Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India
More, Arun Punaji; Nagdawane, Ramkrishna Panchamrao; Gangurde, Aniket K
2013-01-01
Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR) has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence...
Munro-Rojas, Daniela; Fernandez-Morales, Esdras; Zarrabal-Meza, José; Martínez-Cazares, Ma. Teresa; Parissi-Crivelli, Aurora; Fuentes-Domínguez, Javier; Séraphin, Marie Nancy; Lauzardo, Michael; González-y-Merchand, Jorge Alberto; Rivera-Gutierrez, Sandra
2018-01-01
Background Mexico is one of the most important contributors of drug and multidrug-resistant tuberculosis in Latin America; however, knowledge of the genetic diversity of drug-resistant tuberculosis isolates is limited. Methods In this study, the genetic structure of 112 Mycobacterium tuberculosis strains from the southeastern Mexico was determined by spoligotyping and 24-loci MIRU-VNTRs. Findings The results show eight major lineages, the most of which was T1 (24%), followed by LAM (16%) and H (15%). A total of 29 (25%) isolates were identified as orphan. The most abundant SITs were SIT53/T1 and SIT42/LAM9 with 10 isolates each and SIT50/H3 with eight isolates. Fifty-two spoligotype patterns, twenty-seven clusters and ten clonal complexes were observed, demonstrating an important genetic diversity of drug and multidrug-resistant tuberculosis isolates in circulation and transmission level of these aggravated forms of tuberculosis. Being defined as orphan or as part of an orphan cluster, was a risk factor for multidrug resistant-tuberculosis (OR 2.5, IC 1.05–5.86 and OR 3.3, IC 1–11.03, respectively). Multiple correspondence analyses showed association of some clusters and SITs with specific geographical locations. Conclusions Our study provides one of the most detailed description of the genetic structure of drug and multidrug-resistant tuberculosis strains in southeast Mexico, establishing for the first time a baseline of the genotypes observed in resistant isolates circulating, however further studies are required to better elucidate the genetic structure of tuberculosis in region and the factors that could be participating in their dispersion. PMID:29543819
The imaging feature of multidrug-resistant tuberculosis
International Nuclear Information System (INIS)
Yang Jun; Zhou Xinhua; Li Xi; Fu Yuhong; Zheng Suhua; Lv Pingxin; Ma Daqing
2004-01-01
Objective: To evaluate the imaging features of multidrug-resistant tuberculosis by collecting multidrug-resistant tuberculosis verified by test of drug-sensitivity, which defined as resistance to three anti-tuberculosis drugs. Methods:Fifty-one cases of multidrug-resistant tuberculosis were categorized as group of observed, and 46 cases of drug sensitive tuberculosis were categorized as control. Cultures were positive for Mycobacterium tuberculosis in all cases with no other illness such as diabetes mellitus. All patients had chest radiographs available for review, while 64 cases had tomography and 30 cases had CT during the same time. All images were analyzed by three of the radiologists, disagreement among them was discussed and a consensus was reached. Results: There was no difference in the distribution of lesions between the multidrug-resistant tuberculosis group and control group. However, the radiological findings in the multidrug-resistant tuberculosis group were significantly more common than in control group, such as multiple nodules (10 cases), disseminated foci (23 cases), cavity (9 cases), and complications (10 cases). Comparing the dynamic cases, deteriorating cases were more commonly seen in observed group than in control group, while improved cases were less in observed group than in control group. Conclusion: Multidrug-resistant tuberculosis is the most serious tuberculosis, which is characterized with significant activity, more disseminated foci, cavity, and complications. The lesion deteriorated while correct anti-tuberculosis treatment is applied. (authors)
Directory of Open Access Journals (Sweden)
Mohd Zakihalani A. Halim
2016-03-01
Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary
Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India
Directory of Open Access Journals (Sweden)
Arun P. More
2013-03-01
Full Text Available Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence ofcombined resistance to first and second-line anti-tuberculosis drugs is remarkably high. The isolates of M. tuberculosiswas identified and subjected to drug susceptibility testing. The patterns of drug susceptibility of isolates of M. tuberculosisduring the periods 2000 and 2004 were compared with drug susceptibility patterns of the organisms during theperiod 2008 to 2011.Results: The 260 isolates identified as M. tuberculosis show mean drug resistance prevalence of 45.6% for more than anytwo drugs and the MDR rate as 37% in the years 2000 to 2004 whereas 305 isolates of the organism show mean drugresistance prevalence of 30.2% and the MDR rate as 25% in the years 2008 to 2011.Conclusion: The researcher found that, though the prevalence of multidrug resistance to the drugs tested is remarkablyhigh, it has come down noticeably during the past seven years due to efforts of State Government and strict implementationof treatment guidelines of WHO by the physicians. J Microbiol Infect Dis 2013; 3(1: 12-17Key words: MDR-TB, XDR-TB, DOTS, drug-resistance prevalence rate.
Beyond multidrug-resistant tuberculosis in Europe: a TBNET study
Günther, G.; van Leth, F.; Altet, N.; Dedicoat, M.; Duarte, R.; Gualano, G.; Kunst, H.; Muylle, I.; Spinu, V.; Tiberi, S.; Viiklepp, P.; Lange, C.; Alexandru, S.; Cernenco, I.; Ciobanu, A.; Donica, A.; Cayla, J.; Fina, L.; Galvao, M. L. de Souza; Maldonado, J.; Avsar, K.; Bang, D.; Andersen, A. B.; Barbuta, R.; Dubceac, V.; Bothamley, G.; Crudu, V.; Davilovits, M.; Atunes, A.; de Lange, W.; Leimane, V.; Rusmane, L.; de Lorenzo, S.; Cuppen, F.; de Guchtenaire, I.; Magis-Escurra, C.; McLaughlin, A.-M.; Meesters, R.; te Pas, M.; Prins, B.; Mütterlein, R.; Kotrbova, J.; Polcová, V.; Vasakova, M.; Pontali, E.; Rumetshofer, R.; Rowhani, M.; Skrahina, A.; Avchinko, V.; Katovich, D.
2015-01-01
The emergence of drug-resistant tuberculosis (TB) is a challenge to TB control in Europe. We evaluated second-line drug susceptibility testing in Mycobacterium tuberculosis isolates from patients with multidrug-resistant, pre-extensively drug-resistant (pre-XDR-TB) and XDR-TB at 23 TBNET sites in 16
Molecular Genetic Analysis of Multi-drug Resistance in Indian Isolates of Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Noman Siddiqi
1998-09-01
Full Text Available A total of 116 isolates from patients attending the out-patient department at the All India Institute of Medical Sciences, New Delhi and the New Delhi Tuberculosis Centre, New Delhi, India were collected. They were analyzed for resistance to drugs prescribed in the treatment for tuberculosis. The drug resistance was initially determined by microbiological techniques. The Bactec 460TB system was employed to determine the type and level of resistance in each isolate. The isolates were further characterized at molecular level. The multi-drug loci corresponding to rpo b, gyr A, kat G were studied for mutation(s by the polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP technique. The SSCP positive samples were sequenced to characterize the mutations in rpo b, and gyr A loci. While previously reported mutations in the gyr A and rpo b loci were found to be present, several novel mutations were also scored in the rpo b locus. Interestingly, analysis of the gyr A locus showed the presence of point mutation(s that could not be detected by PCR-SSCP. Furthermore, rifampicin resistance was found to be an important marker for checking multi-drug resistance (MDR in clinical isolates of Mycobacterium tuberculosis. This is the first report on molecular genetic analysis of MDR tuberculosis one from India, highlights the increasing incidence of MDR in the Indian isolates of M. tuberculosis.
International Nuclear Information System (INIS)
Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.
2015-01-01
Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)
Multidrug-resistant tuberculosis in Europe, 2010-2011
DEFF Research Database (Denmark)
Günther, Gunar; van Leth, Frank; Alexandru, Sofia
2015-01-01
Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...
Ordway, Diane; Viveiros, Miguel; Leandro, Clara; Bettencourt, Rosário; Almeida, Josefina; Martins, Marta; Kristiansen, Jette E.; Molnar, Joseph; Amaral, Leonard
2003-01-01
The phenothiazines chlorpromazine (CPZ) and thioridazine (TZ) have equal in vitro activities against antibiotic-sensitive and -resistant Mycobacterium tuberculosis. These compounds have not been used as anti-M. tuberculosis agents because their in vitro activities take place at concentrations which are beyond those that are clinically achievable. In addition, chronic administration of CPZ produces frequent severe side effects. Because CPZ has been shown to enhance the killing of intracellular M. tuberculosis at concentrations in the medium that are clinically relevant, we have investigated whether TZ, a phenothiazine whose negative side effects are less frequent and serious than those associated with CPZ, kills M. tuberculosis organisms that have been phagocytosed by human macrophages, which have nominal killing activities against these bacteria. Both CPZ and TZ killed intracellular antibiotic-sensitive and -resistant M. tuberculosis organisms when they were used at concentrations in the medium well below those present in the plasma of patients treated with these agents. These concentrations in vitro were not toxic to the macrophage, nor did they affect in vitro cellular immune processes. TZ thus appears to be a serious candidate for the management of a freshly diagnosed infection of pulmonary tuberculosis or as an adjunct to conventional antituberculosis therapy if the patient originates from an area known to have a high prevalence of multidrug-resistant M. tuberculosis isolates. Nevertheless, we must await the outcomes of clinical trials to determine whether TZ itself may be safely and effectively used as an antituberculosis agent. PMID:12604522
Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.
Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko
2012-06-01
Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.
Ritacco, Viviana; Iglesias, María-José; Ferrazoli, Lucilaine; Monteserin, Johana; Dalla Costa, Elis R; Cebollada, Alberto; Morcillo, Nora; Robledo, Jaime; de Waard, Jacobus H; Araya, Pamela; Aristimuño, Liselotte; Díaz, Raúl; Gavin, Patricia; Imperiale, Belen; Simonsen, Vera; Zapata, Elsa M; Jiménez, María S; Rossetti, Maria L; Martin, Carlos; Barrera, Lucía; Samper, Sofia
2012-06-01
Multidrug-resistant Mycobacterium tuberculosis strain diversity in Ibero-America was examined by comparing extant genotype collections in national or state tuberculosis networks. To this end, genotypes from over 1000 patients with multidrug-resistant tuberculosis diagnosed from 2004 through 2008 in Argentina, Brazil, Chile, Colombia, Venezuela and Spain were compared in a database constructed ad hoc. Most of the 116 clusters identified by IS6110 restriction fragment length polymorphism were small and restricted to individual countries. The three largest clusters, of 116, 49 and 25 patients, were found in Argentina and corresponded to previously documented locally-epidemic strains. Only 13 small clusters involved more than one country, altogether accounting for 41 patients, of whom 13 were, in turn, immigrants from Latin American countries different from those participating in the study (Peru, Ecuador and Bolivia). Most of these international clusters belonged either to the emerging RD(Rio) LAM lineage or to the Haarlem family of M. tuberculosis and four were further split by country when analyzed with spoligotyping and rifampin resistance-conferring mutations, suggesting that they did not represent ongoing transnational transmission events. The Beijing genotype accounted for 1.3% and 10.2% of patients with multidrug-resistant tuberculosis in Latin America and Spain, respectively, including one international cluster of two cases. In brief, Euro-American genotypes were widely predominant among multidrug-resistant M. tuberculosis strains in Ibero-America, reflecting closely their predominance in the general M. tuberculosis population in the region, and no evidence was found of acknowledged outbreak strains trespassing country borders. Copyright © 2011 Elsevier B.V. All rights reserved.
Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients
Jamil, K. F.
2018-03-01
Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.
Dumonceaux, Genevieve A; St Leger, Judy; Olsen, John H; Burton, Michael S; Ashkin, David; Maslow, Joel N
2011-12-01
A female Asian elephant (Elephas maximus) developed vaginal and trunk discharge. Cultures were positive for pan-susceptible Mycobacterium tuberculosis. Isoniazid and pyrazinamide were given rectally and monitored by serum levels. After being trained at 10 mo to accept oral dosing, treatment was changed and rifampin was added. Oral medications were administered for another 10 mo. A year after completion of therapy, the vaginal discharge increased and cultures yielded M. tuberculosis, resistant to isoniazid and rifampin. Treatment with oral ethambutol, pyrazinamide, and enrofloxacin and intramuscular amikacin was initiated. Although followup cultures became negative, adverse reactions to medications precluded treatment completion. Due to public health concerns related to multidrug resistant M. tuberculosis (MDR-TB), the elephant was euthanized. Postmortem smears from the lung, peribronchial, and abdominal lymph nodes yielded acid-fast bacteria, although cultures were negative. This case highlights important considerations in the treatment of M. tuberculosis in animals and the need for a consistent approach to diagnosis, treatment, and follow-up.
Multidrug-resistant tuberculosis
Directory of Open Access Journals (Sweden)
McNerney Ruth
2008-01-01
Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose
Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.
2017-01-01
Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681
Directory of Open Access Journals (Sweden)
Aki Tamaru
Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.
Coban, Ahmet Yilmaz; Uzun, Meltem
2013-01-01
Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA) in detecting isoniazid (INH) and rifampicin (RIF) resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results. PMID:24402143
Directory of Open Access Journals (Sweden)
Ahmet Yilmaz Coban
2013-12-01
Full Text Available Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA in detecting isoniazid (INH and rifampicin (RIF resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV, negative predictive value (NPV and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results.
Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O
2016-06-01
Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
U D Gupta
2015-01-01
Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of
García, Ana-Belén; Palacios, Juan J.; Ruiz, María-Jesús; Barluenga, José; Aznar, Fernando; Cabal, María-Paz; García, José María; Díaz, Natalia
2010-01-01
Two new rifabutin analogs, RFA-1 and RFA-2, show high in vitro antimycobacterial activities against Mycobacterium tuberculosis. MIC values of RFA-1 and RFA-2 were ≤0.02 μg/ml against rifamycin-susceptible strains and 0.5 μg/ml against a wide selection of multidrug-resistant strains, compared to ≥50 μg/ml for rifampin and 10 μg/ml for rifabutin. Molecular dynamic studies indicate that the compounds may exert tighter binding to mutants of RNA polymerase that have adapted to the rifamycins. PMID:20855731
Directory of Open Access Journals (Sweden)
L.D. Todoriko
2016-02-01
Conclusions. Comprehensive assessment of integral indices of endogenous intoxication and level of certain pro- and anti-inflammatory cytokines in the blood plasma of patients with MDR TB shows a moderate endogenous intoxication, break down of the cellular component of the immune reactivity due to the formation of conditions for the development of Mycobacterium tuberculosis resistance, with further growth of cytotoxic hypoxia and activation of systemic inflammatory response syndrome. Analysis of plasma concentration of IL-6, IL-10 and IL-18 in patients with multidrug-resistance proved, that their level depends on the nature of Mycobacterium tuberculosis resistance.
Molecular Characterization of the Resistance of Mycobacterium ...
African Journals Online (AJOL)
Purpose: To characterize the resistance of Mycobacterium tuberculosis to second line drugs using a line probe assay. Methods: Multi-drug resistant strains of Mycobacterium tuberculosis isolated between December 2008 and December 2009 were tested for resistance to fluoroquinolones and second-line injectable drugs ...
Directory of Open Access Journals (Sweden)
A. H. Kurniawan
2016-01-01
Full Text Available Background: Tuberculosis (TB is a high burden disease in Indonesia with multidrug-resistant (MDR TB incidence started to increase. Treatment success of MDR-TB globally was low in number than it was targeted which was especially caused by fluoroquinolone resistance. One of the fluoroquinolone is levofloxacin, an antibiotic that has been widely used irrationally as antimicrobial treatment. Therefore, this study investigated the sensitivity and MBC of MDR Mycobacterium tuberculosis isolates against Levofloxacin. Method: The susceptibility test for MDR-Mycobacterium tuberculosis on levofloxacin by standard method with levofloxacin were on concentrations 0,5 μg/ml, 1 μg/ml, and 2 μg/ml. Sample of 8 strains MDR-Mycobacterium tuberculosis were cultured with each concentrations on Middlebrook 7H9 for 1 week incubation. Next, each of the incubated concentration was subcultured on solid media Middlebrook 7H10 for 3 weeks incubation. Colonized agar plates after 3 weeks incubation were confirmed with acid-fast stain. Results: On MB 7H10 with levofloxacin concentration 2 μg/ml showed bactericidal effect 100% by no MDR Mycobacterium tuberculosis colony grew (0/8 while the MB 7H10 with levofloxacin concentration 1 μg/ml and 0,5 μg/ml showed the bactericidal effect 37,5% and 25% respectively. The colonized agar plate implied that the MDR Mycobacterium tuberculosis with levofloxacin concentration 1 μg/ml (5/8 and 0,5 μg/ml (6/8 grew well. Conclusion: Levofloxacin concentration 2 μg/ml was susceptible on MDR Mycobacterium tuberculosis. The concentration 2 μg/ml of levofloxacin could be considered as MBC.
Indolcarboxamide is a preclinical candidate for treating multidrug-resistant tuberculosis.
Rao, Srinivasa P S; Lakshminarayana, Suresh B; Kondreddi, Ravinder R; Herve, Maxime; Camacho, Luis R; Bifani, Pablo; Kalapala, Sarath K; Jiricek, Jan; Ma, Ng L; Tan, Bee H; Ng, Seow H; Nanjundappa, Mahesh; Ravindran, Sindhu; Seah, Peck G; Thayalan, Pamela; Lim, Siao H; Lee, Boon H; Goh, Anne; Barnes, Whitney S; Chen, Zhong; Gagaring, Kerstin; Chatterjee, Arnab K; Pethe, Kevin; Kuhen, Kelli; Walker, John; Feng, Gu; Babu, Sreehari; Zhang, Lijun; Blasco, Francesca; Beer, David; Weaver, Margaret; Dartois, Veronique; Glynne, Richard; Dick, Thomas; Smith, Paul W; Diagana, Thierry T; Manjunatha, Ujjini H
2013-12-04
New chemotherapeutic compounds against multidrug-resistant Mycobacterium tuberculosis (Mtb) are urgently needed to combat drug resistance in tuberculosis (TB). We have identified and characterized the indolcarboxamides as a new class of antitubercular bactericidal agent. Genetic and lipid profiling studies identified the likely molecular target of indolcarboxamides as MmpL3, a transporter of trehalose monomycolate that is essential for mycobacterial cell wall biosynthesis. Two lead candidates, NITD-304 and NITD-349, showed potent activity against both drug-sensitive and multidrug-resistant clinical isolates of Mtb. Promising pharmacokinetic profiles of both compounds after oral dosing in several species enabled further evaluation for efficacy and safety. NITD-304 and NITD-349 were efficacious in treating both acute and chronic Mtb infections in mouse efficacy models. Furthermore, dosing of NITD-304 and NITD-349 for 2 weeks in exploratory rat toxicology studies revealed a promising safety margin. Finally, neither compound inhibited the activity of major cytochrome P-450 enzymes or the hERG (human ether-a-go-go related gene) channel. These results suggest that NITD-304 and NITD-349 should undergo further development as a potential treatment for multidrug-resistant TB.
Increasing incidence of fluoroquinolone-resistant Mycobacterium tuberculosis in Mumbai, India.
Agrawal, D; Udwadia, Z F; Rodriguez, C; Mehta, A
2009-01-01
Tertiary referral centre, private hospital, Mumbai, India. To analyse the incidence of fluoroquinolone (FQ) resistant Mycobacterium tuberculosis (TB) in our laboratory from 1995 to 2004. Retrospective review and analysis of the drug susceptibility test records of all M. tuberculosis culture-positive samples from our Microbiology Department from 1995 to 2004. FQ resistance has increased exponentially in our laboratory, from 3% in 1996 to 35% in 2004. The incidence of multidrug-resistant tuberculosis has also increased during the same period, from 33% in 1995 to 56% in 2004. The incidence of FQ-resistant M. tuberculosis is gradually increasing to alarming levels. This may be due to widespread use of this vital group of drugs in the treatment of community-acquired infections. We urge that these broad spectrum antibiotics be used judiciously, and ideally be reserved for treatment of resistant TB in TB-endemic areas.
Baranyai, Zsuzsa; Krátký, Martin; Vinšová, Jarmila; Szabó, Nóra; Senoner, Zsuzsanna; Horváti, Kata; Stolaříková, Jiřina; Dávid, Sándor; Bősze, Szilvia
2015-08-28
In the Mycobacterium genus over one hundred species are already described and new ones are periodically reported. Species that form colonies in a week are classified as rapid growers, those requiring longer periods (up to three months) are the mostly pathogenic slow growers. More recently, new emerging species have been identified to lengthen the list, all rapid growers. Of these, Mycobacterium abscessus is also an intracellular pathogen and it is the most chemotherapy-resistant rapid-growing mycobacterium. In addition, the cases of multidrug-resistant Mycobacterium tuberculosis infection are also increasing. Therefore there is an urgent need to find new active molecules against these threatening strains. Based on previous results, a series of salicylanilides, salicylanilide 5-chloropyrazinoates and carbamates was designed, synthesized and characterised. The compounds were evaluated for their in vitro activity on M. abscessus, susceptible M. tuberculosis H37Rv, multidrug-resistant (MDR) M. tuberculosis MDR A8, M. tuberculosis MDR 9449/2006 and on the extremely-resistant Praha 131 (XDR) strains. All derivatives exhibited a significant activity with minimum inhibitory concentrations (MICs) in the low micromolar range. Eight salicylanilide carbamates and two salicylanilide esters exhibited an excellent in vitro activity on M. abscessus with MICs from 0.2 to 2.1 μM, thus being more effective than ciprofloxacin and gentamicin. This finding is potentially promising, particularly, as M. abscessus is a threateningly chemotherapy-resistant species. M. tuberculosis H37Rv was inhibited with MICs from 0.2 μM, and eleven compounds have lower MICs than isoniazid. Salicylanilide esters and carbamates were found that they were effective also on MDR and XDR M. tuberculosis strains with MICs ≥1.0 μM. The in vitro cytotoxicity (IC50) was also determined on human MonoMac-6 cells, and selectivity index (SI) of the compounds was established. In general, salicylanilide
Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis
Directory of Open Access Journals (Sweden)
Alya Putri Khairani
2017-09-01
Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.
Drug Resistance of Mycobacterium tuberculosis Complex among ...
African Journals Online (AJOL)
BACKGROUND: In Burkina Faso, there is no recent data about the level of drug resistance in Mycobacterium tuberculosis strains among newly diagnosed tuberculosis cases. OBJECTIVE: To provide an update of the primary drug resistance of mycobacterium tuberculosis among patients in Burkina faso. METHODS: ...
Mycobacterium bovis and Other Uncommon Members of the Mycobacterium tuberculosis Complex.
Esteban, Jaime; Muñoz-Egea, Maria-Carmen
2016-12-01
Since its discovery by Theobald Smith, Mycobacterium bovis has been a human pathogen closely related to animal disease. At present, M. bovis tuberculosis is still a problem of importance in many countries and is considered the main cause of zoonotic tuberculosis throughout the world. Recent development of molecular epidemiological tools has helped us to improve our knowledge about transmission patterns of this organism, which causes a disease indistinguishable from that caused by Mycobacterium tuberculosis. Diagnosis and treatment of this mycobacterium are similar to those for conventional tuberculosis, with the important exceptions of constitutive resistance to pyrazinamide and the fact that multidrug-resistant and extremely drug-resistant M. bovis strains have been described. Among other members of this complex, Mycobacterium africanum is the cause of many cases of tuberculosis in West Africa and can be found in other areas mainly in association with immigration. M. bovis BCG is the currently available vaccine for tuberculosis, but it can cause disease in some patients. Other members of the M. tuberculosis complex are mainly animal pathogens with only exceptional cases of human disease, and there are even some strains, like "Mycobacterium canettii," which is a rare human pathogen that could have an important role in the knowledge of the evolution of tuberculosis in the history.
Directory of Open Access Journals (Sweden)
Muthu S Kumaran
2017-01-01
Full Text Available Tuberculosis (TB is still a major public health problem in the world, with many factors contributing to this burden, including poor living conditions, overcrowding, poverty, malnutrition, illiteracy, and rapid spread of human immunodeficiency virus infection. Cutaneous tuberculosis is a less common form of extrapulmonary tuberculosis, and in this paucibacillary form the diagnosis depends on histopathology, tuberculin positivity, and response to treatment. The diagnosis is even more difficult in cases with drug resistant Mycobacterium tuberculosis due to lack of awareness and lack of facilities to diagnose drug resistant tuberculosis. In this article, we describe an unusual case of multidrug resistant lupus vulgaris (LV, in a 34-year-old male who responded to anti-tubercular treatment (ATT initially, but developed recurrent disease which failed to respond to standard four-drug ATT; subsequently, tissue culture showed growth of multidrug resistant M. tuberculosis. Subsequently, he also developed cutaneous squamous cell carcinoma. This article aims to exemplify a grave complication that can occur in long-standing case of LV, the limitations faced by clinicians in developing countries where tuberculosis is endemic, and classical methods of proving drug resistance are generally unavailable or fail.
Beijing Lineage of MDR Mycobacterium tuberculosis in Bulgaria, 2007-2011
Panaiotov, Stefan; Bachiyska, Elizabeta; Yordanova, Stanislava; Atanasova, Yuliana; Brankova, Nadia; Levterova, Viktoria; Sengstake, Sarah; Anthony, Richard; Bergval, Indra; Sola, Christophe; Kantardjiev, Todor
2014-01-01
To assess the spread of the Mycobacterium tuberculosis Beijing genotype among patients with multidrug-resistant and extensively resistant tuberculosis in Bulgaria, we genotyped 188 (72%) of 261 microbiologically confirmed resistant isolates obtained during 2007-2011. The estimated prevalence of the
Relationship Between Substance Abuse and Multidrug-Resistant Tuberculosis
Directory of Open Access Journals (Sweden)
Sadya Afroz
2012-07-01
Full Text Available This case control study was conducted between January to June 2010 to determine the relationship between substance abuse and multidrug- resistant tuberculosis. A total of 73 cases were selected purposively, from culture- positive multidrug- resistant tuberculosis patients admitted in the National Institute of Diseases of the Chest and Hospital, Dhaka and compared with 81 un-matched controls, recruited from the cured patients of pulmonary tuberculosis who attended several DOTS centers of ‘Nagar Shastho Kendra’ under Urban Primary Health Care Project in Dhaka city. Data were collected by face to face interview and documents’ review, using a pre- tested structured questionnaire and a checklist. Multidrug- resistance was found to be associated with smoking status (χ2 = 11.76; p = 0.01 and panmasala use (χ2 = 8.28; p = 0.004. The study also revealed that alcohol consumption and other substance abuse such as jarda, sadapata, gul, snuff, heroine, cannabis, injectable drugs was not associated with the development of multidrug- resistant tuberculosis. Relationship between substance abuse and multidrug- resistant tuberculosis are more or less similar in the developing countries. Bangladesh is not out of this trend. The present study revealed the same fact, which warrants actions targeting specific factors. Further study is recommended to assess the magnitude and these factors related to the development of multidrug- resistant tuberculosis in different settings in our country. Ibrahim Med. Coll. J. 2012; 6(2: 50-54
Directory of Open Access Journals (Sweden)
Navisha Dookie
2016-10-01
Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.
Multidrug-Resistant Tuberculosis
Centers for Disease Control (CDC) Podcasts
In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.
Huyen, Mai N. T.; Buu, Tran N.; Tiemersma, Edine; Lan, Nguyen T. N.; Dung, Nguyen H.; Kremer, Kristin; Soolingen, Dick V.; Cobelens, Frank G. J.
2013-01-01
In Vietnam, the Mycobacterium tuberculosis Beijing genotype is associated with multi-drug resistance and is emerging. A possible explanation for this genotype's success is an increased rate of relapse. In a prospective cohort study, isolates from patients with smear-positive tuberculosis were
Borgdorff, Martien W.; van Deutekom, Henk; de Haas, Petra E. W.; Kremer, Kristin; van Soolingen, Dick
2004-01-01
Mycobacterium tuberculosis strains of the Beijing genotype have been involved in various outbreaks of multidrug-resistant tuberculosis. Some studies suggest that the infection with the Beijing genotype is associated with a different host immune response. Since this might also lead to a different
Dalla Costa, Elis R.; Vasconcelos, Sidra E. G.; Esteves, Leonardo S.; Gomes, Harrison M.; Gomes, Lia L.; Almeida da Silva, Pedro; Perdigã o, Joã o; Portugal, Isabel; Viveiros, Miguel; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Rastogi, Nalin; Unis, Gisela; Rossetti, Maria Lucia R.; Suffys, Philip Noel
2015-01-01
We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.
Dalla Costa, Elis R.
2015-09-23
We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.
T cell-based tracking of multidrug resistant tuberculosis infection after brief exposure.
Richeldi, Luca; Ewer, Katie; Losi, Monica; Bergamini, Barbara M; Roversi, Pietro; Deeks, Jonathan; Fabbri, Leonardo M; Lalvani, Ajit
2004-08-01
Molecular epidemiology indicates significant transmission of Mycobacterium tuberculosis after casual contact with infectious tuberculosis cases. We investigated M. tuberculosis transmission after brief exposure using a T cell-based assay, the enzyme-linked-immunospot (ELISPOT) for IFN-gamma. After childbirth, a mother was diagnosed with sputum smear-positive multidrug-resistant tuberculosis. Forty-one neonates and 47 adults were present during her admission on the maternity unit; 11 weeks later, all underwent tuberculin skin testing (TST) and ELISPOT. We correlated test results with markers of exposure to the index case. The participants, who were asymptomatic and predominantly had no prior tuberculosis exposure, had 6.05 hours mean exposure (range: 0-65 hours) to the index case. Seventeen individuals, including two newborns, were ELISPOT-positive, and ELISPOT results correlated significantly with three of four predefined measures of tuberculosis exposure. For each hour sharing room air with the index case, the odds of a positive ELISPOT result increased by 1.05 (95% CI: 1.02-1.09, p = 0.003). Only four adults were TST-positive and TST results did not correlate with exposure. Thus, ELISPOT, but not TST, suggested quite extensive nosocomial transmission of multidrug-resistant M. tuberculosis after brief exposure. These results help to explain the apparent importance of casual contact for tuberculosis transmission, and may have implications for prevention.
The radiological spectrum of pulmonary multidrug-resistant tuberculosis: in HIV-Negative patients
International Nuclear Information System (INIS)
Zahirifard, S.; Amiri, M.V.; Bakhshayesh Karam, M.; Mirsaeidi, S.M.; Ehsanpour, A.; Masjedi, M.R.
2003-01-01
Background: Multidrug-resistant tuberculosis is a major worldwide health problem. In countries where tuberculosis is of moderate to high prevalence, the issue of Multidrug-resistant tuberculosis carries significant importance. Multidrug-resistant tuberculosis, similar to drug-sensitive tuberculosis, is contagious. Meanwhile its treatment is not only more difficult but also more expensive with lower success rates. Regarding clinical findings, there is no significant difference between Multidrug-resistant tuberculosis and drug-sensitive tuberculosis. Therefore determination of characteristic radiological findings in cases of Multidrug-resistant tuberculosis might be of help in early detection, and hence appropriate management of this disease condition. Objective: To explain the radiological spectrum of pulmonary Multidrug-resistant tuberculosis. Patients and methods: We retrospectively evaluated the radiographic images of 35 patients with clinically-and microbiologically- proven Multidrug-resistant tuberculosis admitted to our tertiary-care tuberculosis unit over a period of 13 months. The latest chest x-ray of all patients and the conventional chest CT scan without contrast of 15 patients were reviewed by three expert radiologists who rendered consensus opinion. Results: Of the 35 patients with imaging studies, 23 (66%) were male and 12 (34%) were female. The mean±SD age of participants was 38.2±17.3 (range: 16-20) years. 33 patients were known as secondary and only 2 had primary Multidrug-resistant tuberculosis. Chest radiography revealed cavitary lesion in 80% pulmonary infiltration in 89% and nodules in 80% of the cases. Pleurisy was the rarest finding observed in only 5 (14%) patients. All of 15 chest CT scans revealed cavitation, 93% of which were bilateral and multiple. Pleural involvement was seen in 93% of patients. Conclusion: Presence of multiple cavities, especially in both lungs, nodular and infiltrative lesions, and pleural effusion are main features
Characterization of extensively drug-resistant Mycobacterium tuberculosis in Nepal.
Poudel, Ajay; Maharjan, Bhagwan; Nakajima, Chie; Fukushima, Yukari; Pandey, Basu D; Beneke, Antje; Suzuki, Yasuhiko
2013-01-01
The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global control of TB. Although molecular characterization of drug resistance-associated mutations in multidrug-resistant isolates in Nepal has been made, mutations in XDR isolates and their genotypes have not been reported previously. In this study, we identified and characterized 13 XDR Mycobacterium tuberculosis isolates from clinical isolates in Nepal. The most prevalent mutations involved in rifampicin, isoniazid, ofloxacin, and kanamycin/capreomycin resistance were Ser531Leu in rpoB gene (92.3%), Ser315Thr in katG gene (92.3%), Asp94Gly in gyrA gene (53.9%) and A1400G in rrs gene (61.5%), respectively. Spoligotyping and multilocus sequence typing revealed that 69% belonged to Beijing family, especially modern types. Further typing with 26-loci variable number of tandem repeats suggested the current spread of XDR M. tuberculosis. Our result highlights the need to reinforce the TB policy in Nepal with regard to control and detection strategies. Copyright © 2012 Elsevier Ltd. All rights reserved.
Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard
2005-01-01
The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166
Multidrug-Resistant Tuberculosis
Centers for Disease Control (CDC) Podcasts
2008-10-28
In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition. Created: 10/28/2008 by Emerging Infectious Diseases. Date Released: 10/28/2008.
Sertel Şelale, Denİz; Uzun, Meltem
2018-01-01
Inexpensive, rapid, and reliable tests for detecting the presence and drug susceptibility of Mycobacterium tuberculosis complex (MTBC) are urgently needed to control the transmission of tuberculosis. In this study, we aimed to assess the accuracy and speed of the microscopic-observation drug susceptibility (MODS) assay in the identification of MTBC and detection of multidrug resistance. Sputum samples from patients suspected to have tuberculosis were simultaneously tested with MODS and conventional culture [Löwenstein-Jensen (LJ) culture, BACTEC MGIT™ 960 (MGIT) system], and drug susceptibility testing (MGIT system) methods. A total of 331 sputum samples were analyzed. Sensitivity and specificity of MODS assay for detection of MTBC strains were 96% and 98.8%, respectively. MODS assay detected multidrug resistant MTBC isolates with 92.3% sensitivity and 96.6% specificity. Median time to culture positivity was similar for MGIT (8 days) and MODS culture (8 days), but was significantly longer with LJ culture (20 days) (p tuberculosis and detection of multidrug resistance. © 2017 APMIS. Published by John Wiley & Sons Ltd.
Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil
Directory of Open Access Journals (Sweden)
Geisa Fregona
Full Text Available ABSTRACT OBJECTIVE To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. METHODS This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis – from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. RESULTS In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24–14.05 and re-entry after abandonment (OR = 3.91; 95%CI 1.81–8.43], smoking (OR = 3.93; 95%CI 1.98–7.79, and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15–8.99. CONCLUSIONS The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo.
MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis
REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG
2015-01-01
Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150
Linezolid in multidrug-resistant tuberculosis
Bolhuis, Mathieu
2015-01-01
Tuberculose is een potentieel dodelijke infectieziekte die wordt veroorzaakt door de bacterie Mycobacterium tuberculosis. Een deel van de tuberculosepatiënten is besmet met multiresistente tuberculose. In het geval van multiresistente tuberculose is de bacterie resistent tegen de twee belangrijkste
Multi-drug resistant tuberculosis in Tanzania: Initial description of ...
African Journals Online (AJOL)
Background: Drug resistant Tuberculosis is well documented worldwide and is associated with increasing morbidity and mortality complicating Tuberculosis control with increasing costs of managing the disease. Broad. Objective: To describe clinical and laboratory characteristics of multi-drug resistant Tuberculosis ...
Directory of Open Access Journals (Sweden)
Márcia Beatriz de Souza
2006-10-01
Full Text Available OBJETIVO: Estudar os fatores determinantes da multirresistência do Mycobacterium tuberculosis às drogas tuberculostáticas em centro de referência de doenças infecto-contagiosas do Estado de Minas Gerais, Hospital Eduardo de Menezes. MÉTODOS: Estudo tipo caso-controle, retrospectivo, realizado de setembro de 2000 a janeiro de 2004. Nesse período, 473 culturas com crescimento de M. tuberculosis relativas a 313 pacientes foram analisadas quanto ao perfil de sensibilidade, no Laboratório Central de Minas Gerais. Foram selecionados os casos multirresistentes definidos como resistência a pelo menos rifampicina e isoniazida, depois de pareados com o grupo controle de pacientes com tuberculose sensível a todas as drogas na razão de 1:3. A associação dos dados demográficos e clínicos foi feita por análise estatística uni e multivariada. RESULTADOS: Durante o período de estudo, doze casos de tuberculose multirresistente foram identificados (3,83%. Na análise univariada, a tuberculose multirresistente foi mais comum no sexo masculino, em pacientes com baciloscopia de escarro positiva, pacientes com cavitações maiores que 4 cm de diâmetro e pacientes com um ou mais tratamentos prévios para tuberculose (p = 0,10. Após a análise multivariada somente o tratamento anterior para tuberculose permaneceu estatisticamente significativo (p = 0,0374, com odds ratio de 14,36 (1,96 - 176,46. CONCLUSÃO: O fator de risco que se mostrou independentemente associado ao desenvolvimento de tuberculose multirresistente neste estudo foi a presença de um ou mais tratamentos prévios para tuberculose.OBJECTIVE: To assess the determining factors for Mycobacterium tuberculosis multidrug resistance at a referral center for infectious diseases in the state of Minas Gerais, Brazil. METHODS: A retrospective case-control study was conducted using data collected from September of 2000 to January of 2004. During this period, 473 cultures presenting growth of M
Clusters of Multidrug-Resistant Mycobacterium tuberculosis Cases, Europe
Kremer, Kristin; Heersma, Herre; Van Soolingen, Dick
2009-01-01
Molecular surveillance of multidrug-resistant tuberculosis (MDR TB) was implemented in Europe as case reporting in 2005. For all new MDR TB cases detected from January 2003 through June 2007, countries reported case-based epidemiologic data and DNA fingerprint patterns of MDR TB strains when available. International clusters were detected and analyzed. From 2003 through mid-2007 in Europe, 2,494 cases of MDR TB were reported from 24 European countries. Epidemiologic and molecular data were linked for 593 (39%) cases, and 672 insertion sequence 6110 DNA fingerprint patterns were reported from 19 countries. Of these patterns, 288 (43%) belonged to 18 European clusters; 7 clusters (242/288 cases, 84%) were characterized by strains of the Beijing genotype family, including the largest cluster (175/288 cases, 61%). Both clustering and the Beijing genotype were associated with strains originating in eastern European countries. Molecular cluster detection contributes to identification of transmission profile, risk factors, and control measures. PMID:19624920
Directory of Open Access Journals (Sweden)
Stefan Niemann
2009-10-01
Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using
Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C
2009-10-12
Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard
Directory of Open Access Journals (Sweden)
Zakham F
2013-11-01
new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu, accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T.Conclusion: The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in critical cases to adjust the treatment regimen and limit the emergence of MDR and XDR strains.Keywords: Morocco, Mycobacterium tuberculosis, multidrug resistance, rpoB, katG, inhA promoter
Ejo, Mebrat; Gehre, Florian; Barry, Mamadou Dian; Sow, Oumou; Bah, Nene Mamata; Camara, Mory; Bah, Boubacar; Uwizeye, Cecile; Nduwamahoro, Elie; Fissette, Kristina; Rijk, Pim De; Merle, Corinne; Olliaro, Piero; Burgos, Marcos; Lienhardt, Christian; Rigouts, Leen; de Jong, Bouke C.
2015-01-01
In this study we assessed first-line anti-tuberculosis drug resistance and the genotypic distribution of Mycobacterium tuberculosis complex (MTBC) isolates that had been collected from consecutive new tuberculosis patients enrolled in two clinical trials conducted in Guinea between 2005 and 2010. Among the total 359 MTBC strains that were analyzed in this study, 22.8% were resistant to at least one of the first line anti-tuberculosis drugs, including 2.5% multidrug resistance and 17.5% isoniazid resistance, with or without other drugs. In addition, further characterization of isolates from a subset of the two trials (n = 184) revealed a total of 80 different spoligotype patterns, 29 “orphan” and 51 shared patterns. We identified the six major MTBC lineages of human relevance, with predominance of the Euro-American lineage. In total, 132 (71.7%) of the strains were genotypically clustered, and further analysis (using the DESTUS model) suggesting significantly faster spread of LAM10_CAM family (p = 0.00016). In conclusion, our findings provide a first insight into drug resistance and the population structure of the MTBC in Guinea, with relevance for public health scientists in tuberculosis control programs. PMID:26004194
Adaptation and evolution of drug-resistant Mycobacterium tuberculosis
Bergval, I.L.
2013-01-01
Many studies have been conducted on drug resistance and the evolution of Mycobacterium tuberculosis. Notwithstanding, many molecular mechanisms facilitating the emergence, adaptation and spread of drug-resistant tuberculosis have yet to be discovered. This thesis reports studies of the adaptive
Olano, Juanita; López, Beatriz; Reyes, Alejandro; Lemos, María del Pilar; Correa, Nidia; Del Portillo, Patricia; Barrera, Lucia; Robledo, Jaime; Ritacco, Viviana; Zambrano, María Mercedes
2007-11-01
The analysis of the DNA repair genes ogt and ung was carried out in 117 Mycobacterium tuberculosis clinical isolates from Argentina and Colombia in order to explore correlation between mutations in these genes and multi-drug resistance. With the exception of two Beijing family isolates, the rest of the strains harbored either two wild-type or two mutant alleles with identical single nucleotide polymorphisms (SNPs) in each gene (ogt44 and ung501). These ogt44 and ung501 mutations were not associated with multi-drug resistance and occurred simultaneously in circulating Haarlem genotype M. tuberculosis strains. We therefore propose the use of these markers as tools in phylogenetic and epidemiologic studies.
A case of multidrug-resistant monoarticular joint tuberculosis in a renal transplant recipient.
Regmi, A; Singh, P; Harford, A
2014-01-01
Tuberculosis (TB) is a common opportunistic infection after renal transplantation. The risk of TB in renal transplant recipients is reported to be 20 to 74 times higher than in the general population. Although extrapulmonary TB occurs frequently, isolated ankle joint TB is a rare form of extrapulmonary TB infection. It is often difficult to diagnose because of its atypical presentation; management is complex, especially with multidrug-resistant TB, the need for a prolonged course of therapy, and the risks of drug interactions and drug toxicity. We report herein a case of a 60-year-old female renal allograft recipient who developed multidrug-resistant ankle joint TB 11 months after her deceased donor renal transplantation. She presented to the emergency department with escalating pain and swelling of the left ankle, difficulty in ambulation, and a low-grade fever. An x-ray of the ankle revealed an effusion and soft tissue swelling. A synovial fluid culture was performed which tested positive for acid fast bacilli which grew a multidrug-resistant form of Mycobacterium tuberculosis. She was initially treated with isoniazid, rifampin, ethambutol, and pyrazinamide; then therapy was tailored secondary to the resistant nature of the organism. She received a combination of extensive debridement of the joint and institution of second-line anti-TB therapy with pyrazinamide, ethambutol, moxifloxacin, and ethionamide. To our knowledge, no other cases of multidrug-resistant TB have been reported in the literature after renal transplantation. This case shows both an atypical presentation of TB and the difficulties in managing a transplant patient with this disease. Copyright © 2014 Elsevier Inc. All rights reserved.
Exploring the iron metabolism in multidrug resistant tuberculosis ...
African Journals Online (AJOL)
The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis (MDR-TB) treated with second generation ...
Exploring the iron metabolism in multidrug resistant tuberculosis ...
African Journals Online (AJOL)
The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis. (MDR-TB) treated with second ...
Directory of Open Access Journals (Sweden)
Tatiane eCoelho
2015-04-01
Full Text Available Drug resistant tuberculosis continues to increase and new approaches for its treatment are necessary. The identification of M. tuberculosis clinical isolates presenting efflux as part of their resistant phenotype has a major impact in tuberculosis treatment. In this work, we used a checkerboard procedure combined with the tetrazolium microplate-based assay (TEMA to study single combinations between antituberculosis drugs and efflux inhibitors (EIs against multidrug resistant M. tuberculosis clinical isolates using the fully susceptible strain H37Rv as reference. Efflux activity was studied on a real-time basis by a fluorometric method that uses ethidium bromide as efflux substrate. Quantification of efflux pump genes mRNA transcriptional levels were performed by RT-qPCR. The fractional inhibitory concentrations (FIC indicated synergistic activity for the interactions between isoniazid, rifampicin, amikacin, ofloxacin, and ethidium bromide plus the EIs verapamil, thioridazine and chlorpromazine. The FICs ranged from 0.25, indicating a four-fold reduction on the MICs, to 0.015, 64-fold reduction. The detection of active efflux by real-time fluorometry showed that all strains presented intrinsic efflux activity that contributes to the overall resistance which can be inhibited in the presence of the EIs. The quantification of the mRNA levels of the most important efflux pump genes on these strains shows that they are intrinsically predisposed to expel toxic compounds as the exposure to subinhibitory concentrations of antibiotics were not necessary to increase the pump mRNA levels when compared with the non-exposed counterpart. The results obtained in this study confirm that the intrinsic efflux activity contributes to the overall resistance in multidrug resistant clinical isolates of M. tuberculosis and that the inhibition of efflux pumps by the EIs can enhance the clinical effect of antibiotics that are their substrates.
Assessment of trends of ofloxacin resistance in Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
J S Verma
2011-01-01
Full Text Available Purpose: Ofloxacin (OFX is one of the potent fluoroquinolone (FQ recommended to treat MDR-TB. Over a decade, the preexposure of this drug for the treatment of other bacterial infections has resulted in acquisition of FQ resistance among Mycobacterium tuberculosis strains. Considering this possibility, a study was undertaken in a tertiary care center in the capital city (India to assess the drug resistance trends of OFX among susceptible and multidrug resistant (MDR strains of M. tuberculosis. Materials and Methods: A total of 102 M. tuberculosis isolates (47 susceptible to first-line drugs and 55 MDR isolates were screened for susceptibility testing of OFX with a critical concentration of 2 μg/ml by Lowenstein Jensen (LJ proportion method. Results: The results showed 40 (85.1% isolates among 47 susceptible isolates and 34 (61.8% isolates among 55 MDR isolates, were found to be susceptible to OFX. Fisher′s exact test showed significant P-value (0.0136 demonstrating 1.377 fold (95% confidence interval increased risk to become resistant to OFX than susceptible isolates. These finding shows decreased OFX susceptibility is not only limited to MDR isolates but also increasingly seen in susceptible strains as a result of drug abuse. Conclusions: Our finding were not alarming, but highlights the general risk of acquiring resistance to OFX, jeopardizing the potential for these drugs to be used as second-line anti-TB agents in the management of drug-resistant TB and creating incurable TB strains .
Multidrug-resistant tuberculosis, Somalia, 2010-2011.
Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal; Zignol, Matteo
2013-03-01
In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia.
Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB
ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.
2012-01-01
To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099
Ramazanzadeh, Rashid; Roshani, Daem; Shakib, Pegah; Rouhi, Samaneh
2015-01-01
Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis) can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB) in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR) in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012) that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10). Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20%) with negative MDR-TB and in China in 2010 (0.8%), respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%).0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family. PMID:25767526
Directory of Open Access Journals (Sweden)
Matthias Merker
Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and
Diversity and evolution of drug resistance mechanisms in Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Al-Saeedi M
2017-10-01
Full Text Available Mashael Al-Saeedi, Sahal Al-Hajoj Department of Infection and Immunity, Mycobacteriology Research Section, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia Abstract: Despite the efficacy of antibiotics to protect humankind against many deadly pathogens, such as Mycobacterium tuberculosis, nothing can prevent the emergence of drug-resistant strains. Several mechanisms facilitate drug resistance in M. tuberculosis including compensatory evolution, epistasis, clonal interference, cell wall integrity, efflux pumps, and target mimicry. In this study, we present recent findings relevant to these mechanisms, which can enable the discovery of new drug targets and subsequent development of novel drugs for treatment of drug-resistant M. tuberculosis. Keywords: Mycobacterium tuberculosis, antibiotic resistance, compensatory evolution, epistasis, efflux pumps, fitness cost
Multidrug-resistant tuberculosis and migration to Europe
DEFF Research Database (Denmark)
Hargreaves, S.; Lönnroth, K.; Nellums, L. B.
2017-01-01
Multidrug-resistant tuberculosis (MDR-TB) in low-incidence countries in Europe is more prevalent among migrants than the native population. The impact of the recent increase in migration to EU and EEA countries with a low incidence of TB (
Manning, Thomas; Plummer, Sydney; Baker, Tess; Wylie, Greg; Clingenpeel, Amy C; Phillips, Dennis
2015-10-15
The bacterium responsible for causing tuberculosis has evolved resistance to antibiotics used to treat the disease, resulting in new multidrug resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug resistant M. tuberculosis (XDR-TB) strains. Analytical techniques (1)H and (13)C Nuclear Magnetic Resonance (NMR), Fourier Transform-Ion Cyclotron Resonance with Electrospray Ionization (FT-ICR/ESI), and Matrix Assisted Laser Desorption Ionization-Mass Spectrometry (MALDI-TOF-MS) were used to study different aspects of the Cu(II)-polyethylene glycol (PEG-3350)-sucrose-isoniazid and Cu(II)-polyethylene glycol (PEG3350)-glucose-isoniazid complexes. The Cu(II) cation, sucrose or glucose, and the aggregate formed by PEG primarily serve as a composite drug delivery agent for the frontline antibiotic, however the improvement in MIC values produced with the CU-PEG-SUC-INH complex suggest an additional effect. Several Cu-PEG-SUC-INH complex variations were tested against INH resistant and nonresistant strains of M. tuberculosis. Copyright © 2015 Elsevier Ltd. All rights reserved.
Multidrug-Resistant Tuberculosis, Somalia, 2010–2011
Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal
2013-01-01
In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia. PMID:23621911
International Nuclear Information System (INIS)
Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing
2004-01-01
To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)
Walker, Timothy M; Merker, Matthias; Knoblauch, Astrid M; Helbling, Peter; Schoch, Otto D; van der Werf, Marieke J; Kranzer, Katharina; Fiebig, Lena; Kröger, Stefan; Haas, Walter; Hoffmann, Harald; Indra, Alexander; Egli, Adrian; Cirillo, Daniela M; Robert, Jérôme; Rogers, Thomas R; Groenheit, Ramona; Mengshoel, Anne T; Mathys, Vanessa; Haanperä, Marjo; Soolingen, Dick van; Niemann, Stefan; Böttger, Erik C; Keller, Peter M
2018-01-01
The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan.
Directory of Open Access Journals (Sweden)
Rashid Ramazanzadeh
2015-01-01
Full Text Available Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012 that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10. Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20% with negative MDR-TB and in China in 2010 (0.8%, respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%.0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family.
International Nuclear Information System (INIS)
Veigas, Bruno; Baptista, Pedro V; Machado, Diana; Couto, Isabel; Viveiros, Miguel; Perdigao, Joao; Portugal, Isabel
2010-01-01
Tuberculosis (TB) is one of the leading causes of infection in humans, causing high morbility and mortality all over the world. The rate of new cases of multidrug resistant tuberculosis (MDRTB) continues to increase, and since these infections are very difficult to manage, they constitute a serious health problem. In most cases, drug resistance in Mycobacterium tuberculosis has been related to mutations in several loci within the pathogen's genome. The development of fast, cheap and simple screening methodologies would be of paramount relevance for the early detection of these mutations, essential for the timely and effective diagnosis and management of MDRTB patients. The use of gold nanoparticles derivatized with thiol-modified oligonucleotides (Au-nanoprobes) has led to new approaches in molecular diagnostics. Based on the differential non-cross-linking aggregation of Au-nanoprobes, we were able to develop a colorimetric method for the detection of specific sequences and to apply this approach to pathogen identification and single base mutations/single nucleotide polymorphisms (SNP) discrimination. Here we report on the development of Au-nanoprobes for the specific identification of SNPs within the beta subunit of the RNA polymerase (rpoB locus), responsible for resistance to rifampicin in over 95% of rifampicin resistant M. tuberculosis strains.
Energy Technology Data Exchange (ETDEWEB)
Veigas, Bruno; Baptista, Pedro V [CIGMH, Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal); Machado, Diana; Couto, Isabel; Viveiros, Miguel [Unidade de Micobacterias, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa (IHMT/UNL) (Portugal); Perdigao, Joao; Portugal, Isabel, E-mail: pmvb@fct.unl.pt [Centro de Patogenese Molecular/URIA, Faculdade de Farmacia, Universidade de Lisboa, Lisboa (Portugal)
2010-10-15
Tuberculosis (TB) is one of the leading causes of infection in humans, causing high morbility and mortality all over the world. The rate of new cases of multidrug resistant tuberculosis (MDRTB) continues to increase, and since these infections are very difficult to manage, they constitute a serious health problem. In most cases, drug resistance in Mycobacterium tuberculosis has been related to mutations in several loci within the pathogen's genome. The development of fast, cheap and simple screening methodologies would be of paramount relevance for the early detection of these mutations, essential for the timely and effective diagnosis and management of MDRTB patients. The use of gold nanoparticles derivatized with thiol-modified oligonucleotides (Au-nanoprobes) has led to new approaches in molecular diagnostics. Based on the differential non-cross-linking aggregation of Au-nanoprobes, we were able to develop a colorimetric method for the detection of specific sequences and to apply this approach to pathogen identification and single base mutations/single nucleotide polymorphisms (SNP) discrimination. Here we report on the development of Au-nanoprobes for the specific identification of SNPs within the beta subunit of the RNA polymerase (rpoB locus), responsible for resistance to rifampicin in over 95% of rifampicin resistant M. tuberculosis strains.
Directory of Open Access Journals (Sweden)
Rita Macedo
2009-05-01
Full Text Available Nowadays, the greatest concern of tuberculosis control programmes is the appearance of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis. Rapid determination of drug resistance in clinical samples, with Mycobacterium tuberculosis complex (MTC, is the prerequisite for initiating effective chemotherapy, ensuring successful treatment of the patient and preventing further spread of drugresistant isolates.The aim of our study was to determine the sensitivity of the new MTBDRplus® assay in comparison to culture, identification and classic DST, directly from smear-positive clinical specimens.A total of 68 smear-positive sputum specimens were processed by both the classical mycobacteriological methods and the molecular assay, MTBDRplus®.MTBDRplus® assay allowed an accurate identification of MTC species by detection of the specific band in all samples, from which we also isolated and identified MTC strains by culture methods. In the samples from which we isolated susceptible strains (63.2%, wild type patterns were found using MTBDRplus® assay. The samples from which we isolated resistant strains (36.8% showed specific mutations associated with the correspondent resistant phenotype.Our study indicated that this assay allows rapid detection of resistance, always in agreement with classic methods. Resumo: Uma das principais problematicas no controlo da tuberculose e o aparecimento de casos de tuberculose multirresistente (TB-MR e tuberculose extensivamente resistente (TB-XDR. A deteccao precoce da resistencia a farmacos, directamente a partir de amostras respiratorias, e essencial para que se assegure o tratamento atempado, adequado e eficaz da tuberculose, bem como para prevenir a disseminacao destes casos de especial gravidade.O nosso objectivo foi avaliar a sensibilidade e comparar os resultados obtidos com um metodo de genetica molecular disponivel comercialmente â MTBDRplus® â e o isolamento
Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.
Merker Matthias; Blin Camille; Mona Stefano; Duforet-Frebourg Nicolas; Lecher Sophie; Willery Eve; Blum Michael G B; Rüsch-Gerdes Sabine; Mokrousov Igor; Aleksic Eman; Allix-Béguec Caroline; Antierens Annick; Augustynowicz-Kopec Ewa; Ballif Marie; Barletta Francesca
2015-01-01
International audience; Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiat...
Multidrug-resistant tuberculosis in pregnancy
International Nuclear Information System (INIS)
Dhingra, V.K.; Arora, V.K.; Rajpal, S.
2007-01-01
This is a case report of 26 years old pregnant woman with multidrug-resistant tuberculosis (MDR TB), treated at outpatient department of New Delhi Tuberculosis (NDTB) Centre, India with second line agents. Before presentation at NDTB Centre, she had been treated with first line drugs for approximately one and-a-half-year, including category II re-treatment DOTS regimen under RNTCP. Patient conceived twice during her anti-TB treatment. The first one was during her category II treatment, when put on second line drugs. We describe congenital abnormalities documented in her second child exposed in-utero to second line anti-tubercular drugs with a brief review of treatment of MDR TB in pregnancy. (author)
New-Onset Psychosis in a Multi-Drug Resistant Tuberculosis Patient ...
African Journals Online (AJOL)
Drug-resistant tuberculosis poses a serious challenge to global control of TB. These forms of TB do not respond to the standard six-month treatment; it can take two years or more to treat with category IV drugs that are less potent, more toxic and much more expensive. Treatment of multi-drug resistant tuberculosis is still ...
Walker, T.M.; Merker, M.; Knoblauch, A.M.; Helbling, P.; Schoch, O.D.; Werf, M.J. van der; Kranzer, K.; Fiebig, L.; Kroger, S.; Haas, W.; Hoffmann, H.; Indra, A.; Egli, A.; Cirillo, D.M.; Robert, J.; Rogers, T.R.; Groenheit, R.; Mengshoel, A.T.; Mathys, V.; Haanpera, M.; Soolingen, D.V.; Niemann, S.; Bottger, E.C.; Keller, P.M.; Ingen, J. van; Wagner-Wiening, C.; Witschi, M.
2018-01-01
BACKGROUND: The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan. METHODS: On April 29 and May 30, 2016,
Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil.
Fregona, Geisa; Cosme, Lorrayne Belique; Moreira, Cláudia Maria Marques; Bussular, José Luis; Dettoni, Valdério do Valle; Dalcolmo, Margareth Pretti; Zandonade, Eliana; Maciel, Ethel Leonor Noia
2017-04-27
To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin) in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis - from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24-14.05) and re-entry after abandonment (OR = 3.91; 95%CI 1.81-8.43)], smoking (OR = 3.93; 95%CI 1.98-7.79), and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15-8.99). The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo. Analisar a prevalência e fatores associados à tuberculose resistente
The diarylquinoline TMC207 for multidrug-resistant tuberculosis
Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin; Patientia, Ramonde; Rustomjee, Roxana; Page-Shipp, Liesl; Pistorius, Christoffel; Krause, Rene; Bogoshi, Mampedi; Churchyard, Gavin; Venter, Amour; Allen, Jenny; Palomino, Juan Carlos; de Marez, Tine; van Heeswijk, Rolf P. G.; Lounis, Nacer; Meyvisch, Paul; Verbeeck, Johan; Parys, Wim; de Beule, Karel; Andries, Koen; Mc Neeley, David F.
2009-01-01
BACKGROUND: The diarylquinoline TMC207 offers a new mechanism of antituberculosis action by inhibiting mycobacterial ATP synthase. TMC207 potently inhibits drug-sensitive and drug-resistant Mycobacterium tuberculosis in vitro and shows bactericidal activity in patients who have drug-susceptible
Risk factors for multidrug resistant tuberculosis patients in Amhara ...
African Journals Online (AJOL)
Risk factors for multidrug resistant tuberculosis patients in Amhara National ... risk factors of MDR-TB patients in Amhara National Regional State, Ethiopia. ... strict adherence to directly observed therapy, appropriate management of TB ...
Multidrug-Resistant Tuberculosis and Culture Conversion with Bedaquiline
Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin P.; de Los Rios, Jorge M.; Gotuzzo, Eduardo; Vasilyeva, Irina; Leimane, Vaira; Andries, Koen; Bakare, Nyasha; de Marez, Tine; Haxaire-Theeuwes, Myriam; Lounis, Nacer; Meyvisch, Paul; de Paepe, Els; van Heeswijk, Rolf P. G.; Dannemann, Brian; Rolla, Valeria; Dalcomo, Margreth; Gripp, Karla; Escada, Rodrigo; Tavares, Isabel; Borga, Liamar; Thomas, Aleyamma; Rekha, Banu; Nair, Dina; Chandrasekar, Chockalingam; Parthasarathy, Ramavaran Thiruvengadaraj; Sekhar, Gomathi; Ganesh, Krishnamoorthy; Rajagopalan, Krishnakumar; Rajapandian, Gangadevi; Dorairajalu, Rajendran; Sharma, Surendra Kumar; Banavaliker, Jayant; Kadhiravan, Tamilarasu; Gulati, Vinay; Mahmud, Hanif; Gupta, Arvind; Bhatnagar, Anuj; Jain, Vipin; Hari, Smriti; Gupta, Yogesh Kumar; Vaid, Ashok; Cirule, Andra; Dravniece, Gunta; Skripconoka, Vija; Kuksa, Liga; Kreigere, Edite; Ramos, Carlos Rafael Seas; Amat y Leon, Ivan Arapovic
2014-01-01
BACKGROUND Bedaquiline (Sirturo, TMC207), a diarylquinoline that inhibits mycobacterial ATP synthase, has been associated with accelerated sputum-culture conversion in patients with multidrug-resistant tuberculosis, when added to a preferred background regimen for 8 weeks. METHODS In this phase 2b
Emergence and spread of a human-transmissible multidrug-resistant nontuberculous mycobacterium
DEFF Research Database (Denmark)
Bryant, Josephine M; Grogono, Dorothy M; Rodriguez-Rincon, Daniela
2016-01-01
Lung infections with Mycobacterium abscessus, a species of multidrug-resistant nontuberculous mycobacteria, are emerging as an important global threat to individuals with cystic fibrosis (CF), in whom M. abscessus accelerates inflammatory lung damage, leading to increased morbidity and mortality....
Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay
2018-01-01
Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors
Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D
2014-10-01
There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.
Risk factors associated with multidrug resistant tuberculosis among ...
African Journals Online (AJOL)
Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...
Genotypes of Mycobacterium tuberculosis in patients at risk of drug resistance in Bolivia.
Monteserin, Johana; Camacho, Mirtha; Barrera, Lucía; Palomino, Juan Carlos; Ritacco, Viviana; Martin, Anandi
2013-07-01
Bolivia ranks among the 10 Latin American countries with the highest rates of tuberculosis (TB) and multidrug resistant (MDR) TB. In view of this, and of the lacking information on the population structure of Mycobacterium tuberculosis in the country, we explored genotype associations with drug resistance and clustering by analyzing isolates collected in 2010 from 100 consecutive TB patients at risk of drug resistance in seven of the nine departments in which Bolivia is divided. Fourteen isolates were MDR, 29 had other drug resistance profiles, and 57 were pansusceptible. Spoligotype family distribution was: Haarlem 39.4%, LAM 26.3%, T 22.2%, S 2.0%, X 1.0%, orphan 9.1%, with very low intra-family diversity and absence of Beijing genotypes. We found 66 different MIRU-VNTR patterns; the most frequent corresponded to Multiple Locus Variable Analysis (MLVA) MtbC15 patterns 860, 372 and 873. Twelve clusters, each with identical MIRU-VNTR and spoligotypes, gathered 35 patients. We found no association of genotype with drug resistant or MDR-TB. Clustering associated with SIT 50 and the H3 subfamily to which it belongs (pBolivia. However, results should be taken cautiously because the sample is small and includes a particular subset of M. tuberculosis population. Copyright © 2013 Elsevier B.V. All rights reserved.
High prevalence of multidrug resistant tuberculosis in Djibouti: a retrospective study.
Boyer-Cazajous, Géraldine; Martinaud, Christophe; Déhan, Céline; Hassan, Mohammed Osman; Gaas, Yassin; Chenilleau-Vidal, Marie-Caroline; Soler, Charles
2014-02-13
The Republic of Djibouti is an African country that exhibits one of the highest incidence rate of tuberculosis in the world. The aim of this study was to evaluate the prevalence of multidrug-resistant tuberculosis among new cases. We studied retrospectively every tuberculosis case diagnosed over a 12-month period in patients hospitalized at the French Military Hospital of Bouffard. During this period, 1,274 samples from 675 patients were tested. We isolated 266 mycobacteria corresponding to 180 cases of tuberculosis. Thirty-three were fully susceptible and 57% met the tuberculosis criteria, with 46% primary resistance. No extensively-drug-resistant tuberculosis was found. Our results highlight a major concern about the situation in this part of the world.
Directory of Open Access Journals (Sweden)
Nafees Ahmad
2016-01-01
Conclusion: The high degree of drug resistance observed, particularly to fluoroquinolones, is alarming. We recommend the adoption of more restrictive policies to control non-prescription sale of fluoroquinolones, its rational use by physicians, and training doctors in both private and public–private mix sectors to prevent further increase in fluoroquinolones resistant Mycobacterium tuberculosis strains.
Yari, Shamsi; Hadizadeh Tasbiti, Alireza; Ghanei, Mostafa; Shokrgozar, Mohammad Ali; Fateh, Abolfazl; Mahdian, Reza; Yari, Fatemeh; Bahrmand, Ahmadreza
2017-01-01
Multidrug-resistant tuberculosis (MDR-TB) is a form of TB caused by Mycobacterium tuberculosis (M. tuberculosis) that do not respond to, at least, isoniazid and rifampicin, the two most powerful, first-line (or standard) anti-TB drugs. Novel intervention strategies for eliminating this disease were based on finding proteins that can be used for designing new drugs or new and reliable kits for diagnosis. The aim of this study was to compare the protein profiles of MDR-TB with sensitive isolates. Proteomic analysis of M. tuberculosis MDR-TB and sensitive isolates was obtained with ion exchange chromatography coupled with MALDI-TOF-TOF (matrix-assisted laser desorption/ionization) in order to identify individual proteins that have different expression in MDR-TB to be used as a drug target or diagnostic marker for designing valuable TB vaccines or TB rapid tests. We identified eight proteins in MDR-TB isolates, and analyses showed that these proteins are absent in M. tuberculosis-sensitive isolates: (Rv2140c, Rv0009, Rv1932, Rv0251c, Rv2558, Rv1284, Rv3699 and MMP major membrane proteins). These data will provide valuable clues in further investigation for suitable TB rapid tests or drug targets against drug-resistant and sensitive M. tuberculosis isolates.
Directory of Open Access Journals (Sweden)
A K Maurya
2013-01-01
Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.
Directory of Open Access Journals (Sweden)
Gerard de Vries
2017-04-01
Full Text Available Abstract Background In the European Union and European Economic Area only 38% of multidrug-resistant tuberculosis patients notified in 2011 completed treatment successfully at 24 months’ evaluation. Socio-economic factors and patient factors such as demographic characteristics, behaviour and attitudes are associated with treatment outcomes. Characteristics of healthcare systems also affect health outcomes. This study was conducted to identify and better understand the contribution of health system components to successful treatment of multidrug-resistant tuberculosis. Methods We selected four European Union countries to provide for a broad range of geographical locations and levels of treatment success rates of the multidrug-resistant tuberculosis cohort in 2009. We conducted semi-structured interviews following a conceptual framework with representatives from policy and planning authorities, healthcare providers and civil society organisations. Responses were organised according to the six building blocks of the World Health Organization health systems framework. Results In the four included countries, Austria, Bulgaria, Spain, and the United Kingdom, the following healthcare system factors were perceived as key to achieving good treatment results for patients with multidrug-resistant tuberculosis: timely diagnosis of drug-resistant tuberculosis; financial systems that ensure access to a full course of treatment and support for multidrug-resistant tuberculosis patients; patient-centred approaches with strong intersectoral collaboration that address patients’ emotional and social needs; motivated and dedicated healthcare workers with sufficient mandate and means to support patients; and cross-border management of multidrug-resistant tuberculosis to secure continuum of care between countries. Conclusion We suggest that the following actions may improve the success of treatment for multidrug-resistant tuberculosis patients: deployment of
Mnyambwa, Nicholaus Peter; Kim, Dong-Jin; Ngadaya, Esther; Chun, Jongsik; Ha, Sung-Min; Petrucka, Pammla; Addo, Kennedy Kwasi; Kazwala, Rudovick R; Mfinanga, Sayoki G
2018-04-24
Mycobacterium yongonense is a recently described novel species belonging to Mycobacterium avium complex which is the most prevalent etiology of non-tuberculous mycobacteria associated with pulmonary infections, and posing tuberculosis diagnostic challenges in high-burden, resource-constrained settings. We used whole genome shotgun sequencing and comparative microbial genomic analyses to characterize the isolate from a patient diagnosed with multi-drug resistant tuberculosis (MDR-TB) after relapse. We present a genome sequence of the first case of M. yongonense (M. yongonense RT 955-2015) in Tanzania. Sequence analysis revealed that the RT 955-2015 strain had a high similarity to M. yongonense 05-1390(T) (98.74%) and M. chimaera DSM 44623(T) (98%). Its 16S rRNA showed similarity to M. paraintracellulare KCTC 290849(T) (100%); M. intracellulare ATCC 13950(T) (100%); M. chimaera DSM 44623(T) (99.9%); and M. yongonense 05-1390(T) (98%). The strain had a substantially different rpoB sequence from that of M. yongonense 05-1390 (95.16%) but exhibited a sequence closely related to M. chimaera DSM 44623(T) (99.86%), M. intracellulare ATCC 13950(T) (99.53%), and M. paraintracellulare KCTC 290849(T) (99.53%). In light of the OrthoANI algorithm, and phylogenetic analysis, we conclude that the isolate was M. yongonense Type II genotype, which is an indication that the patient was misdiagnosed with TB/MDR-TB and received inappropriate treatment. Copyright © 2018. Published by Elsevier Ltd.
Manning, Thomas; Mikula, Rachel; Wylie, Greg; Phillips, Dennis; Jarvis, Jackie; Zhang, Fengli
2015-02-01
The bacterium responsible for tuberculosis is increasing its resistance to antibiotics resulting in new multidrug-resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB). In this study, several analytical techniques including NMR, FT-ICR, MALDI-MS, LC-MS and UV/Vis are used to study the copper-Rifampicin-Polyethylene glycol (PEG-3350) complex. The copper (II) cation is a carrier for the antibiotic Rifampicin as well as nutrients for the bacterium. The NIH-NIAID cell line containing several Tb strains (including antibiotic resistant strains) is tested against seven copper-PEG-RIF complex variations. Copyright © 2014 Elsevier Ltd. All rights reserved.
Clarithromycin increases linezolid exposure in multidrug-resistant tuberculosis patients
Bolhuis, Mathieu S.; van Altena, Richard; van Soolingen, Dick; de Lange, Wiel C. M.; Uges, Donald R. A.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.
2013-01-01
The use of linezolid for the treatment of multidrug-resistant tuberculosis is limited by dose-and time-dependent toxicity. Recently, we reported a case of pharmacokinetic drug drug interaction between linezolid and clarithromycin that resulted in increased linezolid exposure. The aim of this
Beijing/W genotype Mycobacterium tuberculosis and drug resistance.
Glynn, Judith R; Kremer, Kristin; Borgdorff, Martien W; Rodriguez, Mar Pujades; Soolingen, Dick van
2006-01-01
Beijing/W genotype Mycobacterium tuberculosis is widespread, may be increasing, and may have a predilection for drug resistance. Individual-level data on >29,000 patients from 49 studies in 35 countries were combined to assess the Beijing genotype's prevalence worldwide, trends over time and with
Bedaquiline in the multidrug-resistant tuberculosis treatment: Belarus experience
Directory of Open Access Journals (Sweden)
Alena Skrahina
2016-01-01
Conclusion: Our interim results on safety and effectiveness of bedaquiline-containing regimens in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB patients are encouraging. They will add value to understanding role and place of this new anti-TB drug in M/XDR-TB treatment.
Associations between Mycobacterium tuberculosis Strains and Phenotypes
Brown, Timothy; Nikolayevskyy, Vladyslav; Velji, Preya
2010-01-01
To inform development of tuberculosis (TB) control strategies, we characterized a total of 2,261 Mycobacterium tuberculosis complex isolates by using multiple phenotypic and molecular markers, including polymorphisms in repetitive sequences (spoligotyping and variable-number tandem repeats [VNTRs]) and large sequence and single-nucleotide polymorphisms. The Beijing family was strongly associated with multidrug resistance (p = 0.0001), and VNTR allelic variants showed strong associations with spoligotyping families: >5 copies at exact tandem repeat (ETR) A, >2 at mycobacterial interspersed repetitive unit 24, and >3 at ETR-B associated with the East African–Indian and M. bovis strains. All M. tuberculosis isolates were differentiated into 4 major lineages, and a maximum parsimony tree was constructed suggesting a more complex phylogeny for M. africanum. These findings can be used as a model of pathogen global diversity. PMID:20113558
Aung, Wah Wah; Ei, Phyu Win; Nyunt, Wint Wint; Swe, Thyn Lei; Lwin, Thandar; Htwe, Mi Mi; Kim, Kyung Jun; Lee, Jong Seok; Kim, Chang Ki; Cho, Sang Nae; Song, Sun Dae; Chang, Chulhun L
2015-09-01
Tuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar. We determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid). Of 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01). The results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.
Millán-Lou, M I; Ollé-Goig, J E; Tortola, M T; Martin, C; Samper, S
2016-02-01
On detecting a high prevalence of multidrug-resistant tuberculosis (TB) in Djibouti, 32 Mycobacterium tuberculosis isolates of patients hospitalised in the TB referral centre of the capital were genotyped. A high variety of M. tuberculosis lineages, including lineage 1, Indo-Oceanic, lineage 2, East-Asian, lineage 3, East-African Indian and lineage 4, Euro-American, were detected.
Keijzer, J. de; Haas, P.E. de; Ru, A.H. de; Veelen, P.A. van; Soolingen, D. van
2014-01-01
The Mycobacterium tuberculosis Beijing genotype, consisting of the more ancient (atypical) and modern (typical) emerging sublineage, is one of the most prevalent and genetically conserved genotype families and has often been associated with multidrug resistance. In this study, we employed a
Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan
2018-01-01
An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751
Disinfectant-susceptibility of multi-drug-resistant Mycobacterium tuberculosis isolated in Japan
Directory of Open Access Journals (Sweden)
Noriko Shinoda
2016-02-01
Full Text Available Abstract Background Multi-drug-resistant Mycobacterium tuberculosis has been an important problem in public health around the world. However, limited information about disinfectant-susceptibility of multi-drug-resistant strain of M. tuberculosis was available. Findings We studied susceptibility of several Japanese isolates of multi-drug-resistant M. tuberculosis against disinfectants, which are commonly used in clinical and research laboratories. We selected a laboratory reference strain (H37Rv and eight Japanese isolates, containing five drug-susceptible strains and three multi-drug-resistant strains, and determined profiles of susceptibility against eight disinfectants. The M. tuberculosis strains were distinguished into two groups by the susceptibility profile. There was no relationship between multi-drug-resistance and disinfectant-susceptibility in the M. tuberculosis strains. Cresol soap and oxydol were effective against all strains we tested, regardless of drug resistance. Conclusions Disinfectant-resistance is independent from multi-drug-resistance in M. tuberculosis. Cresol soap and oxydol were effective against all strains we tested, regardless of drug resistance.
Vale, Nuno; Correia, Alexandra; Silva, Sara; Figueiredo, Patrícia; Mäkilä, , Ermei; Salonen, Jarno; Hirvonen, Jouni; Pedrosa, Jorge; Santos Hélder A.; Fraga, Alexandra
2017-01-01
Ethionamide (ETH) is an important second-line antituberculosis drug used for the treatment of patients infected with multidrug-resistant Mycobacterium tuberculosis. Recently, we reported that the loading of ETH into thermally carbonized-porous silicon (TCPSi) nanoparticles enhanced the solubility and permeability of ETH at different pH-values and also increased its metabolization process. Based on these results, we synthesized carboxylic acid functionalized thermally hydrocarbonized porous si...
Directory of Open Access Journals (Sweden)
Courtney M Yuen
Full Text Available BACKGROUND: Development of resistance to antituberculosis drugs during treatment (i.e., acquired resistance can lead to emergence of resistant strains and consequent poor clinical outcomes. However, it is unknown whether Mycobacterium tuberculosis complex species and lineage affects the likelihood of acquired resistance. METHODS: We analyzed data from the U.S. National Tuberculosis Surveillance System and National Tuberculosis Genotyping Service for tuberculosis cases during 2004-2011 with assigned species and lineage and both initial and final drug susceptibility test results. We determined univariate associations between species and lineage of Mycobacterium tuberculosis complex bacteria and acquired resistance to isoniazid, rifamycins, fluoroquinolones, and second-line injectables. We used Poisson regression with backward elimination to generate multivariable models for acquired resistance to isoniazid and rifamycins. RESULTS: M. bovis was independently associated with acquired resistance to isoniazid (adjusted prevalence ratio = 8.46, 95% CI 2.96-24.14 adjusting for HIV status, and with acquired resistance to rifamycins (adjusted prevalence ratio = 4.53, 95% CI 1.29-15.90 adjusting for homelessness, HIV status, initial resistance to isoniazid, site of disease, and administration of therapy. East Asian lineage was associated with acquired resistance to fluoroquinolones (prevalence ratio = 6.10, 95% CI 1.56-23.83. CONCLUSIONS: We found an association between mycobacterial species and lineage and acquired drug resistance using U.S. surveillance data. Prospective clinical studies are needed to determine the clinical significance of these findings, including whether rapid genotyping of isolates at the outset of treatment may benefit patient management.
Vera-Cabrera, Lucio; Gonzalez, Eva; Rendon, Adrian; Ocampo-Candiani, Jorge; Welsh, Oliverio; Velazquez-Moreno, Victor M; Choi, Sung Hak; Molina-Torres, Carmen
2006-09-01
The in vitro activities of DA-7157, a novel oxazolidinone, against clinical isolates of Nocardia brasiliensis and Mycobacterium tuberculosis were determined. Equal MIC(50)s and MIC(90)s (0.25 and 0.5 microg/ml, respectively) were found for susceptible and multidrug-resistant isolates of M. tuberculosis. The N. brasiliensis isolates showed an MIC(90) of 1 microg/ml and an MIC(50) of 1 microg/ml. The DA-7157 prodrug, DA-7218, exhibited similar MICs for M. tuberculosis but fivefold-higher MICs for N. brasiliensis.
Millet, J; Berchel, M; Prudenté, F; Streit, E; Bomer, A-G; Schuster, F; Vanhomwegen, J; Paasch, D; Galbert, I; Valery, E; Aga, R; Rastogi, N
2014-05-01
This is the first overview on resistant and multidrug resistant isolates of Mycobacterium tuberculosis circulating in the French Department of the Americas (Guadeloupe, Martinique, and French Guiana) over 17 years (January 1995-December 2011). A total of 1,239 cases were studied: 1,199 new cases (primary and multidrug resistance of 11.8 and 1.6% respectively), and 40 persistent (defined as cases with a previous history of positive culture over 6 months interval and whose spoligotypes remain unchanged), in which significantly higher proportions of resistance to at least isoniazid (22.5%, P = 0.002), rifampicin (20.0%, P < 0.001), and multidrug resistance (17.5%, P < 0.001) were observed as compared to new cases. The 281 spoligotypes obtained showed the presence of five major lineages, T (29.9%), LAM (23.9%), Haarlem (22.1%), EAI (7.1%), and X (6.7%). Two of these lineages, X and LAM, predominate among resistant and multidrug resistant isolates respectively (X: 10.5% of resistant isolates, P = 0.04; LAM: 42.3% of multidrug resistant isolates, P = 0.02). Four of the 19 major spoligo-profiles, corresponding to SIT 20, 64, 45, and 46, were significantly associated with drug resistance. Among them, genotype SIT 20, associated with monoresistance to isoniazid and multidrug resistance, would be actively and persistently in circulation, since 1999, in French Guiana, department in which one may also observe the presence of strains of M. tuberculosis phylogeographically associated to Guiana and Suriname (SIT 131 and SIT 1340).
Disratthakit, Areeya; Meada, Shinji; Prammananan, Therdsak; Thaipisuttikul, Iyarit; Doi, Norio; Chaiprasert, Angkana
2015-06-01
Drug-resistant tuberculosis (TB), which includes multidrug-resistant (MDR-TB), quinolone-resistant (QR-TB) and extensively drug-resistant tuberculosis (XDR-TB), is a serious threat to TB control. We aimed to characterize the genotypic diversity of drug-resistant TB clinical isolates collected in Thailand to establish whether the emergence of drug-resistant TB is attributable to transmitted resistance or acquired resistance. We constructed the first molecular phylogeny of MDR-TB (n=95), QR-TB (n=69) and XDR-TB (n=28) in Thailand based on spoligotyping and proposed 24-locus multilocus variable-number of tandem repeat analysis (MLVA). Clustering analysis was performed using the unweighted pair group method with arithmetic mean. Spoligotyping identified the Beijing strain (SIT1) as the most predominant genotype (n=139; 72.4%). The discriminatory power of 0.9235 Hunter-Gaston Discriminatory Index (HGDI) with the 15-locus variable-number tandem repeats of mycobacterial interspersed repetitive units typing was improved to a 0.9574 HGDI with proposed 24-locus MLVA, thereby resulting in the subdivision of a large cluster of Beijing strains (SIT1) into 17 subclusters. We identified the spread of drug-resistant TB clones caused by three different MLVA types in the Beijing strain (SIT1) and a specific clone of XDR-TB caused by a rare genotype, the Manu-ancestor strain (SIT523). Overall, 49.5% of all isolates were clustered. These findings suggest that a remarkable transmission of drug-resistant TB occurred in Thailand. The remaining 50% of drug-resistant TB isolates were unique genotypes, which may have arisen from the individual acquisition of drug resistance. Our results suggest that transmitted and acquired resistance have played an equal role in the emergence of drug-resistant TB. Further characterization of whole genome sequences of clonal strains could help to elucidate the mycobacterial genetic factors relevant for drug resistance, transmissibility and virulence
The Association between Mycobacterium Tuberculosis Genotype and Drug Resistance in Peru.
Directory of Open Access Journals (Sweden)
Louis Grandjean
Full Text Available The comparison of Mycobacterium tuberculosis bacterial genotypes with phenotypic, demographic, geospatial and clinical data improves our understanding of how strain lineage influences the development of drug-resistance and the spread of tuberculosis.To investigate the association of Mycobacterium tuberculosis bacterial genotype with drug-resistance. Drug susceptibility testing together with genotyping using both 15-loci MIRU-typing and spoligotyping, was performed on 2,139 culture positive isolates, each from a different patient in Lima, Peru. Demographic, geospatial and socio-economic data were collected using questionnaires, global positioning equipment and the latest national census.The Latin American Mediterranean (LAM clade (OR 2.4, p<0.001 was significantly associated with drug-resistance and alone accounted for more than half of all drug resistance in the region. Previously treated patients, prisoners and genetically clustered cases were also significantly associated with drug-resistance (OR's 2.5, 2.4 and 1.8, p<0.001, p<0.05, p<0.001 respectively.Tuberculosis disease caused by the LAM clade was more likely to be drug resistant independent of important clinical, genetic and socio-economic confounding factors. Explanations for this include; the preferential co-evolution of LAM strains in a Latin American population, a LAM strain bacterial genetic background that favors drug-resistance or the "founder effect" from pre-existing LAM strains disproportionately exposed to drugs.
Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia
Sagwa, Evans
2017-01-01
Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which
Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin
2017-11-06
Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.
Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong
2017-10-01
Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.
Perdigão, João
2014-11-18
Background Multidrug- (MDR) and extensively drug resistant (XDR) tuberculosis (TB) presents a challenge to disease control and elimination goals. In Lisbon, Portugal, specific and successful XDR-TB strains have been found in circulation for almost two decades. Results In the present study we have genotyped and sequenced the genomes of 56 Mycobacterium tuberculosis isolates recovered mostly from Lisbon. The genotyping data revealed three major clusters associated with MDR-TB, two of which are associated with XDR-TB. Whilst the genomic data contributed to elucidate the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of Mycobacterium tuberculosis clinical isolates, revealed two major clades responsible for M/XDR-TB in the region: Lisboa3 and Q1 (LAM). The data presented by this study yielded insights on microevolution and identification of novel compensatory mutations associated with rifampicin resistance in rpoB and rpoC. The screening for other structural variations revealed putative clade-defining variants. One deletion in PPE41, found among Lisboa3 isolates, is proposed to contribute to immune evasion and as a selective advantage. Insertion sequence (IS) mapping has also demonstrated the role of IS6110 as a major driver in mycobacterial evolution by affecting gene integrity and regulation. Conclusions Globally, this study contributes with novel genome-wide phylogenetic data and has led to the identification of new genomic variants that support the notion of a growing genomic diversity facing both setting and host adaptation.
Genotyping of rifampin-resistant Mycobacterium tuberculosis isolates from Western Turkey
International Nuclear Information System (INIS)
Cavasoglu, Cengiz; Bilgic, Altinay; Durmaz, Riza; Gunal, Selami
2004-01-01
Although the rate of multiple drug resistance is high there is no published data on the transmission rate of drug-resistant strains of Mycobacterium tuberculosis in the Aegean region of Western Turkey that are based on molecular methods. IS6110 and pTBN12 restriction fragment lengthpolymorphism (RFLP) methods were used for typing Mycobacterium tuberculosis isolated from 26 sputum samples from 26 patients. 19 of rifampin-resistant isolates (73.1%) contained 6 to 11 copies of 156110. Eighteen different IS6110 DNA fingerprint patterns were observed in the 26 rifampin resistant isolates. 23 of the 26 rifampin-resistant isolates were also resistant to isoniazid. When evaluated together, both methods yielded 21 (80.9%) different banding patterns and the level of clustering was 34.6%. The average number per pattern was 1.23 (26/21). IS6110 fingerprinting suggests that the rifampin-resistant isolates obtained from the Aegean region had a relatively high clustering rate and were clonally related. These findings showed that the rifampin-resistant isolates are actively transmitted between patients. Urgent measures should be taken to prevent the spread of these resistant strains. (author)
Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis
Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.
2014-01-01
Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of
Mohd Shariff, Noorsuzana; Shah, Shamsul Azhar; Kamaludin, Fadzilah
2016-03-01
The number of multidrug-resistant tuberculosis patients is increasing each year in many countries all around the globe. Malaysia has no exception in facing this burdensome health problem. We aimed to investigate the factors that contribute to the occurrence of multidrug-resistant tuberculosis among Malaysian tuberculosis patients. An unmatched case-control study was conducted among tuberculosis patients who received antituberculosis treatments from April 2013 until April 2014. Cases are those diagnosed as pulmonary tuberculosis patients clinically, radiologically, and/or bacteriologically, and who were confirmed to be resistant to both isoniazid and rifampicin through drug-sensitivity testing. On the other hand, pulmonary tuberculosis patients who were sensitive to all first-line antituberculosis drugs and were treated during the same time period served as controls. A total of 150 tuberculosis patients were studied, of which the susceptible cases were 120. Factors found to be significantly associated with the occurrence of multidrug-resistant tuberculosis are being Indian or Chinese (odds ratio 3.17, 95% confidence interval 1.04-9.68; and odds ratio 6.23, 95% confidence interval 2.24-17.35, respectively), unmarried (odds ratio 2.58, 95% confidence interval 1.09-6.09), living in suburban areas (odds ratio 2.58, 95% confidence interval 1.08-6.19), are noncompliant (odds ratio 4.50, 95% confidence interval 1.71-11.82), were treated previously (odds ratio 8.91, 95% confidence interval 3.66-21.67), and showed positive sputum smears at the 2nd (odds ratio 7.00, 95% confidence interval 2.46-19.89) and 6th months of treatment (odds ratio 17.96, 95% confidence interval 3.51-91.99). Living in suburban areas, positive sputum smears in the 2nd month of treatment, and was treated previously are factors that independently contribute to the occurrence of multidrug-resistant tuberculosis. Those with positive smears in the second month of treatment, have a history of previous
Amikacin Concentrations Predictive of Ototoxicity in Multidrug-Resistant Tuberculosis Patients.
Modongo, Chawangwa; Pasipanodya, Jotam G; Zetola, Nicola M; Williams, Scott M; Sirugo, Giorgio; Gumbo, Tawanda
2015-10-01
Aminoglycosides, such as amikacin, are used to treat multidrug-resistant tuberculosis. However, ototoxicity is a common problem and is monitored using peak and trough amikacin concentrations based on World Health Organization recommendations. Our objective was to identify clinical factors predictive of ototoxicity using an agnostic machine learning method. We used classification and regression tree (CART) analyses to identify clinical factors, including amikacin concentration thresholds that predicted audiometry-confirmed ototoxicity among 28 multidrug-resistant pulmonary tuberculosis patients in Botswana. Amikacin concentrations were measured for all patients. The quantitative relationship between predictive factors and the probability of ototoxicity were then identified using probit analyses. The primary predictors of ototoxicity on CART analyses were cumulative days of therapy, followed by cumulative area under the concentration-time curve (AUC), which improved on the primary predictor by 87%. The area under the receiver operating curve was 0.97 on the test set. Peak and trough were not predictors in any tree. When algorithms were forced to pick peak and trough as primary predictors, the area under the receiver operating curve fell to 0.46. Probit analysis revealed that the probability of ototoxicity increased sharply starting after 6 months of therapy to near maximum at 9 months. A 10% probability of ototoxicity occurred with a threshold cumulative AUC of 87,232 days · mg · h/liter, while that of 20% occurred at 120,000 days · mg · h/liter. Thus, cumulative amikacin AUC and duration of therapy, and not peak and trough concentrations, should be used as the primary decision-making parameters to minimize the likelihood of ototoxicity in multidrug-resistant tuberculosis. Copyright © 2015, Modongo et al.
Directory of Open Access Journals (Sweden)
Yonatan Moges Mesfin
Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral
Domínguez, J.; Boettger, E. C.; Cirillo, D.; Cobelens, F.; Eisenach, K. D.; Gagneux, S.; Hillemann, D.; Horsburgh, R.; Molina-Moya, B.; Niemann, S.; Tortoli, E.; Whitelaw, A.; Lange, C.
2016-01-01
The emergence of drug-resistant strains of Mycobacterium tuberculosis is a challenge to global tuberculosis (TB) control. Although culture-based methods have been regarded as the gold standard for drug susceptibility testing (DST), molecular methods provide rapid information on mutations in the M.
Phenothiazines as a solution for multidrug resistant tuberculosis
DEFF Research Database (Denmark)
Kristiansen, Jette E; Dastidar, Sujata G; Palchoudhuri, Shauroseni
2015-01-01
Historically, multiplicity of actions in synthetic compounds is a rule rather than exception. The science of non-antibiotics evolved in this background. From the antimalarial and antitrypanosomial dye methylene blue, chemically similar compounds, the phenothiazines, were developed. The phenothiaz...... thioridazine and its (-) form to be combined with other antitubercular drugs to treat infections by drug-resistant strains of Mycobacterium tuberculosis and try to eradicate this deadly disease. [Int Microbiol 2015; 18(1):1-12]....
International Nuclear Information System (INIS)
Syaifudin, M.
2010-01-01
An accurate identification of different species of Mycobacterium provides to allow appropriate treatment for Mycobacterium tuberculosis infection. Beside that, drug resistance of M. tuberculosis strains to rifampin is not clearly understood in contributing to the spread of tuberculosis in Indonesia. To assess the molecular mechanism of rifampin resistance, a number of clinical specimens of M. tuberculosis were analyzed their molecular nature of a part of the rpoB gene using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) methods. DNA's extracted from sputum samples were amplified and 32 P-labeled by PCR with the specific primers and the product was analyzed their mutation conferring resistance by MDE gel electrophoresis. Of the 70 specimens tested, 57 specimens were positive for M. tuberculosis organism only, three specimens contained a mixture of M. tuberculosis and non tuberculosis mycobacteria (NTM), and 10 specimens were negative approved by Duplex PCR. Of these sixty DNA positive samples (thus the sensitivity of PCR was 85.71%), 5 (8.3%) of them suspected to contain mutations in rpoB which were associated with rifampin resistance. Even though the frequency of mutation was low, the results from our study clearly indicate that the molecular mechanism of rifampin resistance in M. tuberculosis isolates from Indonesia involves alterations in the rpoB gene. Molecular diagnosis by PCR which is fast and easy to perform is useful for early and rapid detection of TB in sputum specimen. (author)
Clinical and Drug Resistance Characteristics of New Pediatric Tuberculosis Cases in Northern China.
Wang, Ting; Dong, Fang; Li, Qin-Jing; Yin, Qing-Qin; Song, Wen-Qi; Mokrousov, Igor; Jiao, Wei-Wei; Shen, A-Dong
2018-05-09
The aim of this study was to evaluate the clinical features and characteristics of drug resistance in newly diagnosed pediatric tuberculosis (TB) patients in northern China. Mycobacterium tuberculosis isolates were collected from September 2010 to October 2016 at the Beijing Children's Hospital. Patients were divided into two groups (resistant to at least one drug and pan-susceptible) according to drug susceptibility testing (DST) results. A total of 132 new cases, mainly from northern China (87.9%), were included in the study. The median age was 1.9 years (1 month-15 years). Resistance to at least one drug was detected in Mycobacterium tuberculosis isolates from 33 (25%) cases. Eight cases of multidrug-resistant TB (MDR-TB) (6.1%) were detected. The two groups did not differ in clinical presentations (disease site, fever >2 weeks, and cough >2 weeks) or in chest imaging (lesion location, lymphadenitis [mediastinal], and pleural effusion). The rate of Mycobacterium tuberculosis drug resistance in new pediatric TB cases was as high as in the new adult patients surveyed in the national drug resistance survey conducted in 2007. No significant difference was observed in clinical features between patients infected with drug-resistant and drug-susceptible strains. Routine DST is important for prescribing effective antituberculosis treatment regimens.
Rashid Ali, Muhammad Redzwan S.; Parameswaran, Uma; William, Timothy; Bird, Elspeth; Wilkes, Christopher S.; Lee, Wai Khew; Yeo, Tsin Wen; Anstey, Nicholas M.; Ralph, Anna P.
2015-01-01
Introduction. The burden of tuberculosis is high in eastern Malaysia, and rates of Mycobacterium tuberculosis drug resistance are poorly defined. Our objectives were to determine M. tuberculosis susceptibility and document management after receipt of susceptibility results. Methods. Prospective study of adult outpatients with smear-positive pulmonary tuberculosis (PTB) in Sabah, Malaysia. Additionally, hospital clinicians accessed the reference laboratory for clinical purposes during the study. Results. 176 outpatients were enrolled; 173 provided sputum samples. Mycobacterial culture yielded M. tuberculosis in 159 (91.9%) and nontuberculous Mycobacterium (NTM) in three (1.7%). Among outpatients there were no instances of multidrug resistant M. tuberculosis (MDR-TB). Seven people (4.5%) had isoniazid resistance (INH-R); all were switched to an appropriate second-line regimen for varying durations (4.5–9 months). Median delay to commencement of the second-line regimen was 13 weeks. Among 15 inpatients with suspected TB, 2 had multidrug resistant TB (one extensively drug resistant), 2 had INH-R, and 4 had NTM. Conclusions. Current community rates of MDR-TB in Sabah are low. However, INH-resistance poses challenges, and NTM is an important differential diagnosis in this setting, where smear microscopy is the usual diagnostic modality. To address INH-R management issues in our setting, we propose an algorithm for the treatment of isoniazid-resistant PTB. PMID:25838829
Genome-wide re-sequencing of multidrug-resistant Mycobacterium leprae Airaku-3.
Singh, P; Benjak, A; Carat, S; Kai, M; Busso, P; Avanzi, C; Paniz-Mondolfi, A; Peter, C; Harshman, K; Rougemont, J; Matsuoka, M; Cole, S T
2014-10-01
Genotyping and molecular characterization of drug resistance mechanisms in Mycobacterium leprae enables disease transmission and drug resistance trends to be monitored. In the present study, we performed genome-wide analysis of Airaku-3, a multidrug-resistant strain with an unknown mechanism of resistance to rifampicin. We identified 12 unique non-synonymous single-nucleotide polymorphisms (SNPs) including two in the transporter-encoding ctpC and ctpI genes. In addition, two SNPs were found that improve the resolution of SNP-based genotyping, particularly for Venezuelan and South East Asian strains of M. leprae. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.
Genome-wide analysis of multi- and extensively drug-resistant Mycobacterium tuberculosis
Coll, Francesc; Phelan, Jody; Hill-Cawthorne, Grant A.; Nair, Mridul; Mallard, Kim; Ali, Shahjahan; Abdallah, Abdallah; Alghamdi, Saad; Alsomali, Mona; Ahmed, Abdallah O.; Portelli, Stephanie; Oppong, Yaa; Alves, Adriana; Bessa, Theolis Barbosa; Campino, Susana; Caws, Maxine; Chatterjee, Anirvan; Crampin, Amelia C.; Dheda, Keertan; Furnham, Nicholas; Glynn, Judith R.; Grandjean, Louis; Minh Ha, Dang; Hasan, Rumina; Hasan, Zahra; Hibberd, Martin L.; Joloba, Moses; Jones-Ló pez, Edward C.; Matsumoto, Tomoshige; Miranda, Anabela; Moore, David J.; Mocillo, Nora; Panaiotov, Stefan; Parkhill, Julian; Penha, Carlos; Perdigã o, Joã o; Portugal, Isabel; Rchiad, Zineb; Robledo, Jaime; Sheen, Patricia; Shesha, Nashwa Talaat; Sirgel, Frik A.; Sola, Christophe; Oliveira Sousa, Erivelton; Streicher, Elizabeth M.; Helden, Paul Van; Viveiros, Miguel; Warren, Robert M.; McNerney, Ruth; Pain, Arnab; Clark, Taane G.
2018-01-01
To characterize the genetic determinants of resistance to antituberculosis drugs, we performed a genome-wide association study (GWAS) of 6,465 Mycobacterium tuberculosis clinical isolates from more than 30 countries. A GWAS approach within a mixed
In vitro and in vivo activities of the nitroimidazole TBA-354 against Mycobacterium tuberculosis.
Upton, A M; Cho, S; Yang, T J; Kim, Y; Wang, Y; Lu, Y; Wang, B; Xu, J; Mdluli, K; Ma, Z; Franzblau, S G
2015-01-01
Nitroimidazoles are a promising new class of antitubercular agents. The nitroimidazo-oxazole delamanid (OPC-67683, Deltyba) is in phase III trials for the treatment of multidrug-resistant tuberculosis, while the nitroimidazo-oxazine PA-824 is entering phase III for drug-sensitive and drug-resistant tuberculosis. TBA-354 (SN31354[(S)-2-nitro-6-((6-(4-trifluoromethoxy)phenyl)pyridine-3-yl)methoxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine]) is a pyridine-containing biaryl compound with exceptional efficacy against chronic murine tuberculosis and favorable bioavailability in preliminary rodent studies. It was selected as a potential next-generation antituberculosis nitroimidazole following an extensive medicinal chemistry effort. Here, we further evaluate the pharmacokinetic properties and activity of TBA-354 against Mycobacterium tuberculosis. TBA-354 is narrow spectrum and bactericidal in vitro against replicating and nonreplicating Mycobacterium tuberculosis, with potency similar to that of delamanid and greater than that of PA-824. The addition of serum protein or albumin does not significantly alter this activity. TBA-354 maintains activity against Mycobacterium tuberculosis H37Rv isogenic monoresistant strains and clinical drug-sensitive and drug-resistant isolates. Spontaneous resistant mutants appear at a frequency of 3 × 10(-7). In vitro studies and in vivo studies in mice confirm that TBA-354 has high bioavailability and a long elimination half-life. In vitro studies suggest a low risk of drug-drug interactions. Low-dose aerosol infection models of acute and chronic murine tuberculosis reveal time- and dose-dependent in vivo bactericidal activity that is at least as potent as that of delamanid and more potent than that of PA-824. Its superior potency and pharmacokinetic profile that predicts suitability for once-daily oral dosing suggest that TBA-354 be studied further for its potential as a next-generation nitroimidazole. Copyright © 2015, American
Directory of Open Access Journals (Sweden)
Arax Hovhannesyan
2012-06-01
Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5-17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.
Directory of Open Access Journals (Sweden)
Arax Hovhannesyan
2012-01-01
Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5- 17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.
Directory of Open Access Journals (Sweden)
Jyoti Arora
2017-06-01
Full Text Available A total of 312 sputum samples from pediatric patients presumptive of multidrug resistant tuberculosis were tested for the detection of drug resistance using the GenoTypeMTBDRplus assay. A total of 193 (61.8% patients were smear positive and 119 (38.1% were smear negative by Ziehl–Neelsen staining. Line probe assay (LPA was performed for 208 samples/cultures (193 smear positive samples and 15 cultures from smear negative samples. Valid results were obtained from 198 tests. Of these, 125/198 (63.1% were sensitive to both rifampicin (RIF and isoniazid (INH. 73/198 (36.9% were resistant to at least INH/RIF, out of which 49 (24.7% were resistant to both INH and RIF (multidrug resistant. Children with tuberculosis are often infected by someone close to them, so strengthening of contact tracing in the program may help in early diagnosis to identify additional cases within the household. There is a need to evaluate newer diagnostic assays which have a high sensitivity in the case of smear negative samples, additional samples other than sputum among young children not able to expectorate, and also to fill the gap between estimated and reported cases under the program.
Directory of Open Access Journals (Sweden)
G. V. Panov
2015-01-01
Full Text Available The paper characterizes drug susceptibility in Mycobacterium tuberculosis isolated from new cases of tuberculosis concurrent with HIV infection. The investigators have studied the spectrum of drug resistance in Mycobacterium tuberculosis isolated from new cases of tuberculosis concurrent with and without HIV infection (172 and 309 clinical isolates, respectively. There are differences in the rate of primary drug resistance to antituberculosis drugs in patients with and without HIV infection (59 and 43.5% of the cases, respectively. The HIV-infected have also shown high rifampicin resistance rates in Mycobacterium tuberculosis (41.7%. The reasons for these differences are as yet unknown and call for further investigation.
Modelling the Transitional Dynamics of Mycobacterium Tuberculosis ...
African Journals Online (AJOL)
The World Health Organization's targets of eliminating Tuberculosis (TB) by 2050 is challenged by the emergence and spread of drug resistance TB. However, the traditional mechanism of resistance is that of acquired resistance, whereby the mycobacterium Tuberculosis (MTB) strain develops mutations under selective ...
Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C
2012-01-01
Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.
Aggressive Regimens for Multidrug-Resistant Tuberculosis Reduce Recurrence
Franke, Molly F.; Appleton, Sasha C.; Mitnick, Carole D.; Furin, Jennifer J.; Bayona, Jaime; Chalco, Katiuska; Shin, Sonya; Murray, Megan; Becerra, Mercedes C.
2013-01-01
Background. Recurrent tuberculosis disease occurs within 2 years in as few as 1% and as many as 29% of individuals successfully treated for multidrug-resistant (MDR) tuberculosis. A better understanding of treatment-related factors associated with an elevated risk of recurrent tuberculosis after cure is urgently needed to optimize MDR tuberculosis therapy. Methods. We conducted a retrospective cohort study among adults successfully treated for MDR tuberculosis in Peru. We used multivariable Cox proportional hazards regression analysis to examine whether receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion from positive to negative was associated with a reduced rate of recurrent tuberculosis. Results. Among 402 patients, the median duration of follow-up was 40.5 months (interquartile range, 21.2–53.4). Receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion was associated with a lower risk of recurrent tuberculosis (hazard ratio, 0.40 [95% confidence interval, 0.17–0.96]; P = .04). A baseline diagnosis of diabetes mellitus also predicted recurrent tuberculosis (hazard ratio, 10.47 [95% confidence interval, 2.17–50.60]; P = .004). Conclusions. Individuals who received an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion experienced a lower rate of recurrence after cure. Efforts to ensure that an aggressive regimen is accessible to all patients with MDR tuberculosis, such as minimization of sequential ineffective regimens, expanded drug access, and development of new MDR tuberculosis compounds, are critical to reducing tuberculosis recurrence in this population. Patients with diabetes mellitus should be carefully managed during initial treatment and followed closely for recurrent disease. PMID:23223591
Genetic Determinants of Drug Resistance in Mycobacterium tuberculosis and Their Diagnostic Value
Farhat, M.R.; Sultana, R.; Iartchouk, O.; Bozeman, S.; Galagan, J.; Sisk, P.; Stolte, C.; Nebenzahl-Guimaraes, H.; Jacobson, K.; Sloutsky, A.; Kaur, D.; Posey, J.; Kreiswirth, B.N.; Kurepina, N.; Rigouts, L.; Streicher, E.M.; Victor, T.C.; Warren, R.M.; Soolingen, D. van; Murray, M.
2016-01-01
RATIONALE: The development of molecular diagnostics that detect both the presence of Mycobacterium tuberculosis in clinical samples and drug resistance-conferring mutations promises to revolutionize patient care and interrupt transmission by ensuring early diagnosis. However, these tools require the
Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi
2017-06-01
In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.
Drug-resistant tuberculosis: time for visionary political leadership.
Abubakar, Ibrahim; Zignol, Matteo; Falzon, Dennis; Raviglione, Mario; Ditiu, Lucica; Masham, Susan; Adetifa, Ifedayo; Ford, Nathan; Cox, Helen; Lawn, Stephen D; Marais, Ben J; McHugh, Timothy D; Mwaba, Peter; Bates, Matthew; Lipman, Marc; Zijenah, Lynn; Logan, Simon; McNerney, Ruth; Zumla, Adam; Sarda, Krishna; Nahid, Payam; Hoelscher, Michael; Pletschette, Michel; Memish, Ziad A; Kim, Peter; Hafner, Richard; Cole, Stewart; Migliori, Giovanni Battista; Maeurer, Markus; Schito, Marco; Zumla, Alimuddin
2013-06-01
Two decades ago, WHO declared tuberculosis a global emergency, and invested in the highly cost-effective directly observed treatment short-course programme to control the epidemic. At that time, most strains of Mycobacterium tuberculosis were susceptible to first-line tuberculosis drugs, and drug resistance was not a major issue. However, in 2013, tuberculosis remains a major public health concern worldwide, with prevalence of multidrug-resistant (MDR) tuberculosis rising. WHO estimates roughly 630 000 cases of MDR tuberculosis worldwide, with great variation in the frequency of MDR tuberculosis between countries. In the past 8 years, extensively drug-resistant (XDR) tuberculosis has emerged, and has been reported in 84 countries, heralding the possibility of virtually untreatable tuberculosis. Increased population movement, the continuing HIV pandemic, and the rise in MDR tuberculosis pose formidable challenges to the global control of tuberculosis. We provide an overview of the global burden of drug-resistant disease; discuss the social, health service, management, and control issues that fuel and sustain the epidemic; and suggest specific recommendations for important next steps. Visionary political leadership is needed to curb the rise of MDR and XDR tuberculosis worldwide, through sustained funding and the implementation of global and regional action plans. Copyright © 2013 World Health Organization. Published by Elsevier Ltd/Inc/BV. All rights reserved. Published by Elsevier Ltd. All rights reserved.
Unusual Complication of Multidrug Resistant Tuberculosis
Directory of Open Access Journals (Sweden)
Prerna Sharma
2017-01-01
Full Text Available Introduction. Capreomycin is a second-line drug often used for multidrug-resistant tuberculosis which can result in nephrotoxic effects similar to other aminoglycosides. We describe a case of capreomycin induced Bartter-like syndrome with hypocalcemic tetany. Case Report. 23-year-old female patient presented with carpopedal spasms and tingling sensations in hands. Patient was being treated with capreomycin for two months for tuberculosis. On further investigation, hypocalcemia, hyponatremia, hypomagnesemia, hypokalemia, and hypochloremic metabolic alkalosis were noted. Vitamin D and serum PTH levels were within normal limits. Hypercalciuria was confirmed by urine calcium/creatinine ratio. Calcium, potassium, and magnesium supplementation was given and capreomycin was discontinued. Electrolytes normalized in two days after cessation of capreomycin with no further abnormalities on repeat investigations. Discussion. Aminoglycosides can result in renal tubular dysfunction leading to Fanconi syndrome, Bartter syndrome, and distal tubular acidosis. Impaired mitochondrial function in the tubular cells has been hypothesized as the possible cause of these tubulopathies. Acquired Bartter-like syndrome phenotypically resembles autosomal dominant type 5 Bartter syndrome. Treatment consists of correction of electrolyte abnormalities, indomethacin, and potassium-sparing diuretics. Prompt diagnosis and treatment of severe dyselectrolytemia are warranted in patients on aminoglycoside therapy.
Namouchi, Amine; Cimino, Mena; Favre-Rochex, Sandrine; Charles, Patricia; Gicquel, Brigitte
2017-07-13
Tuberculosis (TB) is caused by Mycobacterium tuberculosis and represents one of the major challenges facing drug discovery initiatives worldwide. The considerable rise in bacterial drug resistance in recent years has led to the need of new drugs and drug regimens. Model systems are regularly used to speed-up the drug discovery process and circumvent biosafety issues associated with manipulating M. tuberculosis. These include the use of strains such as Mycobacterium smegmatis and Mycobacterium marinum that can be handled in biosafety level 2 facilities, making high-throughput screening feasible. However, each of these model species have their own limitations. We report and describe the first complete genome sequence of Mycobacterium aurum ATCC23366, an environmental mycobacterium that can also grow in the gut of humans and animals as part of the microbiota. This species shows a comparable resistance profile to that of M. tuberculosis for several anti-TB drugs. The aims of this study were to (i) determine the drug resistance profile of a recently proposed model species, Mycobacterium aurum, strain ATCC23366, for anti-TB drug discovery as well as Mycobacterium smegmatis and Mycobacterium marinum (ii) sequence and annotate the complete genome sequence of this species obtained using Pacific Bioscience technology (iii) perform comparative genomics analyses of the various surrogate strains with M. tuberculosis (iv) discuss how the choice of the surrogate model used for drug screening can affect the drug discovery process. We describe the complete genome sequence of M. aurum, a surrogate model for anti-tuberculosis drug discovery. Most of the genes already reported to be associated with drug resistance are shared between all the surrogate strains and M. tuberculosis. We consider that M. aurum might be used in high-throughput screening for tuberculosis drug discovery. We also highly recommend the use of different model species during the drug discovery screening process.
International Nuclear Information System (INIS)
Liu Fuquan; Yue Zhendong; Gao Shunyu; Li YanSheng; Wei Guobin; Guo Weiyi; Chen Xijun; Li Baoyu
2004-01-01
Objective: To evaluate the clinical value of percutaneous injection of 70% ethanol in the treatment of multidrug resistant pulmonary tuberculosis. Methods: Percutaneous and transcatheter absolute ethanol, 70% ethanol, and 60% meglucamine diatrizoate(or distilled water) injection into the lung (25 cases) and the bronchi (25 cases) of healthy rabbits were performed, respectively.All specimens were studied with pathology. On the base of animals experiment, thirty-five patients with multi-drug resistant pulmonary tuberculosis were treated with percutaneous 70% ethanol injection. Every patient was treated by the same way for 1-3 times. Results: Pathological findings of the specimens of pulmonary tissue showed nonspecific inflammation, necrosis, and fibrosis. The chief pathological changes with percutaneous or transcatheter 70% ethanol injection were slighter than those with absolute ethanol injection. Pathological findings of the specimens of bronchi showed slight mucosal edema, nonspecific inflammation, and focal cytonecrosis. Recovery of the damaged bronchial mucosa occurred within 14-30 days after the treatment. All patients with multi-drug resistant pulmonary tuberculosis were followed up for 6 to 33 months. The sputum bacterial conversion to negative rate was 100% within 6 months after the treatment. Cavity closing, shrinking, and no changing rate were 47.1% (16/34), 50.0% (17/34), and 2.9% (1/34), respectively. Radiographic improvement rate was 94.3 % (33/35). No severe complications and adverse reactions occurred. Conclusion: Percutaneous 70% ethanol injection is safe, effective, and easy to perform in the treatment of multi-drug resistant pulmonary tuberculosis. (authors)
Energy Technology Data Exchange (ETDEWEB)
Garzan, Atefeh; Willby, Melisa J.; Green, Keith D.; Gajadeera, Chathurada S.; Hou, Caixia; Tsodikov, Oleg V.; Posey, James E.; Garneau-Tsodikova, Sylvie
2016-12-08
A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28–37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.
Winglee, Kathryn; Lun, Shichun; Pieroni, Marco; Kozikowski, Alan; Bishai, William
2015-11-01
Drug resistance is a major problem in Mycobacterium tuberculosis control, and it is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M. tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor) family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Grandjean, Louis; Gilman, Robert H.; Martin, Laura; Soto, Esther; Castro, Beatriz; Lopez, Sonia; Coronel, Jorge; Castillo, Edith; Alarcon, Valentina; Lopez, Virginia; San Miguel, Angela; Quispe, Neyda; Asencios, Luis; Dye, Christopher; Moore, David A. J.
2015-01-01
Background The “fitness” of an infectious pathogen is defined as the ability of the pathogen to survive, reproduce, be transmitted, and cause disease. The fitness of multidrug-resistant tuberculosis (MDRTB) relative to drug-susceptible tuberculosis is cited as one of the most important determinants of MDRTB spread and epidemic size. To estimate the relative fitness of drug-resistant tuberculosis cases, we compared the incidence of tuberculosis disease among the household contacts of MDRTB index patients to that among the contacts of drug-susceptible index patients. Methods and Findings This 3-y (2010–2013) prospective cohort household follow-up study in South Lima and Callao, Peru, measured the incidence of tuberculosis disease among 1,055 household contacts of 213 MDRTB index cases and 2,362 household contacts of 487 drug-susceptible index cases. A total of 35/1,055 (3.3%) household contacts of 213 MDRTB index cases developed tuberculosis disease, while 114/2,362 (4.8%) household contacts of 487 drug-susceptible index patients developed tuberculosis disease. The total follow-up time for drug-susceptible tuberculosis contacts was 2,620 person-years, while the total follow-up time for MDRTB contacts was 1,425 person-years. Using multivariate Cox regression to adjust for confounding variables including contact HIV status, contact age, socio-economic status, and index case sputum smear grade, the hazard ratio for tuberculosis disease among MDRTB household contacts was found to be half that for drug-susceptible contacts (hazard ratio 0.56, 95% CI 0.34–0.90, p = 0.017). The inference of transmission in this study was limited by the lack of genotyping data for household contacts. Capturing incident disease only among household contacts may also limit the extrapolation of these findings to the community setting. Conclusions The low relative fitness of MDRTB estimated by this study improves the chances of controlling drug-resistant tuberculosis. However, fitter
DEFF Research Database (Denmark)
Koul, A.; Vranckx, L.; Dhar, N.
2014-01-01
Bedaquiline (BDQ), an ATP synthase inhibitor, is the first drug to be approved for treatment of multidrug-resistant tuberculosis in decades. Though BDQ has shown excellent efficacy in clinical trials, its early bactericidal activity during the first week of chemotherapy is minimal. Here, using...... microfluidic devices and time-lapse microscopy of Mycobacterium tuberculosis, we confirm the absence of significant bacteriolytic activity during the first 3-4 days of exposure to BDQ. BDQ-induced inhibition of ATP synthesis leads to bacteriostasis within hours after drug addition. Transcriptional...... and proteomic analyses reveal that M. tuberculosis responds to BDQ by induction of the dormancy regulon and activation of ATP-generating pathways, thereby maintaining bacterial viability during initial drug exposure. BDQ-induced bacterial killing is significantly enhanced when the mycobacteria are grown on non...
Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der
2010-01-01
BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In
Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.
2010-01-01
Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In
The function of the thyroid gland in patients with multi-drug resistant tuberculosis
Directory of Open Access Journals (Sweden)
S. L. Matveyeva
2017-08-01
Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDRTB remains a health problem for many countries in the world. The share of MDRTB is 10–30% among newly diagnosed cases and 20–70% among relapses and treatment failure. The aim of the study is to define the side effects of second line drugs used in the treatment of MDRTB on thyroid function. Methods In 30 patients with multidrug resistant tuberculosis, echostructure of thyroid was studied by ultrasound imaging method. Indices of thyroid function: plasma levels of free thyroxin, thyroid stimulating hormone were studied before chemotherapy initiated, at the end of intensive phase and after the treatment finished. Results Decreasing of thyroid function under antituberculosis chemotherapy was approved. Monitoring and correction of thyroid function during antituberculosis chemotherapy was suggested. Conclusion Patients with MDRTB taking ethionamide and PAS are at increased risk for hypothyroidism and goiter, and therefore require monitoring of thyroid function at all stages of antituberculosis chemotherapy for its timely correction.
Directory of Open Access Journals (Sweden)
O. M. Raznatovska
2017-08-01
Full Text Available According to the World Health Organization, today in the world among the infectious chronic diseases one of the leading places and causes of death is multi-drug resistant tuberculosis of the lungs, and chronic non-communicable diseases – diabetes mellitus. The situation is complicated by the fact that the number of patients with combined course of these two heavy separate illnesses that complicate each other increases. It is established that with increasing severity of diabetes mellitus, tuberculosis process in the lungs becomes more complicate and deteriorates, and vice versa, the specific process complicates the course of diabetes mellitus, contributing to the development of diabetic complications. Against this background, the effectiveness of treatment of patients suffering from multi-drug resistant tuberculosis of the lungs in our country remains very low, mainly due to the toxic adverse reactions to antimycobacterial drugs of the reserve line, and in the case of adding diabetes mellitus, it deteriorates even more. The aim of this study was to review the scientific literature to determine the relevance of the study of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus and perspectives of innovative methods of diagnosis of diabetes mellitus. Early diagnosis of pre-diabetes, and autoimmune diseases will allow the use of timely correction techniques that prevents the development of diabetes mellitus, depending on its type, and in the future the development of serious irreversible processes, allow timely applying appropriate methods of correction of the revealed violations. Results. Very little amount of work is dedicated to the problem of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus, regardless of its type, the theme is relevant for today, in Ukraine there are no data regarding its study. This combined course of very difficult in the treatment diseases requires
Schiebler, Mark; Brown, Karen; Hegyi, Krisztina; Newton, Sandra M; Renna, Maurizio; Hepburn, Lucy; Klapholz, Catherine; Coulter, Sarah; Obregón-Henao, Andres; Henao Tamayo, Marcela; Basaraba, Randall; Kampmann, Beate; Henry, Katherine M; Burgon, Joseph; Renshaw, Stephen A; Fleming, Angeleen; Kay, Robert R; Anderson, Karen E; Hawkins, Phillip T; Ordway, Diane J; Rubinsztein, David C; Floto, Rodrigo Andres
2015-02-01
Mycobacterium tuberculosis (MTB) remains a major challenge to global health made worse by the spread of multidrug resistance. We therefore examined whether stimulating intracellular killing of mycobacteria through pharmacological enhancement of macroautophagy might provide a novel therapeutic strategy. Despite the resistance of MTB to killing by basal autophagy, cell-based screening of FDA-approved drugs revealed two anticonvulsants, carbamazepine and valproic acid, that were able to stimulate autophagic killing of intracellular M. tuberculosis within primary human macrophages at concentrations achievable in humans. Using a zebrafish model, we show that carbamazepine can stimulate autophagy in vivo and enhance clearance of M. marinum, while in mice infected with a highly virulent multidrug-resistant MTB strain, carbamazepine treatment reduced bacterial burden, improved lung pathology and stimulated adaptive immunity. We show that carbamazepine induces antimicrobial autophagy through a novel, evolutionarily conserved, mTOR-independent pathway controlled by cellular depletion of myo-inositol. While strain-specific differences in susceptibility to in vivo carbamazepine treatment may exist, autophagy enhancement by repurposed drugs provides an easily implementable potential therapy for the treatment of multidrug-resistant mycobacterial infection. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.
Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay
2018-01-01
Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...
Multidrug-resistant tuberculosis in Lithuania – Still a long way ahead
Directory of Open Access Journals (Sweden)
Greta Musteikienė
2016-01-01
Full Text Available Despite the recent advances in the diagnosis of tuberculosis, treatment of the disease, for the most part, remains the same as it was half a century ago. In recent years only two new anti-tuberculosis drugs have been approved by the European Medicines Agency and Food and Drug Administration. Though the prevalence of this disease is slowly decreasing all over Europe, new challenges appear. One of them is multidrug-resistant tuberculosis (MDR-TB. This problem is especially prominent in Lithuania, which is one of the 27 high MDR-TB burden countries in the world and falls behind neighboring countries in terms of the prevalence of the disease. The objective of this paper was to review the situation of tuberculosis and MDR-TB in Lithuania, and current available methods of treatment, control and diagnosis of this disease.
Kozińska, Monika; Augustynowicz-Kopeć, Ewa
2015-01-01
In total, 1095 Mycobacterium tuberculosis clinical isolates from 282 patients with drug-resistant and 813 with drug-sensitive tuberculosis (TB) in Poland during 2007-2011 were analysed. Seventy-one (6.5%) patients were found to have strains of Beijing genotype as defined by spoligotyping. The majority of patients were Polish-born; among foreign-born a large proportion came from Chechnya and Vietnam. Analysis showed strong associations between Beijing genotype infection and MDR, pre-XDR and XDR resistance, with a considerable relative risk among new patients, suggesting that this is due to increased spread of drug-resistant strains rather than acquisition of resistance during treatment.
Fox, Gregory J.; Mitnick, Carole D.; Benedetti, Andrea; Chan, Edward D.; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S.; Menzies, Dick; van der Werf, Tjip S.
2016-01-01
Background. Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual
Directory of Open Access Journals (Sweden)
Kostera J
2018-05-01
Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance
Bovine tuberculosis is a ‘neglected zoonosis’ and its contribution to the proportion of Mycobacterium tuberculosis complex infections in humans is unknown. A retrospective study on archived Mycobacterium tuberculosis complex (MTC) isolates from a reference laboratory in Uganda was undertaken to iden...
Directory of Open Access Journals (Sweden)
A K Maurya
2013-01-01
Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted
2012-01-01
Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper
Clustering of Mycobacterium tuberculosis strains from foreign-born patients in Korea.
Jeon, Christie Y; Kang, Heeyoon; Kim, Mihye; Murray, Megan B; Kim, Heejin; Cho, Eun Hee; Park, Young Kil
2011-12-01
Information on drug resistance and transmission patterns of tuberculosis (TB) in foreign-born patients is lacking in Asia where immigration is increasing. We examined the drug-resistance profiles of 288 Mycobacterium tuberculosis isolates from foreign-born patients in South Korea, and assessed for potential transmission in the host country by analysing their IS6110 genotypes, as well as those of 4780 strains from native Korean TB patients. The prevalence of multidrug-resistant (MDR) TB was 9.7% and 42% among new and previously treated patients, respectively. Chinese nationality was associated with MDR TB (OR(China)=3.0, 95% CI 1.1-9.3). Of the 288 strains, 51 (17.7%) formed 31 clusters, of which 22 were identical to strains from native Koreans. A number of strains belonged to the K family, subtypes known to occur endemically in Korea. MDR TB was common, and clustering patterns showed potential cross-cultural transmission among foreign-born TB patients. Further molecular epidemiological studies of all isolates in the area are needed to determine the extent of international TB transmission in Asia. © 2011 SGM
Projahn, M.; Koser, C. U.; Homolka, S.; Summers, D. K.; Archer, John A.C.; Niemann, S.
2011-01-01
Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.
Projahn, M.
2011-06-27
Sequence analyses of 74 strains that encompassed major phylogenetic lineages of the Mycobacterium tuberculosis complex revealed 10 polymorphisms in mshA (Rv0486) and four polymorphisms in inhA (Rv1484) that were not responsible for isoniazid or prothionamide resistance. Instead, some of these mutations were phylogenetically informative. This genetic diversity must be taken into consideration for drug development and for the design of molecular tests for drug resistance.
Surgical aspects of pulmonary tuberculosis: an update.
Dewan, Ravindra Kumar; Pezzella, A Thomas
2016-10-01
Tuberculosis remains a major global medical challenge and concern. In the world's population of over 7.4 billion people, 8.6 million are estimated to be infected with Mycobacterium tuberculosis; another 2.2 billion have latent tuberculosis. There is an annual incidence of 16,000 new cases in the USA and 7-8 million new cases worldwide, of which 440,000 are multidrug-resistant or extensively multidrug-resistant, mainly in developing countries or emerging economies. According to the World Health Organization, the incidence of tuberculosis is 133 cases per 100,000 of the population; 3.3% new cases are drug resistant and 20% are already treated cases. Of the drug-resistant cases, 9.7% are extensively drug-resistant. The annual global mortality attributable to tuberculosis is over 1.3 million people. The association with HIV/AIDS in 430,000 people has compounded the global concern and challenge. This review presents the historical indications for surgical treatment of tuberculosis, reviews the current literature and clinical experience, and collates this into increased awareness and contemporary understanding of the indications and need for surgery in primary active tuberculosis, adjuvant surgical therapy for multidrug-resistant tuberculosis, and the complications of chronic tuberculosis sequelae or previous tuberculosis surgery. © The Author(s) 2016.
Laboratory Diagnosis and Susceptibility Testing for Mycobacterium tuberculosis.
Procop, Gary W
2016-12-01
The laboratory, which utilizes some of the most sophisticated and rapidly changing technologies, plays a critical role in the diagnosis of tuberculosis. Some of these tools are being employed in resource-challenged countries for the rapid detection and characterization of Mycobacterium tuberculosis. Foremost, the laboratory defines appropriate specimen criteria for optimal test performance. The direct detection of mycobacteria in the clinical specimen, predominantly done by acid-fast staining, may eventually be replaced by rapid-cycle PCR. The widespread use of the Xpert MTB/RIF (Cepheid) assay, which detects both M. tuberculosis and key genetic determinants of rifampin resistance, is important for the early detection of multidrug-resistant strains. Culture, using both broth and solid media, remains the standard for establishing the laboratory-based diagnosis of tuberculosis. Cultured isolates are identified far less commonly by traditional biochemical profiling and more commonly by molecular methods, such as DNA probes and broad-range PCR with DNA sequencing. Non-nucleic acid-based methods of identification, such as high-performance liquid chromatography and, more recently, matrix-assisted laser desorption/ionization-time of flight mass spectrometry, may also be used for identification. Cultured isolates of M. tuberculosis should be submitted for susceptibility testing according to standard guidelines. The use of broth-based susceptibility testing is recommended to significantly decrease the time to result. Cultured isolates may also be submitted for strain typing for epidemiologic purposes. The use of massive parallel sequencing, also known as next-generation sequencing, promises to continue to this molecular revolution in mycobacteriology, as whole-genome sequencing provides identification, susceptibility, and typing information simultaneously.
The Mycobacterium tuberculosis homologue of the Mycobacterium ...
African Journals Online (AJOL)
With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...
Phelan, Jody; Maitra, Arundhati; McNerney, Ruth; Nair, Mridul; Gupta, Antima; Coll, Francesc; Pain, Arnab; Bhakta, Sanjib; Clark, Taane G.
2015-01-01
Mycobacterium aurum (M. aurum) is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02 Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related) to 96.2% for rrs (streptomycin, capreomycin). We observed two homologous genes encoding the catalase-peroxidase enzyme (katG) that is associated with resistance to isoniazid. Similarly, two embB homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum, this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae.
Phelan, Jody
2015-06-04
Mycobacterium aurum (M. aurum) is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02 Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related) to 96.2% for rrs (streptomycin, capreomycin). We observed two homologous genes encoding the catalase-peroxidase enzyme (katG) that is associated with resistance to isoniazid. Similarly, two embB homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum, this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae.
Directory of Open Access Journals (Sweden)
Jody Phelan
2015-01-01
Full Text Available Mycobacterium aurum (M. aurum is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02 Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related to 96.2% for rrs (streptomycin, capreomycin. We observed two homologous genes encoding the catalase-peroxidase enzyme (katG that is associated with resistance to isoniazid. Similarly, two emb B homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum , this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae.
Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O
2016-01-01
OBJECTIVE/BACKGROUND: Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays
Lipoprotein Processing Is Essential for Resistance of Mycobacterium tuberculosis to Malachite Green▿
Banaei, Niaz; Kincaid, Eleanor Z.; Lin, S.-Y. Grace; Desmond, Edward; Jacobs, William R.; Ernst, Joel D.
2009-01-01
Malachite green, a synthetic antimicrobial dye, has been used for over 50 years in mycobacterial culture medium to inhibit the growth of contaminants. The molecular basis of mycobacterial resistance to malachite green is unknown, although the presence of malachite green-reducing enzymes in the cell envelope has been suggested. The objective of this study was to investigate the role of lipoproteins in resistance of Mycobacterium tuberculosis to malachite green. The replication of an M. tubercu...
Managing a case of extensively drug-resistant (XDR) pulmonary tuberculosis in Singapore.
Phua, Chee Kiang; Chee, Cynthia B E; Chua, Angeline P G; Gan, Suay Hong; Ahmed, Aneez D B; Wang, Yee Tang
2011-03-01
Extensively drug-resistant tuberculosis (XDR-TB) is an emerging global health risk. We present the first case report of XDR-TB in Singapore. A 41-year-old Indonesian lady with previously treated pulmonary tuberculosis presented with chronic cough. Her sputum was strongly acid-fast bacilli positive and grew Mycobacterium tuberculosis complex resistant to first and second-line TB medications. She received 5 months of intensive multidrug treatment without sputum smear conversion. She then underwent resection of the diseased lung. The total cost incurred amounted to over S$100,000. She achieved sputum smear/culture conversion post-surgery, but will require further medical therapy for at least 18 months. XDRTB is poorly responsive to therapy and extremely expensive to manage. Its prevention by strict compliance to therapy is paramount.
Molecular detection of multidrug-resistant Mycobacterium leprae from Indian leprosy patients.
Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal; Das, Loretta; Kumar, Archana; Darlong, Joydeepa; Nathan, Rajeev; Maseey, Asha
2018-03-01
The emergence of multidrug-resistant (MDR) organisms for any infectious disease is a public health concern. Global efforts to control leprosy by intensive chemotherapy have led to a significant decrease in the number of registered patients. Currently recommended control measures for treating leprosy with multidrug therapy (MDT) were designed to prevent the spread of dapsone-resistant Mycobacterium leprae strains. Here we report the identification of MDR M. leprae from relapse leprosy patients from endemic regions in India. Resistance profiles to rifampicin, dapsone and ofloxacin of the isolated strains were confirmed by identification of mutations in genes previously shown to be associated with resistance to each drug. Between 2009-2016, slit-skin smear samples were collected from 239 relapse and 11 new leprosy cases from hospitals of The Leprosy Mission across India. DNA was extracted from the samples and was analysed by PCR targeting the rpoB, folP and gyrA genes associated with resistance to rifampicin, dapsone and ofloxacin, respectively, in M. leprae. M. leprae Thai-53 (wild-type) and Zensho-4 (MDR) were used as reference strains. Fifteen strains showed representative mutations in at least two resistance genes. Two strains showed mutations in all three genes responsible for drug resistance. Seven, seven and one strain, respectively, showed mutations in genes responsible for rifampicin and dapsone resistance, for dapsone and ofloxacin resistance and for rifampicin and ofloxacin resistance. This study showed the emergence of MDR M. leprae in MDT-treated leprosy patients from endemic regions of India. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Lenaerts, Anne J.; Gruppo, Veronica; Marietta, Karen S.; Johnson, Christine M.; Driscoll, Diane K.; Tompkins, Nicholas M.; Rose, Jerry D.; Reynolds, Robert C.; Orme, Ian M.
2005-01-01
This study extends earlier reports regarding the in vitro and in vivo efficacies of the nitroimidazopyran PA-824 against Mycobacterium tuberculosis. PA-824 was tested in vitro against a broad panel of multidrug-resistant clinical isolates and was found to be highly active against all isolates (MIC < 1 μg/ml). The activity of PA-824 against M. tuberculosis was also assessed grown under conditions of oxygen depletion. PA-824 showed significant activity at 2, 10, and 50 μg/ml, similar to that of...
Machowski, Edith Erika; Kana, Bavesh Davandra
2017-12-01
Molecular diagnostics have revolutionized the management of health care through enhanced detection of disease or infection and effective enrollment into treatment. In recognition of this, the World Health Organization approved the rollout of nucleic acid amplification technologies for identification of Mycobacterium tuberculosis using platforms such as GeneXpert MTB/RIF, the GenoType MTBDR plus line probe assay, and, more recently, GeneXpert MTB/RIF Ultra. These assays can simultaneously detect tuberculosis infection and assess rifampin resistance. However, their widespread use in health systems requires verification and quality assurance programs. To enable development of these, we report the construction of genetically modified strains of Mycobacterium smegmatis that mimic the profile of Mycobacterium tuberculosis on both the GeneXpert MTB/RIF and the MTBDR plus line probe diagnostic tests. Using site-specific gene editing, we also created derivatives that faithfully mimic the diagnostic result of rifampin-resistant M. tuberculosis , with mutations at positions 513, 516, 526, 531, and 533 in the rifampin resistance-determining region of the rpoB gene. Next, we extended this approach to other diseases and demonstrated that a Staphylococcus aureus gene sequence can be introduced into M. smegmatis to generate a positive response for the SCC mec probe in the GeneXpert SA Nasal Complete molecular diagnostic cartridge, designed for identification of methicillin-resistant S. aureus These biomimetic strains are cost-effective, have low biohazard content, accurately mimic drug resistance, and can be produced with relative ease, thus illustrating their potential for widespread use as verification standards for diagnosis of a variety of diseases. Copyright © 2017 American Society for Microbiology.
Análise genotÃpica de isolados de Mycobacterium tuberculosis de um hospital em Lisboa, Portugal
Directory of Open Access Journals (Sweden)
João Perdigão
2009-09-01
Full Text Available Resumo: Portugal apresenta uma das taxas de incidência de tuberculose mais altas da União Europeia, tendo a Região de Saúde de Lisboa uma taxa de incidência muito acima da média nacional. O presente estudo analisa a transmissão, susceptibilidade aos antibacilares e caracterÃsticas de uma população de estudo de um hospital central de Lisboa. Cento e trinta e dois isolados clÃnicos de Mycobacterium tuberculosis foram pre-viamente testados quanto à susceptibilidade aos antibacilares de primeira linha. A taxa de multirresistência encontrada foi de 3,0%, enquanto 13,6% dos isolados eram resistentes a um ou mais antibacilares de primeira linha. A serologia para o VIH estava disponÃvel para 98 doentes, 26 (26,5% eram positivos. Os isolados foram genotipados por MIRU-VNTR e 53 (40,2% dos 132 isolados encontravam-se distribuÃdos por 17 clusters MIRU-VNTR diferentes de dois ou mais isolados. De todos os isolados analisados, 25,8% perten-ciam à famÃlia Lisboa. ConcluÃmos que a transmissão de estirpes de Mycobacterium tuberculosis, resistentes e susceptÃveis, está a ocorrer, com especial preocupação para as estirpes Lisboa.Rev Port Pneumol 2009; XV (5: 761-769 Abstract: Portugal has one of the highest tuberculosis notification rates of the European Union with Lisbon Health Region having an incidence rate well above the national average. The present study analyses the transmission, drug susceptibility and characteristics of a study population from a Central Lisbonâs Hospital. One hundred and thirty-two Mycobacterium tuberculosis clinical isolates were previously tested for drug susceptibility to first-line drugs. The multidrug (MDR resistance rate was found to be 3.0%, while 13.6% of the isolates were resistant to one or more first-line drugs. HIV serology was available for 98 patients, 26 (26.5% were positive. Genotyping was performed by MIRU-VNTR and 53 (40,2% out of the 132 isolates
Resistance patterns and trends of extensively drug-resistant tuberculosis: 5-year experience
Directory of Open Access Journals (Sweden)
Amresh Kumar Singh
2013-12-01
Full Text Available Objective:Extensively drug-resistant tuberculosis (XDR-TB strains were emerged when multidrug-resistant TB (MDR- TB was inadequately treated. Inadequate treatment of MDR-TB cases may result in additional resistance especially non-XDR-TB and then XDR-TB. The aim of this study was to know the prevalence, resistance patterns and trends of the XDR-TB strains among the MDR-TB at a tertiary care hospital in Lucknow, India Methods: A total of 430 Mycobacterium isolates were underwent NAP test and TB MPT64 Ag test for the identification of Mycobacterium tuberculosis complex (MTBC. Drug-susceptibility test (DST was performed over MTBC for the first line drugs by 1% proportion method (Bactec and for the second-line drugs by 1% proportion method (Lowenstein- Jensen media. The XDR-TB status was further confirmed by line probe assay (GenoType® MTBDRsl assay. Results: Among the 430 isolates of mycobacterium, 365 (84.9% were MTBC and 139 (38.1% were MDR-TB respectively. Further 97 MDR-TB from “highly suspected drug resistant-TB (DR-TB” cases among MDR-TB were tested with second line drugs in which 15 (15.5% XDR-TB and 82 (84.5% were non-XDR-TB. Regarding XDR-TB status, using the 1% proportion method a 100% agreement was seen with the GenoType® MTBDRsl assay. Resistance patterns of XDR-TB were as; 10/15 (66.7% as isoniazid + rifampicin + ciprofloxacin + amikacin resistance and 5/15 (33.3% as isoniazid + rifampicin + ciprofloxacin + amikacin + kanamycin resistance. Conclusion:The prevalence of XDR-TB was 15.5% among MDR-TB. Hence laboratory testing of “highly suspected drug resistant-TB” isolates should be done for both first and second line drugs simultaneously especially in developing countries.J Microbiol Infect Dis 2013;3(4: 169-175
Bravo, Lulette Tricia C.; Tuohy, Marion J.; Ang, Concepcion; Destura, Raul V.; Mendoza, Myrna; Procop, Gary W.; Gordon, Steven M.; Hall, Geraldine S.; Shrestha, Nabin K.
2009-01-01
After isoniazid and rifampin (rifampicin), the next pivotal drug class in Mycobacterium tuberculosis treatment is the fluoroquinolone class. Mutations in resistance-determining regions (RDR) of the rpoB, katG, and gyrA genes occur with frequencies of 97%, 50%, and 85% among M. tuberculosis isolates resistant to rifampin, isoniazid, and fluoroquinolones, respectively. Sequences are highly conserved, and certain mutations correlate well with phenotypic resistance. We developed a pyrosequencing assay to determine M. tuberculosis genotypic resistance to rifampin, isoniazid, and fluoroquinolones. We characterized 102 M. tuberculosis clinical isolates from the Philippines for susceptibility to rifampin, isoniazid, and ofloxacin by using the conventional submerged-disk proportion method and validated our pyrosequencing assay using these isolates. DNA was extracted and amplified by using PCR primers directed toward the RDR of the rpoB, katG, and gyrA genes, and pyrosequencing was performed on the extracts. The M. tuberculosis H37Rv strain (ATCC 25618) was used as the reference strain. The sensitivities and specificities of pyrosequencing were 96.7% and 97.3%, 63.8% and 100%, and 70.0% and 100% for the detection of resistance to rifampin, isoniazid, and ofloxacin, respectively. Pyrosequencing is thus a rapid and accurate method for detecting M. tuberculosis resistance to these three drugs. PMID:19846642
Alffenaar, Jan-Willem C.; Kosterink, Jos G. W.; van Altena, Richard; van der Werf, Tjip S.; Uges, Donald R. A.; Proost, Johannes H.
Introduction: Linezolid is a potential drug for the treatment of multidrug-resistant tuberculosis but its use is limited because of severe adverse effects such as anemia, thrombocytopenia, and peripheral neuropathy. This study aimed to develop a model for the prediction of linezolid area. under the
Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El
2013-01-01
Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in
Phelan, Jody; Maitra, Arundhati; McNerney, Ruth; Nair, Mridul; Gupta, Antima; Coll, Francesc; Pain, Arnab; Bhakta, Sanjib; Clark, Taane G
2015-09-01
Mycobacterium aurum (M. aurum) is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related) to 96.2% for rrs (streptomycin, capreomycin). We observed two homologous genes encoding the catalase-peroxidase enzyme (katG) that is associated with resistance to isoniazid. Similarly, two embB homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum, this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
Ritacco, Viviana; López, Beatriz; Cafrune, Patricia I; Ferrazoli, Lucilaine; Suffys, Philip N; Candia, Norma; Vásquez, Lucy; Realpe, Teresa; Fernández, Jorge; Lima, Karla V; Zurita, Jeannete; Robledo, Jaime; Rossetti, Maria L; Kritski, Afranio L; Telles, Maria A; Palomino, Juan C; Heersma, Herre; van Soolingen, Dick; Kremer, Kristin; Barrera, Lucía
2008-08-01
The frequency of the Beijing genotype of Mycobacterium tuberculosis as a cause of tuberculosis (TB) in South America was determined by analyzing genotypes of strains isolated from patients that had been diagnosed with the disease between 1997 and 2003 in seven countries of the subcontinent. In total, 19 of the 1,202 (1.6%) TB cases carried Beijing isolates, including 11 of the 185 patients from Peru (5.9%), five of the 512 patients from Argentina (1.0%), two of the 252 Brazilian cases (0.8%), one of the 166 patients from Paraguay (0.6%) and none of the samples obtained from Chile (35), Colombia (36) and Ecuador (16). Except for two patients that were East Asian immigrants, all cases with Beijing strains were native South Americans. No association was found between carrying a strain with the Beijing genotype and having drug or multi-drug resistant disease. Our data show that presently transmission of M. tuberculosis strains of the Beijing genotype is not frequent in Latin America. In addition, the lack of association of drug resistant TB and infection with M. tuberculosis of the Beijing genotype observed presently demands efforts to define better the contribution of the virulence and lack of response to treatment to the growing spread of Beijing strains observed in other parts of the world.
Directory of Open Access Journals (Sweden)
Viviana Ritacco
2008-08-01
Full Text Available The frequency of the Beijing genotype of Mycobacterium tuberculosis as a cause of tuberculosis (TB in South America was determined by analyzing genotypes of strains isolated from patients that had been diagnosed with the disease between 1997 and 2003 in seven countries of the subcontinent. In total, 19 of the 1,202 (1.6% TB cases carried Beijing isolates, including 11 of the 185 patients from Peru (5.9%, five of the 512 patients from Argentina (1.0%, two of the 252 Brazilian cases (0.8%, one of the 166 patients from Paraguay (0.6% and none of the samples obtained from Chile (35, Colombia (36 and Ecuador (16. Except for two patients that were East Asian immigrants, all cases with Beijing strains were native South Americans. No association was found between carrying a strain with the Beijing genotype and having drug or multi-drug resistant disease. Our data show that presently transmission of M. tuberculosis strains of the Beijing genotype is not frequent in Latin America. In addition, the lack of association of drug resistant TB and infection with M. tuberculosis of the Beijing genotype observed presently demands efforts to define better the contribution of the virulence and lack of response to treatment to the growing spread of Beijing strains observed in other parts of the world.
Mycobacterium tuberculosis and Mycobacterium bovis are responsible for tuberculosis in humans or animals, respectively. Both species are closely related and belong to the Mycobacterium tuberculosis complex (MTC). M. tuberculosis is the most ancient species from which M. bovis and the other members o...
Castro, Claudia; Ricardo, Alba; Zabaleta, Angie; Llerena, Claudia; Puerto, Gloria
2017-01-24
One third of the increase in tuberculosis cases is attributed to the spread of HIV. In 2012, 1,397 HIV-associated tuberculosis cases were reported in Colombia, i.e., 11.8% of the total cases. Molecular epidemiology tools help to understand the transmission of tuberculosis. To characterize clinical isolates of Mycobacterium tuberculosis derived from HIV-infected individuals, received at the Laboratorio Nacional de Referencia in the Instituto Nacional de Salud. This was a descriptive observational study. We analyzed 63 isolates of M. tuberculosis from HIV-infected individuals. Identification, drug susceptibility and genotyping assays were performed. Of the new cases evaluated, three (5.0%) were resistant to isoniazid combined with streptomycin; two (3.3%) to rifampicin, and one (1.6%) to isoniazid. Previously treated cases were sensitive. No multidrug resistance was evident. Among the predominant genotypes, 20 isolates were (31.7%) LAM9, eight (12.7%), H1, and seven (11.1%), T1. Nineteen isolates corresponded to orphan patterns. One single grouping was observed among tested isolates. We found no statistically significantdifference between the proportions of the antituberculous drug resistance and genotypes. We found resistant isolates to the most powerful drugs, rifampicin and isoniazid, among new cases, showing the transmission of resistant strains. Genetic families of M. tuberculosis LAM9, T1 and H1 correspond to those described in the general population. We detected no active transmission among studied isolates. More comprehensive studies are needed to assess the real situation of HIV associated tuberculosis in the country regarding sensitivity and transmission.
Salamon, Hugh; Yamaguchi, Ken D; Cirillo, Daniela M; Miotto, Paolo; Schito, Marco; Posey, James; Starks, Angela M; Niemann, Stefan; Alland, David; Hanna, Debra; Aviles, Enrique; Perkins, Mark D; Dolinger, David L
2015-04-01
Tuberculosis remains a major global public health challenge. Although incidence is decreasing, the proportion of drug-resistant cases is increasing. Technical and operational complexities prevent Mycobacterium tuberculosis drug susceptibility phenotyping in the vast majority of new and retreatment cases. The advent of molecular technologies provides an opportunity to obtain results rapidly as compared to phenotypic culture. However, correlations between genetic mutations and resistance to multiple drugs have not been systematically evaluated. Molecular testing of M. tuberculosis sampled from a typical patient continues to provide a partial picture of drug resistance. A database of phenotypic and genotypic testing results, especially where prospectively collected, could document statistically significant associations and may reveal new, predictive molecular patterns. We examine the feasibility of integrating existing molecular and phenotypic drug susceptibility data to identify associations observed across multiple studies and demonstrate potential for well-integrated M. tuberculosis mutation data to reveal actionable findings. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
van den Hof, Susan; Collins, David; Hafidz, Firdaus; Beyene, Demissew; Tursynbayeva, Aigul; Tiemersma, Edine
2016-01-01
One of the main goals of the post-2015 global tuberculosis (TB) strategy is that no families affected by TB face catastrophic costs. We revised an existing TB patient cost measurement tool to specifically also measure multi-drug resistant (MDR) TB patients' costs and applied it in Ethiopia,
Extended spectrum of antibiotic susceptibility for tuberculosis, Djibouti.
Bouzid, Fériel; Astier, Hélène; Osman, Djaltou Aboubaker; Javelle, Emilie; Hassan, Mohamed Osman; Simon, Fabrice; Garnotel, Eric; Drancourt, Michel
2018-02-01
In the Horn of Africa, there is a high prevalence of tuberculosis that is reported to be partly driven by multidrug-resistant (MDR) Mycobacterium tuberculosis strictu sensu strains. We conducted a prospective study to investigate M. tuberculosis complex species causing tuberculosis in Djibouti, and their in vitro susceptibility to standard anti-tuberculous antibiotics in addition to clofazimine, minocycline, chloramphenicol and sulfadiazine. Among the 118 mycobacteria isolates from 118 successive patients with suspected pulmonary tuberculosis, 111 strains of M. tuberculosis, five Mycobacterium canettii, one 'Mycobacterium simulans' and one Mycobacterium kansasii were identified. Drug-susceptibility tests performed on the first 78 isolates yielded nine MDR M. tuberculosis isolates. All isolates were fully susceptible to clofazimine, minocycline and chloramphenicol, and 75 of 78 isolates were susceptible to sulfadiazine. In the Horn of Africa, patients with confirmed pulmonary tuberculosis caused by an in vitro susceptible strain may benefit from anti-leprosy drugs, sulfamides and phenicol antibiotics. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Vu, D H; Bolhuis, M S; Koster, R A; Greijdanus, B; de Lange, W C M; van Altena, R; Brouwers, J R B J; Uges, D R A; Alffenaar, J W C
2012-01-01
Linezolid is a promising antimicrobial agent for the treatment of multidrug-resistant tuberculosis (MDR-TB), but its use is limited by toxicity. Therapeutic drug monitoring (TDM) may help to minimize toxicity while adequate drug exposure is maintained. Conventional plasma sampling and monitoring
Meropenem-Clavulanate is Effective Against Extensive Drug-Resistant Mycobacterium Tuberculosis
Energy Technology Data Exchange (ETDEWEB)
Hugonnet, J.; Tremblay, L; Boshoff, H; Barry, C; Blanchard, J
2009-01-01
e-lactam antibiotics are ineffective against Mycobacterium tuberculosis, being rapidly hydrolyzed by the chromosomally encoded blaC gene product. The carbapenem class of e-lactams are very poor substrates for BlaC, allowing us to determine the three-dimensional structure of the covalent BlaC-meropenem covalent complex at 1.8 angstrom resolution. When meropenem was combined with the e-lactamase inhibitor clavulanate, potent activity against laboratory strains of M. tuberculosis was observed [minimum inhibitory concentration (MICmeropenem) less than 1 microgram per milliliter], and sterilization of aerobically grown cultures was observed within 14 days. In addition, this combination exhibited inhibitory activity against anaerobically grown cultures that mimic the 'persistent' state and inhibited the growth of 13 extensively drug-resistant strains of M. tuberculosis at the same levels seen for drug-susceptible strains. Meropenem and clavulanate are Food and Drug Administration-approved drugs and could potentially be used to treat patients with currently untreatable disease.
Drug resistance patterns in pulmonary tuberculosis
International Nuclear Information System (INIS)
Khoharo, H.K.; Shaikh, I.A.
2011-01-01
Objective: To determine the resistance patterns of mycobacterium tuberculosis (MTB) isolates among category I and II patients of pulmonary tuberculosis. Methods: This cross sectional study was conducted at the Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, from November 2008 to September 2009. Patients were divided into category I and II. The sputa were collected, stained with Ziehl-Nielsen (Z-N) staining and ultimately inoculated on Lowenstein-Jensen (L-J) media for six weeks. Out of 890 pulmonary tuberculosis (PTB) patients, the growth was obtained in 285 cases. The Drug sensitivity testing (DST) for Isoniazid (INH), Rifampicin (RIF), Ethambutol (EMB) Pyrazinamide (PZA) and Streptomycin (SM) were performed. The data was analyzed on SPSS 10.0. A p-value of <0.05 was taken as significant. Result: Out of 285 cases, 176 (61.75%) were male and 109 (38.24%) female. The mean age was 37 +- 19.90 years. The DST showed drug sensitive and drug resistant isolates in 80 (28.05%) and 205 (71.92%) cases respectively (p=0.001). The drug resistant tuberculosis (DR-TB) rates for individual drugs; INH, RIF, EMB, PZA and SM were 51,22%, 15.4%, 13.33%, 9%12, and 3.85% respectively (p=0.03). The MDR-TB isolates were detected in 120 (42.10%) cases, including 5 (5.88%) in category I and 115 (57.50%) in category II patients (p=0.0001). Conclusion: Drug resistant and multidrug resistant tuberculosis was observed mainly in category II patients. However, primary MDR was also observed in category I patients and reflects dissemination of MDR cases within the community. (author)
Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar.
Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko
2016-03-01
The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.
Lhadon, Tenzin; Jullien, Sophie
2018-04-20
Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.
Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.
Merker, Matthias; Blin, Camille; Mona, Stefano; Duforet-Frebourg, Nicolas; Lecher, Sophie; Willery, Eve; Blum, Michael G B; Rüsch-Gerdes, Sabine; Mokrousov, Igor; Aleksic, Eman; Allix-Béguec, Caroline; Antierens, Annick; Augustynowicz-Kopeć, Ewa; Ballif, Marie; Barletta, Francesca; Beck, Hans Peter; Barry, Clifton E; Bonnet, Maryline; Borroni, Emanuele; Campos-Herrero, Isolina; Cirillo, Daniela; Cox, Helen; Crowe, Suzanne; Crudu, Valeriu; Diel, Roland; Drobniewski, Francis; Fauville-Dufaux, Maryse; Gagneux, Sébastien; Ghebremichael, Solomon; Hanekom, Madeleine; Hoffner, Sven; Jiao, Wei-wei; Kalon, Stobdan; Kohl, Thomas A; Kontsevaya, Irina; Lillebæk, Troels; Maeda, Shinji; Nikolayevskyy, Vladyslav; Rasmussen, Michael; Rastogi, Nalin; Samper, Sofia; Sanchez-Padilla, Elisabeth; Savic, Branislava; Shamputa, Isdore Chola; Shen, Adong; Sng, Li-Hwei; Stakenas, Petras; Toit, Kadri; Varaine, Francis; Vukovic, Dragana; Wahl, Céline; Warren, Robin; Supply, Philip; Niemann, Stefan; Wirth, Thierry
2015-03-01
Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiated worldwide in several waves. We detected successive increases in population size for this pathogen over the last 200 years, practically coinciding with the Industrial Revolution, the First World War and HIV epidemics. Two MDR clones of this lineage started to spread throughout central Asia and Russia concomitantly with the collapse of the public health system in the former Soviet Union. Mutations identified in genes putatively under positive selection and associated with virulence might have favored the expansion of the most successful branches of the lineage.
Greenstein, Robert J; Su, Liya; Shahidi, Azra; Brown, William D; Clifford, Anya; Brown, Sheldon T
2014-09-01
The development of novel antibiotics to treat multidrug-resistant (MDR) tuberculosis is time-consuming and expensive. Multiple immune modulators, immune suppressants, anti-inflammatories, and growth enhancers, and vitamins A and D, inhibit Mycobacterium avium subspecies paratuberculosis (MAP) in culture. We studied the culture inhibition of Mycobacterium tuberculosis complex by these agents. Biosafety level two M. tuberculosis complex (ATCC 19015 and ATCC 25177) was studied in radiometric Bactec or MGIT culture. Agents evaluated included clofazimine, methotrexate, 6-mercaptopurine, cyclosporine A, rapamycin, tacrolimus, monensin, and vitamins A and D. All the agents mentioned above caused dose-dependent inhibition of the M. tuberculosis complex. There was no inhibition by the anti-inflammatory 5-aminosalicylic acid, which causes bacteriostatic inhibition of MAP. We conclude that, at a minimum, studies with virulent M. tuberculosis are indicated with the agents mentioned above, as well as with the thioamide 5-propothiouricil, which has previously been shown to inhibit the M. tuberculosis complex in culture. Our data additionally emphasize the importance of vitamins A and D in treating mycobacterial diseases. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Drug-resistant spinal tuberculosis
Directory of Open Access Journals (Sweden)
Anil K Jain
2018-01-01
Full Text Available Drug-resistant spinal tuberculosis (TB is an emerging health problem in both developing and developed countries. In this review article, we aim to define management protocols for suspicion, diagnosis, and treatment of such patients. Spinal TB is a deep-seated paucibacillary lesion, and the demonstration of acid-fast bacilli on Ziehl-Neelsen staining is possible only in 10%–30% of cases. Drug resistance is suspected in patients showing the failure of clinicoradiological improvement or appearance of a fresh lesion of osteoarticular TB while on anti tubercular therapy (ATT for a minimum period of 5 months. The conventional culture of Mycobacterium tuberculosis remains the gold standard for both bacteriological diagnosis and drug sensitivity testing (DST; however, the high turn around time of 2–6 weeks for detection with added 3 weeks for DST is a major limitation. To overcome this problem, rapid culture methods and molecular methods have been introduced. From a public health perspective, reducing the period between diagnosis and treatment initiation has direct benefits for both the patient and the community. For all patients of drug-resistant spinal TB, a complete Drug-O-Gram should be prepared which includes details of all drugs, their doses, and duration. Patients with confirmed multidrug-resistant TB strains should receive a regimen with at least five effective drugs, including pyrazinamide and one injectable. Patients with resistance to additional antitubercular drugs should receive individualized ATT as per their DST results.
Directory of Open Access Journals (Sweden)
A. I. De la Iglesia
2006-04-01
Full Text Available La tuberculosis constituye todavía una de la causas más frecuentes de mortalidad en el mundo. A pesar de la implementación de tratamientos con cuatro drogas antituberculosas, la aparición de cepas resistentes y multirresistentes ha comprometido la eficacia de los mismos. Dos de las drogas en uso, la rifampicina y la isoniacida, recibieron gran atención por su importancia terapéutica, incluso se han identificado los genes involucrados en los mecanismos de resistencia y los que codifican para sus blancos moleculares. La rifampicina es un inhibidor de la subunidad beta de la ARN polimerasa de procariotas, incluido Mycobacterium tuberculosis. La resistencia a esta droga está principalmente mediada por mutaciones agrupadas en una región del gen rpoB. Una pequeña fracción de cepas resistentes no mostró mutaciones en rpoB, lo que sugiere la existencia de otros mecanismos de resistencia, posiblemente eflujo de la droga. La isoniacida es una prodroga que se activa por la catalasa-peroxidasa KatG. Mutaciones en katG son las más comúnmente identificadas en cepas clínicas de M. tuberculosis resistentes a isoniacida, confiriendo altos niveles de resistencia. Sin embargo, el blanco molecular de acción para la isoniacida es la InhA, una enoil-ACP reductasa involucrada en la vía de síntesis de los ácidos micólicos. Otras mutaciones involucradas en la resistencia a la isoniacida afectan al gen ndh, que codifica para la NADH deshidrogenasa.Human tuberculosis is still one of the most frequent causes of death worldwide. Despite the implementation of therapeutic regimes combining four drugs, the rise of resistant and multidrug-resistant Mycobacterium tuberculosis strains has compromised their efficacy. Two of the most effective anti-tubercular drugs in use, rifampicin and isoniazid, have been closely studied due to their therapeutic importance. These studies have led to the identification of the genes involved in resistance mechanisms and of those
In vitro screening of snake venom against multidrug-resistant tuberculosis
Directory of Open Access Journals (Sweden)
Sujay Kumar Bhunia
2015-12-01
Full Text Available The re-emergence of multidrug-resistant tuberculosis (MDR-TB has brought to light the importance of screening effective novel drugs. In the present study, in vitro activities of different snake (Naja naja, Bungarus fasciatus, Daboia russelli russelli, Naja kaouthia venoms have been investigated against clinical isolate of MDR-TB strains. The treatment with all the venoms inhibited the mycobacterial growth for at least a week in common and two of them (Naja naja and Naja kaouthia showed significantly longer inhibition up to two weeks against the MDR-TB strain with single dose and a repetition of those two venoms exhibited inhibition up to more than four weeks.
Dudley, Matthew Z.; Sheen, Patricia; Gilman, Robert H.; Ticona, Eduardo; Friedland, Jon S.; Kirwan, Daniela E.; Caviedes, Luz; Rodriguez, Richard; Cabrera, Lilia Z.; Coronel, Jorge; Grandjean, Louis; Moore, David A. J.; Evans, Carlton A.; Huaroto, Luz; Chávez-Pérez, Víctor; Zimic, Mirko
2016-01-01
Hospital infection control measures are crucial to tuberculosis (TB) control strategies within settings caring for human immunodeficiency virus (HIV)–positive patients, as these patients are at heightened risk of developing TB. Pyrazinamide (PZA) is a potent drug that effectively sterilizes persistent Mycobacterium tuberculosis bacilli. However, PZA resistance associated with mutations in the nicotinamidase/pyrazinamidase coding gene, pncA, is increasing. A total of 794 patient isolates obtained from four sites in Lima, Peru, underwent spoligotyping and drug resistance testing. In one of these sites, the HIV unit of Hospital Dos de Mayo (HDM), an isolation ward for HIV/TB coinfected patients opened during the study as an infection control intervention: circulating genotypes and drug resistance pre- and postintervention were compared. All other sites cared for HIV-negative outpatients: genotypes and drug resistance rates from these sites were compared with those from HDM. HDM patients showed high concordance between multidrug resistance, PZA resistance according to the Wayne method, the two most common genotypes (spoligotype international type [SIT] 42 of the Latino American-Mediterranean (LAM)-9 clade and SIT 53 of the T1 clade), and the two most common pncA mutations (G145A and A403C). These associations were absent among community isolates. The infection control intervention was associated with 58–92% reductions in TB caused by SIT 42 or SIT 53 genotypes (odds ratio [OR] = 0.420, P = 0.003); multidrug-resistant TB (OR = 0.349, P < 0.001); and PZA-resistant TB (OR = 0.076, P < 0.001). In conclusion, pncA mutation typing, with resistance testing and spoligotyping, was useful in identifying a nosocomial TB outbreak and demonstrating its resolution after implementation of infection control measures. PMID:27928075
Phelan, Jody
2016-03-23
Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure and interaction modelling are used to understand the functional effects of putative mutations and provide insight into the molecular mechanisms leading to resistance. Methods To investigate the potential utility of these approaches, we analysed the genomes of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify polymorphisms associated with minimum inhibitory concentrations for first-line anti-tuberculosis drugs. In addition, the effect of identified candidate mutations on protein stability and interactions was assessed quantitatively with well-established computational methods. Results The analysis revealed that mutations in the genes rpoB (rifampicin), katG (isoniazid), inhA-promoter (isoniazid), rpsL (streptomycin) and embB (ethambutol) were responsible for the majority of resistance observed. A subset of the mutations identified in rpoB and katG were predicted to affect protein stability. Further, a strong direct correlation was observed between the minimum inhibitory concentration values and the distance of the mutated residues in the three-dimensional structures of rpoB and katG to their respective drugs binding sites. Conclusions Using the TDR resource, we demonstrate the usefulness of whole genome association and convergent evolution approaches to detect known and potentially novel mutations associated with drug resistance. Further, protein structural modelling could provide a means of predicting the impact of polymorphisms on drug efficacy in the absence of phenotypic data. These approaches could ultimately lead to novel resistance
Directory of Open Access Journals (Sweden)
Miguel Viveiros
2017-04-01
Full Text Available Numerous studies show efflux as a universal bacterial mechanism contributing to antibiotic resistance and also that the activity of the antibiotics subject to efflux can be enhanced by the combined use of efflux inhibitors. Nevertheless, the contribution of efflux to the overall drug resistance levels of clinical isolates of Mycobacterium tuberculosis is poorly understood and still is ignored by many. Here, we evaluated the contribution of drug efflux plus target-gene mutations to the drug resistance levels in clinical isolates of M. tuberculosis. A panel of 17 M. tuberculosis clinical strains were characterized for drug resistance associated mutations and antibiotic profiles in the presence and absence of efflux inhibitors. The correlation between the effect of the efflux inhibitors and the resistance levels was assessed by quantitative drug susceptibility testing. The bacterial growth/survival vs. growth inhibition was analyzed through the comparison between the time of growth in the presence and absence of an inhibitor. For the same mutation conferring antibiotic resistance, different MICs were observed and the different resistance levels found could be reduced by efflux inhibitors. Although susceptibility was not restored, the results demonstrate the existence of a broad-spectrum synergistic interaction between antibiotics and efflux inhibitors. The existence of efflux activity was confirmed by real-time fluorometry. Moreover, the efflux pump genes mmr, mmpL7, Rv1258c, p55, and efpA were shown to be overexpressed in the presence of antibiotics, demonstrating the contribution of these efflux pumps to the overall resistance phenotype of the M. tuberculosis clinical isolates studied, independently of the genotype of the strains. These results showed that the drug resistance levels of multi- and extensively-drug resistant M. tuberculosis clinical strains are a combination between drug efflux and the presence of target-gene mutations, a reality
International Nuclear Information System (INIS)
Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam
2013-01-01
Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)
Energy Technology Data Exchange (ETDEWEB)
Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam, E-mail: bestlala@yahoo.com [Chronic Respiratory Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of)
2013-03-15
Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)
Molecular detection methods of resistance to antituberculosis drugs in Mycobacterium tuberculosis.
Brossier, F; Sougakoff, W
2017-09-01
Molecular methods predict drug resistance several weeks before phenotypic methods and enable rapid implementation of appropriate therapeutic treatment. We aimed to detail the most representative molecular tools used in routine practice for the rapid detection of resistance to antituberculosis drugs among Mycobacterium tuberculosis strains. The molecular diagnosis of resistance to antituberculosis drugs in clinical samples or from in vitro cultures is based on the detection of the most common mutations in the genes involved in the development of resistance in M. tuberculosis strains (encoding either protein targets of antibiotics, or antibiotic activating enzymes) by commercial molecular kits or by sequencing. Three hypotheses could explain the discrepancies between the genotypic results and the phenotypic drug susceptibility testing results: a low percentage of resistant mutants precluding the detection by genotypic methods on the primary culture; a low level of resistance not detected by phenotypic testing; and other resistance mechanisms not yet characterized. Molecular methods have varying sensitivity with regards to detecting antituberculosis drug resistance; that is why phenotypic susceptibility testing methods are mandatory for detecting antituberculosis drug-resistant isolates that have not been detected by molecular methods. The questionable ability of existing phenotypic and genotypic drug susceptibility testing to properly classify strains as susceptible or resistant, and at what level of resistance, was raised for several antituberculosis agents. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Juréen, P; Angeby, K; Sturegård, E; Chryssanthou, E; Giske, C G; Werngren, J; Nordvall, M; Johansson, A; Kahlmeter, G; Hoffner, S; Schön, T
2010-05-01
The aminoglycosides and cyclic polypeptides are essential drugs in the treatment of multidrug-resistant tuberculosis, underscoring the need for accurate and reproducible drug susceptibility testing (DST). The epidemiological cutoff value (ECOFF) separating wild-type susceptible strains from non-wild-type strains is an important but rarely used tool for indicating susceptibility breakpoints against Mycobacterium tuberculosis. In this study, we established wild-type MIC distributions on Middlebrook 7H10 medium for amikacin, kanamycin, streptomycin, capreomycin, and viomycin using 90 consecutive clinical isolates and 21 resistant strains. Overall, the MIC variation between and within runs did not exceed +/-1 MIC dilution step, and validation of MIC values in Bactec 960 MGIT demonstrated good agreement. Tentative ECOFFs defining the wild type were established for all investigated drugs, including amikacin and viomycin, which currently lack susceptibility breakpoints for 7H10. Five out of seven amikacin- and kanamycin-resistant isolates were classified as susceptible to capreomycin according to the current critical concentration (10 mg/liter) but were non-wild type according to the ECOFF (4 mg/liter), suggesting that the critical concentration may be too high. All amikacin- and kanamycin-resistant isolates were clearly below the ECOFF for viomycin, and two of them were below the ECOFF for streptomycin, indicating that these two drugs may be considered for treatment of amikacin-resistant strains. Pharmacodynamic indices (peak serum concentration [Cmax]/MIC) were more favorable for amikacin and viomycin compared to kanamycin and capreomycin. In conclusion, our data emphasize the importance of establishing wild-type MIC distributions for improving the quality of drug susceptibility testing against Mycobacterium tuberculosis.
Directory of Open Access Journals (Sweden)
Ahmet Yilmaz Coban
2015-08-01
Full Text Available The purpose of this study is to evaluate four rapid colourimetric methods, including the resazurin microtitre assay (REMA, malachite green decolourisation assay (MGDA, microplate nitrate reductase assay (MNRA and crystal violet decolourisation assay (CVDA, for the rapid detection of multidrug-resistant (MDR tuberculosis. Fifty Mycobacterium tuberculosisisolates were used in this study. Eighteen isolates were MDR, two isolates were only resistant to isoniazid (INH and the remaining isolates were susceptible to both INH and rifampicin (RIF. INH and RIF were tested in 0.25 µg/mL and 0.5 µg/mL, respectively. The agar proportion method was used as a reference method. MNRA and REMA were performed with some modifications. MGDA and CVDA were performed as defined in the literature. The agreements of the MNRA for INH and RIF were 96% and 94%, respectively, while the agreement of the other assays for INH and RIF were 98%. In this study, while the specificities of the REMA, MGDA and CVDA were 100%, the specificity of the MNRA was lower than the others (93.3% for INH and 90.9% for RIF. In addition, while the sensitivity of the MNRA was 100%, the sensitivities of the others were lower than that of the MNRA (from 94.1-95%. The results were reported on the seventh-10th day of the incubation. All methods are reliable, easy to perform, inexpensive and easy to evaluate and do not require special equipment.
Zhou, Yang; van den Hof, Susan; Wang, Shengfen; Pang, Yu; Zhao, Bing; Xia, Hui; Anthony, Richard; Ou, Xichao; Li, Qiang; Zheng, Yang; Song, Yuanyuan; Zhao, Yanlin; van Soolingen, Dick
2017-01-01
We describe the population structure of a representative collection of 3,133 Mycobacterium tuberculosis isolates, collected within the framework of a national resistance survey from 2007 in China. Genotyping data indicate that the epidemic strains in China can be divided into seven major complexes,
Rapid drug susceptibility test of mycobacterium tuberculosis by bioluminescence sensor
Lu, Bin; Xu, Shunqing; Chen, Zifei; Zhou, Yikai
2001-09-01
With the persisting increase of drug-resistant stains of M. Tuberculosis around the world, rapid and sensitive detection of antibiotic of M. Tuberculosis is becoming more and more important. In the present study, drug susceptibility of M. tuberculosis were detected by recombination mycobacteriophage combined with bioluminescence sensor. It is based on the use of recombination mycobacteriophage which can express firefly luciferase when it infects viable mycobacteria, and can effectively produce quantifiable photon. Meanwhile, in mycobacterium cells treated with active antibiotic, no light is observed. The emitted light is recorded by a bioluminscence sensor, so the result of drug-resistant test can be determined by the naked eye. 159 stains of M. tuberculosis were applied to this test on their resistant to rifampin, streptomycin and isoniazid. It is found that the agreement of this assay with Liewenstein- Jensen slat is: rifampin 95.60 percent, isoniazid 91.82 percent, streptomycin 88.68 percent, which showed that it is a fast and practical method to scene and detect drug resistant of mycobacterium stains.
International Nuclear Information System (INIS)
Centeno Urena, Yadel
2014-01-01
A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es
Mase, Sundari R; Jereb, John A; Gonzalez, Daniel; Martin, Fatma; Daley, Charles L; Fred, Dorina; Loeffler, Ann M; Menon, Lakshmy R; Bamrah Morris, Sapna; Brostrom, Richard; Chorba, Terence; Peloquin, Charles A
2016-04-01
In the Federated States of Micronesia and then the Republic of the Marshall Islands (RMI), levofloxacin pharmacokinetics were studied in children receiving directly observed once-daily regimens (10 mg/kg, age >5 years; 15-20 mg/kg, age ≤5 years) for either multidrug-resistant tuberculosis disease or latent infection after multidrug-resistant tuberculosis exposure, to inform future dosing strategies. Blood samples were collected at 0 (RMI only), 1, 2 and 6 hours (50 children, aged 6 months to 15 years) after oral levofloxacin at >6 weeks of treatment. Clinical characteristics and maximal drug concentration (Cmax) of levofloxacin, elimination half-life and area under the curve from 0 to 24 hours (AUC0-24 hours × μg/mL) were correlated to determine the optimal dosage and to examine associations. Population pharmacokinetics and target attainment were modeled. With results from the Federated States of Micronesia, dosages were increased in RMI toward the target Cmax for Mycobacterium tuberculosis, 8-12 µg/mL. Cmax correlated linearly with per-weight dosage. Neither Cmax nor half-life was associated with gender, age, body mass index, concurrent medications or predose meals. At levofloxacin dosage of 15-20 mg/kg, Cmax ≥8 µg/mL was observed, and modeling corroborated a high target attainment across the ratio of the area under the free concentration versus time curve to minimum inhibitory concentration (fAUCss,0-24/MIC) values. Levofloxacin dosage should be 15-20 mg/kg for Cmax ≥8 µg/mL and a high target attainment across fAUCss,0-24/MIC values in children ≥2 years of age.
Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted
2012-03-01
Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.
Lipoprotein Processing Is Essential for Resistance of Mycobacterium tuberculosis to Malachite Green▿
Banaei, Niaz; Kincaid, Eleanor Z.; Lin, S.-Y. Grace; Desmond, Edward; Jacobs, William R.; Ernst, Joel D.
2009-01-01
Malachite green, a synthetic antimicrobial dye, has been used for over 50 years in mycobacterial culture medium to inhibit the growth of contaminants. The molecular basis of mycobacterial resistance to malachite green is unknown, although the presence of malachite green-reducing enzymes in the cell envelope has been suggested. The objective of this study was to investigate the role of lipoproteins in resistance of Mycobacterium tuberculosis to malachite green. The replication of an M. tuberculosis lipoprotein signal peptidase II (lspA) mutant (ΔlspA::lspAmut) on Middlebrook agar with and without 1 mg/liter malachite green was investigated. The lspA mutant was also compared with wild-type M. tuberculosis in the decolorization rate of malachite green and sensitivity to sodium dodecyl sulfate (SDS) detergent and first-line antituberculosis drugs. The lspA mutant has a 104-fold reduction in CFU-forming efficiency on Middlebrook agar with malachite green. Malachite green is decolorized faster in the presence of the lspA mutant than wild-type bacteria. The lspA mutant is hypersensitive to SDS detergent and shows increased sensitivity to first-line antituberculosis drugs. In summary, lipoprotein processing by LspA is essential for resistance of M. tuberculosis to malachite green. A cell wall permeability defect is likely responsible for the hypersensitivity of lspA mutant to malachite green. PMID:19596883
Lipoprotein processing is essential for resistance of Mycobacterium tuberculosis to malachite green.
Banaei, Niaz; Kincaid, Eleanor Z; Lin, S-Y Grace; Desmond, Edward; Jacobs, William R; Ernst, Joel D
2009-09-01
Malachite green, a synthetic antimicrobial dye, has been used for over 50 years in mycobacterial culture medium to inhibit the growth of contaminants. The molecular basis of mycobacterial resistance to malachite green is unknown, although the presence of malachite green-reducing enzymes in the cell envelope has been suggested. The objective of this study was to investigate the role of lipoproteins in resistance of Mycobacterium tuberculosis to malachite green. The replication of an M. tuberculosis lipoprotein signal peptidase II (lspA) mutant (DeltalspA::lspAmut) on Middlebrook agar with and without 1 mg/liter malachite green was investigated. The lspA mutant was also compared with wild-type M. tuberculosis in the decolorization rate of malachite green and sensitivity to sodium dodecyl sulfate (SDS) detergent and first-line antituberculosis drugs. The lspA mutant has a 10(4)-fold reduction in CFU-forming efficiency on Middlebrook agar with malachite green. Malachite green is decolorized faster in the presence of the lspA mutant than wild-type bacteria. The lspA mutant is hypersensitive to SDS detergent and shows increased sensitivity to first-line antituberculosis drugs. In summary, lipoprotein processing by LspA is essential for resistance of M. tuberculosis to malachite green. A cell wall permeability defect is likely responsible for the hypersensitivity of lspA mutant to malachite green.
Directory of Open Access Journals (Sweden)
Yie-Vern Lee
2015-01-01
Full Text Available Isocitrate lyase (ICL is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle, especially Mycobacterium tuberculosis (MTB. In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a MTB ICL with natural compounds; (b MTB ICL with synthetic compounds; (c non-MTB ICL with natural compounds; and (d non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL.
Rabodoarivelo, Marie Sylvianne; Imperiale, Bélen; andrianiavomikotroka, Rina; Brandao, Angela; Kumar, Parveen; Singh, Sarman; Ferrazoli, Lucilaine; Morcillo, Nora; Rasolofo, Voahangy; Palomino, Juan Carlos; Vandamme, Peter; Martin, Anandi
2015-01-01
Background Detection of drug-resistant tuberculosis is essential for the control of the disease but it is often hampered by the limitation of transport and storage of samples from remote locations to the reference laboratory. We performed a retrospective field study to evaluate the performance of four supports enabling the transport and storage of samples to be used for molecular detection of drug resistance using the GenoType MTBDRplus. Methods Two hundred Mycobacterium tuberculosis strains were selected and spotted on slides, FTA cards, GenoCards, and in ethanol. GenoType MTBDRplus was subsequently performed with the DNA extracted from these supports. Sensitivity and specificity were calculated and compared to the results obtained by drug susceptibility testing. Results For all supports, the overall sensitivity and specificity for detection of resistance to RIF was between 95% and 100%, and for INH between 95% and 98%. Conclusion The four transport and storage supports showed a good sensitivity and specificity for the detection of resistance to RIF and INH in M. tuberculosis strains using the GenoType MTBDRplus. These supports can be maintained at room temperature and could represent an important alternative cost-effective method useful for rapid molecular detection of drug-resistant TB in low-resource settings. PMID:26431352
Directory of Open Access Journals (Sweden)
Alexandre Gouzy
2014-02-01
Full Text Available Mycobacterium tuberculosis is an intracellular pathogen. Within macrophages, M. tuberculosis thrives in a specialized membrane-bound vacuole, the phagosome, whose pH is slightly acidic, and where access to nutrients is limited. Understanding how the bacillus extracts and incorporates nutrients from its host may help develop novel strategies to combat tuberculosis. Here we show that M. tuberculosis employs the asparagine transporter AnsP2 and the secreted asparaginase AnsA to assimilate nitrogen and resist acid stress through asparagine hydrolysis and ammonia release. While the role of AnsP2 is partially spared by yet to be identified transporter(s, that of AnsA is crucial in both phagosome acidification arrest and intracellular replication, as an M. tuberculosis mutant lacking this asparaginase is ultimately attenuated in macrophages and in mice. Our study provides yet another example of the intimate link between physiology and virulence in the tubercle bacillus, and identifies a novel pathway to be targeted for therapeutic purposes.
[Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Peru].
Torres, Julio; Sardón, Victoria; Soto, Mirtha G; Anicama, Rolado; Arroyo-Hernández, Hugo; Munayco, César V
2011-01-01
We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB) cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS). Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months). A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.
Multidrug Resistant Tuberculosis involving the Clavicle, Spine and Ribs
Directory of Open Access Journals (Sweden)
H Krishnan
2011-03-01
Full Text Available This report describes an unusual case of multidrug resistant tuberculosis (MDR-TB, involving the right clavicle and multicentric aytpical spine involvement without any neurological deficit. The female patient presented with acute onset of right clavicular pain associated with a one-month history of lower backache with constitutional symptoms. The clavicular lesion and MRI spine findings were highly suggestive of TB. Anti TB drugs (ATD were started empirically as Sabah, Malaysia the patient’s home, is an endemic area for TB. Despite, 2 months of ATD administration, the patient did not respond well clinically and developed left sided chest wall abscesses arising from the left 3rd and 6th ribs. She was then treated for MDR-TB infection and has responded well to this treatment.
Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu
2016-01-01
Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.
Evaluation of Genetic Pattern of Non-Tuberculosis Mycobacterium Using VNTR Method
Directory of Open Access Journals (Sweden)
Noorozi J
2011-06-01
Full Text Available Background and Objectives: Epidemiological studies of Non-tuberculosis Mycobacterium is important because of the drug resistance pattern and worldwide dissemination of these organisms. One of genetic fingerprinting methods for epidemiological studies is VNTR (Variable Number Tandem Repeat. In this study genetic pattern of atypical Mycobacterium was evaluated by VNTR method for epidemiologic studies. Methods: 48 pulmonary and non pulmonary specimens separated from patients with the symptoms of pulmonary tuberculosis (PTB and identified as Non-tuberculosis Mycobacteriumby phenotypic and PCR-RFLP methods were selected for this study. Clinical samples and their standard strains were evaluated according to VNTR pattern using the 7 genetic loci including ETR-B. ETR-F. ETR-C. MPTR-A. ETR-A. ETR-E. ETR-D.Results: The results of VNTR method showed that none of the 7 loci had any polymorphism in the standard strains of atypical mycobacterium. Some of these variable number tandem repeat in 42 clinical samples of non-tuberculosis Mycobacterium were polymorphic while the PCR product (for any loci was not found in the remaining 6 specimens. Conclusion: Although the used genetic loci of this study were suitable for epidemiological studies of Mycobacterium tuberculosis, these loci were not able to determine the diversity of genetics of non-tuberculosis Mycobacterium Therefore, it seems necessary that other loci be studied using VNTR method.
Detection of mycobacterium tuberculosis in clinical samples by smear and culture
International Nuclear Information System (INIS)
Aftab, R.; Amjad, F.; Khurshid, R.
2009-01-01
Pcr for early detection and drug susceptibility keeping in view the rise in the number of multi-drug resistant cases of tuberculosis in the last few years. (author)
Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12
Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted
2012-01-01
SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962
Surgical Face Masks Worn by Patients with Multidrug-Resistant Tuberculosis
Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A.; van der Walt, Martie; Nardell, Edward A.
2012-01-01
Rationale: Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. Objectives: We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Methods: Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Measurements and Main Results: Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68–85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31–51%), representing a 56% (95% CI, 33–70.5%) decreased risk of TB transmission when patients used masks. Conclusions: Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients. PMID:22323300
Bolhuis, M. S.; van Altena, R.; van Hateren, K.; de Lange, W. C. M.; Greijdanus, B.; Uges, D. R. A.; Kosterink, J. G. W.; van der Werf, T. S.; Alffenaar, J. W. C.
Linezolid plays an increasingly important role in the treatment of multidrug-resistant tuberculosis (MDR-TB). However, patients should be carefully monitored due to time-and dose-dependent toxicity. Clarithromycin plays a more modest role. Therapeutic drug monitoring may contribute to assessment of
Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds
Directory of Open Access Journals (Sweden)
Cataldi Angel A
2011-07-01
Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are
Pérez-Navarro, Lucia Monserrat; Fuentes-Domínguez, Francisco Javier; Zenteno-Cuevas, Roberto
2015-01-01
To determine the factors associated with the presence of pulmonary tuberculosis in patients with type 2 diabetes mellitus and the effect in the development of drug and multi-drug resistance, in a population with tuberculosis from the southeast of Mexico. This is a case-control study including 409 individuals, 146 with the binomial tuberculosis-type 2 diabetes mellitus and 263 individuals with tuberculosis. Demographic, epidemiological and outcome variables were collected. Risks were calculated. The factors associated with the presence of type 2 diabetes mellitus were age ≥35years, (OR=9.7; CI: 5.2-17.8), previous contact with a person infected with tuberculosis (OR=1.7; CI: 1.1-3.1). Body mass index ≥25 kg/m(2) (OR=2.2; CI: 1.1-4.3), and inherited family history of diabetes (OR=5.4; CI: 3.2-9.2). It was also found that patients with tuberculosis-type 2 diabetes mellitus presented a 4.7-fold (CI: 1.4-11.3) and 3.5-fold (CI: 1.1-11.1) higher risk of developing drug- and multidrug resistance tuberculosis, respectively. By last, individuals with tuberculosis-type 2 diabetes had a 2.3-fold (CI: 1.5-4.1) greater chance of persisting as tuberculosis-positive by the second month of treatment, delaying the resolution of the tuberculosis infection. Type 2 diabetes exerts a strong influence on the presentation and evolution of tuberculosis within the analyzed population and displays remarkable particularities, necessitating the development of dedicated tuberculosis-diabetes surveillance systems that consider the particular epidemiological characteristics of the population affected. Copyright © 2015 Elsevier Inc. All rights reserved.
Genome-wide analysis of multi- and extensively drug-resistant Mycobacterium tuberculosis
Coll, Francesc
2018-01-16
To characterize the genetic determinants of resistance to antituberculosis drugs, we performed a genome-wide association study (GWAS) of 6,465 Mycobacterium tuberculosis clinical isolates from more than 30 countries. A GWAS approach within a mixed-regression framework was followed by a phylogenetics-based test for independent mutations. In addition to mutations in established and recently described resistance-associated genes, novel mutations were discovered for resistance to cycloserine, ethionamide and para-aminosalicylic acid. The capacity to detect mutations associated with resistance to ethionamide, pyrazinamide, capreomycin, cycloserine and para-aminosalicylic acid was enhanced by inclusion of insertions and deletions. Odds ratios for mutations within candidate genes were found to reflect levels of resistance. New epistatic relationships between candidate drug-resistance-associated genes were identified. Findings also suggest the involvement of efflux pumps (drrA and Rv2688c) in the emergence of resistance. This study will inform the design of new diagnostic tests and expedite the investigation of resistance and compensatory epistatic mechanisms.
Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.
2013-01-01
Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO
INHIBITION OF MYCOLIC ACID TRANSPORT ACROSS THE MYCOBACTERIUM TUBERCULOSIS PLASMA MEMBRANE
Grzegorzewicz, Anna E.; Pham, Ha; Gundi, Vijay A. K. B.; Scherman, Michael S.; North, Elton J.; Hess, Tamara; Jones, Victoria; Gruppo, Veronica; Born, Sarah E. M.; Korduláková, Jana; Chavadi, Sivagami Sundaram; Morisseau, Christophe; Lenaerts, Anne J.; Lee, Richard E.; McNeil, Michael R.; Jackson, Mary
2011-01-01
New chemotherapeutics active against multidrug-resistant Mycobacterium tuberculosis (M. tb) are urgently needed. We report on the identification of an adamantyl urea compound displaying potent bactericidal activity against M. tb and a unique mode of action, namely the abolition of the translocation of mycolic acids from the cytoplasm where they are synthesized to the periplasmic side of the plasma membrane where they are transferred onto cell wall arabinogalactan or used in the formation of virulence-associated outer membrane trehalose-containing glycolipids. Whole genome sequencing of spontaneous resistant mutants of M. tb selected in vitro followed by genetic validation experiments revealed that our prototype inhibitor targets the inner membrane transporter, MmpL3. Conditional gene expression of mmpL3 in mycobacteria and analysis of inhibitor-treated cells validate MmpL3 as essential for mycobacterial growth and support the involvement of this transporter in the translocation of trehalose monomycolate across the plasma membrane. PMID:22344175
Walls, Genevieve; Bulifon, Sophie; Breysse, Serge; Daneth, Thol; Bonnet, Maryline; Hurtado, Northan; Molfino, Lucas
2015-01-01
There are no recent data on the prevalence of drug-resistant tuberculosis (DR TB) in Cambodia. We aim to describe TB drug resistance amongst adults with pulmonary and extra-pulmonary TB and human immunodeficiency virus (HIV) co-infection in a national referral hospital in Phnom Penh, Cambodia. Between 22 November 2007 and 30 November 2009, clinical specimens from HIV-infected patients suspected of having TB underwent routine microscopy, Mycobacterium tuberculosis culture, and drug susceptibility testing. Laboratory and clinical data were collected for patients with positive M. tuberculosis cultures. M. tuberculosis was cultured from 236 HIV-infected patients. Resistance to any first-line TB drug occurred in 34.7% of patients; 8.1% had multidrug resistant tuberculosis (MDR TB). The proportion of MDR TB amongst new patients and previously treated patients was 3.7 and 28.9%, respectively (pCambodia may be higher than previously recognised, particularly amongst HIV-infected patients. Additional prevalence studies are needed. This study also illustrates the feasibility and utility of analysis of non-respiratory specimens in the diagnosis of TB, even in low-resource settings, and suggests that extra-pulmonary specimens should be included in TB diagnostic algorithms.
Directory of Open Access Journals (Sweden)
Bostanabad S
2008-01-01
Full Text Available The aim of this study was to investigate the frequency, location and type of katG mutations in Mycobacterium tuberculosis strains isolated from patients in Belarus. Forty two isoniazid-resistant isolates were identified from sputum of 163 patients with active pulmonary tuberculosis. Drug susceptibility testing was determined by using CDC standard conventional proportional method and BACTEC system. Standard PCR method for detection of isoniazid resistance associated mutations was performed by katG gene amplification and DNA sequencing. Most mutations were found in katG gene codons 315, 316 and 309. Four types of mutations were identified in codon 315: AGC→ACC ( n = 36 85%, AGC→AGG ( n = 1 2.3%, AGC→AAC ( n = 2 4.7%, AGC→GGC ( n = 1 2.3%. One type of mutation was found in codon 316: GGC→AGC ( n = 1841.4%, four types of mutations were detected in codon 309: GGT→GGT ( n = 716.1%, GGT→GCT ( n = 49.2%, GGT→GTC ( n = 36.9%, GGT→GGG ( n = 12.7%. The highest frequency of mutations sharing between primary and secondary infections was found in codon 315.
Juréen, P.; Ängeby, K.; Sturegård, E.; Chryssanthou, E.; Giske, C. G.; Werngren, J.; Nordvall, M.; Johansson, A.; Kahlmeter, G.; Hoffner, S.; Schön, T.
2010-01-01
The aminoglycosides and cyclic polypeptides are essential drugs in the treatment of multidrug-resistant tuberculosis, underscoring the need for accurate and reproducible drug susceptibility testing (DST). The epidemiological cutoff value (ECOFF) separating wild-type susceptible strains from non-wild-type strains is an important but rarely used tool for indicating susceptibility breakpoints against Mycobacterium tuberculosis. In this study, we established wild-type MIC distributions on Middlebrook 7H10 medium for amikacin, kanamycin, streptomycin, capreomycin, and viomycin using 90 consecutive clinical isolates and 21 resistant strains. Overall, the MIC variation between and within runs did not exceed ±1 MIC dilution step, and validation of MIC values in Bactec 960 MGIT demonstrated good agreement. Tentative ECOFFs defining the wild type were established for all investigated drugs, including amikacin and viomycin, which currently lack susceptibility breakpoints for 7H10. Five out of seven amikacin- and kanamycin-resistant isolates were classified as susceptible to capreomycin according to the current critical concentration (10 mg/liter) but were non-wild type according to the ECOFF (4 mg/liter), suggesting that the critical concentration may be too high. All amikacin- and kanamycin-resistant isolates were clearly below the ECOFF for viomycin, and two of them were below the ECOFF for streptomycin, indicating that these two drugs may be considered for treatment of amikacin-resistant strains. Pharmacodynamic indices (peak serum concentration [Cmax]/MIC) were more favorable for amikacin and viomycin compared to kanamycin and capreomycin. In conclusion, our data emphasize the importance of establishing wild-type MIC distributions for improving the quality of drug susceptibility testing against Mycobacterium tuberculosis. PMID:20237102
Affolabi, Dissou; Sanoussi, N'Dira; Codo, Sergio; Sogbo, Fréderic; Wachinou, Prudence; Massou, Faridath; Kehinde, Aderemi; Anagonou, Séverin
2017-01-01
Molecular studies on tuberculosis (TB) are rare in low-resource countries like Benin, where data on molecular study on previously treated TB cases is unavailable. From January to December 2014, all smear- and culture-positive previously treated pulmonary TB patients from all TB clinics were systematically recruited. Drug susceptibility testing and spoligotyping were performed on all isolates. Of the 100 patients recruited, 71 (71.0%) were relapse cases and 24 (24.0%) were failure cases, while 5 (5.0%) were default cases. Resistance rate to any first-line drug was 40.0%, while 12.0% of strains were multidrug-resistant (MDR) and no strain was extensively drug-resistant (XDR). A total of 40 distinct spoligotypes were found to be corresponding to a genotypic diversity of 40.0%. ST61 was the most predominant spoligotype with prevalence of 33.0%. In all, 31 single spoligotypes and nine clusters were observed with 2 to 33 strains per cluster giving a clustering rate of 69.0%. Euro-American (Lineage 4) was the most prevalent lineage (74.0%) and Lineage 2 was associated with resistance to streptomycin. This first insight into genetic diversity of previously treated pulmonary TB patients in Benin showed a relatively high genetic diversity of Mycobacterium tuberculosis .
Directory of Open Access Journals (Sweden)
Dissou Affolabi
2017-01-01
Full Text Available Background. Molecular studies on tuberculosis (TB are rare in low-resource countries like Benin, where data on molecular study on previously treated TB cases is unavailable. Materials and Methods. From January to December 2014, all smear- and culture-positive previously treated pulmonary TB patients from all TB clinics were systematically recruited. Drug susceptibility testing and spoligotyping were performed on all isolates. Results. Of the 100 patients recruited, 71 (71.0% were relapse cases and 24 (24.0% were failure cases, while 5 (5.0% were default cases. Resistance rate to any first-line drug was 40.0%, while 12.0% of strains were multidrug-resistant (MDR and no strain was extensively drug-resistant (XDR. A total of 40 distinct spoligotypes were found to be corresponding to a genotypic diversity of 40.0%. ST61 was the most predominant spoligotype with prevalence of 33.0%. In all, 31 single spoligotypes and nine clusters were observed with 2 to 33 strains per cluster giving a clustering rate of 69.0%. Euro-American (Lineage 4 was the most prevalent lineage (74.0% and Lineage 2 was associated with resistance to streptomycin. Conclusion. This first insight into genetic diversity of previously treated pulmonary TB patients in Benin showed a relatively high genetic diversity of Mycobacterium tuberculosis.
MIRU-VNTR typing of drug-resistant tuberculosis isolates in Greece.
Rovina, Nikoletta; Karabela, Simona; Constantoulakis, Pantelis; Michou, Vassiliki; Konstantinou, Konstantinos; Sgountzos, Vassileios; Roussos, Charis; Poulakis, Nikolaos
2011-08-01
The increasing immigration rate in Greece from countries with a high prevalence of Mycobacterium tuberculosis (MTB) and multidrug-resistant tuberculosis (MDR-TB) may have an impact οn the number of MDR-TB cases in Greece. The aim of this study was to genotypically characterize the MTB isolates from patients with pulmonary drug-resistant tuberculosis (DR-TB) in Greece, and to determine whether there is any association between the prevalent genotypes and drug resistance. Fifty-three drug-resistant MTB strains isolated from culture specimens of clinical material from native Greeks and immigrant patients with pulmonary tuberculosis were genotyped using the mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR) method. The phylogenetically distinct groups of isolates identified were: the Beijing (34%), the LAM (11%), the Haarlem (24.5%), the Uganda I (9.4%), the Ural (3.8%), the Delhi/CAS (9.4%) and the Cameroon (3.8%) families. Greek patients were more likely to have monoresistant and polyresistant TB with the most prevalent isolates belonging to the Haarlem family. Among foreign-born patients with MDR-TB, the most prevalent genotypes belonged to the Beijing family. MIRU-VNTR rapidly obtained clinically useful genotyping data, by characterizing clonal MTB heterogeneity in the isolated strains. Our results underline the need for more effective antituberculosis control programs in order to control the expansion of DR-TB in Greece.
Directory of Open Access Journals (Sweden)
Tzu-Chieh Hung
2014-01-01
Full Text Available Tuberculosis (TB is an infectious disease caused by many strains of mycobacteria, but commonly Mycobacterium tuberculosis. As a possible method of reducing the drug resistance of M. tuberculosis, this research investigates the inhibition of Folylpolyglutamate synthetase, a protein transcript from the resistance association gene folC. After molecular docking to screen the traditional Chinese medicine (TCM database, the candidate TCM compounds, with Folylpolyglutamate synthetase, were selected by molecular dynamics. The 10,000 ps simulation in association with RMSD analysis and total energy and structural variation defined the protein-ligand interaction. The selected TCM compounds Saussureamine C, methyl 3-O-feruloylquinate, and Labiatic acid have been found to inhibit the activity of bacteria and viruses and to regulate immunity. We also suggest the possible pathway in protein for each ligand. Compared with the control, similar interactions and structural variations indicate that these compounds might have an effect on Folylpolyglutamate synthetase. Finally, we suggest Saussureamine C is the best candidate compound as the complex has a high score, maintains its structural composition, and has a larger variation value than the control, thus inhibiting the drug resistance ability of Mycobacterium tuberculosis.
Directory of Open Access Journals (Sweden)
João Perdigão
2015-01-01
Full Text Available Multidrug- (MDR and extensively drug-resistant (XDR tuberculosis (TB present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidencerate and unusual and successful XDR-TB strains that have been found in circulation foralmost two decades. For the last 20 years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS. Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon. It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB isolates, mostly recovered in Lisbon, were genotyped by 24-loci Mycobacterial Interspersed Repetitive Unit – Variable Number of Tandem Repeats (MIRU-VNTR and the genomes sequenced using a next generation sequencing platform – Illumina HiSeq 2000. The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1, two of which are associated with XDR-TB (Lisboa3-B and Q1, whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region
Perdigã o, Joã o; Silva, Hugo; Machado, Diana; Macedo, Rita; Maltez, Fernando; Silva, Carla; Jordao, Luisa; Couto, Isabel; Mallard, Kim; Coll, Francesc; Hill-Cawthorne, Grant A.; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Viveiros, Miguel; Portugal, Isabel
2015-01-01
Multidrug- (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidence rate and unusual and successful XDR-TB strains that have been found in circulation for almost two decades. For the last 20. years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS). Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon.It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB) isolates, mostly recovered in Lisbon, were genotyped by 24-. loci Mycobacterial Interspersed Repetitive Unit - Variable Number of Tandem Repeats (MIRU-VNTR) and the genomes sequenced using a next generation sequencing platform - Illumina HiSeq 2000.The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1), two of which are associated with XDR-TB (Lisboa3-B and Q1), whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region: Lisboa3 and Q
Perdigão, João
2015-03-01
Multidrug- (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidence rate and unusual and successful XDR-TB strains that have been found in circulation for almost two decades. For the last 20. years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS). Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon.It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB) isolates, mostly recovered in Lisbon, were genotyped by 24-. loci Mycobacterial Interspersed Repetitive Unit - Variable Number of Tandem Repeats (MIRU-VNTR) and the genomes sequenced using a next generation sequencing platform - Illumina HiSeq 2000.The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1), two of which are associated with XDR-TB (Lisboa3-B and Q1), whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region: Lisboa3 and Q
Casal, M J; Rodriguez, F C; Luna, M D; Benavente, M C
1987-01-01
The in vitro susceptibility of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium avium, Mycobacterium fortuitum, and Mycobacterium chelonae (M. chelonei) to ticarcillin in combination with calvulanic acid (CA) was studied by the agar dilution method. All the M. tuberculosis, M. bovis, and M. africanum strains were inhibited at a ticarcillin concentration of 32 micrograms/ml or lower in combination with 5 micrograms of CA. M. chelonae and M. avium strains ...
MicroRNA signatures from multidrug‑resistant Mycobacterium tuberculosis.
Ren, Na; Gao, Guiju; Sun, Yue; Zhang, Ling; Wang, Huizhu; Hua, Wenhao; Wan, Kanglin; Li, Xingwang
2015-11-01
Tuberculosis (TB) infections, caused by multidrug‑resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug‑resistance in MTB.
Mutations in rpoB and katG genes of multidrug resistant ...
African Journals Online (AJOL)
Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...
International Nuclear Information System (INIS)
Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.
2003-01-01
Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)
[Multidrug-resistant tuberculosis: challenges of a global emergence].
Comolet, T
2015-10-01
Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.
Mycobacterium tuberculosis: nepřekonatelný nepřítel
Czech Academy of Sciences Publication Activity Database
Machová, Iva; Pichová, Iva
2014-01-01
Roč. 24, č. 4 (2014), s. 98-100 ISSN 1210-1737 R&D Projects: GA MŠk LO1302; GA MŠk(CZ) 7E11070 EU Projects: European Commission(XE) 241587 - SYSTEMTB Institutional support: RVO:61388963 Keywords : Mycobacterium tuberculosis * tuberculosis * latent infection * resistance * metabolism * drugs Subject RIV: CE - Biochemistry
van Doorn, H. R.; de Haas, P. E. W.; Kremer, K.; Vandenbroucke-Grauls, C. M. J. E.; Borgdorff, M. W.; van Soolingen, D.
2006-01-01
A previous limited study demonstrated that Mycobacterium tuberculosis isolates with a mutation at amino-acid position 315 of katG (Delta315) exhibited high-level resistance to isoniazid and were more frequently resistant to streptomycin. In the present study, isoniazid-resistant M. tuberculosis
Outbreak of multidrug-resistant tuberculosis in two secondary schools.
Miravet Sorribes, Luis; Arnedo Pena, Alberto; Bellido Blasco, Juan B; Romeu García, María Angeles; Gil Fortuño, María; García Sidro, Patricia; Cortés Miró, Pascual
2016-02-01
To describe an outbreak of multidrug-resistant tuberculosis (MDR-TB) in two schools This was a prospective, observational study of an outbreak of MDR-TB in 2 schools located in the towns of Onda and Nules, in the Spanish province of Castellon, from the moment of detection in November 2008 until November 2014, including patient follow-up and contact tracing. Five cases of MDR-TB were diagnosed. Overall attack rate was 0.9%, and among the contacts traced, 66 had latent tuberculous infection, with an infection rate of 14.4%. Molecular characterization of the 5M. tuberculosis isolates was performed by restriction fragment length polymorphism (RFLP) analysis of the IS6110 sequence. In all 5 patients, cultures were negative at 4-month follow-up, showing the efficacy of the treatment given. No recurrence has been reported to date. In the context of globalization and the increased prevalence of MDR-TB, outbreaks such as the one presented here are only to be expected. Contact tracing, strict follow-up of confirmed cases, the availability of fast diagnostic techniques to avoid treatment delay, and chemoprophylaxis, together with the molecular characterization of strains, are still essential. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.
Radiographic differentiation of atypical tuberculosis from mycobacterium tuberculosis
International Nuclear Information System (INIS)
Tarver, R.D.; Pearcy, E.A.; Conces, D.J. Jr.; Mathur, P.N.
1987-01-01
The chest radiographs of 95 patients with the new diagnosis of atypical turberculosis were reviewed to determine if any significant differences between atypical tuberculosis and that caused by Mycobacterium tuberculosis could be discerned. Findings included upper lobe involvement in B4 of the 95 patients and cavities in 76, with nearly equal groups having no, moderate, or extensive surrounding alveolar disease. Nodules were common; in six patients a nodule was the sole manifestation of disease. Adenopathy was seen in 12 of the 95 patients, atlectasis in 45, pleural thickening in 90, and effusions in three. These radiographic findings did not allow the radiographic differentiation of atypical tuberculosis from Mycobacterium tuberculosis infection
Microbe Profile: Mycobacterium tuberculosis: Humanity's deadly microbial foe.
Gordon, Stephen V; Parish, Tanya
2018-04-01
Mycobacterium tuberculosis is an expert and deadly pathogen, causing the disease tuberculosis (TB) in humans. It has several notable features: the ability to enter non-replicating states for long periods and cause latent infection; metabolic remodelling during chronic infection; a thick, waxy cell wall; slow growth rate in culture; and intrinsic drug resistance and antibiotic tolerance. As a pathogen, M. tuberculosis has a complex relationship with its host, is able to replicate inside macrophages, and expresses diverse immunomodulatory molecules. M. tuberculosis currently causes over 1.8 million deaths a year, making it the world's most deadly human pathogen.
Acid-fast bacilli culture positivity and drug resistance in abdominal tuberculosis in Mumbai, India.
Samant, Hrishikesh; Desai, Devendra; Abraham, Philip; Joshi, Anand; Gupta, Tarun; Rodrigues, Camilla; George, Siji
2014-09-01
Culture positivity for Mycobacterium tuberculosis complex (MTB) in abdominal tuberculosis (TB) using Lowenstein Jensen medium and Bactec system varies from 25 % to 36 %. Data on the prevalence of drug resistance in primary abdominal TB is scant. Our aim was to study the acid-fast bacilli (AFB) culture positivity rate in primary abdominal TB using Bactec Mycobacterial Growth Indicator Tubes (MGIT) system and the prevalence of drug resistance in these patients. Records of patients with abdominal TB (diagnosed on clinical features, endoscopy, histology, microbiology) seen during the period 2008 to 2013 were retrieved from the Gastroenterology and Microbiology departments. Patients with extra-abdominal TB (five pulmonary, two nodal), adnexal (one), and HIV (one) were excluded from analysis. Of 61 patients, 31 (50.8 %) had a positive AFB culture. In the 30 culture-negative patients, histology showed non-caseating granulomas in 25 patients. Drug sensitivity pattern was analyzed in 18 patients; resistance was detected in eight (14.3 % of all patients and 44.4 % of patients in whom drug sensitivity was done) including three (5.4 % of all subjects and 16.6 % in whom drug sensitivity was available) who were multidrug-resistant. The rate of AFB culture positivity in primary abdominal TB was 50.8 % using Bactec MGIT. Likelihood of drug resistance was seen in 14.3 %, of whom 5.4 % were multidrug-resistant.
Drug-resistant tuberculosis--current dilemmas, unanswered questions, challenges, and priority needs.
Zumla, Alimuddin; Abubakar, Ibrahim; Raviglione, Mario; Hoelscher, Michael; Ditiu, Lucica; McHugh, Timothy D; Squire, S Bertel; Cox, Helen; Ford, Nathan; McNerney, Ruth; Marais, Ben; Grobusch, Martin; Lawn, Stephen D; Migliori, Giovanni-Battista; Mwaba, Peter; O'Grady, Justin; Pletschette, Michel; Ramsay, Andrew; Chakaya, Jeremiah; Schito, Marco; Swaminathan, Soumya; Memish, Ziad; Maeurer, Markus; Atun, Rifat
2012-05-15
Tuberculosis was declared a global emergency by the World Health Organization (WHO) in 1993. Following the declaration and the promotion in 1995 of directly observed treatment short course (DOTS), a cost-effective strategy to contain the tuberculosis epidemic, nearly 7 million lives have been saved compared with the pre-DOTS era, high cure rates have been achieved in most countries worldwide, and the global incidence of tuberculosis has been in a slow decline since the early 2000s. However, the emergence and spread of multidrug-resistant (MDR) tuberculosis, extensively drug-resistant (XDR) tuberculosis, and more recently, totally drug-resistant tuberculosis pose a threat to global tuberculosis control. Multidrug-resistant tuberculosis is a man-made problem. Laboratory facilities for drug susceptibility testing are inadequate in most tuberculosis-endemic countries, especially in Africa; thus diagnosis is missed, routine surveillance is not implemented, and the actual numbers of global drug-resistant tuberculosis cases have yet to be estimated. This exposes an ominous situation and reveals an urgent need for commitment by national programs to health system improvement because the response to MDR tuberculosis requires strong health services in general. Multidrug-resistant tuberculosis and XDR tuberculosis greatly complicate patient management within resource-poor national tuberculosis programs, reducing treatment efficacy and increasing the cost of treatment to the extent that it could bankrupt healthcare financing in tuberculosis-endemic areas. Why, despite nearly 20 years of WHO-promoted activity and >12 years of MDR tuberculosis-specific activity, has the country response to the drug-resistant tuberculosis epidemic been so ineffectual? The current dilemmas, unanswered questions, operational issues, challenges, and priority needs for global drug resistance screening and surveillance, improved treatment regimens, and management of outcomes and prevention of DR
Pires, David
2015-10-05
Pyrazinamide (PZA) is active against major Mycobacterium tuberculosis species (M. tuberculosis, M. africanum, and M. microti), but not against M. bovis and M. avium. The latter two are mycobacteria species involved in human and cattle tuberculosis and in HIV co-infections, respectively. PZA is a first-line agent for the treatment of human tuberculosis and requires activation by a mycobacterial pyrazinamidase to form the active metabolite pyrazinoic acid (POA). As a result of this mechanism, resistance to PZA as often found in tuberculosis patients is caused by point mutations in pyrazinamidase. In previous work, we have shown that POA esters and amides synthesized in our laboratory were stable in plasma. Although the amides did not present significant activity, the esters were active against sensitive mycobacteria at concentrations 5-to-10 fold lower than those of PZA. Here, we report that these POA derivatives possess antibacterial efficacy in vitro and ex vivo against several species and strains of Mycobacterium with natural or acquired resistance to PZA, including M. bovis and M. avium. Our results indicate that the resistance was probably overcome by cleavage of the prodrugs into POA and a long-chain alcohol. Although it is not possible to rule out that the esters may have intrinsic activity per se, we bring evidence here that long-chain fatty alcohols possess a significant anti-mycobacterial effect against PZA-resistant species and strains and are not mere inactive promoieties. These findings may lead to candidate dual-drugs having enhanced activity against both PZA-susceptible and PZA-resistant isolates and being suitable for clinical development.
Structural Implications of Mutations Conferring Rifampin Resistance in Mycobacterium leprae.
Vedithi, Sundeep Chaitanya; Malhotra, Sony; Das, Madhusmita; Daniel, Sheela; Kishore, Nanda; George, Anuja; Arumugam, Shantha; Rajan, Lakshmi; Ebenezer, Mannam; Ascher, David B; Arnold, Eddy; Blundell, Tom L
2018-03-22
The rpoB gene encodes the β subunit of RNA polymerase holoenzyme in Mycobacterium leprae (M. leprae). Missense mutations in the rpoB gene were identified as etiological factors for rifampin resistance in leprosy. In the present study, we identified mutations corresponding to rifampin resistance in relapsed leprosy cases from three hospitals in southern India which treat leprosy patients. DNA was extracted from skin biopsies of 35 relapse/multidrug therapy non-respondent leprosy cases, and PCR was performed to amplify the 276 bp rifampin resistance-determining region of the rpoB gene. PCR products were sequenced, and mutations were identified in four out of the 35 cases at codon positions D441Y, D441V, S437L and H476R. The structural and functional effects of these mutations were assessed in the context of three-dimensional comparative models of wild-type and mutant M. leprae RNA polymerase holoenzyme (RNAP), based on the recently solved crystal structures of RNAP of Mycobacterium tuberculosis, containing a synthetic nucleic acid scaffold and rifampin. The resistance mutations were observed to alter the hydrogen-bonding and hydrophobic interactions of rifampin and the 5' ribonucleotide of the growing RNA transcript. This study demonstrates that rifampin-resistant strains of M. leprae among leprosy patients in southern India are likely to arise from mutations that affect the drug-binding site and stability of RNAP.
Directory of Open Access Journals (Sweden)
Sueli Lemes de Ávila Alves
2011-09-01
Full Text Available Drug resistance is one of the major concerns regarding tuberculosis (TB infection worldwide because it hampers control of the disease. Understanding the underlying mechanisms responsible for drug resistance development is of the highest importance. To investigate clinical data from drug-resistant TB patients at the Tropical Diseases Hospital, Goiás (GO, Brazil and to evaluate the molecular basis of rifampin (R and isoniazid (H resistance in Mycobacterium tuberculosis. Drug susceptibility testing was performed on 124 isolates from 100 patients and 24 isolates displayed resistance to R and/or H. Molecular analysis of drug resistance was performed by partial sequencing of the rpoB and katGgenes and analysis of the inhA promoter region. Similarity analysis of isolates was performed by 15 loci mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR typing. The molecular basis of drug resistance among the 24 isolates from 16 patients was confirmed in 18 isolates. Different susceptibility profiles among the isolates from the same individual were observed in five patients; using MIRU-VNTR, we have shown that those isolates were not genetically identical, with differences in one to three loci within the 15 analysed loci. Drug-resistant TB in GO is caused by M. tuberculosis strains with mutations in previously described sites of known genes and some patients harbour a mixed phenotype infection as a consequence of a single infective event; however, further and broader investigations are needed to support our findings.
Dorman, Susan E; Schumacher, Samuel G; Alland, David; Nabeta, Pamela; Armstrong, Derek T; King, Bonnie; Hall, Sandra L; Chakravorty, Soumitesh; Cirillo, Daniela M; Tukvadze, Nestani; Bablishvili, Nino; Stevens, Wendy; Scott, Lesley; Rodrigues, Camilla; Kazi, Mubin I; Joloba, Moses; Nakiyingi, Lydia; Nicol, Mark P; Ghebrekristos, Yonas; Anyango, Irene; Murithi, Wilfred; Dietze, Reynaldo; Lyrio Peres, Renata; Skrahina, Alena; Auchynka, Vera; Chopra, Kamal Kishore; Hanif, Mahmud; Liu, Xin; Yuan, Xing; Boehme, Catharina C; Ellner, Jerrold J; Denkinger, Claudia M
2018-01-01
The Xpert MTB/RIF assay is an automated molecular test that has improved the detection of tuberculosis and rifampicin resistance, but its sensitivity is inadequate in patients with paucibacillary disease or HIV. Xpert MTB/RIF Ultra (Xpert Ultra) was developed to overcome this limitation. We compared the diagnostic performance of Xpert Ultra with that of Xpert for detection of tuberculosis and rifampicin resistance. In this prospective, multicentre, diagnostic accuracy study, we recruited adults with pulmonary tuberculosis symptoms presenting at primary health-care centres and hospitals in eight countries (South Africa, Uganda, Kenya, India, China, Georgia, Belarus, and Brazil). Participants were allocated to the case detection group if no drugs had been taken for tuberculosis in the past 6 months or to the multidrug-resistance risk group if drugs for tuberculosis had been taken in the past 6 months, but drug resistance was suspected. Demographic information, medical history, chest imaging results, and HIV test results were recorded at enrolment, and each participant gave at least three sputum specimen on 2 separate days. Xpert and Xpert Ultra diagnostic performance in the same sputum specimen was compared with culture tests and drug susceptibility testing as reference standards. The primary objectives were to estimate and compare the sensitivity of Xpert Ultra test with that of Xpert for detection of smear-negative tuberculosis and rifampicin resistance and to estimate and compare Xpert Ultra and Xpert specificities for detection of rifampicin resistance. Study participants in the case detection group were included in all analyses, whereas participants in the multidrug-resistance risk group were only included in analyses of rifampicin-resistance detection. Between Feb 18, and Dec 24, 2016, we enrolled 2368 participants for sputum sampling. 248 participants were excluded from the analysis, and 1753 participants were distributed to the case detection group (n=1439
Phelan, Jody
2016-01-01
Abstract Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure and interaction modelling are used to understand the functional effects of putative mutations and provide insight into the molecular mechanisms leading to resistance. Methods To investigate the potential utility of these approaches, we analysed the genomes of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify polymorphisms associated with minimum inhibitory concentrations for first-line anti-tuberculosis drugs. In addition, the effect of identified candidate mutations on protein stability and interactions was assessed quantitatively with well-established computational methods. Results The analysis revealed that mutations in the genes rpoB (rifampicin), katG (isoniazid), inhA-promoter (isoniazid), rpsL (streptomycin) and embB (ethambutol) were responsible for the majority of resistance observed. A subset of the mutations identified in rpoB and katG were predicted to affect protein stability. Further, a strong direct correlation was observed between the minimum inhibitory concentration values and the distance of the mutated residues in the three-dimensional structures of rpoB and katG to their respective drugs binding sites. Conclusions Using the TDR resource, we demonstrate the usefulness of whole genome association and convergent evolution approaches to detect known and potentially novel mutations associated with drug resistance. Further, protein structural modelling could provide a means of predicting the impact of polymorphisms on drug efficacy in the absence of phenotypic data. These approaches could ultimately lead to novel
Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter
2017-07-01
Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR
Directory of Open Access Journals (Sweden)
Anirvan Chatterjee
Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with
Hearing loss in children treated for multidrug-resistant tuberculosis.
Seddon, James A; Thee, Stephanie; Jacobs, Kayleen; Ebrahim, Adam; Hesseling, Anneke C; Schaaf, H Simon
2013-04-01
The aminoglycosides and polypeptides are vital drugs for the management of multidrug-resistant (MDR) tuberculosis (TB). Both classes of drug cause hearing loss. We aimed to determine the extent of hearing loss in children treated for MDR-TB. In this retrospective study, children (Hearing was assessed and classified using audiometry and otoacoustic emissions. Ninety-four children were included (median age: 43 months). Of 93 tested, 28 (30%) were HIV-infected. Twenty-three (24%) children had hearing loss. Culture-confirmed, as opposed to presumed, diagnosis of TB was a risk factor for hearing loss (OR: 4.12; 95% CI: 1.13-15.0; p = 0.02). Seven of 11 (64%) children classified as having hearing loss using audiometry had progression of hearing loss after finishing the injectable drug. Hearing loss is common in children treated for MDR-TB. Alternative drugs are required for the treatment of paediatric MDR-TB. Copyright © 2012 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
A robust SNP barcode for typing Mycobacterium tuberculosis complex strains
Coll, Francesc; McNerney, Ruth; Guerra-Assunç ã o, José Afonso; Glynn, Judith R.; Perdigã o, Joã o; Viveiros, Miguel; Portugal, Isabel; Pain, Arnab; Martin, Nigel; Clark, Taane G.
2014-01-01
Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed
DEFF Research Database (Denmark)
Bothamley, Graham H.; Lange, Christoph; Albrecht, Dirk
2017-01-01
AIM: Europe has the highest documented caseload and greatest increase in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB) of all World Health Organization (WHO) regions. This survey examines how recommendations for M/XDR-TB management are being implemented. METHODS: TBNET is a pan...
Antibacterial Activity of Medicinal Aqueous Plant Extracts against Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Muna Mohammed Buzayan
2012-09-01
Full Text Available Tuberculosis (TB remains a serious health problem in many regions of the world, and the development of resistance to antibiotics by this microbe created the need for new drugs to replace those which have lost effectiveness. This study assesses the medicinal anti-Mycobacterium tuberculosis properties of natural products obtained from plants collected from Eastern Libya. In this study aqueous extracts of nine different plants were assayed for their Mycobacterium tuberculosis inhibitory activity using the BACTEC MGIT960 susceptibility test method. The aqueous extracts of Ceratonia siliqua L, Helichrysum stoechas (L. Moench and Thymus algeriensis did not show any activity against M. tuberculosis in different concentrations. The aqueous extract of Marrubium vulgare L. from Syria showed high activity against M. tuberculosis. Marrubium alysson L., Marrubium vulgare L., Pistacia lentiscus L, Quercus coccifera L, Thymus capitatus (L. Hoffm. & Link, showed varying degrees of activity against M. tuberculosis. The results of this study show that aqueous extracts from six different medicinal plants have different effects against M. tuberculosis in vitro.
Boehme, Catharina C.; Nicol, Mark P.; Nabeta, Pamela; Michael, Joy S.; Gotuzzo, Eduardo; Tahirli, Rasim; Gler, Ma Tarcela; Blakemore, Robert; Worodria, William; Gray, Christen; Huang, Laurence; Caceres, Tatiana; Mehdiyev, Rafail; Raymond, Lawrence; Whitelaw, Andrew; Sagadevan, Kalaiselvan; Alexander, Heather; Albert, Heidi; Cobelens, Frank; Cox, Helen; Alland, David; Perkins, Mark D.
2011-01-01
The Xpert MTB/RIF test (Cepheid, Sunnyvale, CA, USA) can detect tuberculosis and its multidrug-resistant form with very high sensitivity and specificity in controlled studies, but no performance data exist from district and subdistrict health facilities in tuberculosis-endemic countries. We aimed to
Huang, Tsi-Shu; Kunin, Calvin M; Yan, Bo-Shiun; Chen, Yao-Shen; Lee, Susan Shin-Jung; Syu, Wan
2012-03-01
This study was designed to determine the susceptibility of clinical isolates of multidrug-resistant (MDR) and non-MDR Mycobacterium tuberculosis to sulfamethoxazole, trimethoprim and trimethoprim/sulfamethoxazole over a 12 year period in Taiwan. We examined a total of 117 clinical isolates of M. tuberculosis collected from Southern Taiwan, 116 from 1995 to 2006 and an extensively drug-resistant (XDR) isolate in 2009. These included 28 isolates susceptible to all four first-line agents, 52 MDR isolates and 36 isolates with a mixed combination of drug resistance patterns other than MDR and 1 XDR isolate. Sulfamethoxazole inhibited 80% growth of all 117 isolates regardless of their susceptibility to the first-line agents at an MIC(90) of 9.5 mg/L. The concentration required to inhibit 99% growth was 38 mg/L. There were no significant changes in the MIC(50) or MIC(90) of sulfamethoxazole over a 12 year period. All 117 isolates were resistant to trimethoprim at >8 mg/L. The combination of trimethoprim/sulfamethoxazole at a ratio of 1:19 had no additive or synergistic effects. Sulfamethoxazole inhibited the growth of clinical isolates of M. tuberculosis at achievable concentrations in plasma after oral administration. Susceptibility to sulfamethoxazole remained constant over a 12 year period. Trimethoprim was inactive against M. tuberculosis and trimethoprim/sulfamethoxazole provided no additional activity. Although the current and prior studies demonstrate that sulfamethoxazole is active against M. tuberculosis the search needs to continue for more active, lipid-soluble sulphonamides that are better absorbed into tissues and have improved therapeutic efficacy.
Directory of Open Access Journals (Sweden)
Roberta dos Santos Silva Luiz
2013-06-01
Full Text Available OBJECTIVES: This study has used a combination of clinical information, spoligotyping, and georeferencing system to elucidate the genetic diversity of the Mycobacterium tuberculosis isolates circulating in a TB-prevalent municipality of Northeast Brazil. METHODS: A total of 115 M. tuberculosis strains were isolated from pulmonary tuberculosis patients from January 2007 to March 2008 in Fortaleza. Drug susceptibility and spoligotyping assays were performed and place of residence of the patients were georeferenced. RESULTS: Of the M. tuberculosis strains studied, 51 (44.3% isolates were resistant to at least one drug (R-TB and 64 (55.7% were sensitive to all the drugs tested (S-TB. A high frequency of resistance was found in previously treated cases (84% and among new cases (16%; p < 0.001. a total of 74 (64% isolates were grouped into 22 spoligotyped lineages, while 41 (36% isolates were identified as new. among the predominant genotypes, 33% were latim american mediterranean (lam, 12% haarlem (h, and 5% u. there was no association of geographic distribution of rt-tb patients as compared to the controls and also the geographic location to the spoligotype patterns. the geospatial analysis revealed that 24 (23% patients (hot spot zones either shared the same residence or lived in a close neighborhood of a case. among these concentration zones, the patients lived in the same residence and shared a common genotype pattern and resistance pattern. DISCUSSION: it was observed that the spoligopatterns family distribution was similar to that reported for south america, prevailing the lam and h lineages. a high rate-case among the resistant TB group occurs as a result of transmitted and acquired resistance. A more effective surveillance program is needed in order to succeed in reducing tuberculosis in Northeast Brazil.
Directory of Open Access Journals (Sweden)
Roberta dos Santos Silva Luiz
Full Text Available OBJECTIVES: This study has used a combination of clinical information, spoligotyping, and georeferencing system to elucidate the genetic diversity of the Mycobacterium tuberculosis isolates circulating in a TB-prevalent municipality of Northeast Brazil. METHODS: A total of 115 M. tuberculosis strains were isolated from pulmonary tuberculosis patients from January 2007 to March 2008 in Fortaleza. Drug susceptibility and spoligotyping assays were performed and place of residence of the patients were georeferenced. RESULTS: Of the M. tuberculosis strains studied, 51 (44.3% isolates were resistant to at least one drug (R-TB and 64 (55.7% were sensitive to all the drugs tested (S-TB. A high frequency of resistance was found in previously treated cases (84% and among new cases (16%; p < 0.001. a total of 74 (64% isolates were grouped into 22 spoligotyped lineages, while 41 (36% isolates were identified as new. among the predominant genotypes, 33% were latim american mediterranean (lam, 12% haarlem (h, and 5% u. there was no association of geographic distribution of rt-tb patients as compared to the controls and also the geographic location to the spoligotype patterns. the geospatial analysis revealed that 24 (23% patients (hot spot zones either shared the same residence or lived in a close neighborhood of a case. among these concentration zones, the patients lived in the same residence and shared a common genotype pattern and resistance pattern. DISCUSSION: it was observed that the spoligopatterns family distribution was similar to that reported for south america, prevailing the lam and h lineages. a high rate-case among the resistant TB group occurs as a result of transmitted and acquired resistance. A more effective surveillance program is needed in order to succeed in reducing tuberculosis in Northeast Brazil.
Bares, R; Khalid, N; Daniel, H; Dittmann, H; Reimold, M; Gallwitz, B; Schmotzer, C
2016-07-01
Hypothyroidism is an adverse effect of certain anti-tuberculosis drugs. This is a prospective study of the frequency and possible pathomechanisms associated with hypothyroidism due to second-line treatment of multidrug-resistant tuberculosis. Fifty human immunodeficiency virus negative patients and 20 controls were included. All participants underwent ultrasonography of the thyroid and measurement of thyroid stimulating hormone (TSH). TSH levels were checked every 3 months. If hypothyroidism was present, T3, T4 and thyroid peroxidase autoantibodies were measured, and imaging extended to scintigraphy and repeated ultrasonography. Before treatment, 7 patients (14%) and 1 control (5%) were hypothyreotic. During the first 6 months of treatment, TSH levels increased in 41 patients (82%), 39 (78%) had values above the normal range and 19 (38%) had overt hypothyroidism. As none of the patients had signs of autoimmune thyroiditis, interaction with anti-tuberculosis drugs was assumed to be the cause of hypothyroidism. Nine patients died during treatment, all of whom had developed hypothyroidism. In seven, the metabolic situation at their death was known, and they had become euthyreotic following levothyroxine substitution. TSH levels should be checked before initiating anti-tuberculosis treatment and after 3 and 6 months to start timely replacement of levothyroxine. Further studies are needed to elucidate the exact pathomechanism involved in hypothyroidism and whether hypothyroidism can be used as predictor of treatment failure.
Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T
2013-03-01
The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.
Elipashev, A A; Nikolsky, V O; Shprykov, A S
to determine whether the activity of tuberculous inflammation is associated with different clinical forms of drug-resistant pulmonary tuberculosis. The material taken from 310 patients operated on in 2010-2015 were retrospectively examined. The patients underwent economical lung resections of limited extent (typical and atypical ones of up to 3 segments) for circumscribed forms of tuberculosis with bacterial excretion. A study group consisted of 161 (51.9%) patients with drug-resistant variants of pulmonary tuberculosis. A control group included 149 (48.1%) patients with preserved susceptibility of Mycobacterium tuberculosis to anti-TB drugs. The activity of specific changes in tuberculosis was morphologically evaluated in accordance with the classification proposed by B.M. Ariel in 1998. The highest activity of fourth-to-fifth degree specific inflammation, including that outside the primary involvement focus, was obtained in the drug-resistant pulmonary tuberculosis group due to the predominance of patients with cavernous and fibrous-cavernous tuberculosis versus those in whom the susceptibility to chemotherapeutic agents was preserved. A macroscopic study showed that the primary lesion focus had a median size in one-half of the all the examinees; but large tuberculomas, caverns, and fibrous caverns over 4 cm in diameter were multiple and detected in the drug-resistant pulmonary tuberculosis group. Multidrug resistance was observed in more than 60% of the patients with fibrous-cavernous pulmonary tuberculosis, extensive drug resistance was seen in those with cavernous tuberculosis, which is an aggravating factor. The data obtained from the morphological study of the intraoperative material can specify the clinical form of tuberculosis and evaluate the efficiency of preoperative specific therapy. The highest activity of specific inflammation was observed in patients with multiple drug-resistant pulmonary tuberculosis, the prevalence of third-to-fourth degree
Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.
2013-01-01
A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable
Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter
2015-01-01
Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954
Directory of Open Access Journals (Sweden)
Mercedes Macías Parra
2011-01-01
Full Text Available The aim of this study was to determine the frequency of drug resistance and the clonality of genotype patterns in M. tuberculosis clinical isolates from pediatric patients in Mexico (n=90 patients from 19 states; time period—January 2002 to December 2003. Pulmonary disease was the most frequent clinical manifestation (71%. Children with systemic tuberculosis (TB were significantly younger compared to patients with localized TB infections (mean 7.7±6.2 years versus 15±3.4 years P=0.001. Resistance to any anti-TB drug was detected in 24/90 (26.7% of the isolates; 21/90 (23.3% and 10/90 (11.1% were resistant to Isoniazid and Rifampicin, respectively, and 10/90 (11.1% strains were multidrug-resistant (MDR. Spoligotyping produced a total of 55 different patterns; 12/55 corresponded to clustered isolates (n=47, clustering rate of 52.2%, and 43/55 to unclustered isolates (19 patterns were designated as orphan by the SITVIT2 database. Database comparison led to designation of 36 shared types (SITs; 32 SITs (n=65 isolates matched a preexisting shared type in SITVIT2, whereas 4 SITs (n=6 isolates were newly created. Lineage classification based on principal genetic groups (PGG revealed that 10% of the strains belonged to PGG1 (Bovis and Manu lineages. Among PGG2/3 group, the most predominant clade was the Latin-American and Mediterranean (LAM in 27.8% of isolates, followed by Haarlem and T lineages. The number of single drug-resistant (DR and multidrug-resistant (MDR-TB isolates in this study was similar to previously reported in studies from adult population with risk factors. No association between the spoligotype, age, region, or resistance pattern was observed. However, contrary to a study on M. tuberculosis spoligotyping in Acapulco city that characterized a single cluster of SIT19 corresponding to the EAI2-Manila lineage in 70 (26% of patients, not a single SIT19 isolate was found in our pediatric patient population. Neither did we find any
Directory of Open Access Journals (Sweden)
Zahra Derakhshani Nezhad
2012-09-01
Full Text Available Background & Objectives: Ethambutol is one of the four main drugs in treatment of tuberculosis. The most common mutation associated with this drug resistance usually occurs in codon 306 of embB. The aim of this study was to detect ethambutol resistance using Allele-Specific PCR and Spoligotyping in various subtypes of Mycobacterium tuberculosis. Methods : 140 sputum specimens were collected from suspected TB patients. They were digested and decontaminated using Pettrof method before culturing them on LJ medium. Drug susceptibility testing was performed on 106 culture positive specimens using proportional method. DNA was extracted from the isolated organisms and subsequently subjected to Allele-Specific PCR to detect any mutationin embB306. Spoligotyping was then used to determine the subtypes. Results: Out of 106 cultures positive samples, 36 samples (33.9% showed resistance to ethambutol using proportional method. Allele-Specific PCR assay identified 93 as sensitive and 13 (27.6% as resistant strains. The results of PCR were in agreement with result of proportional method. The PCR method revealed that 61.5% of mutation occurred in the first and 38.5% in third nucleotides. Spoligotyping differentiated Mycobacterium tuberculosis strains into Beijing (10 9.4%, Bovis (2 1.8%, CAS (24 22.6%, EAI (1 0.9%, Haarlem (27 25.4%, LAM (5 4.7%, Manu (5 4.7%, T (27 25.4% and U( 2 1,8% families. The high frequency of mutation in embB gene was belonged to Haarlem, CAS and T subfamilies. Conclusion: Based on results current study, mutations in the genes other than embB might have occurred in the resistant strains that gave negative result in Allele-Specific PCR assay. Therefore other mechanisms of resistance to this antibiotic should be investigated.
Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E
2015-02-01
Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.
Proteasomal control of cytokinin synthesis protects Mycobacterium tuberculosis against nitric oxide
Samanovic, Marie I.; Tu, Shengjiang; Novák, Ondřej; Iyer, Lakshminarayan M.; McAllister, Fiona E.; Aravind, L.; Gygi, Steven P.; Hubbard, Stevan R.; Strnad, Miroslav; Darwin, K. Heran
2015-01-01
Summary One of several roles of the Mycobacterium tuberculosis proteasome is to defend against host-produced nitric oxide (NO), a free radical that can damage numerous biological macromolecules. Mutations that inactivate proteasomal degradation in Mycobacterium tuberculosis result in bacteria that are hypersensitive to NO and attenuated for growth in vivo, but it was not known why. To elucidate the link between proteasome function, NO-resistance, and pathogenesis, we screened for suppressors of NO hypersensitivity in a mycobacterial proteasome ATPase mutant and identified mutations in Rv1205. We determined that Rv1205 encodes a pupylated proteasome substrate. Rv1205 is a homologue of the plant enzyme LONELY GUY, which catalyzes the production of hormones called cytokinins. Remarkably, we report for the first time that an obligate human pathogen secretes several cytokinins. Finally, we determined that the Rv1205-dependent accumulation of cytokinin breakdown products is likely responsible for the sensitization of Mycobacterium tuberculosis proteasome-associated mutants to NO. PMID:25728768
Directory of Open Access Journals (Sweden)
Roghieh Moghaddam
2016-01-01
Full Text Available Tuberculosis is one of the most important zoonotic diseases in the world. Rapid diagnosis of the disease and identification of species is extremely important for proper treatment of the disease as some species of the complex are resistant to the first-line of tuberculosis drugs. The aim of present study was molecular identification of Mycobacterium tuberculosis (MTB complex isolates from Kermanshah Province, Iran, which were submitted to the Tuberculosis Reference Laboratory at Razi Vaccine and Serum Research Institute (Tehran, Iran. To identify the genus Mycobacterium, all isolates were subjected to 16S rRNA polymerase chain reaction (PCR, and PCR-IS6110 was subsequently used to confirm that the isolates belonged to MTB complex. Finally, region of difference (RD typing was used to identify the species in the complex. The results of 16S rRNA and IS6110 PCR analysis showed the presence of 543-bp and 245-bp bands, respectively. Furthermore, 146bp, 172bp, 235bp, and 369bp at RD1, RD4, RD9, and RD12, respectively, were observed during RD typing. Thus, based on the results, all isolates were identified as MTB. It is worth mentioning that most tuberculosis cases are identified on the basis of acid-fast bacilli detection, and antibiotic therapy is immediately initiated subsequently. Moreover, it should be noted that some of these acid-fast positive cases might not be of genus Mycobacterium, and thus, the antibiotics prescribed might threaten the health of the patients. Additionally, if the identified bacilli are not within MTB complex, the drug therapy would differ. However, Mycobacterium bovis, which is a member of MTB complex and is resistant to pyrazinamide, requires exact strain identification. Based on the findings, individual isolates should be identified by RD typing methods, which could clearly discriminate the species from each other.
Multidrug-resistant pulmonary tuberculosis in Los Altos, Selva and Norte regions, Chiapas, Mexico.
Sánchez-Pérez, H J; Díaz-Vázquez, A; Nájera-Ortiz, J C; Balandrano, S; Martín-Mateo, M
2010-01-01
To analyse the proportion of multidrug-resistant tuberculosis (MDR-TB) in cultures performed during the period 2000-2002 in Los Altos, Selva and Norte regions, Chiapas, Mexico, and to analyse MDR-TB in terms of clinical and sociodemographic indicators. Cross-sectional study of patients with pulmonary tuberculosis (PTB) from the above regions. Drug susceptibility testing results from two research projects were analysed, as were those of routine sputum samples sent in by health personnel for processing (n = 114). MDR-TB was analysed in terms of the various variables of interest using bivariate tests of association and logistic regression. The proportion of primary MDR-TB was 4.6% (2 of 43), that of secondary MDR-TB was 29.2% (7/24), while among those whose history of treatment was unknown the proportion was 14.3% (3/21). According to the logistic regression model, the variables most highly associated with MDR-TB were as follows: having received anti-tuberculosis treatment previously, cough of >3 years' duration and not being indigenous. The high proportion of MDR cases found in the regions studied shows that it is necessary to significantly improve the control and surveillance of PTB.
de Jong, Bouke C.; Hill, Philip C.; Aiken, Alex; Awine, Timothy; Antonio, Martin; Adetifa, Ifedayo M.; Jackson-Sillah, Dolly J.; Fox, Annette; Deriemer, Kathryn; Gagneux, Sebastien; Borgdorff, Martien W.; McAdam, Keith P. W. J.; Corrah, Tumani; Small, Peter M.; Adegbola, Richard A.
2008-01-01
BACKGROUND: There is considerable variability in the outcome of Mycobacterium tuberculosis infection. We hypothesized that Mycobacterium africanum was less likely than M. tuberculosis to transmit and progress to tuberculosis disease. METHODS: In a cohort study of patients with tuberculosis and their
Directory of Open Access Journals (Sweden)
A K Maurya
2012-01-01
Full Text Available Background: Drug-resistant tuberculosis is one of major current challenges to global public health. The transmission of resistant strains is increasing as a burden of multidrug-resistant tuberculosis (MDR-TB patients in extra pulmonary tuberculosis (EPTB cases in India. Aim and Objectives: The aim was to study trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of EPTB in referral hospitals in northern India. Study Design and Setting: A prospectively observational study and referral medical institutions in northern India. Materials and Methods: All EPTB specimens were processed for Ziehl Neelsen staining, BACTEC culture and BACTEC NAP test for Mycobacterium tuberculosis complex. All M. tuberculosis complex isolates were performed for radiometric-based drug susceptibility pattern against streptomycin, isoniazid, rifampicin and ethambutol using the 1% proportion method. Results: We found that 165/756 (20.5% isolates were identified as M. tuberculosis complex by the NAP test. We observed that 39.9% were resistant to first-line antitubercular drugs. The resistance rate was higher in previously treated patients: H (30.3%, R (16.3%, E (15.7% and S (16.3%. MDR-TB was observed in 13.4%, but, in new cases, this was 11.4% and 19.1% of the previously treated patients (P<0.05. Conclusion: MDR-TB is gradually increased in EPTB cases and predominant resistance to previous treated cases of EPTB. The molecular drug sensitivity test (DST method can be an early decision for chemotherapy in MDR-TB patients. The International Standards of TB Care need to be used by the RNTCP and professional medical associations as a tool to improve TB care in the country.
Bashir, Gulnaz; Wani, Tehmeena; Sharma, Pragya; Katoch, V M; Lone, Rubina; Shah, Azra; Katoch, Kiran; Kakru, D K; Chauhan, Devendra Singh
2017-10-01
As there are no data available regarding the strains of Mycobacterium tuberculosis circulating in Kashmir Valley, India, the current study aimed at describing the genetic diversity of M. tuberculosis strains in this region, by spoligotyping and 12-locus-based MIRU-VNTR typing (Mycobacterial Interspersed Repetitive Unit-Variable Number Tandem Repeat). Sputa from 207 smear positive cases with newly diagnosed pulmonary tuberculosis were subjected to culture for M. tuberculosis. Eighty-five isolates confirmed as M. tuberculosis were subjected to drug susceptibility testing and molecular typing by spoligotyping and MIRU-VNTRs. Drug susceptibility results of 72 isolates revealed 76.3% as fully sensitive while 5.5% as multidrug resistant (MDR). Spoligotyping of 85 isolates detected 42 spoligotypes with 50 isolates (58.8%) clustered into seven spoligotypes. SIT26/CAS1_Del was the major spoligotype (23, 27%) followed by SIT127/H4 (12, 14.1%); CAS lineage (37.6%) was predominant, followed by Haarlem (25.8%) and ill-defined T clade (23.5%). MIRU-VNTR analysis displayed 82 MIRU patterns from 85 strains, including 3 small clusters and 79 unique. MIRU 26 was found to be the most discriminatory locus. Kashmir Valley has CAS as the predominant lineage of M. tuberculosis similar to the rest of the Indian sub-continent, while it is peculiar in having Euro American lineages such as Haarlem and ill-defined T clade. Copyright © 2017 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.
Feuerriegel, S.; Koser, C.; Trube, L.; Archer, John A.C.; Rusch Gerdes, S.; Richter, E.; Niemann, S.
2010-01-01
Single nucleotide polymorphisms (SNPs) involved in the development of resistance represent powerful markers for the rapid detection of first- and second-line resistance in clinical Mycobacterium tuberculosis complex (MTBC) isolates. However
Farnia, Parissa; Masjedi, Mohammad Reza; Mohammadi, Foroozan; Tabarsei, Payam; Farnia, Poopak; Mohammadzadeh, Ali Reza; Baghei, Parvaneh; Varahram, Mohammad; Hoffner, Sven; Velayati, Ali Akbar
2007-01-01
The malachite green microtube (MGMT) susceptibility assay was performed directly on sputum specimens (n = 80) and indirectly on Mycobacterium tuberculosis clinical isolates (n = 60). The technique is based on the malachite green dye, which changes color in response to M. tuberculosis growth. The MGMT assay is simple and rapid and does not require expensive instruments.
Machado, Luzia Neri C; Marcondes, Nadir R; Leite, Clarice Q Fijimura; Santos, Adolfo C Barreto; Pavan, Fernando Rogério; Baldin, Vanessa Pietrowski; Castilho, Aline Lemes; Siqueira, Vera Lúcia D; Baeza, Lilian Cristiane; Berghs, Henri; Cardoso, Rosilene Fressatti
2014-01-01
At the triple border Brazil/Paraguay/Argentina there is easy mobility from one city to another for economic and tourism activities. This constant and fast population mobility is mainly to visit Iguazu Falls, in the Iguazu River, on the border of the Brazilian state of Paraná and the Argentina. As the incidence of tuberculosis is high in this setting, our study aimed to establish a first baseline of circulating genotypic lineages of Mycobacterium tuberculosis. This study included 120 patients from 10 cities in southwestern Paraná, Brazil with pulmonary symptoms, from July 2009 to July 2011. Information about sex, age, clinical features and address was collected by reviewing the national tuberculosis notification database. Of these, 96 (80%) isolates were identified as M. tuberculosis and 22 (22.9%) were drug resistant (20, 20.8% INH mono-resistant and 2, 2.1% multidrug-resistant). All isolates were subjected to genotyping by Spoligotyping and MIRU-VNTR typing. The distribution of the isolates analyzed by spoligotyping revealed 30 distinct patterns. The four mainly detected clades were Latin American and Mediterranean (LAM), ill-defined T, Haarlem (H) and S. The MIRU-VNTR showed 85 distinct patterns. Spoligotyping combined to MIRU-VNTR allowed 90 distinct patterns. Our study demonstrated that there is significant molecular diversity in circulating M. tuberculosis, with predominance of the LAM and T clades in cities of southwestern Paraná, Brazil, bordering Argentina and Paraguay.
Directory of Open Access Journals (Sweden)
Luzia Neri C Machado
Full Text Available BACKGROUND: At the triple border Brazil/Paraguay/Argentina there is easy mobility from one city to another for economic and tourism activities. This constant and fast population mobility is mainly to visit Iguazu Falls, in the Iguazu River, on the border of the Brazilian state of Paraná and the Argentina. As the incidence of tuberculosis is high in this setting, our study aimed to establish a first baseline of circulating genotypic lineages of Mycobacterium tuberculosis. METHODOLOGY/PRINCIPAL FINDINGS: This study included 120 patients from 10 cities in southwestern Paraná, Brazil with pulmonary symptoms, from July 2009 to July 2011. Information about sex, age, clinical features and address was collected by reviewing the national tuberculosis notification database. Of these, 96 (80% isolates were identified as M. tuberculosis and 22 (22.9% were drug resistant (20, 20.8% INH mono-resistant and 2, 2.1% multidrug-resistant. All isolates were subjected to genotyping by Spoligotyping and MIRU-VNTR typing. The distribution of the isolates analyzed by spoligotyping revealed 30 distinct patterns. The four mainly detected clades were Latin American and Mediterranean (LAM, ill-defined T, Haarlem (H and S. The MIRU-VNTR showed 85 distinct patterns. Spoligotyping combined to MIRU-VNTR allowed 90 distinct patterns. CONCLUSIONS/SIGNIFICANCE: Our study demonstrated that there is significant molecular diversity in circulating M. tuberculosis, with predominance of the LAM and T clades in cities of southwestern Paraná, Brazil, bordering Argentina and Paraguay.
Impact of drug resistance on the tuberculosis treatment outcome
Directory of Open Access Journals (Sweden)
E. Lesnic
2017-03-01
Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will
Real-Time Measurement of Host Bioenergetics During Mycobacterium Tuberculosis Infection
2015-05-01
AWARD NUMBER: W81XWH-13-1-0149 TITLE: “Real-Time Measurement of Host Bioenergetics During Mycobacterium Tuberculosis Infection...successfully adapted metabolic flux analysis using a Seahorse XF96 metabolic flux analyzer to study Mycobacterium tuberculosis energy metabolism in an...Mycobacterium tuberculosis function. In: Systems Biology of Tuberculosis . Editors: J McFadden, D Beste and A Kierzek. 2013. Springer, New York, NY. 2
International Nuclear Information System (INIS)
Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.
2015-01-01
Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)
Prevalence of drug resistant tuberculosis in Arsi Zone, Ethiopia ...
African Journals Online (AJOL)
Background: Wide spread of occurrence of multi-drug resistance tuberculosis is becoming a major challenge to effective tuberculosis control. Thus, it is imperative to monitor the sensitivity of anti-TB drugs regularly. Objective: To determine the prevalence resistance to anti-TB drugs in a well established control program area ...
Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.
Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van
2010-01-01
This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was
Zou, Lin; Liu, Min; Wang, Yufeng; Lu, Jie; Pang, Yu
2015-12-01
In this study, our objective was to explore the potential in vitro synergy between linezolid (LZD) and six other anti-TB drugs in Mycobacterium tuberculosis strains, especially multidrug-resistant tuberculosis (MDR-TB) strains. Among the different combinations, the LZD-clarithromycin (CLA) combination showed the best synergism, which was observed in 85% (34/40) of 40 isolates. In addition, one (2.5%) and twenty-one (52.5%) of 40 isolates showed synergism for the LZD-levofloxcin (LEV) and LZD-moxifloxacin (MOX) combinations, respectively, and the difference in the proportion of synergy between these two combinations was significantly different (P synergy against non-MDR group seemed higher than that against MDR group in each combination, while the significant difference was only observed in the LZD-EMB combination (P = 0.046). In conclusion, our findings demonstrate that LZD shows the synergistic activity against both non-MDR and MDR M. tuberculosis strains when in combination with CLA, EMB, MOX, amikacin and clofazimine, indicating that LZD may be considered as a promising component involving the regimen for the treatment of MDR-TB. Copyright © 2015 Elsevier Ltd. All rights reserved.
Feuerriegel, S.
2010-08-30
Single nucleotide polymorphisms (SNPs) involved in the development of resistance represent powerful markers for the rapid detection of first- and second-line resistance in clinical Mycobacterium tuberculosis complex (MTBC) isolates. However, the association between particular mutations and phenotypic resistance is not always clear-cut, and phylogenetic SNPs have been misclassified as resistance markers in the past. In the present study, we investigated the utility of a specific polymorphism in thyA (Thr202Ala) as a marker for resistance to para-aminosalicyclic acid (PAS). Sixty-three PAS-susceptible MTBC strains comprising all major phylogenetic lineages, reference strain H37Rv, and 135 multidrug-resistant (MDR) strains from Germany (comprising 8 PAS-resistant isolates) were investigated for the presence of Thr202Ala. In both strain collections, the Thr202Ala SNP was found exclusively in strains of the Latin American Mediterranean (LAM) lineage irrespective of PAS resistance. Furthermore, PAS MICs (0.5 mg/liter) for selected LAM strains (all containing the SNP) and non-LAM strains (not containing the SNP), as well as the results of growth curve analyses performed in liquid 7H9 medium in the presence of increasing PAS concentrations (0 to 2.0 mg/liter), were identical. In conclusion, our data demonstrate that the Thr202Ala polymorphism in thyA is not a valid marker for PAS resistance but, instead, represents a phylogenetic marker for the LAM lineage of the M. tuberculosis complex. These findings challenge some of the previous understanding of PAS resistance and, as a consequence, warrant further in-depth investigations of the genetic variation in PAS-resistant clinical isolates and spontaneous mutants.
Directory of Open Access Journals (Sweden)
Ruth McNerney
2017-03-01
Full Text Available Whole genome sequencing (WGS can provide a comprehensive analysis of Mycobacterium tuberculosis mutations that cause resistance to anti-tuberculosis drugs. With the deployment of bench-top sequencers and rapid analytical software, WGS is poised to become a useful tool to guide treatment. However, direct sequencing from clinical specimens to provide a full drug resistance profile remains a serious challenge. This article reviews current practices for extracting M. tuberculosis DNA and possible solutions for sampling sputum. Techniques under consideration include enzymatic digestion, physical disruption, chemical degradation, detergent solubilization, solvent extraction, ligand-coated magnetic beads, silica columns, and oligonucleotide pull-down baits. Selective amplification of genomic bacterial DNA in sputum prior to WGS may provide a solution, and differential lysis to reduce the levels of contaminating human DNA is also being explored. To remove this bottleneck and accelerate access to WGS for patients with suspected drug-resistant tuberculosis, it is suggested that a coordinated and collaborative approach be taken to more rapidly optimize, compare, and validate methodologies for sequencing from patient samples.
Li, Qiang; Ou, Xi C; Pang, Yu; Xia, Hui; Huang, Hai R; Zhao, Bing; Wang, Sheng F; Zhao, Yan L
2017-07-01
MiniLab tuberculosis (ML TB) assay is a new automatic diagnostic tool for diagnosis of multidrug resistance tuberculosis (MDR-TB). This study was conducted with aims to know the performance of this assay. Sputum sample from 224 TB suspects was collected from tuberculosis suspects seeking medical care at Beijing Chest hospital. The sputum samples were directly used for smear and ML TB test. The left sputum sample was used to conduct Xpert MTB/RIF, Bactec MGIT culture and drug susceptibility test (DST). All discrepancies between the results from DST, molecular and phenotypic methods were confirmed by DNA Sequencing. The sensitivity and specificity of ML TB test for detecting MTBC from TB suspects were 95.1% and 88.9%, respectively. The sensitivity for smear negative TB suspects was 64.3%. For detection of RIF resistance, the sensitivity and specificity of ML TB test were 89.2% and 95.7%, respectively. For detection of INH resistance, the sensitivity and specificity of ML TB test were 78.3% and 98.1%, respectively. ML TB test showed similar performance to Xpert MTB/RIF for detection of MTBC and RIF resistance. In addition, ML TB also had good performance for INH resistance detection. Copyright © 2017. Published by Elsevier Ltd.
DNA repair in Mycobacterium tuberculosis revisited.
Dos Vultos, Tiago; Mestre, Olga; Tonjum, Tone; Gicquel, Brigitte
2009-05-01
Our understanding of Mycobacterium tuberculosis DNA repair mechanisms is still poor compared with that of other bacterial organisms. However, the publication of the first complete M. tuberculosis genome sequence 10 years ago boosted the study of DNA repair systems in this organism. A first step in the elucidation of M. tuberculosis DNA repair mechanisms was taken by Mizrahi and Andersen, who identified homologs of genes involved in the reversal or repair of DNA damage in Escherichia coli and related organisms. Genes required for nucleotide excision repair, base excision repair, recombination, and SOS repair and mutagenesis were identified. Notably, no homologs of genes involved in mismatch repair were identified. Novel characteristics of the M. tuberculosis DNA repair machinery have been found over the last decade, such as nonhomologous end joining, the presence of Mpg, ERCC3 and Hlr - proteins previously presumed to be produced exclusively in mammalian cells - and the recently discovered bifunctional dCTP deaminase:dUTPase. The study of these systems is important to develop therapeutic agents that can counteract M. tuberculosis evolutionary changes and to prevent adaptive events resulting in antibiotic resistance. This review summarizes our current understanding of the M. tuberculosis DNA repair system.
Phelan, Jody; Coll, Francesc; McNerney, Ruth; Ascher, David B.; Pires, Douglas E. V.; Furnham, Nick; Coeck, Nele; Hill-Cawthorne, Grant A.; Nair, Mridul; Mallard, Kim; Ramsay, Andrew; Campino, Susana; Hibberd, Martin L.; Pain, Arnab; Rigouts, Leen; Clark, Taane G.
2016-01-01
of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify
Regulation of Three Virulence Strategies of Mycobacterium tuberculosis: A Success Story
van Dam, Jesse C. J.; Martins dos Santos, Vitor A. P.
2018-01-01
Tuberculosis remains one of the deadliest diseases. Emergence of drug-resistant and multidrug-resistant M. tuberculosis strains makes treating tuberculosis increasingly challenging. In order to develop novel intervention strategies, detailed understanding of the molecular mechanisms behind the success of this pathogen is required. Here, we review recent literature to provide a systems level overview of the molecular and cellular components involved in divalent metal homeostasis and their role in regulating the three main virulence strategies of M. tuberculosis: immune modulation, dormancy and phagosomal rupture. We provide a visual and modular overview of these components and their regulation. Our analysis identified a single regulatory cascade for these three virulence strategies that respond to limited availability of divalent metals in the phagosome. PMID:29364195
Directory of Open Access Journals (Sweden)
Divakar Sharma
2016-11-01
Full Text Available Emergence of extremely drug resistant tuberculosis (XDR-TB is the consequence of the failure of second line TB treatment. Aminoglycosides are the important second line anti-TB drugs used to treat the multi drug resistant tuberculosis (MDR-TB. Main known mechanism of action of aminoglycosides is to inhibit the protein synthesis by inhibiting the normal functioning of ribosome. Primary target of aminoglycosides are the ribosomal RNA and its associated proteins. Various mechanisms have been proposed for aminoglycosides resistance but still some are unsolved. As proteins are involved in most of the biological processes, these act as a potential diagnostic markers and drug targets. In the present study we analyzed the purely cytosolic proteome of amikacin (AK and kanamycin (KM resistant Mycobacterium tuberculosis isolates by proteomic and bioinformatic approaches. Twenty protein spots were found to have over expressed in resistant isolates and were identified. Among these Rv3208A, Rv2623, Rv1360, Rv2140c, Rv1636 and Rv2185c are six proteins with unknown functions or undefined role. Docking results showed that AK and KM binds to the conserved domain (DUF, USP-A, Luciferase, PEBP and Polyketidecyclase/dehydrase domain of these hypothetical proteins and over expression of these proteins might neutralize/modulate the effect of drug molecules. TBPred and GPS-PUP predicted cytoplasmic nature and potential pupylation sites within these identified proteins respectively. String analysis also suggested that over expressed proteins along with their interactive partners might be involved in aminoglycosides resistance. Cumulative effect of these over expressed proteins could be involved in AK and KM resistance by mitigating the toxicity, repression of drug target and neutralizing affect. These findings need further exploitation for the expansion of newer therapeutics or diagnostic markers against AK and KM resistance so that an extreme condition like XDR-TB can
Sharma, Divakar; Lata, Manju; Singh, Rananjay; Deo, Nirmala; Venkatesan, Krishnamurthy; Bisht, Deepa
2016-01-01
Emergence of extensively drug resistant tuberculosis (XDR-TB) is the consequence of the failure of second line TB treatment. Aminoglycosides are the important second line anti-TB drugs used to treat the multi drug resistant tuberculosis (MDR-TB). Main known mechanism of action of aminoglycosides is to inhibit the protein synthesis by inhibiting the normal functioning of ribosome. Primary target of aminoglycosides are the ribosomal RNA and its associated proteins. Various mechanisms have been proposed for aminoglycosides resistance but still some are unsolved. As proteins are involved in most of the biological processes, these act as a potential diagnostic markers and drug targets. In the present study we analyzed the purely cytosolic proteome of amikacin (AK) and kanamycin (KM) resistant Mycobacterium tuberculosis isolates by proteomic and bioinformatic approaches. Twenty protein spots were found to have over expressed in resistant isolates and were identified. Among these Rv3208A, Rv2623, Rv1360, Rv2140c, Rv1636, and Rv2185c are six proteins with unknown functions or undefined role. Docking results showed that AK and KM binds to the conserved domain (DUF, USP-A, Luciferase, PEBP and Polyketidecyclase/dehydrase domain) of these hypothetical proteins and over expression of these proteins might neutralize/modulate the effect of drug molecules. TBPred and GPS-PUP predicted cytoplasmic nature and potential pupylation sites within these identified proteins, respectively. String analysis also suggested that over expressed proteins along with their interactive partners might be involved in aminoglycosides resistance. Cumulative effect of these over expressed proteins could be involved in AK and KM resistance by mitigating the toxicity, repression of drug target and neutralizing affect. These findings need further exploitation for the expansion of newer therapeutics or diagnostic markers against AK and KM resistance so that an extreme condition like XDR-TB can be prevented.
Directory of Open Access Journals (Sweden)
Bálint Mészáros
2011-07-01
Full Text Available Lengthy co-evolution of Homo sapiens and Mycobacterium tuberculosis, the main causative agent of tuberculosis, resulted in a dramatically successful pathogen species that presents considerable challenge for modern medicine. The continuous and ever increasing appearance of multi-drug resistant mycobacteria necessitates the identification of novel drug targets and drugs with new mechanisms of action. However, further insights are needed to establish automated protocols for target selection based on the available complete genome sequences. In the present study, we perform complete proteome level comparisons between M. tuberculosis, mycobacteria, other prokaryotes and available eukaryotes based on protein domains, local sequence similarities and protein disorder. We show that the enrichment of certain domains in the genome can indicate an important function specific to M. tuberculosis. We identified two families, termed pkn and PE/PPE that stand out in this respect. The common property of these two protein families is a complex domain organization that combines species-specific regions, commonly occurring domains and disordered segments. Besides highlighting promising novel drug target candidates in M. tuberculosis, the presented analysis can also be viewed as a general protocol to identify proteins involved in species-specific functions in a given organism. We conclude that target selection protocols should be extended to include proteins with complex domain architectures instead of focusing on sequentially unique and essential proteins only.
Llerena, Claudia; Medina, Raquel
2017-01-24
The GenoType®MTBDRplusV.2 assay is a molecular technique endorsed by the World Health Organization and the Pan American Health Organization that allows for the identification of the Mycobacterium tuberculosis complex and the detection of mutations in the rpoβ gene for rifampicin resistance, and katG and inhA genes for isoniazid resistance. Due to the genetic variability in the circulating strains around the world, the national tuberculosis control programs should assess the performance of these new diagnostic technologies and their use under program conditions as rapid tests. To describe the mutations identified by the GenoType®MTBDRplusV.2 assay in pulmonary samples and Mycobacterium tuberculosis isolates in the Laboratorio Nacional de Referencia of the Instituto Nacional de Salud in 2014. We conducted a retrospective, descriptive study to detect the expression of inhA, KatG and rpoβ genes, responsible for resistence against isoniazid and rifampicin using the GenoType® MTBDRplus V.2 assay in 837 samples and isolates from tuberculosis cases. Several mutations in the rpoβ gene were identified. Ser531Leu was the most frequent (36.6%) followed by Asp516Val (21.6%), while Ser315Thr1 was the most frequent mutation in the katG gene (91.9%). We were able to identify different mutations present in MDR-TB strains in the country, with frequencies similar to those reported in other countries in the South American region.
Rapid determination of anti-tuberculosis drug resistance from whole-genome sequences
Coll, Francesc; McNerney, Ruth; Preston, Mark D; Guerra-Assunç ã o, José Afonso; Warry, Andrew; Hill-Cawthorne, Grant A.; Mallard, Kim; Nair, Mridul; Miranda, Anabela; Alves, Adriana; Perdigã o, Joã o; Viveiros, Miguel; Portugal, Isabel; Hasan, Zahra; Hasan, Rumina; Glynn, Judith R; Martin, Nigel; Pain, Arnab; Clark, Taane G
2015-01-01
Mycobacterium tuberculosis drug resistance (DR) challenges effective tuberculosis disease control. Current molecular tests examine limited numbers of mutations, and although whole genome sequencing approaches could fully characterise DR, data
Drug resistance in Mexico: results from the National Survey on Drug-Resistant Tuberculosis.
Bojorquez-Chapela, I; Bäcker, C E; Orejel, I; López, A; Díaz-Quiñonez, A; Hernández-Serrato, M I; Balandrano, S; Romero, M; Téllez-Rojo Solís, M M; Castellanos, M; Alpuche, C; Hernández-Ávila, M; López-Gatell, H
2013-04-01
To present estimations obtained from a population-level survey conducted in Mexico of prevalence rates of mono-, poly- and multidrug-resistant strains among newly diagnosed cases of pulmonary tuberculosis (TB), as well as the main factors associated with multidrug resistance (combined resistance to isoniazid and rifampicin). Study data came from the National Survey on TB Drug Resistance (ENTB-2008), a nationally representative survey conducted during 2008-2009 in nine states with a stratified cluster sampling design. Samples were obtained for all newly diagnosed cases of pulmonary TB in selected sites. Drug susceptibility testing (DST) was performed for anti-tuberculosis drugs. DST results were obtained for 75% of the cases. Of these, 82.2% (95%CI 79.5-84.7) were susceptible to all drugs. The prevalence of multidrug-resistant TB (MDR-TB) was estimated at 2.8% (95%CI 1.9-4.0). MDR-TB was associated with previous treatment (OR 3.3, 95%CI 1.1-9.4). The prevalence of drug resistance is relatively low in Mexico. ENTB-2008 can be used as a baseline for future follow-up of drug resistance.
Host immunity to Mycobacterium tuberculosis and risk of tuberculosis
DEFF Research Database (Denmark)
Michelsen, Sascha Wilk; Soborg, Bolette; Agger, Else-Marie
2016-01-01
BACKGROUND: Human immune responses to latent Mycobacterium tuberculosis (Mtb) infection (LTBI) may enable individuals to control Mtb infection and halt progression to tuberculosis (TB), a hypothesis applied in several novel TB vaccines. We aimed to evaluate whether immune responses to selected LTBI...
Efficacy of amikacin and ciprofloxacin against clinical isolates of mycobacterium tuberculosis
International Nuclear Information System (INIS)
Satti, M.; Faqir, F.; Sattar, A.; Abbasi, S.; Butt, T.; Karamat, K.A.; Abidi, M.
2010-01-01
Background: Tuberculosis was a leading cause of death at the turn of the 20 century and continues to be one of the medical scourges of mankind. Before the availability of antimicrobial drugs the cornerstone of treatment was rest in the open air in sanatoria. The major breakthrough in treatment of tuberculosis came with the discovery of Streptomycin. Later, INH, Ethambutol, Pyrazinamide, Rifampicin were added to the arsenal. Objective of this study was to determine the sensitivity of clinical isolates of Mycobacterium tuberculosis against two second-line anti-tuberculosis drugs, Amikacin and Ciprofloxacin. Methods: This cross-sectional study was conducted at Department of Microbiology, Armed Forces Institute of Pathology (AFIP) Rawalpindi. All routine clinical samples received for acid fast bacilli (AFB) in the Department of Microbiology, AFIP, Rawalpindi were processed by modified Petroff's technique and inoculated on Lowenstein Jensen (LJ) medium and Bactec 460 Mycobacterium tuberculosis culture system. After identification of M. tuberculosis sensitivity was performed against first-line anti-tuberculosis drugs. Then susceptibility of M. tuberculosis isolates against Amikacin and Ciprofloxacin was performed on LJ medium. H37Rv was used as control strain. Results: Results were interpreted using resistance ratio method. Out of 100 M. tuberculosis isolates, 98% were sensitive to Amikacin and 97% to Ciprofloxacin. Conclusion: Amikacin and Ciprofloxacin are very effective second line anti-tuberculosis drugs against tuberculosis isolates in our set-up. (author)
Multidrug resistant to extensively drug resistant tuberculosis: What is ...
Indian Academy of Sciences (India)
Prakash
The modern, ... World Health Organization is based on a four-drug regimen ... Better management and control of tuberculosis specially drug resistant TB by experienced and qualified .... a comprehensive approach including the major DOTS.
Inhibition of Glutamine Synthetase: A Potential Drug Target in Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Sherry L. Mowbray
2014-08-01
Full Text Available Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis. Globally, tuberculosis is second only to AIDS in mortality and the disease is responsible for over 1.3 million deaths each year. The impractically long treatment schedules (generally 6–9 months and unpleasant side effects of the current drugs often lead to poor patient compliance, which in turn has resulted in the emergence of multi-, extensively- and totally-drug resistant strains. The development of new classes of anti-tuberculosis drugs and new drug targets is of global importance, since attacking the bacterium using multiple strategies provides the best means to prevent resistance. This review presents an overview of the various strategies and compounds utilized to inhibit glutamine synthetase, a promising target for the development of drugs for TB therapy.
Directory of Open Access Journals (Sweden)
Srivastava S
2008-01-01
Full Text Available Purpose: Ethambutol (EMB is an important first line drug, however little information on its molecular mechanism of resistance and pathogenicity of resistant isolates is available. Present work was designed to study virulence of the EMB resistant M. tuberculosis strains and the host responses in-vivo on infection of EMB resistant M. tuberculosis using Balb/c mouse model of infection. Methods: Three groups of Balb/c mice (female, age 4-6 wk; 21 mice in each group were infected intravenously with 106 CFU of M. tuberculosis H37Rv and two EMB resistant clinical isolates. Age and sex matched control animals were mock inoculated with Middlebrook 7H9 broth alone. At 10, 20, 30, 40, 50, 60, and 70 days post-infection three animals from each group were sacrificed by cervical dislocation and lung tissue was collected for further analysis. Results: Infection with EMB resistant M. tuberculosis led to progressive and chronic disease with significantly high bacillary load (p=0.02. Massive infiltration and exacerbated lung pathology with increased expression of IFN-γ and TNF-α was observed in lungs of mice infected with EMB resistant strains. The present study suggests that infection with EMB resistant M. tuberculosis leads to chronic infection with subsequent loss of lung function, bacterial persistence with elevated expression of TNF-α resulting in increased lung pathology. Conclusion: These findings highlight that EMB resistant M. tuberculosis regulates host immune response differentially and its pathogenicity is different from drug sensitive strains of M. tuberculosis.
Directory of Open Access Journals (Sweden)
Elba Guerrero
2013-03-01
Full Text Available The relation of ethambutol resistance to embB mutations remains unclear, and there are no reports on ethambutol resistance from the Caribbean. We examined the sequence of embB in 57 distinct Multi-Drug Resistant (MDR and non-MDR strains of Mycobacterium tuberculosis, mostly from Cuba and the Dominican Republic. embB306 codon mutations were found exclusively in MDR-TB, but in both ethambutol sensitive and resistant strains. Valine substitutions predominated in ethambutol resistant strains, while isoleucine replacements were more common in sensitive strains. Three ethambutol resistant MDR strains without embB306 substitutions had replacements in embB406 or embB497, but these were also found in ethambutol sensitive MDR strains. The results confirm previous findings that amino acid substitutions in EmbB306, EmbB406 and EmbB497 are found only in MDR-TB strains but in both phenotypically resistant and sensitive strains. One ethambutol resistant non-MDR strain did not have any embB mutation suggesting that other undefined mutations can also confer ethambutol resistance.La relación entre resistencia a etambutol y mutaciones en embB no se ha establecido claramente y no existen comunicaciones sobre la resistencia a etambutol en cepas provenientes de países Caribeños. Se evaluó la secuencia del gen embB en 57 cepas de Mycobacterium tuberculosis multi-drogo resistentes (MDR y no-MDR, la mayoría aislada en Cuba y República Dominicana. Se encontraron mutaciones en el codón embB306 exclusivamente en cepas MDR, tanto en cepas sensibles como resistentes a etambutol. Tres cepas MDR resistentes a etambutol, sin sustituciones en embB306, tenían mutaciones en los codones embB406 o embB497, pero estos cambios se encontraron también en cepas sensibles. Los resultados confirman otros estudios, mostrando que sustituciones aminoacídicas en EmbB306, EmbB406 y EmbB497 se encuentran exclusivamente en cepas MDR, tanto resistentes como sensibles a etambutol
Van Deun, A; Aung, K J; Chowdhury, S; Saha, S; Pankaj, A; Ashraf, A; Rigouts, L; Fissette, K; Portaels, F
1999-02-01
Greater Mymensingh District, a rural area of Bangladesh, at the start of the National Tuberculosis Programme (NTP). To determine the prevalence of initial and acquired drug resistance of Mycobacterium tuberculosis, and to assess the appropriateness of the NTP's standard regimens. Sampling of pre-treatment sputum from all newly registered smear-positive cases in five centres covering the area. Culture and susceptibility testing in a supra-national reference laboratory. Initial resistance to isoniazid (H) was 5.4%, and to rifampicin (R) 0.5%. Acquired H and R resistance were 25.9% and 7.4%, respectively. Multidrug resistance (MDR) was observed in one new case only and in 5.6% of previously treated patients. Changing the present NTP indication for retreatment regimen to one month of previous H intake would increase coverage of H-resistant cases from 52% to 89%, adding 6% to drug costs. The prevalence of drug resistance is surprisingly low in Bangladesh, but could rise with improving economic conditions. The NTP regimens for smear-positive cases are appropriate, all the more so since the human immunodeficiency virus is virtually absent. Indications for the retreatment regimen should be extended to include all patients treated for at least one month with any drug. The NTP regimen for smear-negative cases runs the risk of leading to MDR under present field conditions.
Drug-resistant tuberculosis: emerging treatment options
Directory of Open Access Journals (Sweden)
Adhvaryu MR
2011-12-01
Full Text Available Meghna Adhvaryu1, Bhasker Vakharia21Department of Biotechnology, SRK Institute of Computer Education and Applied Sciences, 2R&D, Bhuma Research in Ayurvedic and Herbal Medicine, Surat, Gujarat, IndiaAbstract: Multidrug-resistant tuberculosis has emerged worldwide, with an increasing incidence due to failure of implementation of apparently effective first-line antituberculous therapy as well as primary infection with drug-resistant strains. Failure of current therapy is attributed to a long duration of treatment leading to nonadherence and irregular therapy, lack of patient education about the disease, poverty, irregular supply by care providers, drug–drug interactions in patients coinfected with human immunodeficiency virus (HIV, inadequate regulations causing market overlap and irresponsible drug usage in the private sector, and lack of research, with no addition of new drugs in the last four decades. Present standards of care for the treatment of drug-susceptible tuberculosis, multidrug-resistant tuberculosis, tuberculosis-HIV coinfection, and latent tuberculosis infection are all unsatisfactory. Since 2000, the World Health Organization (WHO has focused on drug development for tuberculosis, as well as research in all relevant aspects to discover new regimens by 2015 and to eliminate tuberculosis as a public health concern by 2050. As a result, some 20 promising compounds from 14 groups of drugs have been discovered. Twelve candidates from eight classes are currently being evaluated in clinical trials. Ongoing research should prioritize identification of novel targets and newer application of existing drugs, discovery of multitargeted drugs from natural compounds, strengthening host factors by immunopotentiation with herbal immunomodulators, as well as protective vaccines before and after exposure, consideration of surgical measures when indicated, development of tools for rapid diagnosis, early identification of resistant strains, and
Deshpande, Devyani; Srivastava, Shashikant; Nuermberger, Eric; Pasipanodya, Jotam G; Swaminathan, Soumya; Gumbo, Tawanda
2016-11-01
The regimen of linezolid and moxifloxacin was found to be efficacious in the hollow fiber system model of pediatric intracellular tuberculosis. However, its kill rate was slower than the standard 3-drug regimen of isoniazid, rifampin, and pyrazinamide. We wanted to examine the effect of adding a third oral agent, faropenem, to this dual combination. We performed a series of studies in the hollow fiber system model of intracellular Mycobacterium tuberculosis, by mimicking pediatric pharmacokinetics of each antibiotic. First, we varied the percentage of time that faropenem persisted above minimum inhibitory concentration (T MIC ) on the moxifloxacin-linezolid regimen. After choosing the best faropenem exposure, we performed experiments in which we varied the moxifloxacin and linezolid doses in the triple regimen. Finally, we performed longer-duration therapy validation experiments. Bacterial burden was quantified using both colony-forming units per milliliter (CFU/mL) and time to positivity (TTP). Kill slopes were modeled using exponential regression. TTP was a more sensitive measure of bacterial burden than CFU/mL. A faropenem T MIC > 62% was associated with steepest microbial kill slope. Regimens of standard linezolid and moxifloxacin plus faropenem T MIC > 60%, as well as higher-dose moxifloxacin, achieved slopes equivalent to those of the standard regimen based by both TTP and CFU/mL over 28 days of treatment. We have developed an oral faropenem-linezolid-moxifloxacin (FLAME) regimen that is free of first-line drugs. The regimen could be effective against both multidrug-resistant and drug-susceptible tuberculosis in children. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.
In vitro efficacy of ethionamide and clarithromycin in mycobacterium tuberculosis isolates
International Nuclear Information System (INIS)
Satti, M.S.; Abbasi, S.; Rafi, S.; Butt, T.; Karamat, K.A.
2010-01-01
To determine the sensitivity of clinical isolates of Mycobacterium tuberculosis isolates against ethionamide, and clarithromycin. Department of Microbiology, Armed Forces institute of Pathology (AFIP) Rawalpindi from June 2003 to June 2004. Materials and Methods: All routine clinical samples received for acid fast bacilli (AFB) culture and yielding positive growth on Lowenstien Jensen medium and Bactec 460 were include in the study. The isolates were from sputum (n=70), bronchioalveolar lavage (n=10), fine needle aspiration (n=6), lymph nodes (n=7), pleural fluid (n=4), endometrium (n=3). After the identification of M. tuberculosis (MTB) sensitivity was performed against first-line antituberculosis drugs. Then susceptibility of M. tuberculosis isolates against ethionamide and clarithromycih was performed on LJ medium. Mycobacterium H37Rv was used as control strain. Results were interpreted using resistance ratio method. Out of 100 M. tuberculosis isolates, sensitivity to ethionamide was 93% and 9% to clarithromycih. Clarithromycin when used alone is ineffective as antituberculosis drug but its efficacy in combination needs to be tested. However ethionamide may be used as an alternative antituberculosis drug. (author)
A Case of False-Positive Mycobacterium tuberculosis Caused by Mycobacterium celatum
Directory of Open Access Journals (Sweden)
Edward Gildeh
2016-01-01
Full Text Available Mycobacterium celatum is a nontuberculous mycobacterium shown to cause symptoms similar to pulmonary M. tuberculosis. Certain strains have been shown to cross-react with the probes used to detect M. tuberculosis, making this a diagnostic challenge. We present a 56-year-old gentleman who developed signs and symptoms of lung infection with computed tomography scan of the chest showing right lung apex cavitation. Serial sputum samples were positive for acid-fast bacilli and nucleic acid amplification testing identified M. tuberculosis ribosomal RNA, resulting in treatment initiation. Further testing with high performance liquid chromatography showed a pattern consistent with M. celatum. This case illustrates the potential for M. celatum to mimic M. tuberculosis in both its clinical history and laboratory testing due to the identical oligonucleotide sequence contained in both. An increasing number of case reports suggest that early reliable differentiation could reduce unnecessary treatment and public health intervention associated with misdiagnosed tuberculosis.
DEFF Research Database (Denmark)
Idh, Jonna; Mekonnen, Mekidim; Abate, Ebba
2012-01-01
The relative contribution of nitric oxide (NO) to the killing of Mycobacterium tuberculosis in human tuberculosis (TB) is controversial, although this has been firmly established in rodents. Studies have demonstrated that clinical strains of M. tuberculosis differ in susceptibility to NO, but how...
Directory of Open Access Journals (Sweden)
Yih-Yuan Chen
2017-12-01
Full Text Available Background: The Beijing lineage of Mycobacterium tuberculosis (MTB is the most predominant MTB strain in Asian countries and is spreading worldwide, however, the East AfricanâIndian (EAI lineage is also particularly prevalent in many tropical Asian countries. The evolutionary relationships among MTB EAI isolates from Taiwan and those of tropical Asian countries remain unknown. Methods: The EAI strains collected from patients in Taiwan were analyzed using spacer oligonucleotide typing and mycobacterial interspersed repetitive unitâvariable number of tandem repeats (MIRU-VNTR typing, and compared with published profiles from Cambodia and Singapore to investigate potential epidemiological linkages. Results: Among the three countries, the EAI lineage was most prevalent in Cambodia (60%; Singapore, 25.62%; and Taiwan, 21.85%, having also the highest rates of multidrug resistance and lowest rates of clustering of MTB isolates. We describe a convenient method using seven selected MIRU-VNTR loci for first-line typing to discriminate Beijing and EAI lineages. A potential epidemiological linkage in these tropical Asian countries is also discussed based on a minimum-spanning tree constructed using 24 MIRU-VNTR loci of MTB EAI strains. Conclusion: This study identified evolutionary relationships among MTB EAI isolates from Taiwan and those of two other tropical Asian countries, Cambodia and Singapore. Keywords: East AfricanâIndian family, Mycobacterium tuberculosis, tropical Asian countries
Directory of Open Access Journals (Sweden)
Miriam Bobadilla-del Valle
2015-09-01
Full Text Available Mycobacterium tuberculosis causes the majority of tuberculosis (TB cases in humans; however, in developing countries, human TB caused by M. bovis may be frequent but undetected. Human TB caused by M. bovis is considered a zoonosis; transmission is mainly through consumption of unpasteurized dairy products, and it is less frequently attributed to animal-to-human or human-to-human contact. We describe the trends of M. bovis isolation from human samples and first-line drug susceptibility during a 15-year period in a referral laboratory located in a tertiary care hospital in Mexico City.Data on mycobacterial isolates from human clinical samples were retrieved from the laboratory's database for the 2000-2014 period. Susceptibility to first-line drugs: rifampin, isoniazid, streptomycin (STR and ethambutol was determined. We identified 1,165 isolates, 73.7% were M. tuberculosis and 26.2%, M. bovis. Among pulmonary samples, 16.6% were M. bovis. The proportion of M. bovis isolates significantly increased from 7.8% in 2000 to 28.4% in 2014 (X(2trend, p<0.001. Primary STR resistance was higher among M. bovis compared with M. tuberculosis isolates (10.9% vs.3.4%, p<0.001. Secondary multidrug resistance (MDR rates were 38.5% and 34.4% for M. bovis and M. tuberculosis, respectively (p = 0.637. A rising trend of primary STR monoresistance was observed for both species (3.4% in 2000-2004 vs. 7.6% in 2010-2014; p = 0.02.There is a high prevalence and a rising trend of M. bovis isolates in our region. The proportion of pulmonary M. bovis isolates is higher than in previous reports. Additionally, we report high rates of primary anti-tuberculosis resistance and secondary MDR in both M. tuberculosis and M. bovis. This is one of the largest reports on drug susceptibility of M. bovis from human samples and shows a significant proportion of first-line anti-tuberculosis drug resistance.
Directory of Open Access Journals (Sweden)
Anna P Lucarelli
Full Text Available The selection and soaring spread of Mycobacterium tuberculosis multidrug-resistant (MDR-TB and extensively drug-resistant strains (XDR-TB is a severe public health problem. Currently, there is an urgent need for new drugs for tuberculosis treatment, with novel mechanisms of action and, moreover, the necessity to identify new drug targets. Mycobacterial phosphoribosylpyrophosphate synthetase (MtbPRPPase is a crucial enzyme involved in the biosynthesis of decaprenylphosphoryl-arabinose, an essential precursor for the mycobacterial cell wall biosynthesis. Moreover, phosphoribosylpyrophosphate, which is the product of the PRPPase catalyzed reaction, is the precursor for the biosynthesis of nucleotides and of some amino acids such as histidine and tryptophan. In this context, the elucidation of the molecular and functional features of MtbPRPPase is mandatory. MtbPRPPase was obtained as a recombinant form, purified to homogeneity and characterized. According to its hexameric form, substrate specificity and requirement of phosphate for activity, the enzyme proved to belong to the class I of PRPPases. Although the sulfate mimicked the phosphate, it was less effective and required higher concentrations for the enzyme activation. MtbPRPPase showed hyperbolic response to ribose 5-phosphate, but sigmoidal behaviour towards Mg-ATP. The enzyme resulted to be allosterically activated by Mg(2+ or Mn(2+ and inhibited by Ca(2+ and Cu(2+ but, differently from other characterized PRPPases, it showed a better affinity for the Mn(2+ and Cu(2+ ions, indicating a different cation binding site geometry. Moreover, the enzyme from M. tuberculosis was allosterically inhibited by ADP, but less sensitive to inhibition by GDP. The characterization of M. tuberculosis PRPPase provides the starting point for the development of inhibitors for antitubercular drug design.
Mycobacterium tuberculosis monoarthritis in a child
Directory of Open Access Journals (Sweden)
Rosenberg Alan M
2008-09-01
Full Text Available Abstract A child with isolated Mycobacterium tuberculosis monoarthritis, with features initially suggesting oligoarthritis subtype of juvenile idiopathic arthritis, is presented. This patient illustrates the need to consider the possibility of tuberculosis as the cause of oligoarthritis in high-risk pediatric populations even in the absence of a tuberculosis contact history and without evidence of overt pulmonary disease.
Directory of Open Access Journals (Sweden)
Yi Hu
Full Text Available OBJECTIVE: Transmission patterns of drug-resistant Mycobacterium tuberculosis (MTB may be influenced by differences in socio-demographics, local tuberculosis (TB endemicity and efficaciousness of TB control programs. This study aimed to investigate the impact of DOTS on the transmission of drug-resistant TB in eastern rural China. METHODS: We conducted a cross-sectional study of all patients diagnosed with drug-resistant TB over a one-year period in two rural Chinese counties with varying lengths of DOTS implementation. Counties included Deqing, with over 11 years' DOTS implementation and Guanyun, where DOTS was introduced 1 year prior to start of this study. We combined demographic, clinical and epidemiologic information with IS6110-based restricted fragment length polymorphism (RFLP and Spoligotyping analysis of MTB isolates. In addition, we conducted DNA sequencing of resistance determining regions to first-line anti-tuberculosis agents. RESULTS: Of the 223 drug-resistant isolates, 73(32.7% isolates were identified with clustered IS6110RFLP patterns. The clustering proportion among total drug-resistant TB was higher in Guanyun than Deqing (26/101.vs.47/122; p,0.04, but not significantly different among the 53 multidrug-resistant isolates (10/18.vs.24/35; p,0.35. Patients with cavitary had increased risk of clustering in both counties. In Guanyun, patients with positive smear test or previous treatment history had a higher clustering proportion. Beijing genotype and isolates resistant to isoniazid and/or rifampicin were more likely to be clustered. Of the 73 patients with clustered drug-resistant isolates, 71.2% lived in the same or neighboring villages. Epidemiological link (household and social contact was confirmed in 12.3% of the clustered isolates. CONCLUSION: Transmission of drug-resistant TB in eastern rural China is characterized by small clusters and limited geographic spread. Our observations highlight the need for supplementing DOTS
Molecular Characterization of the Resistance of Mycobacterium ...
African Journals Online (AJOL)
Abstract. Purpose: To characterize the resistance of Mycobacterium tuberculosis to second line drugs using a line probe assay. Methods: ... Marne-la-Coquette,. France). Bacterial isolates contained in 500 µl of liquid culture were heat- inactivated at 95 °C for 30 min and then sonicated for 12 min. Finally, the suspension was ...
Rodriguez-Rincon, Daniela; Everall, Isobel; Brown, Karen P; Moreno, Pablo; Verma, Deepshikha; Hill, Emily; Drijkoningen, Judith; Gilligan, Peter; Esther, Charles R; Noone, Peadar G; Giddings, Olivia; Bell, Scott C.; Thomson, Rachel; Wainwright, Claire E.; Coulter, Chris; Pandey, Sushil; Wood, Michelle E; Stockwell, Rebecca E; Ramsay, Kay A; Sherrard, Laura J; Kidd, Timothy J; Jabbour, Nassib; Johnson, Graham R; Knibbs, Luke D; Morawska, Lidia; Sly, Peter D; Jones, Andrew; Bilton, Diana; Laurenson, Ian; Ruddy, Michael; Bourke, Stephen; Bowler, Ian CJW; Chapman, Stephen J; Clayton, Andrew; Cullen, Mairi; Daniels, Thomas; Dempsey, Owen; Denton, Miles; Desai, Maya; Drew, Richard J; Edenborough, Frank; Evans, Jason; Folb, Jonathan; Humphrey, Helen; Isalska, Barbara; Jensen-Fangel, Søren; Jönsson, Bodil; Jones, Andrew M.; Katzenstein, Terese L; Lillebaek, Troels; MacGregor, Gordon; Mayell, Sarah; Millar, Michael; Modha, Deborah; Nash, Edward F; O’Brien, Christopher; O’Brien, Deirdre; Ohri, Chandra; Pao, Caroline S; Peckham, Daniel; Perrin, Felicity; Perry, Audrey; Pressler, Tania; Prtak, Laura; Qvist, Tavs; Robb, Ali; Rodgers, Helen; Schaffer, Kirsten; Shafi, Nadia; van Ingen, Jakko; Walshaw, Martin; Watson, Danie; West, Noreen; Whitehouse, Joanna; Haworth, Charles S; Harris, Simon R; Ordway, Diane; Parkhill, Julian; Floto, R. Andres
2016-01-01
Lung infections with Mycobacterium abscessus, a species of multidrug resistant nontuberculous mycobacteria, are emerging as an important global threat to individuals with cystic fibrosis (CF) where they accelerate inflammatory lung damage leading to increased morbidity and mortality. Previously, M. abscessus was thought to be independently acquired by susceptible individuals from the environment. However, using whole genome analysis of a global collection of clinical isolates, we show that the majority of M. abscessus infections are acquired through transmission, potentially via fomites and aerosols, of recently emerged dominant circulating clones that have spread globally. We demonstrate that these clones are associated with worse clinical outcomes, show increased virulence in cell-based and mouse infection models, and thus represent an urgent international infection challenge. PMID:27846606
In vitro drug susceptibility of Mycobacterium tuberculosis for amikacin, kanamycin and capreomycin.
Dijkstra, J A; van der Laan, T; Akkerman, O W; Bolhuis, M S; de Lange, W C M; Kosterink, J G W; van der Werf, T S; Alffenaar, J W C; van Soolingen, D
2018-01-01
Amikacin, kanamycin and capreomycin are listed among the most important 2nd line drugs for multidrug resistant tuberculosis. Although amikacin and kanamycin are administered in the same dose and show the same pharmacokinetics, they have different WHO breakpoints suggesting that the two drugs have a
Phenotypic assays for Mycobacterium tuberculosis infection.
Song, Ok-Ryul; Deboosere, Nathalie; Delorme, Vincent; Queval, Christophe J; Deloison, Gaspard; Werkmeister, Elisabeth; Lafont, Frank; Baulard, Alain; Iantomasi, Raffaella; Brodin, Priscille
2017-10-01
Tuberculosis (TB) is still a major global threat, killing more than one million persons each year. With the constant increase of Mycobacterium tuberculosis strains resistant to first- and second-line drugs, there is an urgent need for the development of new drugs to control the propagation of TB. Although screenings of small molecules on axenic M. tuberculosis cultures were successful for the identification of novel putative anti-TB drugs, new drugs in the development pipeline remains scarce. Host-directed therapy may represent an alternative for drug development against TB. Indeed, M. tuberculosis has multiple specific interactions within host phagocytes, which may be targeted by small molecules. In order to enable drug discovery strategies against microbes residing within host macrophages, we developed multiple fluorescence-based HT/CS phenotypic assays monitoring the intracellular replication of M. tuberculosis as well as its intracellular trafficking. What we propose here is a population-based, multi-parametric analysis pipeline that can be used to monitor the intracellular fate of M. tuberculosis and the dynamics of cellular events such as phagosomal maturation (acidification and permeabilization), zinc poisoning system or lipid body accumulation. Such analysis allows the quantification of biological events considering the host-pathogen interplay and may thus be derived to other intracellular pathogens. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.
Mycobacterium tuberculosis Metabolism
Warner, Digby F.
2015-01-01
Metabolism underpins the physiology and pathogenesis of Mycobacterium tuberculosis. However, although experimental mycobacteriology has provided key insights into the metabolic pathways that are essential for survival and pathogenesis, determining the metabolic status of bacilli during different stages of infection and in different cellular compartments remains challenging. Recent advances—in particular, the development of systems biology tools such as metabolomics—have enabled key insights into the biochemical state of M. tuberculosis in experimental models of infection. In addition, their use to elucidate mechanisms of action of new and existing antituberculosis drugs is critical for the development of improved interventions to counter tuberculosis. This review provides a broad summary of mycobacterial metabolism, highlighting the adaptation of M. tuberculosis as specialist human pathogen, and discusses recent insights into the strategies used by the host and infecting bacillus to influence the outcomes of the host–pathogen interaction through modulation of metabolic functions. PMID:25502746
International Nuclear Information System (INIS)
Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.
2017-01-01
Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)
Directory of Open Access Journals (Sweden)
Olga Mestre
Full Text Available Mycobacterium tuberculosis has the remarkable capacity to survive within the hostile environment of the macrophage, and to resist potent antibacterial molecules such as reactive oxygen species (ROS. Thus, understanding mycobacterial resistance mechanisms against ROS may contribute to the development of new anti-tuberculosis therapies. Here we identified genes involved in such mechanisms by screening a high-density transposon mutant library, and we show that several of them are involved in the intracellular lifestyle of the pathogen. Many of these genes were found to play a part in cell envelope functions, further strengthening the important role of the mycobacterial cell envelope in protection against aggressions such as the ones caused by ROS inside host cells.
High prevalence of drug-resistant tuberculosis, Republic of Lithuania, 2002
DEFF Research Database (Denmark)
Dewan, P; Sosnovskaja, A; Thomsen, V
2005-01-01
BACKGROUND: Nations of the former Soviet Union have the world's highest reported levels of resistance to anti-tuberculosis drugs. We conducted the first national survey of anti-tuberculosis drug resistance in the Republic of Lithuania. METHODS: We tested Mycobacterium tuberculosis isolates from all...... isolates, 475 (41%) were resistant to at least one first-line drug, and 263 (23%) were resistant to at least INH and RMP (MDR); this included 76/818 (9.3%) from new patients and 187/345 (54%) from previously treated patients. Of 52 MDR isolates randomly selected for extended testing at an international...
Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.
Directory of Open Access Journals (Sweden)
Carole D Mitnick
Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.
Fakhar, Zeynab; Naiker, Suhashni; Alves, Claudio N; Govender, Thavendran; Maguire, Glenn E M; Lameira, Jeronimo; Lamichhane, Gyanu; Kruger, Hendrik G; Honarparvar, Bahareh
2016-11-01
An alarming rise of multidrug-resistant Mycobacterium tuberculosis strains and the continuous high global morbidity of tuberculosis have reinvigorated the need to identify novel targets to combat the disease. The enzymes that catalyze the biosynthesis of peptidoglycan in M. tuberculosis are essential and noteworthy therapeutic targets. In this study, the biochemical function and homology modeling of MurI, MurG, MraY, DapE, DapA, Alr, and Ddl enzymes of the CDC1551 M. tuberculosis strain involved in the biosynthesis of peptidoglycan cell wall are reported. Generation of the 3D structures was achieved with Modeller 9.13. To assess the structural quality of the obtained homology modeled targets, the models were validated using PROCHECK, PDBsum, QMEAN, and ERRAT scores. Molecular dynamics simulations were performed to calculate root mean square deviation (RMSD) and radius of gyration (Rg) of MurI and MurG target proteins and their corresponding templates. For further model validation, RMSD and Rg for selected targets/templates were investigated to compare the close proximity of their dynamic behavior in terms of protein stability and average distances. To identify the potential binding mode required for molecular docking, binding site information of all modeled targets was obtained using two prediction algorithms. A docking study was performed for MurI to determine the potential mode of interaction between the inhibitor and the active site residues. This study presents the first accounts of the 3D structural information for the selected M. tuberculosis targets involved in peptidoglycan biosynthesis.
Directory of Open Access Journals (Sweden)
Genevieve Walls
2015-01-01
Full Text Available Background and objective: There are no recent data on the prevalence of drug-resistant tuberculosis (DR TB in Cambodia. We aim to describe TB drug resistance amongst adults with pulmonary and extra-pulmonary TB and human immunodeficiency virus (HIV co-infection in a national referral hospital in Phnom Penh, Cambodia. Design: Between 22 November 2007 and 30 November 2009, clinical specimens from HIV-infected patients suspected of having TB underwent routine microscopy, Mycobacterium tuberculosis culture, and drug susceptibility testing. Laboratory and clinical data were collected for patients with positive M. tuberculosis cultures. Results: M. tuberculosis was cultured from 236 HIV-infected patients. Resistance to any first-line TB drug occurred in 34.7% of patients; 8.1% had multidrug resistant tuberculosis (MDR TB. The proportion of MDR TB amongst new patients and previously treated patients was 3.7 and 28.9%, respectively (p<0.001. The diagnosis of MDR TB was made after death in 15.8% of patients; in total 26.3% of patients with MDR TB died. The diagnosis of TB was established by culture of extra-pulmonary specimens in 23.6% of cases. Conclusions: There is significant resistance to first-line TB drugs amongst new and previously treated TB–HIV co-infected patients in Phnom Penh. These data suggest that the prevalence of DR TB in Cambodia may be higher than previously recognised, particularly amongst HIV-infected patients. Additional prevalence studies are needed. This study also illustrates the feasibility and utility of analysis of non-respiratory specimens in the diagnosis of TB, even in low-resource settings, and suggests that extra-pulmonary specimens should be included in TB diagnostic algorithms.
Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A
2014-01-01
Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.
Directory of Open Access Journals (Sweden)
Hyun Lee
2017-12-01
Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65â58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome
Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.
Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou
2017-05-01
Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively ( P pleural effusion showed the highest sensitivity of 95.0% but the lowest specificity of 38.9%. The cell-free Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS 6110 per ml of pleural effusion and showed good accordance of the results between repeated tests ( r = 0.978, P = 2.84 × 10 -10 ). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.
Marini, Emanuela; Di Giulio, Mara; Magi, Gloria; Di Lodovico, Silvia; Cimarelli, Maria Enrica; Brenciani, Andrea; Nostro, Antonia; Cellini, Luigina; Facinelli, Bruna
2018-03-01
Curcumin, a phenolic compound extracted from Curcuma longa, exerts multiple pharmacological effects, including an antimicrobial action. Mycobacterium abscessus, an environmental, nontuberculous, rapidly growing mycobacterium, is an emerging human pathogen causing serious lung infections and one of the most difficult to treat, due to its multidrug resistance and biofilm-forming ability. We wanted to evaluate the antimicrobial and antivirulence activity of curcumin and its ability to synergize with antibiotics against a clinical M. abscessus strain (29904), isolated from the bronchoaspirate of a 66-year-old woman admitted to hospital for suspected tuberculosis. Curcumin [minimum inhibitory concentrations (MIC) = 128 mg/L] was synergic (fractional inhibitory concentration index ≤0.5) with amikacin, clarithromycin, ciprofloxacin, and linezolid, to which strain 29904 showed resistance/intermediate susceptibility. Curcumin at 1/8 × MIC significantly reduced motility, whereas at 4 × MIC, it completely inhibited 4- and 8-day mature biofilms. Synergistic combinations of curcumin and amikacin induced a general reduction in microbial aggregates and substantial loss in cell viability. Disruption of 4- and 8-day biofilms was the main effect detected when curcumin was the predominant compound. The present findings support previous evidence that curcumin is a potential antibiotic resistance breaker. Curcumin, either alone or combined with antibiotics, could provide a novel strategy to combat antibiotic resistance and virulence of M. abscessus. Copyright © 2017 John Wiley & Sons, Ltd.
Status of drug-resistant tuberculosis in China: A systematic review and meta-analysis.
Zhang, Jingya; Gou, Haimei; Hu, Xuejiao; Hu, Xin; Shang, Mengqiao; Zhou, Juan; Zhou, Yi; Ye, Yuanxin; Song, Xingbo; Lu, Xiaojun; Chen, Xuerong; Ying, Binwu; Wang, Lanlan
2016-06-01
We conducted a systematic review and meta-analysis on drug-resistant tuberculosis in China to provide useful data for tuberculosis (TB) surveillance and treatment. Several databases, including PubMed, Embase, and the Chinese Biological Medical Database, were systematically searched between January 1, 1999, and August 31, 2015, using strict inclusion and exclusion criteria. The corresponding drug-resistant TB prevalence between the new and previously treated cases was significantly different in almost all of the economic regions. The Eastern coastal region is the most developed economic region with the lowest total drug-resistant TB prevalence (any drug resistance: 28%; 95% confidence interval [CI], 25%-32%; multidrug resistance: 9%; 95% CI, 8%-12%) and the lowest number of new cases (any drug resistance: 21%; 95% CI, 19%-23%; multidrug resistance: 4%; 95% CI, 3%-5%). The Northwest is the least developed area with the lowest drug-resistant TB prevalence for previously treated cases (any drug resistance: 45%; 95% CI, 36%-55%; multidrug resistance: 17%; 95% CI, 11%-26%). The prevalence (multidrug and first-line drug resistance) exhibited a downward trend from 1996-2014. The extensively drug-resistant prevalence in China was 3% (95% CI, 2%-5%) in this review. Overall, the status of drug-resistant tuberculosis in China is notably grim and exhibits regional epidemiologic characteristics. We are in urgent need of several comprehensive and effective control efforts to reverse this situation. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Boshoff, H I; Mizrahi, V
2000-10-01
A pyrazinamidase (PZase)-deficient pncA mutant of Mycobacterium tuberculosis, constructed by allelic exchange, was used to investigate the effects of heterologous amidase gene expression on the susceptibility of this organism to pyrazinamide (PZA) and related amides. The mutant was highly resistant to PZA (MIC, >2,000 microg/ml), in accordance with the well-established role of pncA in the PZA susceptibility of M. tuberculosis (A. Scorpio and Y. Zhang, Nat. Med. 2:662-667, 1996). Integration of the pzaA gene encoding the major PZase/nicotinamidase from Mycobacterium smegmatis (H. I. M. Boshoff and V. Mizrahi, J. Bacteriol. 180:5809-5814, 1998) or the M. tuberculosis pncA gene into the pncA mutant complemented its PZase/nicotinamidase defect. In both pzaA- and pncA-complemented mutant strains, the PZase activity was detected exclusively in the cytoplasm, suggesting an intracellular localization for PzaA and PncA. The pzaA-complemented strain was hypersensitive to PZA (MIC, /=20 microg/ml) and was also sensitive to benzamide (MIC, 20 microg/ml), unlike the wild-type and pncA-complemented mutant strains, which were highly resistant to this amide (MIC, >500 microg/ml). This finding was consistent with the observation that benzamide is hydrolyzed by PzaA but not by PncA. Overexpression of PzaA also conferred sensitivity to PZA, nicotinamide, and benzamide on M. smegmatis (MIC, 150 microg/ml in all cases) and rendered Escherichia coli hypersensitive for growth at low pH.
Multidrug resistant tuberculosis in prisons located in former Soviet countries: A systematic review.
Directory of Open Access Journals (Sweden)
Maxwell Droznin
Full Text Available A systematic literature review was performed to investigate the occurrence of multidrug-resistant tuberculosis (MDR TB in prisons located in countries formerly part of the Soviet Union.A systematic search of published studies reporting MDR TB occurrence in prisons located in former Soviet countries was conducted by probing PubMed and Cumulative Index Nursing and Allied Health Literature for articles that met predetermined inclusion criteria.Seventeen studies were identified for systematic review. Studies were conducted in six different countries. Overall, prevalence of MDR TB among prisoners varied greatly between studies. Our findings suggest a high prevalence of MDR TB in prisons of Post-Soviet states with percentages as high as 16 times more than the worldwide prevalence estimated by the WHO in 2014.All studies suggested a high prevalence of MDR TB in prison populations in Post-Soviet states.
Takii, T; Abe, C; Tamura, A; Ramayah, S; Belisle, J T; Brennan, P J; Onozaki, K
2001-03-01
Mycobacteria-induced in vitro events reflecting human tuberculosis can contribute to the evaluation of the pathogenesis of Mycobacterium tuberculosis (MTB). In this study, we propose such an in vitro method based on live mycobacteria-induced cytotoxicity to human cell lines. When human lung-derived normal fibroblast cell line MRC-5 was infected with various strains of mycobacteria (M. tuberculosis H(37)Rv and H(37) Ra, Mycobacterium avium 427S and 2151SmO, and Mycobacterium bovis BCG Pasteur and Tokyo), the fibroblasts were killed by mycobacteria according to the degree of virulence. Other human originated macrophage (U-937, THP-1), myeloid (HL-60), and epithelial carcinoma (A549) cell lines exhibited a similar cytotoxic response to virulent mycobacteria. MRC-5 was most susceptible to virulent mycobacteria among various human cell lines examined. The cytotoxicity was enhanced by the proinflammatory cytokines, interleukin-1 (IL-1) and tumor necrosis factor-a (TNF-alpha), which in the absence of mycobacteria stimulate the growth of normal human fibroblasts. This in vitro evaluation system was applied to clinical isolates of drug-sensitive MTB (DS-MTB), drug-resistant MTB (DR-MTB) including multidrug-resistant (MDR-MTB), and M. avium complex (MAC). MTB strains (n = 24) exhibited strong cytotoxic activity, but MAC strains (n = 5) had only weak activity. Furthermore, there was no significant difference in cytotoxicity between DS-MTB (n = 11) and DR-MTB (n = 13). Collectively, these results suggest that this new in vitro system is useful for evaluating the pathogenesis of mycobacteria and that there was no difference in the pathogenesis between drug-susceptible and drug-resistant clinical isolates.
Balganesh, Meenakshi; Dinesh, Neela; Sharma, Sreevalli; Kuruppath, Sanjana; Nair, Anju V; Sharma, Umender
2012-05-01
Active efflux of drugs mediated by efflux pumps that confer drug resistance is one of the mechanisms developed by bacteria to counter the adverse effects of antibiotics and chemicals. To understand these efflux mechanisms in Mycobacterium tuberculosis, we generated knockout (KO) mutants of four efflux pumps of the pathogen belonging to different classes. We measured the MICs and kill values of two different compound classes on the wild type (WT) and the efflux pump (EP) KO mutants in the presence and absence of the efflux inhibitors verapamil and l-phenylalanyl-l-arginyl-β-naphthylamide (PAβN). Among the pumps studied, the efflux pumps belonging to the ABC (ATP-binding cassette) class, encoded by Rv1218c, and the SMR (small multidrug resistance) class, encoded by Rv3065, appear to play important roles in mediating the efflux of different chemical classes and antibiotics. Efflux pumps encoded by Rv0849 and Rv1258c also mediate the efflux of these compounds, but to a lesser extent. Increased killing is observed in WT M. tuberculosis cells by these compounds in the presence of either verapamil or PAβN. The efflux pump KO mutants were more susceptible to these compounds in the presence of efflux inhibitors. We have shown that these four efflux pumps of M. tuberculosis play a vital role in mediating efflux of different chemical scaffolds. Inhibitors of one or several of these efflux pumps could have a significant impact in the treatment of tuberculosis. The identification and characterization of Rv0849, a new efflux pump belonging to the MFS (major facilitator superfamily) class, are reported.
Directory of Open Access Journals (Sweden)
Figen KAYSERİLİ ORHAN
2018-03-01
Full Text Available Introduction: Phenotypic methods for drug susceptibility testing of Mycobacterium tuberculosis complex (MTC to second-line drugs are not yet standardized. The Sensititre MycoTB Plate is a microtiter plate containing lyophilized antibiotics and configured for determination of MIC to first and second-line anti-tuberculosis drugs. The purpose of this study is to detect the susceptibility rates of MTC strains isolated from patients’ specimens for first and second-line anti-tuberculosis drugs. Materials and Methods: This study included 50 MTC strains isolated from various clinical specimens. Out of the 50 strains, 38 were isolated from sputum, three from cerebrospinal fluid, three from bronchoalveolar lavage, and six from other samples in this study. The susceptibility of strains to anti-tuberculosis drugs were determined by the Sensititre MycoTB Plate Method. Thawed isolates were subcultured, and dilutions were inoculated into MycoTB wells. The results were read at days 7, 14 and 21. Results: At the end of study, out of 50 MTC isolates, 7 (14% showed resistance to Isoniazid (INH, 5 (10% to streptomycin (SM, 4 (8% to ethambutol (EMB, 4 (8% to ethionamide (ETH, 3 (6% to rifampicin (RIF, 3 (6% to rifabutin (RFB, 2 (4% to kanamycin (KAN, 2 (4% to ofloxacin (OFL, 2 (4% to P-aminosalicyclic acid (PAS, 1 (2% to moxiflocacin (MOX, and 1 (2% to cycloserine (CYC. All strains were found sensitive to amikacin while 2 strains (4% were identified as multidrug-resistant tuberculosis (MDR-TB. Thirty-five strains (70% were sensitive to all drugs. Extensively drug resistant tuberculosis (XDR-TB was not determined in this study. Conclusion: This is the first study that tests second line anti-tuberculosis drugs in our location and provides us valuable data regarding MDR-TB and XDR-TB rates. The Sensititre MycoTB Plate Method is a fast, reliable and practical method and can be used to determine the susceptibility of first and second-line anti-tuberculosis drugs.
Levillain, Florence; Poquet, Yannick; Mallet, Ludovic; Mazères, Serge; Marceau, Michael; Brosch, Roland; Bange, Franz-Christoph; Supply, Philip; Magalon, Axel; Neyrolles, Olivier
2017-11-01
The unique ability of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, to persist for long periods of time in lung hypoxic lesions chiefly contributes to the global burden of latent TB. We and others previously reported that the M. tuberculosis ancestor underwent massive episodes of horizontal gene transfer (HGT), mostly from environmental species. Here, we sought to explore whether such ancient HGT played a part in M. tuberculosis evolution towards pathogenicity. We were interested by a HGT-acquired M. tuberculosis-specific gene set, namely moaA1-D1, which is involved in the biosynthesis of the molybdenum cofactor. Horizontal acquisition of this gene set was striking because homologues of these moa genes are present all across the Mycobacterium genus, including in M. tuberculosis. Here, we discovered that, unlike their paralogues, the moaA1-D1 genes are strongly induced under hypoxia. In vitro, a M. tuberculosis moaA1-D1-null mutant has an impaired ability to respire nitrate, to enter dormancy and to survive in oxygen-limiting conditions. Conversely, heterologous expression of moaA1-D1 in the phylogenetically closest non-TB mycobacterium, Mycobacterium kansasii, which lacks these genes, improves its capacity to respire nitrate and grants it with a marked ability to survive oxygen depletion. In vivo, the M. tuberculosis moaA1-D1-null mutant shows impaired survival in hypoxic granulomas in C3HeB/FeJ mice, but not in normoxic lesions in C57BL/6 animals. Collectively, our results identify a novel pathway required for M. tuberculosis resistance to host-imposed stress, namely hypoxia, and provide evidence that ancient HGT bolstered M. tuberculosis evolution from an environmental species towards a pervasive human-adapted pathogen.
Piuri, Mariana; Jacobs, William R.; Hatfull, Graham F.
2009-01-01
Rapid antibiotic susceptibility testing of Mycobacterium tuberculosis is of paramount importance as multiple- and extensively- drug resistant strains of M. tuberculosis emerge and spread. We describe here a virus-based assay in which fluoromycobacteriophages are used to deliver a GFP or ZsYellow fluorescent marker gene to M. tuberculosis, which can then be monitored by fluorescent detection approaches including fluorescent microscopy and flow cytometry. Pre-clinical evaluations show that addition of either Rifampicin or Streptomycin at the time of phage addition obliterates fluorescence in susceptible cells but not in isogenic resistant bacteria enabling drug sensitivity determination in less than 24 hours. Detection requires no substrate addition, fewer than 100 cells can be identified, and resistant bacteria can be detected within mixed populations. Fluorescence withstands fixation by paraformaldehyde providing enhanced biosafety for testing MDR-TB and XDR-TB infections. PMID:19300517
Getahun, Haileyesus; Matteelli, Alberto; Abubakar, Ibrahim; Aziz, Mohamed Abdel; Baddeley, Annabel; Barreira, Draurio; den Boon, Saskia; Borroto Gutierrez, Susana Marta; Bruchfeld, Judith; Burhan, Erlina; Cavalcante, Solange; Cedillos, Rolando; Chaisson, Richard; Chee, Cynthia Bin-Eng; Chesire, Lucy; Corbett, Elizabeth; Dara, Masoud; Denholm, Justin; de Vries, Gerard; Falzon, Dennis; Ford, Nathan; Gale-Rowe, Margaret; Gilpin, Chris; Girardi, Enrico; Go, Un-Yeong; Govindasamy, Darshini; D Grant, Alison; Grzemska, Malgorzata; Harris, Ross; Horsburgh, C. Robert; Ismayilov, Asker; Jaramillo, Ernesto; Kik, Sandra; Kranzer, Katharina; Lienhardt, Christian; LoBue, Philip; Lönnroth, Knut; Marks, Guy; Menzies, Dick; Migliori, Giovanni Battista; Mosca, Davide; Mukadi, Ya Diul; Mwinga, Alwyn; Nelson, Lisa; Nishikiori, Nobuyuki; Oordt-Speets, Anouk; Rangaka, Molebogeng Xheedha; Reis, Andreas; Rotz, Lisa; Sandgren, Andreas; Sañé Schepisi, Monica; Schünemann, Holger J.; Sharma, Surender Kumar; Sotgiu, Giovanni; Stagg, Helen R.; Sterling, Timothy R.; Tayeb, Tamara; Uplekar, Mukund; van der Werf, Marieke J.; Vandevelde, Wim; van Kessel, Femke; van't Hoog, Anna; Varma, Jay K.; Vezhnina, Natalia; Voniatis, Constantia; Vonk Noordegraaf-Schouten, Marije; Weil, Diana; Weyer, Karin; Wilkinson, Robert John; Yoshiyama, Takashi; Zellweger, Jean Pierre; Raviglione, Mario
2015-01-01
Latent tuberculosis infection (LTBI) is characterised by the presence of immune responses to previously acquired Mycobacterium tuberculosis infection without clinical evidence of active tuberculosis (TB). Here we report evidence-based guidelines from the World Health Organization for a public health
Directory of Open Access Journals (Sweden)
Igor Mokrousov
Full Text Available This study aimed to characterize the population structure of Mycobacterium tuberculosis in Pskov oblast in northwestern Russia, to view it in the geographical context, to compare drug resistance properties across major genetic families. Ninety M. tuberculosis strains from tuberculosis (TB patients, permanent residents in Pskov oblast were subjected to LAM-specific IS6110-PCR and spoligotyping, followed by comparison with SITVITWEB and MIRU-VNTRplus databases. The Beijing genotype (n = 40 was found the most prevalent followed by LAM (n = 18, T (n = 13, Haarlem (n = 10, Ural (n = 5, and Manu2 (n = 1; the family status remained unknown for 3 isolates. The high rate of Beijing genotype and prevalence of LAM family are similar to those in the other Russian settings. A feature specific for M. tuberculosis population in Pskov is a relatively higher rate of Haarlem and T types. Beijing strains were further typed with 12-MIRU (followed by comparison with proprietary global database and 3 hypervariable loci QUB-3232, VNTR-3820, VNTR-4120. The 12-MIRU typing differentiated 40 Beijing strains into 14 types (HGI = 0.82 while two largest types were M2 (223325153533 prevalent throughout former USSR and M11 (223325173533 prevalent in Russia and East Asia. The use of 3 hypervariable loci increased a discrimination of the Beijing strains (18 profiles, HGI = 0.89. Both major families Beijing and LAM had similar rate of MDR strains (62.5 and 55.6%, respectively that was significantly higher than in other strains (21.9%; P = 0.001 and 0.03, respectively. The rpoB531 mutations were more frequently found in Beijing strains while LAM drug resistant strains mainly harbored rpoB516 and inhA -15 mutations. Taken together with a high rate of multidrug resistance among Beijing strains from new TB cases (79.3% versus 44.4% in LAM, these findings suggest the critical impact of the Beijing genotype on the current situation with MDR-TB in the
International Nuclear Information System (INIS)
Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok; Koh, Won-Jung; Kwon, O Jung; Kang, Eun Young; Kim, Seonwoo
2006-01-01
The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea); Koh, Won-Jung; Kwon, O Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea); Kang, Eun Young [Korea University Guro Hospital, Department of Diagnostic Radiology, Korea University College of Medicine, Seoul (Korea); Kim, Seonwoo [Sungkyunkwan University School of Medicine, Biostatistics Unit of the Samsung Biomedical Research Institute, Samsung Medical Center, Seoul (Korea)
2006-09-15
The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)
Famewo, Elizabeth B; Clarke, Anna M; Wiid, Ian; Ngwane, Andile; van Helden, Paul; Afolayan, Anthony J
2017-09-01
The emergence of drug-resistant strains of Mycobacterium tuberculosis has become a global public health problem. Polyherbal medicines offer great hope for developing alternative drugs for the treatment of tuberculosis. To evaluate the anti-tubercular activity of polyherbal medicines used for the treatment of tuberculosis. The remedies were screened against Mycobacterium tuberculosis H37Rv using Middlebrook 7H9 media and MGIT BACTEC 960 system. They were liquid preparations from King Williams Town site A (KWTa), King Williams Town site B (KWTb), King Williams Town site C (KWTc), Hogsback first site (HBfs), Hogsback second site (HBss), Hogsback third site (HBts), East London (EL), Alice (AL) and Fort Beaufort (FB). The susceptibility testing revealed that all the remedies contain anti-tubercular activity with KWTa, KWTb, KWTc, HBfs, HBts, AL and FB exhibiting more activity at a concentration below 25 µl/ml. Furthermore, MIC values exhibited inhibitory activity with the most active remedies from KWTa, HBfs and HBts at 1.562 µg/ml. However, isoniazid showed more inhibitory activity against M. tuberculosis at 0.05 µg/ml when compare to the polyherbal remedies. This study has indicated that these remedies could be potential sources of new anti-mycobacterial agents against M. tuberculosis . However, the activity of these preparations and their active principles still require in vivo study in order to assess their future as new anti-tuberculosis agents.
Multidrug-resistant tuberculosis: The problem and some priorities in controlling it
Directory of Open Access Journals (Sweden)
Sven Hoffner
2016-01-01
Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.
Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.
Hoffner, Sven
2016-12-01
Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.
Silva, Marcio Roberto; Rocha, Adalgiza da Silva; da Costa, Ronaldo Rodrigues; de Alencar, Andrea Padilha; de Oliveira, Vania Maria; Fonseca Júnior, Antônio Augusto; Sales, Mariana Lázaro; Issa, Marina de Azevedo; Filho, Paulo Martins Soares; Pereira, Omara Tereza Vianello; dos Santos, Eduardo Calazans; Mendes, Rejane Silva; Ferreira, Angela Maria de Jesus; Mota, Pedro Moacyr Pinto Coelho; Suffys, Philip Noel; Guimarães, Mark Drew Crosland
2013-05-01
In this cross-sectional study, mycobacteria specimens from 189 tuberculosis (TB) patients living in an urban area in Brazil were characterised from 2008-2010 using phenotypic and molecular speciation methods (pncA gene and oxyR pseudogene analysis). Of these samples, 174 isolates simultaneously grew on Löwenstein-Jensen (LJ) and Stonebrink (SB)-containing media and presented phenotypic and molecular profiles of Mycobacterium tuberculosis, whereas 12 had molecular profiles of M. tuberculosis based on the DNA analysis of formalin-fixed paraffin wax-embedded tissue samples (paraffin blocks). One patient produced two sputum isolates, the first of which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, and the second of which only grew on SB media and presented phenotypic profiles of Mycobacterium bovis. One patient provided a bronchial lavage isolate, which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, but had molecular profiles of M. bovis from paraffin block DNA analysis, and one sample had molecular profiles of M. tuberculosis and M. bovis identified from two distinct paraffin blocks. Moreover, we found a low prevalence (1.6%) of M. bovis among these isolates, which suggests that local health service procedures likely underestimate its real frequency and that it deserves more attention from public health officials.
Directory of Open Access Journals (Sweden)
Marcio Roberto Silva
2013-05-01
Full Text Available In this cross-sectional study, mycobacteria specimens from 189 tuberculosis (TB patients living in an urban area in Brazil were characterised from 2008-2010 using phenotypic and molecular speciation methods (pncA gene and oxyR pseudogene analysis. Of these samples, 174 isolates simultaneously grew on Löwenstein-Jensen (LJ and Stonebrink (SB-containing media and presented phenotypic and molecular profiles of Mycobacterium tuberculosis, whereas 12 had molecular profiles of M. tuberculosis based on the DNA analysis of formalin-fixed paraffin wax-embedded tissue samples (paraffin blocks. One patient produced two sputum isolates, the first of which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, and the second of which only grew on SB media and presented phenotypic profiles of Mycobacterium bovis. One patient provided a bronchial lavage isolate, which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, but had molecular profiles of M. bovis from paraffin block DNA analysis, and one sample had molecular profiles of M. tuberculosis and M. bovis identified from two distinct paraffin blocks. Moreover, we found a low prevalence (1.6% of M. bovis among these isolates, which suggests that local health service procedures likely underestimate its real frequency and that it deserves more attention from public health officials.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Pattern of intensive phase treatment outcomes of multi-drug resistant ...
African Journals Online (AJOL)
Pattern of intensive phase treatment outcomes of multi-drug resistant tuberculosis in University of Port Harcourt Treatment Centre: a review of records from ... Data on patients' age, sex, HIV status, treatment outcomes were extracted from the hospital book records into a computer data sheet at the UPTH treatment centre.
Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros
2015-01-01
While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.
LENUS (Irish Health Repository)
Fitzgibbon, M M
2013-01-01
Mycobacterial interspersed repetitive-unit-variable-number tandem repeat typing alone was used to investigate the genetic lineages among 361 Mycobacterium tuberculosis strains circulating in Ireland over a two-year period, 2010 and 2011. The majority of isolates, 63% (229\\/361), belonged to lineage 4 (Euro-American), while lineages 1 (Indo-Oceanic), 2 (East-Asian) and 3 (East-African–Indian) represented 12% of isolates each (42\\/361, 45\\/361, and 45\\/361, respectively). Sub-lineages Beijing (lineage 2), East-African–Indian (lineage 1) and Delhi\\/central-Asian (lineage 3) predominated among foreign-born cases, while a higher proportion of Euro-American lineages were identified among cases born in Ireland. Eighteen molecular clusters involving 63 tuberculosis (TB) cases were identified across four sub-lineages of lineage 4. While the mean cluster size was 3.5 TB cases, the largest cluster (involving 12 Irish-born cases) was identified in the Latin American–Mediterranean sub-lineage. Clustering of isolates was higher among Irish-born TB cases (47 of 63 clustered cases), whereas only one cluster (3\\/63) involved solely foreign-born individuals. Four multidrug-resistant cases identified during this period represented lineages 2 and 4. This study provides the first insight into the structure of the M. tuberculosis population in Ireland.
Directory of Open Access Journals (Sweden)
Tri Yudani Mardining Raras
2012-01-01
Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.
Risk factors for Mycobacterium tuberculosis infection among children in Greenland
DEFF Research Database (Denmark)
Søborg, Bolette; Andersen, Aase Bengaard; Melbye, Mads
2011-01-01
To examine the risk factors for Mycobacterium tuberculosis infection (MTI) among Greenlandic children for the purpose of identifying those at highest risk of infection.......To examine the risk factors for Mycobacterium tuberculosis infection (MTI) among Greenlandic children for the purpose of identifying those at highest risk of infection....
Directory of Open Access Journals (Sweden)
M Haeili
2014-01-01
Full Text Available Background: Early detection of multidrug-resistant tuberculosis (MDR-TB is essential to prevent its transmission in the community and initiate effective anti-TB treatment regimen. Materials and Methods: High-resolution melting curve (HRM analysis was evaluated for rapid detection of resistance conferring mutations in rpoB and katG genes. We screened 95 Mycobacterium tuberculosis clinical isolates including 20 rifampin resistant (RIF-R, 21 isoniazid resistant (INH-R and 54 fully susceptible (S isolates determined by proportion method of drug susceptibility testing. Nineteen M. tuberculosis isolates with known drug susceptibility genotypes were used as references for the assay validation. The nucleotide sequences of the target regions rpoB and katG genes were determined to investigate the frequency and type of mutations and to confirm HRM results. Results: HRM analysis of a 129-bp fragment of rpoB allowed correct identification of 19 of the 20 phenotypically RIF-R and all RIF-S isolates. All INH-S isolates generated wild-type HRM curves and 18 out of 21 INH-R isolates harboured any mutation in 109-bp fragment of katG exhibited mutant type HRM curves. However, 1 RIF-R and 3 INH-R isolates were falsely identified as susceptible which were confirmed for having no mutation in their target regions by sequencing. The main mutations involved in RIF and INH resistance were found at codons rpoB531 (60% of RIF-R isolates and katG315 (85.7% of INH-R isolates, respectively. Conclusion: HRM was found to be a reliable, rapid and low cost method to characterise drug susceptibility of clinical TB isolates in resource-limited settings.
Herlina, N.; Sinaga, B. Y. M.; Siagian, P.; Mutiara, E.
2018-03-01
Low levels of vitamin D is a predisposing factor for Multidrug-resistant tuberculosis. Family members in contact with the patient are also at risk of infection. Currently, there is no study that compares vitamin D levels between MDR-TB patients and household contact. This study aims to identify the association between level vitamin D within MDR-TB occurrence. This was a case-control study, with the number of samples in each group (MDR-TB) patients and household contactswere40 people. Each member of each group was checked for vitamin D levels using enzyme-linked immunosorbent assay (ELISA) technique. Statistical analysis was by using Chi-Square analysis using SPSS. Mean levels of vitamin D in MDR-TB patients were 32.21, household contact 31.7. There was anosignificant association between vitamin D levels and MDR-TB occurrence (p=1.0).No significant associationbetween vitamin D level with theMDR-TB occurrence.
Peritoneal tuberculosis due to Mycobacterium caprae
Directory of Open Access Journals (Sweden)
T. Nebreda
2016-01-01
Full Text Available The incidence of tuberculosis in humans due to Mycobacterium caprae is very low and is almost confined to Europe. We report a case of a previously healthy 41-year-old Moroccan with a 6 month history of abdominal pain, weight loss, fatigue and diarrhea. A diagnosis of peritoneal tuberculosis due to M. caprae was made.
Detection of Mycobacterium Tuberculosis by using PCR
International Nuclear Information System (INIS)
Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.
1996-01-01
Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g
Mycobacterium tuberculosis drug-resistance in previously treated ...
African Journals Online (AJOL)
Corresponding to: Professor Lassana Sangaré, Department of Bacteriology and Virology, University Hospital Centre. Yalgado Ouedraogo, 03 BP 7022 Ouagadougou 03, Burkina Faso. E-mail: sangarel@hotmail.com. Abstract. Background: Tuberculosis drug-resistance becomes common in sub-Saharan Africa; however, ...
Directory of Open Access Journals (Sweden)
Fereshte Hozoorbakhsh
2016-01-01
Full Text Available Background: Mycobacterium tuberculosis (MTB is the causative agent of tuberculosis (TB, which remains one of the major public health problems in the world. The increasing incidence of multidrug-resistant tuberculosis (MDR-TB and extensively drug-resistant tuberculosis (XDR-TB worldwide highlights the urgent need to search for alternative antimycobacterial agents. More and more people in developing countries utilize traditional medicine for their major primary health care needs. It has been determined that the medicinal plants Pulicaria gnaphalodes and Perovskia abrotanoides possess strong antibacterial effect. Materials and Methods: In this study, the antimycobacterial effects of P. gnaphalodes and P. abrotanoides essential oil on MTB were examined. Essential oil was prepared from P. gnaphalodes aerial parts and P. abrotanoides flower. The effects of six different concentrations (20 μg/ml, 40 μg/ml, 80 μg/ml, 160 μg/ml, 320 μg/ml, and 640 μg/ml were examined against sensitive isolates of MTB and MTB H37Rv (ATCC 27294. Results: The results showed that P. gnaphalodes and P. abrotanoides essential oil extracts have strong inhibitory effects on MTB. This activity for P. gnaphalodes was observed from very low (4% to good (70.9% effect; meanwhile, this activity for P. abrotanoides was observed from very low (4% to strong (86% effect. Conclusion: The mean of inhibition percentage for P. gnaphalodes and P. abrotanoides in 640 μg/ml was 58.1% and 76.2%, respectively. So, P. abrotanoides plant is more effective against MTB than P. gnaphalodes. Identification of the effective fraction against MTB is a further step to be studied.
Directory of Open Access Journals (Sweden)
G Kandhakumari
2015-01-01
Full Text Available Background: Investigation of extra pulmonary tuberculosis (EPTB in and around Pondicherry is being carried out since August 2011 in our tertiary care super specialty hospital. Objectives: To compare the rapid Kit SD Bio-Line MPT 64 Ag with conventional and time consuming biochemical tests. Confirmation of Mycobacterium tuberculosis at a reasonable time frame is the main thrust. Materials and Methods: Thirty three Mycobacterium tuberculosis and four Non-Tuberculous Mycobacteria (NTM grown in MGIT960 system/Lowenstein-Jensen media (LJ were examined by the rapid MPT 64 antigen detection as well as a battery of conventional tests like niacin, nitrate reduction, paraminobenzoic acid susceptibility and cord formation. Results and Conclusion: . Both the rapid kit and conventional tests correctly identified 33 M.tuberculosis isolates. Keeping conventional identification as reference, sensitivity and specificity for rapid kit was 100%. Rapid kit which takes only 15 minutes is accurate, cost effective, and facilitates early treatment for these EPTB patients, whose clinical specimens are paucibacillary.
Karunaratne, Galbokka Hewage Roshanthi Eranga; Wijesundera, Sandhya Sulochana; Vidanagama, Dhammika; Adikaram, Chamila Priyangani; Perera, Jennifer
2018-04-23
The emergence and spread of drug-resistant tuberculosis (TB) pose a threat to TB control in Sri Lanka. Isoniazid (INH) is a key element of the first-line anti-TB treatment regimen. Resistance to INH is mainly associated with point mutations in katG, inhA, and ahpC genes. The objective of this study was to determine mutations of these three genes in INH-resistant Mycobacterium tuberculosis (MTb) strains in Sri Lanka. Complete nucleotide sequence of the three genes was amplified by polymerase chain reaction and subjected to DNA sequencing. Point mutations in the katG gene were identified in 93% isolates, of which the majority (78.6%) were at codon 315. Mutations at codons 212 and 293 of the katG gene have not been reported previously. Novel mutations were recognized in the promoter region of the inhA gene (C deletion at -34), fabG1 gene (codon 27), and ahpC gene (codon 39). Single S315T mutation in the katG gene led to a high level of resistance, while a low level of resistance with high frequency (41%) was observed when katG codon 315 coexisted with the mutation at codon 463. Since most of the observed mutations of all three genes coexisted with the katG315 mutation, screening of katG315 mutations will be a useful marker for molecular detection of INH resistance of MTb in Sri Lanka.
Kostera, Joshua; Leckie, Gregor; Tang, Ning; Lampinen, John; Szostak, Magdalena; Abravaya, Klara; Wang, Hong
2016-12-01
Clinical management of drug-resistant tuberculosis patients continues to present significant challenges to global health. To tackle these challenges, the Abbott RealTime MTB RIF/INH Resistance assay was developed to accelerate the diagnosis of rifampicin and/or isoniazid resistant tuberculosis to within a day. This article summarizes the performance of the Abbott RealTime MTB RIF/INH Resistance assay; including reliability, analytical sensitivity, and clinical sensitivity/specificity as compared to Cepheid GeneXpert MTB/RIF version 1.0 and Hain MTBDRplus version 2.0. The limit of detection (LOD) of the Abbott RealTime MTB RIF/INH Resistance assay was determined to be 32 colony forming units/milliliter (cfu/mL) using the Mycobacterium tuberculosis (MTB) strain H37Rv cell line. For rifampicin resistance detection, the Abbott RealTime MTB RIF/INH Resistance assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Cepheid GeneXpert MTB/RIF. For isoniazid resistance detection, the assay demonstrated statistically equivalent clinical sensitivity and specificity as compared to Hain MTBDRplus. The performance data presented herein demonstrate that the Abbott RealTime MTB RIF/INH Resistance assay is a sensitive, robust, and reliable test for realtime simultaneous detection of first line anti-tuberculosis antibiotics rifampicin and isoniazid in patient specimens. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.
Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel
2016-01-01
Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...
Mycobacterium tuberculosis Infection in a Domesticated Korean Wild Boar ( Sus scrofa coreanus).
Seo, Min-Goo; Ouh, In-Ohk; Kim, Munki; Lee, Jienny; Kim, Young-Hoan; Do, Jae-Cheul; Kwak, Dongmi
2017-06-01
Tuberculosis, a chronic progressive disease, has been reported in bovine, swine, and primate species. Here, we report the first case of Mycobacterium tuberculosis infection in a Korean wild boar ( Sus scrofa coreanus). The owners this domesticated boar brought it to the Gyeongbuk Veterinary Service Laboratory in Korea after it was found dead and severely emaciated. Demarcated yellowish white nodules were found around the larynx and retropharyngeal lymph node during necropsy. The lungs had diffuse fibrinous pleuritis, severe congestion, and scattered nodules. More nodules were found in the spleen. Tuberculosis is characterized by massive macrophage infiltration and central caseous necrosis; both characteristics were found in the lungs. Histopathologic examination revealed that the alveolar lumen had marked fibrosis and exudates. Examination of the fluid revealed extensive macrophage permeation. To confirm a Mycobacterium infection, PCR was performed using two primer sets specific to the rpoB gene of Mycobacterium; Mycobacterium was detected in the lungs and spleen. To identify the species of Mycobacterium, immunohistochemical evaluation was performed using antibodies against Mycobacterium tuberculosis and Mycobacterium bovis . The results revealed immunoreactivity against M. tuberculosis but not against M. bovis . The consumption of undercooked or raw meat from game animals may expose humans and other animals to sylvatic infection. Consequently, Koreans who ingest wild boar may be at risk of a tuberculosis infection. To reduce the risk of foodborne infection and maintain public health, continuous monitoring and control strategies are required.
Trends in discovery of new drugs for tuberculosis therapy.
Riccardi, Giovanna; Pasca, Maria Rosalia
2014-09-01
After the introduction of isoniazid and rifampicin, the second one discovered in the Lepetit Research Laboratories (Milan, Italy), under the supervision of Professor Piero Sensi, tuberculosis (TB) was considered an illness of the past. Unfortunately, this infectious disease is still a global health fear, due to the multidrug-resistant Mycobacterium tuberculosis and extensively circulating drug-resistant strains, as well as the unrecognized TB transmission, especially in regions with high HIV incidence. In the last few years, new antitubercular molecules appeared on the horizon both in preclinical and clinical stage of evaluation. In this review, we focus on a few of them and on their mechanism of action. Two new promising drug targets, DprE1 and MmpL3, are also discussed.
Applicability of the shorter ‘Bangladesh regimen’ in high multidrug-resistant tuberculosis settings
Directory of Open Access Journals (Sweden)
Giovanni Sotgiu
2017-03-01
Full Text Available In spite of the recent introduction of two new drugs (delamanid and bedaquiline and a few repurposed compounds to treat multidrug-resistant and extensively drug-resistant tuberculosis (MDR- and XDR-TB, clinicians are facing increasing problems in designing effective regimens in severe cases. Recently a 9 to 12-month regimen (known as the ‘Bangladesh regimen’ proved to be effective in treating MDR-TB cases. It included an initial phase of 4 to 6 months of kanamycin, moxifloxacin, prothionamide, clofazimine, pyrazinamide, high-dose isoniazid, and ethambutol, followed by 5 months of moxifloxacin, clofazimine, pyrazinamide, and ethambutol. However, recent evidence from Europe and Latin America identified prevalences of resistance to the first-line drugs in this regimen (ethambutol and pyrazinamide exceeding 60%, and of prothionamide exceeding 50%. Furthermore, the proportions of resistance to the two most important pillars of the regimen – quinolones and kanamycin – were higher than 40%. Overall, only 14 out of 348 adult patients (4.0% were susceptible to all of the drugs composing the regimen, and were therefore potentially suitable for the ‘shorter regimen’. A shorter, cheaper, and well-tolerated MDR-TB regimen is likely to impact the number of patients treated and improve adherence if prescribed to the right patients through the systematic use of rapid MTBDRsl testing.
Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald
2007-12-01
Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.
Comparative Mycobacteriology of the Mycobacterium tuberculosis complex
Gordon, Stephen V.; Behr, Marcel A.
2015-01-01
The Mycobacterium tuberculosis complex (MTBC) is a group of highly genetically related pathogens that cause tuberculosis (TB) in mammalian species. However, the very name of the complex underlines the fact that our knowledge of these pathogens is dominated by studies on the human pathogen, M. tuberculosis. Of course this is entirely justified; M. tuberculosis is a major global pathogen that exacts a horrendous burden in terms of mortality and morbidity so it is appropriate that it is...
Directory of Open Access Journals (Sweden)
Lilian María Mederos Cuervo
Full Text Available Se presenta un caso de coinfección por Mycobacterium malmoense y Mycobacterium tuberculosis en un paciente cubano con síndrome de inmunodeficiencia adquirida (sida, que producía enfermedad respiratoria y hepática respectivamente. Los cultivos realizados a partir de las muestras de esputo demostraron la presencia de una cepa micobacteriana no pigmentada de crecimiento lento perteneciente al grupo III de Runyon e identificada como Mycobacterium malmoense. A partir de los cultivos del tejido hepático extraído laparoscópicamente se aisló una cepa posteriormente identificada como Mycobacterium tuberculosis. El estudio anatomopatológico confirmó el diagnóstico de tuberculosis, el paciente recibió tratamiento específico y evolucionó clínicamente bien. Se reporta un caso infrecuente de coinfección por Mycobacterium, el cual describe el primer reporte de tuberculosis hepática en una paciente con sida en Cuba.
Carbapenems to Treat Multidrug and Extensively Drug-Resistant Tuberculosis: A Systematic Review.
Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Tiberi, Simon; Esposito, Susanna; Dore, Simone; Spanevello, Antonio; Migliori, Giovanni Battista
2016-03-12
Carbapenems (ertapenem, imipenem, meropenem) are used to treat multidrug-resistant (MDR-) and extensively drug-resistant tuberculosis (XDR-TB), even if the published evidence is limited, particularly when it is otherwise difficult to identify the recommended four active drugs to be included in the regimen. No systematic review to date has ever evaluated the efficacy, safety, and tolerability of carbapenems. A search of peer-reviewed, scientific evidence was carried out, aimed at evaluating the efficacy/effectiveness, safety, and tolerability of carbapenem-containing regimens in individuals with pulmonary/extra-pulmonary disease which was bacteriologically confirmed as M/XDR-TB. We used PubMed to identify relevant full-text, English manuscripts up to the 20 December 2015, excluding editorials and reviews. Seven out of 160 studies satisfied the inclusion criteria: two on ertapenem, one on imipenem, and four on meropenem, all published between 2005 and 2016. Of seven studies, six were retrospective, four were performed in a single center, two enrolled children, two had a control group, and six reported a proportion of XDR-TB cases higher than 20%. Treatment success was higher than 57% in five studies with culture conversion rates between 60% and 94.8%. The safety and tolerability is very good, with the proportion of adverse events attributable to carbapenems below 15%.
Diffuse Type Primary Mycobacterium Tuberculosis of the Breast: A Case Report
Energy Technology Data Exchange (ETDEWEB)
Kim, Hyun A; Kang, Bong Joo; Kim, Sung Hun; Kim, Hnana; Lee, Ah Won [Seoul St. Mary' s Hospital, The Catholic University of Korea, Seoul (Korea, Republic of)
2011-12-15
Tuberculous mastitis is a rare manifestation of mycobacterium tuberculosis infection. It mimics inflammatory breast cancer or other pyogenic inflammations. In most of the tuberculous mastitis reports, coexisting or prior tuberculosis infection and secondary infection of the breast by direct spread via axillary or cervical lymphadenopathy, or hematogenous spread have been noted. We describe the mammographic and ultrasonographic findings of a case of diffuse type mycobacterium tuberculosis of the breast showing diffuse edema which was confirmed as tuberculosis through biopsy and had no evidence of old or concurrent pulmonary tuberculosis on chest computed tomography
Microbial sensor for drug susceptibility testing of Mycobacterium tuberculosis.
Zhang, Z-T; Wang, D-B; Li, C-Y; Deng, J-Y; Zhang, J-B; Bi, L-J; Zhang, X-E
2018-01-01
Drug susceptibility testing (DST) of clinical isolates of Mycobacterium tuberculosis is critical in treating tuberculosis. We demonstrate the possibility of using a microbial sensor to perform DST of M. tuberculosis and shorten the time required for DST. The sensor is made of an oxygen electrode with M. tuberculosis cells attached to its surface. This sensor monitors the residual oxygen consumption of M. tuberculosis cells after treatment with anti-TB drugs with glycerine as a carbon source. In principle, after drug pretreatment for 4-5 days, the response differences between the sensors made of drug-sensitive isolates are distinguishable from the sensors made of drug-resistant isolates. The susceptibility of the M. tuberculosis H37Ra strain, its mutants and 35 clinical isolates to six common anti-TB drugs: rifampicin, isoniazid, streptomycin, ethambutol, levofloxacin and para-aminosalicylic acid were tested using the proposed method. The results agreed well with the gold standard method (LJ) and were determined in significantly less time. The whole procedure takes approximately 11 days and therefore has the potential to inform clinical decisions. To our knowledge, this is the first study that demonstrates the possible application of a dissolved oxygen electrode-based microbial sensor in M. tuberculosis drug resistance testing. This study used the microbial sensor to perform DST of M. tuberculosis and shorten the time required for DST. The overall detection result of the microbial sensor agreed well with that of the conventional LJ proportion method and takes less time than the existing phenotypic methods. In future studies, we will build an O 2 electrode array microbial sensor reactor to enable a high-throughput drug resistance analysis. © 2017 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
G. Varela
2005-03-01
Full Text Available Strains of Mycobacterium tuberculosis were compared using two DNA fingerprinting techniques: Restriction Fragment Length Polymorphism (RFLP and Double-Repetitive-Element-PCR (DRE-PCR. Two of these strains: IH1 (susceptible to isoniazid and IH2 (resistant to isoniazid were recovered from cases of pulmonary tuberculosis which occurred in two brothers who lived together. The first one was recognized on July 1999, and the second was diagnosed one year later. IH1 and IH2 showed the same pattern of bands with both molecular tests. These results suggest that single drug chemoprophylaxis may occasionally select resistant strains for that drug, which can eventually cause disease and be recognized through these tests. Strains IH3, IH4 and IH5 were obtained from sputum samples of 3 different patients, and intra-laboratory cross-contamination was suspected when it was realized that the 3 positive materials had been consecutively processed the same day by the same worker in the same biological safety cabinet. Again, the 3 strains revealed identical band patterns with RFLP and DRE-PCR, confirming the posed suspicion. The results with DRE-PCR were obtained after only 8 hours of work, without the need for subcultures. This procedure allows quick correction of treatment conducts, avoiding unnecessary exposure of people and bacteria to antimicrobial drugs.Se compararon cepas de Mycobacterium tuberculosis utilizando 2 procedimientos de ADN fingerprinting: polimorfismo de los fragmentos de restricción (RFLP y Double-Repetitive-Element-PCR (DRE-PCR. Dos de las cepas: IH1 (susceptible a isoniazida e IH2 (resistente a isoniazida se recuperaron a partir de casos de tuberculosis pulmonar que ocurrieron en dos hermanos convivientes. La primera fue aislada en julio de 1999 y la segunda un año después. IH1 e IH2 mostraron el mismo patrón de bandas por ambos procedimientos. Estos resultados sugieren que la quimioprofilaxis con una sola droga puede ocasionalmente
Directory of Open Access Journals (Sweden)
Keira A Cohen
2015-01-01
Full Text Available The largest global outbreak of extensively drug-resistant (XDR tuberculosis (TB was identified in Tugela Ferry, KwaZulu-Natal (KZN, South Africa in 2005. The antecedents and timing of the emergence of drug resistance in this fatal epidemic XDR outbreak are unknown, and it is unclear whether drug resistance in this region continues to be driven by clonal spread or by the development of de novo resistance. A whole genome sequencing and drug susceptibility testing (DST was performed on 337 clinical isolates of Mycobacterium tuberculosis (M.tb collected in KZN from 2008 to 2013, in addition to three historical isolates, one of which was isolated during the Tugela Ferry outbreak. Using a variety of whole genome comparative approaches, 11 drug-resistant clones of M.tb circulating from 2008 to 2013 were identified, including a 50-member clone of XDR M.tb that was highly related to the Tugela Ferry XDR outbreak strain. It was calculated that the evolutionary trajectory from first-line drug resistance to XDR in this clone spanned more than four decades and began at the start of the antibiotic era. It was also observed that frequent de novo evolution of MDR and XDR was present, with 56 and 9 independent evolutions, respectively. Thus, ongoing amplification of drug-resistance in KwaZulu-Natal is driven by both clonal spread and de novo acquisition of resistance. In drug-resistant TB, isoniazid resistance was overwhelmingly the initial resistance mutation to be acquired, which would not be detected by current rapid molecular diagnostics that assess only rifampicin resistance.
Safety assessment in primary Mycobacterium tuberculosis smear ...
African Journals Online (AJOL)
Introduction Tuberculosis (TB) is caused by Mycobacterium tuberculosis and is transmitted mainly through aerosolization of infected sputum which puts laboratory workers at risk in spite of the laboratory workersf risk of infection being at 3 to 9 times higher than the general public. Laboratory safety should therefore be ...
Geluk, A.; van Meijgaarden, K. E.; Franken, K. L. M. C.; Wieles, B.; Arend, S. M.; Faber, W. R.; Naafs, B.; Ottenhoff, T. H. M.
2004-01-01
Mycobacterium tuberculosis culture filtrate protein-10 (CFP-10) (Rv3874) is considered a promising antigen for the immunodiagnosis of tuberculosis (TB) together with early secreted antigens of M. tuberculosis (ESAT-6). Both ESAT-6 and CFP-10 are encoded by the RD1 region that is deleted from all
Microevolution of Mycobacterium tuberculosis in a tuberculosis patient.
Al-Hajoj, S.A.; Akkerman, O.; Parwati, I.; Al-Gamdi, S.; Rahim, Z.; Soolingen, D. van; Ingen, J. van; Supply, P.; Zanden, A.G. van der
2010-01-01
Five Mycobacterium tuberculosis isolates were obtained from three body sites from a Dutch patient. The isolates displayed a single genotype by 24-locus MIRU-VNTR typing (except for a single locus not amplified from one isolate) but were differentiated by small variations in IS6110 fingerprints,
Molecular typing of mycobacterium tuberculosis isolates circulating in Jiangsu Province, China
Directory of Open Access Journals (Sweden)
Dong Haiyan
2011-10-01
Full Text Available Abstract Background Globally, China is the second place with high burden of tuberculosis (TB. To explore the characteristics of the pathogens of Mycobacterium tuberculosis (MTB circulating in this area is helpful for understanding and controlling the spread of the strains. Recent developments in molecular biology have allowed prompt identification and tracking specific strains of MTB spreading through the population. Methods Spacer-oligonucleotide typing (spoligotyping and mycobacterial interspersed repetitive units variable number tandem repeat (MIRU-VNTR were performed in combination to yield specific genetic profiles of 260 MTB strains isolated from 30 counties of Jiangsu province in China between June and July 2010. The spoligotyping results were in comparison to the world Spoligotyping Database of Institute Pasteur de Guadeloupe (SpolDB4. Drug susceptibility test (DST was performed on all strains by proportion method on Lowenstein-Jensen (LJ culture media. Results Based on the spoligotyping method, 246 strains displayed known patterns and 14 were absent in the database. Predominant spoligotypes belonged to the Beijing family (80.4%. By using the 24-loci VNTR typing scheme, 224 different patterns were identified, including 20 clusters and 204 unique patterns. The largest clade comprised 195 strains belonging to the Beijing family. The combination of spoligotyping and 24-loci MIRU-VNTR demonstrated maximal discriminatory power. Furthermore, we observed a significant association between Beijing family strains and drug-resistant phenotypes. The Beijing family strains presented increased risks for developing multi-drug resistant TB, with the OR (95% CI of 11.07(1.45-84.50. Conclusions The present study demonstrated that Beijing family isolates were the most prevalent strains circulating in Jiangsu province of China. The utility of spoligotyping in combination with 24-loci MIRU-VNTR might be a useful tool for epidemiological analysis of MTB
A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil
Directory of Open Access Journals (Sweden)
Andréa Gobetti Vieira Coelho
2012-09-01
Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.
Repurposing and Revival of the Drugs: A New Approach to Combat the Drug Resistant Tuberculosis
Directory of Open Access Journals (Sweden)
Divakar Sharma
2017-12-01
Full Text Available Emergence of drug resistant tuberculosis like multi drug resistant tuberculosis (MDR-TB, extensively drug-resistant tuberculosis (XDR-TB and totally drug resistant tuberculosis (TDR-TB has created a new challenge to fight against these bad bugs of Mycobacterium tuberculosis. Repurposing and revival of the drugs are the new trends/options to combat these worsen situations of tuberculosis in the antibiotics resistance era or in the situation of global emergency. Bactericidal and synergistic effect of repurposed/revived drugs along with the latest drugs bedaquiline and delamanid used in the treatment of MDR-TB, XDR-TB, and TDR-TB might be the choice for future promising combinatorial chemotherapy against these bad bugs.
G. de Vries (Gerard); R.M. van Hest (Reinier); C.C.A. Burdo (Conny); D. van Soolingen (Dick); J.H. Richardus (Jan Hendrik)
2009-01-01
textabstractBackground: DNA fingerprinting of Mycobacterium tuberculosis isolates offers better opportunities to study links between tuberculosis (TB) cases and can highlight relevant issues in urban TB control in low-endemic countries. Methods: A medium-sized molecular cluster of TB cases with
Gupta, Shashank; Winglee, Kathryn; Gallo, Richard; Bishai, William R
2017-01-01
Antimicrobial peptides such as cathelicidins are an important component of innate immune defence against inhaled microorganisms and have demonstrated antimicrobial activity against Mycobacterium tuberculosis with in vitro models. Despite this, little is known about the regulation and expression of cathelicidin during tuberculosis in vivo. We sought to determine whether the cathelicidin-related antimicrobial peptide (Cramp) gene, the murine functional homologue of the human cathelicidin gene (CAMP or LL-37), is required for regulating protective immunity during M. tuberculosis infection in vivo. We used Cramp−/− mice in a validated model of pulmonary tuberculosis and conducted cell-based assays with macrophages from these mice. We evaluated the in vivo susceptibility of Cramp−/− mice to infection and further dissected various pro-inflammatory immune responses against M. tuberculosis. We observed increased susceptibility of Cramp−/− mice to M. tuberculosis compared to wild type mice. Macrophages from Cramp−/− mice were unable to control M. tuberculosis growth in an in vitro infection model, were deficient in intracellular calcium influx and were defective in stimulating T-cells. Additionally, CD4 and CD8 T-cells from Cramp−/− mice produced less IFNβ upon stimulation. Furthermore, bacterial-derived cyclic-AMP modulated cathelicidin expression in macrophages. Our results demonstrate that cathelicidin is required for innate resistance to M. tuberculosis in a relevant animal model and is a key mediator in regulating the levels of pro-inflammatory cytokines by calcium and cyclic nucleotides. PMID:28097645
Effectiveness of a novel cellular therapy to treat multidrug-resistant tuberculosis
Directory of Open Access Journals (Sweden)
Aliaksandr Skrahin
2016-08-01
Full Text Available Introduction: We urgently need novel treatments for multidrug-resistant tuberculosis (MDR-TB. Autologous mesenchymal stromal cell (MSC infusion is one such possibility due to its potential to repair damaged lung tissue and boost immune responses. We aimed to assess the effectiveness of MSC to improve outcomes among MDR-TB patients. Methods: We analyzed outcomes for 108 Belarussian MDR-TB patients receiving chemotherapy. Thirty-six patients (âcasesâ also had MSCs extracted, cultured and re-infused (average time from chemotherapy start to infusion was 49 days; another 36 patients were âstudy controlsâ. We identified another control group: 36 patients from the Belarussian surveillance database (âsurveillance controlsâ 1:1 matched to cases. Results: Of the cases, 81% had successful outcomes versus 42% of surveillance controls and 39% of study controls. Successful outcome odds were 6.5 (95% Confidence Interval: 1.2â36.2, p=0.032 times greater for cases than surveillance controls (age-adjusted. Radiological improvement was more likely in cases than study controls. Culture analysis prior to infusion demonstrated a poorer initial prognosis in cases, yet despite this they had better outcomes than the control groups. Conclusion: MSC treatment could vastly improve outcomes for MDR-TB patients. Our findings could revolutionize therapy options and have strong implications for future directions of MDR-TB therapy research. Keywords: Mesenchymal stromal cells, Extensively drug resistant, Outcomes, Treatment
Mokrousov, Igor; Shitikov, Egor; Skiba, Yuriy; Kolchenko, Sergey; Chernyaeva, Ekaterina; Vyazovaya, Anna
2017-11-01
To date, a major attention was justly given to the global lineages of Mycobacterium tuberculosis. Here, we demonstrated an importance of the minor ones, on an example of intriguing and underestimated NEW-1 family that belongs to Euro-American lineage (lineage 4). Analysis of the global WGS/NGS datasets (5715 strains) identified 2235 strains of Lineage 4 and 66 strains of sublineage L4.5. This latter is marked with RD122 genomic deletion and includes NEW-1 family. Phylogenomic analysis confirmed a separate position of the NEW-1 family that we tentatively designate L4.5.1/Iran. We propose an evolution/migration scenario starting with origin of L4.5 1000-1300 ya in China, subsequent origin of the pre-NEW-1 intermediate genotype in Tibet, further migration to Xinjiang/Uyghur, and finally to Iran since 800 ya (origin of NEW-1), possibly, via expansion of the Mongol Yuan empire. Analysis of longitudinal phylogeographic datasets revealed a sharp increase in prevalence of NEW-1 strains in Iran and its eastwards neighbors in the last 20years; most alarmingly, it is accompanied with significant association with multidrug resistance (MDR). Ongoing migration, especially, Afghan refugees flows to developed countries emphasize a risk of the wider spread of the epidemic MDR subtype within NEW-1 family that we coin as emerging resistant clone of M. tuberculosis in West Asia. Copyright © 2017 Elsevier Inc. All rights reserved.
High genetic diversity among Mycobacterium tuberculosis strains in Tehran, Iran
Directory of Open Access Journals (Sweden)
Taher Azimi
2018-05-01
Full Text Available Introduction: Tuberculosis (TB still remains an important public health problem in Iran. The genotyping of Mycobacterium tuberculosis isolates is expected to lead to a better understanding of M. tuberculosis transmission in Tehran, the most populated city of Iran. Materials and Methods: A total of 2300 clinical specimens were obtained from TB suspected patients who were referred to a TB center in Tehran from Jan 2014 to Dec 2016. Identification was performed using both conventional and molecular methods. The presence of resistance to rifampicin was examined by the GeneXpert MTB/RIF. The standard 15-locus mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR typing method was applied to genotype of clinical isolates. Results: Of 2300 specimens, 80 isolates were identified as M. tuberculosis by using biochemical and molecular tests. Of 80 M. tuberculosis isolates, 76 (95% had unique genotypic profiles and 4 (5% shared a profile with one or more other strains. Based on single loci variation (SLV 4 clonal complexes were observed. NEW-1 was found to be the most predominant lineage (22.5% followed by West African (1.25%, Central Asian (CAS/Delhi (1.25%, Bovis (1.25%, H37Rv (1.25% and multiple matches (1.25%. Loci MIRU10, MIRU26, MTUB21 and QUB26 were found as highly discriminative. No mutation was detected in the hotspot region of rifampicin by using GeneXpert MTB/RIF. Conclusions: Our study findings show that there was considerable genotypic diversity among M. tuberculosis isolates in Tehran. The 15-locus MIRU-VNTR showed high HGDI and could be used as a first-line genotyping method for epidemiological studies. Keywords: Mycobacterium tuberculosis, Genotyping, MIRU-VNTR, Tehran, Iran
GENETIC DIVERSITY OF DRUG RESISTANT STRAINS OF MYCOBACTERIUM TUBERCULOSIS IN OMSK REGION
Directory of Open Access Journals (Sweden)
O. A. Pаsechnik
2017-01-01
Full Text Available The article presents the investigation results of the specific epidemic situation on tuberculous infection in Omsk Region in 2006-2015 and molecular genetic features of M. tuberculosis strains with multiple drug resistance circulating in this region. Bacteriological, molecular genetic methods, VNTR-typing were used as well as descriptive techniques of the epidemiological process. Tuberculosis prevalence made 269.2 per 100,000 population. There is an increase in those with bacillary excretion among new cases of respiratory tuberculosis from 39.8% to 53.4%. Drug resistance was detected in 48.0% of new cases. Among drug resistance patterns, MDR made 57%, and extensive drug resistance (XDR increased from 2.5 to 7.0%. In 2015 prevalence of XDR tuberculosis made 8.9 per 100,000 population in Omsk Region. When performing VNTR-typing of 77 samples of M. tuberculosis DNA with MDR, 27 genetic types were identified. The population of MDR strain of M. tuberculosis is heterogeneous and presented by strains of various genetic families -Beijing, LAM, S,Haarlem,Uganda. The investigation showed that isolates ofBeijing family prevailed (76.6%.
Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M
2016-05-01
For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Ana Sofia Vilariça
2008-11-01
Full Text Available Introduction: Extensively drug-resistant tuberculosis (XDR-TB is defined as a form of multidrug-resistant tuberculosis (MDR-TB with additional resistance to fluoroquinolones and at least one of the injectable drugs used in tuberculosis treatment: amikacin, kanamycin and capreomycin. It was classified by WHO as a serious threat to tuberculosis (TB control, with world-wide consequences, taking on the proportions of a real pandemic in some regions. Aim: To compare patients with XDR-TB versus other MDR-TB profiles with regard to epidemiological and demographic characteristics, aetiopathogenic factors and inhospital outcomes. Methods: Patients admitted to Pulido Valente Hospital (Pulmonology Service III in the period ranging from April 1999 to June 2007 with MDR-TB diagnosis microbiologically confirmed. The following variables were evaluated: gender, age, race, forms of TB presentation, treatment groups, resistance profile, immigrant status, number and duration of previous treatments, WHO classification, HIV co-infection, alcoholism and/or drug addiction, average length of hospital stay and inhospital mortality.Statistical analysis was performed using the SPSS (Statistical Package for the Social Sciences, version 15.0. In categorical variables, the statistical differences between groups were evaluated by the Chisquare test and numeric variables using the T-test. Logistical regression analysis was used to build the predictive model of XDR-TB existence (dependent variable, which included the following independent variables: WHO classification, HIV co-infection, immigrant status, alcoholism and/or drug addiction and number and duration of previous treatments. Results: We recorded 132 patients with MDR-TB, of which 69 (52.3% were XDR-TB. Statistically significant differences were observed in the following variables: race (black race was associated with XDRTB in 74% of cases versus 46% of the Caucasian race; WHO classification (patients with retreatment
Directory of Open Access Journals (Sweden)
Fahmida Rahman
2013-01-01
Full Text Available This study was designed to determine the extent of drug resistance of M. tuberculosis (MTB isolated from category II treatment failure pulmonary tuberculosis (PTB patients. A total of 100 Ziehl-Neelsen (Z-N smear positive category II failure PTB patients were included in this study. Sputum culture was done in Lowenstein-Jensen (L-J media. Conventional proportion method on Lowenstein-Jensen (L-J media was used to determine the drug susceptibility of M. tuberculosis to isoniazid (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA. Out of 100 sputum samples, a total of 87 samples were positive by culture. Drug susceptibility test (DST revealed that 82 (94.25% isolates were resistant to one or more anti -TB drugs. Resistance to isoniazide (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA was 94.25%, 82.75%, 29.90% and 3.45% respectively. Among these isolates, 79.31% and 3.45% isolates were multi-drug resistant (MDR and extended drug resistant (XDR M. tuberculosis respectively. High rate of anti-tubercular drug resistance was observed among the category II treatment failure TB patients. Ibrahim Med. Coll. J. 2013; 7(1: 9-11
Drug-resistant tuberculosis in Sindh
International Nuclear Information System (INIS)
Almani, S.A.; Memon, N.M.; Qureshi, A.F.
2002-01-01
Objective: To assess the prevalence of primary and secondary drug resistance amongst the clinical isolates of M.tuberculosis, to identify risk factors and how to overcome this problem. Design: A case series of 50 indoor patients with sputum smear-positive pulmonary tuberculosis. Place and duration of Study: Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, Sindh, (Pakistan) from January 1999 to December 2000. Patients and methods: Four first line anti-tuberculous drugs rifampicine, ethambutol and streptomycin were tested for sensitivity pattern. Results: Twelve (26.66%) were sensitive to all four drugs, 12(26.66%) were resistant to one drug, 14 (31.11%) were resistant to two drugs, 2 (4.44%) were resistant to three drugs, and 5(11.11%) were resistant to all four drugs. Resistance to isoniazid was the most common in 27 cases (60%) with primary resistance in 6(13.33%) and secondary resistance in 21(46.66%), followed by resistance to streptomycin in 17 cases (37.77%) with primary resistance in 5(11.11%) and secondary resistance in 12 (26.66%). Resistance to ethambutol in 10 cases (22.22%) and rifampicine in 11 (24.44%) and all cases were secondary. Similarly multi-drugs resistance (MRD) TB was found in 11(24.44%) isolates. Conclusion: This study showed high prevalence of drug resistance among clinical isolates of M. tuberculosis. Their is a need to establish centers at number of places with adequate facilities for susceptibility testing so that the resistant pattern could be ascertained and treatment regimens tailored accordingly. (author)
Fox, Gregory J; Mitnick, Carole D; Benedetti, Andrea; Chan, Edward D; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S; Menzies, Dick; Ahuja, S; Ashkin, D; Avendaño, M; Banerjee, R; Bauer, M; Burgos, M; Centis, R; Cobelens, F; Cox, H; D'Ambrosio, L; de Lange, W C M; DeRiemer, K; Enarson, D; Falzon, D; Flanagan, K; Flood, J; Gandhi, N; Garcia-Garcia, L; Granich, R M; Hollm-Delgado, M G; Holtz, T H; Hopewell, P; Iseman, M; Jarlsberg, L G; Kim, H R; Lancaster, J; Lange, C; Leimane, V; Leung, C C; Li, J; Menzies, D; Migliori, G B; Narita, M; Nathanson, E; Odendaal, R; O'Riordan, P; Pai, M; Palmero, D; Park, S K; Pena, J; Pérez-Guzmán, C; Ponce-de-Leon, A; Quelapio, M I D; Quy, H T; Riekstina, V; Royce, S; Salim, M; Schaaf, H S; Seung, K J; Shah, L; Shean, K; Sifuentes-Osornio, J; Sotgiu, G; Strand, M J; Sung, S W; Tabarsi, P; Tupasi, T E; Vargas, M H; van Altena, R; van der Walt, M; van der Werf, T S; Westenhouse, J; Yew, W W
2016-04-01
Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual patient data metaanalysis to evaluate the effectiveness of surgery as adjunctive therapy for MDR-tuberculosis. Individual patient data, was obtained from the authors of 26 cohort studies, identified from 3 systematic reviews of MDR-tuberculosis treatment. Data included the clinical characteristics and medical and surgical therapy of each patient. Primary analyses compared treatment success (cure and completion) to a combined outcome of failure, relapse, or death. The effects of all forms of resection surgery, pneumonectomy, and partial lung resection were evaluated. A total of 4238 patients from 18 surgical studies and 2193 patients from 8 nonsurgical studies were included. Pulmonary resection surgery was performed on 478 patients. Partial lung resection surgery was associated with improved treatment success (adjusted odds ratio [aOR], 3.0; 95% confidence interval [CI], 1.5-5.9; I(2)R, 11.8%), but pneumonectomy was not (aOR, 1.1; 95% CI, .6-2.3; I(2)R, 13.2%). Treatment success was more likely when surgery was performed after culture conversion than before conversion (aOR, 2.6; 95% CI, 0.9-7.1; I(2)R, 0.2%). Partial lung resection, but not pneumonectomy, was associated with improved treatment success among patients with MDR-tuberculosis. Although improved outcomes may reflect patient selection, partial lung resection surgery after culture conversion may improve treatment outcomes in patients who receive optimal medical therapy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis
Czech Academy of Sciences Publication Activity Database
Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.
2005-01-01
Roč. 280, č. 47 (2005), s. 38942-38947 ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005
Diabetes is Associated with Severe Adverse Events in Multidrug-Resistant Tuberculosis.
Muñoz-Torrico, Marcela; Caminero-Luna, José; Migliori, Giovanni Battista; D'Ambrosio, Lia; Carrillo-Alduenda, José Luis; Villareal-Velarde, Héctor; Torres-Cruz, Alfredo; Flores-Vergara, Héctor; Martínez-Mendoza, Dina; García-Sancho, Cecilia; Centis, Rosella; Salazar-Lezama, Miguel Ángel; Pérez-Padilla, Rogelio
2017-05-01
Diabetes mellitus (DM), a very common disease in Mexico, is a well-known risk factor for tuberculosis (TB). However, it is not known by which extent DM predisposes to adverse events (AE) to anti-TB drugs and/or to worse outcomes in patients with multidrug-resistant (MDR-TB) and extensively drug-resistant TB (XDR-TB). The main objective of this study was to describe the outcomes of TB treatment, the impact of DM and the prevalence of AE in a cohort of patients with MDR-/XDR pulmonary TB treated at the national TB referral centre in Mexico City. Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%), 11 with pre-XDR-TB (12.2%) and 6 (6.7%) with XDR-TB, including 49 (54.4%) with DM, and 3 with Human Immunodeficiency Virus (HIV) co-infection (3.3%). In 98% of patients, diagnosis was made by culture and drug susceptibility testing, while in a single case the diagnosis was made by a molecular test. The presence of DM was associated with an increased risk of serious drug-related AEs, such as nephrotoxicity (Odds Ratio [OR]=6.5; 95% Confidence Interval [95% CI]: 1.9-21.8) and hypothyroidism (OR=8.8; 95% CI: 1.8-54.2), but not for a worse outcome. Our data suggest that DM does not impact second-line TB treatment outcomes, but patients with DM have a higher risk of developing serious AEs to drug-resistant TB treatment, such as nephrotoxicity and hypothyroidism. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Collectin CL-LK Is a Novel Soluble Pattern Recognition Receptor for Mycobacterium tuberculosis
DEFF Research Database (Denmark)
Troegeler, Anthony; Lugo-Villarino, Geanncarlo; Hansen, Søren
2015-01-01
Understanding the molecular components of immune recognition of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, can help designing novel strategies to combat TB. Here, we identify collectin CL-LK as a novel soluble C-type lectin able to bind M. tuberculosis, and characterize mycobacte......Understanding the molecular components of immune recognition of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, can help designing novel strategies to combat TB. Here, we identify collectin CL-LK as a novel soluble C-type lectin able to bind M. tuberculosis, and characterize...
Directory of Open Access Journals (Sweden)
Fahmiya Leena Yacoob
2016-01-01
Full Text Available In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days as compared to solid and liquid cultures (35.6 days and 13.5 days, resp..
Yacoob, Fahmiya Leena; Philomina Jose, Beena; Karunakaran Lelitha, Sarada Devi; Sreenivasan, Sreelatha
2016-01-01
In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days) as compared to solid and liquid cultures (35.6 days and 13.5 days, resp.).
Benzothiazinones kill Mycobacterium tuberculosis by blocking arabinan synthesis
DEFF Research Database (Denmark)
Makarov, Vadim; Manina, Giulia; Mikusova, Katarina
2009-01-01
New drugs are required to counter the tuberculosis (TB) pandemic. Here, we describe the synthesis and characterization of 1,3-benzothiazin-4-ones (BTZs), a new class of antimycobacterial agents that kill Mycobacterium tuberculosis in vitro, ex vivo, and in mouse models of TB. Using genetics...
Tessema, Belay; Nabeta, Pamela; Valli, Eloise; Albertini, Audrey; Collantes, Jimena; Lan, Nguyen Huu; Romancenco, Elena; Tukavdze, Nestani; Denkinger, Claudia M; Dolinger, David L
2017-04-01
The spread of multidrug-resistant (MDR) tuberculosis (TB) and extensively drug-resistant (XDR) TB hampers global efforts in the fight against tuberculosis. To enhance the development and evaluation of diagnostic tests quickly and efficiently, well-characterized strains and samples from drug-resistant tuberculosis patients are necessary. In this project, the Foundation for Innovative New Diagnostics (FIND) has focused on the collection, characterization, and storage of such well-characterized reference materials and making them available to researchers and developers. The collection is being conducted at multiple centers in Southeast Asia, South America, Eastern Europe, and soon the sub-Saharan Africa regions. Strains are characterized for their phenotypic resistances and MICs to first-line drugs (FLDs) and second-line drugs (SLDs) using the automated MGIT 960 system following validated procedures and WHO criteria. Analysis of resistance-associated mutations is done by whole-genome sequencing (WGS) using the Illumina NextSeq system. Mycobacterial interspersed repetitive-unit-variable-number tandem-repeat analysis and WGS are used to determine strain lineages. All strains are maintained frozen at -80°C ± 10°C as distinct mother and daughter lots. All strains are extensively quality assured. The data presented here represent an analysis of the initial part of the collection. Currently, the bank contains 118 unique strains with extracted genomic DNA and matched sputum, serum, and plasma samples and will be expanded to a minimum of 1,000 unique strains over the next 3 years. Analysis of the current strains by phenotypic resistance testing shows 102 (86.4%), 10 (8.5%), and 6 (5.1%) MDR, XDR, and mono/poly resistant strains, respectively. Two of the strains are resistant to all 11 drugs that were phenotypically tested. WGS mutation analysis revealed FLD resistance-associated mutations in the rpoB , katG , inhA , embB , embA , and pncA genes; SLD resistance in the gyr
Brust, James C M; Shah, N Sarita; Mlisana, Koleka; Moodley, Pravi; Allana, Salim; Campbell, Angela; Johnson, Brent A; Master, Iqbal; Mthiyane, Thuli; Lachman, Simlatha; Larkan, Lee-Megan; Ning, Yuming; Malik, Amyn; Smith, Jonathan P; Gandhi, Neel R
2018-04-03
Mortality in multidrug-resistant (MDR) tuberculosis-human immunodeficiency virus (HIV) coinfection has historically been high, but most studies predated the availability of antiretroviral therapy (ART). We prospectively compared survival and treatment outcomes in MDR tuberculosis-HIV-coinfected patients on ART to those in patients with MDR tuberculosis alone. This observational study enrolled culture-confirmed MDR tuberculosis patients with and without HIV in South Africa between 2011 and 2013. Participants received standardized MDR tuberculosis and HIV regimens and were followed monthly for treatment response, adverse events, and adherence. The primary outcome was survival. Among 206 participants, 150 were HIV infected, 131 (64%) were female, and the median age was 33 years (interquartile range [IQR], 26-41). Of the 191 participants with a final MDR tuberculosis outcome, 130 (73%) were cured or completed treatment, which did not differ by HIV status (P = .50). After 2 years, CD4 count increased a median of 140 cells/mm3 (P = .005), and 64% had an undetectable HIV viral load. HIV-infected and HIV-uninfected participants had high rates of survival (86% and 94%, respectively; P = .34). The strongest risk factor for mortality was having a CD4 count ≤100 cells/mm3 (adjusted hazards ratio, 15.6; 95% confidence interval, 4.4-55.6). Survival and treatment outcomes among MDR tuberculosis-HIV individuals receiving concurrent ART approached those of HIV-uninfected patients. The greatest risk of death was among HIV-infected individuals with CD4 counts ≤100 cells/mm3. These findings provide critical evidence to support concurrent treatment of MDR tuberculosis and HIV.
In vitro antimicrobial efficacy of a fixed-dose combination of RHZE against M. tuberculosis
Directory of Open Access Journals (Sweden)
Vanessa Albertina Agertt
Full Text Available ABSTRACT The use of drugs in fixed-dose combination (FDC is now recommended by the World Health Organization (WHO due to the emergence of multidrug-resistant strains of Mycobacterium tuberculosis. FDC uses different drugs against tuberculosis (TB in a single tablet for phase-intensive therapeutic intervention. This therapy aims to optimize treatment, to prevent inappropriate use of drugs, and to prevent the emergence of new resistant strains. This study aims to evaluate the susceptibility of clinical isolates of M. tuberculosis against rifampicin, isoniazid, ethambutol, and pyrazinamide. The antimicrobials were tested separately and in associations according to FDC. This was used for broth microdilution method, which was compared to the proportions method previously considered as the gold standard. In antimicrobials testing alone, several strains were resistant to one, two, or three drugs. However, when applied to association of drugs in FDC, there was no antimicrobial resistance. The results strengthen the FDC's concept, which aims to unite the four anti-TB drugs to combat bacterial resistance.
Directory of Open Access Journals (Sweden)
Ernesto Montoro
2004-06-01
Full Text Available La vigilancia de la resistencia a fármacos a través del cultivo y de las pruebas de susceptibilidad in vitro permite conocer la magnitud regional y mundial de la resistencia en tuberculosis. En el presente trabajo se determinó la prevalencia de la resistencia a fármacos antituberculosos en Cuba, durante el periodo 1995-1998 en casos nuevos y en aquéllos que han recibido tratamiento previo. Los resultados incluidos en este estudio forman parte de los dos proyectos mundiales organizados por la OMS/UICTER. La resistencia a los medicamentos se evaluó usando el método de las proporciones en 1.379 cepas de Mycobacterium tuberculosis a los fármacos de primera línea (isoniacida, rifampicina, estreptomicina y etambutol. La resistencia en casos nuevos fue del 8,3% y 6,5% y la resistencia múltiple a fármacos (multidrug-resistance, MDR fue del 0,7% y 0% en el primer y segundo estudio, respectivamente. Estos resultados permitieron demostrar la escasa circulación de cepas MDR en Cuba; se reconoció a nivel mundial el buen funcionamiento del Programa Nacional de Control y el éxito de la aplicación en nuestro país de la estrategia del tratamiento estrictamente supervisado desde 1971.
Wieles, B.; van Agterveld, M.; Janson, A.; Clark-Curtiss, J.; Rinke de Wit, T.; Harboe, M.; Thole, J.
1994-01-01
Secreted proteins may serve as major targets in the immune response to mycobacteria. To identify potentially secreted Mycobacterium leprae antigens, antisera specific for culture filtrate proteins of Mycobacterium tuberculosis were used to screen a panel of recombinant antigens selected previously
Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.
Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T
2017-02-21
Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.
Characterization of Mycobacterium tuberculosis nicotinamidase/pyrazinamidase.
Zhang, Hua; Deng, Jiao-Yu; Bi, Li-Jun; Zhou, Ya-Feng; Zhang, Zhi-Ping; Zhang, Cheng-Gang; Zhang, Ying; Zhang, Xian-En
2008-02-01
The nicotinamidase/pyrazinamidase (PncA) of Mycobacterium tuberculosis is involved in the activation of the important front-line antituberculosis drug pyrazinamide by converting it into the active form, pyrazinoic acid. Mutations in the pncA gene cause pyrazinamide resistance in M. tuberculosis. The properties of M. tuberculosis PncA were characterized in this study. The enzyme was found to be a 20.89 kDa monomeric protein. The optimal pH and temperature of enzymatic activity were pH 7.0 and 40 degrees C, respectively. Inductively coupled plasma-optical emission spectrometry revealed that the enzyme was an Mn(2+)/Fe(2+)-containing protein with a molar ratio of [Mn(2+)] to [Fe(2+)] of 1 : 1; furthermore, the external addition of either type of metal ion had no apparent effect on the wild-type enzymatic activity. The activity of the purified enzyme was determined by HPLC, and it was shown that it possessed similar pyrazinamidase and nicotinamidase activity, by contrast with previous reports. Nine PncA mutants were generated by site-directed mutagenesis. Determination of the enzymatic activity and metal ion content suggested that Asp8, Lys96 and Cys138 were key residues for catalysis, and Asp49, His51, His57 and His71 were essential for metal ion binding. Our data show that M. tuberculosis PncA may bind metal ions in a manner different from that observed in the case of Pyrococcus horikoshii PncA.
Triple valve endocarditis by mycobacterium tuberculosis. A case report
Directory of Open Access Journals (Sweden)
Shaikh Quratulain
2012-09-01
Full Text Available Abstract Background Granulomas caused by Mycobacterium Tuberculosis have been observed at autopsy in the heart, pre-dominantly in the myocardium and endocardium, but rarely involving the coronary vessels and valvular structures. Mycobacterium tuberculosis valvular endocarditis is extremely rare, with most reports coming from autopsy series. Case presentation We report the case of a 17 year old immunocompetent girl who presented with history of fever, malaise, foot gangrene and a left sided hemiparesis. On investigation she was found to have infective endocarditis involving the aortic, mitral and tricuspid valves. She had developed a right middle cerebral artery stroke. She underwent dual valve replacement and tricuspid repair. The vegetations showed granulomatous inflammation but blood cultures and other biological specimen cultures were negative for any organisms. She was started on antituberculous treatment and anticoagulation. Conclusion This is the first reported case of triple valve endocarditis by Mycobacterium Tuberculosis in an immunocompetent host. Especially important is the fact that the right heart is involved which has been historically described in the setting of intravenous drug abuse. This implies that Tuberculosis should be considered in cases of culture negative endocarditis in endemic areas like Pakistan even in immunocompetent hosts.
Directory of Open Access Journals (Sweden)
Belén R Imperiale
2012-12-01
Full Text Available Tuberculosis (TB and multidrug and extensively drug-resistant (DR TB are important public health problems that are spreading worldwide. The aims of this study were to determine the sensitivity and specificity of the GenoType® MT BDRplus assay from smear-positive clinical specimens and isolates and to explore its possible application in routine work. Clinical samples were previously decontaminated using NaOH-N-acetyl-L-cystein or NaOH-ClNa hypertonic solution for Ziehl-Neelsen staining and cultures. The leftover sediments of smear-positive samples were stored at -20 ºC, 70 of which were selected to be included in this study according to their DR profile. Thirty DR Mycobacterium tuberculosis isolates were also assessed. Sequencing was used as gold standard to detect mutations conferring isoniazid (INH and rifampicin (RIF resistance. Valid results were obtained in 94.0 % of the samples and 85.5 % (53/62 of the INH-R samples were properly identified. Mutations in the katGS315T gene and inhA C-15T gene promoter region were present in 59.7 % (37/62 and 25.8% (16/62 of the INH-R samples, respectively. The system could also identify 97.7 % (41/42 of the RIF-R samples; the mutations found were rpoBS531L (66.7 %, 28/42, D516V (19.0 %, 8/42, H526Y and S531P/W (4.8 %, 2/42 each one, and S522L/Q (2.4 %, 1/42. A 98.8 % concordance between the GenoType assay and sequencing was obtained. GenoType® MT BDRplus has demonstrated to be easy to implement and to perform in clinical laboratories and useful for a rapid detection of DR M. tuberculosis from decontaminated sputa and clinical isolates. Therefore, this assay could be applied as a rapid tool to predict INH-R and/or RIF-R in DR risk cases.La tuberculosis (TBC, y la TBC multi y extensivamente drogo-resistentes (DR son importantes problemas de salud pública mundial. El objetivo de este estudio fue determinar la sensibilidad y especificidad del sistema GenoType® MT BDRplus a partir de esputos (baciloscop
Directory of Open Access Journals (Sweden)
Bruno L. Abbadi
2018-05-01
Full Text Available The emergence of strains of Mycobacterium tuberculosis resistant to isoniazid (INH has underscored the need for the development of new anti-tuberculosis agents. INH is activated by the mycobacterial katG-encoded catalase-peroxidase, forming an acylpyridine fragment that is covalently attached to the C4 of NADH. This isonicotinyl-NAD adduct inhibits the activity of 2-trans-enoyl-ACP(CoA reductase (InhA, which plays a role in mycolic acid biosynthesis. A metal-based INH analog, Na3[FeII(CN5(INH]·4H2O, IQG-607, was designed to have an electronic redistribution on INH moiety that would lead to an intramolecular electron transfer to bypass KatG activation. HPLC and EPR studies showed that the INH moiety can be oxidized by superoxide or peroxide yielding similar metabolites and isonicotinoyl radical only when associated to IQG-607, thereby supporting redox-mediated drug activation as a possible mechanism of action. However, IQG-607 was shown to inhibit the in vitro activity of both wild-type and INH-resistant mutant InhA enzymes in the absence of KatG activation. IQG-607 given by the oral route to M. tuberculosis-infected mice reduced lung lesions. Experiments using early and late controls of infection revealed a bactericidal activity for IQG-607. HPLC and voltammetric methods were developed to quantify IQG-607. Pharmacokinetic studies showed short half-life, high clearance, moderate volume of distribution, and low oral bioavailability, which was not altered by feeding. Safety and toxic effects of IQG-607 after acute and 90-day repeated oral administrations in both rats and minipigs showed occurrence of mild to moderate toxic events. Eight multidrug-resistant strains (MDR-TB were resistant to IQG-607, suggesting an association between katG mutation and increasing MIC values. Whole genome sequencing of three spontaneous IQG-607-resistant strains harbored katG gene mutations. MIC measurements and macrophage infection experiments with a laboratorial
Zhao, Ji-Li; Liu, Wei; Xie, Wan-Ying; Cao, Xu-Dong; Yuan, Li
2018-01-01
Tuberculosis (TB) caused by Mycobacterium tuberculosis (MTB) is one of the most common chronic infectious amphixenotic diseases worldwide. Prevention and control of TB are greatly difficult, due to the increase in drug-resistant TB, particularly multidrug-resistant TB. We speculated that there were some differences between drug-sensitive and drug-resistant MTB strains and that mazEF 3,6,9 toxin-antitoxin systems (TASs) were involved in MTB viability. This study aimed to investigate differences in viability, biofilm formation, and MazEF expression between drug-sensitive and drug-resistant MTB strains circulating in Xinjiang, China, and whether mazEF 3,6,9 TASs contribute to MTB viability under stress conditions. Growth profiles and biofilm-formation abilities of drug-sensitive, drug-resistant MTB strains and the control strain H37Rv were monitored. Using molecular biology experiments, the mRNA expression of the mazF 3, 6, and 9 toxin genes, the mazE 3, 6, and 9 antitoxin genes, and expression of the MazF9 protein were detected in the different MTB strains, H37RvΔ mazEF 3,6,9 mutants from the H37Rv parent strain were generated, and mutant viability was tested. Ex vivo culture analyses demonstrated that drug-resistant MTB strains exhibit higher survival rates than drug-sensitive strains and the control strain H37Rv. However, there was no statistical difference in biofilm-formation ability in the drug-sensitive, drug-resistant, and H37Rv strains. mazE 3,6 mRNA-expression levels were relatively reduced in the drug-sensitive and drug-resistant strains compared to H37Rv. Conversely, mazE 3,9 expression was increased in drug-sensitive strains compared to drug-resistant strains. Furthermore, compared with the H37Rv strain, mazF 3,6 expression was increased in drug-resistant strains, mazF 9 expression was increased in drug-sensitive strains, and mazF 9 exhibited reduced expression in drug-resistant strains compared with drug-sensitive strains. Protein expression of mazF9
Advances in the Laboratory Diagnosis of Mycobacterium Tuberculosis
African Journals Online (AJOL)
Mycobacterium tuberculosis (MTB), the agent of human tuberculosis remains a leading cause of mortality globally. Its resurgence during the last two decades is a reflection of its opportunistic relationship with HIV. The challenges associated with the disease are enormous and often debilitating. The role of clinical and ...
Gcebe, Nomakorinte; Michel, Anita; Gey van Pittius, Nicolaas C; Rutten, Victor
2016-01-01
The Esx and PE/PPE families of proteins are among the most immunodominant mycobacterial antigens and have thus been the focus of research to develop vaccines and immunological tests for diagnosis of bovine and human tuberculosis, mainly caused by Mycobacterium bovis and Mycobacterium tuberculosis,
Buoyant density of Mycobacterium tuberculosis: implications for sputum processing
den Hertog, A. L.; Klatser, P. R.; Anthony, R. M.
2009-01-01
A tuberculosis (TB) research laboratory in the Netherlands. The concentration of Mycobacterium tuberculosis cells from sputum is almost universally performed by centrifugation after chemical liquefaction. These methods are thus dependent on the effective sedimentation of mycobacterial cells, and the
Immune Responses Involved in Mycobacterium Tuberculosis Infection
Directory of Open Access Journals (Sweden)
Roghayeh Teimourpour
2016-09-01
Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.
Perdigã o, Joã o; Silva, Carla; Diniz, Jaciara; Pereira, Catarina; Machado, Diana; Ramos, Jorge; Silva, Hugo; Abilleira, Fernanda; Brum, Clarice; Reis, Ana J.; Macedo, Maí ra; Scaini, Joã o L.; Silva, Ana B.; Esteves, Leonardo; Macedo, Rita; Maltez, Fernando; Clemente, Sofia; Coelho, Elizabeth; Viegas, Sofia; Rabna, Paulo; Rodrigues, Amabé lia; Taveira, Nuno; Jordao, Luí sa; Kritski, Afrâ nio; e Silva, José Lapa; Mokrousov, Igor; Couvin, David; Rastogi, Nalin; Couto, Isabel; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; von Groll, Andrea; Dalla-Costa, Elis R.; Rossetti, Maria Lú cia; da Silva, Pedro E.A.; Viveiros, Miguel; Portugal, Isabel
2018-01-01
Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.
Perdigão, João
2018-03-18
Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.
Intraocular manifestations of mycobacterium tuberculosis: A review of the literature
Directory of Open Access Journals (Sweden)
Lauren A. Dalvin
2017-05-01
Full Text Available Mycobacterium tuberculosis: is most commonly associated with pulmonary infection. However, tuberculosis (TB can also affect the eye. TB can affect nearly any tissue in the eye, and a high index of suspicion is required for accurate diagnosis, as many of the intraocular manifestations of TB can mimic other, more common diseases. Correct diagnosis is critical because systemic anti-tuberculosis treatment may be required, and vision loss or even loss of the affected eye can occur without proper treatment. Thus, it is important for ophthalmologists and infectious disease specialists to work together to accurately diagnose and treat intraocular TB. This article reports the various known presentations of intraocular TB and reviews important elements of diagnosis and treatment. Keywords: Mycobacterium, Tuberculosis, Choroidal granuloma, Retinal vasculitis
Masenga, Sepiso K; Mubila, Harrison; Hamooya, Benson M
2017-09-22
Since the recent introduction of GeneXepert for the detection of Tuberculosis (TB) drug resistance mutations in both primary resistance and acquired resistance in Zambia, little has been documented in literature on the issue of rifampicin resistance especially in the face of a high National TB burden. The study aimed to determine the prevalence of rifampicin resistance in tuberculosis patients at Livingstone Central Hospital for the year 2015. This was a cross sectional study conducted at Livingstone Central Hospital where we reviewed 152 records (from January 1, 2015 to 31st December, 2015) involving patients who presented with clinically suspected TB or documented TB, whose samples were sent to the laboratory for GeneXpert Mycobacterium tuberculosis/rifampicin testing. Statistical evaluations used a one-sample test of proportion and Fisher's exact test. The age of participants ranged from 8 months to 73 years old (median = 34). Of the participants with complete data on gender, 99 (66%) and 52 (34%) were males and females respectively. The TB co-infection with HIV prevalence was 98.3% (p < 0.001). Prevalence of rifampicin resistance was 5.9% and there was no statistical significant difference between being male or female (p = 0.721). We were able to show from our study, evidence of rifampicin resistance at Livingstone Central Hospital. Hence, there was need for further in-depth research and appropriate interventions (i.e close follow-up and patient care for drug resistance positive patients).
Isaakidis, Petros; Das, Mrinalini; Kumar, Ajay M V; Peskett, Christopher; Khetarpal, Minni; Bamne, Arun; Adsul, Balkrishna; Manglani, Mamta; Sachdeva, Kuldeep Singh; Parmar, Malik; Kanchar, Avinash; Rewari, B B; Deshpande, Alaka; Rodrigues, Camilla; Shetty, Anjali; Rebello, Lorraine; Saranchuk, Peter
2014-01-01
Drug-resistant tuberculosis (DR-TB) is a looming threat to tuberculosis control in India. However, no countrywide prevalence data are available. The burden of DR-TB in HIV-co-infected patients is likewise unknown. Undiagnosed and untreated DR-TB among HIV-infected patients is a major cause of mortality and morbidity. We aimed to assess the prevalence of DR-TB (defined as resistance to any anti-TB drug) in patients attending public antiretroviral treatment (ART) centers in greater metropolitan Mumbai, India. A cross-sectional survey was conducted among adults and children ART-center attendees. Smear microscopy, culture and drug-susceptibility-testing (DST) against all first and second-line TB-drugs using phenotypic liquid culture (MGIT) were conducted on all presumptive tuberculosis patients. Analyses were performed to determine DR-TB prevalence and resistance patterns separately for new and previously treated, culture-positive TB-cases. Between March 2013 and January 2014, ART-center attendees were screened during 14135 visits, of whom 1724 had presumptive TB. Of 1724 attendees, 72 (4%) were smear-positive and 202 (12%) had a positive culture for Mycobacterium tuberculosis. Overall DR-TB was diagnosed in 68 (34%, 95% CI: 27%-40%) TB-patients. The proportions of DR-TB were 25% (29/114) and 44% (39/88) among new and previously treated cases respectively. The patterns of DR-TB were: 21% mono-resistant, 12% poly-resistant, 38% multidrug-resistant (MDR-TB), 21% pre-extensively-drug-resistant (MDR-TB plus resistance to either a fluoroquinolone or second-line injectable), 6% extensively drug-resistant (XDR-TB) and 2% extremely drug-resistant TB (XDR-TB plus resistance to any group-IV/V drug). Only previous history of TB was significantly associated with the diagnosis of DR-TB in multivariate models. The burden of DR-TB among HIV-infected patients attending public ART-centers in Mumbai was alarmingly high, likely representing ongoing transmission in the community and
Directory of Open Access Journals (Sweden)
Petros Isaakidis
Full Text Available BACKGROUND: Drug-resistant tuberculosis (DR-TB is a looming threat to tuberculosis control in India. However, no countrywide prevalence data are available. The burden of DR-TB in HIV-co-infected patients is likewise unknown. Undiagnosed and untreated DR-TB among HIV-infected patients is a major cause of mortality and morbidity. We aimed to assess the prevalence of DR-TB (defined as resistance to any anti-TB drug in patients attending public antiretroviral treatment (ART centers in greater metropolitan Mumbai, India. METHODS: A cross-sectional survey was conducted among adults and children ART-center attendees. Smear microscopy, culture and drug-susceptibility-testing (DST against all first and second-line TB-drugs using phenotypic liquid culture (MGIT were conducted on all presumptive tuberculosis patients. Analyses were performed to determine DR-TB prevalence and resistance patterns separately for new and previously treated, culture-positive TB-cases. RESULTS: Between March 2013 and January 2014, ART-center attendees were screened during 14135 visits, of whom 1724 had presumptive TB. Of 1724 attendees, 72 (4% were smear-positive and 202 (12% had a positive culture for Mycobacterium tuberculosis. Overall DR-TB was diagnosed in 68 (34%, 95% CI: 27%-40% TB-patients. The proportions of DR-TB were 25% (29/114 and 44% (39/88 among new and previously treated cases respectively. The patterns of DR-TB were: 21% mono-resistant, 12% poly-resistant, 38% multidrug-resistant (MDR-TB, 21% pre-extensively-drug-resistant (MDR-TB plus resistance to either a fluoroquinolone or second-line injectable, 6% extensively drug-resistant (XDR-TB and 2% extremely drug-resistant TB (XDR-TB plus resistance to any group-IV/V drug. Only previous history of TB was significantly associated with the diagnosis of DR-TB in multivariate models. CONCLUSION: The burden of DR-TB among HIV-infected patients attending public ART-centers in Mumbai was alarmingly high, likely representing
Dharmadhikari, Ashwin S; Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A; van der Walt, Martie; Nardell, Edward A
2012-05-15
Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68-85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31-51%), representing a 56% (95% CI, 33-70.5%) decreased risk of TB transmission when patients used masks. Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients.
21 CFR 866.3370 - Mycobacterium tuberculosis immunofluorescent reagents.
2010-04-01
... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents... used to identify Mycobacterium tuberculosis directly from clinical specimens. The identification aids...
Behar, Samuel M.; Carpenter, Stephen M.; Booty, Matthew G.; Barber, Daniel L.; Jayaraman, Pushpa
2014-01-01
Despite the introduction almost a century ago of Mycobacterium bovis BCG (BCG), an attenuated form of M. bovis that is used as a vaccine against Mycobacterium tuberculosis, tuberculosis remains a global health threat and kills more than 1.5 million people each year. This is mostly because BCG fails to prevent pulmonary disease – the contagious form of tuberculosis. Although there have been significant advances in understanding how the immune system responds to infection, the qualities that define protective immunity against M. tuberculosis remain poorly characterized. The ability to predict who will maintain control over the infection and who will succumb to clinical disease would revolutionize our approach to surveillance, control, and treatment. Here we review the current understanding of pulmonary T cell responses following M. tuberculosis infection. While infection elicits a strong immune response that contains infection, M. tuberculosis evades eradication. Traditionally, its intracellular lifestyle and alteration of macrophage function are viewed as the dominant mechanisms of evasion. Now we appreciate that chronic inflammation leads to T cell dysfunction. While this may arise as the host balances the goals of bacterial sterilization and avoidance of tissue damage, it is becoming clear that T cell dysfunction impairs host resistance. Defining the mechanisms that lead to T cell dysfunction is crucial as memory T cell responses are likely to be subject to the same subject to the same pressures. Thus, success of T cell based vaccines is predicated on memory T cells avoiding exhaustion while at the same time not promoting overt tissue damage. PMID:25311810
DEFF Research Database (Denmark)
Mustafa, A S; Amoudy, H A; Wiker, H G
1998-01-01
GroES, rPstS, rGroEL and rDnaK) antigens of Mycobacterium tuberculosis. The responses of PBMC to these defined antigens were compared with the corresponding results obtained with complex antigens, such as whole-cell M. tuberculosis, M. tuberculosis culture filtrate (MT-CF) and cell wall antigens, as well...... as the vaccine strain, Mycobacterium bovis bacillus Calmette-Guerin (BCG). In addition, M. tuberculosis and MT-CF-induced T-cell lines were tested in the same assays against the panel of purified and complex antigens. The compiled data from PBMC and T-cell lines tested for antigen-induced proliferation and IFN...
Directory of Open Access Journals (Sweden)
Gyamfi Oti K
2010-02-01
Full Text Available Abstract Background The emergence of drug resistant strains of Mycobacterium tuberculosis complex has made the management of tuberculosis difficult. Also, Mycobacterium species has a peculiar cell wall, made of an impermeable complex structure rich in mycolate, making the lyses of its cell difficult. In order to apply a radio-labelled-probe based detection of mutations in selected genes leading to drug resistance, we concede that the evaluation and modifications of nucleic acid extraction protocols that are less sophisticated and less prone to contamination would be useful in the management of tuberculosis in a resource-constrained setting. Findings The average amount of nucleic acids was determined for different extraction treatments. High temperature treatment only, yielded the lowest amount of nucleic acids, i.e. 15.7 ± 3.2 μg. The average amount of nucleic acids obtained with the addition of TE and triton-X100, was 133.7 ± 8.9 μg, while that obtained with the addition of TE only, and TE and SDS were 68.4 ± 22.7 μg and 70.4 ± 20.3 μg respectively. Other treatments yielded 28.8 ± 6.7 μg, 32.5 ± 2.4 μg and 36.9 ± 15.5 μg. The average amount of nucleic acids obtained with high temperature treatment in TE, and that obtained by freezing prior to high temperature treatment, successfully amplified for the genes of interest (rpoB, KatG, rrs. Conclusion We strongly recommend the use of 1× TE buffer, and freezing and heating for improved lysis of cultured M. tuberculosis, and therefore, as an effective method for the preparation of M. tuberculosis nucleic acid useful for PCR.
Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis
Directory of Open Access Journals (Sweden)
Anthony L. Byrne
2017-07-01
Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.
Extensively Drug-Resistant Tuberculosis: Principles of Resistance, Diagnosis, and Management.
Wilson, John W; Tsukayama, Dean T
2016-04-01
Extensively drug-resistant (XDR) tuberculosis (TB) is an unfortunate by-product of mankind's medical and pharmaceutical ingenuity during the past 60 years. Although new drug developments have enabled TB to be more readily curable, inappropriate TB management has led to the emergence of drug-resistant disease. Extensively drug-resistant TB describes Mycobacterium tuberculosis that is collectively resistant to isoniazid, rifampin, a fluoroquinolone, and an injectable agent. It proliferates when established case management and infection control procedures are not followed. Optimized treatment outcomes necessitate time-sensitive diagnoses, along with expanded combinations and prolonged durations of antimicrobial drug therapy. The challenges to public health institutions are immense and most noteworthy in underresourced communities and in patients coinfected with human immunodeficiency virus. A comprehensive and multidisciplinary case management approach is required to optimize outcomes. We review the principles of TB drug resistance and the risk factors, diagnosis, and managerial approaches for extensively drug-resistant TB. Treatment outcomes, cost, and unresolved medical issues are also discussed. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.
SURGERY FOR DRUG-RESISTANT DESTRUCTIVE PULMONARY TUBERCULOSIS
Directory of Open Access Journals (Sweden)
S. N. Skornyakov
2015-01-01
Full Text Available The paper presents the experience in surgically treating 145 patients with destructive, mainly fibrocavernous pulmonary tuberculosis. All the patients completed treatment. In the preoperative preparation, particular emphasis is laid on the promptest determination of a spectrum of pathogen susceptibility/resistance, individualized chemotherapy, and collapse therapy options. Postoperative complications occurred in 27 (18.6% patients, fatal outcomes in 4 (2.7%. The former were recorded most frequently after pneumonectomy in 13 (37.1% cases, the later were seen in 3 (8.6%. Sputum culture conversion was generally achieved in 111 (78% patients, particularly in 97 (78.2% patients with multidrug-resistant tuberculosis and in 14 (66.7% with a broad drug resistance in the pathogen. Out of the 64 patients followed up for more than 3 years, 48 (75.0% were in clinical and bacteriological remission.
Directory of Open Access Journals (Sweden)
Palsson Bernhard Ø
2007-06-01
Full Text Available Abstract Background: Mycobacterium tuberculosis continues to be a major pathogen in the third world, killing almost 2 million people a year by the most recent estimates. Even in industrialized countries, the emergence of multi-drug resistant (MDR strains of tuberculosis hails the need to develop additional medications for treatment. Many of the drugs used for treatment of tuberculosis target metabolic enzymes. Genome-scale models can be used for analysis, discovery, and as hypothesis generating tools, which will hopefully assist the rational drug development process. These models need to be able to assimilate data from large datasets and analyze them. Results: We completed a bottom up reconstruction of the metabolic network of Mycobacterium tuberculosis H37Rv. This functional in silico bacterium, iNJ661, contains 661 genes and 939 reactions and can produce many of the complex compounds characteristic to tuberculosis, such as mycolic acids and mycocerosates. We grew this bacterium in silico on various media, analyzed the model in the context of multiple high-throughput data sets, and finally we analyzed the network in an 'unbiased' manner by calculating the Hard Coupled Reaction (HCR sets, groups of reactions that are forced to operate in unison due to mass conservation and connectivity constraints. Conclusion: Although we observed growth rates comparable to experimental observations (doubling times ranging from about 12 to 24 hours in different media, comparisons of gene essentiality with experimental data were less encouraging (generally about 55%. The reasons for the often conflicting results were multi-fold, including gene expression variability under different conditions and lack of complete biological knowledge. Some of the inconsistencies between in vitro and in silico or in vivo and in silico results highlight specific loci that are worth further experimental investigations. Finally, by considering the HCR sets in the context of known
Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.
Directory of Open Access Journals (Sweden)
Tafsina Haque Aurin
Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.
DEFF Research Database (Denmark)
Doherty, T Mark; Demissie, Abebech; Olobo, Joseph
2002-01-01
Diagnosis of latent Mycobacterium tuberculosis infection is considered essential for tuberculosis control but is hampered by the lack of specific reagents. We report that strong recognition of tuberculosis complex-specific antigen ESAT-6 by healthy household contacts of tuberculosis patients...
Directory of Open Access Journals (Sweden)
Salvatore Nisticò
2013-08-01
Full Text Available Tuberculosis is still a global emergency and a major public health problem, in some cases related to the appearance of strains of multi drug resistance (MDR and extensive drug resistance (XDR Mycobacterium tuberculosis complex.The correct determination of antibiotic sensitivity profiles is therefore crucial to carry out appropriate treatment aimed to decrease the infectivity of each patient and to reduce mortality. The poor adherence to treatment by the patient or the use of therapies based on a single drug, as a result of incorrect requirements, promote the development of drug-resistance. Have some time on the market of molecular diagnostic tests that allow, quickly and directly from biological sample to search for resistance genes some key drugs of anti-TB therapy (Rifampicin and Isoniazid. One of the tests in question is the Genotype MTBDRplus ver 2.0 which can reveal the presence of genes for resistance to Isoniazid (INH and Rifampin (RMP.The loci analyzed are those corresponding to the rpoB gene for rifampicin, katG and inhA for isoniazid. Our study is based on the analysis of 83 strains of tubercular Mycobacteria identified and isolated from patients with tuberculosis disease and subjected to the tests sensitivity, searching for mutations and phenotypic susceptibility testing for Rifampicin and Isoniazid.The comparison of the results has shown that the results obtained using the Genotype MTBDRplus ver 2.0 test, were similar to the results obtained by the traditional susceptibility testing.
DEFF Research Database (Denmark)
Nielsen, Kirstine Klitgaard; Ahrens, Peter
2002-01-01
By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria. The uniquen......By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria....... The uniqueness and diagnostic potential of seven of these fragments in relation to M. paratuberculosis closest relative Mycobacterium avium subsp. avium (M. avium) was confirmed by species-specific PCR and Southern blot. Furthermore, RT-PCR indicated that eight of the nine fragments originate from areas...
Ahmad, Suhail; Al-Mutairi, Noura M; Mokaddas, Eiman
2012-05-01
Frequency of resistance-conferring mutations vary among isoniazid- and ethambutol-resistant Mycobacterium tuberculosis isolates obtained from patients of various ethnic groups. This study was aimed to determine the occurrence of specific rpoB mutations in rifampicin-resistant M. tuberculosis isolates from tuberculosis patients of various ethnic groups in Kuwait. Rifampicin-resistant M. tuberculosis isolates (n=119) from South Asian (n=55), Southeast Asian (n=23), Middle Eastern (n=39) and other (n=2) patients and 107 rifampicin-susceptible isolates were tested. Mutations in rpoB were detected by DNA sequencing. Polymorphisms at katG463 and gyrA95 were detected by PCR-RFLP for genetic group assignment. None of rifampicin-susceptible but 116 of 119 rifampicin-resistant isolates showed rpoB mutation(s). Mutations among isolates from South Asian patients were distributed at rpoB516 (20%), rpoB526 (24%) and rpoB531 (27%) while 78 and 51 per cent of isolates from Southeast Asian and Middle Eastern patients, respectively, contained a mutated rpoB531. All isolates with rpoB N-terminal and cluster II mutations were obtained from Middle Eastern and South Asian patients. Most isolates from South Asian (84%) and Southeast Asian (70%) patients belonged to genetic group I while nearly all remaining isolates belonged to genetic group II. Isolates from Middle Eastern patients were distributed among genetic group I (46%), genetic group II (33%) and genetic group III (21%). The occurrence of specific rpoB mutations varied considerably in rifampicin-resistant M. tuberculosis isolates obtained from patients of different ethnic groups within the same country. The present data have important implications for designing region-specific rapid methods for detecting majority of rifampicin-resistant strains.
Grandjean, Louis; Martin, Laura; Gilman, Robert H; Valencia, Teresa; Herrera, Beatriz; Quino, Willi; Ramos, Eric; Rivero, Maribel; Montoya, Rosario; Escombe, A Roderick; Coleman, David; Mitchison, Denis; Evans, Carlton A
2008-07-01
Tuberculosis culture usually requires sputum decontamination and centrifugation to prevent cultures from being overgrown by contaminating bacteria and fungi. However, decontamination destroys many tuberculous bacilli, and centrifugation often is not possible in resource-poor settings. We therefore assessed the performance of Mycobacterium tuberculosis culture with unprocessed samples plated directly by using tuberculosis-selective media and compared this procedure to conventional culture using centrifuge decontamination. Quadruplicate aliquots of strain H37RV were cultured in 7H9 broth with and without selective antimicrobials and after centrifuge decontamination. The subsequent comparison was made with 715 sputum samples. Split paired sputum samples were cultured conventionally with centrifuge decontamination and by direct culture in tuberculosis-selective media containing antibiotics. Centrifuge decontamination reduced tuberculosis H37RV colonies by 78% (P laboratories this deficit may be outweighed by the ease of use.
Gokulan, Kuppan; Khare, Sangeeta; Cerniglia, Carl E; Foley, Steven L; Varughese, Kottayil I
2018-03-09
The final step of peptidoglycan (PG) synthesis in all bacteria is the formation of cross-linkage between PG-stems. The cross-linking between amino acids in different PG chains gives the peptidoglycan cell wall a 3-dimensional structure and adds strength and rigidity to it. There are two distinct types of cross-linkages in bacterial cell walls. D,D-transpeptidase (D,D-TPs) generate the classical 4➔3 cross-linkages and the L,D-transpeptidase (L,D-TPs) generate the 3➔3 non-classical peptide cross-linkages. The present study is aimed at understanding the nature of drug resistance associated with L,D-TP and gaining insights for designing novel antibiotics against multi-drug resistant bacteria. Penicillin and cephalosporin classes of β-lactams cannot inhibit L,D-TP function; however, carbapenems inactivate its function. We analyzed the structure of L,D-TP of Mycobacterium tuberculosis in the apo form and in complex with meropenem and imipenem. The periplasmic region of L,D-TP folds into three domains. The catalytic residues are situated in the C-terminal domain. The acylation reaction occurs between carbapenem antibiotics and the catalytic Cys-354 forming a covalent complex. This adduct formation mimics the acylation of L,D-TP with the donor PG-stem. A novel aspect of this study is that in the crystal structures of the apo and the carbapenem complexes, the N-terminal domain has a muropeptide unit non-covalently bound to it. Another interesting observation is that the calcium complex crystallized as a dimer through head and tail interactions between the monomers.
Mycobacterium tuberculosis Genotype and Case Notification Rates, Rural Vietnam, 2003-2006
Buu, T.N.; Huyen, M.N.T.; Lan, N.N.T.; Quy, H.T.; Hen, N.V.; Zignol, M.; Borgdorff, M.W.; van Soolingen, D.; Cobelens, F.G.J.
2009-01-01
Tuberculosis case notification rates (CNRs) for young adults in Vietnam are increasing. To determine whether this finding could reflect emergence of Mycobacterium tuberculosis Beijing genotype, we studied all new sputum smear-positive pulmonary tuberculosis patients registered for treatment in 3
Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E
2010-06-01
The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.
van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S
2013-04-01
Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.
Lee, Mei-Feng; Chen, Yen-Hsu; Hsu, Hui-Jine; Peng, Chien-Fang
2010-10-01
In this study, we designed a simple and rapid colorimetric detection method, a one-tube loop-mediated isothermal amplification (LAMP)-PCR-hybridization-restriction endonuclease-ELISA [one-tube LAMP-PCR-HY-RE-ELISA] system, to detect resistance to isoniazid, ethambutol and streptomycin in strains of Mycobacterium tuberculosis isolated from clinical specimens. The clinical performance of this method for detecting isoniazid-resistant, ethambutol-resistant and streptomycin-resistant isolates of M. tuberculosis showed 98.9%, 94.3% and 93.8%, respectively. This assay is rapid and convenient that can be performed within one working day. One-tube LAMP-PCR-HY-RE-ELISA system was designed based on hot spot point mutations in target drug-resistant genes, using LAMP-PCR, hybridization, digestion with restriction endonuclease and colorimetric method of ELISA. In this study, LAMP assay was used to amplify DNA from drug-resistant M. tuberculosis, and ELISA was used for colorimetrical determination. This assay will be a useful tool for rapid diagnosis of mutant codons in strains of M. tuberculosis for isoniazid at katG 315 and katG 463, ethambutol at embB 306 and embB 497, and streptomycin at rpsL 43. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Stellah G Mpagama
Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.
Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis
Young, Douglas B.; Comas, I?aki; de Carvalho, Luiz P. S.
2015-01-01
Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii, and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms (SNPs) with predicted impact on protein function and transcriptional regulation...
The cell envelope glycoconjugates of Mycobacterium tuberculosis
Angala, Shiva Kumar; Belardinelli, Juan Manuel; Huc-Claustre, Emilie; Wheat, William H.; Jackson, Mary
2015-01-01
Tuberculosis (TB) remains the second most common cause of death due to a single infectious agent. The cell envelope of Mycobacterium tuberculosis (Mtb), the causative agent of the disease in humans, is a source of unique glycoconjugates and the most distinctive feature of the biology of this organism. It is the basis of much of Mtb pathogenesis and one of the major causes of its intrinsic resistance to chemotherapeutic agents. At the same time, the unique structures of Mtb cell envelope glycoconjugates, their antigenicity and essentiality for mycobacterial growth provide opportunities for drug, vaccine, diagnostic and biomarker development, as clearly illustrated by recent advances in all of these translational aspects. This review focuses on our current understanding of the structure and biogenesis of Mtb glycoconjugates with particular emphasis on one of most intriguing and least understood aspect of the physiology of mycobacteria: the translocation of these complex macromolecules across the different layers of the cell envelope. It further reviews the rather impressive progress made in the last ten years in the discovery and development of novel inhibitors targeting their biogenesis. PMID:24915502
International Nuclear Information System (INIS)
Tarrand, J.J.; Spicer, A.D.; Groeschel, D.H.
1986-01-01
Pyrazinamide susceptibility testing of Mycobacterium tuberculosis requires an acid environment. By controlling the method of acidification and the quality and quantity of the inoculum, the test can be performed with the BACTEC radiometric system (Johnston Laboratories, Towson, Md.). We acidified BACTEC 7H12 medium with buffered phosphoric acid and adjusted the test inoculum to 1/10 of that usually employed in BACTEC protocols; after 5 days of growth we correctly identified 36 of 36 strains susceptible to 50 micrograms of pyrazinamide per ml. All 18 resistant strains were classified as pyrazinamide resistant. (Susceptibility or resistance had been determined by standard plate assays.) The test was able to detect small resistant populations in artificial mixtures of 1 or 2% resistant bacteria with a susceptible strain (10 mixtures each). We tested 70 M. tuberculosis strains in acidified BACTEC 7H12 medium and by the plate dilution test at pH 5.5. All strains grew in the BACTEC medium, but three strains failed to grow on plates and were not tested further; the results of both methods agreed for the remaining strains
Siderocalin inhibits the intracellular replication of Mycobacterium tuberculosis in macrophages
DEFF Research Database (Denmark)
Johnson, Erin E; Srikanth, Chittur V; Sandgren, Andreas
2010-01-01
Siderocalin is a secreted protein that binds to siderophores to prevent bacterial iron acquisition. While it has been shown to inhibit the growth of Mycobacterium tuberculosis (M.tb) in extracellular cultures, its effect on this pathogen within macrophages is not clear. Here, we show that sideroc......Siderocalin is a secreted protein that binds to siderophores to prevent bacterial iron acquisition. While it has been shown to inhibit the growth of Mycobacterium tuberculosis (M.tb) in extracellular cultures, its effect on this pathogen within macrophages is not clear. Here, we show...... findings are consistent with an important role for siderocalin in protection against M.tb infection and suggest that exogenously administered siderocalin may have therapeutic applications in tuberculosis....
Koser, C. U.; Feuerriegel, S.; Summers, D. K.; Archer, John A.C.; Niemann, S.
2012-01-01
Despite being genetically monomorphic, the limited genetic diversity within the Mycobacterium tuberculosis complex (MTBC) has practical consequences for molecular methods for drug susceptibility testing and for the use of current antibiotics and those in clinical trials. It renders some representatives of MTBC intrinsically resistant against one or multiple antibiotics and affects the spectrum and consequences of resistance mutations selected for during treatment. Moreover, neutral or silent changes within genes responsible for drug resistance can cause false-positive results with hybridization-based assays, which have been recently introduced to replace slower phenotypic methods. We discuss the consequences of these findings and propose concrete steps to rigorously assess the genetic diversity of MTBC to support ongoing clinical trials.
Koser, C. U.
2012-09-24
Despite being genetically monomorphic, the limited genetic diversity within the Mycobacterium tuberculosis complex (MTBC) has practical consequences for molecular methods for drug susceptibility testing and for the use of current antibiotics and those in clinical trials. It renders some representatives of MTBC intrinsically resistant against one or multiple antibiotics and affects the spectrum and consequences of resistance mutations selected for during treatment. Moreover, neutral or silent changes within genes responsible for drug resistance can cause false-positive results with hybridization-based assays, which have been recently introduced to replace slower phenotypic methods. We discuss the consequences of these findings and propose concrete steps to rigorously assess the genetic diversity of MTBC to support ongoing clinical trials.
The Use Of Rap-PCR In Studying Mycobacterium tuberculosis ...
African Journals Online (AJOL)
Mycobacterium tuberculosis is the second leading cause of death from infectious agent. This study sought to detect M. tuberculosis genes, which were specifically expressed, or upregulated during intracellular infection of. J774 murine macrophages; as such genes may be potential targets for novel drug action. J774 murine ...
DEFF Research Database (Denmark)
Doherty, T Mark; Demissie, Abebech; Olobo, Joseph
2002-01-01
Diagnosis of latent Mycobacterium tuberculosis infection is considered essential for tuberculosis control but is hampered by the lack of specific reagents. We report that strong recognition of tuberculosis complex-specific antigen ESAT-6 by healthy household contacts of tuberculosis patients...... correlates with the subsequent development of active tuberculosis during a 2-year follow-up period....
Recurrent tuberculosis in an urban area in China: relapse or exogenous reinfection?
Shen, Xin; Yang, Chongguang; Wu, Jie; Lin, Senlin; Gao, Xu; Wu, Zheyuan; Tian, Jiyun; Gan, Mingyu; Luo, Tao; Wang, Lili; Yu, Chenlei; Mei, Jian; Pan, Qichao; DeRiemer, Kathryn; Yuan, ZhengAn; Gao, Qian
2017-01-01
Recurrent tuberculosis is an important indicator of the effectiveness of tuberculosis control and can occur by relapse or exogenous reinfection. We conducted a retrospective cohort study on all bacteriologically confirmed tuberculosis cases that were successfully treated between 2000 and 2012 in Shanghai, an urban area with a high number but a low prevalence rate of tuberculosis cases and a low prevalence of HIV infection. Genotyping the Mycobacterium tuberculosis from clinical isolates was used to distinguish between relapse and reinfection. In total, 5.3% (710/13,417) of successfully treated cases had a recurrence, a rate of 7.55 (95% CI 7.01–8.13) episodes per 1000 person-years, more than 18 times the rate of tuberculosis in the general population. Patients who were male, age 30–59, retreatment cases, had cavitation, diabetes, drug-resistant or multidrug-resistant tuberculosis in their initial episode of tuberculosis, were at high risk for a recurrence. Among 141 recurrent cases that had paired isolates, 59 (41.8%) had different genotypes, indicating reinfection with a different strain. Patients who completed treatment were still at high risk of another episode of tuberculosis and exogenous reinfection contributed a significant proportion of the recurrent tuberculosis cases. Targeted control strategies are needed to prevent new tuberculosis infections in this setting. PMID:28237039
DEFF Research Database (Denmark)
Thakur, Aneesh; Sharma, Mandeep; Katoch, Vipin C.
2012-01-01
Mycobacterium bovis and Mycobacterium tuberculosis infect both animals and humans. The disease epidemiology by these agents differs in developed and developing countries due to the differences in the implementation of the prevention and control strategies. The present study describes the detectio...
Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Douglas B. Young
2015-03-01
Full Text Available Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms with predicted impact on protein function and transcriptional regulation. Differences in the B12 synthesis pathway, methionine biosynthesis, fatty acid catabolism, and DNA repair and replication are consistent with adaptations to different environmental niches and pathogenic lifestyles. While there is no evidence of further gene acquisition during expansion of the M. tuberculosis complex, the emergence of other forms of genetic diversity provides insights into continuing host-pathogen co-evolution and has the potential to identify novel targets for disease intervention.
Tyagi, Priyanka; Dharmaraja, Allimuthu T; Bhaskar, Ashima; Chakrapani, Harinath; Singh, Amit
2015-07-01
Mycobacterium tuberculosis (Mtb) has evolved protective and detoxification mechanisms to maintain cytoplasmic redox balance in response to exogenous oxidative stress encountered inside host phagocytes. In contrast, little is known about the dynamic response of this pathogen to endogenous oxidative stress generated within Mtb. Using a noninvasive and specific biosensor of cytoplasmic redox state of Mtb, we for first time discovered a surprisingly high sensitivity of this pathogen to perturbation in redox homeostasis induced by elevated endogenous reactive oxygen species (ROS). We synthesized a series of hydroquinone-based small molecule ROS generators and found that ATD-3169 permeated mycobacteria to reliably enhance endogenous ROS including superoxide radicals. When Mtb strains including multidrug-resistant (MDR) and extensively drug-resistant (XDR) patient isolates were exposed to this compound, a dose-dependent, long-lasting, and irreversible oxidative shift in intramycobacterial redox potential was detected. Dynamic redox potential measurements revealed that Mtb had diminished capacity to restore cytoplasmic redox balance in comparison with Mycobacterium smegmatis (Msm), a fast growing nonpathogenic mycobacterial species. Accordingly, Mtb strains were extremely susceptible to inhibition by ATD-3169 but not Msm, suggesting a functional linkage between dynamic redox changes and survival. Microarray analysis showed major realignment of pathways involved in redox homeostasis, central metabolism, DNA repair, and cell wall lipid biosynthesis in response to ATD-3169, all consistent with enhanced endogenous ROS contributing to lethality induced by this compound. This work provides empirical evidence that the cytoplasmic redox poise of Mtb is uniquely sensitive to manipulation in steady-state endogenous ROS levels, thus revealing the importance of targeting intramycobacterial redox metabolism for controlling TB infection. Copyright © 2015 The Authors. Published by
Directory of Open Access Journals (Sweden)
Franky Arisgraha
2012-01-01
Full Text Available Tuberculosis (TBC is an dangerous disease and many people has been infected. One of many important steps to control TBC effectively and efficiently is by increasing case finding using right method and accurate diagnostic. One of them is to detect Mycobacterium Tuberculosis inside sputum. Conventional detection of Mycobacterium Tuberculosis inside sputum can need a lot of time, so digitally detection method of Mycobacterium Tuberculosis was designed as an effort to get better result of detection. This method was designed by using combination between digital image processing method and Neural Network method. From testing report that was done, Mycobacterium can be detected with successful value reach 77.5% and training error less than 5%.
Variable host-pathogen compatibility in Mycobacterium tuberculosis.
Gagneux, Sebastien; DeRiemer, Kathryn; Van, Tran; Kato-Maeda, Midori; Jong, Bouke C de; Narayanan, Sujatha; Nicol, Mark; Niemann, Stefan; Kremer, Kristin; Gutierrez, M Cristina; Hilty, Markus; Hopewell, Philip C; Small, Peter M
2006-01-01
Mycobacterium tuberculosis remains a major cause of morbidity and mortality worldwide. Studies have reported human pathogens to have geographically structured population genetics, some of which have been linked to ancient human migrations. However, no study has addressed the potential evolutionary
Zhang, Lei-lei; Jin, Hua
2015-12-01
Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.
Beta-lactamases of Mycobacterium tuberculosis and Mycobacterium kansasii.
Segura, C; Salvadó, M
1997-09-01
Re-emergence of infectious diseases caused by mycobacteria as well as the emergence of multiresistant strains of Mycobacterium has promoted the research on the use of beta-lactames in the treatment of such diseases. Mycobacteria produce beta-lactamases: M. tuberculosis produces a wide-spectrum beta-lactamase whose behaviour mimicks those of Gram-negative bacteria. M. kansasii produces also beta-lactamase which can be inhibited by clavulanic acid. An overview on beta-lactamases from both species is reported.
Specific T-cell epitopes for immunoassay-based diagnosis of Mycobacterium tuberculosis infection
DEFF Research Database (Denmark)
Brock, I; Weldingh, K; Leyten, EM
2004-01-01
Specific T-cell epitopes for immunoassay-based diagnosis of Mycobacterium tuberculosis infection.Brock I, Weldingh K, Leyten EM, Arend SM, Ravn P, Andersen P. Department of Infectious Disease Immunology, Statens Serum Institute, Artillerivej 5, DK-2300 Copenhagen S, Denmark. The currently used...... method for immunological detection of tuberculosis infection, the tuberculin skin test, has low specificity. Antigens specific for Mycobacterium tuberculosis to replace purified protein derivative are therefore urgently needed. We have performed a rigorous assessment of the diagnostic potential of four...... recently identified antigens (Rv2653, Rv2654, Rv3873, and Rv3878) from genomic regions that are lacking from the Mycobacterium bovis bacillus Calmette-Guerin (BCG) vaccine strains as well as from the most common nontuberculous mycobacteria. The fine specificity of potential epitopes in these molecules...
Understanding Rifampicin Resistance in Tuberculosis through a Computational Approach
Directory of Open Access Journals (Sweden)
Satish Kumar
2014-12-01
Full Text Available The disease tuberculosis, caused by Mycobacterium tuberculosis (MTB, remains a major cause of morbidity and mortality in developing countries. The evolution of drug-resistant tuberculosis causes a foremost threat to global health. Most drug-resistant MTB clinical strains are showing resistance to isoniazid and rifampicin (RIF, the frontline anti-tuberculosis drugs. Mutation in rpoB, the beta subunit of DNA-directed RNA polymerase of MTB, is reported to be a major cause of RIF resistance. Amongst mutations in the well-defined 81-base-pair central region of the rpoB gene, mutation at codon 450 (S450L and 445 (H445Y is mainly associated with RIF resistance. In this study, we modeled two resistant mutants of rpoB (S450L and H445Y using Modeller9v10 and performed a docking analysis with RIF using AutoDock4.2 and compared the docking results of these mutants with the wild-type rpoB. The docking results revealed that RIF more effectively inhibited the wild-type rpoB with low binding energy than rpoB mutants. The rpoB mutants interacted with RIF with positive binding energy, revealing the incapableness of RIF inhibition and thus showing resistance. Subsequently, this was verified by molecular dynamics simulations. This in silico evidence may help us understand RIF resistance in rpoB mutant strains.
Rambukkana, A.; Das, P. K.; Kolk, A. H.; Burggraaf, J. D.; Kuijper, S.; Harboe, M.
1993-01-01
Mycobacterium tuberculosis antigens inducing species-specific immune responses are likely to be particularly important for serodiagnosis or for skin testing of tuberculosis. In the present study, we describe the characterization of two novel monoclonal antibodies (MoAbs) A3h4 (IgG2a) and B5g1 (IgM)
Rothchild, Alissa C; Stowell, Britni; Goyal, Girija; Nunes-Alves, Cláudio; Yang, Qianting; Papavinasasundaram, Kadamba; Sassetti, Christopher M; Dranoff, Glenn; Chen, Xinchun; Lee, Jinhee; Behar, Samuel M
2017-10-24
Mice deficient for granulocyte-macrophage colony-stimulating factor (GM-CSF -/- ) are highly susceptible to infection with Mycobacterium tuberculosis , and clinical data have shown that anti-GM-CSF neutralizing antibodies can lead to increased susceptibility to tuberculosis in otherwise healthy people. GM-CSF activates human and murine macrophages to inhibit intracellular M. tuberculosis growth. We have previously shown that GM-CSF produced by iNKT cells inhibits growth of M. tuberculosis However, the more general role of T cell-derived GM-CSF during infection has not been defined and how GM-CSF activates macrophages to inhibit bacterial growth is unknown. Here we demonstrate that, in addition to nonconventional T cells, conventional T cells also produce GM-CSF during M. tuberculosis infection. Early during infection, nonconventional iNKT cells and γδ T cells are the main source of GM-CSF, a role subsequently assumed by conventional CD4 + T cells as the infection progresses. M. tuberculosis -specific T cells producing GM-CSF are also detected in the peripheral blood of infected people. Under conditions where nonhematopoietic production of GM-CSF is deficient, T cell production of GM-CSF is protective and required for control of M. tuberculosis infection. However, GM-CSF is not required for T cell-mediated protection in settings where GM-CSF is produced by other cell types. Finally, using an in vitro macrophage infection model, we demonstrate that GM-CSF inhibition of M. tuberculosis growth requires the expression of peroxisome proliferator-activated receptor gamma (PPARγ). Thus, we identified GM-CSF production as a novel T cell effector function. These findings suggest that a strategy augmenting T cell production of GM-CSF could enhance host resistance against M. tuberculosis IMPORTANCE Mycobacterium tuberculosis is the bacterium that causes tuberculosis, the leading cause of death by any infection worldwide. T cells are critical components of the immune
Phelan, Jody; Coll, Francesc; McNerney, Ruth; Ascher, David; Pires, Douglas; Furnham, Nick; Coeck, Nele; Hill-Cawthorne, Grant; Nair, Mridul; Mallard, Kim; Ramsay, Andrew; Campino, Susana; Hibberd, Martin; Pain, Arnab; Rigouts, Leen; Clark, Taane
2016-01-01
Abstract Background Combating the spread of drug resistant tuberculosis is a global health priority. Whole genome association studies are being applied to identify genetic determinants of resistance to anti-tuberculosis drugs. Protein structure
Directory of Open Access Journals (Sweden)
Yusran Yusran
2016-01-01
Full Text Available Plants gotu kola (Centella Asiatica L .Urban is a wild plant that efficacious as remedies traditional cure disease tuberculosis (TB.TB is disease contagious infection caused by bacteria mycobacterium tuberculosis. Research aims to understand the ability extract methanol leaves gotu kola red and leaves gotu kola green and determines the concentration optimal extract methanol leaves gotu kola red and leaves gotu kola green and to know the comparison between extract methanol leaves gotu kola red with an extract methanol leaves gotu kola green in inhibits the activity of mycobacterium tuberculosis.Extraction done with the methods maceration use methanol and continued with evaporation until obtained extract viscous .Testing antibacterial activity done in a microscopic observation drug susceptibility ( mods use plate petri dish 24 hole with the variation of concentration ie 20%,40%, 60%, 80% and 100%.The results of testing show that extracts methanol leaves gotu kola red and leaves gotu kola green positive capable of inhibiting the growth of bacteria mycobacterium tuberculosis with inhibition optimal in concentration 80 % and 100 % characterized by the absence of growth bacteria colonies which are (- or 0 %.Extract methanol leaves gotu kola green capable of inhibiting the growth of bacteria mycobacterium tuberculosis better than extract methanol leaves gotu kola red seen in concentration 40% and 60%.
DEFF Research Database (Denmark)
Arendrup, Maiken Cavling; Patterson, Thomas F
2017-01-01
Invasive Candida infections remain an important cause of morbidity and mortality, especially in hospitalized and immunocompromised or critically ill patients. A limited number of antifungal agents from only a few drug classes are available to treat patients with these serious infections. Resistance...... can be either intrinsic or acquired. Resistance mechanisms are not exchanged between Candida; thus, acquired resistance either emerges in response to an antifungal selection pressure in the individual patient or, more rarely, occur due to horizontal transmission of resistant strains between patients....... Although multidrug resistance is uncommon, increasing reports of multidrug resistance to the azoles, echinocandins, and polyenes have occurred in several Candida species, most notably Candida glabrata and more recently Candida auris. Drivers are overall antifungal use, subtherapeutic drug levels at sites...
Surveillance of drug resistance for tuberculosis control: why and how?
Chaulet, P; Boulahbal, F; Grosset, J
1995-12-01
The resistance of Mycobacterium tuberculosis to antibiotics, which reflects the quality of the chemotherapy applied in the community, is one of the elements of epidemiological surveillance used in national tuberculosis programmes. Measurement of drug resistance poses problems for biologists in standardization of laboratory methods and quality control. The definition of rates of acquired and primary drug resistance also necessitates standardization in the methods used to collect information transmitted by clinicians. Finally, the significance of the rates calculated depends on the choice of the patients sample on which sensitivity tests have been performed. National surveys of drug resistance therefore require multidisciplinary participation in order to select the only useful indicators: rates of primary resistance and of acquired resistance. These indicators, gathered in representative groups of patients over a long period, are a measurement of the impact of modern chemotherapy regimens on bacterial ecology.
Directory of Open Access Journals (Sweden)
Nestani Tukvadze
Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.
Insights on the Emergence of Mycobacterium tuberculosis from the Analysis of Mycobacterium kansasii
Wang, Joyce; McIntosh, Fiona; Radomski, Nicolas; Dewar, Ken; Simeone, Roxane; Enninga, Jost; Brosch, Roland; Rocha, Eduardo P.; Veyrier, Frédéric J.; Behr, Marcel A.
2015-01-01
By phylogenetic analysis, Mycobacterium kansasii is closely related to Mycobacterium tuberculosis. Yet, although both organisms cause pulmonary disease, M. tuberculosis is a global health menace, whereas M. kansasii is an opportunistic pathogen. To illuminate the differences between these organisms, we have sequenced the genome of M. kansasii ATCC 12478 and its plasmid (pMK12478) and conducted side-by-side in vitro and in vivo investigations of these two organisms. The M. kansasii genome is 6,432,277 bp, more than 2 Mb longer than that of M. tuberculosis H37Rv, and the plasmid contains 144,951 bp. Pairwise comparisons reveal conserved and discordant genes and genomic regions. A notable example of genomic conservation is the virulence locus ESX-1, which is intact and functional in the low-virulence M. kansasii, potentially mediating phagosomal disruption. Differences between these organisms include a decreased predicted metabolic capacity, an increased proportion of toxin–antitoxin genes, and the acquisition of M. tuberculosis-specific genes in the pathogen since their common ancestor. Consistent with their distinct epidemiologic profiles, following infection of C57BL/6 mice, M. kansasii counts increased by less than 10-fold over 6 weeks, whereas M. tuberculosis counts increased by over 10,000-fold in just 3 weeks. Together, these data suggest that M. kansasii can serve as an image of the environmental ancestor of M. tuberculosis before its emergence as a professional pathogen, and can be used as a model organism to study the switch from an environmental opportunistic pathogen to a professional host-restricted pathogen. PMID:25716827
Curcumin enhances human macrophage control of Mycobacterium tuberculosis infection.
Bai, Xiyuan; Oberley-Deegan, Rebecca E; Bai, An; Ovrutsky, Alida R; Kinney, William H; Weaver, Michael; Zhang, Gong; Honda, Jennifer R; Chan, Edward D
2016-07-01
With the worldwide emergence of highly drug-resistant tuberculosis (TB), novel agents that have direct antimycobacterial effects or that enhance host immunity are urgently needed. Curcumin is a polyphenol responsible for the bright yellow-orange colour of turmeric, a spice derived from the root of the perennial herb Curcuma longa. Curcumin is a potent inducer of apoptosis-an effector mechanism used by macrophages to kill intracellular Mycobacterium tuberculosis (MTB). An in vitro human macrophage infection model was used to determine the effects of curcumin on MTB survival. We found that curcumin enhanced the clearance of MTB in differentiated THP-1 human monocytes and in primary human alveolar macrophages. We also found that curcumin was an inducer of caspase-3-dependent apoptosis and autophagy. Curcumin mediated these anti-MTB cellular functions, in part, via inhibition of nuclear factor-kappa B (NFκB) activation. Curcumin protects against MTB infection in human macrophages. The host-protective role of curcumin against MTB in macrophages needs confirmation in an animal model; if validated, the immunomodulatory anti-TB effects of curcumin would be less prone to drug resistance development. © 2016 Asian Pacific Society of Respirology.
Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S
2016-01-01
Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.
Directory of Open Access Journals (Sweden)
Ana Julia Reis
Full Text Available ABSTRACT We conducted a cross-sectional, retrospective study, characterized by classical and molecular epidemiology, involving M. tuberculosis isolates from a regional prison in southern Brazil. Between January of 2011 and August of 2014, 379 prisoners underwent sputum smear microscopy and culture; 53 (13.9% were diagnosed with active tuberculosis. Of those, 8 (22.9% presented with isoniazid-resistant tuberculosis. Strain genotyping was carried out by 15-locus mycobacterial interspersed repetitive unit-variable-number tandem-repeat analysis; 68.6% of the patients were distributed into five clusters, and 87.5% of the resistant cases were in the same cluster. The frequency of drug-resistant tuberculosis cases and the rate of recent transmission were high. Our data suggest the need to implement an effective tuberculosis control program within the prison system.
International Nuclear Information System (INIS)
Badr, Hesham M.
2011-01-01
The effectiveness of gamma irradiation on the inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese that prepared from artificially inoculated milk samples was studied. Irradiation at dose of 2 kGy was sufficient for the complete inactivation of these mycobacteria as they were not detected in the treated samples during storage at 4±1 o C for 15 days. Moreover, irradiation of cheese samples, that were prepared from un-inoculated milk, at this effective dose had no significant effects on their gross composition and contents from riboflavin, niacin and pantothenic acid, while significant decreases in vitamin A and thiamin were observed. In addition, irradiation of cheese samples had no significant effects on their pH and nitrogen fractions contents, except for the contents of ammonia, which showed a slight, but significant, increases due to irradiation. The analysis of cheese fats indicated that irradiation treatment induced significant increase in their oxidation parameters and contents from free fatty acids; however, the observed increases were relatively low. On the other hand, irradiation of cheese samples induced no significant alterations on their sensory properties. Thus, irradiation dose of 2 kGy can be effectively applied to ensure the safety of soft cheese with regards to these harmful mycobacteria. - Highlights: → We examined the effectiveness of gamma irradiation on inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese. → Irradiation at dose of 2 kGy was sufficient for complete inactivation of these mycobacteria. → Irradiation of cheese samples induced no significant alterations on their sensory properties.
Energy Technology Data Exchange (ETDEWEB)
Badr, Hesham M., E-mail: heshambadr_aea@yahoo.co.uk [Atomic Energy Authority, Nuclear Research Center, Abou Zaabal, P.O. Box 13759 Cairo (Egypt)
2011-11-15
The effectiveness of gamma irradiation on the inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese that prepared from artificially inoculated milk samples was studied. Irradiation at dose of 2 kGy was sufficient for the complete inactivation of these mycobacteria as they were not detected in the treated samples during storage at 4{+-}1 {sup o}C for 15 days. Moreover, irradiation of cheese samples, that were prepared from un-inoculated milk, at this effective dose had no significant effects on their gross composition and contents from riboflavin, niacin and pantothenic acid, while significant decreases in vitamin A and thiamin were observed. In addition, irradiation of cheese samples had no significant effects on their pH and nitrogen fractions contents, except for the contents of ammonia, which showed a slight, but significant, increases due to irradiation. The analysis of cheese fats indicated that irradiation treatment induced significant increase in their oxidation parameters and contents from free fatty acids; however, the observed increases were relatively low. On the other hand, irradiation of cheese samples induced no significant alterations on their sensory properties. Thus, irradiation dose of 2 kGy can be effectively applied to ensure the safety of soft cheese with regards to these harmful mycobacteria. - Highlights: > We examined the effectiveness of gamma irradiation on inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese. > Irradiation at dose of 2 kGy was sufficient for complete inactivation of these mycobacteria. > Irradiation of cheese samples induced no significant alterations on their sensory properties.
Molecular Analysis of Multi-Drug Resistance (MDR) in ...
African Journals Online (AJOL)
This review therefore brings to light some of the processes involved in molecular typing of Mycobacterium tuberculosis strains like the use of restriction fragment length polymorphism (RFLP) and spoligotyping, which have become valuable tools in the epidemiology of tuberculosis, identification of genotypes and ...
Heaton, Brook E.; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C.; Glickman, Michael S.
2014-01-01
Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA bre...
Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy
2007-01-01
PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939
Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P
2015-03-01
To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.
Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe
DEFF Research Database (Denmark)
Post, Frank A; Grint, Daniel; Efsen, Anne Marie Werlinrud
2014-01-01
Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature.We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB...... in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin.Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent...... of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those...
International Nuclear Information System (INIS)
Orme, I.M.
1988-01-01
The results herein show that mice infected with Mycobacterium tuberculosis and then exposed to a protracted course of isoniazid chemotherapy possess a heightened state of acquired resistance to subsequent challenge with the homologous organism. Our results provide the first evidence, moreover, that this resistance is mediated by a long-lived, cyclophosphamide- and irradiation-resistant L3T4+ Lyt-2- lymphocyte capable of giving rise to an accelerated re-emergence of resistance in the animal upon rechallenge. Evidence is also provided to show that triggering of this memory-immune T cell population in the re-challenged host was associated with the rapid emergence of non-specific resistance to secondary bacterial infection; however, the accelerated emergence of this population was only observed if the challenge inoculum consisted of the living organism. The relevance of this latter finding to strategies for vaccine development is discussed
Directory of Open Access Journals (Sweden)
Bony Wiem Lestari
2016-12-01
Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.
Structural studies on Mycobacterium tuberculosis RecA
Indian Academy of Sciences (India)
Structures of crystals of Mycobacterium tuberculosis RecA, grown and analysed under different conditions, provide insights into hitherto underappreciated details of molecular structure and plasticity. In particular, they yield information on the invariant and variable features of the geometry of the P-loop, whose binding to ATP ...
Primary drug resistance in a region with high burden of tuberculosis. A critical problem.
Villa-Rosas, Cecilia; Laniado-Laborín, Rafael; Oceguera-Palao, Lorena
2015-01-01
To determine rates of drug resistance in new cases of pulmonary tuberculosis in a region with a high burden of the disease. New case suspects were referred for drug susceptibility testing. 28.9% of new cases were resistant to at least one first line drug; 3.9% had a multidrug-resistant strain, 15.6% a monoresistant strain and 9.4% a polyresistant strain. Our rate of drug resistant tuberculosis in new cases is very high; this has important clinical implications, since even monoresistance can have a negative impact on the outcome of new cases treated empirically with a six month regimen.
Specific T-cell epitopes for immunoassay-based diagnosis of Mycobacterium tuberculosis infection
DEFF Research Database (Denmark)
Brock, I; Weldingh, K; Leyten, EM
2004-01-01
Specific T-cell epitopes for immunoassay-based diagnosis of Mycobacterium tuberculosis infection.Brock I, Weldingh K, Leyten EM, Arend SM, Ravn P, Andersen P. Department of Infectious Disease Immunology, Statens Serum Institute, Artillerivej 5, DK-2300 Copenhagen S, Denmark. The currently used...... method for immunological detection of tuberculosis infection, the tuberculin skin test, has low specificity. Antigens specific for Mycobacterium tuberculosis to replace purified protein derivative are therefore urgently needed. We have performed a rigorous assessment of the diagnostic potential of four...... selected and combined the specific peptide stretches from the four proteins not recognized by M. bovis BCG-vaccinated individuals. These peptide stretches were tested with peripheral blood mononuclear cells obtained from patients with microscopy- or culture-confirmed tuberculosis and from healthy M. bovis...
Bioenergetics of Mycobacterium: An Emerging Landscape for Drug Discovery
Directory of Open Access Journals (Sweden)
Iram Khan Iqbal
2018-02-01
Full Text Available Mycobacterium tuberculosis (Mtb exhibits remarkable metabolic flexibility that enables it to survive a plethora of host environments during its life cycle. With the advent of bedaquiline for treatment of multidrug-resistant tuberculosis, oxidative phosphorylation has been validated as an important target and a vulnerable component of mycobacterial metabolism. Exploiting the dependence of Mtb on oxidative phosphorylation for energy production, several components of this pathway have been targeted for the development of new antimycobacterial agents. This includes targeting NADH dehydrogenase by phenothiazine derivatives, menaquinone biosynthesis by DG70 and other compounds, terminal oxidase by imidazopyridine amides and ATP synthase by diarylquinolines. Importantly, oxidative phosphorylation also plays a critical role in the survival of persisters. Thus, inhibitors of oxidative phosphorylation can synergize with frontline TB drugs to shorten the course of treatment. In this review, we discuss the oxidative phosphorylation pathway and development of its inhibitors in detail.
Bioenergetics of Mycobacterium: An Emerging Landscape for Drug Discovery
Iqbal, Iram Khan; Bajeli, Sapna; Akela, Ajit Kumar
2018-01-01
Mycobacterium tuberculosis (Mtb) exhibits remarkable metabolic flexibility that enables it to survive a plethora of host environments during its life cycle. With the advent of bedaquiline for treatment of multidrug-resistant tuberculosis, oxidative phosphorylation has been validated as an important target and a vulnerable component of mycobacterial metabolism. Exploiting the dependence of Mtb on oxidative phosphorylation for energy production, several components of this pathway have been targeted for the development of new antimycobacterial agents. This includes targeting NADH dehydrogenase by phenothiazine derivatives, menaquinone biosynthesis by DG70 and other compounds, terminal oxidase by imidazopyridine amides and ATP synthase by diarylquinolines. Importantly, oxidative phosphorylation also plays a critical role in the survival of persisters. Thus, inhibitors of oxidative phosphorylation can synergize with frontline TB drugs to shorten the course of treatment. In this review, we discuss the oxidative phosphorylation pathway and development of its inhibitors in detail. PMID:29473841
Drug susceptibility testing of Mycobacterium tuberculosis to fluoroquinolones
DEFF Research Database (Denmark)
Johansen, I S; Larsen, A R; Sandven, P
2003-01-01
In the first attempt to establish a quality assurance programme for susceptibility testing of Mycobacterium tuberculosis to fluoroquinolones, 20 strains with different fluoroquinolone susceptibility patterns were distributed by the Supranational Reference Laboratory in Stockholm to the other...
de Knegt, Gerjo J; van der Meijden, Aart; de Vogel, Corné P; Aarnoutse, Rob E; de Steenwinkel, Jurriaan E M
2017-03-01
Current treatment for tuberculosis (TB) is complicated by the emergence of multidrug resistant TB (MDR-TB). As a result, there is an urgent need for new powerful anti-TB regimens and novel strategies. In this study, we aimed to potentiate a moxifloxacin + linezolid backbone as treatment for MDR-TB with the efflux pump inhibitors verapamil and timcodar as well as with drugs that act on mycobacterial cell wall stability such as colistin and SQ109. Using a time-kill kinetics assay, the activities of moxifloxacin, linezolid, verapamil, timcodar, colistin and SQ109 as single drugs against Mycobacterium tuberculosis were evaluated. In addition, the activity of the moxifloxacin + linezolid backbone in combination with one of the potentiator drugs was assessed. As little as 0.125 mg/L moxifloxacin achieved 99% killing of M. tuberculosis after 6 days of exposure. Linezolid showed moderate killing but 99% killing was not achieved. Verapamil, timcodar and colistin only resulted in killing with the highest concentrations tested but 99% killing was not achieved. SQ109 resulted in complete elimination after 1 day of exposure to 256 mg/L and in 99% elimination after 6 days of exposure to 1 mg/L. Furthermore, colistin added to the moxifloxacin + linezolid backbone resulted in increased elimination, whereas verapamil, timcodar and SQ109 showed no added value to the backbone. This finding that colistin potentiates the activity of the moxifloxacin + linezolid backbone against M. tuberculosis suggests its potential role in further studies on the applicability of a moxifloxacin + linezolid treatment of MDR-TB. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Primary drug-resistant tuberculosis in Hanoi, Viet Nam: present status and risk factors.
Directory of Open Access Journals (Sweden)
Nguyen Thi Le Hang
Full Text Available INTRODUCTION: Resistance of Mycobacterium tuberculosis (MTB to anti-tuberculosis (TB drugs presents a serious challenge to TB control worldwide. We investigated the status of drug resistance, including multidrug-resistant (MDR TB, and possible risk factors among newly diagnosed TB patients in Hanoi, the capital of Viet Nam. METHODS: Clinical and epidemiological information was collected from 506 newly diagnosed patients with sputum smear- and culture-positive TB, and 489 (96.6% MTB isolates were subjected to conventional drug susceptibility testing, spoligotyping, and 15-locus variable numbers of tandem repeats typing. Adjusted odds ratios (aORs were calculated to analyze the risk factors for primary drug resistance. RESULTS: Of 489 isolates, 298 (60.9% were sensitive to all drugs tested. Resistance to isoniazid, rifampicin, streptomycin, ethambutol, and MDR accounted for 28.2%, 4.9%, 28.2%, 2.9%, and 4.5%, respectively. Of 24 isolates with rifampicin resistance, 22 (91.7% were MDR and also resistant to streptomycin, except one case. Factors associated with isoniazid resistance included living in old urban areas, presence of the Beijing genotype, and clustered strains [aOR = 2.23, 95% confidence interval (CI 1.15-4.35; 1.91, 1.18-3.10; and 1.69, 1.06-2.69, respectively. The Beijing genotype was also associated with streptomycin resistance (aOR = 2.10, 95% CI 1.29-3.40. Human immunodeficiency virus (HIV coinfection was associated with rifampicin resistance and MDR (aOR = 5.42, 95% CI 2.07-14.14; 6.23, 2.34-16.58, respectively. CONCLUSION: Isoniazid and streptomycin resistance was observed in more than a quarter of TB patients without treatment history in Hanoi. Transmission of isoniazid-resistant TB among younger people should be carefully monitored in urban areas, where Beijing strains and HIV coinfection are prevalent. Choosing an optimal treatment regimen on the basis of the results of drug susceptibility tests and monitoring of treatment
Bim is a crucial regulator of apoptosis induced by Mycobacterium tuberculosis
Aguiló, N; Uranga, S; Marinova, D; Martín, C; Pardo, J
2014-01-01
Mycobacterium tuberculosis, the causative agent of tuberculosis, induces apoptosis in infected macrophages in vitro and in vivo. However, the molecular mechanism controlling this process is not known. In order to study the involvement of the mitochondrial apoptotic pathway in M. tuberculosis-induced apoptosis, we analysed cell death in M. tuberculosis-infected embryonic fibroblasts (MEFs) derived from different knockout mice for genes involved in this route. We found that apoptosis induced by M. tuberculosis is abrogated in the absence of Bak and Bax, caspase 9 or the executioner caspases 3 and 7. Notably, we show that MEF deficient in the BH3-only BCL-2-interacting mediator of cell death (Bim) protein were also resistant to this process. The relevance of these results has been confirmed in the mouse macrophage cell line J774, where cell transfection with siRNA targeting Bim impaired apoptosis induced by virulent mycobacteria. Notably, only infection with a virulent strain, but not with attenuated ESX-1-defective strains, such as Bacillus Calmette-Guerin and live-attenuated M. tuberculosis vaccine strain MTBVAC, induced Bim upregulation and apoptosis, probably implicating virulence factor early secreted antigenic target 6-kDa protein in this process. Our results suggest that Bim upregulation and apoptosis is mediated by the p38MAPK-dependent pathway. Our findings show that Bim is a master regulator of apoptosis induced by M. tuberculosis. PMID:25032866
Resistant plasmid profile analysis of multidrug resistant Escherichia ...
African Journals Online (AJOL)
Background: Multi-drug resistant Escherichia coli has become a major threat and cause of many urinary tract infections (UTIs) in Abeokuta, Nigeria. Objectives: This study was carried out to determine the resistant plasmids of multidrug resistant Escherichia coli isolated from (Urinary tract infections)UTIs in Abeokuta.
Integration of HIV testing in tuberculosis drug resistance surveillance in Kazakhstan and Kenya
Klinkenberg, E.; van den Hof, S.; Tursynbayeva, A.; Kipruto, H.; Wahogo, J.; Pak, S.; Kutwa, A.; L'Herminez, R.
2012-01-01
In Kenya and Kazakhstan, integration of human immunodeficiency virus (HIV) testing results into the routine surveillance of multidrug-resistant tuberculosis (MDR-TB) proved feasible and useful. The integration process improved overall data quality and data validation capacity, and integrated data
Bloodstream Infections with Mycobacterium tuberculosis among HIV patients
Centers for Disease Control (CDC) Podcasts
This podcast looks at bloodstream infections with Mycobacterium tuberculosis and other pathogens among outpatients infected with HIV in Southeast Asia. CDC health scientist Kimberly McCarthy discusses the study and why bloodstream infections occur in HIV-infected populations.
Anti-tuberculosis lupane-type isoprenoids from Syzygium guineense Wild DC. (Myrtaceae stem bark
Directory of Open Access Journals (Sweden)
I.A. Oladosu
2017-12-01
Full Text Available Plant derived isoprenoids commonly called terpenoids, are not only useful as chemosytemic markers but are increasingly attracting attention in the development of newer drugs for the treatment of multi-drug resistant tuberculosis. Anti-tuberculosis activity guided solvent fractionation and chromatographic separation of the chloroform extract of S. guineense stem bark resulted in the isolation of two bioactive 3-β-hydroxylupane-type isoprenoids: betulinic acid methylenediol ester (1 (MIC; 0.15 mg/mL and betulinic acid (2 (MIC; 0.60 mg/mL. The structures of the isolated compounds were elucidated using spectroscopic techniques. The antituberculosis assay was done using the Mycobacterium Growth Indicator Tube (MGIT method. This is the first report of the isolation of the anti-tuberculosis constituents of S. guineense and its potentials for the development of drug leads for the treatment of tuberculosis thus validating its ethno-medicinal uses.
Exogenous reinfection of tuberculosis in a low-burden area.
Schiroli, Consuelo; Carugati, Manuela; Zanini, Fabio; Bandera, Alessandra; Di Nardo Stuppino, Silvia; Monge, Elisa; Morosi, Manuela; Gori, Andrea; Matteelli, Alberto; Codecasa, Luigi; Franzetti, Fabio
2015-12-01
Recurrence of tuberculosis (TB) can be the consequence of relapse or exogenous reinfection. The study aimed to assess the factors associated with exogenous TB reinfection. Prospective cohort study based on the TB database, maintained at the Division of Infectious Diseases, Luigi Sacco Hospital (Milan, Italy). Time period: 1995-2010. (1) ≥2 episodes of culture-confirmed TB; (2) cure of the first episode of TB; (3) availability of one Mycobacterium tuberculosis isolate for each episode. Genotyping of the M. tuberculosis strains to differentiate relapse and exogenous reinfection. Logistic regression analysis was used to assess the influence of risk factors on exogenous reinfections. Of the 4682 patients with TB, 83 were included. Of these, exogenous reinfection was diagnosed in 19 (23 %). It was independently associated with absence of multidrug resistance at the first episode [0, 10 (0.01-0.95), p = 0.045] and with prolonged interval between the first TB episode and its recurrence [7.38 (1.92-28.32) p = 0.004]. However, TB relapses occurred until 4 years after the first episode. The risk associated with being foreign born, extrapulmonary site of TB, and HIV infection was not statistically significant. In the relapse and re-infection cohort, one-third of the patients showed a worsened drug resistance profile during the recurrent TB episode. Exogenous TB reinfections have been documented in low endemic areas, such as Italy. A causal association with HIV infection could not be confirmed. Relapses and exogenous reinfections shared an augmented risk of multidrug resistance development, frequently requiring the use of second-line anti-TB regimens.
Mittal, M; Chakravarti, S; Sharma, V; Sanjeeth, B S; Churamani, C P; Kanwar, N S
2014-04-01
Bovine tuberculosis, caused by Mycobacterium bovis, remains one of the most important zoonotic health concerns worldwide. The transmission of Mycobacterium tuberculosis from humans to animals also occurs especially in countries where there is close interaction of humans with the animals. In the present study, thirty bovine lung tissue autopsy samples from an organized dairy farm located in North India were screened for the presence of Mycobacterium tuberculosis complex by smear microscopy, histopathological findings and PCR. Differential diagnosis of M. tuberculosis and M. bovis was made based on the deletion of mce-3 operon in M. bovis. The present study found eight of these samples positive for M. tuberculosis by multiplex PCR. Sequencing was performed on two PCR-positive representative samples and on annotation, and BLAST analysis confirmed the presence of gene fragment specific to Mycobacterium tuberculosis. The presence of M. tuberculosis in all the positive samples raises the possibility of human-to-cattle transmission and possible adaptation of this organism in bovine tissues. This study accentuates the importance of screening and differential diagnosis of Mycobacterium tuberculosis complex in humans and livestock for adopting effective TB control and eradication programmes. © 2014 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
Baptista Ida Maria Foschiani Dias
2002-01-01
Full Text Available Little is known about transmission and drug resistance of tuberculosis (TB in Bauru, State of São Paulo. The objective of this study was to evaluate risk factors for transmission of Mycobacterium tuberculosis strains in this area. Strains were collected from patients attended at ambulatory services in the region and susceptibility towards the main first line antibiotics was determined and fingerprinting performed. A total of 57 strains were submitted to susceptibility testing: 23 (42.6% were resistant to at least one drug while 3 (13% were resistant against both rifampicin and isoniazide. Resistant strains had been isolated from patients that had not (n = 13 or had (n = 9 previously been submitted to anti-TB treatment, demonstrating a preoccupying high level of primary resistance in the context of the study. All strains were submitted to IS6110 restriction fragment length polymorphism (IS6110-RFLP and double repetitive element PCR (DRE-PCR. Using IS6110-RFLP, 26.3% of the strains were clustered and one cluster of 3 patients included 2 HIV-infected individuals that had been hospitalized together during 16 days; clustering of strains of patients from the hospital was however not higher than that of patients attended at health posts. According to DRE-PCR, 55.3% belonged to a cluster, confirming the larger discriminatory power of IS6110-RFLP when compared to DRE-PCR, that should therefore be used as a screening procedure only. No clinical, epidemiological or microbiological characteristics were associated with clustering so risk factors for transmission of TB could not be defined in the present study.
Mahapatra, Sebabrata; Crick, Dean C.; Brennan, Patrick J.
2000-01-01
In the peptidoglycan of Mycobacterium leprae, l-alanine of the side chain is replaced by glycine. When expressed in Escherichia coli, MurC (UDP-N-acetyl-muramate:l-alanine ligase) of M. leprae showed Km and Vmax for l-alanine and glycine similar to those of Mycobacterium tuberculosis MurC, suggesting that another explanation should be sought for the presence of glycine.
Directory of Open Access Journals (Sweden)
Dr. Rohan C. Hire
2014-09-01
Full Text Available Abstract Objective: 1 To assess the adverse drug reactions of second line anti-tubercular drugs used to treat Multi-drug resistant Tuberculosis (MDR TB in central India on the basis of causality, severity and avoidability scales. 2 To study the relationship of type of MDR TB (primary or secondary and presence of diabetes mellitus (DM with mean smear conversion time. Material and Methods: A prospective, observational study was carried out on diagnosed multidrug resistant tuberculosis patients enrolled for DOTS‑Plus regimen at TB and Chest Disease Department from January to December 2012. They were followed for 9 months thereafter and encountered adverse drug reactions (ADRs were noted along with the time of sputum conversion. The data were analysed by Chi-square or Fisher’s exact test and unpaired student’s‘t’ test. Results: Total 64 ADRs were reported in 55 patients out of total 110 patients (n = 110. As per the Naranjo causality assessment of ADRs, 7 patients had “definite” causal relation, 45 had “probable” causal relation and 3 had “possible” causal relation with drugs of DOTS Plus regime. As per the Hartwig’s severity assessment scale, there were total 7 ADRs in Level 1, 6 in Level 2, 33 in Level 3 and 9 in Level 4. Hallas avoidability assessment scale divided the ADRs as 3 being “Definitely avoidable”, 26 “Possibly avoidable”, 23 “Not avoidable” and 3 “unevaluable”. . Mean sputum smear conversion time is significantly higher in patients with secondary type than that of primary type of MDR TB (p = 0.0001 and in patients with DM than those without DM (p <0.0001. Conclusion: ADRs were common in patients of MDR TB on DOTs-Plus drug regime. It was due to lack of availability of safer and equally potent drugs in DOTs-Plus drug regime compared to DOTS regime in non-resistant TB. The frequency and severity of ADRs can be reduced by strict vigilance about known and unknown ADRs, monitoring their laboratory and
DEFF Research Database (Denmark)
Mustafa, A S; Amoudy, H A; Wiker, H G
1998-01-01
We have screened peripheral blood mononuclear cells (PBMC) from tuberculosis (TB) patients for proliferative reactivity and interferon-gamma (IFN-gamma) secretion against a panel of purified recombinant (r) and natural (n) culture filtrate (rESAT-6, nMPT59, nMPT64 and nMPB70) and somatic-derived (r......GroES, rPstS, rGroEL and rDnaK) antigens of Mycobacterium tuberculosis. The responses of PBMC to these defined antigens were compared with the corresponding results obtained with complex antigens, such as whole-cell M. tuberculosis, M. tuberculosis culture filtrate (MT-CF) and cell wall antigens, as well...... as the vaccine strain, Mycobacterium bovis bacillus Calmette-Guerin (BCG). In addition, M. tuberculosis and MT-CF-induced T-cell lines were tested in the same assays against the panel of purified and complex antigens. The compiled data from PBMC and T-cell lines tested for antigen-induced proliferation and IFN...