objective of this study was to develop a high throughput SNP assay for use in the New Zealand sheep industry that gives accurate pedigree assignment and will allow a reduction in breeder input over lambing. This required two phases of development--firstly, a method of extracting quality DNA from ear-punch tissue performed in a high throughput cost efficient manner and secondly a SNP assay that has the ability to assign paternity to progeny resulting from mob mating. A likelihood based approach to infer paternity was used where sires with the highest LOD score (log of the ratio of the likelihood given parentage to likelihood given non-parentage are assigned. An 84 "parentage SNP panel" was developed that assigned, on average, 99% of progeny to a sire in a problem where there were 3,000 progeny from 120 mob mated sires that included numerous half sib sires. In only 6% of those cases was there another sire with at least a 0.02 probability of paternity. Furthermore dam information (either recorded, or by genotyping possible dams was absent, highlighting the SNP test's suitability for paternity testing. Utilization of this parentage SNP assay will allow implementation of progeny testing into large commercial farms where the improved accuracy of sire assignment and genetic evaluations will increase genetic gain in the sheep industry.

  4. Development of a multiplex PCR assay for fine-scale population genetic analysis of the Komodo monitor Varanus komodoensis based on 18 polymorphic microsatellite loci.

    Science.gov (United States)

    Ciofi, Claudio; Tzika, Athanasia C; Natali, Chiara; Watts, Phillip C; Sulandari, Sri; Zein, Moch S A; Milinkovitch, Michel C

    2011-05-01

    Multiplex PCR assays for the coamplification of microsatellite loci allow rapid and cost-effective genetic analyses and the production of efficient screening protocols for international breeding programs. We constructed a partial genomic library enriched for di-nucleotide repeats and characterized 14 new microsatellite loci for the Komodo monitor (or Komodo dragon, Varanus komodoensis). Using these novel microsatellites and four previously described loci, we developed multiplex PCR assays that may be loaded on a genetic analyser in three separate panels. We tested the novel set of microsatellites for polymorphism using 69 individuals from three island populations and evaluated the resolving power of the entire panel of 18 loci by conducting (i) a preliminary assignment test to determine population(s) of origin and (ii) a parentage analysis for 43 captive Komodo monitors. This panel of polymorphic loci proved useful for both purposes and thus can be exploited for fine-scale population genetic analyses and as part of international captive breeding programs directed at maintaining genetically viable ex situ populations and reintroductions. © 2011 Blackwell Publishing Ltd.

  5. Rapid detection and strain typing of Chlamydia trachomatis using a highly multiplexed microfluidic PCR assay.

    Directory of Open Access Journals (Sweden)

    Rosemary S Turingan

    Full Text Available Nucleic acid amplification tests (NAATs are recommended by the CDC for detection of Chlamydia trachomatis (Ct urogenital infections. Current commercial NAATs require technical expertise and sophisticated laboratory infrastructure, are time-consuming and expensive, and do not differentiate the lymphogranuloma venereum (LGV strains that require a longer duration of treatment than non-LGV strains. The multiplexed microfluidic PCR-based assay presented in this work simultaneously interrogates 13 loci to detect Ct and identify LGV and non-LGV strain-types. Based on amplified fragment length polymorphisms, the assay differentiates LGV, ocular, urogenital, and proctocolitis clades, and also serovars L1, L2, and L3 within the LGV group. The assay was evaluated in a blinded fashion using 95 clinical swabs, with 76 previously reported as urogenital Ct-positive samples and typed by ompA genotyping and/or Multi-Locus Sequence Typing. Results of the 13-plex assay showed that 51 samples fell within urogenital clade 2 or 4, 24 samples showed both clade 2 and 4 signatures, indicating possible mixed infection, gene rearrangement, or inter-clade recombination, and one sample was a noninvasive trachoma biovar (either a clade 3 or 4. The remaining 19 blinded samples were correctly identified as LGV clade 1 (3, ocular clade 3 (4, or as negatives (12. To date, no NAAT assay can provide a point-of-care applicable turnaround time for Ct detection while identifying clinically significant Ct strain types to inform appropriate treatment. Coupled with rapid DNA processing of clinical swabs (approximately 60 minutes from swab-in to result-out, the assay has significant potential as a rapid POC diagnostic for Ct infections.

  6. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Trisadee Khamlor

    2014-10-01

    Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  7. Upconversion Nanoparticles-Encoded Hydrogel Microbeads-Based Multiplexed Protein Detection

    Science.gov (United States)

    Shikha, Swati; Zheng, Xiang; Zhang, Yong

    2018-06-01

    Fluorescently encoded microbeads are in demand for multiplexed applications in different fields. Compared to organic dye-based commercially available Luminex's xMAP technology, upconversion nanoparticles (UCNPs) are better alternatives due to their large anti-Stokes shift, photostability, nil background, and single wavelength excitation. Here, we developed a new multiplexed detection system using UCNPs for encoding poly(ethylene glycol) diacrylate (PEGDA) microbeads as well as for labeling reporter antibody. However, to prepare UCNPs-encoded microbeads, currently used swelling-based encapsulation leads to non-uniformity, which is undesirable for fluorescence-based multiplexing. Hence, we utilized droplet microfluidics to obtain encoded microbeads of uniform size, shape, and UCNPs distribution inside. Additionally, PEGDA microbeads lack functionality for probe antibodies conjugation on their surface. Methods to functionalize the surface of PEGDA microbeads (acrylic acid incorporation, polydopamine coating) reported thus far quench the fluorescence of UCNPs. Here, PEGDA microbeads surface was coated with silica followed by carboxyl modification without compromising the fluorescence intensity of UCNPs. In this study, droplet microfluidics-assisted UCNPs-encoded microbeads of uniform shape, size, and fluorescence were prepared. Multiple color codes were generated by mixing UCNPs emitting red and green colors at different ratios prior to encapsulation. UCNPs emitting blue color were used to label the reporter antibody. Probe antibodies were covalently immobilized on red UCNPs-encoded microbeads for specific capture of human serum albumin (HSA) as a model protein. The system was also demonstrated for multiplexed detection of both human C-reactive protein (hCRP) and HSA protein by immobilizing anti-hCRP antibodies on green UCNPs.

  8. Fluorescence-intensity multiplexing: simultaneous seven-marker, two-color immunophenotyping using flow cytometry.

    Science.gov (United States)

    Bradford, Jolene A; Buller, Gayle; Suter, Michael; Ignatius, Michael; Beechem, Joseph M

    2004-10-01

    Conventional immuno-based multiparameter flow cytometric analysis has been limited by the requirement of a dedicated detection channel for each antibody-fluorophore set. To address the need to resolve multiple biological targets simultaneously, flow cytometers with as many as 10-15 detection channels have been developed. In this study, a new Zenon immunolabeling technology is developed that allows for multiple antigen detection per detection channel using a single fluorophore, through a unique method of fluorescence-intensity multiplexing. By varying the Zenon labeling reagent-to-antibody molar ratio, the fluorescence intensity of the antibody-labeled cellular targets can be used as a unique identifier. Although demonstrated in the present study with lymphocyte immunophenotyping, this approach is broadly applicable for any immuno-based multiplexed flow cytomety assay. Lymphocyte immunophenotyping of 38 clinical blood specimens using CD3, CD4, CD8, CD16, CD56, CD19, and CD20 antibodies was performed using conventional flow cytometric analysis and fluorescence-intensity multiplexing analysis. Conventional analysis measures a single antibody-fluorophore per photomultiplier tube (PMT). Fluorescence-intensity multiplex analysis simultaneously measures seven markers with two PMTs, using Zenon labeling reagent-antibody complexes in a single tube: CD19, CD4, CD8, and CD16 antibodies labeled with Zenon Alexa Fluor 488 Mouse IgG(1) labeling reagent and CD56, CD3, and CD20 antibodies labeled with Zenon R-Phycoerythrin (R-PE) Mouse IgG(1) or IgG(2b) labeling reagents. The lymphocyte immunophenotyping results from fluorescence-intensity multiplexing using Zenon labeling reagents in a single tube were comparable to results from conventional flow cytometric analysis. Simultaneous evaluation of multiple antigens using a single fluorophore can be performed using antibodies labeled with varying ratios of a Zenon labeling reagent. Labeling two sets of antibodies with different Zenon

  9. Multiplex real-time PCR for the detection and quantification of latent and persistent viral genomes in cellular or plasma blood fractions.

    Science.gov (United States)

    Compston, Lara Isobel; Sarkobie, Francis; Li, Chengyao; Candotti, Daniel; Opare-Sem, Ohene; Allain, Jean-Pierre

    2008-07-01

    In common with latent viruses such as herpesviruses, parvovirus B19, HBV and GBV-C are contained successfully by the immune response and persist in the host. When immune control breaks down, reactivation of both latent and persistent viruses occurs. Two multiplex assays were developed (B19, HBV, HHV-8), (EBV, CMV, VZV) for blood screening, and tested on blood donor samples from Ghana to determine baseline prevalence of viraemia in immunocompetent persons. Single-virus real-time quantitative PCR (qPCR) assays were optimised for viral load determination of positive initial screening. The qPCR method utilised was absolute quantification with external standards. Multiplex and single-virus qPCR assays had similar sensitivity, except for the B19 assay in which sensitivity was 100-fold lower. Assays were optimised for reproducibility and repeatability, with R(2) of 0.9 being obtained for most assays. With the exception of B19 and CMV, assays had 100% detection limit ranging between 10(1) and 10(2) copies, IU or arbitrary units under single-virus and multiplex assay conditions. The prevalence of viraemia was 1.6% HBV (0.8% DNA+/HBsAg-, 0.8% DNA+/HBsAg+), 0.8% parvovirus B19, and 3.3% GBV-C viraemia in the plasma fraction. The prevalence of four herpesviruses was 1.0% HHV-8, 0.85% CMV, and 8.3% EBV, and no detectable VZV viraemia.

  10. Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay

    Science.gov (United States)

    Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

    2016-01-01

    For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566

  11. Development of a multiplex methylation-specific PCR as candidate triage test for women with an HPV-positive cervical scrape

    International Nuclear Information System (INIS)

    Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM

    2012-01-01

    Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions

  12. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    International Nuclear Information System (INIS)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-01

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal

  13. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  14. A single-tube 27-plex SNP assay for estimating individual ancestry and admixture from three continents.

    Science.gov (United States)

    Wei, Yi-Liang; Wei, Li; Zhao, Lei; Sun, Qi-Fan; Jiang, Li; Zhang, Tao; Liu, Hai-Bo; Chen, Jian-Gang; Ye, Jian; Hu, Lan; Li, Cai-Xia

    2016-01-01

    A single-tube multiplex assay of a small set of ancestry-informative markers (AIMs) for effectively estimating individual ancestry and admixture is an ideal forensic tool to trace the population origin of an unknown DNA sample. We present a newly developed 27-plex single nucleotide polymorphism (SNP) panel with highly robust and balanced differential power to perfectly assign individuals to African, European, and East Asian ancestries. Evaluating 968 previously described intercontinental AIMs from three HapMap population genotyping datasets (Yoruban in Ibadan, Nigeria (YRI); Utah residents with Northern and Western European ancestry from the Centre de'Etude du Polymorphism Humain (CEPH) collection (CEU); and Han Chinese in Beijing, China (CHB)), the best set of markers was selected on the basis of Hardy-Weinberg equilibrium (p > 0.00001), population-specific allele frequency (two of three δ values >0.5), according to linkage disequilibrium (r (2) ancestry of the 11 populations in the HapMap project. Then, we tested the 27-plex SNP assay with 1164 individuals from 17 additional populations. The results demonstrated that the SNP panel was successful for ancestry inference of individuals with African, European, and East Asian ancestry. Furthermore, the system performed well when inferring the admixture of Eurasians (EUR/EAS) after analyzing admixed populations from Xinjiang (Central Asian) as follows: Tajik (68:27), Uyghur (49:46), Kirgiz (40:57), and Kazak (36:60). For individual analyses, we interpreted each sample with a three-ancestry component percentage and a population match probability sequence. This multiplex assay is a convenient and cost-effective tool to assist in criminal investigations, as well as to correct for the effects of population stratification for case-control studies.

  15. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    Science.gov (United States)

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

  16. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins

    Science.gov (United States)

    Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R.

    2011-09-01

    Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells.

  17. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins.

    Science.gov (United States)

    Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R

    2011-09-01

    Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells. © 2011 American Institute of Physics

  18. Multiplex real-time PCR assays for detection of eight Shiga toxin-producing Escherichia coli in food samples by melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2015-12-23

    Shiga toxin-producing Escherichia coli (STEC) are pathogenic strains of E. coli that can cause bloody diarrhea and kidney failure. Seven STEC serogroups, O157, O26, O45, O103, O111, O121 and O145 are responsible for more than 71% of the total infections caused by this group of pathogens. All seven serogroups are currently considered as adulterants in non-intact beef products in the U.S. In this study, two multiplex melt curve real-time PCR assays with internal amplification controls (IACs) were standardized for the detection of eight STEC serogroups. The first multiplex assay targeted E. coli serogroups O145, O121, O104, and O157; while the second set detected E. coli serogroups O26, O45, O103 and O111. The applicability of the assays was tested using 11 different meat and produce samples. For food samples spiked with a cocktail of four STEC serogroups with a combined count of 10 CFU/25 g food, all targets of the multiplex assays were detected after an enrichment period of 6h. The assays also worked efficiently when 325 g of food samples were spiked with 10 CFU of STECs. The assays are not dependent on fluorescent-labeled probes or immunomagnetic beads, and can be used for the detection of eight STEC serogroups in less than 11h. Routine preliminary screening of STECs in food samples is performed by testing for the presence of STEC virulence genes. The assays developed in this study can be useful as a first- or second-tier test for the identification of the eight O serogroup-specific genes in suspected food samples. Copyright © 2015. Published by Elsevier B.V.

  19. Multiplex immunoassay for persistent organic pollutants in tilapia: comparison of imaging- and flow cytometry-based platforms using spectrally encoded paramagnetic microspheres

    NARCIS (Netherlands)

    Meimaridou, A.; Haasnoot, W.; Shelver, W.L.; Franek, M.; Nielen, M.W.F.

    2013-01-01

    Recent developments in spectrally encoded microspheres (SEMs)-based technologies provide high multiplexing possibilities. Most SEMs-based assays require a flow cytometer with sophisticated fluidics and optics. A new imaging super-paramagnetic SEMs-based alternative platform transports SEMs with

  20. Designing and application of SAN extension interface based on CWDM

    Science.gov (United States)

    Qin, Leihua; Yu, Shengsheng; Zhou, Jingli

    2005-11-01

    As Fibre Channel (FC) becomes the protocol of choice within corporate data centers, enterprises are increasingly deploying SANs in their data central. In order to mitigate the risk of losing data and improve the availability of data, more and more enterprises are increasingly adopting storage extension technologies to replicate their business critical data to a secondary site. Transmitting this information over distance requires a carrier grade environment with zero data loss, scalable throughput, low jitter, high security and ability to travel long distance. To address this business requirements, there are three basic architectures for storage extension, they are Storage over Internet Protocol, Storage over Synchronous Optical Network/Synchronous Digital Hierarchy (SONET/SDH) and Storage over Dense Wavelength Division Multiplexing (DWDM). Each approach varies in functionality, complexity, cost, scalability, security, availability , predictable behavior (bandwidth, jitter, latency) and multiple carrier limitations. Compared with these connectiviy technologies,Coarse Wavelength Division Multiplexing (CWDM) is a Simplified, Low Cost and High Performance connectivity solutions for enterprises to deploy their storage extension. In this paper, we design a storage extension connectivity over CWDM and test it's electrical characteristic and random read and write performance of disk array through the CWDM connectivity, testing result show us that the performance of the connectivity over CWDM is acceptable. Furthermore, we propose three kinds of network architecture of SAN extension based on CWDM interface. Finally the credit-Based flow control mechanism of FC, and the relationship between credits and extension distance is analyzed.

  1. Flow Cytometry Enables Multiplexed Measurements of Genetically Encoded Intramolecular FRET Sensors Suitable for Screening.

    Science.gov (United States)

    Doucette, Jaimee; Zhao, Ziyan; Geyer, Rory J; Barra, Melanie M; Balunas, Marcy J; Zweifach, Adam

    2016-07-01

    Genetically encoded sensors based on intramolecular FRET between CFP and YFP are used extensively in cell biology research. Flow cytometry has been shown to offer a means to measure CFP-YFP FRET; we suspected it would provide a unique way to conduct multiplexed measurements from cells expressing different FRET sensors, which is difficult to do with microscopy, and that this could be used for screening. We confirmed that flow cytometry accurately measures FRET signals using cells transiently transfected with an ERK activity reporter, comparing responses measured with imaging and cytometry. We created polyclonal long-term transfectant lines, each expressing a different intramolecular FRET sensor, and devised a way to bar-code four distinct populations of cells. We demonstrated the feasibility of multiplexed measurements and determined that robust multiplexed measurements can be conducted in plate format. To validate the suitability of the method for screening, we measured responses from a plate of bacterial extracts that in unrelated experiments we had determined contained the protein kinase C (PKC)-activating compound teleocidin A-1. The multiplexed assay correctly identifying the teleocidin A-1-containing well. We propose that multiplexed cytometric FRET measurements will be useful for analyzing cellular function and for screening compound collections. © 2016 Society for Laboratory Automation and Screening.

  2. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  3. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Directory of Open Access Journals (Sweden)

    Larry Gold

    2010-12-01

    Full Text Available The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine.We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states.We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

  4. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Science.gov (United States)

    Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N; Carter, Jeff; Dalby, Andrew B; Eaton, Bruce E; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R; Kim, Nancy; Koch, Tad H; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D; Vrkljan, Mike; Walker, Jeffrey J; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K; Wolfson, Alexey; Wolk, Steven K; Zhang, Chi; Zichi, Dom

    2010-12-07

    The interrogation of proteomes ("proteomics") in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (~100 fM-1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

  5. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  6. Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

    Science.gov (United States)

    Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

    2016-03-12

    Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

  7. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  9. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  10. Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay.

    Science.gov (United States)

    Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

    2016-06-01

    For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.

  11. Conversion of a Capture ELISA to a Luminex xMAP Assay using a Multiplex Antibody Screening Method

    Science.gov (United States)

    Baker, Harold N.; Murphy, Robin; Lopez, Erica; Garcia, Carlos

    2012-01-01

    The enzyme-linked immunosorbent assay (ELISA) has long been the primary tool for detection of analytes of interest in biological samples for both life science research and clinical diagnostics. However, ELISA has limitations. It is typically performed in a 96-well microplate, and the wells are coated with capture antibody, requiring a relatively large amount of sample to capture an antigen of interest . The large surface area of the wells and the hydrophobic binding of capture antibody can also lead to non-specific binding and increased background. Additionally, most ELISAs rely upon enzyme-mediated amplification of signal in order to achieve reasonable sensitivity. Such amplification is not always linear and can thus skew results. In the past 15 years, a new technology has emerged that offers the benefits of the ELISA, but also enables higher throughput, increased flexibility, reduced sample volume, and lower cost, with a similar workflow 1, 2. Luminex xMAP Technology is a microsphere (bead) array platform enabling both monoplex and multiplex assays that can be applied to both protein and nucleic acid applications 3-5. The beads have the capture antibody covalently immobilized on a smaller surface area, requiring less capture antibody and smaller sample volumes, compared to ELISA, and non-specific binding is significantly reduced. Smaller sample volumes are important when working with limiting samples such as cerebrospinal fluid, synovial fluid, etc. 6. Multiplexing the assay further reduces sample volume requirements, enabling multiple results from a single sample. Recent improvements by Luminex include: the new MAGPIX system, a smaller, less expensive, easier-to-use analyzer; Low-Concentration Magnetic MagPlex Microspheres which eliminate the need for expensive filter plates and come in a working concentration better suited for assay development and low-throughput applications; and the xMAP Antibody Coupling (AbC) Kit, which includes a protocol, reagents, and

  12. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  13. Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

    Science.gov (United States)

    Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

    2012-11-14

    DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

  14. Molecular Allergen-Specific IgE Assays as a Complement to Allergen Extract-Based Sensitization Assessment

    NARCIS (Netherlands)

    Aalberse, Rob C.; Aalberse, Joost A.

    2015-01-01

    Molecular allergen-based component-resolved diagnostic IgE antibody tests have emerged in the form of singleplex assays and multiplex arrays. They use both native and recombinant allergen molecules, sometimes in combination with each other, to supplement allergen extract-based IgE antibody analyses.

  15. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  16. Automation of complex assays: pharmacogenetics of warfarin dosing.

    Science.gov (United States)

    Wu, Whei-Kuo; Hujsak, Paul G; Kureshy, Fareed

    2007-10-01

    AutoGenomics, Inc. (Carlsbad, CA, USA) have developed a multiplex microarray assay for genotyping both VKORC1 and CYP2C9 using the INFINITI(™) Analyzer. Multiple alleles in each DNA sample are analyzed by polymerase chain reaction amplification, followed by detection primer extension using the INFINITI Analyzer. The INFINITI Analyzer performs single-nucleotide polymorphism (SNP) analysis using universal oligonucleotides immobilized on the biochip. To genotype broader ethnic groups, genomic DNA from whole blood was tested for nine SNPs for VKORC1 and six for CYP2C9 genotypes. Information related to all 15 SNPs is needed to determine dosing of population of diverse ethnic origin. The INFINITI system provides genotyping information for same day dosing of warfarin.

  17. Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deaner, Matthew; Holzman, Allison; Alper, Hal S

    2018-04-16

    Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Ghaznavi-Rad, Ehsanollah; Nor Shamsudin, Mariana; Sekawi, Zamberi; van Belkum, Alex; Neela, Vasanthakumari

    2010-10-01

    A multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus identification and detection of meticillin resistance. All 389 clinical MRSA isolates from Malaysia and 18 European isolates from the Harmony collection harbouring different SCCmec types that we tested were correctly characterized by our PCR assay. SCCmec type III and V were by far the most common types among both hospital- and community-acquired Malaysian MRSA isolates, with an apparent emergence of MRSA harbouring the IVh type.

  19. Available number of multiplexed holograms based on signal-to-noise ratio analysis in reflection-type holographic memory using three-dimensional speckle-shift multiplexing.

    Science.gov (United States)

    Nishizaki, Tatsuya; Matoba, Osamu; Nitta, Kouichi

    2014-09-01

    The recording properties of three-dimensional speckle-shift multiplexing in reflection-type holographic memory are analyzed numerically. Three-dimensional recording can increase the number of multiplexed holograms by suppressing the cross-talk noise from adjacent holograms by using depth-direction multiplexing rather than in-plane multiplexing. Numerical results indicate that the number of multiplexed holograms in three-layer recording can be increased by 1.44 times as large as that of a single-layer recording when an acceptable signal-to-noise ratio is set to be 2 when NA=0.43 and the thickness of the recording medium is 0.5 mm.

  20. Multiplex ligation-dependent probe amplification (MLPA) assay for blood group genotyping, copy number quantification, and analysis of RH variants

    NARCIS (Netherlands)

    Veldhuisen, Barbera; van der Schoot, C. E.; de Haas, Masja

    2015-01-01

    The blood group multiplex ligation-dependent probe amplification (MLPA) is a comprehensive assay, developed for genotyping the majority of clinically relevant blood group antigens in both patients and donors. The MLPA is an easy method to apply and only requires a thermal cycler and capillary

  1. Multiplex Real-Time PCR Assay Targeting Eight Parasites Customized to the Korean Population: Potential Use for Detection in Diarrheal Stool Samples from Gastroenteritis Patients.

    Directory of Open Access Journals (Sweden)

    Eun Jeong Won

    Full Text Available Intestinal parasitic diseases occur worldwide and can cause diarrhea or gastroenteritis; however, their diagnosis is quite difficult, especially in low-endemism countries. We developed a multiplex real-time PCR assay for detection of eight intestinal parasites and prospectively evaluated it for patients with gastroenteritis. The assay targeted Cryptosporidium parvum, Giardia lamblia, Entamoeba histolytica, Blastocystis hominis, Dientamoeba fragilis, Clonorchis sinensis, Metagonimus yokogawai, and Gymnophalloides seoi. Performance characteristics were evaluated based on recovery after DNA extraction, analytical sensitivity, specificity, reproducibility, cross-reactivity, and interference characteristics. Clinical performance was validated against microscopy on 123 diarrheal samples. The assay demonstrated strong correlations between DNA concentrations and Ct values (R2, 0.9924-0.9998, and had a high PCR efficiency (83.3%-109.5%. Polymerase chain reactions detected as few as 10-30 copies of genomic DNA, and coefficient of variance was 0-7%. There was no cross-reactivity to the other 54 microorganisms tested. Interference occurred only in presence of high concentrations of erythrocytes or leukocytes. This assay had a higher correct identification rate (100.0% vs. 90.2% and lower incorrect ID rate (0.0% vs. 9.8% when compared to microscopy. Overall, this assay showed a higher sensitivity (100.0%; 95% confidence interval [CI] of 80.5-100.0 than microscopy (29.4%; 95% CI 10.31-55.96, and the specificity levels were comparable for both methods (100.0%; 95% CI 96.58-100.0. This newly developed multiplex real-time PCR assay offers a potential use for detecting intestinal parasitic pathogens customized to the Korean population.

  2. A multiplexed method for kinetic measurements of apoptosis and proliferation using live-content imaging.

    Science.gov (United States)

    Artymovich, Katherine; Appledorn, Daniel M

    2015-01-01

    In vitro cell proliferation and apoptosis assays are widely used to study cancer cell biology. Commonly used methodologies are however performed at a single, user-defined endpoint. We describe a kinetic multiplex assay incorporating the CellPlayer(TM) NucLight Red reagent to measure proliferation and the CellPlayer(TM) Caspase-3/7 reagent to measure apoptosis using the two-color, live-content imaging platform, IncuCyte(TM) ZOOM. High-definition phase-contrast images provide an additional qualitative validation of cell death based on morphological characteristics. The kinetic data generated using this strategy can be used to derive informed pharmacology measurements to screen potential cancer therapeutics.

  3. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  4. Establishment and application of a multiplex genetic mutation-detection method of lung cancer based on MassARRAY platform

    International Nuclear Information System (INIS)

    Tian, Hong-Xia; Zhang, Xu-Chao; Wang, Zhen; Chen, Jian-Guang; Chen, Shi-Liang; Guo, Wei-Bang; Wu, Yi-Long

    2016-01-01

    Objective: This study aims to establish a method for highly parallel multiplexed detection of genetic mutations in Chinese lung cancer samples through Agena iPLEX chemistry and matrix-assisted laser desorption ionization time-of-flight analysis on MassARRAY mass spectrometry platform. Methods: We reviewed the related literature and data on lung cancer treatments. We also identified 99 mutation hot spots in 13 target genes closely related to the pathogenesis, drug resistance, and metastasis of lung cancer. A total of 297 primers, composed of 99 paired forward and reverse amplification primers and 99 matched extension primers, were designed using Assay Design software. The detection method was established by analyzing eight cell lines and six lung cancer specimens. The proposed method was then validated through comparisons by using a LungCarta TM kit. The sensitivity and specificity of the proposed method were evaluated by directly sequencing EGFR and KRAS genes in 100 lung cancer cases. Results: The proposed method was able to detect multiplex genetic mutations in lung cancer cell lines. This finding was consistent with the observations on previously reported mutations. The proposed method can also detect such mutations in clinical lung cancer specimens. This result was consistent with the observations with LungCarta TM kit. However, an FGFR2 mutation was detected only through the proposed method. The measured sensitivity and specificity were 100% and 96.3%, respectively. Conclusions: The proposed MassARRAY technology-based multiplex method can detect genetic mutations in Chinese lung cancer patients. Therefore, the proposed method can be applied to detect mutations in other cancer tissues

  5. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM analysis [v1; ref status: indexed, http://f1000r.es/2hj

    Directory of Open Access Journals (Sweden)

    Erin K. Hanson

    2013-12-01

    Full Text Available Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE or quantitative RT-PCR (qRT-PCR platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions, IL1F7 (skin, ALAS2 (blood, MMP10 (menstrual blood, HTN3 (saliva and TGM4 (semen.  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green. Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively

  6. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  7. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  8. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  9. Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    C. Latha

    2017-08-01

    Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.

  10. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Single assay for simultaneous detection and differential identification of human and avian influenza virus types, subtypes, and emergent variants.

    Directory of Open Access Journals (Sweden)

    David Metzgar

    Full Text Available For more than four decades the cause of most type A influenza virus infections of humans has been attributed to only two viral subtypes, A/H1N1 or A/H3N2. In contrast, avian and other vertebrate species are a reservoir of type A influenza virus genome diversity, hosting strains representing at least 120 of 144 combinations of 16 viral hemagglutinin and 9 viral neuraminidase subtypes. Viral genome segment reassortments and mutations emerging within this reservoir may spawn new influenza virus strains as imminent epidemic or pandemic threats to human health and poultry production. Traditional methods to detect and differentiate influenza virus subtypes are either time-consuming and labor-intensive (culture-based or remarkably insensitive (antibody-based. Molecular diagnostic assays based upon reverse transcriptase-polymerase chain reaction (RT-PCR have short assay cycle time, and high analytical sensitivity and specificity. However, none of these diagnostic tests determine viral gene nucleotide sequences to distinguish strains and variants of a detected pathogen from one specimen to the next. Decision-quality, strain- and variant-specific pathogen gene sequence information may be critical for public health, infection control, surveillance, epidemiology, or medical/veterinary treatment planning. The Resequencing Pathogen Microarray (RPM-Flu is a robust, highly multiplexed and target gene sequencing-based alternative to both traditional culture- or biomarker-based diagnostic tests. RPM-Flu is a single, simultaneous differential diagnostic assay for all subtype combinations of type A influenza viruses and for 30 other viral and bacterial pathogens that may cause influenza-like illness. These other pathogen targets of RPM-Flu may co-infect and compound the morbidity and/or mortality of patients with influenza. The informative specificity of a single RPM-Flu test represents specimen-specific viral gene sequences as determinants of virus type, A

  12. Single assay for simultaneous detection and differential identification of human and avian influenza virus types, subtypes, and emergent variants.

    Science.gov (United States)

    Metzgar, David; Myers, Christopher A; Russell, Kevin L; Faix, Dennis; Blair, Patrick J; Brown, Jason; Vo, Scott; Swayne, David E; Thomas, Colleen; Stenger, David A; Lin, Baochuan; Malanoski, Anthony P; Wang, Zheng; Blaney, Kate M; Long, Nina C; Schnur, Joel M; Saad, Magdi D; Borsuk, Lisa A; Lichanska, Agnieszka M; Lorence, Matthew C; Weslowski, Brian; Schafer, Klaus O; Tibbetts, Clark

    2010-02-03

    For more than four decades the cause of most type A influenza virus infections of humans has been attributed to only two viral subtypes, A/H1N1 or A/H3N2. In contrast, avian and other vertebrate species are a reservoir of type A influenza virus genome diversity, hosting strains representing at least 120 of 144 combinations of 16 viral hemagglutinin and 9 viral neuraminidase subtypes. Viral genome segment reassortments and mutations emerging within this reservoir may spawn new influenza virus strains as imminent epidemic or pandemic threats to human health and poultry production. Traditional methods to detect and differentiate influenza virus subtypes are either time-consuming and labor-intensive (culture-based) or remarkably insensitive (antibody-based). Molecular diagnostic assays based upon reverse transcriptase-polymerase chain reaction (RT-PCR) have short assay cycle time, and high analytical sensitivity and specificity. However, none of these diagnostic tests determine viral gene nucleotide sequences to distinguish strains and variants of a detected pathogen from one specimen to the next. Decision-quality, strain- and variant-specific pathogen gene sequence information may be critical for public health, infection control, surveillance, epidemiology, or medical/veterinary treatment planning. The Resequencing Pathogen Microarray (RPM-Flu) is a robust, highly multiplexed and target gene sequencing-based alternative to both traditional culture- or biomarker-based diagnostic tests. RPM-Flu is a single, simultaneous differential diagnostic assay for all subtype combinations of type A influenza viruses and for 30 other viral and bacterial pathogens that may cause influenza-like illness. These other pathogen targets of RPM-Flu may co-infect and compound the morbidity and/or mortality of patients with influenza. The informative specificity of a single RPM-Flu test represents specimen-specific viral gene sequences as determinants of virus type, A/HN subtype, virulence

  13. A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

    Science.gov (United States)

    Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

    2015-01-01

    Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform.

  14. A highly scalable peptide-based assay system for proteomics.

    Directory of Open Access Journals (Sweden)

    Igor A Kozlov

    Full Text Available We report a scalable and cost-effective technology for generating and screening high-complexity customizable peptide sets. The peptides are made as peptide-cDNA fusions by in vitro transcription/translation from pools of DNA templates generated by microarray-based synthesis. This approach enables large custom sets of peptides to be designed in silico, manufactured cost-effectively in parallel, and assayed efficiently in a multiplexed fashion. The utility of our peptide-cDNA fusion pools was demonstrated in two activity-based assays designed to discover protease and kinase substrates. In the protease assay, cleaved peptide substrates were separated from uncleaved and identified by digital sequencing of their cognate cDNAs. We screened the 3,011 amino acid HCV proteome for susceptibility to cleavage by the HCV NS3/4A protease and identified all 3 known trans cleavage sites with high specificity. In the kinase assay, peptide substrates phosphorylated by tyrosine kinases were captured and identified by sequencing of their cDNAs. We screened a pool of 3,243 peptides against Abl kinase and showed that phosphorylation events detected were specific and consistent with the known substrate preferences of Abl kinase. Our approach is scalable and adaptable to other protein-based assays.

  15. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    Science.gov (United States)

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  16. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    Science.gov (United States)

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  17. madSTORM: a superresolution technique for large-scale multiplexing at single-molecule accuracy

    Science.gov (United States)

    Yi, Jason; Manna, Asit; Barr, Valarie A.; Hong, Jennifer; Neuman, Keir C.; Samelson, Lawrence E.

    2016-01-01

    Investigation of heterogeneous cellular structures using single-molecule localization microscopy has been limited by poorly defined localization accuracy and inadequate multiplexing capacity. Using fluorescent nanodiamonds as fiducial markers, we define and achieve localization precision required for single-molecule accuracy in dSTORM images. Coupled with this advance, our new multiplexing strategy, madSTORM, allows accurate targeting of multiple molecules using sequential binding and elution of fluorescent antibodies. madSTORM is used on an activated T-cell to localize 25 epitopes, 14 of which are on components of the same multimolecular T-cell receptor complex. We obtain an average localization precision of 2.6 nm, alignment error of 2.0 nm, and molecules within structures. Probing the molecular topology of complex signaling cascades and other heterogeneous networks is feasible with madSTORM. PMID:27708141

  18. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  19. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  20. Evaluation of two real-time multiplex PCR screening assays detecting fetal RHD in plasma from RhD negative women to ascertain the requirement for antenatal RhD prophylaxis

    DEFF Research Database (Denmark)

    Clausen, Frederik Banch; Krog, Grethe Risum; Rieneck, Klaus

    2011-01-01

    and 5. We used the same fluorescent dye for the exon 7 and 10 probes to increase sensitivity; exon 5 was VIC labeled. We evaluated possible inhibition of DNA amplification with dilution experiments. We then tested the two multiplex assays with DNA extracted from 97 plasma samples from 38 RhD negative......OBJECTIVE: To evaluate two different multiplex real-time PCR assays detecting fetal RHD for screening of RhD negative women in relation to antenatal RhD prophylaxis. METHODS: We designed a duplex assay for the detection of RHD exon 7 and 10 and a triplex assay for the detection of RHD exon 7, 10...... assay (exon 7/10), accuracy was 94.2%. Detection of exon 5 was less reliable. CONCLUSION: The duplex assay using exon 7/10 was the most reliable for prenatal prediction of fetal RhD type as a candidate assay for screening of RhD negative women in relation to antenatal RhD prophylaxis. The triplex assay...

  1. Forensic typing of autosomal SNPs with a 29 SNP-multiplex--results of a collaborative EDNAP exercise.

    Science.gov (United States)

    Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N

    2008-06-01

    We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.

  2. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  3. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  4. Olive oil DNA fingerprinting by multiplex SNP genotyping on fluorescent microspheres.

    Science.gov (United States)

    Kalogianni, Despina P; Bazakos, Christos; Boutsika, Lemonia M; Targem, Mehdi Ben; Christopoulos, Theodore K; Kalaitzis, Panagiotis; Ioannou, Penelope C

    2015-04-01

    Olive oil cultivar verification is of primary importance for the competitiveness of the product and the protection of consumers and producers from fraudulence. Single-nucleotide polymorphisms (SNPs) have emerged as excellent DNA markers for authenticity testing. This paper reports the first multiplex SNP genotyping assay for olive oil cultivar identification that is performed on a suspension of fluorescence-encoded microspheres. Up to 100 sets of microspheres, with unique "fluorescence signatures", are available. Allele discrimination was accomplished by primer extension reaction. The reaction products were captured via hybridization on the microspheres and analyzed, within seconds, by a flow cytometer. The "fluorescence signature" of each microsphere is assigned to a specific allele, whereas the signal from a reporter fluorophore denotes the presence of the allele. As a model, a panel of three SNPs was chosen that enabled identification of five common Greek olive cultivars (Adramytini, Chondrolia Chalkidikis, Kalamon, Koroneiki, and Valanolia).

  5. Photocleavable DNA Barcoding Antibodies for Multiplexed Protein Analysis in Single Cells.

    Science.gov (United States)

    Ullal, Adeeti V; Weissleder, Ralph

    2015-01-01

    We describe a DNA-barcoded antibody sensing technique for single cell protein analysis in which the barcodes are photocleaved and digitally detected without amplification steps (Ullal et al., Sci Transl Med 6:219, 2014). After photocleaving the unique ~70 mer DNA barcodes we use a fluorescent hybridization technology for detection, similar to what is commonly done for nucleic acid readouts. This protocol offers a simple method for multiplexed protein detection using 100+ antibodies and can be performed on clinical samples as well as single cells.

  6. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  7. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  8. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  9. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting.

    Directory of Open Access Journals (Sweden)

    Jermaine Khumalo

    Full Text Available Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children.We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis.From 292 samples, bacterial DNA was detected in 12 (4.1% and viral nucleic acids in 94 (32%. Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10% of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR.In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.

  10. Multiplexing symbolic dynamics-based chaos communications using synchronization

    Energy Technology Data Exchange (ETDEWEB)

    Blakely, Jonathan N; Corron, Ned J [US Army RDECOM, AMSRD-AMR-WS-ST, Redstone Arsenal, Huntsville, AL 35898 (United States)

    2005-01-01

    A novel form of multiplexing information-bearing chaotic waveforms is demonstrated experimentally. This scheme dramatically increases the information carrying capacity of a chaotic communication system. In the transmitter, information is encoded in the chaotic waveforms of two electronic circuits using small perturbations to induce the symbolic dynamics to follow a prescribed symbol sequence. Waveforms from each of the drive oscillators are summed to form a single scalar signal that is transmitted to the receiver. Identical oscillators in the receiver synchronize to their counterparts in the drive system, effectively de-multiplexing the transmitted signal. The transmitted information in each channel is extracted from simple return maps of the receiver oscillators.

  11. Multiplexing symbolic dynamics-based chaos communications using synchronization

    International Nuclear Information System (INIS)

    Blakely, Jonathan N; Corron, Ned J

    2005-01-01

    A novel form of multiplexing information-bearing chaotic waveforms is demonstrated experimentally. This scheme dramatically increases the information carrying capacity of a chaotic communication system. In the transmitter, information is encoded in the chaotic waveforms of two electronic circuits using small perturbations to induce the symbolic dynamics to follow a prescribed symbol sequence. Waveforms from each of the drive oscillators are summed to form a single scalar signal that is transmitted to the receiver. Identical oscillators in the receiver synchronize to their counterparts in the drive system, effectively de-multiplexing the transmitted signal. The transmitted information in each channel is extracted from simple return maps of the receiver oscillators

  12. Multiplexed lateral flow biosensors: Technological advances for radically improving point-of-care diagnoses.

    Science.gov (United States)

    Li, Jia; Macdonald, Joanne

    2016-09-15

    Lateral flow biosensors are a leading technology in point-of-care diagnostics due to their simplicity, rapidness and low cost. Their primacy in this arena continues through technological breakthroughs such as multiplexing: the detection of more than one biomarker in a single assay. Multiplexing capacity is critical for improving diagnostic efficiency, enhancing the diagnostic precision for specific diseases and reducing diagnostic cost. Here we review, for the first time, the various types and strategies employed for creating multiplexed lateral flow biosensors. These are classified into four main categories in terms of specific application or multiplexing level, namely linear, parameter, spatial and conceptual. We describe the practical applications and implications for each approach and compare their advantages and disadvantages. Importantly, multiplexing is still subject to limitations of the traditional lateral flow biosensor, such as sensitivity and specificity. However, by pushing the limitations of the traditional medium into the multiplex arena, several technological breakthroughs are emerging with novel solutions that further expand the utility of lateral flow biosensing for point-of-care applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Design, development and evaluation of a resistor-based multiplexing circuit for a 20×20 SiPM array

    International Nuclear Information System (INIS)

    Wang, Zhonghai; Sun, Xishan; Lou, Kai; Meier, Joseph; Zhou, Rong; Yang, Chaowen; Zhu, Xiaorong; Shao, Yiping

    2016-01-01

    One technical challenge in developing a large-size scintillator detector with multiple Silicon Photomultiplier (SiPM) arrays is to read out a large number of detector output channels. To achieve this, different signal multiplexing circuits have been studied and applied with different performances and cost-effective tradeoffs. Resistor-based multiplexing circuits exhibit simplicity and signal integrity, but also present the disadvantage of timing shift among different channels. In this study, a resistor-based multiplexing circuit for a large-sized SiPM array readout was developed and evaluated by simulation and experimental studies. Similarly to a multiplexing circuit used for multi-anode PMT, grounding and branching resistors were connected to each SiPM output channel. The grounding resistor was used to simultaneously reduce the signal crosstalk among different channels and to improve timing performance. Both grounding and branching resistor values were optimized to maintain a balanced performance of the event energy, timing, and positioning. A multiplexing circuit was implemented on a compact PCB and applied for a flat-panel detector which consisted of a 32×32 LYSO scintillator crystals optically coupled to 5×5 SiPM arrays for a total 20×20 output channels. Test results showed excellent crystal identification for all 1024 LYSO crystals (each with 2×2×30 mm"3 size) with "2"2Na flood-source irradiation. The measured peak-to-valley ratio from typical crystal map profile is around 3:1 to 6.6:1, an average single crystal energy resolution of about 17.3%, and an average single crystal timing resolution of about 2 ns. Timing shift among different crystals, as reported in some other resistor-based multiplexing circuit designs, was not observed. In summary, we have designed and implemented a practical resistor-based multiplexing circuit that can be readily applied for reading out a large SiPM array with good detector performance.

  14. Design, development and evaluation of a resistor-based multiplexing circuit for a 20×20 SiPM array

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhonghai [College of Physical Science and Technology, Key Laboratory of Radiation Physics and Technology, Ministry of Education, Sichuan University, Chengdu (China); Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Tx (United States); Sun, Xishan [Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Tx (United States); Lou, Kai [Department of Electrical and Computer Engineering, Rice University, Houston, Tx (United States); Meier, Joseph [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, Houston, Tx (United States); Zhou, Rong; Yang, Chaowen [College of Physical Science and Technology, Key Laboratory of Radiation Physics and Technology, Ministry of Education, Sichuan University, Chengdu (China); Zhu, Xiaorong [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, Houston, Tx (United States); Shao, Yiping [Department of Radiation Oncology, University of Texas Southwestern Medical Center, Dallas, Tx (United States)

    2016-04-21

    One technical challenge in developing a large-size scintillator detector with multiple Silicon Photomultiplier (SiPM) arrays is to read out a large number of detector output channels. To achieve this, different signal multiplexing circuits have been studied and applied with different performances and cost-effective tradeoffs. Resistor-based multiplexing circuits exhibit simplicity and signal integrity, but also present the disadvantage of timing shift among different channels. In this study, a resistor-based multiplexing circuit for a large-sized SiPM array readout was developed and evaluated by simulation and experimental studies. Similarly to a multiplexing circuit used for multi-anode PMT, grounding and branching resistors were connected to each SiPM output channel. The grounding resistor was used to simultaneously reduce the signal crosstalk among different channels and to improve timing performance. Both grounding and branching resistor values were optimized to maintain a balanced performance of the event energy, timing, and positioning. A multiplexing circuit was implemented on a compact PCB and applied for a flat-panel detector which consisted of a 32×32 LYSO scintillator crystals optically coupled to 5×5 SiPM arrays for a total 20×20 output channels. Test results showed excellent crystal identification for all 1024 LYSO crystals (each with 2×2×30 mm{sup 3} size) with {sup 22}Na flood-source irradiation. The measured peak-to-valley ratio from typical crystal map profile is around 3:1 to 6.6:1, an average single crystal energy resolution of about 17.3%, and an average single crystal timing resolution of about 2 ns. Timing shift among different crystals, as reported in some other resistor-based multiplexing circuit designs, was not observed. In summary, we have designed and implemented a practical resistor-based multiplexing circuit that can be readily applied for reading out a large SiPM array with good detector performance.

  15. Immunization of Epidemics in Multiplex Networks

    Science.gov (United States)

    Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

    2014-01-01

    Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks. PMID:25401755

  16. Immunization of epidemics in multiplex networks.

    Science.gov (United States)

    Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

    2014-01-01

    Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks.

  17. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Science.gov (United States)

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  18. Euratom experience with video surveillance - Single camera and other non-multiplexed

    International Nuclear Information System (INIS)

    Otto, P.; Cozier, T.; Jargeac, B.; Castets, J.P.; Wagner, H.G.; Chare, P.; Roewer, V.

    1991-01-01

    The Euratom Safeguards Directorate (ESD) has been using a number of single camera video systems (Ministar, MIVS, DCS) and non-multiplexed multi-camera systems (Digiquad) for routine safeguards surveillance applications during the last four years. This paper describes aspects of system design and considerations relevant for installation. It reports on system reliability and performance and presents suggestions on future improvements

  19. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  20. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  1. Reconfigurable digital receiver for 8PSK subcarrier multiplexed and 16QAM single carrier phase‐modulated radio over fiber links

    DEFF Research Database (Denmark)

    Guerrero Gonzalez, Neil; Zibar, Darko; Yu, Xianbin

    2011-01-01

    A reconfigurable digital receiver based on the k‐means algorithm is proposed for phase‐modulated subcarrier multiplexed (SCM) and quadrature amplitude‐modulated single carrier, phase‐modulated radio‐over‐fiber links. We report successful demodulation after 40 km single mode fiber transmission wit...... with three 50 Mbaud 8PSK SCM signals and a 312.5 Mbaud 16QAM single carrier. © 2011 Wiley Periodicals, Inc. Microwave Opt Technol Lett 53:1015–1018, 2011; View this article online at wileyonlinelibrary.com. DOI 10.1002/mop.25905...

  2. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Human MLPA Probe Design (H-MAPD: a probe design tool for both electrophoresis-based and bead-coupled human multiplex ligation-dependent probe amplification assays

    Directory of Open Access Journals (Sweden)

    Hatchwell Eli

    2008-09-01

    Full Text Available Abstract Background Multiplex ligation-dependent probe amplification (MLPA is an efficient and reliable technique for gene dosage analysis. Currently MLPA can be conducted on two platforms: traditional electrophoresis-based, and FlexMAP bead-coupled. Since its introduction in 2002, MLPA has been rapidly adopted in both clinical and research situations. However, MLPA probe design is a time consuming process requiring many steps that address multiple criteria. There exist only one or two commercial software packages for traditional electrophoresis-based MLPA probe design. To our knowledge, no software is yet available that performs bead-coupled MLPA probe design. Results We have developed H-MAPD, a web-based tool that automates the generation and selection of probes for human genomic MLPA. The software performs physical-chemical property tests using UNAFold software, and uniqueness tests using the UCSC genome browser. H-MAPD supports both traditional electrophoresis-based assays, as well as FlexMAP bead-coupled MLPA. Conclusion H-MAPD greatly reduces the efforts for human genomic MLPA probe design. The software is written in Perl-CGI, hosted on a Linux server, and is freely available to non-commercial users.

  4. Hormone Receptor Expression Analyses in Neoplastic and Non-Neoplastic Canine Mammary Tissue by a Bead Based Multiplex Branched DNA Assay: A Gene Expression Study in Fresh Frozen and Formalin-Fixed, Paraffin-Embedded Samples.

    Directory of Open Access Journals (Sweden)

    Annika Mohr

    Full Text Available Immunohistochemistry (IHC is currently considered the method of choice for steroid hormone receptor status evaluation in human breast cancer and, therefore, it is commonly utilized for assessing canine mammary tumors. In case of low hormone receptor expression, IHC is limited and thus is complemented by molecular analyses. In the present study, a multiplex bDNA assay was evaluated as a method for hormone receptor gene expression detection in canine mammary tissues. Estrogen receptor (ESR1, progesterone receptor (PGR, prolactin receptor (PRLR and growth hormone receptor (GHR gene expressions were evaluated in neoplastic and non-neoplastic canine mammary tissues. A set of 119 fresh frozen and 180 formalin-fixed, paraffin-embedded (FFPE was comparatively analyzed and used for assay evaluation. Furthermore, a possible association between the hormone receptor expression in different histological subtypes of canine malignant mammary tumors and the castration status, breed and invasive growth of the tumor were analyzed. The multiplex bDNA assay proved to be more sensitive for fresh frozen specimens. Hormone receptor expression found was significantly decreased in malignant mammary tumors in comparison to non-neoplastic tissue and benign mammary tumors. Among the histological subtypes the lowest gene expression levels of ESR1, PGR and PRLR were found in solid, anaplastic and ductal carcinomas. In summary, the evaluation showed that the measurement of hormone receptors with the multiplex bDNA assay represents a practicable method for obtaining detailed quantitative information about gene expression in canine mammary tissue for future studies. Still, comparison with IHC or quantitative real-time PCR is needed for further validation of the present method.

  5. Evaluation and validation of a single-dilution potency assay based upon serology of vaccines containing diphtheria toxoid: statistical analysis

    NARCIS (Netherlands)

    Marsman FR; Akkermans AM; Hendriksen CFM; de Jong WH

    1993-01-01

    This document presents the results of a validation study to the use of a single dilution assay in potency testing of the diphtheria component of DPT-polio vaccines. Based on historical data of multi-dilution assays on 27 consecutive batches a simulation study was performed to test the actual

  6. Immunization of epidemics in multiplex networks.

    Directory of Open Access Journals (Sweden)

    Dawei Zhao

    Full Text Available Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted immunization and layer node-based random (targeted immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF networks.

  7. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

    Science.gov (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

    2005-01-01

    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  8. An accurate, specific, sensitive, high-throughput method based on a microsphere immunoassay for multiplex detection of three viruses and bacterial fruit blotch bacterium in cucurbits.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Makornwattana, Manlika; Himananto, Orawan; Seepiban, Channarong; Phuengwas, Sudtida; Warin, Nuchnard; Gajanandana, Oraprapai; Karoonuthaisiri, Nitsara

    2017-09-01

    To employ a microsphere immunoassay (MIA) to simultaneously detect multiple plant pathogens (potyviruses, Watermelon silver mottle virus, Melon yellow spot virus, and Acidovorax avenae subsp. citrulli) in actual plant samples, several factors need to be optimized and rigorously validated. Here, a simple extraction method using a single extraction buffer was successfully selected to detect the four pathogens in various cucurbit samples (cucumber, cantaloupe, melon, and watermelon). The extraction method and assay performance were validated with inoculated and field cucurbit samples. The MIA showed 98-99% relative accuracy, 97-100% relative specificity and 92-100% relative sensitivity when compared to commercial ELISA kits and reverse transcription PCR. In addition, the MIA was also able to accurately detect multiple-infected field samples. The results demonstrate that one common extraction method for all tested cucurbit samples could be applied to detect multiple pathogens; avoiding the need for multiple protocols to be employed. This multiplex method can therefore be instrumental for high-throughput screening of multiple plant pathogens with many advantages such as a shorter assay time (2.5h) with single assay format, a lower cost of detection ($5 vs $19.7 for 4 pathogens/sample) and less labor requirement. Its multiplex capacity can also be expanded to detect up to 50 different pathogens upon the availability of specific antibodies. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Low-latency optical parallel adder based on a binary decision diagram with wavelength division multiplexing scheme

    Science.gov (United States)

    Shinya, A.; Ishihara, T.; Inoue, K.; Nozaki, K.; Kita, S.; Notomi, M.

    2018-02-01

    We propose an optical parallel adder based on a binary decision diagram that can calculate simply by propagating light through electrically controlled optical pass gates. The CARRY and CARRY operations are multiplexed in one circuit by a wavelength division multiplexing scheme to reduce the number of optical elements, and only a single gate constitutes the critical path for one digit calculation. The processing time reaches picoseconds per digit when we use a 100-μm-long optical path gates, which is ten times faster than a CMOS circuit.

  10. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  11. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  12. A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella enterica serotype Typhimurium

    Directory of Open Access Journals (Sweden)

    Brisabois Anne

    2011-06-01

    Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.

  13. Simultaneous detection of viruses and Toxoplasma gondii in cerebrospinal fluid specimens by multiplex polymerase chain reaction-based reverse hybridization assay.

    Science.gov (United States)

    Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe

    2009-04-01

    The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.

  14. Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.

    Science.gov (United States)

    Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A

    2017-12-01

    Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.

  15. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Monitoring bacterial faecal contamination in waters using multiplex ...

    African Journals Online (AJOL)

    Monitoring of sanitary quality or faecal pollution in water is currently based on quantifying some bacterial indicators such as Escherichia coli and faecal enterococci. Using a multiplex real-time PCR assay for faecal enterococci and Bacteroides spp., the detection of faecal contamination in non-treated water can be done in a ...

  17. The development and validation of a single SNaPshot multiplex for tiger species and subspecies identification--implications for forensic purposes.

    Science.gov (United States)

    Kitpipit, Thitika; Tobe, Shanan S; Kitchener, Andrew C; Gill, Peter; Linacre, Adrian

    2012-03-01

    The tiger (Panthera tigris) is currently listed on Appendix I of the Convention on the International Trade in Endangered Species of Wild Fauna and Flora; this affords it the highest level of international protection. To aid in the investigation of alleged illegal trade in tiger body parts and derivatives, molecular approaches have been developed to identify biological material as being of tiger in origin. Some countries also require knowledge of the exact tiger subspecies present in order to prosecute anyone alleged to be trading in tiger products. In this study we aimed to develop and validate a reliable single assay to identify tiger species and subspecies simultaneously; this test is based on identification of single nucleotide polymorphisms (SNPs) within the tiger mitochondrial genome. The mitochondrial DNA sequence from four of the five extant putative tiger subspecies that currently exist in the wild were obtained and combined with DNA sequence data from 492 tiger and 349 other mammalian species available on GenBank. From the sequence data a total of 11 SNP loci were identified as suitable for further analyses. Five SNPs were species-specific for tiger and six amplify one of the tiger subspecies-specific SNPs, three of which were specific to P. t. sumatrae and the other three were specific to P. t. tigris. The multiplex assay was able to reliably identify 15 voucher tiger samples. The sensitivity of the test was 15,000 mitochondrial DNA copies (approximately 0.26 pg), indicating that it will work on trace amounts of tissue, bone or hair samples. This simple test will add to the DNA-based methods currently being used to identify the presence of tiger within mixed samples. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  18. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  19. A capillary-based multiplexed isothermal nucleic acid-based test for sexually transmitted diseases in patients.

    Science.gov (United States)

    Xu, Gaolian; Zhao, Hang; Cooper, Jonathan M; Reboud, Julien

    2016-10-06

    We demonstrate a multiplexed loop mediated isothermal amplification (LAMP) assay for infectious disease diagnostics, where the analytical process flow of target pathogens genomic DNA is performed manually by moving magnetic beads through a series of plugs in a capillary. Heat is provided by a water bath and the results are read by the naked eye, enabling applications in low resource settings.

  20. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs.

    Science.gov (United States)

    Yin, Linlin; Maddison, Lisette A; Li, Mingyu; Kara, Nergis; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Patton, James G; Chen, Wenbiao

    2015-06-01

    Determining the mechanism of gene function is greatly enhanced using conditional mutagenesis. However, generating engineered conditional alleles is inefficient and has only been widely used in mice. Importantly, multiplex conditional mutagenesis requires extensive breeding. Here we demonstrate a system for one-generation multiplex conditional mutagenesis in zebrafish (Danio rerio) using transgenic expression of both cas9 and multiple single guide RNAs (sgRNAs). We describe five distinct zebrafish U6 promoters for sgRNA expression and demonstrate efficient multiplex biallelic inactivation of tyrosinase and insulin receptor a and b, resulting in defects in pigmentation and glucose homeostasis. Furthermore, we demonstrate temporal and tissue-specific mutagenesis using transgenic expression of Cas9. Heat-shock-inducible expression of cas9 allows temporal control of tyr mutagenesis. Liver-specific expression of cas9 disrupts insulin receptor a and b, causing fasting hypoglycemia and postprandial hyperglycemia. We also show that delivery of sgRNAs targeting ascl1a into the eye leads to impaired damage-induced photoreceptor regeneration. Our findings suggest that CRISPR/Cas9-based conditional mutagenesis in zebrafish is not only feasible but rapid and straightforward. Copyright © 2015 by the Genetics Society of America.

  1. High-Capacity Multi-Core Fibers for Space-Division Multiplexing

    DEFF Research Database (Denmark)

    Ye, Feihong

    The transmission capacity of the present optical fiber communication systems based on time division multiplexing (TDM) and wavelength-division multiplexing (WDM) using single-mode fibers (SMFs) is reaching its limit of around 100 Tbit/s per fiber due to the fiber nonlinearities, fiber fuse...... phenomenon and the optical amplifier bandwidth. To meet the ever increasing global data traffic growth and to overcome the looming capacity crunch, a new multiplexing technology using new optical fibers is urgently needed. Space-division multiplexing (SDM) is a promising scheme to overcome the capacity limit...... of the present SMF-based systems. Among the proposed SDM schemes, the one based on uncoupled multi-core fibers (MCFs) having multiple cores in a mutual cladding has proven effective in substantially increasing the transmission capacity per fiber with least system complexity as demonstrated in several state...

  2. Highly multiplexed simultaneous detection of RNAs and proteins in single cells.

    Science.gov (United States)

    Frei, Andreas P; Bava, Felice-Alessio; Zunder, Eli R; Hsieh, Elena W Y; Chen, Shih-Yu; Nolan, Garry P; Gherardini, Pier Federico

    2016-03-01

    To enable the detection of expression signatures specific to individual cells, we developed PLAYR (proximity ligation assay for RNA), a method for highly multiplexed transcript quantification by flow and mass cytometry that is compatible with standard antibody staining. When used with mass cytometry, PLAYR allowed for the simultaneous quantification of more than 40 different mRNAs and proteins. In primary cells, we quantified multiple transcripts, with the identity and functional state of each analyzed cell defined on the basis of the expression of a separate set of transcripts or proteins. By expanding high-throughput deep phenotyping of cells beyond protein epitopes to include RNA expression, PLAYR opens a new avenue for the characterization of cellular metabolism.

  3. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Sirirat Seekhuntod

    Full Text Available Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC. The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR assay to detect KRAS mutations.We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D. We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay.Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%, G12D (25.83% and G12V (12.50% in codon 12.The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues.

  4. Multiplex Immunoassay Profiling of Hormones Involved in Metabolic Regulation.

    Science.gov (United States)

    Stephen, Laurie; Guest, Paul C

    2018-01-01

    Multiplex immunoassays are used for rapid profiling of biomarker proteins and small molecules in biological fluids. The advantages over single immunoassays include lower sample consumption, cost, and labor. This chapter details a protocol to develop a 5-plex assay for glucagon-like peptide 1, growth hormone, insulin, leptin, and thyroid-stimulating hormone on the Luminex ® platform. The results of the analysis of insulin in normal control subjects are given due to the important role of this hormone in nutritional programming diseases.

  5. A novel multiplex poliovirus binding inhibition assay applicable for large serosurveillance and vaccine studies, without the use of live poliovirus.

    Science.gov (United States)

    Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R

    2017-03-01

    Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Protein Detection Using the Multiplexed Proximity Extension Assay (PEA) from Plasma and Vaginal Fluid Applied to the Indicating FTA Elute Micro CardTM

    OpenAIRE

    Berggrund, Malin; Ekman, Daniel; Gustavsson, Inger; Sundfeldt, Karin; Olovsson, Matts; Enroth, Stefan; Gyllensten, Ulf

    2016-01-01

    The indicating FTA elute micro cardTM has been developed to collect and stabilize the nucleic acid in biological samples and is widely used in human and veterinary medicine and other disciplines. This card is not recommended for protein analyses, since surface treatment may denature proteins. We studied the ability to analyse proteins in human plasma and vaginal fluid as applied to the indicating FTA elute micro cardTM using the sensitive proximity extension assay (PEA). Among 92 proteins in ...

  7. A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

    Science.gov (United States)

    Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

    2007-11-01

    The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

  8. A novel multiplex bead-based platform highlights the diversity of extracellular vesicles.

    Science.gov (United States)

    Koliha, Nina; Wiencek, Yvonne; Heider, Ute; Jüngst, Christian; Kladt, Nikolay; Krauthäuser, Susanne; Johnston, Ian C D; Bosio, Andreas; Schauss, Astrid; Wild, Stefan

    2016-01-01

    The surface protein composition of extracellular vesicles (EVs) is related to the originating cell and may play a role in vesicle function. Knowledge of the protein content of individual EVs is still limited because of the technical challenges to analyse small vesicles. Here, we introduce a novel multiplex bead-based platform to investigate up to 39 different surface markers in one sample. The combination of capture antibody beads with fluorescently labelled detection antibodies allows the analysis of EVs that carry surface markers recognized by both antibodies. This new method enables an easy screening of surface markers on populations of EVs. By combining different capture and detection antibodies, additional information on relative expression levels and potential vesicle subpopulations is gained. We also established a protocol to visualize individual EVs by stimulated emission depletion (STED) microscopy. Thereby, markers on single EVs can be detected by fluorophore-conjugated antibodies. We used the multiplex platform and STED microscopy to show for the first time that NK cell-derived EVs and platelet-derived EVs are devoid of CD9 or CD81, respectively, and that EVs isolated from activated B cells comprise different EV subpopulations. We speculate that, according to our STED data, tetraspanins might not be homogenously distributed but may mostly appear as clusters on EV subpopulations. Finally, we demonstrate that EV mixtures can be separated by magnetic beads and analysed subsequently with the multiplex platform. Both the multiplex bead-based platform and STED microscopy revealed subpopulations of EVs that have been indistinguishable by most analysis tools used so far. We expect that an in-depth view on EV heterogeneity will contribute to our understanding of different EVs and functions.

  9. Comparison between Conventional OCDMA and Subcarrier Multiplexing SAC OCDMA System Based on Single Photodiode Detection

    Directory of Open Access Journals (Sweden)

    Ahmad N. A. A

    2017-01-01

    Full Text Available This paper demonstrates the comparison between conventional OCDMA system and subcarrier multiplexing (SCM SAC-OCDMA system by applying Recursive Combinatorial (RC code based on single photodiode detection (SPD. SPD is used in the receiver part to reduce the effect of multiple access interference (MAI which contributes as a dominant noise in incoherent SAC-OCDMA systems. From this analysis, the performance of SCM OCDMA network could be improved by using lower data rates and higher received power. The hybrid SCM OCDMA system shows better performance compare to conventional OCDMA system although the number of users involved is very high. This is because, for hybrid SCM OCDMA system, the number of users can be increased by increasing the number of subcarriers without affect the number of code length and optical codes. Increasing the number of subcarriers will enhance the power consumption by applying hybrid SCM system in OCDMA compared to the conventional OCDMA system. This is because increasing the number of users for hybrid SCM system does not affects the number of code length and the number of optical codes but only increase the number of subcarriers. Thus, hybrid SCM OCDMA system has to increase spectral efficiency and produce better performance compared to conventional of OCDMA system.

  10. Multiplexing Superconducting Qubit Circuit for Single Microwave Photon Generation

    Science.gov (United States)

    George, R. E.; Senior, J.; Saira, O.-P.; Pekola, J. P.; de Graaf, S. E.; Lindström, T.; Pashkin, Yu A.

    2017-10-01

    We report on a device that integrates eight superconducting transmon qubits in λ /4 superconducting coplanar waveguide resonators fed from a common feedline. Using this multiplexing architecture, each resonator and qubit can be addressed individually, thus reducing the required hardware resources and allowing their individual characterisation by spectroscopic methods. The measured device parameters agree with the designed values, and the resonators and qubits exhibit excellent coherence properties and strong coupling, with the qubit relaxation rate dominated by the Purcell effect when brought in resonance with the resonator. Our analysis shows that the circuit is suitable for generation of single microwave photons on demand with an efficiency exceeding 80%.

  11. Pulse patterning effect in optical pulse division multiplexing for flexible single wavelength multiple access optical network

    Science.gov (United States)

    Jung, Sun-Young; Kim, Chang-Hun; Han, Sang-Kook

    2018-05-01

    A demand for high spectral efficiency requires multiple access within a single wavelength, but the uplink signals are significantly degraded because of optical beat interference (OBI) in intensity modulation/direct detection system. An optical pulse division multiplexing (OPDM) technique was proposed that could effectively reduce the OBI via a simple method as long as near-orthogonality is satisfied, but the condition was strict, and thus, the number of multiplexing units was very limited. We propose pulse pattern enhanced OPDM (e-OPDM) to reduce the OBI and improve the flexibility in multiple access within a single wavelength. The performance of the e-OPDM and patterning effect are experimentally verified after 23-km single mode fiber transmission. By employing pulse patterning in OPDM, the tight requirement was relaxed by extending the optical delay dynamic range. This could support more number of access with reduced OBI, which could eventually enhance a multiple access function.

  12. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  13. Forensic typing of autosomal SNPs with a 29 SNP-multiplex--results of a collaborative EDNAP exercise

    DEFF Research Database (Denmark)

    Sanchez, Juan Jose; Børsting, C; Balogh, K

    2008-01-01

    base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA...

  14. PLC-based mode multi/demultiplexers for mode division multiplexing

    Science.gov (United States)

    Saitoh, Kunimasa; Hanzawa, Nobutomo; Sakamoto, Taiji; Fujisawa, Takeshi; Yamashita, Yoko; Matsui, Takashi; Tsujikawa, Kyozo; Nakajima, Kazuhide

    2017-02-01

    Recently developed PLC-based mode multi/demultiplexers (MUX/DEMUXs) for mode division multiplexing (MDM) transmission are reviewed. We firstly show the operation principle and basic characteristics of PLC-based MUX/DEMUXs with an asymmetric directional coupler (ADC). We then demonstrate the 3-mode (2LP-mode) multiplexing of the LP01, LP11a, and LP11b modes by using fabricated PLC-based mode MUX/DEMUX on one chip. In order to excite LP11b mode in the same plane, a PLC-based LP11 mode rotator is introduced. Finally, we show the PLC-based 6-mode (4LP-mode) MUX/DEMUX with a uniform height by using ADCs, LP11 mode rotators, and tapered waveguides. It is shown that the LP21a mode can be excited from the LP11b mode by using ADC, and the two nearly degenerated LP21b and LP02 modes can be (de)multiplexed separately by using tapered mode converter from E13 (E31) mode to LP21b (LP02) mode.

  15. A multiplex bead-based suspension array assay for interrogation of phylogenetically informative single nucleotide polymorphisms for Bacillus anthracis

    DEFF Research Database (Denmark)

    Thierry, Simon; Hamidjaja, Raditijo A.; Girault, Guillaume

    2013-01-01

    been modified and adapted for simultaneous interrogation of 13 biallelic canonical SNPs in a 13-plex assay. Changes made to the originally published method include the design of allele-specific dual-priming-oligonucleotides (DPOs) as competing detection probes (MOLigo probes) and use of asymmetric PCR...

  16. Detection of gene copy number aberrations in mantle cell lymphoma by a single quantitative multiplex PCR assay: clinicopathological relevance and prognosis value.

    Science.gov (United States)

    Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé

    2009-09-01

    The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.

  17. Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells

    Directory of Open Access Journals (Sweden)

    Spyros Darmanis

    2016-01-01

    Full Text Available Significant advances have been made in methods to analyze genomes and transcriptomes of single cells, but to fully define cell states, proteins must also be accessed as central actors defining a cell’s phenotype. Methods currently used to analyze endogenous protein expression in single cells are limited in specificity, throughput, or multiplex capability. Here, we present an approach to simultaneously and specifically interrogate large sets of protein and RNA targets in lysates from individual cells, enabling investigations of cell functions and responses. We applied our method to investigate the effects of BMP4, an experimental therapeutic agent, on early-passage glioblastoma cell cultures. We uncovered significant heterogeneity in responses to treatment at levels of RNA and protein, with a subset of cells reacting in a distinct manner to BMP4. Moreover, we found overall poor correlation between protein and RNA at the level of single cells, with proteins more accurately defining responses to treatment.

  18. Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells.

    Science.gov (United States)

    Darmanis, Spyros; Gallant, Caroline Julie; Marinescu, Voichita Dana; Niklasson, Mia; Segerman, Anna; Flamourakis, Georgios; Fredriksson, Simon; Assarsson, Erika; Lundberg, Martin; Nelander, Sven; Westermark, Bengt; Landegren, Ulf

    2016-01-12

    Significant advances have been made in methods to analyze genomes and transcriptomes of single cells, but to fully define cell states, proteins must also be accessed as central actors defining a cell's phenotype. Methods currently used to analyze endogenous protein expression in single cells are limited in specificity, throughput, or multiplex capability. Here, we present an approach to simultaneously and specifically interrogate large sets of protein and RNA targets in lysates from individual cells, enabling investigations of cell functions and responses. We applied our method to investigate the effects of BMP4, an experimental therapeutic agent, on early-passage glioblastoma cell cultures. We uncovered significant heterogeneity in responses to treatment at levels of RNA and protein, with a subset of cells reacting in a distinct manner to BMP4. Moreover, we found overall poor correlation between protein and RNA at the level of single cells, with proteins more accurately defining responses to treatment. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. A highly sensitive, multiplex broad-spectrum PCR-DNA-enzyme immunoassay and reverse hybridization assay for rapid detection and identification of Chlamydia trachomatis serovars.

    NARCIS (Netherlands)

    Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.

    2007-01-01

    Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT

  20. Recent Progress in Space-Division Multiplexed Transmission Technologies

    DEFF Research Database (Denmark)

    Morioka, Toshio

    2013-01-01

    Recent development of transmission technologies based on space-division multiplexing is described with future perspectives including a recent achievement of one Pb/s transmission in a single strand of fiber....

  1. Centrality in earthquake multiplex networks

    Science.gov (United States)

    Lotfi, Nastaran; Darooneh, Amir Hossein; Rodrigues, Francisco A.

    2018-06-01

    Seismic time series has been mapped as a complex network, where a geographical region is divided into square cells that represent the nodes and connections are defined according to the sequence of earthquakes. In this paper, we map a seismic time series to a temporal network, described by a multiplex network, and characterize the evolution of the network structure in terms of the eigenvector centrality measure. We generalize previous works that considered the single layer representation of earthquake networks. Our results suggest that the multiplex representation captures better earthquake activity than methods based on single layer networks. We also verify that the regions with highest seismological activities in Iran and California can be identified from the network centrality analysis. The temporal modeling of seismic data provided here may open new possibilities for a better comprehension of the physics of earthquakes.

  2. Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

    Directory of Open Access Journals (Sweden)

    Peng Xia

    2009-01-01

    Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

  3. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  4. Frequency-multiplexed bias and readout of a 16-pixel superconducting nanowire single-photon detector array

    Science.gov (United States)

    Doerner, S.; Kuzmin, A.; Wuensch, S.; Charaev, I.; Boes, F.; Zwick, T.; Siegel, M.

    2017-07-01

    We demonstrate a 16-pixel array of microwave-current driven superconducting nanowire single-photon detectors with an integrated and scalable frequency-division multiplexing architecture, which reduces the required number of bias and readout lines to a single microwave feed line. The electrical behavior of the photon-sensitive nanowires, embedded in a resonant circuit, as well as the optical performance and timing jitter of the single detectors is discussed. Besides the single pixel measurements, we also demonstrate the operation of a 16-pixel array with a temporal, spatial, and photon-number resolution.

  5. RHD genotype and zygosity analysis in the Chinese Southern Han D plus , D- and D variant donors using the multiplex ligation-dependent probe amplification assay

    NARCIS (Netherlands)

    Ji, Y. L.; Luo, H.; Wen, J. Z.; Haer-Wigman, L.; Veldhuisen, B.; Wei, L.; Wang, Z.; Ligthart, P.; Lodén-van Straaten, M.; Fu, Y. S.; van der Schoot, C. E.; Luo, G. P.

    2017-01-01

    Background and ObjectivesSeveral comprehensive genotyping platforms for determining red blood cell (RBC) antigens have been established and validated for use in the Caucasian and Black populations, but not for the Chinese. The multiplex ligation-dependent probe amplification (MLPA) assay was

  6. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  7. Gold nanoparticle-enhanced multiplexed imaging surface plasmon resonance (iSPR) detection of Fusarium mycotoxins in wheat

    Science.gov (United States)

    A rapid, sensitive and multiplexed imaging surface plasmon resonance (iSPR) biosensor assay was developed and validated for three Fusarium toxins, deoxynivalenol (DON), zearalenone (ZEA) and T-2 toxin. The iSPR assay was based on a competitive inhibition format with secondary antibodies (Ab2) conjug...

  8. Data transformation methods for multiplexed assays

    Science.gov (United States)

    Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J

    2013-07-23

    Methods to improve the performance of an array assay are described. A correlation between fluorescence intensity-related parameters and negative control values of the assay is determined. The parameters are then adjusted as a function of the correlation. As a result, sensitivity of the assay is improved without changes in its specificity.

  9. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  10. Single Cell Assay for Analyzing Single Cell Exosome and Endocrine Secretion and Cancer Markers

    Science.gov (United States)

    Chiu, Yu-Jui

    To understand the inhomogeneity of cells in biological systems, there is a growing demand for the capability to characterize the properties of individual single cells. Since single cell studies require continuous monitoring of the cell behaviors instead of a snapshot test at a single time point, an effective single-cell assay that can support time lapsed studies in a high throughput manner is desired. Most currently available single-cell technologies cannot provide proper environments to sustain cell growth and cannot provide, for appropriate cell types, proliferation of single cells and convenient, non-invasive tests of single cell behaviors from molecular markers. In this dissertation, I present a highly versatile single-cell assay that can accommodate different cellular types, enable easy and efficient single cell loading and culturing, and be suitable for the study of effects of in-vitro environmental factors in combination with drug screening. The salient features of the assay are the non-invasive collection and surveying of single cell secretions at different time points and massively parallel translocation of single cells by user defined criteria, producing very high compatibility to the downstream process such as single cell qPCR and sequencing. Above all, the acquired information is quantitative -- for example, one of the studies is measured by the number of exosomes each single cell secretes for a given time period. Therefore, our single-cell assay provides a convenient, low-cost, and enabling tool for quantitative, time lapsed studies of single cell properties.

  11. Optimizing and accelerating the assignation of lineages in Mycobacterium tuberculosis using novel alternative single-tube assays.

    Directory of Open Access Journals (Sweden)

    María Carcelén

    Full Text Available The assignation of lineages in Mycobacterium tuberculosis (MTB provides valuable information for evolutionary and phylogeographic studies and makes for more accurate knowledge of the distribution of this pathogen worldwide. Differences in virulence have also been found for certain lineages. MTB isolates were initially assigned to lineages based on data obtained from genotyping techniques, such as spoligotyping or MIRU-VNTR analysis, some of which are more suitable for molecular epidemiology studies. However, since these methods are subject to a certain degree of homoplasy, other criteria have been chosen to assign lineages. These are based on targeting robust and specific SNPs for each lineage. Here, we propose two newly designed multiplex targeting methods-both of which are single-tube tests-to optimize the assignation of the six main lineages in MTB. The first method is based on ASO-PCR and offers an inexpensive and easy-to-implement assay for laboratories with limited resources. The other, which is based on SNaPshot, enables more refined standardized assignation of lineages for laboratories with better resources. Both methods performed well when assigning lineages from cultured isolates from a control panel, a test panel, and a problem panel from an unrelated population, Mexico, which included isolates in which standard genotyping was not able to classify lineages. Both tests were also able to assign lineages from stored isolates, without the need for subculture or purification of DNA, and even directly from clinical specimens with a medium-high bacilli burden. Our assays could broaden the contexts where information on lineages can be acquired, thus enabling us to quickly update data from retrospective collections and to merge data with those obtained at the time of diagnosis of a new TB case.

  12. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2.

    Science.gov (United States)

    Gatto, Francesca; Cassina, Giulia; Broccolo, Francesco; Morreale, Giuseppe; Lanino, Edoardo; Di Marco, Eddi; Vardas, Efthiya; Bernasconi, Daniela; Buttò, Stefano; Principi, Nicola; Esposito, Susanna; Scarlatti, Gabriella; Lusso, Paolo; Malnati, Mauro S

    2011-12-01

    Accurate and highly sensitive tests for the diagnosis of active Epstein-Barr virus (EBV) infection are essential for the clinical management of individuals infected with EBV. A calibrated quantitative real-time PCR assay for the measurement of EBV DNA of both EBV-1 and 2 subtypes was developed, combining the detection of the EBV DNA and a synthetic DNA calibrator in a multiplex PCR format. The assay displays a wide dynamic range and a high degree of accuracy even in the presence of 1μg of human genomic DNA. This assay measures with the same efficiency EBV DNA from strains prevalent in different geographic areas. The clinical sensitivity and specificity of the system were evaluated by testing 181 peripheral blood mononuclear cell (PBMCs) and plasma specimens obtained from 21 patients subjected to bone marrow transplantation, 70 HIV-seropositive subjects and 23 healthy controls. Patients affected by EBV-associated post-transplant lymphoprolipherative disorders had the highest frequency of EBV detection and the highest viral load. Persons infected with HIV had higher levels of EBV DNA load in PBMCs and a higher frequency of EBV plasma viremia compared to healthy controls. In conclusion, this new assay provides a reliable high-throughput method for the quantitation of EBV DNA in clinical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  15. Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin

    2016-05-01

    Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  17. Single Nucleotide Polymorphisms in Common Bean: Their Discovery and Genotyping Using a Multiplex Detection System

    Directory of Open Access Journals (Sweden)

    E. Gaitán-Solís

    2008-11-01

    Full Text Available Single nucleotide polymorphism (SNP markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean ( L. by comparing sequences from coding and noncoding regions obtained from the GenBank and genomic DNA and to compare sequencing results with those obtained using single base extension (SBE assays on the Luminex-100 system for use in high-throughput germplasm evaluation. We assessed the frequency of SNPs in 47 fragments of common bean DNA, using SBE as the evaluation methodology. We conducted a sequence analysis of 10 genotypes of cultivated and wild beans belonging to the Mesoamerican and Andean genetic pools of . For the 10 genotypes evaluated, a total of 20,964 bp of sequence were analyzed in each genotype and compared, resulting in the discovery of 239 SNPs and 133 InDels, giving an average SNP frequency of one per 88 bp and an InDel frequency of one per 157 bp. This is the equivalent of a nucleotide diversity (θ of 6.27 × 10. Comparisons with the SNP genotypes previously obtained by direct sequencing showed that the SBE assays on the Luminex-100 were accurate, with 2.5% being miscalled and 1% showing no signal. These results indicate that the Luminex-100 provides a high-throughput system that can be used to analyze SNPs in large samples of genotypes both for purposes of assessing diversity and also for mapping studies.

  18. Packaged mode multiplexer based on silicon photonics

    NARCIS (Netherlands)

    Chen, H.; Koonen, A.M.J.; Snyder, B.; Raz, O.; Boom, van den H.P.A.; Chen, X.

    2012-01-01

    A silicon photonics based mode multiplexer is proposed. Four chirped grating couplers structure can support all 6 channels in a two-mode fiber and realize LP01 and LP11 mode selective exciting. The packaged device is tested.

  19. Who and How: Comprehensive RNA-Based BodyfluID Assay to Provide Context to a Recovered DNA Profile

    Science.gov (United States)

    2015-08-25

    capillary electrophoresis (CE) and high resolution melt ( HRM ) assays 3 were developed and fully validated. The results of this study demonstrate...Multiplex High Resolution Melt ( HRM ) Assays ................................ 11  D. Developmental Validation of the CE and HRM Assays...Sequences (Top) and Primer Mix Composition (Bottom) for the Blood-Menstrual Blood HRM Assay

  20. Quantitative multiplex assay for simultaneous detection and identification of Indiana and New Jersey serotypes of vesicular stomatitis virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Fernandez, Jovita

    2005-01-01

    In order to establish a rapid and reliable system for the detection of vesicular stomatitis virus (VSV), we developed a quantitative reverse transcription-PCR assay for the detection, quantification, and differentiation of the major serotypes, VSV Indiana and VSV New Jersey, using a closed......-tube multiplex format. The detection system is based on the recently invented primer-probe energy transfer (PriProET) system. A region of the gene encoding the RNA-dependent RNA polymerase was amplified by using VSV-specific primers in the presence of two serotype-specific fluorescent probes. By incorporating...... probes. The limits of detection ware found to be less than 10 50% tissue culture infective doses/ml for both serotypes. The diagnostic value of the new method was tested with clinical materials from experimentally infected pigs, and it is concluded that the method is a powerful tool for the rapid...

  1. Combining spatial domain multiplexing and orbital angular momentum of photon-based multiplexing to increase the bandwidth of optical fiber communication systems

    Science.gov (United States)

    Murshid, Syed; Alanzi, Saud; Hridoy, Arnob; Lovell, Gregory L.; Parhar, Gurinder; Chakravarty, Abhijit; Chowdhury, Bilas

    2016-06-01

    Spatial domain multiplexing/space division multiplexing (SDM) can increase the bandwidth of existing and futuristic optical fibers by an order of magnitude or more. In the SDM technique, we launch multiple single-mode pigtail laser sources of the same wavelength into a carrier multimode fiber at different angles. The launching angles decide the output of the carrier fiber by allocating separate spatial locations for each channel. Each channel follows a helical trajectory while traversing the length of the carrier fiber, thereby allowing spatial reuse of optical frequencies. We launch light from five different single-mode pigtail laser sources (of same wavelength) at different angles (with respect to the axis of the carrier fiber) into the carrier fiber. Owing to helical propagation, five distinct concentric donut-shaped rings with negligible crosstalk at the output end of the fiber were obtained. These SDM channels also exhibit orbital angular momentum (OAM), thereby adding an extradegree of photon freedom. We present the experimental data of five spatially multiplexed channels and compare them with simulated results to show that this technique can potentially improve the data capacity of optical fibers by an order of magnitude: A factor of five using SDM and another factor of two using OAM.

  2. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

  3. Multiplex serology of paraneoplastic antineuronal antibodies.

    Science.gov (United States)

    Maat, Peter; Brouwer, Eric; Hulsenboom, Esther; VanDuijn, Martijn; Schreurs, Marco W J; Hooijkaas, Herbert; Smitt, Peter A E Sillevis

    2013-05-31

    Paraneoplastic neurological syndromes (PNS) are devastating neurological disorders secondary to cancer, associated with onconeural autoantibodies. Such antibodies are directed against neuronal antigens aberrantly expressed by the tumor. The detection of onconeural antibodies in a patient is extremely important in diagnosing a neurological syndrome as paraneoplastic (70% is not yet known to have cancer) and in directing the search for the underlying neoplasm. At present six onconeural antibodies are considered 'well characterized' and recognize the antigens HuD, CDR62 (Yo), amphiphysin, CRMP-5 (CV2), NOVA-1 (Ri), and Ma2. The gold standard of detection is the characteristic immunohistochemical staining pattern on brain tissue sections combined with confirmation by immunoblotting using recombinant purified proteins. Since all six onconeural antibodies are usually analyzed simultaneously and objective cut-off values for these analyses are warranted, we developed a multiplex assay based on Luminex technology. Reaction of serial dilutions of six onconeural standard sera with microsphere-bound antigens showed lower limits of detection than with Western blotting. Using the six standard sera at a dilution of 1:200, the average within-run coefficient of variation (CV) was 4% (range 1.9-7.3%). The average between-run within-day CV was 5.1% (range 2.9-6.7%) while the average between-day CV was 8.1% (range 2.8-11.6%). The shelf-life of the antigen coupled microspheres was at least two months. The sensitivity of the multiplex assay ranged from 83% (Ri) to 100% (Yo, amphiphysin, CV2) and the specificity from 96% (CV2) to 100% (Ri). In conclusion, Luminex-based multiplex serology is highly reproducible with high sensitivity and specificity for the detection of onconeural antibodies. Conventional immunoblotting for diagnosis of onconeural antibodies in the setting of a routine laboratory may be replaced by this novel, robust technology. Copyright © 2013 Elsevier B.V. All rights

  4. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    Science.gov (United States)

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  5. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    Directory of Open Access Journals (Sweden)

    Maria Frølund

    Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  6. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  7. Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....

  8. Community Detection for Multiplex Social Networks Based on Relational Bayesian Networks

    DEFF Research Database (Denmark)

    Jiang, Jiuchuan; Jaeger, Manfred

    2014-01-01

    Many techniques have been proposed for community detection in social networks. Most of these techniques are only designed for networks defined by a single relation. However, many real networks are multiplex networks that contain multiple types of relations and different attributes on the nodes...

  9. A multiplex, internally controlled real-time PCR assay for detection of toxigenic Clostridium difficile and identification of hypervirulent strain 027/ST-1

    DEFF Research Database (Denmark)

    Hoegh, A M; Nielsen, J B; Lester, A

    2012-01-01

    The purpose of this study was to validate a multiplex real-time PCR assay capable of detecting toxigenic Clostridium difficile and simultaneously identifying C. difficile ribotype 027/ST-1 by targeting the toxin genes tcdA, tcdB and cdtA in one reaction and in a separate reaction identifying the Δ...... to confirm the correct identification of the Δ117 deletion in tcdC and C. difficile ribotype 027/ST-1, respectively. The PCR assay displayed a sensitivity, specificity, PPV and NPV of 99.0%, 97.4%, 87.4% and 99.8%, respectively, compared to toxigenic culture on 665 samples evaluable both by PCR and culture....... Sequencing of tcdC, ribotyping and MLST of cultured isolates validated the genotyping assay and confirmed the ability of the assay to correctly identify C. difficile ribotype 027/ST-1 in our current epidemiological setting. We describe the use of a combination of two separate PCR assays for sensitive...

  10. An analytical approach to reduce between-plate variation in multiplex assays that measure antibodies to Plasmodium falciparum antigens.

    Science.gov (United States)

    Fang, Rui; Wey, Andrew; Bobbili, Naveen K; Leke, Rose F G; Taylor, Diane Wallace; Chen, John J

    2017-07-17

    Antibodies play an important role in immunity to malaria. Recent studies show that antibodies to multiple antigens, as well as, the overall breadth of the response are associated with protection from malaria. Yet, the variability and reliability of antibody measurements against a combination of malarial antigens using multiplex assays have not been well characterized. A normalization procedure for reducing between-plate variation using replicates of pooled positive and negative controls was investigated. Sixty test samples (30 from malaria-positive and 30 malaria-negative individuals), together with five pooled positive-controls and two pooled negative-controls, were screened for antibody levels to 9 malarial antigens, including merozoite antigens (AMA1, EBA175, MSP1, MSP2, MSP3, MSP11, Pf41), sporozoite CSP, and pregnancy-associated VAR2CSA. The antibody levels were measured in triplicate on each of 3 plates, and the experiments were replicated on two different days by the same technician. The performance of the proposed normalization procedure was evaluated with the pooled controls for the test samples on both the linear and natural-log scales. Compared with data on the linear scale, the natural-log transformed data were less skewed and reduced the mean-variance relationship. The proposed normalization procedure using pooled controls on the natural-log scale significantly reduced between-plate variation. For malaria-related research that measure antibodies to multiple antigens with multiplex assays, the natural-log transformation is recommended for data analysis and use of the normalization procedure with multiple pooled controls can improve the precision of antibody measurements.

  11. Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

    International Nuclear Information System (INIS)

    Trejos, Sorayda; Barrera, John Fredy; Torroba, Roberto

    2015-01-01

    We present for the first time an optical encrypting–decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome. (paper)

  12. Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

    Science.gov (United States)

    Trejos, Sorayda; Fredy Barrera, John; Torroba, Roberto

    2015-08-01

    We present for the first time an optical encrypting-decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome.

  13. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  14. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  15. Droplet-based microscale colorimetric biosensor for multiplexed DNA analysis via a graphene nanoprobe

    International Nuclear Information System (INIS)

    Xiang Xia; Luo Ming; Shi Liyang; Ji Xinghu; He Zhike

    2012-01-01

    Graphical abstract: With a microvalve manipulate technique combined with droplet platform, a microscale fluorescence-based colorimetric sensor for multiplexed DNA analysis is developed via a graphene nanoprobe. Highlights: ► A quantitative detection for multiplexed DNA is first realized on droplet platform. ► The DNA detection is relied on a simple fluorescence-based colorimetric method. ► GO is served as a quencher for two different DNA fluorescent probes. ► This present work provides a rapid, sensitive, visual and convenient detection tool for droplet biosensor. - Abstract: The development of simple and inexpensive DNA detection strategy is very significant for droplet-based microfluidic system. Here, a droplet-based biosensor for multiplexed DNA analysis is developed with a common imaging device by using fluorescence-based colorimetric method and a graphene nanoprobe. With the aid of droplet manipulation technique, droplet size adjustment, droplet fusion and droplet trap are realized accurately and precisely. Due to the high quenching efficiency of graphene oxide (GO), in the absence of target DNAs, the droplet containing two single-stranded DNA probes and GO shows dark color, in which the DNA probes are labeled carboxy fluorescein (FAM) and 6-carboxy-X-rhodamine (ROX), respectively. The droplet changes from dark to bright color when the DNA probes form double helix with the specific target DNAs leading to the dyes far away from GO. This colorimetric droplet biosensor exhibits a quantitative capability for simultaneous detection of two different target DNAs with the detection limits of 9.46 and 9.67 × 10 −8 M, respectively. It is also demonstrated that this biosensor platform can become a promising detection tool in high throughput applications with low consumption of reagents. Moreover, the incorporation of graphene nanoprobe and droplet technique can drive the biosensor field one more step to some extent.

  16. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

    Science.gov (United States)

    Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

    2014-06-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Multiplexed Quantitation of Intraphagocyte Mycobacterium tuberculosis Secreted Protein Effectors

    Directory of Open Access Journals (Sweden)

    Fadel Sayes

    2018-04-01

    Full Text Available Summary: The pathogenic potential of Mycobacterium tuberculosis largely depends on ESX secretion systems exporting members of the multigenic Esx, Esp, and PE/PPE protein families. To study the secretion and regulation patterns of these proteins while circumventing immune cross-reactions due to their extensive sequence homologies, we developed an approach that relies on the recognition of their MHC class II epitopes by highly discriminative T cell receptors (TCRs of a panel of T cell hybridomas. The latter were engineered so that each expresses a unique fluorescent reporter linked to specific antigen recognition. The resulting polychromatic and multiplexed imaging assay enabled us to measure the secretion of mycobacterial effectors inside infected host cells. We applied this novel technology to a large panel of mutants, clinical isolates, and host-cell types to explore the host-mycobacteria interplay and its impact on the intracellular bacterial secretome, which also revealed the unexpected capacity of phagocytes from lung granuloma to present mycobacterial antigens via MHC class II. : Sayes et al. develop an approach to express distinct fluorescent reporters that is based on the recognition of specific Mycobacterium tuberculosis MHC class II epitopes by highly discriminative T cell hybridomas. This multiplexed technology allows the study of secretion, subcellular location, and regulation patterns of these instrumental protein members. Keywords: mycobacterium tuberculosis, type VII secretion systems, intracellular bacteria, T-cell hybridomas, mycobacterial virulence factors, bacterial antigen presentation, lentiviral vectors, reporter T cells, in vivo antigen presentation, protein localization

  18. Multiplex PageRank.

    Directory of Open Access Journals (Sweden)

    Arda Halu

    Full Text Available Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.

  19. Multiplex PageRank.

    Science.gov (United States)

    Halu, Arda; Mondragón, Raúl J; Panzarasa, Pietro; Bianconi, Ginestra

    2013-01-01

    Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.

  20. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  1. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    Science.gov (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  2. Frequency-domain readout multiplexing of transition-edge sensor arrays

    Energy Technology Data Exchange (ETDEWEB)

    Lanting, T.M. [Physics Department, University of California, Berkeley, CA 94720 (United States)]. E-mail: tlanting@berkeley.edu; Arnold, K. [Physics Department, University of California, Berkeley, CA 94720 (United States); Cho, Hsiao-Mei [Physics Department, University of California, Berkeley, CA 94720 (United States); Clarke, John [Physics Department, University of California, Berkeley, CA 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Dobbs, Matt [Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Holzapfel, William [Physics Department, University of California, Berkeley, CA 94720 (United States); Lee, Adrian T. [Physics Department, University of California, Berkeley, CA 94720 (United States); Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Lueker, M. [Physics Department, University of California, Berkeley, CA 94720 (United States); Richards, P.L. [Physics Department, University of California, Berkeley, CA 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Smith, A.D. [Northrop-Grumman, Redondo Beach, CA 94278 (United States); Spieler, H.G. [Physics Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)

    2006-04-15

    We have demonstrated frequency-domain readout multiplexing of eight channels for superconducting transition-edge sensor bolometer arrays. The multiplexed readout noise is 6.5 pA/{radical}Hz, well below the bolometer dark noise of 15-20 pA/{radical}Hz. We measure an upper limit on crosstalk of 0.004 between channels adjacent in frequency which meets our design requirement of 0.01. We have observed vibration insensitivity in our frequency-domain multiplexed transition-edge sensors, making this system very attractive for telescope and satellite observations. We also discuss extensions to our multiplexed readout. In particular, we are developing a SQUID flux-locked loop that is entirely cold and collaborating on digital multiplexer technology in order to scale up the number of multiplexed channels.

  3. Nanoparticle discrimination based on wavelength and lifetime-multiplexed cathodoluminescence microscopy.

    Science.gov (United States)

    Garming, Mathijs W H; Weppelman, I Gerward C; de Boer, Pascal; Martínez, Felipe Perona; Schirhagl, Romana; Hoogenboom, Jacob P; Moerland, Robert J

    2017-08-31

    Nanomaterials can be identified in high-resolution electron microscopy images using spectrally-selective cathodoluminescence. Capabilities for multiplex detection can however be limited, e.g., due to spectral overlap or availability of filters. Also, the available photon flux may be limited due to degradation under electron irradiation. Here, we demonstrate single-pass cathodoluminescence-lifetime based discrimination of different nanoparticles, using a pulsed electron beam. We also show that cathodoluminescence lifetime is a robust parameter even when the nanoparticle cathodoluminescence intensity decays over an order of magnitude. We create lifetime maps, where the lifetime of the cathodoluminescence emission is correlated with the emission intensity and secondary-electron images. The consistency of lifetime-based discrimination is verified by also correlating the emission wavelength and the lifetime of nanoparticles. Our results show how cathodoluminescence lifetime provides an additional channel of information in electron microscopy.

  4. Electronics for a Next-Generation SQUID-Based Time-Domain Multiplexing System

    International Nuclear Information System (INIS)

    Reintsema, C. D.; Doriese, W. R.; Hilton, G. C.; Irwin, K. D.; Krinsky, J. W.; Adams, J. S.; Baker, R.; Bandler, S. R.; Kelly, R. L.; Kilbourne, C. A.; Porter, F. S.; Figueroa-Feliciano, E.; Wikus, P.

    2009-01-01

    A decade has elapsed since the design, development and realization of a SQUID-based time-division multiplexer at NIST. During this time the system has been used extensively for low-temperature-detector-array measurements. Concurrently, there have been substantial advancements both in detector array and commercial electronic component technology. The relevance and applicability of the technology has blossomed as well, often accompanied by more demanding measurement requirements. These factors have motivated a complete redesign of the NIST room-temperature read-out electronics. The redesign has leveraged advancements in component technology to achieve new capabilities better suited to the SQUID multiplexers and detector arrays being realized today. As examples of specific performance enhancements, the overall system bandwidth has been increased by a factor of four (a row switching rate of 6.24 MHz), the compactness has been increased by over a factor of two (a higher number of detector columns and rows per circuit board), and there are two high speed outputs per column (allowing fast switching of SQUID offsets in addition to digital feedback). The system architecture, design implementations, and performance advantages of the new system will be discussed. As an application example, the science chain flight electronics for the Micro-X High Resolution Microcalorimeter X-ray Imaging Rocket will be described as both a motivation for, and a direct implementation of the new system.

  5. Validation of HAV biomarker 2A for differential diagnostic of hepatitis A infected and vaccinated individuals using multiplex serology.

    Science.gov (United States)

    Bohm, Katrin; Filomena, Angela; Schneiderhan-Marra, Nicole; Krause, Gérard; Sievers, Claudia

    2017-10-13

    Worldwide about 1.5 million clinical cases of hepatitis A virus (HAV) infections occur every year and increasingly countries are introducing HAV vaccination into the childhood immunization schedule with a single dose instead of the originally licenced two dose regimen. Diagnosis of acute HAV infection is determined serologically by anti-HAV-IgM detection using ELISA. Additionally anti-HAV-IgG can become positive during the early phase of symptoms, but remains detectable after infection and also after vaccination against HAV. Currently no serological marker allows the differentiation of HAV vaccinated individuals and those with a past infection with HAV. Such differentiation would greatly improve evaluation of vaccination campaigns and risk assessment of HAV outbreaks. Here we tested the HAV non-structural protein 2A, important for the capsid assembly, as a biomarker for the differentiation of the immune status in previously infected and vaccinated individuals. HAV antigens were recombinantly expressed as glutathione-S-transferase (GST) fusion proteins. Using glutathione tagged, magnetic fluorescent beads (Luminex®), the proteins were affinity purified and used in a multiplex serological assay. The multiplex HAV assay was validated using 381 reference sera in which the immune status HAV negative, vaccinated or infected was established using the Abbott ARCHITECT® HAVAb-IgM or IgG, the commercial HAV ELISA from Abnova and documentation in vaccination cards. HAV multiplex serology showed a sensitivity of 99% and specificity of 95% to detect anti-HAV IgG/IgM positive individuals. HAV biomarker 2A allowed the differentiation between previously infected and vaccinated individuals. HAV vaccinated individuals and previously infected individuals could be identified with 92% accuracy. HAV biomarker 2A can be used to differentiate between previously HAV-vaccinated and naturally infected individuals. Within a multiplex serological approach this assay can provide valuable

  6. Centralized light-source optical access network based on polarization multiplexing.

    Science.gov (United States)

    Grassi, Fulvio; Mora, José; Ortega, Beatriz; Capmany, José

    2010-03-01

    This paper presents and demonstrates a centralized light source optical access network based on optical polarization multiplexing technique. By using two optical sources emitting light orthogonally polarized in the Central Node for downstream and upstream operations, the Remote Node is kept source-free. EVM values below telecommunication standard requirements have been measured experimentally when bidirectional digital signals have been transmitted over 10 km of SMF employing subcarrier multiplexing technique in the electrical domain.

  7. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  8. Direct, Specific and Rapid Detection of Staphylococcal Proteins and Exotoxins Using a Multiplex Antibody Microarray.

    Directory of Open Access Journals (Sweden)

    Bettina Stieber

    Full Text Available S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins.In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays.110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate.The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers.

  9. All-in-One CRISPR-Cas9/FokI-dCas9 Vector-Mediated Multiplex Genome Engineering in Cultured Cells.

    Science.gov (United States)

    Sakuma, Tetsushi; Sakamoto, Takuya; Yamamoto, Takashi

    2017-01-01

    CRISPR-Cas9 enables highly convenient multiplex genome engineering in cultured cells, because it utilizes generic Cas9 nuclease and an easily customizable single-guide RNA (sgRNA) for site-specific DNA double-strand break induction. We previously established a multiplex CRISPR-Cas9 assembly system for constructing an all-in-one vector simultaneously expressing multiple sgRNAs and Cas9 nuclease or other Cas9 variants including FokI-dCas9, which supersedes the wild-type Cas9 with regard to high specificity. In this chapter, we describe a streamlined protocol to design and construct multiplex CRISPR-Cas9 or FokI-dCas9 vectors, to introduce them into cultured cells by lipofection or electroporation, to enrich the genomically edited cells with a transient puromycin selection, to validate the mutation efficiency by Surveyor nuclease assay, and to perform off-target analyses. We show that our protocol enables highly efficient multiplex genome engineering even in hard-to-transfect HepG2 cells.

  10. Design of a Modular DNA Triangular-Prism Sensor Enabling Ratiometric and Multiplexed Biomolecule Detection on a Single Microbead.

    Science.gov (United States)

    Liu, Yu; Chen, Qiaoshu; Liu, Jianbo; Yang, Xiaohai; Guo, Qiuping; Li, Li; Liu, Wei; Wang, Kemin

    2017-03-21

    DNA nanostructures have emerged as powerful and versatile building blocks for the construction of programmable nanoscale structures and functional sensors for biomarker detection, disease diagnostics, and therapy. Here we integrated multiple sensing modules into a single DNA three-dimensional (3D) nanoarchitecture with a triangular-prism (TP) structure for ratiometric and multiplexed biomolecule detection on a single microbead. In our design, the complementary hybridization of three clip sequences formed TP nanoassemblies in which the six single-strand regions in the top and bottom faces act as binding sites for different sensing modules, including an anchor module, reference sequence module, and capture sequence module. The multifunctional modular TP nanostructures were thus exploited for ratiometric and multiplexed biomolecule detection on microbeads. Microbead imaging demonstrated that, after ratiometric self-calibration analysis, the imaging deviations resulting from uneven fluorescence intensity distribution and differing probe concentrations were greatly reduced. The rigid nanostructure also conferred the TP as a framework for geometric positioning of different capture sequences. The inclusion of multiple targets led to the formation of sandwich hybridization structures that gave a readily detectable optical response at different fluorescence channels and distinct fingerprint-like pattern arrays. This approach allowed us to discriminate multiplexed biomolecule targets in a simple and efficient fashion. In this module-designed strategy, the diversity of the controlled DNA assembly coupled with the geometrically well-defined rigid nanostructures of the TP assembly provides a flexible and reliable biosensing approach that shows great promise for biomedical applications.

  11. Evaluation of the Roche LightMix Gastro parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis.

    Science.gov (United States)

    Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R

    2018-03-23

    Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Multiplexed Colorimetric Solid-Phase Extraction

    Science.gov (United States)

    Gazda, Daniel B.; Fritz, James S.; Porter, Marc D.

    2009-01-01

    Multiplexed colorimetric solid-phase extraction (MC-SPE) is an extension of colorimetric solid-phase extraction (C-SPE) an analytical platform that combines colorimetric reagents, solid phase extraction, and diffuse reflectance spectroscopy to quantify trace analytes in water. In CSPE, analytes are extracted and complexed on the surface of an extraction membrane impregnated with a colorimetric reagent. The analytes are then quantified directly on the membrane surface using a handheld diffuse reflectance spectrophotometer. Importantly, the use of solid-phase extraction membranes as the matrix for impregnation of the colorimetric reagents creates a concentration factor that enables the detection of low concentrations of analytes in small sample volumes. In extending C-SPE to a multiplexed format, a filter holder that incorporates discrete analysis channels and a jig that facilitates the concurrent operation of multiple sample syringes have been designed, enabling the simultaneous determination of multiple analytes. Separate, single analyte membranes, placed in a readout cartridge create unique, analyte-specific addresses at the exit of each channel. Following sample exposure, the diffuse reflectance spectrum of each address is collected serially and the Kubelka-Munk function is used to quantify each water quality parameter via calibration curves. In a demonstration, MC-SPE was used to measure the pH of a sample and quantitate Ag(I) and Ni(II).

  13. The production of KIR-Fc fusion proteins and their use in a multiplex HLA class I binding assay.

    Science.gov (United States)

    Hilton, Hugo G; Moesta, Achim K; Guethlein, Lisbeth A; Blokhuis, Jeroen; Parham, Peter; Norman, Paul J

    2015-10-01

    Soluble recombinant proteins that comprise the extracellular part of a surface expressed receptor attached to the Fc region of an IgG antibody have facilitated the determination of ligand specificity for an array of immune system receptors. Among such receptors is the family of killer cell immunoglobulin-like receptors (KIR) that recognize HLA class I ligands. These receptors, expressed on natural killer (NK) cells and T cells, play important roles in both immune defense and placental development in early pregnancy. Here we describe a method for the production of two domain KIR-Fc fusion proteins using baculovirus infected insect cells. This method is more scalable than traditional mammalian cell expression systems and produces efficiently folded proteins that carry posttranslational modifications found in native KIR. We also describe a multiplex binding assay using the Luminex platform that determines the avidity and specificity of two domain KIR-Fc for a panel of microbeads, each coated with one of 97 HLA class I allotypes. This assay is simple to perform, and represents a major improvement over the assays used previously, which were limited in the number of KIR and HLA class I combinations that could be assayed at any one time. The results obtained from this assay can be used to predict the response of NK cell and T cells when their KIR recognize HLA class I. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Turbulence mitigation scheme based on spatial diversity in orbital-angular-momentum multiplexed system

    Science.gov (United States)

    Zou, Li; Wang, Le; Zhao, Shengmei

    2017-10-01

    Atmospheric turbulence (AT) induced crosstalk can significantly impair the performance of free-space optical (FSO) communication link using orbital angular momentum (OAM) multiplexing. In this paper, we propose a spatial diversity (SD) turbulence mitigation scheme in an OAM-multiplexed FSO communication link. First, we present a SD mitigation model for the OAM-multiplexed FSO communication link under AT. Then we present a SD combining technique based on equal gain to enhance AT tolerance of the OAM-multiplexed FSO communication link. The numerical results show that performance of the OAM-multiplexed communication link has greatly improved by the proposed scheme. When the turbulence strength Cn2 is 5 × 10-15m - 2 / 3, the transmission distance is 1000 m and the channel signal-to-noise ratio (SNR) is 20 dB, the bit-error-rate (BER) performance of four spatial multiplexed OAM modes lm = + 1 , + 2 , + 3 , + 4 are 3 fold increase in comparison with those results without the proposed scheme. The proposed scheme is a promising direction for compensating the interference caused by AT in the OAM-multiplexed FSO communication link.

  15. Evaluation of Optical Detection Platforms for Multiplexed Detection of Proteins and the Need for Point-of-Care Biosensors for Clinical Use

    Directory of Open Access Journals (Sweden)

    Samantha Spindel

    2014-11-01

    Full Text Available This review investigates optical sensor platforms for protein multiplexing, the ability to analyze multiple analytes simultaneously. Multiplexing is becoming increasingly important for clinical needs because disease and therapeutic response often involve the interplay between a variety of complex biological networks encompassing multiple, rather than single, proteins. Multiplexing is generally achieved through one of two routes, either through spatial separation on a surface (different wells or spots or with the use of unique identifiers/labels (such as spectral separation—different colored dyes, or unique beads—size or color. The strengths and weaknesses of conventional platforms such as immunoassays and new platforms involving protein arrays and lab-on-a-chip technology, including commercially-available devices, are discussed. Three major public health concerns are identified whereby detecting medically-relevant markers using Point-of-Care (POC multiplex assays could potentially allow for a more efficient diagnosis and treatment of diseases.

  16. Analogue multiplexer

    International Nuclear Information System (INIS)

    Gorshkov, V.A.; Kuznetsov, A.N.

    1980-01-01

    In systems of signal recording from several parallel spectrometric channels one can considerably reduce the total apparatus volume using a special unit - an analog multiplexer. A description of the multiplexer in the CAMAC system on the base of fast linear gating circuits which allows one analog-to-code converter to attend four spectrometric channels is given. On the example of the 4-channel spectrometer the logics of interaction of the multiple with analog-to-digital coxernver and signal recorder is shown. Electrical and functional multiplexer flow-sheets are given and its main characteristics are presented

  17. A nucleic acid strand displacement system for the multiplexed detection of tuberculosis-specific mRNA using quantum dots

    Science.gov (United States)

    Gliddon, H. D.; Howes, P. D.; Kaforou, M.; Levin, M.; Stevens, M. M.

    2016-05-01

    The development of rapid, robust and high performance point-of-care diagnostics relies on the advancement and combination of various areas of research. We have developed an assay for the detection of multiple mRNA molecules that combines DNA nanotechnology with fluorescent nanomaterials. The core switching mechanism is toehold-mediated strand displacement. We have used fluorescent quantum dots (QDs) as signal transducers in this assay, as they bring many benefits including bright fluorescence and multiplexing abilities. The resulting assay is capable of multiplexed detection of long RNA targets against a high concentration of background non-target RNA, with high sensitivity and specificity and limits of detection in the nanomolar range using only a standard laboratory plate reader. We demonstrate the utility of our QD-based system for the detection of two genes selected from a microarray-derived tuberculosis-specific gene expression signature. Levels of up- and downregulated gene transcripts comprising this signature can be combined to give a disease risk score, making the signature more amenable for use as a diagnostic marker. Our QD-based approach to detect these transcripts could pave the way for novel diagnostic assays for tuberculosis.The development of rapid, robust and high performance point-of-care diagnostics relies on the advancement and combination of various areas of research. We have developed an assay for the detection of multiple mRNA molecules that combines DNA nanotechnology with fluorescent nanomaterials. The core switching mechanism is toehold-mediated strand displacement. We have used fluorescent quantum dots (QDs) as signal transducers in this assay, as they bring many benefits including bright fluorescence and multiplexing abilities. The resulting assay is capable of multiplexed detection of long RNA targets against a high concentration of background non-target RNA, with high sensitivity and specificity and limits of detection in the nanomolar

  18. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  19. Simple Multiplexing Hand-Held Control Unit

    Science.gov (United States)

    Hannaford, Blake

    1989-01-01

    Multiplexer consists of series of resistors, each shunted by single-pole, single-throw switch. User operates switches by pressing buttons or squeezing triggers. Prototype includes three switches operated successfully in over 200 hours of system operations. Number of switches accommodated determined by signal-to-noise ratio of current source, noise induced in control unit and cable, and number of bits in output of analog-to-digital converter. Because many computer-contolled robots have extra analog-to-digital channels, such multiplexer added at little extra cost.

  20. A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

    Science.gov (United States)

    Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

    2011-02-01

    In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).

    Science.gov (United States)

    Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M

    2015-02-21

    This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.

  2. Simultaneous use of multiplex ligation-dependent probe amplification assay and flow cytometric DNA ploidy analysis in patients with acute leukemia.

    Science.gov (United States)

    Reyes-Núñez, Virginia; Galo-Hooker, Evelyn; Pérez-Romano, Beatriz; Duque, Ricardo E; Ruiz-Arguelles, Alejandro; Garcés-Eisele, Javier

    2018-01-01

    The aim of this work was to simultaneously use multiplex ligation-dependent probe amplification (MLPA) assay and flow cytometric DNA ploidy analysis (FPA) to detect aneuploidy in patients with newly diagnosed acute leukemia. MLPA assay and propidium iodide FPA were used to test samples from 53 consecutive patients with newly diagnosed acute leukemia referred to our laboratory for immunophenotyping. Results were compared by nonparametric statistics. The combined use of both methods significantly increased the rate of detection of aneuploidy as compared to that obtained by each method alone. The limitations of one method are somehow countervailed by the other and vice versa. MPLA and FPA yield different yet complementary information concerning aneuploidy in acute leukemia. The simultaneous use of both methods might be recommended in the clinical setting. © 2017 International Clinical Cytometry Society. © 2017 International Clinical Cytometry Society.

  3. Effects of temporal correlations in social multiplex networks.

    Science.gov (United States)

    Starnini, Michele; Baronchelli, Andrea; Pastor-Satorras, Romualdo

    2017-08-17

    Multi-layered networks represent a major advance in the description of natural complex systems, and their study has shed light on new physical phenomena. Despite its importance, however, the role of the temporal dimension in their structure and function has not been investigated in much detail so far. Here we study the temporal correlations between layers exhibited by real social multiplex networks. At a basic level, the presence of such correlations implies a certain degree of predictability in the contact pattern, as we quantify by an extension of the entropy and mutual information analyses proposed for the single-layer case. At a different level, we demonstrate that temporal correlations are a signature of a 'multitasking' behavior of network agents, characterized by a higher level of switching between different social activities than expected in a uncorrelated pattern. Moreover, temporal correlations significantly affect the dynamics of coupled epidemic processes unfolding on the network. Our work opens the way for the systematic study of temporal multiplex networks and we anticipate it will be of interest to researchers in a broad array of fields.

  4. Naturally-acquired humoral immune responses against the N- and C-termini of the Plasmodium vivax MSP1 protein in endemic regions of Brazil and Papua New Guinea using a multiplex assay

    Directory of Open Access Journals (Sweden)

    Alonso Pedro L

    2010-01-01

    Full Text Available Abstract Background Progress towards the development of a malaria vaccine against Plasmodium vivax, the most widely distributed human malaria parasite, will require a better understanding of the immune responses that confer clinical protection to patients in regions where malaria is endemic. Methods Glutathione S-transferase (GST and GST-fusion proteins representing the N- terminus of the merozoite surface protein 1 of P. vivax, PvMSP1-N, and the C-terminus, PvMSP1-C, were covalently coupled to BioPlex carboxylated beads. Recombinant proteins and coupled beads were used, respectively, in ELISA and Bioplex assays using immune sera of P. vivax patients from Brazil and PNG to determine IgG and subclass responses. Concordances between the two methods in the seropositivity responses were evaluated using the Kappa statistic and the Spearman's rank correlation. Results The results using this methodology were compared with the classical microtitre enzyme-linked immnosorbent assay (ELISA, showing that the assay was sensitive, reproducible and had good concordance with ELISA; yet, further research into different statistical analyses seems desirable before claiming conclusive results exclusively based on multiplex assays. As expected, results demonstrated that PvMSP1 was immunogenic in natural infections of patients from different endemic regions of Brazil and Papua New Guinea (PNG, and that age correlated only with antibodies against the C-terminus part of the molecule. Furthermore, the IgG subclass profiles were different in these endemic regions having IgG3 predominantly recognizing PvMSP1 in Brazil and IgG1 predominantly recognizing PvMSP1 in PNG. Conclusions This study validates the use of the multiplex assay to measure naturally-acquired IgG antibodies against the merozoite surface protein 1 of P. vivax.

  5. Integration of Multiplexed Microfluidic Electrokinetic Concentrators with a Morpholino Microarray via Reversible Surface Bonding for Enhanced DNA Hybridization.

    Science.gov (United States)

    Martins, Diogo; Wei, Xi; Levicky, Rastislav; Song, Yong-Ak

    2016-04-05

    We describe a microfluidic concentration device to accelerate the surface hybridization reaction between DNA and morpholinos (MOs) for enhanced detection. The microfluidic concentrator comprises a single polydimethylsiloxane (PDMS) microchannel onto which an ion-selective layer of conductive polymer poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) ( PSS) was directly printed and then reversibly surface bonded onto a morpholino microarray for hybridization. Using this electrokinetic trapping concentrator, we could achieve a maximum concentration factor of ∼800 for DNA and a limit of detection of 10 nM within 15 min. In terms of the detection speed, it enabled faster hybridization by around 10-fold when compared to conventional diffusion-based hybridization. A significant advantage of our approach is that the fabrication of the microfluidic concentrator is completely decoupled from the microarray; by eliminating the need to deposit an ion-selective layer on the microarray surface prior to device integration, interfacing between both modules, the PDMS chip for electrokinetic concentration and the substrate for DNA sensing are easier and applicable to any microarray platform. Furthermore, this fabrication strategy facilitates a multiplexing of concentrators. We have demonstrated the proof-of-concept for multiplexing by building a device with 5 parallel concentrators connected to a single inlet/outlet and applying it to parallel concentration and hybridization. Such device yielded similar concentration and hybridization efficiency compared to that of a single-channel device without adding any complexity to the fabrication and setup. These results demonstrate that our concentrator concept can be applied to the development of a highly multiplexed concentrator-enhanced microarray detection system for either genetic analysis or other diagnostic assays.

  6. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  7. An extension to artifact-free projection overlaps

    International Nuclear Information System (INIS)

    Lin, Jianyu

    2015-01-01

    Purpose: In multipinhole single photon emission computed tomography, the overlapping of projections has been used to increase sensitivity. Avoiding artifacts in the reconstructed image associated with projection overlaps (multiplexing) is a critical issue. In our previous report, two types of artifact-free projection overlaps, i.e., projection overlaps that do not lead to artifacts in the reconstructed image, were formally defined and proved, and were validated via simulations. In this work, a new proposition is introduced to extend the previously defined type-II artifact-free projection overlaps so that a broader range of artifact-free overlaps is accommodated. One practical purpose of the new extension is to design a baffle window multipinhole system with artifact-free projection overlaps. Methods: First, the extended type-II artifact-free overlap was theoretically defined and proved. The new proposition accommodates the situation where the extended type-II artifact-free projection overlaps can be produced with incorrectly reconstructed portions in the reconstructed image. Next, to validate the theory, the extended-type-II artifact-free overlaps were employed in designing the multiplexing multipinhole spiral orbit imaging systems with a baffle window. Numerical validations were performed via simulations, where the corresponding 1-pinhole nonmultiplexing reconstruction results were used as the benchmark for artifact-free reconstructions. The mean square error (MSE) was the metric used for comparisons of noise-free reconstructed images. Noisy reconstructions were also performed as part of the validations. Results: Simulation results show that for noise-free reconstructions, the MSEs of the reconstructed images of the artifact-free multiplexing systems are very similar to those of the corresponding 1-pinhole systems. No artifacts were observed in the reconstructed images. Therefore, the testing results for artifact-free multiplexing systems designed using the

  8. Frequent sgRNA-barcode recombination in single-cell perturbation assays.

    Directory of Open Access Journals (Sweden)

    Shiqi Xie

    Full Text Available Simultaneously detecting CRISPR-based perturbations and induced transcriptional changes in the same cell is a powerful approach to unraveling genome function. Several lentiviral approaches have been developed, some of which rely on the detection of distally located genetic barcodes as an indirect proxy of sgRNA identity. Since barcodes are often several kilobases from their corresponding sgRNAs, viral recombination-mediated swapping of barcodes and sgRNAs is feasible. Using a self-circularization-based sgRNA-barcode library preparation protocol, we estimate the recombination rate to be ~50% and we trace this phenomenon to the pooled viral packaging step. Recombination is random, and decreases the signal-to-noise ratio of the assay. Our results suggest that alternative approaches can increase the throughput and sensitivity of single-cell perturbation assays.

  9. Surface Enhanced Raman Spectroscopy (SERS) methods for endpoint and real-time quantification of miRNA assays

    Science.gov (United States)

    Restaino, Stephen M.; White, Ian M.

    2017-03-01

    Surface Enhanced Raman spectroscopy (SERS) provides significant improvements over conventional methods for single and multianalyte quantification. Specifically, the spectroscopic fingerprint provided by Raman scattering allows for a direct multiplexing potential far beyond that of fluorescence and colorimetry. Additionally, SERS generates a comparatively low financial and spatial footprint compared with common fluorescence based systems. Despite the advantages of SERS, it has remained largely an academic pursuit. In the field of biosensing, techniques to apply SERS to molecular diagnostics are constantly under development but, most often, assay protocols are redesigned around the use of SERS as a quantification method and ultimately complicate existing protocols. Our group has sought to rethink common SERS methodologies in order to produce translational technologies capable of allowing SERS to compete in the evolving, yet often inflexible biosensing field. This work will discuss the development of two techniques for quantification of microRNA, a promising biomarker for homeostatic and disease conditions ranging from cancer to HIV. First, an inkjet-printed paper SERS sensor has been developed to allow on-demand production of a customizable and multiplexable single-step lateral flow assay for miRNA quantification. Second, as miRNA concentrations commonly exist in relatively low concentrations, amplification methods (e.g. PCR) are therefore required to facilitate quantification. This work presents a novel miRNA assay alongside a novel technique for quantification of nuclease driven nucleic acid amplification strategies that will allow SERS to be used directly with common amplification strategies for quantification of miRNA and other nucleic acid biomarkers.

  10. Experimental multiplexing of quantum key distribution with classical optical communication

    International Nuclear Information System (INIS)

    Wang, Liu-Jun; Chen, Luo-Kan; Ju, Lei; Xu, Mu-Lan; Zhao, Yong; Chen, Kai; Chen, Zeng-Bing; Chen, Teng-Yun; Pan, Jian-Wei

    2015-01-01

    We demonstrate the realization of quantum key distribution (QKD) when combined with classical optical communication, and synchronous signals within a single optical fiber. In the experiment, the classical communication sources use Fabry-Pérot (FP) lasers, which are implemented extensively in optical access networks. To perform QKD, multistage band-stop filtering techniques are developed, and a wavelength-division multiplexing scheme is designed for the multi-longitudinal-mode FP lasers. We have managed to maintain sufficient isolation among the quantum channel, the synchronous channel and the classical channels to guarantee good QKD performance. Finally, the quantum bit error rate remains below a level of 2% across the entire practical application range. The proposed multiplexing scheme can ensure low classical light loss, and enables QKD over fiber lengths of up to 45 km simultaneously when the fibers are populated with bidirectional FP laser communications. Our demonstration paves the way for application of QKD to current optical access networks, where FP lasers are widely used by the end users

  11. Mass Spectrometry-based Assay for High Throughput and High Sensitivity Biomarker Verification

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Xuejiang; Tang, Keqi

    2017-06-14

    Searching for disease specific biomarkers has become a major undertaking in the biomedical research field as the effective diagnosis, prognosis and treatment of many complex human diseases are largely determined by the availability and the quality of the biomarkers. A successful biomarker as an indicator to a specific biological or pathological process is usually selected from a large group of candidates by a strict verification and validation process. To be clinically useful, the validated biomarkers must be detectable and quantifiable by the selected testing techniques in their related tissues or body fluids. Due to its easy accessibility, protein biomarkers would ideally be identified in blood plasma or serum. However, most disease related protein biomarkers in blood exist at very low concentrations (<1ng/mL) and are “masked” by many none significant species at orders of magnitude higher concentrations. The extreme requirements of measurement sensitivity, dynamic range and specificity make the method development extremely challenging. The current clinical protein biomarker measurement primarily relies on antibody based immunoassays, such as ELISA. Although the technique is sensitive and highly specific, the development of high quality protein antibody is both expensive and time consuming. The limited capability of assay multiplexing also makes the measurement an extremely low throughput one rendering it impractical when hundreds to thousands potential biomarkers need to be quantitatively measured across multiple samples. Mass spectrometry (MS)-based assays have recently shown to be a viable alternative for high throughput and quantitative candidate protein biomarker verification. Among them, the triple quadrupole MS based assay is the most promising one. When it is coupled with liquid chromatography (LC) separation and electrospray ionization (ESI) source, a triple quadrupole mass spectrometer operating in a special selected reaction monitoring (SRM) mode

  12. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  13. Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

    2000-05-05

    Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

  14. Solid-phase single molecule biosensing using dual-color colocalization of fluorescent quantum dot nanoprobes

    Science.gov (United States)

    Liu, Jianbo; Yang, Xiaohai; Wang, Kemin; Wang, Qing; Liu, Wei; Wang, Dong

    2013-10-01

    The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to the QD560-TBA I substrate. Thus, the presence of the target thrombin can be determined based on fluorescent colocalization measurements of the nanoassemblies, without target amplification or probe separation. The detection limit of this assay reached 0.8 pM. This fluorescent colocalization assay has enabled single molecule recognition in a separation-free detection format, and can serve as a sensitive biosensing platform that greatly suppresses the nonspecific adsorption false-positive signal. This method can be extended to other areas such as multiplexed immunoassay, single cell analysis, and real time biomolecule interaction studies.The development of solid-phase surface-based single molecule imaging technology has attracted significant interest during the past decades. Here we demonstrate a sandwich hybridization method for highly sensitive detection of a single thrombin protein at a solid-phase surface based on the use of dual-color colocalization of fluorescent quantum dot (QD) nanoprobes. Green QD560-modified thrombin binding aptamer I (QD560-TBA I) were deposited on a positive poly(l-lysine) assembled layer, followed by bovine serum albumin blocking. It allowed the thrombin protein to mediate the binding of the easily detectable red QD650-modified thrombin binding aptamer II (QD650-TBA II) to

  15. Investigation of parameters that affect the success rate of microarray-based allele-specific hybridization assays.

    Directory of Open Access Journals (Sweden)

    Lena Poulsen

    Full Text Available BACKGROUND: The development of microarray-based genetic tests for diseases that are caused by known mutations is becoming increasingly important. The key obstacle to developing functional genotyping assays is that such mutations need to be genotyped regardless of their location in genomic regions. These regions include large variations in G+C content, and structural features like hairpins. METHODS/FINDINGS: We describe a rational, stable method for screening and combining assay conditions for the genetic analysis of 42 Phenylketonuria-associated mutations in the phenylalanine hydroxylase gene. The mutations are located in regions with large variations in G+C content (20-75%. Custom-made microarrays with different lengths of complementary probe sequences and spacers were hybridized with pooled PCR products of 12 exons from each of 38 individual patient DNA samples. The arrays were washed with eight buffers with different stringencies in a custom-made microfluidic system. The data were used to assess which parameters play significant roles in assay development. CONCLUSIONS: Several assay development methods found suitable probes and assay conditions for a functional test for all investigated mutation sites. Probe length, probe spacer length, and assay stringency sufficed as variable parameters in the search for a functional multiplex assay. We discuss the optimal assay development methods for several different scenarios.

  16. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC.

    Directory of Open Access Journals (Sweden)

    Zachary F Phillips

    Full Text Available We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification-an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC, is a single-shot variant of Differential Phase Contrast (DPC, which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps for various in vitro cell samples and c. elegans in a micro-fluidic channel.

  17. Single-Cell Based Quantitative Assay of Chromosome Transmission Fidelity.

    Science.gov (United States)

    Zhu, Jin; Heinecke, Dominic; Mulla, Wahid A; Bradford, William D; Rubinstein, Boris; Box, Andrew; Haug, Jeffrey S; Li, Rong

    2015-03-30

    Errors in mitosis are a primary cause of chromosome instability (CIN), generating aneuploid progeny cells. Whereas a variety of factors can influence CIN, under most conditions mitotic errors are rare events that have been difficult to measure accurately. Here we report a green fluorescent protein-based quantitative chromosome transmission fidelity (qCTF) assay in budding yeast that allows sensitive and quantitative detection of CIN and can be easily adapted to high-throughput analysis. Using the qCTF assay, we performed genome-wide quantitative profiling of genes that affect CIN in a dosage-dependent manner and identified genes that elevate CIN when either increased (icCIN) or decreased in copy number (dcCIN). Unexpectedly, qCTF screening also revealed genes whose change in copy number quantitatively suppress CIN, suggesting that the basal error rate of the wild-type genome is not minimized, but rather, may have evolved toward an optimal level that balances both stability and low-level karyotype variation for evolutionary adaptation. Copyright © 2015 Zhu et al.

  18. High core count single-mode multicore fiber for dense space division multiplexing

    DEFF Research Database (Denmark)

    Aikawa, K.; Sasaki, Y.; Amma, Y.

    2016-01-01

    Multicore fibers and few-mode fibers have the potential to realize dense-space-division multiplexing systems. Several dense-space-division multiplexing system transmission experiments over multicore fibers and few-mode fibers have been demonstrated so far. Multicore fibers, including recent resul...

  19. Evaluation of the new AmpliSens multiplex real-time PCR assay for simultaneous detection of Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, and Trichomonas vaginalis.

    Science.gov (United States)

    Rumyantseva, Tatiana; Golparian, Daniel; Nilsson, Christian S; Johansson, Emma; Falk, My; Fredlund, Hans; Van Dam, Alje; Guschin, Alexander; Unemo, Magnus

    2015-10-01

    In this study, we performed an evaluation of the new CE-marked multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay compared to APTIMA tests, i.e., APTIMA COMBO 2 assay, APTIMA Trichomonas vaginalis assay (FDA-approved), and two different APTIMA Mycoplasma genitalium assays (research use only; one of them only used for discrepancy analysis). Vaginal swabs (n = 209) and first-void urine (FVU) specimens from females (n = 498) and males (n = 554), consecutive attendees (n = 1261) at a dermatovenerological clinic in Sweden, were examined. The sensitivity of the AmpliSens PCR assay for detection of C. trachomatis (6.3% prevalence), M. genitalium (5.7% prevalence), N. gonorrhoeae (0.3% prevalence), and T. vaginalis (0.08% prevalence) was 97.5% (95% confidence interval (CI): 91.2-99.6%), 81.9% (95% CI: 70.7-89.7%), 100% (95% CI: 40.2-100%) and 100% (95% CI: 16.5-100%), respectively. The specificity of the AmpliSens PCR assay was 100% (95% CI: 99.6-100%) for all agents. The analytical sensitivity and specificity for N. gonorrhoeae detection was excellent, i.e., 55 international gonococcal strains detected and 135 isolates of 13 non-gonococcal Neisseria species were negative. In conclusion, the multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay demonstrated high sensitivity and excellent specificity for the detection of C. trachomatis, N. gonorrhoeae, and T. vaginalis, and excellent specificity but suboptimal sensitivity for M. genitalium detection. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  20. Light-Addressed Electrodeposition of Enzyme-Entrapped Chitosan Membranes for Multiplexed Enzyme-Based Bioassays Using a Digital Micromirror Device

    Directory of Open Access Journals (Sweden)

    Yeu-Long Jiang

    2013-08-01

    Full Text Available This paper describes a light-addressed electrolytic system used to perform an electrodeposition of enzyme-entrapped chitosan membranes for multiplexed enzyme-based bioassays using a digital micromirror device (DMD. In this system, a patterned light illumination is projected onto a photoconductive substrate serving as a photo-cathode to electrolytically produce hydroxide ions, which leads to an increased pH gradient. The high pH generated at the cathode can cause a local gelation of chitosan through sol-gel transition. By controlling the illumination pattern on the DMD, a light-addressed electrodeposition of chitosan membranes with different shapes and sizes, as well as multiplexed micropatterning, was performed. The effect of the illumination time of the light pattern on the dimensional resolution of chitosan membrane formation was examined experimentally. Moreover, multiplexed enzyme-based bioassay of enzyme-entrapped chitosan membranes was also successfully demonstrated through the electrodeposition of the chitosan membranes with various shapes/sizes and entrapping different enzymes. As a model experiment, glucose and ethanol were simultaneously detected in a single detection chamber without cross-talk using shape-coded chitosan membranes entrapped with glucose oxidase (GOX, peroxidase (POD, and Amplex Red (AmR or alcohol oxidase (AOX, POD, and AmR by using same fluorescence indicator (AmR.

  1. A Lateral Flow Protein Microarray for Rapid and Sensitive Antibody Assays

    Directory of Open Access Journals (Sweden)

    Helene Andersson-Svahn

    2011-11-01

    Full Text Available Protein microarrays are useful tools for highly multiplexed determination of presence or levels of clinically relevant biomarkers in human tissues and biofluids. However, such tools have thus far been restricted to laboratory environments. Here, we present a novel 384-plexed easy to use lateral flow protein microarray device capable of sensitive (< 30 ng/mL determination of antigen-specific antibodies in ten minutes of total assay time. Results were developed with gold nanobeads and could be recorded by a cell-phone camera or table top scanner. Excellent accuracy with an area under curve (AUC of 98% was achieved in comparison with an established glass microarray assay for 26 antigen-specific antibodies. We propose that the presented framework could find use in convenient and cost-efficient quality control of antibody production, as well as in providing a platform for multiplexed affinity-based assays in low-resource or mobile settings.

  2. Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.

    Science.gov (United States)

    Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon

    2017-01-01

    A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.

  3. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

    DEFF Research Database (Denmark)

    Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

    2013-01-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay....... The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel...... testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...

  4. 2x2 MIMO-OFDM Gigabit fiber-wireless access system based on polarization division multiplexed WDM-PON

    DEFF Research Database (Denmark)

    Deng, Lei; Pang, Xiaodan; Zhao, Ying

    2012-01-01

    We propose a spectral efficient radio over wavelength division multiplexed passive optical network (WDM-PON) system by combining optical polarization division multiplexing (PDM) and wireless multiple input multiple output (MIMO) spatial multiplexing techniques. In our experiment, a training-based...

  5. Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens

    Directory of Open Access Journals (Sweden)

    Mehmet Sarıer

    2017-03-01

    Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion

  6. The single-cell gel electrophoresis assay to determine apoptosis ...

    African Journals Online (AJOL)

    When the frequency of appearance of apoptotic cells following was observed over a period of time, there was a significant increase in appearance of apoptosis when using single cell gel electrophoresis assay. The present report demonstrates that the characteristic pattern of apoptotic comets detected by the comet assay ...

  7. Development of a multiplex assay for genus- and species-specific detection of Phytophthora based on differences in mitochondrial gene order.

    Science.gov (United States)

    Bilodeau, Guillaume J; Martin, Frank N; Coffey, Michael D; Blomquist, Cheryl L

    2014-07-01

    A molecular diagnostic assay for Phytophthora spp. that is specific, sensitive, has both genus- and species-specific detection capabilities multiplexed, and can be used to systematically develop markers for detection of a wide range of species would facilitate research and regulatory efforts. To address this need, a marker system was developed based on the high copy sequences of the mitochondrial DNA utilizing gene orders that were highly conserved in the genus Phytophthora but different in the related genus Pythium and plants to reduce the importance of highly controlled annealing temperatures for specificity. An amplification primer pair designed from conserved regions of the atp9 and nad9 genes produced an amplicon of ≈340 bp specific for the Phytophthora spp. tested. The TaqMan probe for the genus-specific Phytophthora test was designed from a conserved portion of the atp9 gene whereas variable intergenic spacer sequences were used for designing the species-specific TaqMan probes. Specific probes were developed for 13 species and the P. citricola species complex. In silico analysis suggests that species-specific probes could be developed for at least 70 additional described and provisional species; the use of locked nucleic acids in TaqMan probes should expand this list. A second locus spanning three tRNAs (trnM-trnP-trnM) was also evaluated for genus-specific detection capabilities. At 206 bp, it was not as useful for systematic development of a broad range of species-specific probes as the larger 340-bp amplicon. All markers were validated against a test panel that included 87 Phytophthora spp., 14 provisional Phytophthora spp., 29 Pythium spp., 1 Phytopythium sp., and 39 plant species. Species-specific probes were validated further against a range of geographically diverse isolates to ensure uniformity of detection at an intraspecific level, as well as with other species having high levels of sequence similarity to ensure specificity. Both diagnostic

  8. Fast reconstruction of off-axis digital holograms based on digital spatial multiplexing.

    Science.gov (United States)

    Sha, Bei; Liu, Xuan; Ge, Xiao-Lu; Guo, Cheng-Shan

    2014-09-22

    A method for fast reconstruction of off-axis digital holograms based on digital multiplexing algorithm is proposed. Instead of the existed angular multiplexing (AM), the new method utilizes a spatial multiplexing (SM) algorithm, in which four off-axis holograms recorded in sequence are synthesized into one SM function through multiplying each hologram with a tilted plane wave and then adding them up. In comparison with the conventional methods, the SM algorithm simplifies two-dimensional (2-D) Fourier transforms (FTs) of four N*N arrays into a 1.25-D FTs of one N*N arrays. Experimental results demonstrate that, using the SM algorithm, the computational efficiency can be improved and the reconstructed wavefronts keep the same quality as those retrieved based on the existed AM method. This algorithm may be useful in design of a fast preview system of dynamic wavefront imaging in digital holography.

  9. Multiplex detection of tumor markers with photonic suspension array

    Energy Technology Data Exchange (ETDEWEB)

    Zhao Yuanjin; Zhao Xiangwei [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Pei Xiaoping [Department of Hematology, Affiliated Zhongda Hospital, Southeast University, Nanjing 210009 (China); Hu Jing; Zhao Wenju [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Chen Baoan [Department of Hematology, Affiliated Zhongda Hospital, Southeast University, Nanjing 210009 (China); Gu Zhongze [State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096 (China); Laboratory of Environment and Biosafety, Research Institute of Southeast University in Suzhou, Dushu Lake Higher Education Town, Suzhou 215123 (China)], E-mail: gu@seu.edu.cn

    2009-02-02

    A novel photonic suspension array was developed for multiplex immunoassay. The carries of this array were silica colloidal crystal beads (SCCBs). The codes of these carriers are the characteristic reflection peak originated from their structural periodicity, and therefore they do not suffer from fading, bleaching, quenching, and chemical instability. In addition, because no dyes or materials related with fluorescence are included, the fluorescence background of SCCBs is very low. With a sandwich format, the proposed suspension array was used for simultaneous multiplex detection of tumor markers in one test tube. The results showed that the four tumor markers, {alpha}-fetoprotein (AFP), carcinoembryonic antigen (CEA), carcinoma antigen 125 (CA 125) and carcinoma antigen 19-9 (CA 19-9) could be assayed in the ranges of 1.0-500 ng mL{sup -1}, 1.0-500 ng mL{sup -1}, 1.0-500 U mL{sup -1} and 3.0-500 U mL{sup -1} with limits of detection of 0.68 ng mL{sup -1}, 0.95 ng mL{sup -1}, 0.99 U mL{sup -1} and 2.30 U mL{sup -1} at 3{sigma}, respectively. The proposed array showed acceptable accuracy, detection reproducibility, storage stability and the results obtained were in acceptable agreement with those from parallel single-analyte test of practical clinical sera. This technique provides a new strategy for low cost, automated, and simultaneous multiplex immunoassay.

  10. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Detection and removal of spatial bias in multiwell assays.

    Science.gov (United States)

    Lachmann, Alexander; Giorgi, Federico M; Alvarez, Mariano J; Califano, Andrea

    2016-07-01

    Multiplex readout assays are now increasingly being performed using microfluidic automation in multiwell format. For instance, the Library of Integrated Network-based Cellular Signatures (LINCS) has produced gene expression measurements for tens of thousands of distinct cell perturbations using a 384-well plate format. This dataset is by far the largest 384-well gene expression measurement assay ever performed. We investigated the gene expression profiles of a million samples from the LINCS dataset and found that the vast majority (96%) of the tested plates were affected by a significant 2D spatial bias. Using a novel algorithm combining spatial autocorrelation detection and principal component analysis, we could remove most of the spatial bias from the LINCS dataset and show in parallel a dramatic improvement of similarity between biological replicates assayed in different plates. The proposed methodology is fully general and can be applied to any highly multiplexed assay performed in multiwell format. ac2248@columbia.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Topology-optimized silicon photonic wire mode (de)multiplexer

    DEFF Research Database (Denmark)

    Frellsen, Louise Floor; Frandsen, Lars Hagedorn; Ding, Yunhong

    2015-01-01

    We have designed and for the first time experimentally verified a topology optimized mode (de)multiplexer, which demultiplexes the fundamental and the first order mode of a double mode photonic wire to two separate single mode waveguides (and multiplexes vice versa). The device has a footprint...

  13. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    Science.gov (United States)

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  14. Inter-laboratory assessment of a prototype multiplex kit for determination of recent HIV-1 infection.

    Directory of Open Access Journals (Sweden)

    Kelly A Curtis

    Full Text Available BACKGROUND: Accurate and reliable laboratory-based assays are needed for estimating HIV-1 incidence from cross-sectional samples. We recently described the development of a customized, HIV-1-specific Bio-Plex assay that allows for the measurement of HIV-specific antibody levels and avidity to multiple analytes for improved HIV-1 incidence estimates. METHODS: To assess intra- and inter-laboratory assay performance, prototype multiplex kits were developed and evaluated by three distinct laboratories. Longitudinal seroconversion specimens were tested in parallel by each laboratory and kit performance was compared to that of an in-house assay. Additionally, the ability of the kit to distinguish recent from long-term HIV-1 infection, as compared to the in-house assay, was determined by comparing the reactivity of known recent (infected 12 months drug naïve specimens. RESULTS: Although the range of reactivity for each analyte varied between the prototype kit and in-house assay, a measurable distinction in reactivity between recent and long-term specimens was observed with both assays in all three laboratories. Additionally, kit performance was consistent between all three laboratories. The intra-assay coefficient of variation (CV, between sample replicates for all laboratories, ranged from 0.5% to 6.1%. The inter-laboratory CVs ranged from 8.5% to 21.3% for gp160-avidity index (a and gp120-normalized mean fluorescent intensity (MFI value (n, respectively. CONCLUSION: We demonstrate the feasibility of producing a multiplex kit for measuring HIV antibody levels and avidity, with the potential for improved incidence estimates based on multi-analyte algorithms. The availability of a commercial kit will facilitate the transfer of technology among diverse laboratories for widespread assay use.

  15. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  16. Demonstration of Time Domain Multiplexed Readout for Magnetically Coupled Calorimeters

    Science.gov (United States)

    Porst, J.-P.; Adams, J. S.; Balvin, M.; Bandler, S.; Beyer, J.; Busch, S. E.; Drung, D.; Seidel, G. M.; Smith, S. J.; Stevenson, T. R.

    2012-01-01

    Magnetically coupled calorimeters (MCC) have extremely high potential for x-ray applications due to the inherent high energy resolution capability and being non-dissipative. Although very high energy-resolution has been demonstrated, until now there has been no demonstration of multiplexed read-out. We report on the first realization of a time domain multiplexed (TDM) read-out. While this has many similarities with TDM of transition-edge-sensors (TES), for MGGs the energy resolution is limited by the SQUID read-out noise and requires the well established scheme to be altered in order to minimize degradation due to noise aliasing effects. In cur approach, each pixel is read out by a single first stage SQUID (SQ1) that is operated in open loop. The outputs of the SQ1 s are low-pass filtered with an array of low cross-talk inductors, then fed into a single-stage SQUID TD multiplexer. The multiplexer is addressed from room temperature and read out through a single amplifier channel. We present results achieved with a new detector platform. Noise performance is presented and compared to expectations. We have demonstrated multiplexed X-ray spectroscopy at 5.9keV with delta_FWHM=10eV. In an optimized setup, we show it is possible to multiplex 32 detectors without significantly degrading the Intrinsic detector resolution.

  17. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  18. Allergen extracts and recombinant proteins: comparison of efficiency of in vitro allergy diagnostics using multiplex assay on a biological microchip.

    Science.gov (United States)

    Smoldovskaya, Olga; Feyzkhanova, Guzel; Arefieva, Alla; Voloshin, Sergei; Ivashkina, Olga; Reznikov, Yuriy; Rubina, Alla

    2016-01-01

    Immunological test systems for diagnostics of type I hypersensitivity involve the following types of antigens: whole allergen extracts, individual highly purified proteins and their recombinant analogues. The goal of this study was to compare the results obtained with whole allergen extracts (birch pollen, cat dander, and timothy grass pollen) and their respective recombinant proteins in biochip-based immunoassay. Multiplex fluorescent immunoassay of 139 patients' blood serum samples was carried out using biological microchips (biochips). sIgE concentrations for the chosen allergens and their recombinant components were measured. ROC analysis was used for comparison of the results and determination of diagnostic accuracy. The results for the birch pollen extract and its recombinant allergens have shown that the diagnostic accuracy of the methods utilizing the whole allergen extract, its major component Bet v 1 and the combination of major and minor components (Bet v 1 and Bet v 2) was the same. Values for diagnostic accuracy for the cat dander extract and its major recombinant component Fel d 1 were equal. In contrast with birch pollen and cat dander allergens, using of recombinant components of timothy grass pollen (Phl p 1, Phl p 5, Phl p 7 and Phl p 12) did not allow reaching the diagnostic accuracy of using natural extract. Multiplex analysis of samples obtained from patients with allergy to birch pollen and cat dander using biological microchips has shown that comparable accuracy was observed for the assay with natural extracts and recombinant allergens. In the case of timothy grass allergen, using the recombinant components may be insufficient.

  19. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

    Science.gov (United States)

    Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

    2002-12-01

    The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

  20. Multiplexed, high density electrophysiology with nanofabricated neural probes.

    Directory of Open Access Journals (Sweden)

    Jiangang Du

    Full Text Available Extracellular electrode arrays can reveal the neuronal network correlates of behavior with single-cell, single-spike, and sub-millisecond resolution. However, implantable electrodes are inherently invasive, and efforts to scale up the number and density of recording sites must compromise on device size in order to connect the electrodes. Here, we report on silicon-based neural probes employing nanofabricated, high-density electrical leads. Furthermore, we address the challenge of reading out multichannel data with an application-specific integrated circuit (ASIC performing signal amplification, band-pass filtering, and multiplexing functions. We demonstrate high spatial resolution extracellular measurements with a fully integrated, low noise 64-channel system weighing just 330 mg. The on-chip multiplexers make possible recordings with substantially fewer external wires than the number of input channels. By combining nanofabricated probes with ASICs we have implemented a system for performing large-scale, high-density electrophysiology in small, freely behaving animals that is both minimally invasive and highly scalable.

  1. Improved multiplex ligation-dependent probe amplification analysis identifies a deleterious PMS2 allele generated by recombination with crossover between PMS2 and PMS2CL

    OpenAIRE

    Wernstedt, Annekatrin; Valtorta, Emanuele; Armelao, Franco; Togni, Roberto; Girlando, Salvatore; Baudis, Michael; Heinimann, Karl; Messiaen, Ludwine; Staehli, Noemie; Zschocke, Johannes; Marra, Giancarlo; Wimmer, Katharina

    2012-01-01

    Heterozygous PMS2 germline mutations are associated with Lynch syndrome. Up to one third of these mutations are genomic deletions. Their detection is complicated by a pseudogene (PMS2CL), which – owing to extensive interparalog sequence exchange – closely resembles PMS2 downstream of exon 12. A recently redesigned multiplex ligation-dependent probe amplification (MLPA) assay identifies PMS2 copy number alterations with improved reliability when used with reference DNAs containing equal number...

  2. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jakociunas, Tadas; Bonde, Ida; Herrgard, Markus

    2015-01-01

    CRISPR/Cas9 is a simple and efficient tool for targeted and marker-free genome engineering. Here, we report the development and successful application of a multiplex CRISPR/Cas9 system for genome engineering of up to 5 different genomic loci in one transformation step in baker's yeast Saccharomyces...... cerevisiae. To assess the specificity of the tool we employed genome re-sequencing to screen for off-target sites in all single knock-out strains targeted by different gRNAs. This extensive analysis identified no more genome variants in CRISPR/Cas9 engineered strains compared to wild-type reference strains...

  3. Simultaneous measurements of auto-immune and infectious disease specific antibodies using a high throughput multiplexing tool.

    Directory of Open Access Journals (Sweden)

    Atul Asati

    Full Text Available Considering importance of ganglioside antibodies as biomarkers in various immune-mediated neuropathies and neurological disorders, we developed a high throughput multiplexing tool for the assessment of gangliosides-specific antibodies based on Biolpex/Luminex platform. In this report, we demonstrate that the ganglioside high throughput multiplexing tool is robust, highly specific and demonstrating ∼100-fold higher concentration sensitivity for IgG detection than ELISA. In addition to the ganglioside-coated array, the high throughput multiplexing tool contains beads coated with influenza hemagglutinins derived from H1N1 A/Brisbane/59/07 and H1N1 A/California/07/09 strains. Influenza beads provided an added advantage of simultaneous detection of ganglioside- and influenza-specific antibodies, a capacity important for the assay of both infectious antigen-specific and autoimmune antibodies following vaccination or disease. Taken together, these results support the potential adoption of the ganglioside high throughput multiplexing tool for measuring ganglioside antibodies in various neuropathic and neurological disorders.

  4. Design and fabrication of three-dimensional polymer mode multiplexer based on asymmetric waveguide couplers

    Science.gov (United States)

    He, Guobing; Gao, Yang; Xu, Yan; Ji, Lanting; Sun, Xiaoqiang; Wang, Xibin; Yi, Yunji; Chen, Changming; Wang, Fei; Zhang, Daming; Wu, Yuanda

    2018-05-01

    A polymer mode multiplexer based on asymmetric couplers is theoretically designed and experimentally demonstrated. The proposed X-junction coupler is formed by waveguides overlapped with different crossing angles in the vertical direction. A beam propagation method is adopted to optimize the dimensional parameters of the mode multiplexer to convert LP01 mode of two lower waveguides to LP11a and LP21a mode of the upper waveguide. The ultraviolet lithography and wet chemical etching are used in the fabrication process. A conversion ratio over 98% for both LP11a and LP21a mode in the wavelength range from 1530 to 1570 nm are experimentally demonstrated. This mode multiplexer has potential in broadband mode-division multiplexing transmission systems.

  5. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience.

    Science.gov (United States)

    Nielsen, Alex Christian Yde; Böttiger, Blenda; Midgley, Sofie Elisabeth; Nielsen, Lars Peter

    2013-11-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay. The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses in 171 (8%) and 66 (3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause similar clinical symptoms. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Using latent class analysis to estimate the test characteristics of the γ-interferon test, the single intradermal comparative tuberculin test and a multiplex immunoassay under Irish conditions

    DEFF Research Database (Denmark)

    Clegg, Tracy A.; Duignan, Anthony; Whelan, Clare

    2011-01-01

    Considerable effort has been devoted to improving the existing diagnostic tests for bovine tuberculosis (single intradermal comparative tuberculin test [SICTT] and ¿-interferon assay [¿-IFN]) and to develop new tests. Previously, the diagnostic characteristics (sensitivity, specificity) have been...... estimated in populations with defined infection status. However, these approaches can be problematic as there may be few herds in Ireland where freedom from infection is guaranteed. We used latent class models to estimate the diagnostic characteristics of existing (SICTT and ¿-IFN) and new (multiplex...... immunoassay [Enferplex-TB]) diagnostic tests under Irish field conditions where true disease status was unknown. The study population consisted of herds recruited in areas with no known TB problems (2197 animals) and herds experiencing a confirmed TB breakdown (2740 animals). A Bayesian model was developed...

  7. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Børsting, Claus; Morling, Niels

    2012-01-01

    and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...

  8. A micro-controlled universal message multiplexer

    International Nuclear Information System (INIS)

    Fontaine, G.; Guglielmi, L.; Jaeger, J.J.; Szafran, S.

    1981-01-01

    Based on the Motorola 6800, this multiplexer is designed to provide a microprocessor development tool in the specific environment of a high energy physics laboratory. The basic philosophy of this device is to allow communication of a target (prototype) processor with a host computer under control of a human operator. The host can be an experimental on-line computer or any remote machine with a time-sharing network. It is thus possible to speed up design and debugging of a physics application program by taking advantage of the sophisticated resources usually available in a computer centre (powerful editor, large disk space, source management via ''Patchy'' etc...). In addition to the classical cross-macroassembler, a loader is available on the host for down-line loading binary code, via the multiplexer, into the prototype memory. Such a scheme is easiextended to the communication of any host interactive processing program with a data acquisition microprocessor, and provides the latter with a convenient and easily portable extension of its computing power. A typical application of this mode is described in a separate paper

  9. Development of an ELISA microarray assay for the sensitive and simultaneous detection of ten biodefense toxins.

    Energy Technology Data Exchange (ETDEWEB)

    Jenko, Kathryn; Zhang, Yanfeng; Kostenko, Yulia; Fan, Yongfeng; Garcia-Rodriguez, Consuelo; Lou, Jianlong; Marks, James D.; Varnum, Susan M.

    2014-10-21

    Plant and microbial toxins are considered bioterrorism threat agents because of their extreme toxicity and/or ease of availability. Additionally, some of these toxins are increasingly responsible for accidental food poisonings. The current study utilized an ELISA-based protein antibody microarray for the multiplexed detection of ten biothreat toxins, botulinum neurotoxins (BoNT) A, B, C, D, E, F, ricin, shiga toxins 1 and 2 (Stx), and staphylococcus enterotoxin B (SEB), in buffer and complex biological matrices. The multiplexed assay displayed a sensitivity of 1.3 pg/mL (BoNT/A, BoNT/B, SEB, Stx-1 and Stx-2), 3.3 pg/mL (BoNT/C, BoNT/E, BoNT/F) and 8.2 pg/mL (BoNT/D, ricin). All assays demonstrated high accuracy (75-120 percent recovery) and reproducibility (most coefficients of variation < 20%). Quantification curves for the ten toxins were also evaluated in clinical samples (serum, plasma, nasal fluid, saliva, stool, and urine) and environmental samples (apple juice, milk and baby food) with overall minimal matrix effects. The multiplex assays were highly specific, with little crossreactivity observed between the selected toxin antibodies. The results demonstrate a multiplex microarray that improves current immunoassay sensitivity for biological warfare agents in buffer, clinical, and environmental samples.

  10. Ultra-high resolution HLA genotyping and allele discovery by highly multiplexed cDNA amplicon pyrosequencing

    Directory of Open Access Journals (Sweden)

    Lank Simon M

    2012-08-01

    Full Text Available Abstract Background High-resolution HLA genotyping is a critical diagnostic and research assay. Current methods rarely achieve unambiguous high-resolution typing without making population-specific frequency inferences due to a lack of locus coverage and difficulty in exon-phase matching. Achieving high-resolution typing is also becoming more challenging with traditional methods as the database of known HLA alleles increases. Results We designed a cDNA amplicon-based pyrosequencing method to capture 94% of the HLA class I open-reading-frame with only two amplicons per sample, and an analogous method for class II HLA genes, with a primary focus on sequencing the DRB loci. We present a novel Galaxy server-based analysis workflow for determining genotype. During assay validation, we performed two GS Junior sequencing runs to determine the accuracy of the HLA class I amplicons and DRB amplicon at different levels of multiplexing. When 116 amplicons were multiplexed, we unambiguously resolved 99%of class I alleles to four- or six-digit resolution, as well as 100% unambiguous DRB calls. The second experiment, with 271 multiplexed amplicons, missed some alleles, but generated high-resolution, concordant typing for 93% of class I alleles, and 96% for DRB1 alleles. In a third, preliminary experiment we attempted to sequence novel amplicons for other class II loci with mixed success. Conclusions The presented assay is higher-throughput and higher-resolution than existing HLA genotyping methods, and suitable for allele discovery or large cohort sampling. The validated class I and DRB primers successfully generated unambiguously high-resolution genotypes, while further work is needed to validate additional class II genotyping amplicons.

  11. Development of a bead-based Luminex assay using lipopolysaccharide specific monoclonal antibodies to detect biological threats from Brucella species.

    Science.gov (United States)

    Silbereisen, Angelika; Tamborrini, Marco; Wittwer, Matthias; Schürch, Nadia; Pluschke, Gerd

    2015-10-05

    Brucella, a Gram-negative bacterium, is classified as a potential bioterrorism agent mainly due to the low dose needed to cause infection and the ability to transmit the bacteria via aerosols. Goats/sheep, cattle, pigs, dogs, sheep and rodents are infected by B. melitensis, B. abortus, B. suis, B. canis, B. ovis and B. neotomae, respectively, the six classical Brucella species. Most human cases are caused by B. melitensis and B. abortus. Our aim was to specifically detect Brucellae with 'smooth' lipopolysaccharide (LPS) using a highly sensitive monoclonal antibody (mAb) based immunological assay. To complement molecular detection systems for potential bioterror agents, as required by international biodefense regulations, sets of mAbs were generated by B cell hybridoma technology and used to develop immunological assays. The combination of mAbs most suitable for an antigen capture assay format was identified and an immunoassay using the Luminex xMAP technology was developed. MAbs specific for the LPS O-antigen of Brucella spp. were generated by immunising mice with inactivated B. melitensis or B. abortus cells. Most mAbs recognised both B. melitensis and B. abortus and antigen binding was not impeded by inactivation of the bacterial cells by γ irradiation, formalin or heat treatment, a step required to analyse the samples immunologically under biosafety level two conditions. The Luminex assay recognised all tested Brucella species with 'smooth' LPS with detection limits of 2×10(2) to 8×10(4) cells per mL, depending on the species tested. Milk samples spiked with Brucella spp. cells were identified successfully using the Luminex assay. In addition, the bead-based immunoassay was integrated into a multiplex format, allowing for simultaneous, rapid and specific detection of Brucella spp., Bacillus anthracis, Francisella tularensis and Yersinia pestis within a single sample. Overall, the robust Luminex assay should allow detection of Brucella spp. in both natural

  12. Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

    Science.gov (United States)

    TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

  13. An in vitro tag-and-modify protein sample generation method for single-molecule fluorescence resonance energy transfer.

    Science.gov (United States)

    Hamadani, Kambiz M; Howe, Jesse; Jensen, Madeleine K; Wu, Peng; Cate, Jamie H D; Marqusee, Susan

    2017-09-22

    Biomolecular systems exhibit many dynamic and biologically relevant properties, such as conformational fluctuations, multistep catalysis, transient interactions, folding, and allosteric structural transitions. These properties are challenging to detect and engineer using standard ensemble-based techniques. To address this drawback, single-molecule methods offer a way to access conformational distributions, transient states, and asynchronous dynamics inaccessible to these standard techniques. Fluorescence-based single-molecule approaches are parallelizable and compatible with multiplexed detection; to date, however, they have remained limited to serial screens of small protein libraries. This stems from the current absence of methods for generating either individual dual-labeled protein samples at high throughputs or protein libraries compatible with multiplexed screening platforms. Here, we demonstrate that by combining purified and reconstituted in vitro translation, quantitative unnatural amino acid incorporation via AUG codon reassignment, and copper-catalyzed azide-alkyne cycloaddition, we can overcome these challenges for target proteins that are, or can be, methionine-depleted. We present an in vitro parallelizable approach that does not require laborious target-specific purification to generate dual-labeled proteins and ribosome-nascent chain libraries suitable for single-molecule FRET-based conformational phenotyping. We demonstrate the power of this approach by tracking the effects of mutations, C-terminal extensions, and ribosomal tethering on the structure and stability of three protein model systems: barnase, spectrin, and T4 lysozyme. Importantly, dual-labeled ribosome-nascent chain libraries enable single-molecule co-localization of genotypes with phenotypes, are well suited for multiplexed single-molecule screening of protein libraries, and should enable the in vitro directed evolution of proteins with designer single-molecule conformational

  14. Single-cell nanotoxicity assays of superparamagnetic iron oxide nanoparticles.

    Science.gov (United States)

    Eustaquio, Trisha; Leary, James F

    2012-01-01

    Properly evaluating the nanotoxicity of nanoparticles involves much more than bulk-cell assays of cell death by necrosis. Cells exposed to nanoparticles may undergo repairable oxidative stress and DNA damage or be induced into apoptosis. Exposure to nanoparticles may cause the cells to alter their proliferation or differentiation or their cell-cell signaling with neighboring cells in a tissue. Nanoparticles are usually more toxic to some cell subpopulations than others, and toxicity often varies with cell cycle. All of these facts dictate that any nanotoxicity assay must be at the single-cell level and must try whenever feasible and reasonable to include many of these other factors. Focusing on one type of quantitative measure of nanotoxicity, we describe flow and scanning image cytometry approaches to measuring nanotoxicity at the single-cell level by using a commonly used assay for distinguishing between necrotic and apoptotic causes of cell death by one type of nanoparticle. Flow cytometry is fast and quantitative, provided that the cells can be prepared into a single-cell suspension for analysis. But when cells cannot be put into suspension without altering nanotoxicity results, or if morphology, attachment, and stain location are important, a scanning image cytometry approach must be used. Both methods are described with application to a particular type of nanoparticle, a superparamagnetic iron oxide nanoparticle (SPION), as an example of how these assays may be applied to the more general problem of determining the effects of nanomaterial exposure to living cells.

  15. Multiplex engineering of industrial yeast genomes using CRISPRm.

    Science.gov (United States)

    Ryan, Owen W; Cate, Jamie H D

    2014-01-01

    Global demand has driven the use of industrial strains of the yeast Saccharomyces cerevisiae for large-scale production of biofuels and renewable chemicals. However, the genetic basis of desired domestication traits is poorly understood because robust genetic tools do not exist for industrial hosts. We present an efficient, marker-free, high-throughput, and multiplexed genome editing platform for industrial strains of S. cerevisiae that uses plasmid-based expression of the CRISPR/Cas9 endonuclease and multiple ribozyme-protected single guide RNAs. With this multiplex CRISPR (CRISPRm) system, it is possible to integrate DNA libraries into the chromosome for evolution experiments, and to engineer multiple loci simultaneously. The CRISPRm tools should therefore find use in many higher-order synthetic biology applications to accelerate improvements in industrial microorganisms.

  16. Development of a VHH-Based Erythropoietin Quantification Assay

    DEFF Research Database (Denmark)

    Kol, Stefan; Beuchert Kallehauge, Thomas; Adema, Simon

    2015-01-01

    Erythropoietin (EPO) quantification during cell line selection and bioreactor cultivation has traditionally been performed with ELISA or HPLC. As these techniques suffer from several drawbacks, we developed a novel EPO quantification assay. A camelid single-domain antibody fragment directed against...... human EPO was evaluated as a capturing antibody in a label-free biolayer interferometry-based quantification assay. Human recombinant EPO can be specifically detected in Chinese hamster ovary cell supernatants in a sensitive and pH-dependent manner. This method enables rapid and robust quantification...

  17. Highly efficient volume hologram multiplexing in thick dye-doped jelly-like gelatin.

    Science.gov (United States)

    Katarkevich, Vasili M; Rubinov, Anatoli N; Efendiev, Terlan Sh

    2014-08-01

    Dye-doped jelly-like gelatin is a thick-layer self-developing photosensitive medium that allows single and multiplexed volume phase holograms to be successfully recorded using pulsed laser radiation. In this Letter, we present a method for multiplexed recording of volume holograms in a dye-doped jelly-like gelatin, which provides significant increase in their diffraction efficiency. The method is based on the recovery of the photobleached dye molecule concentration in the hologram recording zone of gel, thanks to molecule diffusion from other unexposed gel areas. As an example, an optical recording of a multiplexed hologram consisting of three superimposed Bragg gratings with mean values of the diffraction efficiency and angular selectivity of ∼75% and ∼21', respectively, is demonstrated by using the proposed method.

  18. Development and Validation of a Novel Real-time Assay for the Detection and Quantification of Vibrio cholerae

    DEFF Research Database (Denmark)

    Rashid, Ridwan Bin; Ferdous, Jannataul; Tulsiani, Suhella

    2017-01-01

    is rapid since neither lengthy incubation period nor electrophoresis is required. The assay had excellent repeatability (CV%: 0.24–1.32) and remarkable reproducibility (CV%: 1.08–3.7). Amplification efficiencies in the 89–100% range were observed. The assay is more economical than Taqman-based multiplex...

  19. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  20. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  1. Microbead agglutination based assays

    KAUST Repository

    Kodzius, Rimantas

    2013-01-21

    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microbeads in the presence of a specific analyte thus enabling the macroscopic observation. Such tests are most often used to explore antibody-antigen reactions. Agglutination has been used for protein assays using a biotin/streptavidin system as well as a hybridization based assay. The agglutination systems are prone to selftermination of the linking analyte, prone to active site saturation and loss of agglomeration at high analyte concentrations. We investigated the molecular target/ligand interaction, explaining the common agglutination problems related to analyte self-termination, linkage of the analyte to the same bead instead of different microbeads. We classified the agglutination process into three kinds of assays: a two- component assay, a three-component assay and a stepped three- component assay. Although we compared these three kinds of assays for recognizing DNA and protein molecules, the assay can be used for virtually any molecule, including ions and metabolites. In total, the optimized assay permits detecting analytes with high sensitivity in a short time, 5 min, at room temperature. Such a system is appropriate for POC testing.

  2. Progress on the development of human in vitro dendritic cell based assays for assessment of the sensitizing potential of a compound

    International Nuclear Information System (INIS)

    Galvao dos Santos, G.; Reinders, J.; Ouwehand, K.; Rustemeyer, T.; Scheper, R.J.; Gibbs, S.

    2009-01-01

    Allergic contact dermatitis is the result of an adaptive immune response of the skin to direct exposure to an allergen. Since many chemicals are also allergens, European regulations require strict screening of all ingredients in consumer products. Until recently, identifying a potential allergen has completely relied on animal testing (e.g.: Local Lymph Node Assay). In addition to the ethical problems, both the 7th Amendment to the Cosmetics Directive and REACH have stimulated the development of alternative tests for the assessment of potential sensitizers. This review is aimed at summarising the progress on cell based assays, in particular dendritic cell based assays, being developed as animal alternatives. Primary cells (CD34 + derived dendritic cells, monocyte derived dendritic cells) as well as dendritic cell-like cell lines (THP-1, U-937, MUTZ-3, KG-1, HL-60, and K562) are extensively described along with biomarkers such as cell surface markers, cytokines, chemokines and kinases. From this review, it can be concluded that no single cell based assay nor single marker is yet able to distinguish all sensitizers from non-sensitizers in a test panel of chemicals, nor is it possible to rank the sensitizing potential of the test chemicals. This suggests that sensitivity and specificity may be increased by a tiered assay approach. Only a limited number of genomic and proteomic studies have been completed until now. Such studies have the potential to identify novel biomarkers for inclusion in future assay development. Although progress is promising, this review suggests that it may be difficult to meet the up and coming European regulatory deadlines.

  3. Aquaporin-4 autoantibodies in neuromyelitis optica spectrum disorders: comparison between tissue-based and cell-based indirect immunofluorescence assays

    Directory of Open Access Journals (Sweden)

    Chan Koon H

    2010-09-01

    Full Text Available Abstract Background Neuromyelitis optica spectrum disorders (NMOSD are severe central nervous system inflammatory demyelinating disorders (CNS IDD characterized by monophasic or relapsing, longitudinally extensive transverse myelitis (LETM and/or optic neuritis (ON. A significant proportion of NMOSD patients are seropositive for aquaporin-4 (AQP4 autoantibodies. We compared the AQP4 autoantibody detection rates of tissue-based indirect immunofluorescence assay (IIFA and cell-based IIFA. Methods Serum of Chinese CNS IDD patients were assayed for AQP4 autoantibodies by tissue-based IIFA using monkey cerebellum and cell-based IIFA using transfected HEK293 cells which express human AQP4 on their cell membranes. Results In total, 128 CNS IDD patients were studied. We found that 78% of NMO patients were seropositive for AQP4 autoantibodies by cell-based IIFA versus 61% by tissue-based IFA (p = 0.250, 75% of patients having relapsing myelitis (RM with LETM were seropositive by cell-based IIFA versus 50% by tissue-based IIFA (p = 0.250, and 33% of relapsing ON patients were seropositive by cell-based IIFA versus 22% by tissue-based IIFA (p = 1.000; however the differences were not statistically significant. All patients seropositive by tissue-based IIFA were also seropositive for AQP4 autoantibodies by cell-based IIFA. Among 29 NMOSD patients seropositive for AQP4 autoantibodies by cell-based IIFA, 20 (69% were seropositive by tissue-based IIFA. The 9 patients seropositive by cell-based IIFA while seronegative by tissue-based IIFA had NMO (3, RM with LETM (3, a single attack of LETM (1, relapsing ON (1 and a single ON attack (1. Among 23 NMO or RM patients seropositive for AQP4 autoantibodies by cell-based IIFA, comparison between those seropositive (n = 17 and seronegative (n = 6 by tissue-based IIFA revealed no differences in clinical and neuroradiological characteristics between the two groups. Conclusion Cell-based IIFA is slightly more sensitive

  4. Reach Extension and Capacity Enhancement of VCSEL-Based Transmission Over Single-Lane MMF Links

    DEFF Research Database (Denmark)

    Tatarczak, Anna; Motaghiannezam, S. M. Reza; Kocot, Chris

    2017-01-01

    This paper reviews and examines several techniques for expanding the carrying capacity of multimode fiber (MMF) using vertical cavity surface emitting lasers (VCSELs). The first approach utilizes short wavelength division multiplexing in combination with MMF optimized for operation between 850 an...

  5. Multiplexed interfacial transduction of nucleic acid hybridization using a single color of immobilized quantum dot donor and two acceptors in fluorescence resonance energy transfer.

    Science.gov (United States)

    Algar, W Russ; Krull, Ulrich J

    2010-01-01

    A multiplexed solid-phase assay for the detection of nucleic acid hybridization was developed on the basis of a single color of immobilized CdSe/ZnS quantum dot (QD) as a donor in fluorescence resonance energy transfer (FRET). This work demonstrated that two channels of detection did not necessitate two different QD donors. Two probe oligonucleotides were coimmobilized on optical fibers modified with QDs, and a sandwich assay was used to associate the acceptor dyes with interfacial hybridization events without target labeling. FRET-sensitized acceptor emission provided an analytical signal that was concentration dependent down to 10 nM. Changes in the ratio of coimmobilized probe oligonucleotides were found to yield linear changes in the relative amounts of acceptor emission. These changes were compared to previous studies that used mixed films of two QD donors for two detection channels. The analysis indicated that probe dilution effects were primarily driven by changes in acceptor number density and that QD dilution effects or changes in mean donor-acceptor distance were secondary. Hybridization kinetics were found to be consistent between different ratios of coimmobilized probes, suggesting that hybridization in this type of system occurred via the accepted model for solid-phase hybridization, where adsorption and then diffusion at the solid interface drove hybridization.

  6. Multipurpose assessment for the quantification of Vibrio spp. and total bacteria in fish and seawater using multiplex real-time polymerase chain reaction

    Science.gov (United States)

    Kim, Ji Yeun; Lee, Jung-Lim

    2014-01-01

    Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974

  7. SERS-based inverse molecular sentinel (iMS) nanoprobes for multiplexed detection of microRNA cancer biomarkers in biological samples

    Science.gov (United States)

    Crawford, Bridget M.; Wang, Hsin-Neng; Fales, Andrew M.; Bowie, Michelle L.; Seewaldt, Victoria L.; Vo-Dinh, Tuan

    2017-02-01

    The development of sensitive and selective biosensing techniques is of great interest for clinical diagnostics. Here, we describe the development and application of a surface enhanced Raman scattering (SERS) sensing technology, referred to as "inverse Molecular Sentinel (iMS)" nanoprobes, for the detection of nucleic acid biomarkers in biological samples. This iMS nanoprobe involves the use of plasmonic-active nanostars as the sensing platform for a homogenous assay for multiplexed detection of nucleic acid biomarkers, including DNA, RNA and microRNA (miRNA). The "OFF-to-ON" signal switch is based on a non-enzymatic strand-displacement process and the conformational change of stem-loop (hairpin) oligonucleotide probes upon target binding. Here, we demonstrate the development of iMS nanoprobes for the detection of DNA sequences as well as a modified design of the nanoprobe for the detection of short (22-nt) microRNA sequences. The application of iMS nanoprobes to detect miRNAs in real biological samples was performed with total small RNA extracted from breast cancer cell lines. The multiplex capability of the iMS technique was demonstrated using a mixture of the two differently labeled nanoprobes to detect miR-21 and miR-34a miRNA biomarkers for breast cancer. The results of this study demonstrate the feasibility of applying the iMS technique for multiplexed detection of nucleic acid biomarkers, including short miRNAs molecules.

  8. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  9. NCI-FDA Interagency Oncology Task Force Workshop Provides Guidance for Analytical Validation of Protein-based Multiplex Assays | Office of Cancer Clinical Proteomics Research

    Science.gov (United States)

    An NCI-FDA Interagency Oncology Task Force (IOTF) Molecular Diagnostics Workshop was held on October 30, 2008 in Cambridge, MA, to discuss requirements for analytical validation of protein-based multiplex technologies in the context of its intended use. This workshop developed through NCI's Clinical Proteomic Technologies for Cancer initiative and the FDA focused on technology-specific analytical validation processes to be addressed prior to use in clinical settings. In making this workshop unique, a case study approach was used to discuss issues related to

  10. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    Science.gov (United States)

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  11. Microwave multiplex readout for superconducting sensors

    Energy Technology Data Exchange (ETDEWEB)

    Ferri, E., E-mail: elena.ferri@mib.infn.it [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Becker, D.; Bennett, D. [NIST, Boulder, CO (United States); Faverzani, M. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Fowler, J.; Gard, J. [NIST, Boulder, CO (United States); Giachero, A. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Hays-Wehle, J.; Hilton, G. [NIST, Boulder, CO (United States); Maino, M. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Mates, J. [NIST, Boulder, CO (United States); Puiu, A.; Nucciotti, A. [Università Milano-Bicocca, Milan (Italy); INFN Sez. di Milano-Bicocca, Milan (Italy); Reintsema, C.; Schmidt, D.; Swetz, D.; Ullom, J.; Vale, L. [NIST, Boulder, CO (United States)

    2016-07-11

    The absolute neutrino mass scale is still an outstanding challenge in both particle physics and cosmology. The calorimetric measurement of the energy released in a nuclear beta decay is a powerful tool to determine the effective electron-neutrino mass. In the last years, the progress on low temperature detector technologies has allowed to design large scale experiments aiming at pushing down the sensitivity on the neutrino mass below 1 eV. Even with outstanding performances in both energy (~ eV on keV) and time resolution (~ 1 μs) on the single channel, a large number of detectors working in parallel is required to reach a sub-eV sensitivity. Microwave frequency domain readout is the best available technique to readout large array of low temperature detectors, such as Transition Edge Sensors (TESs) or Microwave Kinetic Inductance Detectors (MKIDs). In this way a multiplex factor of the order of thousands can be reached, limited only by the bandwidth of the available commercial fast digitizers. This microwave multiplexing system will be used to readout the HOLMES detectors, an array of 1000 microcalorimeters based on TES sensors in which the {sup 163}Ho will be implanted. HOLMES is a new experiment for measuring the electron neutrino mass by means of the electron capture (EC) decay of {sup 163}Ho. We present here the microwave frequency multiplex which will be used in the HOLMES experiment and the microwave frequency multiplex used to readout the MKID detectors developed in Milan as well.

  12. Mixture models for single-cell assays with applications to vaccine studies

    OpenAIRE

    Finak, Greg; McDavid, Andrew; Chattopadhyay, Pratip; Dominguez, Maria; De Rosa, Steve; Roederer, Mario; Gottardo, Raphael

    2013-01-01

    Blood and tissue are composed of many functionally distinct cell subsets. In immunological studies, these can be measured accurately only using single-cell assays. The characterization of these small cell subsets is crucial to decipher system-level biological changes. For this reason, an increasing number of studies rely on assays that provide single-cell measurements of multiple genes and proteins from bulk cell samples. A common problem in the analysis of such data is to identify biomarkers...

  13. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  14. Mapping Cellular Hierarchy by Single-Cell Analysis of the Cell Surface Repertoire

    OpenAIRE

    Guo, Guoji; Luc, Sidinh; Marco, Eugenio; Lin, Ta-Wei; Peng, Cong; Kerenyi, Marc A.; Beyaz, Semir; Kim, Woojin; Xu, Jian; Das, Partha Pratim; Neff, Tobias; Zou, Keyong; Yuan, Guo-Cheng; Orkin, Stuart H.

    2013-01-01

    Stem cell differentiation pathways are most often studied at the population level, whereas critical decisions are executed at the level of single cells. We have established a highly multiplexed, quantitative PCR assay to profile in an unbiased manner a panel of all commonly used cell surface markers (280 genes) from individual cells. With this method we analyzed over 1500 single cells throughout the mouse hematopoietic system, and illustrate its utility for revealing important biological insi...

  15. The application of single cell gel electrophoresis or comet assay to human monitoring studies

    Directory of Open Access Journals (Sweden)

    Valverde Mahara

    1999-01-01

    Full Text Available Objective. In the search of new human genotoxic biomarkers, the single cell gel electrophoresis assay has been proposed as a sensible alternative. Material and methods. This technique detects principally single strand breaks as well as alkali-labile and repair-retarded sites. Results. Herein we present our experience using the single cell gel electrophoresis assay in human population studies, both occupationally and environmentally exposed. Conclusions. We discuss the assay feasibility as a genotoxic biomarker.

  16. Evaluation of the Sepsis Flow Chip assay for the diagnosis of blood infections.

    Science.gov (United States)

    Galiana, Antonio; Coy, Javier; Gimeno, Adelina; Guzman, Noemi Marco; Rosales, Francisco; Merino, Esperanza; Royo, Gloria; Rodríguez, Juan Carlos

    2017-01-01

    Blood infections are serious complex conditions that generally require rapid diagnosis and treatment. The big challenge is to reduce the time necessary to make a diagnosis with current clinical microbiological methods so as to improve the treatment given to patients. In this study, we assess for the first time the Sepsis Flow Chip assay, which is a novel diagnostic assay for simultaneous rapid-detection of the vast majority of bloodstream pathogens, including Gram-positive and Gram-negative bacteria and fungi, in the same assay, and for the detection of most common antibiotic resistance genes. The SFC assay is based on multiplex PCR and low density DNA arrays. Positive blood cultures from 202 consecutive bacteremia patients were analyzed by SFC assay and the results were compared with the results obtained by the gold standard methodology used in clinical microbiology diagnostic laboratories (EUCAST guidelines). SFC assay overall sensitivity and specificity for bacterial identification were 93.3% and 100% respectively and sensitivity and specificity for the identification of antibiotic genetic resistance determinants were 93.6% and 100% respectively. This is the first evaluation of SFC assay in clinical samples. This new method appears to be very promising by combining the high number of distinct pathogens and genetic resistance determinants identified in a single assay. Further investigations should be done to evaluate the usefulness of this assay in combination with clinical multidisciplinary groups (stewardship), in order for the results to be applied appropriately to the management of patients`infectious processes.

  17. Effective identification of Lactobacillus casei group species: genome-based selection of the gene mutL as the target of a novel multiplex PCR assay.

    Science.gov (United States)

    Bottari, Benedetta; Felis, Giovanna E; Salvetti, Elisa; Castioni, Anna; Campedelli, Ilenia; Torriani, Sandra; Bernini, Valentina; Gatti, Monica

    2017-07-01

    Lactobacillus casei,Lactobacillus paracasei and Lactobacillusrhamnosus form a closely related taxonomic group (the L. casei group) within the facultatively heterofermentative lactobacilli. Strains of these species have been used for a long time as probiotics in a wide range of products, and they represent the dominant species of nonstarter lactic acid bacteria in ripened cheeses, where they contribute to flavour development. The close genetic relationship among those species, as well as the similarity of biochemical properties of the strains, hinders the development of an adequate selective method to identify these bacteria. Despite this being a hot topic, as demonstrated by the large amount of literature about it, the results of different proposed identification methods are often ambiguous and unsatisfactory. The aim of this study was to develop a more robust species-specific identification assay for differentiating the species of the L. casei group. A taxonomy-driven comparative genomic analysis was carried out to select the potential target genes whose similarity could better reflect genome-wide diversity. The gene mutL appeared to be the most promising one and, therefore, a novel species-specific multiplex PCR assay was developed to rapidly and effectively distinguish L. casei, L. paracasei and L. rhamnosus strains. The analysis of a collection of 76 wild dairy isolates, previously identified as members of the L. casei group combining the results of multiple approaches, revealed that the novel designed primers, especially in combination with already existing ones, were able to improve the discrimination power at the species level and reveal previously undiscovered intraspecific biodiversity.

  18. Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii.

    Science.gov (United States)

    Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N

    2017-09-01

    Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.

  19. Biobarcode assay for the oral anticoagulant acenocoumarol.

    Science.gov (United States)

    Broto, Marta; Salvador, J Pablo; Galve, Roger; Marco, M Pilar

    2018-02-01

    A novel approach for therapeutic drug monitoring of oral anticoagulants (OA) in clinical samples is reported, based on a NP-based biobarcode assay. The proposed strategy uses specific antibodies for acenocumarol (ACL) covalently bound to magnetic particles (pAb236-MP) and a bioconjugate competitor (hACL-BSA) linked to encoded polystyrene probes (hACL-BSA-ePSP) on a classical competitive immunochemical format. By using this scheme ACL can be detected in low nM range (LOD, 0.96 ± 0.26, N = 3, in buffer) even in complex samples such as serum or plasma (LOD 4 ± 1). The assay shows a high reproducibility (%CV 1.1 day-to-day) and is robust, as it is demonstrated by the fact that ACL can be quantified in complex biological samples with a very good accuracy (slope = 0.97 and R 2 = 0.91, of the linear regression obtained when analyzing spiked vs measured values). Moreover, we have demonstrated that the biobarcode approach has the potential to overcome one of the main challenges of the multiplexed diagnostic, which is the possibility to measure in a single run biomarker targets present at different concentration ranges. Thus, it has been proven that the signal and the detectability can be modulated by just modifying the oligonucleotide load of the encoded probes. This fact opens the door for combining in the same assay encoded probes with the necessary oligonucleotide load to achieve the detectability required for each biomarker target. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Broadband multiplex coherent anti-Stokes Raman scattering microscopy employing photonic-crystal fibers

    DEFF Research Database (Denmark)

    Andresen, Esben Ravn; Paulsen, Henrik Nørgaard; Birkedal, Victoria

    2006-01-01

    We demonstrate spectral multiplex coherent anti-Stokes Raman scattering (CARS) spectroscopy and microscopy based on a single Ti:sapphire oscillator and a nonlinear photonic-crystal fiber (PCF). The Stokes pulse is generated by spectral conversion of the laser pulse in a PCF. The pump pulse is eit...

  1. A rapid, accurate and robust particle-based assay for the simultaneous screening of plasma samples for the presence of five different anti-cytokine autoantibodies

    DEFF Research Database (Denmark)

    Guldager, Daniel Kring Rasmussen; von Stemann, Jakob Hjorth; Larsen, Rune

    2015-01-01

    suitable for larger screenings. Based on confirmed antibody binding characteristics and the resultant reactivity in this multiplex assay, a classification of the c-aAb levels was suggested. The screening results of the recipients who received blood transfusions indicate that more studies are needed...... plasma samples and pooled normal immunoglobulin preparations were used to validate the assay. Plasma samples from 98 transfusion recipients, half of whom presented with febrile reactions, were tested by the assay. RESULTS: The assay detected specific and saturable immunoglobulin G (IgG) binding to each...... cytokine autoantibodies quantities in the negative plasma samples ranged between 80% and 125%. The analytical intra- and inter-assay variations were 4% and 11%, respectively. Varying c-aAb levels were detectable in the transfusion recipients. There was no difference in c-aAb frequency between the patients...

  2. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  3. Multiplex fluorescence melting curve analysis for mutation detection with dual-labeled, self-quenched probes.

    Directory of Open Access Journals (Sweden)

    Qiuying Huang

    2011-04-01

    Full Text Available Probe-based fluorescence melting curve analysis (FMCA is a powerful tool for mutation detection based on melting temperature generated by thermal denaturation of the probe-target hybrid. Nevertheless, the color multiplexing, probe design, and cross-platform compatibility remain to be limited by using existing probe chemistries. We hereby explored two dual-labeled, self-quenched probes, TaqMan and shared-stem molecular beacons, in their ability to conduct FMCA. Both probes could be directly used for FMCA and readily integrated with closed-tube amplicon hybridization under asymmetric PCR conditions. Improved flexibility of FMCA by using these probes was illustrated in three representative applications of FMCA: mutation scanning, mutation identification and mutation genotyping, all of which achieved improved color-multiplexing with easy probe design and versatile probe combination and all were validated with a large number of real clinical samples. The universal cross-platform compatibility of these probes-based FMCA was also demonstrated by a 4-color mutation genotyping assay performed on five different real-time PCR instruments. The dual-labeled, self-quenched probes offered unprecedented combined advantage of enhanced multiplexing, improved flexibility in probe design, and expanded cross-platform compatibility, which would substantially improve FMCA in mutation detection of various applications.

  4. Multiplexed capillary microfluidic immunoassay with smartphone data acquisition for parallel mycotoxin detection.

    Science.gov (United States)

    Machado, Jessica M D; Soares, Ruben R G; Chu, Virginia; Conde, João P

    2018-01-15

    The field of microfluidics holds great promise for the development of simple and portable lab-on-a-chip systems. The use of capillarity as a means of fluidic manipulation in lab-on-a-chip systems can potentially reduce the complexity of the instrumentation and allow the development of user-friendly devices for point-of-need analyses. In this work, a PDMS microchannel-based, colorimetric, autonomous capillary chip provides a multiplexed and semi-quantitative immunodetection assay. Results are acquired using a standard smartphone camera and analyzed with a simple gray scale quantification procedure. The performance of this device was tested for the simultaneous detection of the mycotoxins ochratoxin A (OTA), aflatoxin B1 (AFB1) and deoxynivalenol (DON) which are strictly regulated food contaminants with severe detrimental effects on human and animal health. The multiplexed assay was performed approximately within 10min and the achieved sensitivities of<40, 0.1-0.2 and<10ng/mL for OTA, AFB1 and DON, respectively, fall within the majority of currently enforced regulatory and/or recommended limits. Furthermore, to assess the potential of the device to analyze real samples, the immunoassay was successfully validated for these 3 mycotoxins in a corn-based feed sample after a simple sample preparation procedure. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe.

    Directory of Open Access Journals (Sweden)

    Ke Feng

    Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.

  6. Multi-beam synchronous measurement based on PSD phase detection using frequency-domain multiplexing

    Science.gov (United States)

    Duan, Ying; Qin, Lan; Xue, Lian; Xi, Feng; Mao, Jiubing

    2013-10-01

    According to the principle of centroid measurement, position-sensitive detectors (PSD) are commonly used for micro displacement detection. However, single-beam detection method cannot satisfy such tasks as multi-dimension position measurement, three dimension vision reconstruction, and robot precision positioning, which require synchronous measurement of multiple light beams. Consequently, we designed PSD phase detection method using frequency-domain multiplexing for synchronous detection of multiple modulated light beams. Compared to previous PSD amplitude detection method, the phase detection method using FDM has advantages of simplified measuring system, low cost, high capability of resistance to light interference as well as improved resolution. The feasibility of multi-beam synchronous measurement based on PSD phase detection using FDM was validated by multi-beam measuring experiments. The maximum non-linearity error of the multi-beam synchronous measurement is 6.62%.

  7. Microarray-based screening of heat shock protein inhibitors.

    Science.gov (United States)

    Schax, Emilia; Walter, Johanna-Gabriela; Märzhäuser, Helene; Stahl, Frank; Scheper, Thomas; Agard, David A; Eichner, Simone; Kirschning, Andreas; Zeilinger, Carsten

    2014-06-20

    Based on the importance of heat shock proteins (HSPs) in diseases such as cancer, Alzheimer's disease or malaria, inhibitors of these chaperons are needed. Today's state-of-the-art techniques to identify HSP inhibitors are performed in microplate format, requiring large amounts of proteins and potential inhibitors. In contrast, we have developed a miniaturized protein microarray-based assay to identify novel inhibitors, allowing analysis with 300 pmol of protein. The assay is based on competitive binding of fluorescence-labeled ATP and potential inhibitors to the ATP-binding site of HSP. Therefore, the developed microarray enables the parallel analysis of different ATP-binding proteins on a single microarray. We have demonstrated the possibility of multiplexing by immobilizing full-length human HSP90α and HtpG of Helicobacter pylori on microarrays. Fluorescence-labeled ATP was competed by novel geldanamycin/reblastatin derivatives with IC50 values in the range of 0.5 nM to 4 μM and Z(*)-factors between 0.60 and 0.96. Our results demonstrate the potential of a target-oriented multiplexed protein microarray to identify novel inhibitors for different members of the HSP90 family. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Development and standardization of multiplexed antibody microarrays for use in quantitative proteomics

    Directory of Open Access Journals (Sweden)

    Sorette M

    2004-12-01

    Full Text Available Abstract Background Quantitative proteomics is an emerging field that encompasses multiplexed measurement of many known proteins in groups of experimental samples in order to identify differences between groups. Antibody arrays are a novel technology that is increasingly being used for quantitative proteomics studies due to highly multiplexed content, scalability, matrix flexibility and economy of sample consumption. Key applications of antibody arrays in quantitative proteomics studies are identification of novel diagnostic assays, biomarker discovery in trials of new drugs, and validation of qualitative proteomics discoveries. These applications require performance benchmarking, standardization and specification. Results Six dual-antibody, sandwich immunoassay arrays that measure 170 serum or plasma proteins were developed and experimental procedures refined in more than thirty quantitative proteomics studies. This report provides detailed information and specification for manufacture, qualification, assay automation, performance, assay validation and data processing for antibody arrays in large scale quantitative proteomics studies. Conclusion The present report describes development of first generation standards for antibody arrays in quantitative proteomics. Specifically, it describes the requirements of a comprehensive validation program to identify and minimize antibody cross reaction under highly multiplexed conditions; provides the rationale for the application of standardized statistical approaches to manage the data output of highly replicated assays; defines design requirements for controls to normalize sample replicate measurements; emphasizes the importance of stringent quality control testing of reagents and antibody microarrays; recommends the use of real-time monitors to evaluate sensitivity, dynamic range and platform precision; and presents survey procedures to reveal the significance of biomarker findings.

  9. Multiplex detection of pathogen biomarkers in human blood, serum, and saliva using silicon photonic microring resonators

    Science.gov (United States)

    Estrada, I. A.; Burlingame, R. W.; Wang, A. P.; Chawla, K.; Grove, T.; Wang, J.; Southern, S. O.; Iqbal, M.; Gunn, L. C.; Gleeson, M. A.

    2015-05-01

    Genalyte has developed a multiplex silicon photonic chip diagnostics platform (MaverickTM) for rapid detection of up to 32 biological analytes from a drop of sample in just 10 to 20 minutes. The chips are manufactured with waveguides adjacent to ring resonators, and probed with a continuously variable wavelength laser. A shift in the resonant wavelength as mass binds above the ring resonators is measured and is directly proportional to the amount of bound macromolecules. We present here the ability to multiplex the detection of hemorrhagic fever antigens in whole blood, serum, and saliva in a 16 minute assay. Our proof of concept testing of a multiplex antigencapture chip has the ability to detect Zaire Ebola (ZEBOV) recombinant soluble glycoprotein (rsGP), Marburg virus (MARV) Angola recombinant glycoprotein (rGP) and dengue nonstructural protein I (NS1). In parallel, detection of 2 malaria antigens has proven successful, but has yet to be incorporated into multiplex with the others. Each assay performs with sensitivity ranging from 1.6 ng/ml to 39 ng/ml depending on the antigen detected, and with minimal cross-reactivity.

  10. Evaluation and validation of a single-dilution potency assay based upon serology of vaccines containing diphtheria toxoid: analysis for consistency in production and testing at the laboratory of the Control of Biological Products of the RIVM

    NARCIS (Netherlands)

    Akkermans AM; Hendriksen CFM; Marsman FR; de Jong WH; van de Donk HJM

    1993-01-01

    A single-dilution assay can be a valid procedure to demonstrate that a product exceeds the minimal requirement given for potency provided that consistency in production and testing has been proven. Information is presented justifying the use of a single dilution assay based upon quantitative

  11. A Multiplex PCR Assay for Differentiating Coconut Rhinoceros Beetle (Coleoptera: Scarabaeidae) From Oriental Flower Beetle (Coleoptera: Scarabaeidae) in Early Life Stages and Excrement.

    Science.gov (United States)

    Watanabe, S; Melzer, M J

    2017-04-01

    The coconut rhinoceros beetle, Oryctes rhinoceros (L.), is a major pest of coconut and other palm trees. An incipient coconut rhinoceros beetle population was recently discovered on the island of Oahu, Hawaii and is currently the target of a large, mutiagency eradication program. Confounding this program is the widespread presence of another scarab beetle on Oahu, the oriental flower beetle, Protaetia orientalis (Gory and Percheron 1833). Eggs, early life stages, and fecal excrement of coconut rhinoceros beetle and oriental flower beetle are morphologically indistinguishable, thereby creating uncertainty when such specimens are discovered in the field. Here, we report the development of a multiplex PCR assay targeting cytochrome oxidase I of coconut rhinoceros beetle and oriental flower beetle that can rapidly detect and distinguish between these insects. This assay also features an internal positive control to ensure DNA of sufficient quantity and quality is used in the assay, increasing its reliability and reducing the chances of false negative results. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Shared protection based virtual network mapping in space division multiplexing optical networks

    Science.gov (United States)

    Zhang, Huibin; Wang, Wei; Zhao, Yongli; Zhang, Jie

    2018-05-01

    Space Division Multiplexing (SDM) has been introduced to improve the capacity of optical networks. In SDM optical networks, there are multiple cores/modes in each fiber link, and spectrum resources are multiplexed in both frequency and core/modes dimensions. Enabled by network virtualization technology, one SDM optical network substrate can be shared by several virtual networks operators. Similar with point-to-point connection services, virtual networks (VN) also need certain survivability to guard against network failures. Based on customers' heterogeneous requirements on the survivability of their virtual networks, this paper studies the shared protection based VN mapping problem and proposes a Minimum Free Frequency Slots (MFFS) mapping algorithm to improve spectrum efficiency. Simulation results show that the proposed algorithm can optimize SDM optical networks significantly in terms of blocking probability and spectrum utilization.

  13. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  14. Spatial analysis of various multiplex cinema types

    Directory of Open Access Journals (Sweden)

    Young-Seo Park

    2016-03-01

    Full Text Available This study identifies the spatial characteristics and relationships of each used space according to the multiplex type. In this study, multiplexes are classified according to screen rooms and circulation systems, and each used space is quantitatively analyzed. The multiplex type based on screen rooms and moving line systems influences the relationship and characteristics of each used space in various ways. In particular, the structure of the used space of multiplexes has a significant effect on profit generation and audience convenience.

  15. Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR.

    Science.gov (United States)

    Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira

    2013-05-27

    Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.

  16. A TaqMan-based real time PCR assay for specific detection and quantification of Xylella fastidiosa strains causing bacterial leaf scorch in oleander.

    Science.gov (United States)

    Guan, Wei; Shao, Jonathan; Singh, Raghuwinder; Davis, Robert E; Zhao, Tingchang; Huang, Qi

    2013-02-15

    A TaqMan-based real-time PCR assay was developed for specific detection of strains of X. fastidiosa causing oleander leaf scorch. The assay uses primers WG-OLS-F1 and WG-OLS-R1 and the fluorescent probe WG-OLS-P1, designed based on unique sequences found only in the genome of oleander strain Ann1. The assay is specific, allowing detection of only oleander-infecting strains, not other strains of X. fastidiosa nor other plant-associated bacteria tested. The assay is also sensitive, with a detection limit of 10.4fg DNA of X. fastidiosa per reaction in vitro and in planta. The assay can also be applied to detect low numbers of X. fastidiosa in insect samples, or further developed into a multiplex real-time PCR assay to simultaneously detect and distinguish diverse strains of X. fastidiosa that may occupy the same hosts or insect vectors. Specific and sensitive detection and quantification of oleander strains of X. fastidiosa should be useful for disease diagnosis, epidemiological studies, management of oleander leaf scorch disease, and resistance screening for oleander shrubs. Published by Elsevier B.V.

  17. A Study of Dispersion Compensation of Polarization Multiplexing-Based OFDM-OCDMA for Radio-over-Fiber Transmissions.

    Science.gov (United States)

    Yen, Chih-Ta; Chen, Wen-Bin

    2016-09-07

    Chromatic dispersion from optical fiber is the most important problem that produces temporal skews and destroys the rectangular structure of code patterns in the spectra-amplitude-coding-based optical code-division multiple-access (SAC-OCDMA) system. Thus, the balance detection scheme does not work perfectly to cancel multiple access interference (MAI) and the system performance will be degraded. Orthogonal frequency-division multiplexing (OFDM) is the fastest developing technology in the academic and industrial fields of wireless transmission. In this study, the radio-over-fiber system is realized by integrating OFDM and OCDMA via polarization multiplexing scheme. The electronic dispersion compensation (EDC) equalizer element of OFDM integrated with the dispersion compensation fiber (DCF) is used in the proposed radio-over-fiber (RoF) system, which can efficiently suppress the chromatic dispersion influence in long-haul transmitted distance. A set of length differences for 10 km-long single-mode fiber (SMF) and 4 km-long DCF is to verify the compensation scheme by relative equalizer algorithms and constellation diagrams. In the simulation result, the proposed dispersion mechanism successfully compensates the dispersion from SMF and the system performance with dispersion equalizer is highly improved.

  18. A Study of Dispersion Compensation of Polarization Multiplexing-Based OFDM-OCDMA for Radio-over-Fiber Transmissions

    Directory of Open Access Journals (Sweden)

    Chih-Ta Yen

    2016-09-01

    Full Text Available Chromatic dispersion from optical fiber is the most important problem that produces temporal skews and destroys the rectangular structure of code patterns in the spectra-amplitude-coding-based optical code-division multiple-access (SAC-OCDMA system. Thus, the balance detection scheme does not work perfectly to cancel multiple access interference (MAI and the system performance will be degraded. Orthogonal frequency-division multiplexing (OFDM is the fastest developing technology in the academic and industrial fields of wireless transmission. In this study, the radio-over-fiber system is realized by integrating OFDM and OCDMA via polarization multiplexing scheme. The electronic dispersion compensation (EDC equalizer element of OFDM integrated with the dispersion compensation fiber (DCF is used in the proposed radio-over-fiber (RoF system, which can efficiently suppress the chromatic dispersion influence in long-haul transmitted distance. A set of length differences for 10 km-long single-mode fiber (SMF and 4 km-long DCF is to verify the compensation scheme by relative equalizer algorithms and constellation diagrams. In the simulation result, the proposed dispersion mechanism successfully compensates the dispersion from SMF and the system performance with dispersion equalizer is highly improved.

  19. Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.

    Science.gov (United States)

    Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva

    2007-01-01

    Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.

  20. Evaluation of the Sepsis Flow Chip assay for the diagnosis of blood infections.

    Directory of Open Access Journals (Sweden)

    Antonio Galiana

    Full Text Available Blood infections are serious complex conditions that generally require rapid diagnosis and treatment. The big challenge is to reduce the time necessary to make a diagnosis with current clinical microbiological methods so as to improve the treatment given to patients.In this study, we assess for the first time the Sepsis Flow Chip assay, which is a novel diagnostic assay for simultaneous rapid-detection of the vast majority of bloodstream pathogens, including Gram-positive and Gram-negative bacteria and fungi, in the same assay, and for the detection of most common antibiotic resistance genes. The SFC assay is based on multiplex PCR and low density DNA arrays.Positive blood cultures from 202 consecutive bacteremia patients were analyzed by SFC assay and the results were compared with the results obtained by the gold standard methodology used in clinical microbiology diagnostic laboratories (EUCAST guidelines. SFC assay overall sensitivity and specificity for bacterial identification were 93.3% and 100% respectively and sensitivity and specificity for the identification of antibiotic genetic resistance determinants were 93.6% and 100% respectively.This is the first evaluation of SFC assay in clinical samples. This new method appears to be very promising by combining the high number of distinct pathogens and genetic resistance determinants identified in a single assay. Further investigations should be done to evaluate the usefulness of this assay in combination with clinical multidisciplinary groups (stewardship, in order for the results to be applied appropriately to the management of patients`infectious processes.

  1. Development of an Indirect Competitive Enzyme-Linked Immunosorbent Assay for Glycocholic Acid Based on Chicken Single-Chain Variable Fragment Antibodies.

    Science.gov (United States)

    Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D

    2017-10-17

    Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.

  2. Spatial Frequency Multiplexing of Fiber-Optic Interferometric Refractive Index Sensors Based on Graded-Index Multimode Fibers

    Science.gov (United States)

    Liu, Li; Gong, Yuan; Wu, Yu; Zhao, Tian; Wu, Hui-Juan; Rao, Yun-Jiang

    2012-01-01

    Fiber-optic interferometric sensors based on graded-index multimode fibers have very high refractive-index sensitivity, as we previously demonstrated. In this paper, spatial-frequency multiplexing of this type of fiber-optic refractive index sensors is investigated. It is estimated that multiplexing of more than 10 such sensors is possible. In the multiplexing scheme, one of the sensors is used to investigate the refractive index and temperature responses. The fast Fourier transform (FFT) of the combined reflective spectra is analyzed. The intensity of the FFT spectra is linearly related with the refractive index and is not sensitive to the temperature.

  3. Standardization and validation of a cytometric bead assay to assess antibodies to multiple Plasmodium falciparum recombinant antigens

    Directory of Open Access Journals (Sweden)

    Ondigo Bartholomew N

    2012-12-01

    Full Text Available Abstract Background Multiplex cytometric bead assay (CBA have a number of advantages over ELISA for antibody testing, but little information is available on standardization and validation of antibody CBA to multiple Plasmodium falciparum antigens. The present study was set to determine optimal parameters for multiplex testing of antibodies to P. falciparum antigens, and to compare results of multiplex CBA to ELISA. Methods Antibodies to ten recombinant P. falciparum antigens were measured by CBA and ELISA in samples from 30 individuals from a malaria endemic area of Kenya and compared to known positive and negative control plasma samples. Optimal antigen amounts, monoplex vs multiplex testing, plasma dilution, optimal buffer, number of beads required were assessed for CBA testing, and results from CBA vs. ELISA testing were compared. Results Optimal amounts for CBA antibody testing differed according to antigen. Results for monoplex CBA testing correlated strongly with multiplex testing for all antigens (r = 0.88-0.99, P values from Conclusion With optimization, CBA may be the preferred method of testing for antibodies to P. falciparum antigens, as CBA can test for antibodies to multiple recombinant antigens from a single plasma sample and produces a greater range of values in positive samples and lower background readings for blank samples than ELISA.

  4. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    Science.gov (United States)

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  5. High-throughput single nucleotide polymorphism genotyping using nanofluidic Dynamic Arrays

    Directory of Open Access Journals (Sweden)

    Crenshaw Andrew

    2009-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have emerged as the genetic marker of choice for mapping disease loci and candidate gene association studies, because of their high density and relatively even distribution in the human genomes. There is a need for systems allowing medium multiplexing (ten to hundreds of SNPs with high throughput, which can efficiently and cost-effectively generate genotypes for a very large sample set (thousands of individuals. Methods that are flexible, fast, accurate and cost-effective are urgently needed. This is also important for those who work on high throughput genotyping in non-model systems where off-the-shelf assays are not available and a flexible platform is needed. Results We demonstrate the use of a nanofluidic Integrated Fluidic Circuit (IFC - based genotyping system for medium-throughput multiplexing known as the Dynamic Array, by genotyping 994 individual human DNA samples on 47 different SNP assays, using nanoliter volumes of reagents. Call rates of greater than 99.5% and call accuracies of greater than 99.8% were achieved from our study, which demonstrates that this is a formidable genotyping platform. The experimental set up is very simple, with a time-to-result for each sample of about 3 hours. Conclusion Our results demonstrate that the Dynamic Array is an excellent genotyping system for medium-throughput multiplexing (30-300 SNPs, which is simple to use and combines rapid throughput with excellent call rates, high concordance and low cost. The exceptional call rates and call accuracy obtained may be of particular interest to those working on validation and replication of genome- wide- association (GWA studies.

  6. Drift chamber and pulse height readout systems using analog multiplexing

    International Nuclear Information System (INIS)

    Cisneros, E.L; Kang, H.K.; Hall, J.N.; Larsen, R.S.

    1976-11-01

    Drift chamber and pulse-height readout systems are being developed for use in a new large scale detector at the SPEAR colliding beam facility. The systems are based upon 32 channels of sample-and-hold together with an analog multiplexer in a single-width CAMAC module. The modules within each crate are scanned by an autonomous controller containing a single ADC and memory plus arithmetic capability for offset, gain and linearity corrections. The drift chamber module has a facility for extracting hit wire information for use in trigger decision circuitry

  7. A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

    Directory of Open Access Journals (Sweden)

    Marta Durlak

    Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

  8. Preliminary Assessment of Microwave Readout Multiplexing Factor

    Energy Technology Data Exchange (ETDEWEB)

    Croce, Mark Philip [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Koehler, Katrina Elizabeth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rabin, Michael W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Bennett, D. A. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Mates, J. A. B. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Gard, J. D. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Becker, D. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Schmidt, D. R. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States); Ullom, J. N. [National Inst. of Standards and Technology (NIST), Boulder, CO (United States)

    2017-01-23

    Ultra-high resolution microcalorimeter gamma spectroscopy is a new non-destructive assay technology for measurement of plutonium isotopic composition, with the potential to reduce total measurement uncertainty to a level competitive with destructive analysis methods [1-4]. Achieving this level of performance in practical applications requires not only the energy resolution now routinely achieved with transition-edge sensor microcalorimeter arrays (an order of magnitude better than for germanium detectors) but also high throughput. Microcalorimeter gamma spectrometers have not yet achieved detection efficiency and count rate capability that is comparable to germanium detectors, largely because of limits from existing readout technology. Microcalorimeter detectors must be operated at low temperature to achieve their exceptional energy resolution. Although the typical 100 mK operating temperatures can be achieved with reliable, cryogen-free systems, the cryogenic complexity and heat load from individual readout channels for large sensor arrays is prohibitive. Multiplexing is required for practical systems. The most mature multiplexing technology at present is time-division multiplexing (TDM) [3, 5-6]. In TDM, the sensor outputs are switched by applying bias current to one SQUID amplifier at a time. Transition-edge sensor (TES) microcalorimeter arrays as large as 256 pixels have been developed for X-ray and gamma-ray spectroscopy using TDM technology. Due to bandwidth limits and noise scaling, TDM is limited to a maximum multiplexing factor of approximately 32-40 sensors on one readout line [8]. Increasing the size of microcalorimeter arrays above the kilopixel scale, required to match the throughput of germanium detectors, requires the development of a new readout technology with a much higher multiplexing factor.

  9. Bidirectional and simultaneous FTTX/Ethernet services using RSOA based remodulation and polarization multiplexing technique

    Science.gov (United States)

    Das, Anindya S.; Patra, Ardhendu S.

    2015-08-01

    A bidirectional and simultaneous transmission of Ethernet, FTTX services through single optical carrier wavelength employing polarization multiplexing technique in the transmitter end and the user end. 10 Gbps and 2.5 Gbps datarates are transmitted over 50 km single mode fiber employing POLMUX technique at OLT and ONU to provide Ethernet and FTTX services concurrently to the user. Reflective semiconductor optical amplifier is used to reuse and remodulate the downlink signal to uplink transmission. The upstream and the downstream transmission performances are observed by the bit error rate values and the eye diagrams obtained by the BER analyzer.

  10. Frequency multiplexing for readout of spin qubits

    Energy Technology Data Exchange (ETDEWEB)

    Hornibrook, J. M.; Colless, J. I.; Mahoney, A. C.; Croot, X. G.; Blanvillain, S.; Reilly, D. J., E-mail: david.reilly@sydney.edu.au [ARC Centre of Excellence for Engineered Quantum Systems, School of Physics, University of Sydney, Sydney, NSW 2006 (Australia); Lu, H.; Gossard, A. C. [Materials Department, University of California, Santa Barbara, California 93106 (United States)

    2014-03-10

    We demonstrate a low loss, chip-level frequency multiplexing scheme for readout of scaled-up spin qubit devices. By integrating separate bias tees and resonator circuits on-chip for each readout channel, we realise dispersive gate-sensing in combination with charge detection based on two radio frequency quantum point contacts. We apply this approach to perform multiplexed readout of a double quantum dot in the few-electron regime and further demonstrate operation of a 10-channel multiplexing device. Limitations for scaling spin qubit readout to large numbers of multiplexed channels are discussed.

  11. User Multiplexing in Relay Enhanced LTE-Advanced Networks

    DEFF Research Database (Denmark)

    Teyeb, Oumer Mohammed; Frederiksen, Frank; Redana, Simone

    2010-01-01

    is radio relaying. This uses relay nodes that act as surrogate base stations for mobile users whose radio links with the base stations are not experiencing good enough conditions. In the downlink, the data that is destined for the relayed users may first have to be multiplexed by the base station, sent...... over the wireless backhaul link towards the relay node, and de-multiplexed and forwarded to the individual users by the relay node. The reverse process also has to be undertaken in the uplink. In this paper, we present a novel multiplexing scheme which is able to adapt the addressing and bitmapping...... of user identification to the actual number of users being served by the relay nodes, and thus greatly reduce the multiplexing overhead....

  12. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  13. Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens

    Directory of Open Access Journals (Sweden)

    Denis A. Kleymenov

    2017-11-01

    Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.

  14. Multiplexed Simultaneous High Sensitivity Sensors with High-Order Mode Based on the Integration of Photonic Crystal 1 × 3 Beam Splitter and Three Different Single-Slot PCNCs.

    Science.gov (United States)

    Zhou, Jian; Huang, Lijun; Fu, Zhongyuan; Sun, Fujun; Tian, Huiping

    2016-07-07

    We simulated an efficient method for the sensor array of high-sensitivity single-slot photonic crystal nanobeam cavities (PCNCs) on a silicon platform. With the combination of a well-designed photonic crystal waveguide (PhCW) filter and an elaborate single-slot PCNC, a specific high-order resonant mode was filtered for sensing. A 1 × 3 beam splitter carefully established was implemented to split channels and integrate three sensors to realize microarrays. By applying the three-dimensional finite-difference-time-domain (3D-FDTD) method, the sensitivities calculated were S₁ = 492 nm/RIU, S₂ = 244 nm/RIU, and S₃ = 552 nm/RIU, respectively. To the best of our knowledge, this is the first multiplexing design in which each sensor cite features such a high sensitivity simultaneously.

  15. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  16. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    Science.gov (United States)

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design