WorldWideScience

Sample records for multidrug-resistant mycobacterium tuberculosis

  1. Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

    OpenAIRE

    More, Arun Punaji; Nagdawane, Ramkrishna Panchamrao; Gangurde, Aniket K

    2013-01-01

    Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR) has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence...

  2. Clusters of Multidrug-Resistant Mycobacterium tuberculosis Cases, Europe

    Science.gov (United States)

    Kremer, Kristin; Heersma, Herre; Van Soolingen, Dick

    2009-01-01

    Molecular surveillance of multidrug-resistant tuberculosis (MDR TB) was implemented in Europe as case reporting in 2005. For all new MDR TB cases detected from January 2003 through June 2007, countries reported case-based epidemiologic data and DNA fingerprint patterns of MDR TB strains when available. International clusters were detected and analyzed. From 2003 through mid-2007 in Europe, 2,494 cases of MDR TB were reported from 24 European countries. Epidemiologic and molecular data were linked for 593 (39%) cases, and 672 insertion sequence 6110 DNA fingerprint patterns were reported from 19 countries. Of these patterns, 288 (43%) belonged to 18 European clusters; 7 clusters (242/288 cases, 84%) were characterized by strains of the Beijing genotype family, including the largest cluster (175/288 cases, 61%). Both clustering and the Beijing genotype were associated with strains originating in eastern European countries. Molecular cluster detection contributes to identification of transmission profile, risk factors, and control measures. PMID:19624920

  3. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  4. Genetic diversity of drug and multidrug-resistant Mycobacterium tuberculosis circulating in Veracruz, Mexico

    Science.gov (United States)

    Munro-Rojas, Daniela; Fernandez-Morales, Esdras; Zarrabal-Meza, José; Martínez-Cazares, Ma. Teresa; Parissi-Crivelli, Aurora; Fuentes-Domínguez, Javier; Séraphin, Marie Nancy; Lauzardo, Michael; González-y-Merchand, Jorge Alberto; Rivera-Gutierrez, Sandra

    2018-01-01

    Background Mexico is one of the most important contributors of drug and multidrug-resistant tuberculosis in Latin America; however, knowledge of the genetic diversity of drug-resistant tuberculosis isolates is limited. Methods In this study, the genetic structure of 112 Mycobacterium tuberculosis strains from the southeastern Mexico was determined by spoligotyping and 24-loci MIRU-VNTRs. Findings The results show eight major lineages, the most of which was T1 (24%), followed by LAM (16%) and H (15%). A total of 29 (25%) isolates were identified as orphan. The most abundant SITs were SIT53/T1 and SIT42/LAM9 with 10 isolates each and SIT50/H3 with eight isolates. Fifty-two spoligotype patterns, twenty-seven clusters and ten clonal complexes were observed, demonstrating an important genetic diversity of drug and multidrug-resistant tuberculosis isolates in circulation and transmission level of these aggravated forms of tuberculosis. Being defined as orphan or as part of an orphan cluster, was a risk factor for multidrug resistant-tuberculosis (OR 2.5, IC 1.05–5.86 and OR 3.3, IC 1–11.03, respectively). Multiple correspondence analyses showed association of some clusters and SITs with specific geographical locations. Conclusions Our study provides one of the most detailed description of the genetic structure of drug and multidrug-resistant tuberculosis strains in southeast Mexico, establishing for the first time a baseline of the genotypes observed in resistant isolates circulating, however further studies are required to better elucidate the genetic structure of tuberculosis in region and the factors that could be participating in their dispersion. PMID:29543819

  5. MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis

    Science.gov (United States)

    REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG

    2015-01-01

    Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150

  6. Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

    Directory of Open Access Journals (Sweden)

    Arun P. More

    2013-03-01

    Full Text Available Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence ofcombined resistance to first and second-line anti-tuberculosis drugs is remarkably high. The isolates of M. tuberculosiswas identified and subjected to drug susceptibility testing. The patterns of drug susceptibility of isolates of M. tuberculosisduring the periods 2000 and 2004 were compared with drug susceptibility patterns of the organisms during theperiod 2008 to 2011.Results: The 260 isolates identified as M. tuberculosis show mean drug resistance prevalence of 45.6% for more than anytwo drugs and the MDR rate as 37% in the years 2000 to 2004 whereas 305 isolates of the organism show mean drugresistance prevalence of 30.2% and the MDR rate as 25% in the years 2008 to 2011.Conclusion: The researcher found that, though the prevalence of multidrug resistance to the drugs tested is remarkablyhigh, it has come down noticeably during the past seven years due to efforts of State Government and strict implementationof treatment guidelines of WHO by the physicians. J Microbiol Infect Dis 2013; 3(1: 12-17Key words: MDR-TB, XDR-TB, DOTS, drug-resistance prevalence rate.

  7. Multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    McNerney Ruth

    2008-01-01

    Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

  8. Multidrug-Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.

  9. Clinical Concentrations of Thioridazine Kill Intracellular Multidrug-Resistant Mycobacterium tuberculosis

    Science.gov (United States)

    Ordway, Diane; Viveiros, Miguel; Leandro, Clara; Bettencourt, Rosário; Almeida, Josefina; Martins, Marta; Kristiansen, Jette E.; Molnar, Joseph; Amaral, Leonard

    2003-01-01

    The phenothiazines chlorpromazine (CPZ) and thioridazine (TZ) have equal in vitro activities against antibiotic-sensitive and -resistant Mycobacterium tuberculosis. These compounds have not been used as anti-M. tuberculosis agents because their in vitro activities take place at concentrations which are beyond those that are clinically achievable. In addition, chronic administration of CPZ produces frequent severe side effects. Because CPZ has been shown to enhance the killing of intracellular M. tuberculosis at concentrations in the medium that are clinically relevant, we have investigated whether TZ, a phenothiazine whose negative side effects are less frequent and serious than those associated with CPZ, kills M. tuberculosis organisms that have been phagocytosed by human macrophages, which have nominal killing activities against these bacteria. Both CPZ and TZ killed intracellular antibiotic-sensitive and -resistant M. tuberculosis organisms when they were used at concentrations in the medium well below those present in the plasma of patients treated with these agents. These concentrations in vitro were not toxic to the macrophage, nor did they affect in vitro cellular immune processes. TZ thus appears to be a serious candidate for the management of a freshly diagnosed infection of pulmonary tuberculosis or as an adjunct to conventional antituberculosis therapy if the patient originates from an area known to have a high prevalence of multidrug-resistant M. tuberculosis isolates. Nevertheless, we must await the outcomes of clinical trials to determine whether TZ itself may be safely and effectively used as an antituberculosis agent. PMID:12604522

  10. Multidrug-Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    2008-10-28

    In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.  Created: 10/28/2008 by Emerging Infectious Diseases.   Date Released: 10/28/2008.

  11. Molecular Genetic Analysis of Multi-drug Resistance in Indian Isolates of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Noman Siddiqi

    1998-09-01

    Full Text Available A total of 116 isolates from patients attending the out-patient department at the All India Institute of Medical Sciences, New Delhi and the New Delhi Tuberculosis Centre, New Delhi, India were collected. They were analyzed for resistance to drugs prescribed in the treatment for tuberculosis. The drug resistance was initially determined by microbiological techniques. The Bactec 460TB system was employed to determine the type and level of resistance in each isolate. The isolates were further characterized at molecular level. The multi-drug loci corresponding to rpo b, gyr A, kat G were studied for mutation(s by the polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP technique. The SSCP positive samples were sequenced to characterize the mutations in rpo b, and gyr A loci. While previously reported mutations in the gyr A and rpo b loci were found to be present, several novel mutations were also scored in the rpo b locus. Interestingly, analysis of the gyr A locus showed the presence of point mutation(s that could not be detected by PCR-SSCP. Furthermore, rifampicin resistance was found to be an important marker for checking multi-drug resistance (MDR in clinical isolates of Mycobacterium tuberculosis. This is the first report on molecular genetic analysis of MDR tuberculosis one from India, highlights the increasing incidence of MDR in the Indian isolates of M. tuberculosis.

  12. Genitourinary and pulmonary multidrug resistant Mycobacterium tuberculosis infection in an Asian elephant (Elephas maximus).

    Science.gov (United States)

    Dumonceaux, Genevieve A; St Leger, Judy; Olsen, John H; Burton, Michael S; Ashkin, David; Maslow, Joel N

    2011-12-01

    A female Asian elephant (Elephas maximus) developed vaginal and trunk discharge. Cultures were positive for pan-susceptible Mycobacterium tuberculosis. Isoniazid and pyrazinamide were given rectally and monitored by serum levels. After being trained at 10 mo to accept oral dosing, treatment was changed and rifampin was added. Oral medications were administered for another 10 mo. A year after completion of therapy, the vaginal discharge increased and cultures yielded M. tuberculosis, resistant to isoniazid and rifampin. Treatment with oral ethambutol, pyrazinamide, and enrofloxacin and intramuscular amikacin was initiated. Although followup cultures became negative, adverse reactions to medications precluded treatment completion. Due to public health concerns related to multidrug resistant M. tuberculosis (MDR-TB), the elephant was euthanized. Postmortem smears from the lung, peribronchial, and abdominal lymph nodes yielded acid-fast bacteria, although cultures were negative. This case highlights important considerations in the treatment of M. tuberculosis in animals and the need for a consistent approach to diagnosis, treatment, and follow-up.

  13. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  14. Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

    Science.gov (United States)

    Coban, Ahmet Yilmaz; Uzun, Meltem

    2013-01-01

    Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA) in detecting isoniazid (INH) and rifampicin (RIF) resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results. PMID:24402143

  15. Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban

    2013-12-01

    Full Text Available Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA in detecting isoniazid (INH and rifampicin (RIF resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV, negative predictive value (NPV and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results.

  16. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Directory of Open Access Journals (Sweden)

    Stefan Niemann

    2009-10-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

  17. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Science.gov (United States)

    Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

    2009-10-12

    Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

  18. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

    2012-06-01

    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  19. Conspicuous multidrug-resistant Mycobacterium tuberculosis cluster strains do not trespass country borders in Latin America and Spain.

    Science.gov (United States)

    Ritacco, Viviana; Iglesias, María-José; Ferrazoli, Lucilaine; Monteserin, Johana; Dalla Costa, Elis R; Cebollada, Alberto; Morcillo, Nora; Robledo, Jaime; de Waard, Jacobus H; Araya, Pamela; Aristimuño, Liselotte; Díaz, Raúl; Gavin, Patricia; Imperiale, Belen; Simonsen, Vera; Zapata, Elsa M; Jiménez, María S; Rossetti, Maria L; Martin, Carlos; Barrera, Lucía; Samper, Sofia

    2012-06-01

    Multidrug-resistant Mycobacterium tuberculosis strain diversity in Ibero-America was examined by comparing extant genotype collections in national or state tuberculosis networks. To this end, genotypes from over 1000 patients with multidrug-resistant tuberculosis diagnosed from 2004 through 2008 in Argentina, Brazil, Chile, Colombia, Venezuela and Spain were compared in a database constructed ad hoc. Most of the 116 clusters identified by IS6110 restriction fragment length polymorphism were small and restricted to individual countries. The three largest clusters, of 116, 49 and 25 patients, were found in Argentina and corresponded to previously documented locally-epidemic strains. Only 13 small clusters involved more than one country, altogether accounting for 41 patients, of whom 13 were, in turn, immigrants from Latin American countries different from those participating in the study (Peru, Ecuador and Bolivia). Most of these international clusters belonged either to the emerging RD(Rio) LAM lineage or to the Haarlem family of M. tuberculosis and four were further split by country when analyzed with spoligotyping and rifampin resistance-conferring mutations, suggesting that they did not represent ongoing transnational transmission events. The Beijing genotype accounted for 1.3% and 10.2% of patients with multidrug-resistant tuberculosis in Latin America and Spain, respectively, including one international cluster of two cases. In brief, Euro-American genotypes were widely predominant among multidrug-resistant M. tuberculosis strains in Ibero-America, reflecting closely their predominance in the general M. tuberculosis population in the region, and no evidence was found of acknowledged outbreak strains trespassing country borders. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

    International Nuclear Information System (INIS)

    Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

    2015-01-01

    Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

  1. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu, accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T.Conclusion: The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in critical cases to adjust the treatment regimen and limit the emergence of MDR and XDR strains.Keywords: Morocco, Mycobacterium tuberculosis, multidrug resistance, rpoB, katG, inhA promoter

  2. Strong In Vitro Activities of Two New Rifabutin Analogs against Multidrug-Resistant Mycobacterium tuberculosis ▿ †

    Science.gov (United States)

    García, Ana-Belén; Palacios, Juan J.; Ruiz, María-Jesús; Barluenga, José; Aznar, Fernando; Cabal, María-Paz; García, José María; Díaz, Natalia

    2010-01-01

    Two new rifabutin analogs, RFA-1 and RFA-2, show high in vitro antimycobacterial activities against Mycobacterium tuberculosis. MIC values of RFA-1 and RFA-2 were ≤0.02 μg/ml against rifamycin-susceptible strains and 0.5 μg/ml against a wide selection of multidrug-resistant strains, compared to ≥50 μg/ml for rifampin and 10 μg/ml for rifabutin. Molecular dynamic studies indicate that the compounds may exert tighter binding to mutants of RNA polymerase that have adapted to the rifamycins. PMID:20855731

  3. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  4. Enhancement of antibiotic activity by efflux inhibitors against multidrug resistant Mycobacterium tuberculosis clinical isolates from Brazil

    Directory of Open Access Journals (Sweden)

    Tatiane eCoelho

    2015-04-01

    Full Text Available Drug resistant tuberculosis continues to increase and new approaches for its treatment are necessary. The identification of M. tuberculosis clinical isolates presenting efflux as part of their resistant phenotype has a major impact in tuberculosis treatment. In this work, we used a checkerboard procedure combined with the tetrazolium microplate-based assay (TEMA to study single combinations between antituberculosis drugs and efflux inhibitors (EIs against multidrug resistant M. tuberculosis clinical isolates using the fully susceptible strain H37Rv as reference. Efflux activity was studied on a real-time basis by a fluorometric method that uses ethidium bromide as efflux substrate. Quantification of efflux pump genes mRNA transcriptional levels were performed by RT-qPCR. The fractional inhibitory concentrations (FIC indicated synergistic activity for the interactions between isoniazid, rifampicin, amikacin, ofloxacin, and ethidium bromide plus the EIs verapamil, thioridazine and chlorpromazine. The FICs ranged from 0.25, indicating a four-fold reduction on the MICs, to 0.015, 64-fold reduction. The detection of active efflux by real-time fluorometry showed that all strains presented intrinsic efflux activity that contributes to the overall resistance which can be inhibited in the presence of the EIs. The quantification of the mRNA levels of the most important efflux pump genes on these strains shows that they are intrinsically predisposed to expel toxic compounds as the exposure to subinhibitory concentrations of antibiotics were not necessary to increase the pump mRNA levels when compared with the non-exposed counterpart. The results obtained in this study confirm that the intrinsic efflux activity contributes to the overall resistance in multidrug resistant clinical isolates of M. tuberculosis and that the inhibition of efflux pumps by the EIs can enhance the clinical effect of antibiotics that are their substrates.

  5. The imaging feature of multidrug-resistant tuberculosis

    International Nuclear Information System (INIS)

    Yang Jun; Zhou Xinhua; Li Xi; Fu Yuhong; Zheng Suhua; Lv Pingxin; Ma Daqing

    2004-01-01

    Objective: To evaluate the imaging features of multidrug-resistant tuberculosis by collecting multidrug-resistant tuberculosis verified by test of drug-sensitivity, which defined as resistance to three anti-tuberculosis drugs. Methods:Fifty-one cases of multidrug-resistant tuberculosis were categorized as group of observed, and 46 cases of drug sensitive tuberculosis were categorized as control. Cultures were positive for Mycobacterium tuberculosis in all cases with no other illness such as diabetes mellitus. All patients had chest radiographs available for review, while 64 cases had tomography and 30 cases had CT during the same time. All images were analyzed by three of the radiologists, disagreement among them was discussed and a consensus was reached. Results: There was no difference in the distribution of lesions between the multidrug-resistant tuberculosis group and control group. However, the radiological findings in the multidrug-resistant tuberculosis group were significantly more common than in control group, such as multiple nodules (10 cases), disseminated foci (23 cases), cavity (9 cases), and complications (10 cases). Comparing the dynamic cases, deteriorating cases were more commonly seen in observed group than in control group, while improved cases were less in observed group than in control group. Conclusion: Multidrug-resistant tuberculosis is the most serious tuberculosis, which is characterized with significant activity, more disseminated foci, cavity, and complications. The lesion deteriorated while correct anti-tuberculosis treatment is applied. (authors)

  6. Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

    KAUST Repository

    Dalla Costa, Elis R.; Vasconcelos, Sidra E. G.; Esteves, Leonardo S.; Gomes, Harrison M.; Gomes, Lia L.; Almeida da Silva, Pedro; Perdigã o, Joã o; Portugal, Isabel; Viveiros, Miguel; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Rastogi, Nalin; Unis, Gisela; Rossetti, Maria Lucia R.; Suffys, Philip Noel

    2015-01-01

    We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

  7. Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

    KAUST Repository

    Dalla Costa, Elis R.

    2015-09-23

    We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

  8. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

    Science.gov (United States)

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

  9. Beyond multidrug-resistant tuberculosis in Europe: a TBNET study

    NARCIS (Netherlands)

    Günther, G.; van Leth, F.; Altet, N.; Dedicoat, M.; Duarte, R.; Gualano, G.; Kunst, H.; Muylle, I.; Spinu, V.; Tiberi, S.; Viiklepp, P.; Lange, C.; Alexandru, S.; Cernenco, I.; Ciobanu, A.; Donica, A.; Cayla, J.; Fina, L.; Galvao, M. L. de Souza; Maldonado, J.; Avsar, K.; Bang, D.; Andersen, A. B.; Barbuta, R.; Dubceac, V.; Bothamley, G.; Crudu, V.; Davilovits, M.; Atunes, A.; de Lange, W.; Leimane, V.; Rusmane, L.; de Lorenzo, S.; Cuppen, F.; de Guchtenaire, I.; Magis-Escurra, C.; McLaughlin, A.-M.; Meesters, R.; te Pas, M.; Prins, B.; Mütterlein, R.; Kotrbova, J.; Polcová, V.; Vasakova, M.; Pontali, E.; Rumetshofer, R.; Rowhani, M.; Skrahina, A.; Avchinko, V.; Katovich, D.

    2015-01-01

    The emergence of drug-resistant tuberculosis (TB) is a challenge to TB control in Europe. We evaluated second-line drug susceptibility testing in Mycobacterium tuberculosis isolates from patients with multidrug-resistant, pre-extensively drug-resistant (pre-XDR-TB) and XDR-TB at 23 TBNET sites in 16

  10. Whole genome sequencing reveals complex evolution patterns of multidrug-resistant Mycobacterium tuberculosis Beijing strains in patients.

    Directory of Open Access Journals (Sweden)

    Matthias Merker

    Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and

  11. A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study.

    NARCIS (Netherlands)

    Walker, Timothy M; Merker, Matthias; Knoblauch, Astrid M; Helbling, Peter; Schoch, Otto D; van der Werf, Marieke J; Kranzer, Katharina; Fiebig, Lena; Kröger, Stefan; Haas, Walter; Hoffmann, Harald; Indra, Alexander; Egli, Adrian; Cirillo, Daniela M; Robert, Jérôme; Rogers, Thomas R; Groenheit, Ramona; Mengshoel, Anne T; Mathys, Vanessa; Haanperä, Marjo; Soolingen, Dick van; Niemann, Stefan; Böttger, Erik C; Keller, Peter M

    2018-01-01

    The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan.

  12. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  13. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

    Science.gov (United States)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-06-01

    Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

  14. Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

    Science.gov (United States)

    Ramazanzadeh, Rashid; Roshani, Daem; Shakib, Pegah; Rouhi, Samaneh

    2015-01-01

    Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis) can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB) in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR) in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012) that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10). Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20%) with negative MDR-TB and in China in 2010 (0.8%), respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%).0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family. PMID:25767526

  15. Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Rashid Ramazanzadeh

    2015-01-01

    Full Text Available Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012 that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10. Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20% with negative MDR-TB and in China in 2010 (0.8%, respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%.0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family.

  16. A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study

    NARCIS (Netherlands)

    Walker, T.M.; Merker, M.; Knoblauch, A.M.; Helbling, P.; Schoch, O.D.; Werf, M.J. van der; Kranzer, K.; Fiebig, L.; Kroger, S.; Haas, W.; Hoffmann, H.; Indra, A.; Egli, A.; Cirillo, D.M.; Robert, J.; Rogers, T.R.; Groenheit, R.; Mengshoel, A.T.; Mathys, V.; Haanpera, M.; Soolingen, D.V.; Niemann, S.; Bottger, E.C.; Keller, P.M.; Ingen, J. van; Wagner-Wiening, C.; Witschi, M.

    2018-01-01

    BACKGROUND: The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan. METHODS: On April 29 and May 30, 2016,

  17. Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

    Science.gov (United States)

    Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

    2017-11-06

    Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

  18. Genome sequence of Mycobacterium yongonense RT 955-2015 isolate from a patient misdiagnosed with multi-drug resistant tuberculosis: first clinical isolate in Tanzania.

    Science.gov (United States)

    Mnyambwa, Nicholaus Peter; Kim, Dong-Jin; Ngadaya, Esther; Chun, Jongsik; Ha, Sung-Min; Petrucka, Pammla; Addo, Kennedy Kwasi; Kazwala, Rudovick R; Mfinanga, Sayoki G

    2018-04-24

    Mycobacterium yongonense is a recently described novel species belonging to Mycobacterium avium complex which is the most prevalent etiology of non-tuberculous mycobacteria associated with pulmonary infections, and posing tuberculosis diagnostic challenges in high-burden, resource-constrained settings. We used whole genome shotgun sequencing and comparative microbial genomic analyses to characterize the isolate from a patient diagnosed with multi-drug resistant tuberculosis (MDR-TB) after relapse. We present a genome sequence of the first case of M. yongonense (M. yongonense RT 955-2015) in Tanzania. Sequence analysis revealed that the RT 955-2015 strain had a high similarity to M. yongonense 05-1390(T) (98.74%) and M. chimaera DSM 44623(T) (98%). Its 16S rRNA showed similarity to M. paraintracellulare KCTC 290849(T) (100%); M. intracellulare ATCC 13950(T) (100%); M. chimaera DSM 44623(T) (99.9%); and M. yongonense 05-1390(T) (98%). The strain had a substantially different rpoB sequence from that of M. yongonense 05-1390 (95.16%) but exhibited a sequence closely related to M. chimaera DSM 44623(T) (99.86%), M. intracellulare ATCC 13950(T) (99.53%), and M. paraintracellulare KCTC 290849(T) (99.53%). In light of the OrthoANI algorithm, and phylogenetic analysis, we conclude that the isolate was M. yongonense Type II genotype, which is an indication that the patient was misdiagnosed with TB/MDR-TB and received inappropriate treatment. Copyright © 2018. Published by Elsevier Ltd.

  19. Multidrug-resistant tuberculosis in pregnancy

    International Nuclear Information System (INIS)

    Dhingra, V.K.; Arora, V.K.; Rajpal, S.

    2007-01-01

    This is a case report of 26 years old pregnant woman with multidrug-resistant tuberculosis (MDR TB), treated at outpatient department of New Delhi Tuberculosis (NDTB) Centre, India with second line agents. Before presentation at NDTB Centre, she had been treated with first line drugs for approximately one and-a-half-year, including category II re-treatment DOTS regimen under RNTCP. Patient conceived twice during her anti-TB treatment. The first one was during her category II treatment, when put on second line drugs. We describe congenital abnormalities documented in her second child exposed in-utero to second line anti-tubercular drugs with a brief review of treatment of MDR TB in pregnancy. (author)

  20. Unusual Complication of Multidrug Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Prerna Sharma

    2017-01-01

    Full Text Available Introduction. Capreomycin is a second-line drug often used for multidrug-resistant tuberculosis which can result in nephrotoxic effects similar to other aminoglycosides. We describe a case of capreomycin induced Bartter-like syndrome with hypocalcemic tetany. Case Report. 23-year-old female patient presented with carpopedal spasms and tingling sensations in hands. Patient was being treated with capreomycin for two months for tuberculosis. On further investigation, hypocalcemia, hyponatremia, hypomagnesemia, hypokalemia, and hypochloremic metabolic alkalosis were noted. Vitamin D and serum PTH levels were within normal limits. Hypercalciuria was confirmed by urine calcium/creatinine ratio. Calcium, potassium, and magnesium supplementation was given and capreomycin was discontinued. Electrolytes normalized in two days after cessation of capreomycin with no further abnormalities on repeat investigations. Discussion. Aminoglycosides can result in renal tubular dysfunction leading to Fanconi syndrome, Bartter syndrome, and distal tubular acidosis. Impaired mitochondrial function in the tubular cells has been hypothesized as the possible cause of these tubulopathies. Acquired Bartter-like syndrome phenotypically resembles autosomal dominant type 5 Bartter syndrome. Treatment consists of correction of electrolyte abnormalities, indomethacin, and potassium-sparing diuretics. Prompt diagnosis and treatment of severe dyselectrolytemia are warranted in patients on aminoglycoside therapy.

  1. Risk factors for multidrug resistant tuberculosis patients in Amhara ...

    African Journals Online (AJOL)

    Risk factors for multidrug resistant tuberculosis patients in Amhara National ... risk factors of MDR-TB patients in Amhara National Regional State, Ethiopia. ... strict adherence to directly observed therapy, appropriate management of TB ...

  2. Linezolid in multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Bolhuis, Mathieu

    2015-01-01

    Tuberculose is een potentieel dodelijke infectieziekte die wordt veroorzaakt door de bacterie Mycobacterium tuberculosis. Een deel van de tuberculosepatiënten is besmet met multiresistente tuberculose. In het geval van multiresistente tuberculose is de bacterie resistent tegen de twee belangrijkste

  3. Relationship Between Substance Abuse and Multidrug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Sadya Afroz

    2012-07-01

    Full Text Available This case control study was conducted between January to June 2010 to determine the relationship between substance abuse and multidrug- resistant tuberculosis. A total of 73 cases were selected purposively, from culture- positive multidrug- resistant tuberculosis patients admitted in the National Institute of Diseases of the Chest and Hospital, Dhaka and compared with 81 un-matched controls, recruited from the cured patients of pulmonary tuberculosis who attended several DOTS centers of ‘Nagar Shastho Kendra’ under Urban Primary Health Care Project in Dhaka city. Data were collected by face to face interview and documents’ review, using a pre- tested structured questionnaire and a checklist. Multidrug- resistance was found to be associated with smoking status (χ2 = 11.76; p = 0.01 and panmasala use (χ2 = 8.28; p = 0.004. The study also revealed that alcohol consumption and other substance abuse such as jarda, sadapata, gul, snuff, heroine, cannabis, injectable drugs was not associated with the development of multidrug- resistant tuberculosis. Relationship between substance abuse and multidrug- resistant tuberculosis are more or less similar in the developing countries. Bangladesh is not out of this trend. The present study revealed the same fact, which warrants actions targeting specific factors. Further study is recommended to assess the magnitude and these factors related to the development of multidrug- resistant tuberculosis in different settings in our country. Ibrahim Med. Coll. J. 2012; 6(2: 50-54

  4. AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum

    2014-10-01

    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  5. Exploring the iron metabolism in multidrug resistant tuberculosis ...

    African Journals Online (AJOL)

    The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis. (MDR-TB) treated with second ...

  6. Multi-drug resistant tuberculosis in Tanzania: Initial description of ...

    African Journals Online (AJOL)

    Background: Drug resistant Tuberculosis is well documented worldwide and is associated with increasing morbidity and mortality complicating Tuberculosis control with increasing costs of managing the disease. Broad. Objective: To describe clinical and laboratory characteristics of multi-drug resistant Tuberculosis ...

  7. Exploring the iron metabolism in multidrug resistant tuberculosis ...

    African Journals Online (AJOL)

    The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis (MDR-TB) treated with second generation ...

  8. Features of Cytokine Regulation in Multidrug-Resistant Tuberculosis Depending on Severity of Endogenous Intoxication

    Directory of Open Access Journals (Sweden)

    L.D. Todoriko

    2016-02-01

    Conclusions. Comprehensive assessment of integral indices of endogenous intoxication and level of certain pro- and anti-inflammatory cytokines in the blood plasma of patients with MDR TB shows a moderate endogenous intoxication, break down of the cellular component of the immune reactivity due to the formation of conditions for the development of Mycobacterium tuberculosis resistance, with further growth of cytotoxic hypoxia and activation of systemic inflammatory response syndrome. Analysis of plasma concentration of IL-6, IL-10 and IL-18 in patients with multidrug-resistance proved, that their level depends on the nature of Mycobacterium tuberculosis resistance.

  9. Multidrug-resistant tuberculosis, Somalia, 2010-2011.

    Science.gov (United States)

    Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal; Zignol, Matteo

    2013-03-01

    In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia.

  10. Multidrug-Resistant Tuberculosis, Somalia, 2010–2011

    Science.gov (United States)

    Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal

    2013-01-01

    In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia. PMID:23621911

  11. Clarithromycin increases linezolid exposure in multidrug-resistant tuberculosis patients

    NARCIS (Netherlands)

    Bolhuis, Mathieu S.; van Altena, Richard; van Soolingen, Dick; de Lange, Wiel C. M.; Uges, Donald R. A.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

    2013-01-01

    The use of linezolid for the treatment of multidrug-resistant tuberculosis is limited by dose-and time-dependent toxicity. Recently, we reported a case of pharmacokinetic drug drug interaction between linezolid and clarithromycin that resulted in increased linezolid exposure. The aim of this

  12. Multidrug-Resistant Tuberculosis and Culture Conversion with Bedaquiline

    NARCIS (Netherlands)

    Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin P.; de Los Rios, Jorge M.; Gotuzzo, Eduardo; Vasilyeva, Irina; Leimane, Vaira; Andries, Koen; Bakare, Nyasha; de Marez, Tine; Haxaire-Theeuwes, Myriam; Lounis, Nacer; Meyvisch, Paul; de Paepe, Els; van Heeswijk, Rolf P. G.; Dannemann, Brian; Rolla, Valeria; Dalcomo, Margreth; Gripp, Karla; Escada, Rodrigo; Tavares, Isabel; Borga, Liamar; Thomas, Aleyamma; Rekha, Banu; Nair, Dina; Chandrasekar, Chockalingam; Parthasarathy, Ramavaran Thiruvengadaraj; Sekhar, Gomathi; Ganesh, Krishnamoorthy; Rajagopalan, Krishnakumar; Rajapandian, Gangadevi; Dorairajalu, Rajendran; Sharma, Surendra Kumar; Banavaliker, Jayant; Kadhiravan, Tamilarasu; Gulati, Vinay; Mahmud, Hanif; Gupta, Arvind; Bhatnagar, Anuj; Jain, Vipin; Hari, Smriti; Gupta, Yogesh Kumar; Vaid, Ashok; Cirule, Andra; Dravniece, Gunta; Skripconoka, Vija; Kuksa, Liga; Kreigere, Edite; Ramos, Carlos Rafael Seas; Amat y Leon, Ivan Arapovic

    2014-01-01

    BACKGROUND Bedaquiline (Sirturo, TMC207), a diarylquinoline that inhibits mycobacterial ATP synthase, has been associated with accelerated sputum-culture conversion in patients with multidrug-resistant tuberculosis, when added to a preferred background regimen for 8 weeks. METHODS In this phase 2b

  13. Risk factors associated with multidrug resistant tuberculosis among ...

    African Journals Online (AJOL)

    Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

  14. Multidrug-resistant tuberculosis and migration to Europe

    DEFF Research Database (Denmark)

    Hargreaves, S.; Lönnroth, K.; Nellums, L. B.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB) in low-incidence countries in Europe is more prevalent among migrants than the native population. The impact of the recent increase in migration to EU and EEA countries with a low incidence of TB (

  15. Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

    Science.gov (United States)

    Jamil, K. F.

    2018-03-01

    Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

  16. Perfil de sensibilidade e fatores de risco associados à resistência do Mycobacterium tuberculosis, em centro de referência de doenças infecto-contagiosas de Minas Gerais Multidrug-resistant Mycobacterium tuberculosis at a referral center for infectious diseases in the state of Minas Gerais, Brazil: sensitivity profile and related risk factors

    Directory of Open Access Journals (Sweden)

    Márcia Beatriz de Souza

    2006-10-01

    Full Text Available OBJETIVO: Estudar os fatores determinantes da multirresistência do Mycobacterium tuberculosis às drogas tuberculostáticas em centro de referência de doenças infecto-contagiosas do Estado de Minas Gerais, Hospital Eduardo de Menezes. MÉTODOS: Estudo tipo caso-controle, retrospectivo, realizado de setembro de 2000 a janeiro de 2004. Nesse período, 473 culturas com crescimento de M. tuberculosis relativas a 313 pacientes foram analisadas quanto ao perfil de sensibilidade, no Laboratório Central de Minas Gerais. Foram selecionados os casos multirresistentes definidos como resistência a pelo menos rifampicina e isoniazida, depois de pareados com o grupo controle de pacientes com tuberculose sensível a todas as drogas na razão de 1:3. A associação dos dados demográficos e clínicos foi feita por análise estatística uni e multivariada. RESULTADOS: Durante o período de estudo, doze casos de tuberculose multirresistente foram identificados (3,83%. Na análise univariada, a tuberculose multirresistente foi mais comum no sexo masculino, em pacientes com baciloscopia de escarro positiva, pacientes com cavitações maiores que 4 cm de diâmetro e pacientes com um ou mais tratamentos prévios para tuberculose (p = 0,10. Após a análise multivariada somente o tratamento anterior para tuberculose permaneceu estatisticamente significativo (p = 0,0374, com odds ratio de 14,36 (1,96 - 176,46. CONCLUSÃO: O fator de risco que se mostrou independentemente associado ao desenvolvimento de tuberculose multirresistente neste estudo foi a presença de um ou mais tratamentos prévios para tuberculose.OBJECTIVE: To assess the determining factors for Mycobacterium tuberculosis multidrug resistance at a referral center for infectious diseases in the state of Minas Gerais, Brazil. METHODS: A retrospective case-control study was conducted using data collected from September of 2000 to January of 2004. During this period, 473 cultures presenting growth of M

  17. Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

    2005-01-01

    The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

  18. T cell-based tracking of multidrug resistant tuberculosis infection after brief exposure.

    Science.gov (United States)

    Richeldi, Luca; Ewer, Katie; Losi, Monica; Bergamini, Barbara M; Roversi, Pietro; Deeks, Jonathan; Fabbri, Leonardo M; Lalvani, Ajit

    2004-08-01

    Molecular epidemiology indicates significant transmission of Mycobacterium tuberculosis after casual contact with infectious tuberculosis cases. We investigated M. tuberculosis transmission after brief exposure using a T cell-based assay, the enzyme-linked-immunospot (ELISPOT) for IFN-gamma. After childbirth, a mother was diagnosed with sputum smear-positive multidrug-resistant tuberculosis. Forty-one neonates and 47 adults were present during her admission on the maternity unit; 11 weeks later, all underwent tuberculin skin testing (TST) and ELISPOT. We correlated test results with markers of exposure to the index case. The participants, who were asymptomatic and predominantly had no prior tuberculosis exposure, had 6.05 hours mean exposure (range: 0-65 hours) to the index case. Seventeen individuals, including two newborns, were ELISPOT-positive, and ELISPOT results correlated significantly with three of four predefined measures of tuberculosis exposure. For each hour sharing room air with the index case, the odds of a positive ELISPOT result increased by 1.05 (95% CI: 1.02-1.09, p = 0.003). Only four adults were TST-positive and TST results did not correlate with exposure. Thus, ELISPOT, but not TST, suggested quite extensive nosocomial transmission of multidrug-resistant M. tuberculosis after brief exposure. These results help to explain the apparent importance of casual contact for tuberculosis transmission, and may have implications for prevention.

  19. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana

    NARCIS (Netherlands)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-01-01

    OBJECTIVE/BACKGROUND: Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays

  20. Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Alya Putri Khairani

    2017-09-01

    Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

  1. Indolcarboxamide is a preclinical candidate for treating multidrug-resistant tuberculosis.

    Science.gov (United States)

    Rao, Srinivasa P S; Lakshminarayana, Suresh B; Kondreddi, Ravinder R; Herve, Maxime; Camacho, Luis R; Bifani, Pablo; Kalapala, Sarath K; Jiricek, Jan; Ma, Ng L; Tan, Bee H; Ng, Seow H; Nanjundappa, Mahesh; Ravindran, Sindhu; Seah, Peck G; Thayalan, Pamela; Lim, Siao H; Lee, Boon H; Goh, Anne; Barnes, Whitney S; Chen, Zhong; Gagaring, Kerstin; Chatterjee, Arnab K; Pethe, Kevin; Kuhen, Kelli; Walker, John; Feng, Gu; Babu, Sreehari; Zhang, Lijun; Blasco, Francesca; Beer, David; Weaver, Margaret; Dartois, Veronique; Glynne, Richard; Dick, Thomas; Smith, Paul W; Diagana, Thierry T; Manjunatha, Ujjini H

    2013-12-04

    New chemotherapeutic compounds against multidrug-resistant Mycobacterium tuberculosis (Mtb) are urgently needed to combat drug resistance in tuberculosis (TB). We have identified and characterized the indolcarboxamides as a new class of antitubercular bactericidal agent. Genetic and lipid profiling studies identified the likely molecular target of indolcarboxamides as MmpL3, a transporter of trehalose monomycolate that is essential for mycobacterial cell wall biosynthesis. Two lead candidates, NITD-304 and NITD-349, showed potent activity against both drug-sensitive and multidrug-resistant clinical isolates of Mtb. Promising pharmacokinetic profiles of both compounds after oral dosing in several species enabled further evaluation for efficacy and safety. NITD-304 and NITD-349 were efficacious in treating both acute and chronic Mtb infections in mouse efficacy models. Furthermore, dosing of NITD-304 and NITD-349 for 2 weeks in exploratory rat toxicology studies revealed a promising safety margin. Finally, neither compound inhibited the activity of major cytochrome P-450 enzymes or the hERG (human ether-a-go-go related gene) channel. These results suggest that NITD-304 and NITD-349 should undergo further development as a potential treatment for multidrug-resistant TB.

  2. Emergence and spread of a human-transmissible multidrug-resistant nontuberculous mycobacterium

    DEFF Research Database (Denmark)

    Bryant, Josephine M; Grogono, Dorothy M; Rodriguez-Rincon, Daniela

    2016-01-01

    Lung infections with Mycobacterium abscessus, a species of multidrug-resistant nontuberculous mycobacteria, are emerging as an important global threat to individuals with cystic fibrosis (CF), in whom M. abscessus accelerates inflammatory lung damage, leading to increased morbidity and mortality....

  3. Aggressive Regimens for Multidrug-Resistant Tuberculosis Reduce Recurrence

    Science.gov (United States)

    Franke, Molly F.; Appleton, Sasha C.; Mitnick, Carole D.; Furin, Jennifer J.; Bayona, Jaime; Chalco, Katiuska; Shin, Sonya; Murray, Megan; Becerra, Mercedes C.

    2013-01-01

    Background. Recurrent tuberculosis disease occurs within 2 years in as few as 1% and as many as 29% of individuals successfully treated for multidrug-resistant (MDR) tuberculosis. A better understanding of treatment-related factors associated with an elevated risk of recurrent tuberculosis after cure is urgently needed to optimize MDR tuberculosis therapy. Methods. We conducted a retrospective cohort study among adults successfully treated for MDR tuberculosis in Peru. We used multivariable Cox proportional hazards regression analysis to examine whether receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion from positive to negative was associated with a reduced rate of recurrent tuberculosis. Results. Among 402 patients, the median duration of follow-up was 40.5 months (interquartile range, 21.2–53.4). Receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion was associated with a lower risk of recurrent tuberculosis (hazard ratio, 0.40 [95% confidence interval, 0.17–0.96]; P = .04). A baseline diagnosis of diabetes mellitus also predicted recurrent tuberculosis (hazard ratio, 10.47 [95% confidence interval, 2.17–50.60]; P = .004). Conclusions. Individuals who received an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion experienced a lower rate of recurrence after cure. Efforts to ensure that an aggressive regimen is accessible to all patients with MDR tuberculosis, such as minimization of sequential ineffective regimens, expanded drug access, and development of new MDR tuberculosis compounds, are critical to reducing tuberculosis recurrence in this population. Patients with diabetes mellitus should be carefully managed during initial treatment and followed closely for recurrent disease. PMID:23223591

  4. A case of multidrug-resistant monoarticular joint tuberculosis in a renal transplant recipient.

    Science.gov (United States)

    Regmi, A; Singh, P; Harford, A

    2014-01-01

    Tuberculosis (TB) is a common opportunistic infection after renal transplantation. The risk of TB in renal transplant recipients is reported to be 20 to 74 times higher than in the general population. Although extrapulmonary TB occurs frequently, isolated ankle joint TB is a rare form of extrapulmonary TB infection. It is often difficult to diagnose because of its atypical presentation; management is complex, especially with multidrug-resistant TB, the need for a prolonged course of therapy, and the risks of drug interactions and drug toxicity. We report herein a case of a 60-year-old female renal allograft recipient who developed multidrug-resistant ankle joint TB 11 months after her deceased donor renal transplantation. She presented to the emergency department with escalating pain and swelling of the left ankle, difficulty in ambulation, and a low-grade fever. An x-ray of the ankle revealed an effusion and soft tissue swelling. A synovial fluid culture was performed which tested positive for acid fast bacilli which grew a multidrug-resistant form of Mycobacterium tuberculosis. She was initially treated with isoniazid, rifampin, ethambutol, and pyrazinamide; then therapy was tailored secondary to the resistant nature of the organism. She received a combination of extensive debridement of the joint and institution of second-line anti-TB therapy with pyrazinamide, ethambutol, moxifloxacin, and ethionamide. To our knowledge, no other cases of multidrug-resistant TB have been reported in the literature after renal transplantation. This case shows both an atypical presentation of TB and the difficulties in managing a transplant patient with this disease. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. The radiological spectrum of pulmonary multidrug-resistant tuberculosis: in HIV-Negative patients

    International Nuclear Information System (INIS)

    Zahirifard, S.; Amiri, M.V.; Bakhshayesh Karam, M.; Mirsaeidi, S.M.; Ehsanpour, A.; Masjedi, M.R.

    2003-01-01

    Background: Multidrug-resistant tuberculosis is a major worldwide health problem. In countries where tuberculosis is of moderate to high prevalence, the issue of Multidrug-resistant tuberculosis carries significant importance. Multidrug-resistant tuberculosis, similar to drug-sensitive tuberculosis, is contagious. Meanwhile its treatment is not only more difficult but also more expensive with lower success rates. Regarding clinical findings, there is no significant difference between Multidrug-resistant tuberculosis and drug-sensitive tuberculosis. Therefore determination of characteristic radiological findings in cases of Multidrug-resistant tuberculosis might be of help in early detection, and hence appropriate management of this disease condition. Objective: To explain the radiological spectrum of pulmonary Multidrug-resistant tuberculosis. Patients and methods: We retrospectively evaluated the radiographic images of 35 patients with clinically-and microbiologically- proven Multidrug-resistant tuberculosis admitted to our tertiary-care tuberculosis unit over a period of 13 months. The latest chest x-ray of all patients and the conventional chest CT scan without contrast of 15 patients were reviewed by three expert radiologists who rendered consensus opinion. Results: Of the 35 patients with imaging studies, 23 (66%) were male and 12 (34%) were female. The mean±SD age of participants was 38.2±17.3 (range: 16-20) years. 33 patients were known as secondary and only 2 had primary Multidrug-resistant tuberculosis. Chest radiography revealed cavitary lesion in 80% pulmonary infiltration in 89% and nodules in 80% of the cases. Pleurisy was the rarest finding observed in only 5 (14%) patients. All of 15 chest CT scans revealed cavitation, 93% of which were bilateral and multiple. Pleural involvement was seen in 93% of patients. Conclusion: Presence of multiple cavities, especially in both lungs, nodular and infiltrative lesions, and pleural effusion are main features

  6. Multidrug Resistant Tuberculosis involving the Clavicle, Spine and Ribs

    Directory of Open Access Journals (Sweden)

    H Krishnan

    2011-03-01

    Full Text Available This report describes an unusual case of multidrug resistant tuberculosis (MDR-TB, involving the right clavicle and multicentric aytpical spine involvement without any neurological deficit. The female patient presented with acute onset of right clavicular pain associated with a one-month history of lower backache with constitutional symptoms. The clavicular lesion and MRI spine findings were highly suggestive of TB. Anti TB drugs (ATD were started empirically as Sabah, Malaysia the patient’s home, is an endemic area for TB. Despite, 2 months of ATD administration, the patient did not respond well clinically and developed left sided chest wall abscesses arising from the left 3rd and 6th ribs. She was then treated for MDR-TB infection and has responded well to this treatment.

  7. Outbreak of multidrug-resistant tuberculosis in two secondary schools.

    Science.gov (United States)

    Miravet Sorribes, Luis; Arnedo Pena, Alberto; Bellido Blasco, Juan B; Romeu García, María Angeles; Gil Fortuño, María; García Sidro, Patricia; Cortés Miró, Pascual

    2016-02-01

    To describe an outbreak of multidrug-resistant tuberculosis (MDR-TB) in two schools This was a prospective, observational study of an outbreak of MDR-TB in 2 schools located in the towns of Onda and Nules, in the Spanish province of Castellon, from the moment of detection in November 2008 until November 2014, including patient follow-up and contact tracing. Five cases of MDR-TB were diagnosed. Overall attack rate was 0.9%, and among the contacts traced, 66 had latent tuberculous infection, with an infection rate of 14.4%. Molecular characterization of the 5M. tuberculosis isolates was performed by restriction fragment length polymorphism (RFLP) analysis of the IS6110 sequence. In all 5 patients, cultures were negative at 4-month follow-up, showing the efficacy of the treatment given. No recurrence has been reported to date. In the context of globalization and the increased prevalence of MDR-TB, outbreaks such as the one presented here are only to be expected. Contact tracing, strict follow-up of confirmed cases, the availability of fast diagnostic techniques to avoid treatment delay, and chemoprophylaxis, together with the molecular characterization of strains, are still essential. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

  8. The diarylquinoline TMC207 for multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin; Patientia, Ramonde; Rustomjee, Roxana; Page-Shipp, Liesl; Pistorius, Christoffel; Krause, Rene; Bogoshi, Mampedi; Churchyard, Gavin; Venter, Amour; Allen, Jenny; Palomino, Juan Carlos; de Marez, Tine; van Heeswijk, Rolf P. G.; Lounis, Nacer; Meyvisch, Paul; Verbeeck, Johan; Parys, Wim; de Beule, Karel; Andries, Koen; Mc Neeley, David F.

    2009-01-01

    BACKGROUND: The diarylquinoline TMC207 offers a new mechanism of antituberculosis action by inhibiting mycobacterial ATP synthase. TMC207 potently inhibits drug-sensitive and drug-resistant Mycobacterium tuberculosis in vitro and shows bactericidal activity in patients who have drug-susceptible

  9. Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil

    Directory of Open Access Journals (Sweden)

    Geisa Fregona

    Full Text Available ABSTRACT OBJECTIVE To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. METHODS This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis – from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. RESULTS In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24–14.05 and re-entry after abandonment (OR = 3.91; 95%CI 1.81–8.43], smoking (OR = 3.93; 95%CI 1.98–7.79, and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15–8.99. CONCLUSIONS The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo.

  10. The value of microscopic-observation drug susceptibility assay in the diagnosis of tuberculosis and detection of multidrug resistance.

    Science.gov (United States)

    Sertel Şelale, Denİz; Uzun, Meltem

    2018-01-01

    Inexpensive, rapid, and reliable tests for detecting the presence and drug susceptibility of Mycobacterium tuberculosis complex (MTBC) are urgently needed to control the transmission of tuberculosis. In this study, we aimed to assess the accuracy and speed of the microscopic-observation drug susceptibility (MODS) assay in the identification of MTBC and detection of multidrug resistance. Sputum samples from patients suspected to have tuberculosis were simultaneously tested with MODS and conventional culture [Löwenstein-Jensen (LJ) culture, BACTEC MGIT™ 960 (MGIT) system], and drug susceptibility testing (MGIT system) methods. A total of 331 sputum samples were analyzed. Sensitivity and specificity of MODS assay for detection of MTBC strains were 96% and 98.8%, respectively. MODS assay detected multidrug resistant MTBC isolates with 92.3% sensitivity and 96.6% specificity. Median time to culture positivity was similar for MGIT (8 days) and MODS culture (8 days), but was significantly longer with LJ culture (20 days) (p tuberculosis and detection of multidrug resistance. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  11. Hearing loss in children treated for multidrug-resistant tuberculosis.

    Science.gov (United States)

    Seddon, James A; Thee, Stephanie; Jacobs, Kayleen; Ebrahim, Adam; Hesseling, Anneke C; Schaaf, H Simon

    2013-04-01

    The aminoglycosides and polypeptides are vital drugs for the management of multidrug-resistant (MDR) tuberculosis (TB). Both classes of drug cause hearing loss. We aimed to determine the extent of hearing loss in children treated for MDR-TB. In this retrospective study, children (Hearing was assessed and classified using audiometry and otoacoustic emissions. Ninety-four children were included (median age: 43 months). Of 93 tested, 28 (30%) were HIV-infected. Twenty-three (24%) children had hearing loss. Culture-confirmed, as opposed to presumed, diagnosis of TB was a risk factor for hearing loss (OR: 4.12; 95% CI: 1.13-15.0; p = 0.02). Seven of 11 (64%) children classified as having hearing loss using audiometry had progression of hearing loss after finishing the injectable drug. Hearing loss is common in children treated for MDR-TB. Alternative drugs are required for the treatment of paediatric MDR-TB. Copyright © 2012 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  12. [Multidrug-resistant tuberculosis: challenges of a global emergence].

    Science.gov (United States)

    Comolet, T

    2015-10-01

    Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.

  13. Phenothiazines as a solution for multidrug resistant tuberculosis

    DEFF Research Database (Denmark)

    Kristiansen, Jette E; Dastidar, Sujata G; Palchoudhuri, Shauroseni

    2015-01-01

    Historically, multiplicity of actions in synthetic compounds is a rule rather than exception. The science of non-antibiotics evolved in this background. From the antimalarial and antitrypanosomial dye methylene blue, chemically similar compounds, the phenothiazines, were developed. The phenothiaz...... thioridazine and its (-) form to be combined with other antitubercular drugs to treat infections by drug-resistant strains of Mycobacterium tuberculosis and try to eradicate this deadly disease. [Int Microbiol 2015; 18(1):1-12]....

  14. New-Onset Psychosis in a Multi-Drug Resistant Tuberculosis Patient ...

    African Journals Online (AJOL)

    Drug-resistant tuberculosis poses a serious challenge to global control of TB. These forms of TB do not respond to the standard six-month treatment; it can take two years or more to treat with category IV drugs that are less potent, more toxic and much more expensive. Treatment of multi-drug resistant tuberculosis is still ...

  15. Evaluation of four colourimetric susceptibility tests for the rapid detection of multidrug-resistant Mycobacterium tuberculosisisolates

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban

    2015-08-01

    Full Text Available The purpose of this study is to evaluate four rapid colourimetric methods, including the resazurin microtitre assay (REMA, malachite green decolourisation assay (MGDA, microplate nitrate reductase assay (MNRA and crystal violet decolourisation assay (CVDA, for the rapid detection of multidrug-resistant (MDR tuberculosis. Fifty Mycobacterium tuberculosisisolates were used in this study. Eighteen isolates were MDR, two isolates were only resistant to isoniazid (INH and the remaining isolates were susceptible to both INH and rifampicin (RIF. INH and RIF were tested in 0.25 µg/mL and 0.5 µg/mL, respectively. The agar proportion method was used as a reference method. MNRA and REMA were performed with some modifications. MGDA and CVDA were performed as defined in the literature. The agreements of the MNRA for INH and RIF were 96% and 94%, respectively, while the agreement of the other assays for INH and RIF were 98%. In this study, while the specificities of the REMA, MGDA and CVDA were 100%, the specificity of the MNRA was lower than the others (93.3% for INH and 90.9% for RIF. In addition, while the sensitivity of the MNRA was 100%, the sensitivities of the others were lower than that of the MNRA (from 94.1-95%. The results were reported on the seventh-10th day of the incubation. All methods are reliable, easy to perform, inexpensive and easy to evaluate and do not require special equipment.

  16. Concordance of programmatic and laboratory-based multidrug-resistant tuberculosis treatment outcomes in Peru.

    Science.gov (United States)

    Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C

    2012-01-01

    Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.

  17. Multidrug-resistant tuberculosis: Rapid molecular detection with MTBDRplus® assay in clinical samples

    Directory of Open Access Journals (Sweden)

    Rita Macedo

    2009-05-01

    Full Text Available Nowadays, the greatest concern of tuberculosis control programmes is the appearance of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis. Rapid determination of drug resistance in clinical samples, with Mycobacterium tuberculosis complex (MTC, is the prerequisite for initiating effective chemotherapy, ensuring successful treatment of the patient and preventing further spread of drugresistant isolates.The aim of our study was to determine the sensitivity of the new MTBDRplus® assay in comparison to culture, identification and classic DST, directly from smear-positive clinical specimens.A total of 68 smear-positive sputum specimens were processed by both the classical mycobacteriological methods and the molecular assay, MTBDRplus®.MTBDRplus® assay allowed an accurate identification of MTC species by detection of the specific band in all samples, from which we also isolated and identified MTC strains by culture methods. In the samples from which we isolated susceptible strains (63.2%, wild type patterns were found using MTBDRplus® assay. The samples from which we isolated resistant strains (36.8% showed specific mutations associated with the correspondent resistant phenotype.Our study indicated that this assay allows rapid detection of resistance, always in agreement with classic methods. Resumo: Uma das principais problematicas no controlo da tuberculose e o aparecimento de casos de tuberculose multirresistente (TB-MR e tuberculose extensivamente resistente (TB-XDR. A deteccao precoce da resistencia a farmacos, directamente a partir de amostras respiratorias, e essencial para que se assegure o tratamento atempado, adequado e eficaz da tuberculose, bem como para prevenir a disseminacao destes casos de especial gravidade.O nosso objectivo foi avaliar a sensibilidade e comparar os resultados obtidos com um metodo de genetica molecular disponivel comercialmente – MTBDRplus® – e o isolamento

  18. Limited Sampling Strategies for Therapeutic Drug Monitoring of Linezolid in Patients With Multidrug-Resistant Tuberculosis

    NARCIS (Netherlands)

    Alffenaar, Jan-Willem C.; Kosterink, Jos G. W.; van Altena, Richard; van der Werf, Tjip S.; Uges, Donald R. A.; Proost, Johannes H.

    Introduction: Linezolid is a potential drug for the treatment of multidrug-resistant tuberculosis but its use is limited because of severe adverse effects such as anemia, thrombocytopenia, and peripheral neuropathy. This study aimed to develop a model for the prediction of linezolid area. under the

  19. Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

    NARCIS (Netherlands)

    Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

    2012-01-01

    Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper

  20. Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis : An Individual Patient Data Metaanalysis

    NARCIS (Netherlands)

    Fox, Gregory J.; Mitnick, Carole D.; Benedetti, Andrea; Chan, Edward D.; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S.; Menzies, Dick; van der Werf, Tjip S.

    2016-01-01

    Background. Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual

  1. Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

    NARCIS (Netherlands)

    Sagwa, Evans

    2017-01-01

    Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

  2. Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

    2014-01-01

    Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

  3. The socioeconomic impact of multidrug resistant tuberculosis on patients: results from Ethiopia, Indonesia and Kazakhstan

    NARCIS (Netherlands)

    van den Hof, Susan; Collins, David; Hafidz, Firdaus; Beyene, Demissew; Tursynbayeva, Aigul; Tiemersma, Edine

    2016-01-01

    One of the main goals of the post-2015 global tuberculosis (TB) strategy is that no families affected by TB face catastrophic costs. We revised an existing TB patient cost measurement tool to specifically also measure multi-drug resistant (MDR) TB patients' costs and applied it in Ethiopia,

  4. Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

    OpenAIRE

    Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

    2018-01-01

    Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

  5. Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

    International Nuclear Information System (INIS)

    Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam

    2013-01-01

    Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

  6. Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

    Energy Technology Data Exchange (ETDEWEB)

    Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam, E-mail: bestlala@yahoo.com [Chronic Respiratory Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of)

    2013-03-15

    Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

  7. Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil.

    Science.gov (United States)

    Fregona, Geisa; Cosme, Lorrayne Belique; Moreira, Cláudia Maria Marques; Bussular, José Luis; Dettoni, Valdério do Valle; Dalcolmo, Margareth Pretti; Zandonade, Eliana; Maciel, Ethel Leonor Noia

    2017-04-27

    To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin) in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis - from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24-14.05) and re-entry after abandonment (OR = 3.91; 95%CI 1.81-8.43)], smoking (OR = 3.93; 95%CI 1.98-7.79), and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15-8.99). The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo. Analisar a prevalência e fatores associados à tuberculose resistente

  8. Multidrug resistant to extensively drug resistant tuberculosis: What is ...

    Indian Academy of Sciences (India)

    Prakash

    The modern, ... World Health Organization is based on a four-drug regimen ... Better management and control of tuberculosis specially drug resistant TB by experienced and qualified .... a comprehensive approach including the major DOTS.

  9. High prevalence of multidrug resistant tuberculosis in Djibouti: a retrospective study.

    Science.gov (United States)

    Boyer-Cazajous, Géraldine; Martinaud, Christophe; Déhan, Céline; Hassan, Mohammed Osman; Gaas, Yassin; Chenilleau-Vidal, Marie-Caroline; Soler, Charles

    2014-02-13

    The Republic of Djibouti is an African country that exhibits one of the highest incidence rate of tuberculosis in the world. The aim of this study was to evaluate the prevalence of multidrug-resistant tuberculosis among new cases. We studied retrospectively every tuberculosis case diagnosed over a 12-month period in patients hospitalized at the French Military Hospital of Bouffard. During this period, 1,274 samples from 675 patients were tested. We isolated 266 mycobacteria corresponding to 180 cases of tuberculosis. Thirty-three were fully susceptible and 57% met the tuberculosis criteria, with 46% primary resistance. No extensively-drug-resistant tuberculosis was found. Our results highlight a major concern about the situation in this part of the world.

  10. Bedaquiline in the multidrug-resistant tuberculosis treatment: Belarus experience

    Directory of Open Access Journals (Sweden)

    Alena Skrahina

    2016-01-01

    Conclusion: Our interim results on safety and effectiveness of bedaquiline-containing regimens in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB patients are encouraging. They will add value to understanding role and place of this new anti-TB drug in M/XDR-TB treatment.

  11. Health system factors influencing management of multidrug-resistant tuberculosis in four European Union countries - learning from country experiences

    Directory of Open Access Journals (Sweden)

    Gerard de Vries

    2017-04-01

    Full Text Available Abstract Background In the European Union and European Economic Area only 38% of multidrug-resistant tuberculosis patients notified in 2011 completed treatment successfully at 24 months’ evaluation. Socio-economic factors and patient factors such as demographic characteristics, behaviour and attitudes are associated with treatment outcomes. Characteristics of healthcare systems also affect health outcomes. This study was conducted to identify and better understand the contribution of health system components to successful treatment of multidrug-resistant tuberculosis. Methods We selected four European Union countries to provide for a broad range of geographical locations and levels of treatment success rates of the multidrug-resistant tuberculosis cohort in 2009. We conducted semi-structured interviews following a conceptual framework with representatives from policy and planning authorities, healthcare providers and civil society organisations. Responses were organised according to the six building blocks of the World Health Organization health systems framework. Results In the four included countries, Austria, Bulgaria, Spain, and the United Kingdom, the following healthcare system factors were perceived as key to achieving good treatment results for patients with multidrug-resistant tuberculosis: timely diagnosis of drug-resistant tuberculosis; financial systems that ensure access to a full course of treatment and support for multidrug-resistant tuberculosis patients; patient-centred approaches with strong intersectoral collaboration that address patients’ emotional and social needs; motivated and dedicated healthcare workers with sufficient mandate and means to support patients; and cross-border management of multidrug-resistant tuberculosis to secure continuum of care between countries. Conclusion We suggest that the following actions may improve the success of treatment for multidrug-resistant tuberculosis patients: deployment of

  12. Tuberculosis relapse in Vietnam is significantly associated with Mycobacterium tuberculosis Beijing genotype infections

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Buu, Tran N.; Tiemersma, Edine; Lan, Nguyen T. N.; Dung, Nguyen H.; Kremer, Kristin; Soolingen, Dick V.; Cobelens, Frank G. J.

    2013-01-01

    In Vietnam, the Mycobacterium tuberculosis Beijing genotype is associated with multi-drug resistance and is emerging. A possible explanation for this genotype's success is an increased rate of relapse. In a prospective cohort study, isolates from patients with smear-positive tuberculosis were

  13. Mycobacterium tuberculosis, Beijing genotype strains not associated with radiological presentation of pulmonary tuberculosis

    NARCIS (Netherlands)

    Borgdorff, Martien W.; van Deutekom, Henk; de Haas, Petra E. W.; Kremer, Kristin; van Soolingen, Dick

    2004-01-01

    Mycobacterium tuberculosis strains of the Beijing genotype have been involved in various outbreaks of multidrug-resistant tuberculosis. Some studies suggest that the infection with the Beijing genotype is associated with a different host immune response. Since this might also lead to a different

  14. Genome-wide re-sequencing of multidrug-resistant Mycobacterium leprae Airaku-3.

    Science.gov (United States)

    Singh, P; Benjak, A; Carat, S; Kai, M; Busso, P; Avanzi, C; Paniz-Mondolfi, A; Peter, C; Harshman, K; Rougemont, J; Matsuoka, M; Cole, S T

    2014-10-01

    Genotyping and molecular characterization of drug resistance mechanisms in Mycobacterium leprae enables disease transmission and drug resistance trends to be monitored. In the present study, we performed genome-wide analysis of Airaku-3, a multidrug-resistant strain with an unknown mechanism of resistance to rifampicin. We identified 12 unique non-synonymous single-nucleotide polymorphisms (SNPs) including two in the transporter-encoding ctpC and ctpI genes. In addition, two SNPs were found that improve the resolution of SNP-based genotyping, particularly for Venezuelan and South East Asian strains of M. leprae. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  15. Time to sputum conversion in multidrug-resistant tuberculosis patients in Armenia: retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Arax Hovhannesyan

    2012-06-01

    Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5-17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.

  16. Time to sputum conversion in multidrug-resistant tuberculosis patients in Armenia: retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Arax Hovhannesyan

    2012-01-01

    Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5- 17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.

  17. Multidrug-resistant tuberculosis in Lithuania – Still a long way ahead

    Directory of Open Access Journals (Sweden)

    Greta Musteikienė

    2016-01-01

    Full Text Available Despite the recent advances in the diagnosis of tuberculosis, treatment of the disease, for the most part, remains the same as it was half a century ago. In recent years only two new anti-tuberculosis drugs have been approved by the European Medicines Agency and Food and Drug Administration. Though the prevalence of this disease is slowly decreasing all over Europe, new challenges appear. One of them is multidrug-resistant tuberculosis (MDR-TB. This problem is especially prominent in Lithuania, which is one of the 27 high MDR-TB burden countries in the world and falls behind neighboring countries in terms of the prevalence of the disease. The objective of this paper was to review the situation of tuberculosis and MDR-TB in Lithuania, and current available methods of treatment, control and diagnosis of this disease.

  18. Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

    Science.gov (United States)

    Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

    2012-03-01

    Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

  19. Amikacin Concentrations Predictive of Ototoxicity in Multidrug-Resistant Tuberculosis Patients.

    Science.gov (United States)

    Modongo, Chawangwa; Pasipanodya, Jotam G; Zetola, Nicola M; Williams, Scott M; Sirugo, Giorgio; Gumbo, Tawanda

    2015-10-01

    Aminoglycosides, such as amikacin, are used to treat multidrug-resistant tuberculosis. However, ototoxicity is a common problem and is monitored using peak and trough amikacin concentrations based on World Health Organization recommendations. Our objective was to identify clinical factors predictive of ototoxicity using an agnostic machine learning method. We used classification and regression tree (CART) analyses to identify clinical factors, including amikacin concentration thresholds that predicted audiometry-confirmed ototoxicity among 28 multidrug-resistant pulmonary tuberculosis patients in Botswana. Amikacin concentrations were measured for all patients. The quantitative relationship between predictive factors and the probability of ototoxicity were then identified using probit analyses. The primary predictors of ototoxicity on CART analyses were cumulative days of therapy, followed by cumulative area under the concentration-time curve (AUC), which improved on the primary predictor by 87%. The area under the receiver operating curve was 0.97 on the test set. Peak and trough were not predictors in any tree. When algorithms were forced to pick peak and trough as primary predictors, the area under the receiver operating curve fell to 0.46. Probit analysis revealed that the probability of ototoxicity increased sharply starting after 6 months of therapy to near maximum at 9 months. A 10% probability of ototoxicity occurred with a threshold cumulative AUC of 87,232 days · mg · h/liter, while that of 20% occurred at 120,000 days · mg · h/liter. Thus, cumulative amikacin AUC and duration of therapy, and not peak and trough concentrations, should be used as the primary decision-making parameters to minimize the likelihood of ototoxicity in multidrug-resistant tuberculosis. Copyright © 2015, Modongo et al.

  20. [Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Peru].

    Science.gov (United States)

    Torres, Julio; Sardón, Victoria; Soto, Mirtha G; Anicama, Rolado; Arroyo-Hernández, Hugo; Munayco, César V

    2011-01-01

    We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB) cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS). Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months). A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

  1. Drug resistance detection and mutation patterns of multidrug resistant tuberculosis strains from children in Delhi

    Directory of Open Access Journals (Sweden)

    Jyoti Arora

    2017-06-01

    Full Text Available A total of 312 sputum samples from pediatric patients presumptive of multidrug resistant tuberculosis were tested for the detection of drug resistance using the GenoTypeMTBDRplus assay. A total of 193 (61.8% patients were smear positive and 119 (38.1% were smear negative by Ziehl–Neelsen staining. Line probe assay (LPA was performed for 208 samples/cultures (193 smear positive samples and 15 cultures from smear negative samples. Valid results were obtained from 198 tests. Of these, 125/198 (63.1% were sensitive to both rifampicin (RIF and isoniazid (INH. 73/198 (36.9% were resistant to at least INH/RIF, out of which 49 (24.7% were resistant to both INH and RIF (multidrug resistant. Children with tuberculosis are often infected by someone close to them, so strengthening of contact tracing in the program may help in early diagnosis to identify additional cases within the household. There is a need to evaluate newer diagnostic assays which have a high sensitivity in the case of smear negative samples, additional samples other than sputum among young children not able to expectorate, and also to fill the gap between estimated and reported cases under the program.

  2. The function of the thyroid gland in patients with multi-drug resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    S. L. Matveyeva

    2017-08-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDRTB remains a health problem for many countries in the world. The share of MDRTB is 10–30% among newly diagnosed cases and 20–70% among relapses and treatment failure. The aim of the study is to define the side effects of second line drugs used in the treatment of MDRTB on thyroid function. Methods In 30 patients with multidrug resistant tuberculosis, echostructure of thyroid was studied by ultrasound imaging method. Indices of thyroid function: plasma levels of free thyroxin, thyroid stimulating hormone were studied before chemotherapy initiated, at the end of intensive phase and after the treatment finished. Results Decreasing of thyroid function under antituberculosis chemotherapy was approved. Monitoring and correction of thyroid function during antituberculosis chemotherapy was suggested. Conclusion Patients with MDRTB taking ethionamide and PAS are at increased risk for hypothyroidism and goiter, and therefore require monitoring of thyroid function at all stages of antituberculosis chemotherapy for its timely correction.

  3. Transmission of Multidrug-Resistant and Drug-Susceptible Tuberculosis within Households: A Prospective Cohort Study

    Science.gov (United States)

    Grandjean, Louis; Gilman, Robert H.; Martin, Laura; Soto, Esther; Castro, Beatriz; Lopez, Sonia; Coronel, Jorge; Castillo, Edith; Alarcon, Valentina; Lopez, Virginia; San Miguel, Angela; Quispe, Neyda; Asencios, Luis; Dye, Christopher; Moore, David A. J.

    2015-01-01

    Background The “fitness” of an infectious pathogen is defined as the ability of the pathogen to survive, reproduce, be transmitted, and cause disease. The fitness of multidrug-resistant tuberculosis (MDRTB) relative to drug-susceptible tuberculosis is cited as one of the most important determinants of MDRTB spread and epidemic size. To estimate the relative fitness of drug-resistant tuberculosis cases, we compared the incidence of tuberculosis disease among the household contacts of MDRTB index patients to that among the contacts of drug-susceptible index patients. Methods and Findings This 3-y (2010–2013) prospective cohort household follow-up study in South Lima and Callao, Peru, measured the incidence of tuberculosis disease among 1,055 household contacts of 213 MDRTB index cases and 2,362 household contacts of 487 drug-susceptible index cases. A total of 35/1,055 (3.3%) household contacts of 213 MDRTB index cases developed tuberculosis disease, while 114/2,362 (4.8%) household contacts of 487 drug-susceptible index patients developed tuberculosis disease. The total follow-up time for drug-susceptible tuberculosis contacts was 2,620 person-years, while the total follow-up time for MDRTB contacts was 1,425 person-years. Using multivariate Cox regression to adjust for confounding variables including contact HIV status, contact age, socio-economic status, and index case sputum smear grade, the hazard ratio for tuberculosis disease among MDRTB household contacts was found to be half that for drug-susceptible contacts (hazard ratio 0.56, 95% CI 0.34–0.90, p = 0.017). The inference of transmission in this study was limited by the lack of genotyping data for household contacts. Capturing incident disease only among household contacts may also limit the extrapolation of these findings to the community setting. Conclusions The low relative fitness of MDRTB estimated by this study improves the chances of controlling drug-resistant tuberculosis. However, fitter

  4. Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.

    Science.gov (United States)

    Lhadon, Tenzin; Jullien, Sophie

    2018-04-20

    Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.

  5. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  6. Soluble Urokinase Plasminogen Activator Receptor Levels in Tuberculosis Patients at High Risk for Multidrug Resistance

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2012-01-01

    Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.

  7. Dried blood spot analysis for therapeutic drug monitoring of linezolid in patients with multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Vu, D H; Bolhuis, M S; Koster, R A; Greijdanus, B; de Lange, W C M; van Altena, R; Brouwers, J R B J; Uges, D R A; Alffenaar, J W C

    2012-01-01

    Linezolid is a promising antimicrobial agent for the treatment of multidrug-resistant tuberculosis (MDR-TB), but its use is limited by toxicity. Therapeutic drug monitoring (TDM) may help to minimize toxicity while adequate drug exposure is maintained. Conventional plasma sampling and monitoring

  8. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  9. Clinical Validation of the Analysis of Linezolid and Clarithromycin in Oral Fluid of Patients with Multidrug-Resistant Tuberculosis

    NARCIS (Netherlands)

    Bolhuis, M. S.; van Altena, R.; van Hateren, K.; de Lange, W. C. M.; Greijdanus, B.; Uges, D. R. A.; Kosterink, J. G. W.; van der Werf, T. S.; Alffenaar, J. W. C.

    Linezolid plays an increasingly important role in the treatment of multidrug-resistant tuberculosis (MDR-TB). However, patients should be carefully monitored due to time-and dose-dependent toxicity. Clarithromycin plays a more modest role. Therapeutic drug monitoring may contribute to assessment of

  10. Multidrug resistant tuberculosis in prisons located in former Soviet countries: A systematic review.

    Directory of Open Access Journals (Sweden)

    Maxwell Droznin

    Full Text Available A systematic literature review was performed to investigate the occurrence of multidrug-resistant tuberculosis (MDR TB in prisons located in countries formerly part of the Soviet Union.A systematic search of published studies reporting MDR TB occurrence in prisons located in former Soviet countries was conducted by probing PubMed and Cumulative Index Nursing and Allied Health Literature for articles that met predetermined inclusion criteria.Seventeen studies were identified for systematic review. Studies were conducted in six different countries. Overall, prevalence of MDR TB among prisoners varied greatly between studies. Our findings suggest a high prevalence of MDR TB in prisons of Post-Soviet states with percentages as high as 16 times more than the worldwide prevalence estimated by the WHO in 2014.All studies suggested a high prevalence of MDR TB in prison populations in Post-Soviet states.

  11. In vitro screening of snake venom against multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Sujay Kumar Bhunia

    2015-12-01

    Full Text Available The re-emergence of multidrug-resistant tuberculosis (MDR-TB has brought to light the importance of screening effective novel drugs. In the present study, in vitro activities of different snake (Naja naja, Bungarus fasciatus, Daboia russelli russelli, Naja kaouthia venoms have been investigated against clinical isolate of MDR-TB strains. The treatment with all the venoms inhibited the mycobacterial growth for at least a week in common and two of them (Naja naja and Naja kaouthia showed significantly longer inhibition up to two weeks against the MDR-TB strain with single dose and a repetition of those two venoms exhibited inhibition up to more than four weeks.

  12. Serum vitamin d level and susceptibility to multidrug-resistant tuberculosis among household contacts

    Science.gov (United States)

    Herlina, N.; Sinaga, B. Y. M.; Siagian, P.; Mutiara, E.

    2018-03-01

    Low levels of vitamin D is a predisposing factor for Multidrug-resistant tuberculosis. Family members in contact with the patient are also at risk of infection. Currently, there is no study that compares vitamin D levels between MDR-TB patients and household contact. This study aims to identify the association between level vitamin D within MDR-TB occurrence. This was a case-control study, with the number of samples in each group (MDR-TB) patients and household contactswere40 people. Each member of each group was checked for vitamin D levels using enzyme-linked immunosorbent assay (ELISA) technique. Statistical analysis was by using Chi-Square analysis using SPSS. Mean levels of vitamin D in MDR-TB patients were 32.21, household contact 31.7. There was anosignificant association between vitamin D levels and MDR-TB occurrence (p=1.0).No significant associationbetween vitamin D level with theMDR-TB occurrence.

  13. Hypothyroidism during second-line treatment of multidrug-resistant tuberculosis: a prospective study.

    Science.gov (United States)

    Bares, R; Khalid, N; Daniel, H; Dittmann, H; Reimold, M; Gallwitz, B; Schmotzer, C

    2016-07-01

    Hypothyroidism is an adverse effect of certain anti-tuberculosis drugs. This is a prospective study of the frequency and possible pathomechanisms associated with hypothyroidism due to second-line treatment of multidrug-resistant tuberculosis. Fifty human immunodeficiency virus negative patients and 20 controls were included. All participants underwent ultrasonography of the thyroid and measurement of thyroid stimulating hormone (TSH). TSH levels were checked every 3 months. If hypothyroidism was present, T3, T4 and thyroid peroxidase autoantibodies were measured, and imaging extended to scintigraphy and repeated ultrasonography. Before treatment, 7 patients (14%) and 1 control (5%) were hypothyreotic. During the first 6 months of treatment, TSH levels increased in 41 patients (82%), 39 (78%) had values above the normal range and 19 (38%) had overt hypothyroidism. As none of the patients had signs of autoimmune thyroiditis, interaction with anti-tuberculosis drugs was assumed to be the cause of hypothyroidism. Nine patients died during treatment, all of whom had developed hypothyroidism. In seven, the metabolic situation at their death was known, and they had become euthyreotic following levothyroxine substitution. TSH levels should be checked before initiating anti-tuberculosis treatment and after 3 and 6 months to start timely replacement of levothyroxine. Further studies are needed to elucidate the exact pathomechanism involved in hypothyroidism and whether hypothyroidism can be used as predictor of treatment failure.

  14. Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

    Science.gov (United States)

    Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

    2014-10-01

    There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  15. Changing patterns and trends of multidrug-resistant tuberculosis at referral centre in Northern India: A 4-year experience

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.

  16. Risk factors and timing of default from treatment for non-multidrug-resistant tuberculosis in Moldova.

    Science.gov (United States)

    Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T

    2013-03-01

    The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.

  17. Multidrug-resistant pulmonary tuberculosis in Los Altos, Selva and Norte regions, Chiapas, Mexico.

    Science.gov (United States)

    Sánchez-Pérez, H J; Díaz-Vázquez, A; Nájera-Ortiz, J C; Balandrano, S; Martín-Mateo, M

    2010-01-01

    To analyse the proportion of multidrug-resistant tuberculosis (MDR-TB) in cultures performed during the period 2000-2002 in Los Altos, Selva and Norte regions, Chiapas, Mexico, and to analyse MDR-TB in terms of clinical and sociodemographic indicators. Cross-sectional study of patients with pulmonary tuberculosis (PTB) from the above regions. Drug susceptibility testing results from two research projects were analysed, as were those of routine sputum samples sent in by health personnel for processing (n = 114). MDR-TB was analysed in terms of the various variables of interest using bivariate tests of association and logistic regression. The proportion of primary MDR-TB was 4.6% (2 of 43), that of secondary MDR-TB was 29.2% (7/24), while among those whose history of treatment was unknown the proportion was 14.3% (3/21). According to the logistic regression model, the variables most highly associated with MDR-TB were as follows: having received anti-tuberculosis treatment previously, cough of >3 years' duration and not being indigenous. The high proportion of MDR cases found in the regions studied shows that it is necessary to significantly improve the control and surveillance of PTB.

  18. Molecular detection of multidrug-resistant Mycobacterium leprae from Indian leprosy patients.

    Science.gov (United States)

    Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal; Das, Loretta; Kumar, Archana; Darlong, Joydeepa; Nathan, Rajeev; Maseey, Asha

    2018-03-01

    The emergence of multidrug-resistant (MDR) organisms for any infectious disease is a public health concern. Global efforts to control leprosy by intensive chemotherapy have led to a significant decrease in the number of registered patients. Currently recommended control measures for treating leprosy with multidrug therapy (MDT) were designed to prevent the spread of dapsone-resistant Mycobacterium leprae strains. Here we report the identification of MDR M. leprae from relapse leprosy patients from endemic regions in India. Resistance profiles to rifampicin, dapsone and ofloxacin of the isolated strains were confirmed by identification of mutations in genes previously shown to be associated with resistance to each drug. Between 2009-2016, slit-skin smear samples were collected from 239 relapse and 11 new leprosy cases from hospitals of The Leprosy Mission across India. DNA was extracted from the samples and was analysed by PCR targeting the rpoB, folP and gyrA genes associated with resistance to rifampicin, dapsone and ofloxacin, respectively, in M. leprae. M. leprae Thai-53 (wild-type) and Zensho-4 (MDR) were used as reference strains. Fifteen strains showed representative mutations in at least two resistance genes. Two strains showed mutations in all three genes responsible for drug resistance. Seven, seven and one strain, respectively, showed mutations in genes responsible for rifampicin and dapsone resistance, for dapsone and ofloxacin resistance and for rifampicin and ofloxacin resistance. This study showed the emergence of MDR M. leprae in MDT-treated leprosy patients from endemic regions of India. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  19. Converging risk factors but no association between HIV infection and multidrug-resistant tuberculosis in Kazakhstan.

    Science.gov (United States)

    van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S

    2013-04-01

    Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.

  20. Beijing Lineage of MDR Mycobacterium tuberculosis in Bulgaria, 2007-2011

    NARCIS (Netherlands)

    Panaiotov, Stefan; Bachiyska, Elizabeta; Yordanova, Stanislava; Atanasova, Yuliana; Brankova, Nadia; Levterova, Viktoria; Sengstake, Sarah; Anthony, Richard; Bergval, Indra; Sola, Christophe; Kantardjiev, Todor

    2014-01-01

    To assess the spread of the Mycobacterium tuberculosis Beijing genotype among patients with multidrug-resistant and extensively resistant tuberculosis in Bulgaria, we genotyped 188 (72%) of 261 microbiologically confirmed resistant isolates obtained during 2007-2011. The estimated prevalence of the

  1. Previous treatment, sputum-smear nonconversion, and suburban living: The risk factors of multidrug-resistant tuberculosis among Malaysians.

    Science.gov (United States)

    Mohd Shariff, Noorsuzana; Shah, Shamsul Azhar; Kamaludin, Fadzilah

    2016-03-01

    The number of multidrug-resistant tuberculosis patients is increasing each year in many countries all around the globe. Malaysia has no exception in facing this burdensome health problem. We aimed to investigate the factors that contribute to the occurrence of multidrug-resistant tuberculosis among Malaysian tuberculosis patients. An unmatched case-control study was conducted among tuberculosis patients who received antituberculosis treatments from April 2013 until April 2014. Cases are those diagnosed as pulmonary tuberculosis patients clinically, radiologically, and/or bacteriologically, and who were confirmed to be resistant to both isoniazid and rifampicin through drug-sensitivity testing. On the other hand, pulmonary tuberculosis patients who were sensitive to all first-line antituberculosis drugs and were treated during the same time period served as controls. A total of 150 tuberculosis patients were studied, of which the susceptible cases were 120. Factors found to be significantly associated with the occurrence of multidrug-resistant tuberculosis are being Indian or Chinese (odds ratio 3.17, 95% confidence interval 1.04-9.68; and odds ratio 6.23, 95% confidence interval 2.24-17.35, respectively), unmarried (odds ratio 2.58, 95% confidence interval 1.09-6.09), living in suburban areas (odds ratio 2.58, 95% confidence interval 1.08-6.19), are noncompliant (odds ratio 4.50, 95% confidence interval 1.71-11.82), were treated previously (odds ratio 8.91, 95% confidence interval 3.66-21.67), and showed positive sputum smears at the 2nd (odds ratio 7.00, 95% confidence interval 2.46-19.89) and 6th months of treatment (odds ratio 17.96, 95% confidence interval 3.51-91.99). Living in suburban areas, positive sputum smears in the 2nd month of treatment, and was treated previously are factors that independently contribute to the occurrence of multidrug-resistant tuberculosis. Those with positive smears in the second month of treatment, have a history of previous

  2. Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12

    Science.gov (United States)

    Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted

    2012-01-01

    SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962

  3. Surgical Face Masks Worn by Patients with Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A.; van der Walt, Martie; Nardell, Edward A.

    2012-01-01

    Rationale: Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. Objectives: We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Methods: Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Measurements and Main Results: Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68–85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31–51%), representing a 56% (95% CI, 33–70.5%) decreased risk of TB transmission when patients used masks. Conclusions: Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients. PMID:22323300

  4. Topicality of the problem of combined course of multi-drug resistant pulmonary tuberculosis with diabetes mellitus

    Directory of Open Access Journals (Sweden)

    O. M. Raznatovska

    2017-08-01

    Full Text Available According to the World Health Organization, today in the world among the infectious chronic diseases one of the leading places and causes of death is multi-drug resistant tuberculosis of the lungs, and chronic non-communicable diseases – diabetes mellitus. The situation is complicated by the fact that the number of patients with combined course of these two heavy separate illnesses that complicate each other increases. It is established that with increasing severity of diabetes mellitus, tuberculosis process in the lungs becomes more complicate and deteriorates, and vice versa, the specific process complicates the course of diabetes mellitus, contributing to the development of diabetic complications. Against this background, the effectiveness of treatment of patients suffering from multi-drug resistant tuberculosis of the lungs in our country remains very low, mainly due to the toxic adverse reactions to antimycobacterial drugs of the reserve line, and in the case of adding diabetes mellitus, it deteriorates even more. The aim of this study was to review the scientific literature to determine the relevance of the study of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus and perspectives of innovative methods of diagnosis of diabetes mellitus. Early diagnosis of pre-diabetes, and autoimmune diseases will allow the use of timely correction techniques that prevents the development of diabetes mellitus, depending on its type, and in the future the development of serious irreversible processes, allow timely applying appropriate methods of correction of the revealed violations. Results. Very little amount of work is dedicated to the problem of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus, regardless of its type, the theme is relevant for today, in Ukraine there are no data regarding its study. This combined course of very difficult in the treatment diseases requires

  5. Resistance patterns, prevalence, and predictors of fluoroquinolones resistance in multidrug resistant tuberculosis patients

    Directory of Open Access Journals (Sweden)

    Nafees Ahmad

    2016-01-01

    Conclusion: The high degree of drug resistance observed, particularly to fluoroquinolones, is alarming. We recommend the adoption of more restrictive policies to control non-prescription sale of fluoroquinolones, its rational use by physicians, and training doctors in both private and public–private mix sectors to prevent further increase in fluoroquinolones resistant Mycobacterium tuberculosis strains.

  6. Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis: An Individual Patient Data Metaanalysis.

    Science.gov (United States)

    Fox, Gregory J; Mitnick, Carole D; Benedetti, Andrea; Chan, Edward D; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S; Menzies, Dick; Ahuja, S; Ashkin, D; Avendaño, M; Banerjee, R; Bauer, M; Burgos, M; Centis, R; Cobelens, F; Cox, H; D'Ambrosio, L; de Lange, W C M; DeRiemer, K; Enarson, D; Falzon, D; Flanagan, K; Flood, J; Gandhi, N; Garcia-Garcia, L; Granich, R M; Hollm-Delgado, M G; Holtz, T H; Hopewell, P; Iseman, M; Jarlsberg, L G; Kim, H R; Lancaster, J; Lange, C; Leimane, V; Leung, C C; Li, J; Menzies, D; Migliori, G B; Narita, M; Nathanson, E; Odendaal, R; O'Riordan, P; Pai, M; Palmero, D; Park, S K; Pena, J; Pérez-Guzmán, C; Ponce-de-Leon, A; Quelapio, M I D; Quy, H T; Riekstina, V; Royce, S; Salim, M; Schaaf, H S; Seung, K J; Shah, L; Shean, K; Sifuentes-Osornio, J; Sotgiu, G; Strand, M J; Sung, S W; Tabarsi, P; Tupasi, T E; Vargas, M H; van Altena, R; van der Walt, M; van der Werf, T S; Westenhouse, J; Yew, W W

    2016-04-01

    Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual patient data metaanalysis to evaluate the effectiveness of surgery as adjunctive therapy for MDR-tuberculosis. Individual patient data, was obtained from the authors of 26 cohort studies, identified from 3 systematic reviews of MDR-tuberculosis treatment. Data included the clinical characteristics and medical and surgical therapy of each patient. Primary analyses compared treatment success (cure and completion) to a combined outcome of failure, relapse, or death. The effects of all forms of resection surgery, pneumonectomy, and partial lung resection were evaluated. A total of 4238 patients from 18 surgical studies and 2193 patients from 8 nonsurgical studies were included. Pulmonary resection surgery was performed on 478 patients. Partial lung resection surgery was associated with improved treatment success (adjusted odds ratio [aOR], 3.0; 95% confidence interval [CI], 1.5-5.9; I(2)R, 11.8%), but pneumonectomy was not (aOR, 1.1; 95% CI, .6-2.3; I(2)R, 13.2%). Treatment success was more likely when surgery was performed after culture conversion than before conversion (aOR, 2.6; 95% CI, 0.9-7.1; I(2)R, 0.2%). Partial lung resection, but not pneumonectomy, was associated with improved treatment success among patients with MDR-tuberculosis. Although improved outcomes may reflect patient selection, partial lung resection surgery after culture conversion may improve treatment outcomes in patients who receive optimal medical therapy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  7. Animal experiment and clinical preliminary application of percutaneous 70% ethanol injection therapy in multi-drug resistant pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Liu Fuquan; Yue Zhendong; Gao Shunyu; Li YanSheng; Wei Guobin; Guo Weiyi; Chen Xijun; Li Baoyu

    2004-01-01

    Objective: To evaluate the clinical value of percutaneous injection of 70% ethanol in the treatment of multidrug resistant pulmonary tuberculosis. Methods: Percutaneous and transcatheter absolute ethanol, 70% ethanol, and 60% meglucamine diatrizoate(or distilled water) injection into the lung (25 cases) and the bronchi (25 cases) of healthy rabbits were performed, respectively.All specimens were studied with pathology. On the base of animals experiment, thirty-five patients with multi-drug resistant pulmonary tuberculosis were treated with percutaneous 70% ethanol injection. Every patient was treated by the same way for 1-3 times. Results: Pathological findings of the specimens of pulmonary tissue showed nonspecific inflammation, necrosis, and fibrosis. The chief pathological changes with percutaneous or transcatheter 70% ethanol injection were slighter than those with absolute ethanol injection. Pathological findings of the specimens of bronchi showed slight mucosal edema, nonspecific inflammation, and focal cytonecrosis. Recovery of the damaged bronchial mucosa occurred within 14-30 days after the treatment. All patients with multi-drug resistant pulmonary tuberculosis were followed up for 6 to 33 months. The sputum bacterial conversion to negative rate was 100% within 6 months after the treatment. Cavity closing, shrinking, and no changing rate were 47.1% (16/34), 50.0% (17/34), and 2.9% (1/34), respectively. Radiographic improvement rate was 94.3 % (33/35). No severe complications and adverse reactions occurred. Conclusion: Percutaneous 70% ethanol injection is safe, effective, and easy to perform in the treatment of multi-drug resistant pulmonary tuberculosis. (authors)

  8. Applicability of the shorter ‘Bangladesh regimen’ in high multidrug-resistant tuberculosis settings

    Directory of Open Access Journals (Sweden)

    Giovanni Sotgiu

    2017-03-01

    Full Text Available In spite of the recent introduction of two new drugs (delamanid and bedaquiline and a few repurposed compounds to treat multidrug-resistant and extensively drug-resistant tuberculosis (MDR- and XDR-TB, clinicians are facing increasing problems in designing effective regimens in severe cases. Recently a 9 to 12-month regimen (known as the ‘Bangladesh regimen’ proved to be effective in treating MDR-TB cases. It included an initial phase of 4 to 6 months of kanamycin, moxifloxacin, prothionamide, clofazimine, pyrazinamide, high-dose isoniazid, and ethambutol, followed by 5 months of moxifloxacin, clofazimine, pyrazinamide, and ethambutol. However, recent evidence from Europe and Latin America identified prevalences of resistance to the first-line drugs in this regimen (ethambutol and pyrazinamide exceeding 60%, and of prothionamide exceeding 50%. Furthermore, the proportions of resistance to the two most important pillars of the regimen – quinolones and kanamycin – were higher than 40%. Overall, only 14 out of 348 adult patients (4.0% were susceptible to all of the drugs composing the regimen, and were therefore potentially suitable for the ‘shorter regimen’. A shorter, cheaper, and well-tolerated MDR-TB regimen is likely to impact the number of patients treated and improve adherence if prescribed to the right patients through the systematic use of rapid MTBDRsl testing.

  9. Multidrug-resistant tuberculosis treatment failure detection depends on monitoring interval and microbiological method

    Science.gov (United States)

    White, Richard A.; Lu, Chunling; Rodriguez, Carly A.; Bayona, Jaime; Becerra, Mercedes C.; Burgos, Marcos; Centis, Rosella; Cohen, Theodore; Cox, Helen; D'Ambrosio, Lia; Danilovitz, Manfred; Falzon, Dennis; Gelmanova, Irina Y.; Gler, Maria T.; Grinsdale, Jennifer A.; Holtz, Timothy H.; Keshavjee, Salmaan; Leimane, Vaira; Menzies, Dick; Milstein, Meredith B.; Mishustin, Sergey P.; Pagano, Marcello; Quelapio, Maria I.; Shean, Karen; Shin, Sonya S.; Tolman, Arielle W.; van der Walt, Martha L.; Van Deun, Armand; Viiklepp, Piret

    2016-01-01

    Debate persists about monitoring method (culture or smear) and interval (monthly or less frequently) during treatment for multidrug-resistant tuberculosis (MDR-TB). We analysed existing data and estimated the effect of monitoring strategies on timing of failure detection. We identified studies reporting microbiological response to MDR-TB treatment and solicited individual patient data from authors. Frailty survival models were used to estimate pooled relative risk of failure detection in the last 12 months of treatment; hazard of failure using monthly culture was the reference. Data were obtained for 5410 patients across 12 observational studies. During the last 12 months of treatment, failure detection occurred in a median of 3 months by monthly culture; failure detection was delayed by 2, 7, and 9 months relying on bimonthly culture, monthly smear and bimonthly smear, respectively. Risk (95% CI) of failure detection delay resulting from monthly smear relative to culture is 0.38 (0.34–0.42) for all patients and 0.33 (0.25–0.42) for HIV-co-infected patients. Failure detection is delayed by reducing the sensitivity and frequency of the monitoring method. Monthly monitoring of sputum cultures from patients receiving MDR-TB treatment is recommended. Expanded laboratory capacity is needed for high-quality culture, and for smear microscopy and rapid molecular tests. PMID:27587552

  10. First evaluation in Argentina of the GenoType® MTBDRplus assay for multidrug-resistant Mycobacterium tuberculosis detection from clinical isolates and specimens Primera evaluación en Argentina de GenoType® MTBDRplus para la detección de Mycobacterium tuberculosis multidrogo-resistente desde aislamientos y especímenes clínicos

    Directory of Open Access Journals (Sweden)

    Belén R Imperiale

    2012-12-01

    Full Text Available Tuberculosis (TB and multidrug and extensively drug-resistant (DR TB are important public health problems that are spreading worldwide. The aims of this study were to determine the sensitivity and specificity of the GenoType® MT BDRplus assay from smear-positive clinical specimens and isolates and to explore its possible application in routine work. Clinical samples were previously decontaminated using NaOH-N-acetyl-L-cystein or NaOH-ClNa hypertonic solution for Ziehl-Neelsen staining and cultures. The leftover sediments of smear-positive samples were stored at -20 ºC, 70 of which were selected to be included in this study according to their DR profile. Thirty DR Mycobacterium tuberculosis isolates were also assessed. Sequencing was used as gold standard to detect mutations conferring isoniazid (INH and rifampicin (RIF resistance. Valid results were obtained in 94.0 % of the samples and 85.5 % (53/62 of the INH-R samples were properly identified. Mutations in the katGS315T gene and inhA C-15T gene promoter region were present in 59.7 % (37/62 and 25.8% (16/62 of the INH-R samples, respectively. The system could also identify 97.7 % (41/42 of the RIF-R samples; the mutations found were rpoBS531L (66.7 %, 28/42, D516V (19.0 %, 8/42, H526Y and S531P/W (4.8 %, 2/42 each one, and S522L/Q (2.4 %, 1/42. A 98.8 % concordance between the GenoType assay and sequencing was obtained. GenoType® MT BDRplus has demonstrated to be easy to implement and to perform in clinical laboratories and useful for a rapid detection of DR M. tuberculosis from decontaminated sputa and clinical isolates. Therefore, this assay could be applied as a rapid tool to predict INH-R and/or RIF-R in DR risk cases.La tuberculosis (TBC, y la TBC multi y extensivamente drogo-resistentes (DR son importantes problemas de salud pública mundial. El objetivo de este estudio fue determinar la sensibilidad y especificidad del sistema GenoType® MT BDRplus a partir de esputos (baciloscop

  11. Type 2 diabetes mellitus and its influence in the development of multidrug resistance tuberculosis in patients from southeastern Mexico.

    Science.gov (United States)

    Pérez-Navarro, Lucia Monserrat; Fuentes-Domínguez, Francisco Javier; Zenteno-Cuevas, Roberto

    2015-01-01

    To determine the factors associated with the presence of pulmonary tuberculosis in patients with type 2 diabetes mellitus and the effect in the development of drug and multi-drug resistance, in a population with tuberculosis from the southeast of Mexico. This is a case-control study including 409 individuals, 146 with the binomial tuberculosis-type 2 diabetes mellitus and 263 individuals with tuberculosis. Demographic, epidemiological and outcome variables were collected. Risks were calculated. The factors associated with the presence of type 2 diabetes mellitus were age ≥35years, (OR=9.7; CI: 5.2-17.8), previous contact with a person infected with tuberculosis (OR=1.7; CI: 1.1-3.1). Body mass index ≥25 kg/m(2) (OR=2.2; CI: 1.1-4.3), and inherited family history of diabetes (OR=5.4; CI: 3.2-9.2). It was also found that patients with tuberculosis-type 2 diabetes mellitus presented a 4.7-fold (CI: 1.4-11.3) and 3.5-fold (CI: 1.1-11.1) higher risk of developing drug- and multidrug resistance tuberculosis, respectively. By last, individuals with tuberculosis-type 2 diabetes had a 2.3-fold (CI: 1.5-4.1) greater chance of persisting as tuberculosis-positive by the second month of treatment, delaying the resolution of the tuberculosis infection. Type 2 diabetes exerts a strong influence on the presentation and evolution of tuberculosis within the analyzed population and displays remarkable particularities, necessitating the development of dedicated tuberculosis-diabetes surveillance systems that consider the particular epidemiological characteristics of the population affected. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Associations between Mycobacterium tuberculosis Strains and Phenotypes

    Science.gov (United States)

    Brown, Timothy; Nikolayevskyy, Vladyslav; Velji, Preya

    2010-01-01

    To inform development of tuberculosis (TB) control strategies, we characterized a total of 2,261 Mycobacterium tuberculosis complex isolates by using multiple phenotypic and molecular markers, including polymorphisms in repetitive sequences (spoligotyping and variable-number tandem repeats [VNTRs]) and large sequence and single-nucleotide polymorphisms. The Beijing family was strongly associated with multidrug resistance (p = 0.0001), and VNTR allelic variants showed strong associations with spoligotyping families: >5 copies at exact tandem repeat (ETR) A, >2 at mycobacterial interspersed repetitive unit 24, and >3 at ETR-B associated with the East African–Indian and M. bovis strains. All M. tuberculosis isolates were differentiated into 4 major lineages, and a maximum parsimony tree was constructed suggesting a more complex phylogeny for M. africanum. These findings can be used as a model of pathogen global diversity. PMID:20113558

  13. Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yonatan Moges Mesfin

    Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

  14. Knowledge and Attitude about Multidrug-Resistant Tuberculosis among Healthcare Workers in Public Health Centres

    Directory of Open Access Journals (Sweden)

    Bony Wiem Lestari

    2016-12-01

    Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.

  15. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  16. Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Hyun Lee

    2017-12-01

    Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

  17. Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

  18. Pharmacokinetics and Dosing of Levofloxacin in Children Treated for Active or Latent Multidrug-resistant Tuberculosis, Federated States of Micronesia and Republic of the Marshall Islands.

    Science.gov (United States)

    Mase, Sundari R; Jereb, John A; Gonzalez, Daniel; Martin, Fatma; Daley, Charles L; Fred, Dorina; Loeffler, Ann M; Menon, Lakshmy R; Bamrah Morris, Sapna; Brostrom, Richard; Chorba, Terence; Peloquin, Charles A

    2016-04-01

    In the Federated States of Micronesia and then the Republic of the Marshall Islands (RMI), levofloxacin pharmacokinetics were studied in children receiving directly observed once-daily regimens (10 mg/kg, age >5 years; 15-20 mg/kg, age ≤5 years) for either multidrug-resistant tuberculosis disease or latent infection after multidrug-resistant tuberculosis exposure, to inform future dosing strategies. Blood samples were collected at 0 (RMI only), 1, 2 and 6 hours (50 children, aged 6 months to 15 years) after oral levofloxacin at >6 weeks of treatment. Clinical characteristics and maximal drug concentration (Cmax) of levofloxacin, elimination half-life and area under the curve from 0 to 24 hours (AUC0-24 hours × μg/mL) were correlated to determine the optimal dosage and to examine associations. Population pharmacokinetics and target attainment were modeled. With results from the Federated States of Micronesia, dosages were increased in RMI toward the target Cmax for Mycobacterium tuberculosis, 8-12 µg/mL. Cmax correlated linearly with per-weight dosage. Neither Cmax nor half-life was associated with gender, age, body mass index, concurrent medications or predose meals. At levofloxacin dosage of 15-20 mg/kg, Cmax ≥8 µg/mL was observed, and modeling corroborated a high target attainment across the ratio of the area under the free concentration versus time curve to minimum inhibitory concentration (fAUCss,0-24/MIC) values. Levofloxacin dosage should be 15-20 mg/kg for Cmax ≥8 µg/mL and a high target attainment across fAUCss,0-24/MIC values in children ≥2 years of age.

  19. Multidrug-resistant tuberculosis: The problem and some priorities in controlling it

    Directory of Open Access Journals (Sweden)

    Sven Hoffner

    2016-01-01

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.

  20. Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.

    Science.gov (United States)

    Hoffner, Sven

    2016-12-01

    Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.

  1. Possible impact of the standardized Category IV regimen on multidrug-resistant tuberculosis patients in Mumbai.

    Science.gov (United States)

    Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S

    2016-01-01

    Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.

  2. Risk factors and mortality associated with default from multidrug-resistant tuberculosis treatment.

    Science.gov (United States)

    Franke, Molly F; Appleton, Sasha C; Bayona, Jaime; Arteaga, Fernando; Palacios, Eda; Llaro, Karim; Shin, Sonya S; Becerra, Mercedes C; Murray, Megan B; Mitnick, Carole D

    2008-06-15

    Completing treatment for multidrug-resistant (MDR) tuberculosis (TB) may be more challenging than completing first-line TB therapy, especially in resource-poor settings. The objectives of this study were to (1) identify risk factors for default from MDR TB therapy (defined as prolonged treatment interruption), (2) quantify mortality among patients who default from treatment, and (3) identify risk factors for death after default from treatment. We performed a retrospective chart review to identify risk factors for default from MDR TB therapy and conducted home visits to assess mortality among patients who defaulted from such therapy. Sixty-seven (10.0%) of 671 patients defaulted from MDR TB therapy. The median time to treatment default was 438 days (interquartile range, 152-710 days), and 27 (40.3%) of the 67 patients who defaulted from treatment had culture-positive sputum at the time of default. Substance use (hazard ratio, 2.96; 95% confidence interval, 1.56-5.62; P = .001), substandard housing conditions (hazard ratio, 1.83; 95% confidence interval, 1.07-3.11; P = .03), later year of enrollment (hazard ratio, 1.62, 95% confidence interval, 1.09-2.41; P = .02), and health district (P = .02) predicted default from therapy in a multivariable analysis. Severe adverse events did not predict default from therapy. Forty-seven (70.1%) of 67 patients who defaulted from therapy were successfully traced; of these, 25 (53.2%) had died. Poor bacteriologic response, default, low education level, and diagnosis with a psychiatric disorder significantly predicted death after default in a multivariable analysis. The proportion of patients who defaulted from MDR TB treatment was relatively low. The large proportion of patients who had culture-positive sputum at the time of treatment default underscores the public health importance of minimizing treatment default. Prognosis for patients who defaulted from therapy was poor. Interventions aimed at preventing treatment default may

  3. Impact of diabetes on treatment outcomes and long-term survival in multidrug-resistant tuberculosis.

    Science.gov (United States)

    Kang, Young Ae; Kim, Song Yee; Jo, Kyung-Wook; Kim, Hee Jin; Park, Seung-Kyu; Kim, Tae-Hyung; Kim, Eun Kyung; Lee, Ki Man; Lee, Sung Soon; Park, Jae Seuk; Koh, Won-Jung; Kim, Dae Yun; Shim, Tae Sun

    2013-01-01

    Few studies have investigated the impact of diabetes mellitus (DM), a globally increasing metabolic disease, on treatment outcomes and long-term survival in patients with multidrug-resistant forms of tuberculosis (MDR-TB). We analyzed outcomes in a large cohort to assess the impact of DM on treatment outcomes of patients with MDR-TB. MDR-TB patients newly diagnosed or retreated between 2000 and 2002 and followed for 8-11 years were retrospectively analyzed with respect to the effect of DM as a comorbidity on their treatment outcome and long-term survival. Of 1,407 patients with MDR-TB, 239 (17.0%) had coexisting DM. The mean age and body mass index were higher in MDR-TB patients with DM [MDR-TBDM(+)] than in those without DM [MDR-TBDM(-)]. Patients with MDR-TB and a comorbidity of DM had a significantly lower treatment success rate than those without a history of DM (36.0 vs. 47.2%, p = 0.002). In addition, DM was the negative predictor for MDR-TB treatment success in multivariate analyses [odds ratio 0.51, 95% confidence interval (CI) 0.26-0.99]. Mean survival times were also lower in MDR-TBDM(+) than in MDR-TBDM(-) patients (102 vs. 114 months, p = 0.001), with DM as a significant predictor of poor long-term survival in multivariate analyses (hazard ratio 1.59, 95% CI 1.01-2.50). Among MDR-TB patients, DM was a relatively common comorbidity. In patients undergoing treatment for MDR-TB and followed for 8-11 years, it was found to be independently associated with an increased risk of both treatment failure and death. Copyright © 2013 S. Karger AG, Basel.

  4. Effectiveness of a novel cellular therapy to treat multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Aliaksandr Skrahin

    2016-08-01

    Full Text Available Introduction: We urgently need novel treatments for multidrug-resistant tuberculosis (MDR-TB. Autologous mesenchymal stromal cell (MSC infusion is one such possibility due to its potential to repair damaged lung tissue and boost immune responses. We aimed to assess the effectiveness of MSC to improve outcomes among MDR-TB patients. Methods: We analyzed outcomes for 108 Belarussian MDR-TB patients receiving chemotherapy. Thirty-six patients (“cases” also had MSCs extracted, cultured and re-infused (average time from chemotherapy start to infusion was 49 days; another 36 patients were “study controls”. We identified another control group: 36 patients from the Belarussian surveillance database (“surveillance controls” 1:1 matched to cases. Results: Of the cases, 81% had successful outcomes versus 42% of surveillance controls and 39% of study controls. Successful outcome odds were 6.5 (95% Confidence Interval: 1.2–36.2, p=0.032 times greater for cases than surveillance controls (age-adjusted. Radiological improvement was more likely in cases than study controls. Culture analysis prior to infusion demonstrated a poorer initial prognosis in cases, yet despite this they had better outcomes than the control groups. Conclusion: MSC treatment could vastly improve outcomes for MDR-TB patients. Our findings could revolutionize therapy options and have strong implications for future directions of MDR-TB therapy research. Keywords: Mesenchymal stromal cells, Extensively drug resistant, Outcomes, Treatment

  5. Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Anthony L. Byrne

    2017-07-01

    Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.

  6. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  7. Diabetes is Associated with Severe Adverse Events in Multidrug-Resistant Tuberculosis.

    Science.gov (United States)

    Muñoz-Torrico, Marcela; Caminero-Luna, José; Migliori, Giovanni Battista; D'Ambrosio, Lia; Carrillo-Alduenda, José Luis; Villareal-Velarde, Héctor; Torres-Cruz, Alfredo; Flores-Vergara, Héctor; Martínez-Mendoza, Dina; García-Sancho, Cecilia; Centis, Rosella; Salazar-Lezama, Miguel Ángel; Pérez-Padilla, Rogelio

    2017-05-01

    Diabetes mellitus (DM), a very common disease in Mexico, is a well-known risk factor for tuberculosis (TB). However, it is not known by which extent DM predisposes to adverse events (AE) to anti-TB drugs and/or to worse outcomes in patients with multidrug-resistant (MDR-TB) and extensively drug-resistant TB (XDR-TB). The main objective of this study was to describe the outcomes of TB treatment, the impact of DM and the prevalence of AE in a cohort of patients with MDR-/XDR pulmonary TB treated at the national TB referral centre in Mexico City. Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%), 11 with pre-XDR-TB (12.2%) and 6 (6.7%) with XDR-TB, including 49 (54.4%) with DM, and 3 with Human Immunodeficiency Virus (HIV) co-infection (3.3%). In 98% of patients, diagnosis was made by culture and drug susceptibility testing, while in a single case the diagnosis was made by a molecular test. The presence of DM was associated with an increased risk of serious drug-related AEs, such as nephrotoxicity (Odds Ratio [OR]=6.5; 95% Confidence Interval [95% CI]: 1.9-21.8) and hypothyroidism (OR=8.8; 95% CI: 1.8-54.2), but not for a worse outcome. Our data suggest that DM does not impact second-line TB treatment outcomes, but patients with DM have a higher risk of developing serious AEs to drug-resistant TB treatment, such as nephrotoxicity and hypothyroidism. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. The making of a public health problem: multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Engel, Nora C

    2013-07-01

    This paper examines how actors construct the public problem of multi-drug resistant tuberculosis (MDR-TB) in India. MDR-TB has been framed by the World Health Organization as a pressing, global public health problem. The responses to MDR-TB are complicated as treatment takes longer and is more expensive than routine TB treatment. This is particularly problematic in countries, such as India, with high patient loads, a large and unregulated private sector, weak health systems and potentially high numbers of MDR-TB cases. This paper analyses how actors struggle for control over ownership, causal theories and political responsibility of the public problem of MDR-TB in India. It combines Gusfield's theory on the construction of public problems with insights from literature on the social construction of diseases and on medical social control. It highlights that there are flexible definitions of public problems, which are negotiated among actor groups and which shift over time. The Indian government has shifted its policy in recent years and acknowledged that MDR-TB needs to be dealt with within the TB programme. The study results reveal how the policy shift happened, why debates on the construction of MDR-TB as a public problem in India continue, and why actors with alternative theories than the government do not succeed in their lobbying efforts. Two main arguments are put forward. First, the construction of the public problem of MDR-TB in India is a social and political process. The need for representative data, international influence and politics define what is controllable. Second, the government seems to be anxious to control the definition of India's MDR-TB problem. This impedes an open, critical and transparent discussion on the definition of the public problem of MDR-TB, which is important in responding flexibly to emerging public health challenges.

  9. Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

    Directory of Open Access Journals (Sweden)

    Carole D Mitnick

    Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

  10. Population-level genomics identifies the emergence and global spread of a human transmissible multidrug-resistant nontuberculous mycobacterium

    Science.gov (United States)

    Rodriguez-Rincon, Daniela; Everall, Isobel; Brown, Karen P; Moreno, Pablo; Verma, Deepshikha; Hill, Emily; Drijkoningen, Judith; Gilligan, Peter; Esther, Charles R; Noone, Peadar G; Giddings, Olivia; Bell, Scott C.; Thomson, Rachel; Wainwright, Claire E.; Coulter, Chris; Pandey, Sushil; Wood, Michelle E; Stockwell, Rebecca E; Ramsay, Kay A; Sherrard, Laura J; Kidd, Timothy J; Jabbour, Nassib; Johnson, Graham R; Knibbs, Luke D; Morawska, Lidia; Sly, Peter D; Jones, Andrew; Bilton, Diana; Laurenson, Ian; Ruddy, Michael; Bourke, Stephen; Bowler, Ian CJW; Chapman, Stephen J; Clayton, Andrew; Cullen, Mairi; Daniels, Thomas; Dempsey, Owen; Denton, Miles; Desai, Maya; Drew, Richard J; Edenborough, Frank; Evans, Jason; Folb, Jonathan; Humphrey, Helen; Isalska, Barbara; Jensen-Fangel, Søren; Jönsson, Bodil; Jones, Andrew M.; Katzenstein, Terese L; Lillebaek, Troels; MacGregor, Gordon; Mayell, Sarah; Millar, Michael; Modha, Deborah; Nash, Edward F; O’Brien, Christopher; O’Brien, Deirdre; Ohri, Chandra; Pao, Caroline S; Peckham, Daniel; Perrin, Felicity; Perry, Audrey; Pressler, Tania; Prtak, Laura; Qvist, Tavs; Robb, Ali; Rodgers, Helen; Schaffer, Kirsten; Shafi, Nadia; van Ingen, Jakko; Walshaw, Martin; Watson, Danie; West, Noreen; Whitehouse, Joanna; Haworth, Charles S; Harris, Simon R; Ordway, Diane; Parkhill, Julian; Floto, R. Andres

    2016-01-01

    Lung infections with Mycobacterium abscessus, a species of multidrug resistant nontuberculous mycobacteria, are emerging as an important global threat to individuals with cystic fibrosis (CF) where they accelerate inflammatory lung damage leading to increased morbidity and mortality. Previously, M. abscessus was thought to be independently acquired by susceptible individuals from the environment. However, using whole genome analysis of a global collection of clinical isolates, we show that the majority of M. abscessus infections are acquired through transmission, potentially via fomites and aerosols, of recently emerged dominant circulating clones that have spread globally. We demonstrate that these clones are associated with worse clinical outcomes, show increased virulence in cell-based and mouse infection models, and thus represent an urgent international infection challenge. PMID:27846606

  11. Feasibility, diagnostic accuracy, and effectiveness of decentralised use of the Xpert MTB/RIF test for diagnosis of tuberculosis and multidrug resistance: a multicentre implementation study

    NARCIS (Netherlands)

    Boehme, Catharina C.; Nicol, Mark P.; Nabeta, Pamela; Michael, Joy S.; Gotuzzo, Eduardo; Tahirli, Rasim; Gler, Ma Tarcela; Blakemore, Robert; Worodria, William; Gray, Christen; Huang, Laurence; Caceres, Tatiana; Mehdiyev, Rafail; Raymond, Lawrence; Whitelaw, Andrew; Sagadevan, Kalaiselvan; Alexander, Heather; Albert, Heidi; Cobelens, Frank; Cox, Helen; Alland, David; Perkins, Mark D.

    2011-01-01

    The Xpert MTB/RIF test (Cepheid, Sunnyvale, CA, USA) can detect tuberculosis and its multidrug-resistant form with very high sensitivity and specificity in controlled studies, but no performance data exist from district and subdistrict health facilities in tuberculosis-endemic countries. We aimed to

  12. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  13. Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

    Science.gov (United States)

    Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

    2015-01-01

    While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

  14. Performance of Four Transport and Storage Systems for Molecular Detection of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Rabodoarivelo, Marie Sylvianne; Imperiale, Bélen; andrianiavomikotroka, Rina; Brandao, Angela; Kumar, Parveen; Singh, Sarman; Ferrazoli, Lucilaine; Morcillo, Nora; Rasolofo, Voahangy; Palomino, Juan Carlos; Vandamme, Peter; Martin, Anandi

    2015-01-01

    Background Detection of drug-resistant tuberculosis is essential for the control of the disease but it is often hampered by the limitation of transport and storage of samples from remote locations to the reference laboratory. We performed a retrospective field study to evaluate the performance of four supports enabling the transport and storage of samples to be used for molecular detection of drug resistance using the GenoType MTBDRplus. Methods Two hundred Mycobacterium tuberculosis strains were selected and spotted on slides, FTA cards, GenoCards, and in ethanol. GenoType MTBDRplus was subsequently performed with the DNA extracted from these supports. Sensitivity and specificity were calculated and compared to the results obtained by drug susceptibility testing. Results For all supports, the overall sensitivity and specificity for detection of resistance to RIF was between 95% and 100%, and for INH between 95% and 98%. Conclusion The four transport and storage supports showed a good sensitivity and specificity for the detection of resistance to RIF and INH in M. tuberculosis strains using the GenoType MTBDRplus. These supports can be maintained at room temperature and could represent an important alternative cost-effective method useful for rapid molecular detection of drug-resistant TB in low-resource settings. PMID:26431352

  15. Responding to the multidrug-resistant tuberculosis crisis: mainstreaming programmatic management to the Philippine National Tuberculosis Programme.

    Science.gov (United States)

    Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E

    2010-06-01

    The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.

  16. Mycobacterium bovis and Other Uncommon Members of the Mycobacterium tuberculosis Complex.

    Science.gov (United States)

    Esteban, Jaime; Muñoz-Egea, Maria-Carmen

    2016-12-01

    Since its discovery by Theobald Smith, Mycobacterium bovis has been a human pathogen closely related to animal disease. At present, M. bovis tuberculosis is still a problem of importance in many countries and is considered the main cause of zoonotic tuberculosis throughout the world. Recent development of molecular epidemiological tools has helped us to improve our knowledge about transmission patterns of this organism, which causes a disease indistinguishable from that caused by Mycobacterium tuberculosis. Diagnosis and treatment of this mycobacterium are similar to those for conventional tuberculosis, with the important exceptions of constitutive resistance to pyrazinamide and the fact that multidrug-resistant and extremely drug-resistant M. bovis strains have been described. Among other members of this complex, Mycobacterium africanum is the cause of many cases of tuberculosis in West Africa and can be found in other areas mainly in association with immigration. M. bovis BCG is the currently available vaccine for tuberculosis, but it can cause disease in some patients. Other members of the M. tuberculosis complex are mainly animal pathogens with only exceptional cases of human disease, and there are even some strains, like "Mycobacterium canettii," which is a rare human pathogen that could have an important role in the knowledge of the evolution of tuberculosis in the history.

  17. A systematic review of the cost and cost effectiveness of treatment for multidrug-resistant tuberculosis.

    Science.gov (United States)

    Fitzpatrick, Christopher; Floyd, Katherine

    2012-01-01

    Around 0.4 million cases of multidrug-resistant tuberculosis (MDR-TB) occur each year. Only a small fraction of these cases are treated according to international guidelines. Evidence relevant to decisions about whether to scale-up treatment for MDR-TB includes cost and cost-effectiveness data. Up to 2010, no systematic review of this evidence has been available. Our objective was to conduct a systematic review of the cost and cost effectiveness of treatment for MDR-TB and synthesize the available data. We searched for papers published or prepared for publication in peer-review journals and grey literature using search terms in five languages: English, French, Portuguese, Russian and Spanish. From an initial set of 420 studies, four were included, from Peru, the Philippines, Estonia and Tomsk Oblast in the Russian Federation. Results on costs, effectiveness and cost effectiveness were extracted. Assessment of the quality of each economic evaluation was guided by two existing checklists around which there is broad consensus. Costs were adjusted to a common year of value (2005) to remove distortions caused by inflation, and calculated in two common currencies: $US and international dollars (I$), to standardize for purchasing power parity. Data from the four identified studies were then synthesized using probabilistic sensitivity analysis, to appraise the likely cost and cost effectiveness of MDR-TB treatment in other settings, relative to WHO benchmarks for assessing whether or not an intervention is cost effective. Best estimates are provided as means, with 5th and 95th percentiles of the distributions. The cost per patient for MDR-TB treatment in Estonia, Peru, the Philippines and Tomsk was $US10 880, $US2423, $US3613 and $US14 657, respectively. Best estimates of the cost per disability-adjusted life-year (DALY) averted were $US598 (I$960), $US163 (I$291), $US143 (I$255) and $US745 (I$1059), respectively. The main influences on costs were (i) the model of care

  18. Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.

    OpenAIRE

    Merker Matthias; Blin Camille; Mona Stefano; Duforet-Frebourg Nicolas; Lecher Sophie; Willery Eve; Blum Michael G B; Rüsch-Gerdes Sabine; Mokrousov Igor; Aleksic Eman; Allix-Béguec Caroline; Antierens Annick; Augustynowicz-Kopec Ewa; Ballif Marie; Barletta Francesca

    2015-01-01

    International audience; Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiat...

  19. Comparison of the pharmacokinetics of two dosage regimens of linezolid in multidrug-resistant and extensively drug-resistant tuberculosis patients.

    NARCIS (Netherlands)

    Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der

    2010-01-01

    BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  20. Comparison of the Pharmacokinetics of Two Dosage Regimens of Linezolid in Multidrug-Resistant and Extensively Drug-Resistant Tuberculosis Patients

    NARCIS (Netherlands)

    Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.

    2010-01-01

    Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  1. Colorimetric Detection of Multidrug-Resistant or Extensively Drug-Resistant Tuberculosis by Use of Malachite Green Indicator Dye▿

    OpenAIRE

    Farnia, Parissa; Masjedi, Mohammad Reza; Mohammadi, Foroozan; Tabarsei, Payam; Farnia, Poopak; Mohammadzadeh, Ali Reza; Baghei, Parvaneh; Varahram, Mohammad; Hoffner, Sven; Velayati, Ali Akbar

    2007-01-01

    The malachite green microtube (MGMT) susceptibility assay was performed directly on sputum specimens (n = 80) and indirectly on Mycobacterium tuberculosis clinical isolates (n = 60). The technique is based on the malachite green dye, which changes color in response to M. tuberculosis growth. The MGMT assay is simple and rapid and does not require expensive instruments.

  2. [Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

    Science.gov (United States)

    Zhang, Lei-lei; Jin, Hua

    2015-12-01

    Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

  3. A Faropenem, Linezolid, and Moxifloxacin Regimen for Both Drug-Susceptible and Multidrug-Resistant Tuberculosis in Children: FLAME Path on the Milky Way.

    Science.gov (United States)

    Deshpande, Devyani; Srivastava, Shashikant; Nuermberger, Eric; Pasipanodya, Jotam G; Swaminathan, Soumya; Gumbo, Tawanda

    2016-11-01

     The regimen of linezolid and moxifloxacin was found to be efficacious in the hollow fiber system model of pediatric intracellular tuberculosis. However, its kill rate was slower than the standard 3-drug regimen of isoniazid, rifampin, and pyrazinamide. We wanted to examine the effect of adding a third oral agent, faropenem, to this dual combination.  We performed a series of studies in the hollow fiber system model of intracellular Mycobacterium tuberculosis, by mimicking pediatric pharmacokinetics of each antibiotic. First, we varied the percentage of time that faropenem persisted above minimum inhibitory concentration (T MIC ) on the moxifloxacin-linezolid regimen. After choosing the best faropenem exposure, we performed experiments in which we varied the moxifloxacin and linezolid doses in the triple regimen. Finally, we performed longer-duration therapy validation experiments. Bacterial burden was quantified using both colony-forming units per milliliter (CFU/mL) and time to positivity (TTP). Kill slopes were modeled using exponential regression.  TTP was a more sensitive measure of bacterial burden than CFU/mL. A faropenem T MIC > 62% was associated with steepest microbial kill slope. Regimens of standard linezolid and moxifloxacin plus faropenem T MIC > 60%, as well as higher-dose moxifloxacin, achieved slopes equivalent to those of the standard regimen based by both TTP and CFU/mL over 28 days of treatment.  We have developed an oral faropenem-linezolid-moxifloxacin (FLAME) regimen that is free of first-line drugs. The regimen could be effective against both multidrug-resistant and drug-susceptible tuberculosis in children. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  4. Disclosure of selective advantages in the "modern" sublineage of the Mycobacterium tuberculosis Beijing genotype family by quantitative proteomics

    NARCIS (Netherlands)

    Keijzer, J. de; Haas, P.E. de; Ru, A.H. de; Veelen, P.A. van; Soolingen, D. van

    2014-01-01

    The Mycobacterium tuberculosis Beijing genotype, consisting of the more ancient (atypical) and modern (typical) emerging sublineage, is one of the most prevalent and genetically conserved genotype families and has often been associated with multidrug resistance. In this study, we employed a

  5. A novel automatic molecular test for detection of multidrug resistance tuberculosis in sputum specimen: A case control study.

    Science.gov (United States)

    Li, Qiang; Ou, Xi C; Pang, Yu; Xia, Hui; Huang, Hai R; Zhao, Bing; Wang, Sheng F; Zhao, Yan L

    2017-07-01

    MiniLab tuberculosis (ML TB) assay is a new automatic diagnostic tool for diagnosis of multidrug resistance tuberculosis (MDR-TB). This study was conducted with aims to know the performance of this assay. Sputum sample from 224 TB suspects was collected from tuberculosis suspects seeking medical care at Beijing Chest hospital. The sputum samples were directly used for smear and ML TB test. The left sputum sample was used to conduct Xpert MTB/RIF, Bactec MGIT culture and drug susceptibility test (DST). All discrepancies between the results from DST, molecular and phenotypic methods were confirmed by DNA Sequencing. The sensitivity and specificity of ML TB test for detecting MTBC from TB suspects were 95.1% and 88.9%, respectively. The sensitivity for smear negative TB suspects was 64.3%. For detection of RIF resistance, the sensitivity and specificity of ML TB test were 89.2% and 95.7%, respectively. For detection of INH resistance, the sensitivity and specificity of ML TB test were 78.3% and 98.1%, respectively. ML TB test showed similar performance to Xpert MTB/RIF for detection of MTBC and RIF resistance. In addition, ML TB also had good performance for INH resistance detection. Copyright © 2017. Published by Elsevier Ltd.

  6. Mycobacterium tuberculosis Metabolism

    Science.gov (United States)

    Warner, Digby F.

    2015-01-01

    Metabolism underpins the physiology and pathogenesis of Mycobacterium tuberculosis. However, although experimental mycobacteriology has provided key insights into the metabolic pathways that are essential for survival and pathogenesis, determining the metabolic status of bacilli during different stages of infection and in different cellular compartments remains challenging. Recent advances—in particular, the development of systems biology tools such as metabolomics—have enabled key insights into the biochemical state of M. tuberculosis in experimental models of infection. In addition, their use to elucidate mechanisms of action of new and existing antituberculosis drugs is critical for the development of improved interventions to counter tuberculosis. This review provides a broad summary of mycobacterial metabolism, highlighting the adaptation of M. tuberculosis as specialist human pathogen, and discusses recent insights into the strategies used by the host and infecting bacillus to influence the outcomes of the host–pathogen interaction through modulation of metabolic functions. PMID:25502746

  7. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  8. A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Andréa Gobetti Vieira Coelho

    2012-09-01

    Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

  9. Surgical face masks worn by patients with multidrug-resistant tuberculosis: impact on infectivity of air on a hospital ward.

    Science.gov (United States)

    Dharmadhikari, Ashwin S; Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A; van der Walt, Martie; Nardell, Edward A

    2012-05-15

    Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68-85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31-51%), representing a 56% (95% CI, 33-70.5%) decreased risk of TB transmission when patients used masks. Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients.

  10. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  11. Tuberculosis diagnosis and multidrug resistance testing by direct sputum culture in selective broth without decontamination or centrifugation.

    Science.gov (United States)

    Grandjean, Louis; Martin, Laura; Gilman, Robert H; Valencia, Teresa; Herrera, Beatriz; Quino, Willi; Ramos, Eric; Rivero, Maribel; Montoya, Rosario; Escombe, A Roderick; Coleman, David; Mitchison, Denis; Evans, Carlton A

    2008-07-01

    Tuberculosis culture usually requires sputum decontamination and centrifugation to prevent cultures from being overgrown by contaminating bacteria and fungi. However, decontamination destroys many tuberculous bacilli, and centrifugation often is not possible in resource-poor settings. We therefore assessed the performance of Mycobacterium tuberculosis culture with unprocessed samples plated directly by using tuberculosis-selective media and compared this procedure to conventional culture using centrifuge decontamination. Quadruplicate aliquots of strain H37RV were cultured in 7H9 broth with and without selective antimicrobials and after centrifuge decontamination. The subsequent comparison was made with 715 sputum samples. Split paired sputum samples were cultured conventionally with centrifuge decontamination and by direct culture in tuberculosis-selective media containing antibiotics. Centrifuge decontamination reduced tuberculosis H37RV colonies by 78% (P laboratories this deficit may be outweighed by the ease of use.

  12. A PROSPECTIVE, OBSERVATIONAL STUDY OF ADVERSE REACTIONS TO DRUG REGIME FOR MULTI-DRUG RESISTANT PULMONARY TUBERCULOSIS IN CENTRAL INDIA.

    Directory of Open Access Journals (Sweden)

    Dr. Rohan C. Hire

    2014-09-01

    Full Text Available Abstract Objective: 1 To assess the adverse drug reactions of second line anti-tubercular drugs used to treat Multi-drug resistant Tuberculosis (MDR TB in central India on the basis of causality, severity and avoidability scales. 2 To study the relationship of type of MDR TB (primary or secondary and presence of diabetes mellitus (DM with mean smear conversion time. Material and Methods: A prospective, observational study was carried out on diagnosed multidrug resistant tuberculosis patients enrolled for DOTS‑Plus regimen at TB and Chest Disease Department from January to December 2012. They were followed for 9 months thereafter and encountered adverse drug reactions (ADRs were noted along with the time of sputum conversion. The data were analysed by Chi-square or Fisher’s exact test and unpaired student’s‘t’ test. Results: Total 64 ADRs were reported in 55 patients out of total 110 patients (n = 110. As per the Naranjo causality assessment of ADRs, 7 patients had “definite” causal relation, 45 had “probable” causal relation and 3 had “possible” causal relation with drugs of DOTS Plus regime. As per the Hartwig’s severity assessment scale, there were total 7 ADRs in Level 1, 6 in Level 2, 33 in Level 3 and 9 in Level 4. Hallas avoidability assessment scale divided the ADRs as 3 being “Definitely avoidable”, 26 “Possibly avoidable”, 23 “Not avoidable” and 3 “unevaluable”. . Mean sputum smear conversion time is significantly higher in patients with secondary type than that of primary type of MDR TB (p = 0.0001 and in patients with DM than those without DM (p <0.0001. Conclusion: ADRs were common in patients of MDR TB on DOTs-Plus drug regime. It was due to lack of availability of safer and equally potent drugs in DOTs-Plus drug regime compared to DOTS regime in non-resistant TB. The frequency and severity of ADRs can be reduced by strict vigilance about known and unknown ADRs, monitoring their laboratory and

  13. Preparation and biological evaluation of ethionamide-mesoporous silicon nanoparticles against Mycobacterium tuberculosis

    OpenAIRE

    Vale, Nuno; Correia, Alexandra; Silva, Sara; Figueiredo, Patrícia; Mäkilä, , Ermei; Salonen, Jarno; Hirvonen, Jouni; Pedrosa, Jorge; Santos Hélder A.; Fraga, Alexandra

    2017-01-01

    Ethionamide (ETH) is an important second-line antituberculosis drug used for the treatment of patients infected with multidrug-resistant Mycobacterium tuberculosis. Recently, we reported that the loading of ETH into thermally carbonized-porous silicon (TCPSi) nanoparticles enhanced the solubility and permeability of ETH at different pH-values and also increased its metabolization process. Based on these results, we synthesized carboxylic acid functionalized thermally hydrocarbonized porous si...

  14. Sequential analysis as a tool for detection of amikacin ototoxicity in the treatment of multidrug-resistant tuberculosis.

    Science.gov (United States)

    Vasconcelos, Karla Anacleto de; Frota, Silvana Maria Monte Coelho; Ruffino-Netto, Antonio; Kritski, Afrânio Lineu

    2018-04-01

    To investigate early detection of amikacin-induced ototoxicity in a population treated for multidrug-resistant tuberculosis (MDR-TB), by means of three different tests: pure-tone audiometry (PTA); high-frequency audiometry (HFA); and distortion-product otoacoustic emission (DPOAE) testing. This was a longitudinal prospective cohort study involving patients aged 18-69 years with a diagnosis of MDR-TB who had to receive amikacin for six months as part of their antituberculosis drug regimen for the first time. Hearing was assessed before treatment initiation and at two and six months after treatment initiation. Sequential statistics were used to analyze the results. We included 61 patients, but the final population consisted of 10 patients (7 men and 3 women) because of sequential analysis. Comparison of the test results obtained at two and six months after treatment initiation with those obtained at baseline revealed that HFA at two months and PTA at six months detected hearing threshold shifts consistent with ototoxicity. However, DPOAE testing did not detect such shifts. The statistical method used in this study makes it possible to conclude that, over the six-month period, amikacin-associated hearing threshold shifts were detected by HFA and PTA, and that DPOAE testing was not efficient in detecting such shifts.

  15. Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

    Science.gov (United States)

    Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

    2018-03-01

    New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

  16. Multidrug-resistant tuberculosis in Moldova and the Former Yugoslav Republic of Macedonia: The importance of health system governance

    Directory of Open Access Journals (Sweden)

    R. Gregory Thomas-Reilly

    2016-04-01

    Full Text Available Aim: Multidrug-resistant tuberculosis (MDR-TB arises where treatment is interrupted or inadequate, when patients are treated inappropriately, or when an individual has impaired immune function, which can lead to a rapid progression from infection with an MDR-strain to disease. This study examines the role of health systems in amplifying or preventing the development of MDR-TB. Methods: We present two comparative studies, which were undertaken in The Former Yugoslav Republic of Macedonia (TFYR Macedonia and Moldova. Results: The findings reveal several health systems-level factors that contribute to the different rates of MDR-TB observed in these two countries, including: pre-existing burden of disease; organization of the health system, with the existence of parallel systems; power dynamics among policy makers and disease programmes; and the accountability & effectiveness of programme oversight. Conclusions: The findings do not offer a universal template for health system reform but do identify specific factors that may be contributing to the epidemic and are worthy of further attention in the two countries.

  17. Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

    Science.gov (United States)

    Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

    2015-01-01

    Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

  18. Association between Multidrug-Resistant Tuberculosis and Risk Factors in China: Applying Partial Least Squares Path Modeling.

    Directory of Open Access Journals (Sweden)

    Yun-Xia Liu

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB resulting from various factors has raised serious public health concerns worldwide. Identifying the ecological risk factors associated with MDR-TB is critical to its prevention and control. This study aimed to explore the association between the development of MDR-TB and the risk factors at the group-level (ecological risk factors in China.Data on MDR-TB in 120 counties were obtained from the National Tuberculosis Information Management System, and data on risk-factor variables were extracted from the Health Statistical Yearbook, provincial databases, and the meteorological bureau of each province (municipality. Partial Least Square Path Modeling was used to detect the associations.The median proportion of MDR-TB in new TB cases was 3.96% (range, 0-39.39%. Six latent factors were extracted from the ecological risk factors, which explained 27.60% of the total variance overall in the prevalence of MDR-TB. Based on the results of PLS-PM, TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors were all associated with the risk of MDR-TB, but socioeconomic factors were not significant.The development of MDR-TB was influenced by TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors. Such information may help us to establish appropriate public health intervention strategies to prevent and control MDR-TB and yield benefits to the entire public health system in China.

  19. Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

    Directory of Open Access Journals (Sweden)

    Stellah G Mpagama

    Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

  20. The Potential Impact of Up-Front Drug Sensitivity Testing on India's Epidemic of Multi-Drug Resistant Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Kuldeep Singh Sachdeva

    Full Text Available In India as elsewhere, multi-drug resistance (MDR poses a serious challenge in the control of tuberculosis (TB. The End TB strategy, recently approved by the world health assembly, aims to reduce TB deaths by 95% and new cases by 90% between 2015 and 2035. A key pillar of this approach is early diagnosis of tuberculosis, including use of higher-sensitivity diagnostic testing and universal rapid drug susceptibility testing (DST. Despite limitations of current laboratory assays, universal access to rapid DST could become more feasible with the advent of new and emerging technologies. Here we use a mathematical model of TB transmission, calibrated to the TB epidemic in India, to explore the potential impact of a major national scale-up of rapid DST. To inform key parameters in a clinical setting, we take GeneXpert as an example of a technology that could enable such scale-up. We draw from a recent multi-centric demonstration study conducted in India that involved upfront Xpert MTB/RIF testing of all TB suspects.We find that widespread, public-sector deployment of high-sensitivity diagnostic testing and universal DST appropriately linked with treatment could substantially impact MDR-TB in India. Achieving 75% access over 3 years amongst all cases being diagnosed for TB in the public sector alone could avert over 180,000 cases of MDR-TB (95% CI 44187 - 317077 cases between 2015 and 2025. Sufficiently wide deployment of Xpert could, moreover, turn an increasing MDR epidemic into a diminishing one. Synergistic effects were observed with assumptions of simultaneously improving MDR-TB treatment outcomes. Our results illustrate the potential impact of new and emerging technologies that enable widespread, timely DST, and the important effect that universal rapid DST in the public sector can have on the MDR-TB epidemic in India.

  1. Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

    Science.gov (United States)

    Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

    2015-02-01

    Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  2. In vitro activities of DA-7157 and DA-7218 against Mycobacterium tuberculosis and Nocardia brasiliensis.

    Science.gov (United States)

    Vera-Cabrera, Lucio; Gonzalez, Eva; Rendon, Adrian; Ocampo-Candiani, Jorge; Welsh, Oliverio; Velazquez-Moreno, Victor M; Choi, Sung Hak; Molina-Torres, Carmen

    2006-09-01

    The in vitro activities of DA-7157, a novel oxazolidinone, against clinical isolates of Nocardia brasiliensis and Mycobacterium tuberculosis were determined. Equal MIC(50)s and MIC(90)s (0.25 and 0.5 microg/ml, respectively) were found for susceptible and multidrug-resistant isolates of M. tuberculosis. The N. brasiliensis isolates showed an MIC(90) of 1 microg/ml and an MIC(50) of 1 microg/ml. The DA-7157 prodrug, DA-7218, exhibited similar MICs for M. tuberculosis but fivefold-higher MICs for N. brasiliensis.

  3. Individualized treatment of multidrug-resistant tuberculosis using therapeutic drug monitoring

    Directory of Open Access Journals (Sweden)

    Mathieu S Bolhuis

    2016-01-01

    Conclusion: TDM is highly valuable to individualize and optimize treatment of complex MDR-TB patients. TDM is routinely applied in Tuberculosis Center Beatrixoord, and high success rates for treatment of MDR-TB patients have been achieved. DBS and LSS make implementation of TDM feasible, even in low- and middle-income countries.

  4. Genetic diversity of multidrug-resistant tuberculosis in a resource-limited region of China

    Directory of Open Access Journals (Sweden)

    Dan Zhang

    2014-12-01

    Conclusions: Beijing genotype was the predominant genotype among the isolates from MDR-TB cases in Chongqing. The re-treated MDR-TB cases were more likely to be attributed to Beijing genotype infection. The 10-locus VNTR set demonstrated a good discrimination power for genotyping MDR M. tuberculosis isolates circulating in Chongqing Municipality.

  5. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

    OpenAIRE

    Marie Sylvianne Rabodoarivelo; A Brandao; M C Cergole Novella; A G C. Bombonatte; B Imperiale; N Rakotosamimanana; N Morcillo; V Rasolofo; J C Palomino; A Martin

    2018-01-01

    Background: In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. Methods: This was a multicenter study. Molecular detection of ...

  6. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    International Nuclear Information System (INIS)

    Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok; Koh, Won-Jung; Kwon, O Jung; Kang, Eun Young; Kim, Seonwoo

    2006-01-01

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  7. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea); Koh, Won-Jung; Kwon, O Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea); Kang, Eun Young [Korea University Guro Hospital, Department of Diagnostic Radiology, Korea University College of Medicine, Seoul (Korea); Kim, Seonwoo [Sungkyunkwan University School of Medicine, Biostatistics Unit of the Samsung Biomedical Research Institute, Samsung Medical Center, Seoul (Korea)

    2006-09-15

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  8. Multidrug-resistant tuberculosis patients’ views of interventions to reduce treatment loss to follow-up

    Science.gov (United States)

    Tupasi, T.; Garfin, A. M. C. G.; Mangan, J. M.; Orillaza-Chi, R.; Naval, L. C.; Balane, G. I.; Basilio, R.; Golubkov, A.; Joson, E. S.; Lew, W-J.; Lofranco, V.; Mantala, M.; Pancho, S.; Sarol, J. N.; Blumberg, A.; Burt, D.; Kurbatova, E. V.

    2017-01-01

    SUMMARY SETTING Patients who initiated treatment for multi-drug-resistant tuberculosis (MDR-TB) at 15 Programmatic Management of Drug-resistant Tuberculosis (PMDT) health facilities in the Philippines between July and December 2012. OBJECTIVES To describe patients’ views of current interventions, and suggest changes likely to reduce MDR-TB loss to follow-up. METHODS In-depth interviews were conducted between April and July 2014 with MDR-TB patients who were undergoing treatment, had finished treatment at the time of the interview (controls), or had been lost to follow-up (LTFU). Responses were thematically analyzed. RESULTS Interviews were conducted with 182 patients who were undergoing or had completed treatment and 91 LTFU patients. Views and suggestions could be thematically categorized as approaches to facilitate adherence or address barriers to adherence. The top themes were the need for transportation assistance or improvements to the current transportation assistance program, food assistance, and difficulties patients encountered related to their medications. These themes were addressed by respectively 63%, 60%, and 32% of the participants. CONCLUSIONS A more patient-centered approach is needed to improve MDR-TB treatment adherence. Programs should strive to provide assistance that considers patient preferences, is adequate to cover actual costs or needs, and is delivered in a timely, uninterrupted manner. PMID:28157461

  9. Psychosocial wellbeing of patients with multidrug resistant tuberculosis voluntarily confined to long-term hospitalisation in Nigeria

    Science.gov (United States)

    Oladimeji, Olanrewaju; Ushie, Boniface Ayanbekongshie; Udoh, Ekerette Emmanuel; Oladimeji, Kelechi Elizabeth; Ige, Olusoji Mayowa; Obasanya, Olusegun; Lekharu, Daisy; Atilola, Olayinka; Lawson, Lovett; Eltayeb, Osman; Gidado, Mustapha; Tsoka-Gwegweni, Joyce M; Ihekweazu, Chikwe A; Chasela, Charles S

    2016-01-01

    Background and objective Patient isolation, which is a widely successful treatment strategy for tuberculosis (TB), has been suspected to have effects on patient psychosocial wellbeing. We assessed the psychosocial wellbeing of multidrug resistant TB (MDR-TB) patients in voluntary and isolated long-term hospitalisation in Nigeria. Methods 98 accessible and consenting patients in four drug-resistant treatment centres (University College Hospital and Government Chest Hospital, Ibadan; Mainland Hospital, Lagos, and Lawrence Henshaw Memorial Hospital, Calabar) were enrolled in this study. Data were collected using an 18-item psychosocial wellbeing questionnaire including sociodemographic characteristics. We used descriptive statistics to present demographic characteristics; the χ2 test was used to assess associations between psychosocial wellbeing and independent variables and the relationship was modelled using logistic regression. Results The mean age of respondents was 36.1±11.9 years and 63% were males. Respondents had been in hospital an average of 4.5±1.9 months. Females had more psychosocial concerns compared with males. The most common concerns recorded among respondents were concern that people will get to know that the respondent had a bad type of TB (70%), discontent with being separated from and longing for the company of their marital partner (72%), concerns that they may have taken too many drugs (73%), and displeasure with being unable to continue to engage in their usual social and economic activities (75%). Respondents who were employed had eight times the odds of having more psychosocial concerns than the median number among respondents. Respondents who were supported by their own families during hospitalisation experienced a lower burden of psychosocial concerns compared with those who were supported by third parties. Conclusions Prolonged hospitalisation resulted in significant psychosocial burden for the MDR-TB patients in our study centres

  10. Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

    Directory of Open Access Journals (Sweden)

    Philly O'Riordan

    2008-09-01

    Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

  11. Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Ramachandran, Rajeswari; Muniyandi, M

    2018-03-01

    Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

  12. Prevalence of multidrug resistance among retreatment pulmonary tuberculosis cases in a tertiary care hospital, Hyderabad, India

    Directory of Open Access Journals (Sweden)

    Subhakar Kandi

    2013-01-01

    Full Text Available Background: India is one of the high tuberculosis (TB burden countries in the world. India ranks second in harboring multi drug resistant (MDR-TB cases. About 50,000 of MDR cases are recorded in retreatment pulmonary TB cases. This study was conducted in a tertiary care facility (Government General and Chest Hospital in Hyderabad, India. Objectives: Toassess: Proportion of the TB patients having MDR-TB at the initiation of retreatment regimen; the prevalence of isoniazid (INH resistance in this geographical area. Materials and Methods: An analytical, observational, prospective cohort study of patients attending the out-patient department from December 2010 to March 2011. Results: Sputum samples from 100 patients were subjected to acid fast bacilli (AFB culture and drug sensitivity testing. Of these, 28 (28% were MDR-TB, 42 (42% were non-MDR-TB and 39% being INH resistance. Conclusions: In conclusion, one third of the retreatment pulmonary TB cases attending a tertiary care institute for TB will be MDR-TB at the initiation of treatment and there is a need to include ethambutol in the continuation phase of new TB case treatment in view of high INH resistance.

  13. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

    Directory of Open Access Journals (Sweden)

    Marie Sylvianne Rabodoarivelo

    2018-01-01

    Full Text Available Background: In low-income countries, rapid detection of tuberculosis (TB drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF and isoniazid (INH resistance. Methods: This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. Results: From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Conclusion: Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  14. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study.

    Science.gov (United States)

    Rabodoarivelo, Marie Sylvianne; Brandao, A; Cergole Novella, M C; C Bombonatte, A G; Imperiale, B; Rakotosamimanana, N; Morcillo, N; Rasolofo, V; Palomino, J C; Martin, A

    2018-01-01

    In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  15. Retrospective study of tolerability and efficacy of linezolid in patients with multidrug-resistant tuberculosis (1998-2014).

    Science.gov (United States)

    Ramírez-Lapausa, Marta; Pascual Pareja, José Francisco; Carrillo Gómez, Raquel; Martínez-Prieto, Mónica; González-Ruano Pérez, Patricia; Noguerado Asensio, Arturo

    2016-02-01

    Although linezolid is known to be effective when used as an adjunct therapy in the treatment of patients with multidrug-resistant tuberculosis (MDR-TB), the clinical experience is limited. In this study the efficacy and adverse effects of linezolid treatment were evaluated. A retrospective study of tolerability and efficacy of linezolid in MDR-TB patients was performed in Madrid, Spain. Demographic characteristics, microbiological and clinical features and data on treatment tolerability were collected. Regimens were constructed with a target of prescribing, at least, five anti-tuberculosis agents likely to be effective. Linezolid, at a dosage of 1200 or 600 mg daily, was included to complete the treatment if no other sensitive drugs were available. Vitamin B6 was used to reduce toxicity. Treatment outcome and clinical status at last contact were compared between patients with linezolid-containing regimens and with those without linezolid-containing regimens. During the period 1998-2014, 55 patients with MDR-TB received treatment. In 21 of these patients, linezolid was added. The median of linezolid administration was 23.9 months (IQT 13.1-24.7). Patients using linezolid showed a greater resistance to drugs, with a median of 6 (IQR 5-7) compared with those who did not use it, with a median of 4 drugs (IQR 3-5) (plinezolid group (73.5 days) did not differ significantly from those in the non-linezolid group (61 days) (p=0.29). There were no significant differences in the outcomes of the two patient groups. There were no reported adverse events in 81% of patients assigned to linezolid therapy. Only four patients developed toxicity attributed to linezolid. The most serious adverse event in these patients was anemia observed in the two patients treated with 1200 mg per day. One of them also developed moderate paresthesia. In both cases the dosage was reduced to 600 mg per day, with improvement of the anemia and paresthesias. No patients stopped linezolid therapy. A daily

  16. Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

    Directory of Open Access Journals (Sweden)

    Ejaz Qadeer

    2017-05-01

    Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

  17. Multidrug-Resistant Tuberculosis and Its Association with Adrenal Insufficiency: Assessment with the Low-Dose ACTH Stimulation Test

    Directory of Open Access Journals (Sweden)

    René Rodríguez-Gutiérrez

    2016-01-01

    Full Text Available Background. Multidrug-resistant tuberculosis (MDR-TB is a major public health care concern that affects the life of millions of people around the world. The association of tuberculosis and adrenal insufficiency is well known; however, it is thought to be less prevalent every time. A spike in TB incidence and a lack of evidence of this association in patients with MDR-TB call for reassessment of an illness (adrenal dysfunction that if not diagnosed could seriously jeopardize patients’ health. Objective. To determine the prevalence of adrenocortical insufficiency in patients with MDR-TB using the low-dose (1 μg ACTH stimulation test at baseline and at 6–12 months of follow-up after antituberculosis treatment and culture conversion. Methods. A total of 48 men or women, aged ≥18 years (HIV-negative patients diagnosed with pulmonary MDR-TB were included in this prospective observational study. Blood samples for serum cortisol were taken at baseline and 30 and 60 minutes after 1 μg ACTH stimulation at our tertiary level university hospital before and after antituberculosis treatment. Results. Forty-seven percent of subjects had primary MDR-TB; 43.8% had type 2 diabetes; none were HIV-positive. We found at enrollment 2 cases (4.2% of adrenal insufficiency taking 500 nmol/L as the standard cutoff point value and 4 cases (8.3% alternatively, using 550 nmol/L. After antituberculosis intensive phase drug-treatment and a negative mycobacterial culture (10.2±3.6 months adrenocortical function was restored in all cases. Conclusions. In patients with MDR-TB, using the low-dose ACTH stimulation test, a low prevalence of mild adrenal insufficiency was observed. After antituberculosis treatment adrenal function was restored in all cases. Given the increasing and worrying epidemic of MDR-TB these findings have important clinical implications that may help clinicians and patients make better decisions when deciding to test for adrenocortical

  18. Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

    Science.gov (United States)

    Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

    2015-03-01

    To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

  19. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

    OpenAIRE

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-01-01

    Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

  20. Combating highly resistant emerging pathogen Mycobacterium abscessus and Mycobacterium tuberculosis with novel salicylanilide esters and carbamates.

    Science.gov (United States)

    Baranyai, Zsuzsa; Krátký, Martin; Vinšová, Jarmila; Szabó, Nóra; Senoner, Zsuzsanna; Horváti, Kata; Stolaříková, Jiřina; Dávid, Sándor; Bősze, Szilvia

    2015-08-28

    In the Mycobacterium genus over one hundred species are already described and new ones are periodically reported. Species that form colonies in a week are classified as rapid growers, those requiring longer periods (up to three months) are the mostly pathogenic slow growers. More recently, new emerging species have been identified to lengthen the list, all rapid growers. Of these, Mycobacterium abscessus is also an intracellular pathogen and it is the most chemotherapy-resistant rapid-growing mycobacterium. In addition, the cases of multidrug-resistant Mycobacterium tuberculosis infection are also increasing. Therefore there is an urgent need to find new active molecules against these threatening strains. Based on previous results, a series of salicylanilides, salicylanilide 5-chloropyrazinoates and carbamates was designed, synthesized and characterised. The compounds were evaluated for their in vitro activity on M. abscessus, susceptible M. tuberculosis H37Rv, multidrug-resistant (MDR) M. tuberculosis MDR A8, M. tuberculosis MDR 9449/2006 and on the extremely-resistant Praha 131 (XDR) strains. All derivatives exhibited a significant activity with minimum inhibitory concentrations (MICs) in the low micromolar range. Eight salicylanilide carbamates and two salicylanilide esters exhibited an excellent in vitro activity on M. abscessus with MICs from 0.2 to 2.1 μM, thus being more effective than ciprofloxacin and gentamicin. This finding is potentially promising, particularly, as M. abscessus is a threateningly chemotherapy-resistant species. M. tuberculosis H37Rv was inhibited with MICs from 0.2 μM, and eleven compounds have lower MICs than isoniazid. Salicylanilide esters and carbamates were found that they were effective also on MDR and XDR M. tuberculosis strains with MICs ≥1.0 μM. The in vitro cytotoxicity (IC50) was also determined on human MonoMac-6 cells, and selectivity index (SI) of the compounds was established. In general, salicylanilide

  1. Cost-effectiveness of adding bedaquiline to drug regimens for the treatment of multidrug-resistant tuberculosis in the UK.

    Directory of Open Access Journals (Sweden)

    Lara J Wolfson

    Full Text Available To evaluate the cost-effectiveness of adding bedaquiline to a background regimen (BR of drugs for multidrug-resistant tuberculosis (MDR-TB in the United Kingdom (UK.A cohort-based Markov model was developed to estimate the incremental cost-effectiveness ratio of bedaquiline plus BR (BBR versus BR alone (BR in the treatment of MDR-TB, over a 10-year time horizon. A National Health Service (NHS and personal social services perspective was considered. Cost-effectiveness was evaluated in terms of Quality-Adjusted Life Years (QALYs and Disability-Adjusted Life Years (DALYs. Data were sourced from a phase II, placebo-controlled trial, NHS reference costs, and the literature; the US list price of bedaquiline was used and converted to pounds (£18,800. Costs and effectiveness were discounted at a rate of 3.5% per annum. Probabilistic and deterministic sensitivity analysis was conducted.The total discounted cost per patient (pp on BBR was £106,487, compared with £117,922 for BR. The total discounted QALYs pp were 5.16 for BBR and 4.01 for BR. The addition of bedaquiline to a BR resulted in a cost-saving of £11,434 and an additional 1.14 QALYs pp over a 10-year period, and is therefore considered to be the dominant (less costly and more effective strategy over BR. BBR remained dominant in the majority of sensitivity analyses, with a 81% probability of being dominant versus BR in the probabilistic analysis.In the UK, bedaquiline is likely to be cost-effective and cost-saving, compared with the current MDR-TB standard of care under a range of scenarios. Cost-savings over a 10-year period were realized from reductions in length of hospitalization, which offset the bedaquiline drug costs. The cost-benefit conclusions held after several sensitivity analyses, thus validating assumptions made, and suggesting that the results would hold even if the actual price of bedaquiline in the UK were higher than in the US.

  2. Poor Outcomes in a Cohort of HIV-Infected Adolescents Undergoing Treatment for Multidrug-Resistant Tuberculosis in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

    2013-01-01

    Background Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10–19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. Methods A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. Results The median age was 16 (IQR 14–18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8–250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Conclusions Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

  3. High Rate of Hypothyroidism in Multidrug-Resistant Tuberculosis Patients Co-Infected with HIV in Mumbai, India

    Science.gov (United States)

    Andries, Aristomo; Isaakidis, Petros; Das, Mrinalini; Khan, Samsuddin; Paryani, Roma; Desai, Chitranjan; Dalal, Alpa; Mansoor, Homa; Verma, Reena; Fernandes, Dolorosa; Sotgiu, Giovanni; Migliori, Giovanni B.; Saranchuk, Peter

    2013-01-01

    Background Adverse events (AEs) among HIV-infected patients with multidrug-resistant tuberculosis (MDR-TB) receiving anti-TB and antiretroviral treatments (ART) are under-researched and underreported. Hypothyroidism is a common AE associated with ethionamide, p-aminosalicylic acid (PAS), and stavudine. The aim of this study was to determine the frequency of and risk factors associated with hypothyroidism in HIV/MDR-TB co-infected patients. Methods This was a prospective, observational cohort study, using routine laboratory data in a Médecins Sans Frontières (MSF) clinic in collaboration with Sewri TB Hospital, Mumbai, India. Hypothyroidism was defined as a thyroid stimulating hormone (TSH) result >10 mIU/L at least once during treatment. Patients having a baseline result and one additional result after 3 months were eligible for enrolment. Results Between October 2006 and March 2013, 116 patients were enrolled, 69 of whom were included. The median (IQR) age was 38 years (34-43) and 61% were male. By March 2013, 37/69 (54%) had hypothyroidism after at least 90 days of treatment. Age, gender, CD4 counts and stavudine-based ART were not associated with the occurrence of hypothyroidism in multivariate models. The co-administration of PAS and ethionamide was found to double the risk of hypothyroidism (RR: 1.93, 95% CI: 1.06-3.54). Discussion High rate of hypothyroidism was recorded in a Mumbai cohort of MDR-TB/HIV co-infected patients on treatment. This is a treatable and reversible AE, however, it may go undiagnosed in the absence of regular monitoring. Care providers should not wait for clinical symptoms, as this risks compromising treatment adherence. Simple, affordable and reliable point-of-care tools for measuring TSH are needed, especially in high MDR-TB burden countries. Our findings suggest the need for TSH screening at baseline, three months, six months, and every six months thereafter for HIV-infected patients on MDR-TB treatment regimens containing PAS and

  4. Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

    Directory of Open Access Journals (Sweden)

    Petros Isaakidis

    Full Text Available BACKGROUND: Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF project in Mumbai, India. METHODS: A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. RESULTS: The median age was 16 (IQR 14-18 years and 54% were female. Five (46% adolescents had pulmonary TB (PTB, two (18% extrapulmonary disease (EPTB and four (36% had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5. By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5% patients: one was cured and three were still on treatment with negative culture results. Seven patients (64% had poor outcomes: four (36.5% died and three (27% defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100% on-treatment experienced adverse events (AEs: two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. CONCLUSIONS: Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

  5. Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

    Science.gov (United States)

    Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

    2013-01-01

    Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. The median age was 16 (IQR 14-18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial support for co-infected adolescents

  6. Intensive-phase treatment outcomes among hospitalized multidrug-resistant tuberculosis patients: results from a nationwide cohort in Nigeria.

    Directory of Open Access Journals (Sweden)

    Olanrewaju Oladimeji

    Full Text Available BACKGROUND: Nigeria is faced with a high burden of Human Immunodeficiency Virus (HIV infection and multidrug-resistant tuberculosis (MDR-TB. Treatment outcomes among MDR-TB patients registered across the globe have been poor, partly due to high loss-to-follow-up. To address this challenge, MDR-TB patients in Nigeria are hospitalized during the intensive-phase(IP of treatment (first 6-8 months and are provided with a package of care including standardized MDR-TB treatment regimen, antiretroviral therapy (ART and cotrimoxazole prophylaxis (CPT for HIV-infected patients, nutritional and psychosocial support. In this study, we report the end-IP treatment outcomes among them. METHODS: In this retrospective cohort study, we reviewed the patient records of all bacteriologically-confirmed MDR-TB patients admitted for treatment between July 2010 and October 2012. RESULTS: Of 162 patients, 105(65% were male, median age was 34 years and 28(17% were HIV-infected; all 28 received ART and CPT. Overall, 138(85% were alive and culture negative at the end of IP, 24(15% died and there was no loss-to-follow-up. Mortality was related to low CD4-counts at baseline among HIV-positive patients. The median increase in body mass index among those documented to be underweight was 2.6 kg/m2 (p<0.01 and CD4-counts improved by a median of 52 cells/microL among the HIV-infected patients (p<0.01. CONCLUSIONS: End-IP treatment outcomes were exceptional compared to previously published data from international cohorts, thus confirming the usefulness of a hospitalized model of care. However, less than five percent of all estimated 3600 MDR-TB patients in Nigeria were initiated on treatment during the study period. Given the expected scale-up of MDR-TB care, the hospitalized model is challenging to sustain and the national TB programme is contemplating to move to ambulatory care. Hence, we recommend using both ambulatory and hospitalized approaches, with the latter being reserved

  7. MULTIDRUG-RESISTANT TUBERCULOSIS

    African Journals Online (AJOL)

    Kurt

    health, with the focus of DOTS programmes on cure of infectious TB patients and prevention of drug resistance. ... Despite highly effective drugs and disease control strategies, morbidity and mortality .... notification and registration system.

  8. MULTIDRUG-RESISTANT TUBERCULOSIS

    African Journals Online (AJOL)

    Kurt

    grammes consider implementation of MDR-TB treatment using second-line reserve .... patients with persistently positive acid- fast bacilli ... and emotional support are particularly ..... Importance of socioeconomic conditions should ... not be underestimated as contributing factor to ... Depression and depressive symptoms may.

  9. Molecular Characterization of the Resistance of Mycobacterium ...

    African Journals Online (AJOL)

    Purpose: To characterize the resistance of Mycobacterium tuberculosis to second line drugs using a line probe assay. Methods: Multi-drug resistant strains of Mycobacterium tuberculosis isolated between December 2008 and December 2009 were tested for resistance to fluoroquinolones and second-line injectable drugs ...

  10. Extensively and Pre-Extensively Drug Resistant Tuberculosis in Clinical Isolates of Multi-Drug Resistant Tuberculosis Using Classical Second Line Drugs (Levofloxacin and Amikacin)

    International Nuclear Information System (INIS)

    Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.

    2015-01-01

    Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)

  11. Cutaneous squamous cell carcinoma in lupus vulgaris caused by drug resistant Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Muthu S Kumaran

    2017-01-01

    Full Text Available Tuberculosis (TB is still a major public health problem in the world, with many factors contributing to this burden, including poor living conditions, overcrowding, poverty, malnutrition, illiteracy, and rapid spread of human immunodeficiency virus infection. Cutaneous tuberculosis is a less common form of extrapulmonary tuberculosis, and in this paucibacillary form the diagnosis depends on histopathology, tuberculin positivity, and response to treatment. The diagnosis is even more difficult in cases with drug resistant Mycobacterium tuberculosis due to lack of awareness and lack of facilities to diagnose drug resistant tuberculosis. In this article, we describe an unusual case of multidrug resistant lupus vulgaris (LV, in a 34-year-old male who responded to anti-tubercular treatment (ATT initially, but developed recurrent disease which failed to respond to standard four-drug ATT; subsequently, tissue culture showed growth of multidrug resistant M. tuberculosis. Subsequently, he also developed cutaneous squamous cell carcinoma. This article aims to exemplify a grave complication that can occur in long-standing case of LV, the limitations faced by clinicians in developing countries where tuberculosis is endemic, and classical methods of proving drug resistance are generally unavailable or fail.

  12. Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

    Science.gov (United States)

    Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

    2017-07-01

    Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

  13. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  14. Drug Resistance of Mycobacterium tuberculosis Complex among ...

    African Journals Online (AJOL)

    BACKGROUND: In Burkina Faso, there is no recent data about the level of drug resistance in Mycobacterium tuberculosis strains among newly diagnosed tuberculosis cases. OBJECTIVE: To provide an update of the primary drug resistance of mycobacterium tuberculosis among patients in Burkina faso. METHODS: ...

  15. Improved Survival and Cure Rates With Concurrent Treatment for Multidrug-Resistant Tuberculosis-Human Immunodeficiency Virus Coinfection in South Africa.

    Science.gov (United States)

    Brust, James C M; Shah, N Sarita; Mlisana, Koleka; Moodley, Pravi; Allana, Salim; Campbell, Angela; Johnson, Brent A; Master, Iqbal; Mthiyane, Thuli; Lachman, Simlatha; Larkan, Lee-Megan; Ning, Yuming; Malik, Amyn; Smith, Jonathan P; Gandhi, Neel R

    2018-04-03

    Mortality in multidrug-resistant (MDR) tuberculosis-human immunodeficiency virus (HIV) coinfection has historically been high, but most studies predated the availability of antiretroviral therapy (ART). We prospectively compared survival and treatment outcomes in MDR tuberculosis-HIV-coinfected patients on ART to those in patients with MDR tuberculosis alone. This observational study enrolled culture-confirmed MDR tuberculosis patients with and without HIV in South Africa between 2011 and 2013. Participants received standardized MDR tuberculosis and HIV regimens and were followed monthly for treatment response, adverse events, and adherence. The primary outcome was survival. Among 206 participants, 150 were HIV infected, 131 (64%) were female, and the median age was 33 years (interquartile range [IQR], 26-41). Of the 191 participants with a final MDR tuberculosis outcome, 130 (73%) were cured or completed treatment, which did not differ by HIV status (P = .50). After 2 years, CD4 count increased a median of 140 cells/mm3 (P = .005), and 64% had an undetectable HIV viral load. HIV-infected and HIV-uninfected participants had high rates of survival (86% and 94%, respectively; P = .34). The strongest risk factor for mortality was having a CD4 count ≤100 cells/mm3 (adjusted hazards ratio, 15.6; 95% confidence interval, 4.4-55.6). Survival and treatment outcomes among MDR tuberculosis-HIV individuals receiving concurrent ART approached those of HIV-uninfected patients. The greatest risk of death was among HIV-infected individuals with CD4 counts ≤100 cells/mm3. These findings provide critical evidence to support concurrent treatment of MDR tuberculosis and HIV.

  16. Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India

    Directory of Open Access Journals (Sweden)

    Fahmiya Leena Yacoob

    2016-01-01

    Full Text Available In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days as compared to solid and liquid cultures (35.6 days and 13.5 days, resp..

  17. Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India.

    Science.gov (United States)

    Yacoob, Fahmiya Leena; Philomina Jose, Beena; Karunakaran Lelitha, Sarada Devi; Sreenivasan, Sreelatha

    2016-01-01

    In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days) as compared to solid and liquid cultures (35.6 days and 13.5 days, resp.).

  18. High levels of multidrug resistant tuberculosis in new and treatment-failure patients from the Revised National Tuberculosis Control Programme in an urban metropolis (Mumbai in Western India

    Directory of Open Access Journals (Sweden)

    Nicol Mark

    2009-06-01

    Full Text Available Abstract Background India, China and Russia account for more than 62% of multidrug resistant tuberculosis (MDRTB globally. Within India, locations like urban metropolitan Mumbai with its burgeoning population and high incidence of TB are suspected to be a focus for MDRTB. However apart from sporadic surveys at watched sites in the country, there has been no systematic attempt by the Revised National Tuberculosis Control Programme (RNTCP of India to determine the extent of MDRTB in Mumbai that could feed into national estimates. Drug susceptibility testing (DST is not routinely performed as a part of programme policy and public health laboratory infrastructure, is limited and poorly equipped to cope with large scale testing. Methods From April 2004 to January 2007 we determined the extent of drug resistance in 724 {493 newly diagnosed, previously untreated and 231 first line treatment failures (sputum-smear positive at the fifth month after commencement of therapy} cases of pulmonary tuberculosis drawn from the RNTCP in four suboptimally performing municipal wards of Mumbai. The observations were obtained using a modified radiorespirometric Buddemeyer assay and validated by the Swedish Institute for Infectious Disease Control, Stockholm, a supranational reference laboratory. Data was analyzed utilizing SPSS 10.0 and Epi Info 2002. Results This study undertaken for the first time in RNTCP outpatients in Mumbai reveals a high proportion of MDRTB strains in both previously untreated (24% and treatment-failure cases (41%. Amongst new cases, resistance to 3 or 4 drug combinations (amplified drug resistance including isoniazid (H and rifampicin (R, was greater (20% than resistance to H and R alone (4% at any point in time during the study. The trend for monoresistance was similar in both groups remaining highest to H and lowest to R. External quality control revealed good agreement for H and R resistance (k = 0.77 and 0.76 respectively. Conclusion

  19. High levels of multidrug resistant tuberculosis in new and treatment-failure patients from the Revised National Tuberculosis Control Programme in an urban metropolis (Mumbai) in Western India.

    Science.gov (United States)

    D'souza, Desiree T B; Mistry, Nerges F; Vira, Tina S; Dholakia, Yatin; Hoffner, Sven; Pasvol, Geoffrey; Nicol, Mark; Wilkinson, Robert J

    2009-06-29

    India, China and Russia account for more than 62% of multidrug resistant tuberculosis (MDRTB) globally. Within India, locations like urban metropolitan Mumbai with its burgeoning population and high incidence of TB are suspected to be a focus for MDRTB. However apart from sporadic surveys at watched sites in the country, there has been no systematic attempt by the Revised National Tuberculosis Control Programme (RNTCP) of India to determine the extent of MDRTB in Mumbai that could feed into national estimates. Drug susceptibility testing (DST) is not routinely performed as a part of programme policy and public health laboratory infrastructure, is limited and poorly equipped to cope with large scale testing. From April 2004 to January 2007 we determined the extent of drug resistance in 724 {493 newly diagnosed, previously untreated and 231 first line treatment failures (sputum-smear positive at the fifth month after commencement of therapy)} cases of pulmonary tuberculosis drawn from the RNTCP in four suboptimally performing municipal wards of Mumbai. The observations were obtained using a modified radiorespirometric Buddemeyer assay and validated by the Swedish Institute for Infectious Disease Control, Stockholm, a supranational reference laboratory. Data was analyzed utilizing SPSS 10.0 and Epi Info 2002. This study undertaken for the first time in RNTCP outpatients in Mumbai reveals a high proportion of MDRTB strains in both previously untreated (24%) and treatment-failure cases (41%). Amongst new cases, resistance to 3 or 4 drug combinations (amplified drug resistance) including isoniazid (H) and rifampicin (R), was greater (20%) than resistance to H and R alone (4%) at any point in time during the study. The trend for monoresistance was similar in both groups remaining highest to H and lowest to R. External quality control revealed good agreement for H and R resistance (k = 0.77 and 0.76 respectively). Levels of MDRTB are much higher in both previously

  20. Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

    Science.gov (United States)

    Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

    2017-11-01

    BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

  1. Increasing incidence of fluoroquinolone-resistant Mycobacterium tuberculosis in Mumbai, India.

    Science.gov (United States)

    Agrawal, D; Udwadia, Z F; Rodriguez, C; Mehta, A

    2009-01-01

    Tertiary referral centre, private hospital, Mumbai, India. To analyse the incidence of fluoroquinolone (FQ) resistant Mycobacterium tuberculosis (TB) in our laboratory from 1995 to 2004. Retrospective review and analysis of the drug susceptibility test records of all M. tuberculosis culture-positive samples from our Microbiology Department from 1995 to 2004. FQ resistance has increased exponentially in our laboratory, from 3% in 1996 to 35% in 2004. The incidence of multidrug-resistant tuberculosis has also increased during the same period, from 33% in 1995 to 56% in 2004. The incidence of FQ-resistant M. tuberculosis is gradually increasing to alarming levels. This may be due to widespread use of this vital group of drugs in the treatment of community-acquired infections. We urge that these broad spectrum antibiotics be used judiciously, and ideally be reserved for treatment of resistant TB in TB-endemic areas.

  2. Mutations in DNA repair genes are associated with the Haarlem lineage of Mycobacterium tuberculosis independently of their antibiotic resistance.

    Science.gov (United States)

    Olano, Juanita; López, Beatriz; Reyes, Alejandro; Lemos, María del Pilar; Correa, Nidia; Del Portillo, Patricia; Barrera, Lucia; Robledo, Jaime; Ritacco, Viviana; Zambrano, María Mercedes

    2007-11-01

    The analysis of the DNA repair genes ogt and ung was carried out in 117 Mycobacterium tuberculosis clinical isolates from Argentina and Colombia in order to explore correlation between mutations in these genes and multi-drug resistance. With the exception of two Beijing family isolates, the rest of the strains harbored either two wild-type or two mutant alleles with identical single nucleotide polymorphisms (SNPs) in each gene (ogt44 and ung501). These ogt44 and ung501 mutations were not associated with multi-drug resistance and occurred simultaneously in circulating Haarlem genotype M. tuberculosis strains. We therefore propose the use of these markers as tools in phylogenetic and epidemiologic studies.

  3. Targeting phenotypically tolerant Mycobacterium tuberculosis

    Science.gov (United States)

    Gold, Ben; Nathan, Carl

    2016-01-01

    While the immune system is credited with averting tuberculosis in billions of individuals exposed to Mycobacterium tuberculosis, the immune system is also culpable for tempering the ability of antibiotics to deliver swift and durable cure of disease. In individuals afflicted with tuberculosis, host immunity produces diverse microenvironmental niches that support suboptimal growth, or complete growth arrest, of M. tuberculosis. The physiological state of nonreplication in bacteria is associated with phenotypic drug tolerance. Many of these host microenvironments, when modeled in vitro by carbon starvation, complete nutrient starvation, stationary phase, acidic pH, reactive nitrogen intermediates, hypoxia, biofilms, and withholding streptomycin from the streptomycin-addicted strain SS18b, render M. tuberculosis profoundly tolerant to many of the antibiotics that are given to tuberculosis patients in a clinical setting. Targeting nonreplicating persisters is anticipated to reduce the duration of antibiotic treatment and rate of post-treatment relapse. Some promising drugs to treat tuberculosis, such as rifampicin and bedaquiline, only kill nonreplicating M. tuberculosis in vitro at concentrations far greater than their minimal inhibitory concentrations against replicating bacilli. There is an urgent demand to identify which of the currently used antibiotics, and which of the molecules in academic and corporate screening collections, have potent bactericidal action on nonreplicating M. tuberculosis. With this goal, we review methods of high throughput screening to target nonreplicating M. tuberculosis and methods to progress candidate molecules. A classification based on structures and putative targets of molecules that have been reported to kill nonreplicating M. tuberculosis revealed a rich diversity in pharmacophores. However, few of these compounds were tested under conditions that would exclude the impact of adsorbed compound acting during the recovery phase of

  4. Characterization of extensively drug-resistant Mycobacterium tuberculosis in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Maharjan, Bhagwan; Nakajima, Chie; Fukushima, Yukari; Pandey, Basu D; Beneke, Antje; Suzuki, Yasuhiko

    2013-01-01

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global control of TB. Although molecular characterization of drug resistance-associated mutations in multidrug-resistant isolates in Nepal has been made, mutations in XDR isolates and their genotypes have not been reported previously. In this study, we identified and characterized 13 XDR Mycobacterium tuberculosis isolates from clinical isolates in Nepal. The most prevalent mutations involved in rifampicin, isoniazid, ofloxacin, and kanamycin/capreomycin resistance were Ser531Leu in rpoB gene (92.3%), Ser315Thr in katG gene (92.3%), Asp94Gly in gyrA gene (53.9%) and A1400G in rrs gene (61.5%), respectively. Spoligotyping and multilocus sequence typing revealed that 69% belonged to Beijing family, especially modern types. Further typing with 26-loci variable number of tandem repeats suggested the current spread of XDR M. tuberculosis. Our result highlights the need to reinforce the TB policy in Nepal with regard to control and detection strategies. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  6. SUSCEPTIBILITY OF RIFAMPICIN-ISONIAZID RESISTANT MYCOBACTERIUM TUBERCULOSIS ISOLATES AGAINST LEVOFLOXACIN

    Directory of Open Access Journals (Sweden)

    A. H. Kurniawan

    2016-01-01

    Full Text Available Background: Tuberculosis (TB is a high burden disease in Indonesia with multidrug-resistant (MDR TB incidence started to increase. Treatment success of MDR-TB globally was low in number than it was targeted which was especially caused by fluoroquinolone resistance. One of the fluoroquinolone is levofloxacin, an antibiotic that has been widely used irrationally as antimicrobial treatment. Therefore, this study investigated the sensitivity and MBC of MDR Mycobacterium tuberculosis isolates against Levofloxacin. Method: The susceptibility test for MDR-Mycobacterium tuberculosis on levofloxacin by standard method with levofloxacin were on concentrations 0,5 μg/ml, 1 μg/ml, and 2 μg/ml. Sample of 8 strains MDR-Mycobacterium tuberculosis were cultured with each concentrations on Middlebrook 7H9 for 1 week incubation. Next, each of the incubated concentration was subcultured on solid media Middlebrook 7H10 for 3 weeks incubation. Colonized agar plates after 3 weeks incubation were confirmed with acid-fast stain. Results: On MB 7H10 with levofloxacin concentration 2 μg/ml showed bactericidal effect 100% by no MDR Mycobacterium tuberculosis colony grew (0/8 while the MB 7H10 with levofloxacin concentration 1 μg/ml and 0,5 μg/ml showed the bactericidal effect 37,5% and 25% respectively. The colonized agar plate implied that the MDR Mycobacterium tuberculosis with levofloxacin concentration 1 μg/ml (5/8 and 0,5 μg/ml (6/8 grew well. Conclusion: Levofloxacin concentration 2 μg/ml was susceptible on MDR Mycobacterium tuberculosis. The concentration 2 μg/ml of levofloxacin could be considered as MBC.

  7. Mycobacterium tuberculosis strains of the Beijing genotype are rarely observed in tuberculosis patients in South America.

    Science.gov (United States)

    Ritacco, Viviana; López, Beatriz; Cafrune, Patricia I; Ferrazoli, Lucilaine; Suffys, Philip N; Candia, Norma; Vásquez, Lucy; Realpe, Teresa; Fernández, Jorge; Lima, Karla V; Zurita, Jeannete; Robledo, Jaime; Rossetti, Maria L; Kritski, Afranio L; Telles, Maria A; Palomino, Juan C; Heersma, Herre; van Soolingen, Dick; Kremer, Kristin; Barrera, Lucía

    2008-08-01

    The frequency of the Beijing genotype of Mycobacterium tuberculosis as a cause of tuberculosis (TB) in South America was determined by analyzing genotypes of strains isolated from patients that had been diagnosed with the disease between 1997 and 2003 in seven countries of the subcontinent. In total, 19 of the 1,202 (1.6%) TB cases carried Beijing isolates, including 11 of the 185 patients from Peru (5.9%), five of the 512 patients from Argentina (1.0%), two of the 252 Brazilian cases (0.8%), one of the 166 patients from Paraguay (0.6%) and none of the samples obtained from Chile (35), Colombia (36) and Ecuador (16). Except for two patients that were East Asian immigrants, all cases with Beijing strains were native South Americans. No association was found between carrying a strain with the Beijing genotype and having drug or multi-drug resistant disease. Our data show that presently transmission of M. tuberculosis strains of the Beijing genotype is not frequent in Latin America. In addition, the lack of association of drug resistant TB and infection with M. tuberculosis of the Beijing genotype observed presently demands efforts to define better the contribution of the virulence and lack of response to treatment to the growing spread of Beijing strains observed in other parts of the world.

  8. Mycobacterium tuberculosis strains of the Beijing genotype are rarely observed in tuberculosis patients in South America

    Directory of Open Access Journals (Sweden)

    Viviana Ritacco

    2008-08-01

    Full Text Available The frequency of the Beijing genotype of Mycobacterium tuberculosis as a cause of tuberculosis (TB in South America was determined by analyzing genotypes of strains isolated from patients that had been diagnosed with the disease between 1997 and 2003 in seven countries of the subcontinent. In total, 19 of the 1,202 (1.6% TB cases carried Beijing isolates, including 11 of the 185 patients from Peru (5.9%, five of the 512 patients from Argentina (1.0%, two of the 252 Brazilian cases (0.8%, one of the 166 patients from Paraguay (0.6% and none of the samples obtained from Chile (35, Colombia (36 and Ecuador (16. Except for two patients that were East Asian immigrants, all cases with Beijing strains were native South Americans. No association was found between carrying a strain with the Beijing genotype and having drug or multi-drug resistant disease. Our data show that presently transmission of M. tuberculosis strains of the Beijing genotype is not frequent in Latin America. In addition, the lack of association of drug resistant TB and infection with M. tuberculosis of the Beijing genotype observed presently demands efforts to define better the contribution of the virulence and lack of response to treatment to the growing spread of Beijing strains observed in other parts of the world.

  9. In vitro susceptibility of Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium bovis, Mycobacterium avium, Mycobacterium fortuitum, and Mycobacterium chelonae to ticarcillin in combination with clavulanic acid.

    OpenAIRE

    Casal, M J; Rodriguez, F C; Luna, M D; Benavente, M C

    1987-01-01

    The in vitro susceptibility of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium avium, Mycobacterium fortuitum, and Mycobacterium chelonae (M. chelonei) to ticarcillin in combination with calvulanic acid (CA) was studied by the agar dilution method. All the M. tuberculosis, M. bovis, and M. africanum strains were inhibited at a ticarcillin concentration of 32 micrograms/ml or lower in combination with 5 micrograms of CA. M. chelonae and M. avium strains ...

  10. Structural measurements and cell line studies of the copper-PEG-Rifampicin complex against Mycobacterium tuberculosis.

    Science.gov (United States)

    Manning, Thomas; Mikula, Rachel; Wylie, Greg; Phillips, Dennis; Jarvis, Jackie; Zhang, Fengli

    2015-02-01

    The bacterium responsible for tuberculosis is increasing its resistance to antibiotics resulting in new multidrug-resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB). In this study, several analytical techniques including NMR, FT-ICR, MALDI-MS, LC-MS and UV/Vis are used to study the copper-Rifampicin-Polyethylene glycol (PEG-3350) complex. The copper (II) cation is a carrier for the antibiotic Rifampicin as well as nutrients for the bacterium. The NIH-NIAID cell line containing several Tb strains (including antibiotic resistant strains) is tested against seven copper-PEG-RIF complex variations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Delayed bactericidal response of Mycobacterium tuberculosis to bedaquiline involves remodelling of bacterial metabolism

    DEFF Research Database (Denmark)

    Koul, A.; Vranckx, L.; Dhar, N.

    2014-01-01

    Bedaquiline (BDQ), an ATP synthase inhibitor, is the first drug to be approved for treatment of multidrug-resistant tuberculosis in decades. Though BDQ has shown excellent efficacy in clinical trials, its early bactericidal activity during the first week of chemotherapy is minimal. Here, using...... microfluidic devices and time-lapse microscopy of Mycobacterium tuberculosis, we confirm the absence of significant bacteriolytic activity during the first 3-4 days of exposure to BDQ. BDQ-induced inhibition of ATP synthesis leads to bacteriostasis within hours after drug addition. Transcriptional...... and proteomic analyses reveal that M. tuberculosis responds to BDQ by induction of the dormancy regulon and activation of ATP-generating pathways, thereby maintaining bacterial viability during initial drug exposure. BDQ-induced bacterial killing is significantly enhanced when the mycobacteria are grown on non...

  12. Impact of Infection Control Measures to Control an Outbreak of Multidrug-Resistant Tuberculosis in a Human Immunodeficiency Virus Ward, Peru

    Science.gov (United States)

    Ticona, Eduardo; Huaroto, Luz; Kirwan, Daniela E.; Chumpitaz, Milagros; Munayco, César V.; Maguiña, Mónica; Tovar, Marco A.; Evans, Carlton A.; Escombe, Roderick; Gilman, Robert H.

    2016-01-01

    Multidrug-resistant tuberculosis (MDRTB) rates in a human immunodeficiency virus (HIV) care facility increased by the year 2000—56% of TB cases, eight times the national MDRTB rate. We reported the effect of tuberculosis infection control measures that were introduced in 2001 and that consisted of 1) building a respiratory isolation ward with mechanical ventilation, 2) triage segregation of patients, 3) relocation of waiting room to outdoors, 4) rapid sputum smear microscopy, and 5) culture/drug–susceptibility testing with the microscopic-observation drug-susceptibility assay. Records pertaining to patients attending the study site between 1997 and 2004 were reviewed. Six hundred and fifty five HIV/TB–coinfected patients (mean age 33 years, 79% male) who attended the service during the study period were included. After the intervention, MDRTB rates declined to 20% of TB cases by the year 2004 (P = 0.01). Extremely limited access to antiretroviral therapy and specific MDRTB therapy did not change during this period, and concurrently, national MDRTB prevalence increased, implying that the infection control measures caused the fall in MDRTB rates. The infection control measures were estimated to have cost US$91,031 while preventing 97 MDRTB cases, potentially saving US$1,430,026. Thus, this intervention significantly reduced MDRTB within an HIV care facility in this resource-constrained setting and should be cost-effective. PMID:27621303

  13. Comparative analysis of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis – Epidemiology and predictive factors

    Directory of Open Access Journals (Sweden)

    Ana Sofia Vilariça

    2008-11-01

    Full Text Available Introduction: Extensively drug-resistant tuberculosis (XDR-TB is defined as a form of multidrug-resistant tuberculosis (MDR-TB with additional resistance to fluoroquinolones and at least one of the injectable drugs used in tuberculosis treatment: amikacin, kanamycin and capreomycin. It was classified by WHO as a serious threat to tuberculosis (TB control, with world-wide consequences, taking on the proportions of a real pandemic in some regions. Aim: To compare patients with XDR-TB versus other MDR-TB profiles with regard to epidemiological and demographic characteristics, aetiopathogenic factors and inhospital outcomes. Methods: Patients admitted to Pulido Valente Hospital (Pulmonology Service III in the period ranging from April 1999 to June 2007 with MDR-TB diagnosis microbiologically confirmed. The following variables were evaluated: gender, age, race, forms of TB presentation, treatment groups, resistance profile, immigrant status, number and duration of previous treatments, WHO classification, HIV co-infection, alcoholism and/or drug addiction, average length of hospital stay and inhospital mortality.Statistical analysis was performed using the SPSS (Statistical Package for the Social Sciences, version 15.0. In categorical variables, the statistical differences between groups were evaluated by the Chisquare test and numeric variables using the T-test. Logistical regression analysis was used to build the predictive model of XDR-TB existence (dependent variable, which included the following independent variables: WHO classification, HIV co-infection, immigrant status, alcoholism and/or drug addiction and number and duration of previous treatments. Results: We recorded 132 patients with MDR-TB, of which 69 (52.3% were XDR-TB. Statistically significant differences were observed in the following variables: race (black race was associated with XDRTB in 74% of cases versus 46% of the Caucasian race; WHO classification (patients with retreatment

  14. Laboratory Diagnosis and Susceptibility Testing for Mycobacterium tuberculosis.

    Science.gov (United States)

    Procop, Gary W

    2016-12-01

    The laboratory, which utilizes some of the most sophisticated and rapidly changing technologies, plays a critical role in the diagnosis of tuberculosis. Some of these tools are being employed in resource-challenged countries for the rapid detection and characterization of Mycobacterium tuberculosis. Foremost, the laboratory defines appropriate specimen criteria for optimal test performance. The direct detection of mycobacteria in the clinical specimen, predominantly done by acid-fast staining, may eventually be replaced by rapid-cycle PCR. The widespread use of the Xpert MTB/RIF (Cepheid) assay, which detects both M. tuberculosis and key genetic determinants of rifampin resistance, is important for the early detection of multidrug-resistant strains. Culture, using both broth and solid media, remains the standard for establishing the laboratory-based diagnosis of tuberculosis. Cultured isolates are identified far less commonly by traditional biochemical profiling and more commonly by molecular methods, such as DNA probes and broad-range PCR with DNA sequencing. Non-nucleic acid-based methods of identification, such as high-performance liquid chromatography and, more recently, matrix-assisted laser desorption/ionization-time of flight mass spectrometry, may also be used for identification. Cultured isolates of M. tuberculosis should be submitted for susceptibility testing according to standard guidelines. The use of broth-based susceptibility testing is recommended to significantly decrease the time to result. Cultured isolates may also be submitted for strain typing for epidemiologic purposes. The use of massive parallel sequencing, also known as next-generation sequencing, promises to continue to this molecular revolution in mycobacteriology, as whole-genome sequencing provides identification, susceptibility, and typing information simultaneously.

  15. Social support received by multidrug-resistant tuberculosis patients and related factors: a cross-sectional study in Zhejiang Province, People's Republic of China

    Directory of Open Access Journals (Sweden)

    Chen B

    2016-06-01

    Full Text Available Bin Chen,1 Yin Peng,1 Lin Zhou,1 Chengliang Chai,1 Hui-Chi Yeh,2 Songhua Chen,1 Fei Wang,1 Mingwu Zhang,1 Tieniu He,1 Xiaomeng Wang1 1Department of Tuberculosis Control and Prevention, Zhejiang Provincial Center for Disease Control and Prevention, Binjiang District, Hangzhou, People’s Republic of China; 2Politics & International Relations, Social Sciences, University of Southampton, Southampton, UK Objectives: The objective of this study is to assess the social support received by patients diagnosed with multidrug-resistant tuberculosis (MDR-TB in Zhejiang Province, People’s Republic of China and the factors that may have influenced it. Methods: A total of 220 MDR-TB patients participated in the questionnaire-based survey, and the data from 212 valid questionnaires were analyzed. The respondents reported their sociodemographic status, disease features, and attitudes toward the disease. The social support rating scale was used to measure the patients’ social support scores. An Independent Samples t-test, one-way analysis of variance, and a multiple linear regression model were used to analyze the related factors for the social support scores. Result: The average social support score of each MDR-TB patient was 32.56±7.86. Participants who were single, widowed or divorced, retired, and had fewer family members and lower family income were found to have lower social support scores. Participants unwilling to disclose their disease tended to have less social support (31.59<34.23, P=0.010. Participants who perceived great help from health care workers reported higher social support rating scale scores than those who perceived no help (35.36>29.89, P=0.014. Conclusion: MDR-TB patients in Zhejiang Province were shown to have a low level of social support. Patients who were not married, had smaller families, and lower family income received less social support, suggesting that family harmony could be an important source of social support. Patients

  16. Mycobacterium tuberculosis monoarthritis in a child

    Directory of Open Access Journals (Sweden)

    Rosenberg Alan M

    2008-09-01

    Full Text Available Abstract A child with isolated Mycobacterium tuberculosis monoarthritis, with features initially suggesting oligoarthritis subtype of juvenile idiopathic arthritis, is presented. This patient illustrates the need to consider the possibility of tuberculosis as the cause of oligoarthritis in high-risk pediatric populations even in the absence of a tuberculosis contact history and without evidence of overt pulmonary disease.

  17. Drug resistance-related mutations in multidrug-resistant Mycobacterium tuberculosis isolates from diverse geographical regions

    Directory of Open Access Journals (Sweden)

    Senia Rosales-Klintz

    2012-01-01

    Conclusion: This study confirms that there are significant geographical differences in the distribution of resistance-related mutations and suggests that an increased understanding of such differences in the specific distribution of resistance conferring mutations is crucial for development of new, generally applicable, molecular tools for rapid diagnosis of drug-resistant TB. The fact that a narrower distribution of mutations in high MDR-TB prevalence settings was seen suggests that much of the problems in these settings can be a result of an ongoing transmission of certain MDR-TB strains.

  18. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    OpenAIRE

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN), Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laborat...

  19. Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

    Science.gov (United States)

    Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

    2007-12-01

    Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

  20. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  1. Comparative Mycobacteriology of the Mycobacterium tuberculosis complex

    OpenAIRE

    Gordon, Stephen V.; Behr, Marcel A.

    2015-01-01

    The Mycobacterium tuberculosis complex (MTBC) is a group of highly genetically related pathogens that cause tuberculosis (TB) in mammalian species. However, the very name of the complex underlines the fact that our knowledge of these pathogens is dominated by studies on the human pathogen, M. tuberculosis. Of course this is entirely justified; M. tuberculosis is a major global pathogen that exacts a horrendous burden in terms of mortality and morbidity so it is appropriate that it is...

  2. [Resistance to first-line drugs and major genotypic lineages of Mycobacterium tuberculosis in the 3 French Department of the Americas: Profiles, evolution, and trends (1995-2011)].

    Science.gov (United States)

    Millet, J; Berchel, M; Prudenté, F; Streit, E; Bomer, A-G; Schuster, F; Vanhomwegen, J; Paasch, D; Galbert, I; Valery, E; Aga, R; Rastogi, N

    2014-05-01

    This is the first overview on resistant and multidrug resistant isolates of Mycobacterium tuberculosis circulating in the French Department of the Americas (Guadeloupe, Martinique, and French Guiana) over 17 years (January 1995-December 2011). A total of 1,239 cases were studied: 1,199 new cases (primary and multidrug resistance of 11.8 and 1.6% respectively), and 40 persistent (defined as cases with a previous history of positive culture over 6 months interval and whose spoligotypes remain unchanged), in which significantly higher proportions of resistance to at least isoniazid (22.5%, P = 0.002), rifampicin (20.0%, P < 0.001), and multidrug resistance (17.5%, P < 0.001) were observed as compared to new cases. The 281 spoligotypes obtained showed the presence of five major lineages, T (29.9%), LAM (23.9%), Haarlem (22.1%), EAI (7.1%), and X (6.7%). Two of these lineages, X and LAM, predominate among resistant and multidrug resistant isolates respectively (X: 10.5% of resistant isolates, P = 0.04; LAM: 42.3% of multidrug resistant isolates, P = 0.02). Four of the 19 major spoligo-profiles, corresponding to SIT 20, 64, 45, and 46, were significantly associated with drug resistance. Among them, genotype SIT 20, associated with monoresistance to isoniazid and multidrug resistance, would be actively and persistently in circulation, since 1999, in French Guiana, department in which one may also observe the presence of strains of M. tuberculosis phylogeographically associated to Guiana and Suriname (SIT 131 and SIT 1340).

  3. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol.

    Science.gov (United States)

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-10-17

    Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This evaluation is innovative as it combines patient and health system costs, as well as operational modelling in assessing the impact. An economic evaluation nested in a clinical trial with 2 arms will be performed at 4 facilities. The primary outcome measure is incremental cost to the health system of the study regimen compared with the control regimen. Secondary outcome measures are mean incremental costs incurred by patients by treatment outcome; patient costs by category (direct medical costs, transport, food and accommodation costs, and cost of guardians/accompanying persons and lost time); health systems cost by category and drugs; and costs related to serious adverse events. The study has been evaluated and approved by the Ethics Advisory Group of the International Union Against Tuberculosis and Lung Disease; South African Medical Research Ethics Committee; Wits Health Consortium Protocol Review Committee; University of the Witwatersrand Human Research Ethics Committee; University of Kwazulu-Natal Biomedical Research Ethics Committee; St Peter TB Specialized Hospital Ethical Review Committee; AHRI-ALERT Ethical Review Committee, and all participants will provide written informed consent. The results of the economic evaluation will be published in a peer-reviewed journal. ISRCTN78372190. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  4. Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.

    Science.gov (United States)

    Merker, Matthias; Blin, Camille; Mona, Stefano; Duforet-Frebourg, Nicolas; Lecher, Sophie; Willery, Eve; Blum, Michael G B; Rüsch-Gerdes, Sabine; Mokrousov, Igor; Aleksic, Eman; Allix-Béguec, Caroline; Antierens, Annick; Augustynowicz-Kopeć, Ewa; Ballif, Marie; Barletta, Francesca; Beck, Hans Peter; Barry, Clifton E; Bonnet, Maryline; Borroni, Emanuele; Campos-Herrero, Isolina; Cirillo, Daniela; Cox, Helen; Crowe, Suzanne; Crudu, Valeriu; Diel, Roland; Drobniewski, Francis; Fauville-Dufaux, Maryse; Gagneux, Sébastien; Ghebremichael, Solomon; Hanekom, Madeleine; Hoffner, Sven; Jiao, Wei-wei; Kalon, Stobdan; Kohl, Thomas A; Kontsevaya, Irina; Lillebæk, Troels; Maeda, Shinji; Nikolayevskyy, Vladyslav; Rasmussen, Michael; Rastogi, Nalin; Samper, Sofia; Sanchez-Padilla, Elisabeth; Savic, Branislava; Shamputa, Isdore Chola; Shen, Adong; Sng, Li-Hwei; Stakenas, Petras; Toit, Kadri; Varaine, Francis; Vukovic, Dragana; Wahl, Céline; Warren, Robin; Supply, Philip; Niemann, Stefan; Wirth, Thierry

    2015-03-01

    Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiated worldwide in several waves. We detected successive increases in population size for this pathogen over the last 200 years, practically coinciding with the Industrial Revolution, the First World War and HIV epidemics. Two MDR clones of this lineage started to spread throughout central Asia and Russia concomitantly with the collapse of the public health system in the former Soviet Union. Mutations identified in genes putatively under positive selection and associated with virulence might have favored the expansion of the most successful branches of the lineage.

  5. Functional drug screening reveals anticonvulsants as enhancers of mTOR-independent autophagic killing of Mycobacterium tuberculosis through inositol depletion.

    Science.gov (United States)

    Schiebler, Mark; Brown, Karen; Hegyi, Krisztina; Newton, Sandra M; Renna, Maurizio; Hepburn, Lucy; Klapholz, Catherine; Coulter, Sarah; Obregón-Henao, Andres; Henao Tamayo, Marcela; Basaraba, Randall; Kampmann, Beate; Henry, Katherine M; Burgon, Joseph; Renshaw, Stephen A; Fleming, Angeleen; Kay, Robert R; Anderson, Karen E; Hawkins, Phillip T; Ordway, Diane J; Rubinsztein, David C; Floto, Rodrigo Andres

    2015-02-01

    Mycobacterium tuberculosis (MTB) remains a major challenge to global health made worse by the spread of multidrug resistance. We therefore examined whether stimulating intracellular killing of mycobacteria through pharmacological enhancement of macroautophagy might provide a novel therapeutic strategy. Despite the resistance of MTB to killing by basal autophagy, cell-based screening of FDA-approved drugs revealed two anticonvulsants, carbamazepine and valproic acid, that were able to stimulate autophagic killing of intracellular M. tuberculosis within primary human macrophages at concentrations achievable in humans. Using a zebrafish model, we show that carbamazepine can stimulate autophagy in vivo and enhance clearance of M. marinum, while in mice infected with a highly virulent multidrug-resistant MTB strain, carbamazepine treatment reduced bacterial burden, improved lung pathology and stimulated adaptive immunity. We show that carbamazepine induces antimicrobial autophagy through a novel, evolutionarily conserved, mTOR-independent pathway controlled by cellular depletion of myo-inositol. While strain-specific differences in susceptibility to in vivo carbamazepine treatment may exist, autophagy enhancement by repurposed drugs provides an easily implementable potential therapy for the treatment of multidrug-resistant mycobacterial infection. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  6. Radiographic differentiation of atypical tuberculosis from mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Tarver, R.D.; Pearcy, E.A.; Conces, D.J. Jr.; Mathur, P.N.

    1987-01-01

    The chest radiographs of 95 patients with the new diagnosis of atypical turberculosis were reviewed to determine if any significant differences between atypical tuberculosis and that caused by Mycobacterium tuberculosis could be discerned. Findings included upper lobe involvement in B4 of the 95 patients and cavities in 76, with nearly equal groups having no, moderate, or extensive surrounding alveolar disease. Nodules were common; in six patients a nodule was the sole manifestation of disease. Adenopathy was seen in 12 of the 95 patients, atlectasis in 45, pleural thickening in 90, and effusions in three. These radiographic findings did not allow the radiographic differentiation of atypical tuberculosis from Mycobacterium tuberculosis infection

  7. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  8. Polymorphisms of twenty regulatory proteins between Mycobacterium tuberculosis and Mycobacterium bovis

    Science.gov (United States)

    Mycobacterium tuberculosis and Mycobacterium bovis are responsible for tuberculosis in humans or animals, respectively. Both species are closely related and belong to the Mycobacterium tuberculosis complex (MTC). M. tuberculosis is the most ancient species from which M. bovis and the other members o...

  9. Multidrug-Resistant Candida

    DEFF Research Database (Denmark)

    Arendrup, Maiken Cavling; Patterson, Thomas F

    2017-01-01

    Invasive Candida infections remain an important cause of morbidity and mortality, especially in hospitalized and immunocompromised or critically ill patients. A limited number of antifungal agents from only a few drug classes are available to treat patients with these serious infections. Resistance...... can be either intrinsic or acquired. Resistance mechanisms are not exchanged between Candida; thus, acquired resistance either emerges in response to an antifungal selection pressure in the individual patient or, more rarely, occur due to horizontal transmission of resistant strains between patients....... Although multidrug resistance is uncommon, increasing reports of multidrug resistance to the azoles, echinocandins, and polyenes have occurred in several Candida species, most notably Candida glabrata and more recently Candida auris. Drivers are overall antifungal use, subtherapeutic drug levels at sites...

  10. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  11. Assessment of trends of ofloxacin resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    J S Verma

    2011-01-01

    Full Text Available Purpose: Ofloxacin (OFX is one of the potent fluoroquinolone (FQ recommended to treat MDR-TB. Over a decade, the preexposure of this drug for the treatment of other bacterial infections has resulted in acquisition of FQ resistance among Mycobacterium tuberculosis strains. Considering this possibility, a study was undertaken in a tertiary care center in the capital city (India to assess the drug resistance trends of OFX among susceptible and multidrug resistant (MDR strains of M. tuberculosis. Materials and Methods: A total of 102 M. tuberculosis isolates (47 susceptible to first-line drugs and 55 MDR isolates were screened for susceptibility testing of OFX with a critical concentration of 2 μg/ml by Lowenstein Jensen (LJ proportion method. Results: The results showed 40 (85.1% isolates among 47 susceptible isolates and 34 (61.8% isolates among 55 MDR isolates, were found to be susceptible to OFX. Fisher′s exact test showed significant P-value (0.0136 demonstrating 1.377 fold (95% confidence interval increased risk to become resistant to OFX than susceptible isolates. These finding shows decreased OFX susceptibility is not only limited to MDR isolates but also increasingly seen in susceptible strains as a result of drug abuse. Conclusions: Our finding were not alarming, but highlights the general risk of acquiring resistance to OFX, jeopardizing the potential for these drugs to be used as second-line anti-TB agents in the management of drug-resistant TB and creating incurable TB strains .

  12. Potential Inhibitors for Isocitrate Lyase of Mycobacterium tuberculosis and Non-M. tuberculosis: A Summary

    Directory of Open Access Journals (Sweden)

    Yie-Vern Lee

    2015-01-01

    Full Text Available Isocitrate lyase (ICL is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle, especially Mycobacterium tuberculosis (MTB. In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a MTB ICL with natural compounds; (b MTB ICL with synthetic compounds; (c non-MTB ICL with natural compounds; and (d non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL.

  13. Detection of Mycobacterium Tuberculosis by using PCR

    International Nuclear Information System (INIS)

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  14. Safety assessment in primary Mycobacterium tuberculosis smear ...

    African Journals Online (AJOL)

    Introduction Tuberculosis (TB) is caused by Mycobacterium tuberculosis and is transmitted mainly through aerosolization of infected sputum which puts laboratory workers at risk in spite of the laboratory workersf risk of infection being at 3 to 9 times higher than the general public. Laboratory safety should therefore be ...

  15. Peritoneal tuberculosis due to Mycobacterium caprae

    Directory of Open Access Journals (Sweden)

    T. Nebreda

    2016-01-01

    Full Text Available The incidence of tuberculosis in humans due to Mycobacterium caprae is very low and is almost confined to Europe. We report a case of a previously healthy 41-year-old Moroccan with a 6 month history of abdominal pain, weight loss, fatigue and diarrhea. A diagnosis of peritoneal tuberculosis due to M. caprae was made.

  16. Modelling the Transitional Dynamics of Mycobacterium Tuberculosis ...

    African Journals Online (AJOL)

    The World Health Organization's targets of eliminating Tuberculosis (TB) by 2050 is challenged by the emergence and spread of drug resistance TB. However, the traditional mechanism of resistance is that of acquired resistance, whereby the mycobacterium Tuberculosis (MTB) strain develops mutations under selective ...

  17. Effect of a comprehensive programme to provide universal access to care for sputum-smear-positive multidrug-resistant tuberculosis in China: a before-and-after study.

    Science.gov (United States)

    Li, Renzhong; Ruan, Yunzhou; Sun, Qiang; Wang, Xiexiu; Chen, Mingting; Zhang, Hui; Zhao, Yanlin; Zhao, Jin; Chen, Cheng; Xu, Caihong; Su, Wei; Pang, Yu; Cheng, Jun; Chi, Junying; Wang, Qian; Fu, Yunting; Huan, Shitong; Wang, Lixia; Wang, Yu; Chin, Daniel P

    2015-04-01

    China has a quarter of all patients with multidrug-resistant tuberculosis (MDRTB) worldwide, but less than 5% are in quality treatment programmes. In a before-and-after study we aimed to assess the effect of a comprehensive programme to provide universal access to diagnosis, treatment, and follow-up for MDRTB in four Chinese cities (population 18 million). We designated city-level hospitals in each city to diagnose and treat MDRTB. All patients with smear-positive pulmonary tuberculosis diagnosed in Center for Disease Control (CDC) clinics and hospitals were tested for MDRTB with molecular and conventional drug susceptibility tests. Patients were treated with a 24 month treatment package for MDRTB based on WHO guidelines. Outpatients were referred to the CDC for directly observed therapy. We capped total treatment package cost at US$4644. Insurance reimbursement and project subsidies limited patients' expenses to 10% of charges for services within the package. We compared data from a 12 month programme period (2011) to those from a retrospective survey of all patients with MDRTB diagnosed in the same cities during a baseline period (2006-09). 243 patients were diagnosed with MDRTB or rifampicin-resistant tuberculosis during the 12 month programme period compared with 92 patients (equivalent to 24 per year) during the baseline period. 172 (71%) of 243 individuals were enrolled in the programme. Time from specimen collection for resistance testing to treatment initiation decreased by 90% (from median 139 days [IQR 69-207] to 14 days [10-21]), the proportion of patients who started on appropriate drug regimen increased 2·7 times (from nine [35%] of 26 patients treated to 166 [97%] of 172), and follow-up by the CDC after initial hospitalisation increased 24 times (from one [4%] of 23 patients to 163 [99%] of 164 patients). 6 months after starting treatment, the proportion of patients remaining on treatment increased ten times (from two [8%] of 26 patients to 137 [80

  18. Peripheral neuropathy in a diabetic child treated with linezolid for multidrug-resistant tuberculosis: a case report and review of the literature.

    Science.gov (United States)

    Swaminathan, Aravind; du Cros, Philipp; Seddon, James A; Mirgayosieva, Shamsiya; Asladdin, Rajabov; Dusmatova, Zulfiya

    2017-06-12

    Extensively drug-resistant (XDR) tuberculosis (TB) and multidrug resistant (MDR)-TB with additional resistance to injectable agents or fluoroquinolones are challenging to treat due to lack of available, effective drugs. Linezolid is one of the few drugs that has shown promise in treating these conditions. Long-term linezolid use is associated with toxicities such as peripheral and optic neuropathies. Diabetes mellitus (DM), especially when uncontrolled, can also result in peripheral neuropathy. The global burden of DM is increasing, and DM has been associated with a three-fold increased risk of developing TB disease. TB and DM can be a challenging combination to treat. DM can inhibit the host immune response to tuberculosis infection; and TB and some anti-TB drugs can worsen glycaemic control. A child experiencing neuropathy that is a possible complication of both DM and linezolid used to treat TB has not been reported previously. We report peripheral neuropathy in a 15-year-old boy with type 1 DM, diagnosed with MDR-TB and additional resistance to injectable TB medications. The boy was treated with a linezolid-based regimen, but after 8 months developed peripheral neuropathy. It was unclear whether the neuropathy was caused by the DM or the linezolid therapy. He had clinical improvement following cessation of linezolid and was declared cured following 21 months of treatment. Following completion of treatment, nerve conduction studies demonstrated significant improvement in neuropathy. To the best of our knowledge, this is the first case of peripheral neuropathy reported in a diabetic child on long-term linezolid therapy for tuberculosis. This case study underlines the importance of stringent follow-up for side effects of linezolid, especially when associated with co-morbidity such as DM that increases the chances of adverse effects. The presence of both DM and TB should alert a physician to strive for optimal glycaemic control to minimize the risk of

  19. Evaluation of the microscopic observational drug susceptibility assay for rapid and efficient diagnosis of multi-drug resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    R P Lazarus

    2012-01-01

    Full Text Available Purpose: Tuberculosis (TB is endemic in India and the burden of multi-drug-resistant tuberculosis (MDR-TB is high. Early detection of MDR-TB is of primary importance in controlling the spread of TB. The microscopic observational drug susceptibility (MODS assay has been described as a cost-effective and rapid method by which mycobacterial culture and the drug susceptibility test (DST can be done at the same time. Materials and Methods: A total of 302 consecutive sputum samples that were received in an accredited mycobacteriology laboratory for conventional culture and DST were evaluated by the MODS assay. Results: In comparison with conventional culture on Lowenstein Jensen (LJ media, the MODS assay showed a sensitivity of 94.12% and a specificity of 89.39% and its concordance with the DST by the proportion method on LJ media to isoniazid and rifampicin was 90.8% and 91.5%, respectively. The turnaround time for results by MODS was 9 days compared to 21 days by culture on LJ media and an additional 42 days for DST by the 1% proportion method. The cost of performing a single MODS assay was Rs. 250/-, compared to Rs. 950/- for culture and 1st line DST on LJ. Conclusion: MODS was found to be a sensitive and rapid alternative method for performing culture and DST to identify MDR-TB in resource poor settings.

  20. Outcomes of multidrug-resistant tuberculosis treatment with early initiation of antiretroviral therapy for HIV co-infected patients in Lesotho.

    Directory of Open Access Journals (Sweden)

    Hind Satti

    Full Text Available BACKGROUND: Although the importance of concurrent treatment for multidrug-resistant tuberculosis (MDR-TB and HIV co-infection has been increasingly recognized, there have been few studies reporting outcomes of MDR-TB and HIV co-treatment. We report final outcomes of comprehensive, integrated MDR-TB and HIV treatment in Lesotho and examine factors associated with death or treatment failure. METHODS: We reviewed clinical charts of all adult patients who initiated MDR-TB treatment in Lesotho between January 2008 and September 2009. We calculated hazard ratios (HR and used multivariable Cox proportional hazards regression to identify predictors of poor outcomes. RESULTS: Of 134 confirmed MDR-TB patients, 83 (62% were cured or completed treatment, 46 (34% died, 3 (2% transferred, 1 (1% defaulted, and 1 (1% failed treatment. Treatment outcomes did not differ significantly by HIV status. Among the 94 (70% patients with HIV co-infection, 53% were already on antiretroviral therapy (ART before MDR-TB treatment initiation, and 43% started ART a median of 16 days after the start of the MDR-TB regimen. Among HIV co-infected patients who died, those who had not started ART before MDR-TB treatment had a shorter median time to death (80 days vs. 138 days, p=0.065. In multivariable analysis, predictors of increased hazard of failure or death were low and severely low body mass index (HR 2.75, 95% confidence interval [CI] 1.27-5.93; HR 5.50, 95% CI 2.38-12.69, and a history of working in South Africa (HR 2.37, 95% CI 1.24-4.52. CONCLUSIONS: Favorable outcomes can be achieved in co-infected patients using a community-based treatment model when both MDR-TB and HIV disease are treated concurrently and treatment is initiated promptly.

  1. Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

    Directory of Open Access Journals (Sweden)

    Anand Kumar Maurya

    2013-01-01

    Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

  2. The relationship between social support, treatment interruption and treatment outcome in patients with multidrug-resistant tuberculosis in China: a mixed-methods study.

    Science.gov (United States)

    Yin, Jia; Wang, Xiaomeng; Zhou, Lin; Wei, Xiaolin

    2018-04-24

    Multidrug-resistant tuberculosis (MDR-TB) has been a major threat for successful TB control. We examined the relationship between social support and treatment outcomes in MDR-TB patients and evaluated barriers to social support. Retrospective cohort study with MDR-TB patients enrolled in the Global Fund program between 1 January 2009 and 30 June 2014 in Zhejiang, China. We reviewed all MDR-TB patients' diagnoses and treatment outcomes. In-depth interviews were conducted with 10 community health workers and 10 patients. Pathway analysis was employed to examine the association between social support and treatment outcomes, and the mediating effect of medication adherence on their relationship. Of 218 participants, 144 (66%) were successfully treated and 59 (27%) had poor treatment adherence. Directly observed therapy (DOT) had an indirect positive effect on treatment success, mediating through medication adherence (β.=0.541, p=0.008; β =0.538, p<0.001). Financial support had both a direct (β.=0.769, p<0.001) and an indirect positive effect on treatment success, which was mediated by a self-reported social support scale (β.=0.541, p=0.008; β =0.538, p<0.001). The interviews indicated poor performance of DOT. Patients often suffered from substantial stigma, but were not provided with psychological support. DOT and financial support were effective strategies for improving successful treatment outcomes in MDR-TB patients, but they were delivered not considering patients' perspectives. There is an urgent need for consistent and specific psychological support for MDR-TB patients in their communities. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Host immunity to Mycobacterium tuberculosis and risk of tuberculosis

    DEFF Research Database (Denmark)

    Michelsen, Sascha Wilk; Soborg, Bolette; Agger, Else-Marie

    2016-01-01

    BACKGROUND: Human immune responses to latent Mycobacterium tuberculosis (Mtb) infection (LTBI) may enable individuals to control Mtb infection and halt progression to tuberculosis (TB), a hypothesis applied in several novel TB vaccines. We aimed to evaluate whether immune responses to selected LTBI...

  4. In vitro and in vivo activities of the nitroimidazole TBA-354 against Mycobacterium tuberculosis.

    Science.gov (United States)

    Upton, A M; Cho, S; Yang, T J; Kim, Y; Wang, Y; Lu, Y; Wang, B; Xu, J; Mdluli, K; Ma, Z; Franzblau, S G

    2015-01-01

    Nitroimidazoles are a promising new class of antitubercular agents. The nitroimidazo-oxazole delamanid (OPC-67683, Deltyba) is in phase III trials for the treatment of multidrug-resistant tuberculosis, while the nitroimidazo-oxazine PA-824 is entering phase III for drug-sensitive and drug-resistant tuberculosis. TBA-354 (SN31354[(S)-2-nitro-6-((6-(4-trifluoromethoxy)phenyl)pyridine-3-yl)methoxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine]) is a pyridine-containing biaryl compound with exceptional efficacy against chronic murine tuberculosis and favorable bioavailability in preliminary rodent studies. It was selected as a potential next-generation antituberculosis nitroimidazole following an extensive medicinal chemistry effort. Here, we further evaluate the pharmacokinetic properties and activity of TBA-354 against Mycobacterium tuberculosis. TBA-354 is narrow spectrum and bactericidal in vitro against replicating and nonreplicating Mycobacterium tuberculosis, with potency similar to that of delamanid and greater than that of PA-824. The addition of serum protein or albumin does not significantly alter this activity. TBA-354 maintains activity against Mycobacterium tuberculosis H37Rv isogenic monoresistant strains and clinical drug-sensitive and drug-resistant isolates. Spontaneous resistant mutants appear at a frequency of 3 × 10(-7). In vitro studies and in vivo studies in mice confirm that TBA-354 has high bioavailability and a long elimination half-life. In vitro studies suggest a low risk of drug-drug interactions. Low-dose aerosol infection models of acute and chronic murine tuberculosis reveal time- and dose-dependent in vivo bactericidal activity that is at least as potent as that of delamanid and more potent than that of PA-824. Its superior potency and pharmacokinetic profile that predicts suitability for once-daily oral dosing suggest that TBA-354 be studied further for its potential as a next-generation nitroimidazole. Copyright © 2015, American

  5. Preclinical Testing of the Nitroimidazopyran PA-824 for Activity against Mycobacterium tuberculosis in a Series of In Vitro and In Vivo Models

    OpenAIRE

    Lenaerts, Anne J.; Gruppo, Veronica; Marietta, Karen S.; Johnson, Christine M.; Driscoll, Diane K.; Tompkins, Nicholas M.; Rose, Jerry D.; Reynolds, Robert C.; Orme, Ian M.

    2005-01-01

    This study extends earlier reports regarding the in vitro and in vivo efficacies of the nitroimidazopyran PA-824 against Mycobacterium tuberculosis. PA-824 was tested in vitro against a broad panel of multidrug-resistant clinical isolates and was found to be highly active against all isolates (MIC < 1 μg/ml). The activity of PA-824 against M. tuberculosis was also assessed grown under conditions of oxygen depletion. PA-824 showed significant activity at 2, 10, and 50 μg/ml, similar to that of...

  6. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  7. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  8. Mycobacterial diversity causing multi- and extensively drug-resistant tuberculosis in Djibouti, Horn of Africa.

    Science.gov (United States)

    Millán-Lou, M I; Ollé-Goig, J E; Tortola, M T; Martin, C; Samper, S

    2016-02-01

    On detecting a high prevalence of multidrug-resistant tuberculosis (TB) in Djibouti, 32 Mycobacterium tuberculosis isolates of patients hospitalised in the TB referral centre of the capital were genotyped. A high variety of M. tuberculosis lineages, including lineage 1, Indo-Oceanic, lineage 2, East-Asian, lineage 3, East-African Indian and lineage 4, Euro-American, were detected.

  9. Infection caused by Mycobacterium tuberculosis.

    Science.gov (United States)

    Peloquin, C A; Berning, S E

    1994-01-01

    To update readers on the clinical management of infections caused by Mycobacterium tuberculosis, to provide a general description of the organism, culture and susceptibility testing, and clinical manifestations of the disease, and to provide several aspects of the treatment of the disease, including historical perspective, current approaches, and research opportunities for the future. The current medical literature, including abstracts presented at recent international meetings, is reviewed. References were identified through MEDLINE, MEDLARS II, Current Contents, and published meeting abstracts. Data regarding the epidemiology, clinical manifestations, culture and susceptibility testing, and treatment of tuberculosis are cited. Specific attention has been focused on the clinical management of patients with noncontagious infection and potentially contagious active disease (TB) caused by M. tuberculosis. Information contributing to the discussion of the topics selected by the authors is reviewed. Data supporting and disputing specific conclusions are presented. The incidence of TB is increasing in the US, despite the fact that available technologies are capable of controlling the vast majority of existing cases. Fueling the fire is the problem of coinfection with HIV and M. tuberculosis. Very few drugs are available for the treatment of TB, and few of these approach the potency of isoniazid and rifampin. Preventive therapy of patients exposed to multiple-drug-resistant M. tuberculosis (MDR-TB) is controversial and of unknown efficacy. Treatment of active disease caused by MDR-TB requires up to four times longer, is associated with increased toxicity, and is far less successful than the treatment of drug-susceptible TB. Strategies for the management of such cases are presented. The rising incidence of TB in the US reflects a breakdown in the healthcare systems responsible for controlling the disease, which reflects the past budgetary reductions. Although TB control

  10. INHIBITION OF MYCOLIC ACID TRANSPORT ACROSS THE MYCOBACTERIUM TUBERCULOSIS PLASMA MEMBRANE

    Science.gov (United States)

    Grzegorzewicz, Anna E.; Pham, Ha; Gundi, Vijay A. K. B.; Scherman, Michael S.; North, Elton J.; Hess, Tamara; Jones, Victoria; Gruppo, Veronica; Born, Sarah E. M.; Korduláková, Jana; Chavadi, Sivagami Sundaram; Morisseau, Christophe; Lenaerts, Anne J.; Lee, Richard E.; McNeil, Michael R.; Jackson, Mary

    2011-01-01

    New chemotherapeutics active against multidrug-resistant Mycobacterium tuberculosis (M. tb) are urgently needed. We report on the identification of an adamantyl urea compound displaying potent bactericidal activity against M. tb and a unique mode of action, namely the abolition of the translocation of mycolic acids from the cytoplasm where they are synthesized to the periplasmic side of the plasma membrane where they are transferred onto cell wall arabinogalactan or used in the formation of virulence-associated outer membrane trehalose-containing glycolipids. Whole genome sequencing of spontaneous resistant mutants of M. tb selected in vitro followed by genetic validation experiments revealed that our prototype inhibitor targets the inner membrane transporter, MmpL3. Conditional gene expression of mmpL3 in mycobacteria and analysis of inhibitor-treated cells validate MmpL3 as essential for mycobacterial growth and support the involvement of this transporter in the translocation of trehalose monomycolate across the plasma membrane. PMID:22344175

  11. A field evaluation of the Hardy TB MODS Kit™ for the rapid phenotypic diagnosis of tuberculosis and multi-drug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Laura Martin

    Full Text Available Even though the WHO-endorsed, non-commercial MODS assay offers rapid, reliable TB liquid culture and phenotypic drug susceptibility testing (DST at lower cost than any other diagnostic, uptake has been patchy. In part this reflects misperceptions about in-house assay quality assurance, but user convenience of one-stop procurement is also important. A commercial MODS kit was developed by Hardy Diagnostics (Santa Maria, CA, USA with PATH (Seattle, WA, USA to facilitate procurement, simplify procedures through readymade media, and enhance safety with a sealing silicone plate lid. Here we report the results from a large-scale field evaluation of the MODS kit in a government service laboratory.2446 sputum samples were cultured in parallel in Lowenstein-Jensen (LJ, conventional MODS and in the MODS kit. MODS kit DST was compared with conventional MODS (direct DST and proportion method (indirect DST. 778 samples (31.8% were Mycobacterium tuberculosis culture-positive. Compared to conventional MODS the sensitivity, specificity, positive, and negative predictive values (95% confidence intervals of the MODS Kit were 99.3% (98.3-99.8%, 98.3% (97.5-98.8%, 95.8% (94.0-97.1%, and 99.7% (99.3-99.9%. Median (interquartile ranges time to culture-positivity (and rifampicin and isoniazid DST was 10 (9-13 days for conventional MODS and 8.5 (7-11 for MODS Kit (p<0.01. Direct rifampicin and isoniazid DST in MODS kit was almost universally concordant with conventional MODS (97.9% agreement, 665/679 evaluable samples and reference indirect DST (97.9% agreement, 687/702 evaluable samples.MODS kit delivers performance indistinguishable from conventional MODS and offers a convenient, affordable alternative with enhanced safety from the sealing silicone lid. The availability in the marketplace of this platform, which conforms to European standards (CE-marked, readily repurposed for second-line DST in the near future, provides a fresh opportunity for improving equity of

  12. Determination of plasma concentrations of levofloxacin by high performance liquid chromatography for use at a multidrug-resistant tuberculosis hospital in Tanzania.

    Science.gov (United States)

    Ebers, Andrew; Stroup, Suzanne; Mpagama, Stellah; Kisonga, Riziki; Lekule, Isaack; Liu, Jie; Heysell, Scott

    2017-01-01

    Therapeutic drug monitoring may improve multidrug-resistant tuberculosis (MDR-TB) treatment outcomes. Levofloxacin demonstrates significant individual pharmacokinetic variability. Thus, we sought to develop and validate a high-performance liquid chromatography (HPLC) method with ultraviolet (UV) detection for levofloxacin in patients on MDR-TB treatment. The HPLC-UV method is based on a solid phase extraction (SPE) and a direct injection into the HPLC system. The limit of quantification was 0.25 μg/mL, and the assay was linear over the concentration range of 0.25-15 μg/mL (y = 0.5668x-0.0603, R2 = 0.9992) for the determination of levofloxacin in plasma. The HPLC-UV methodology achieved excellent accuracy and reproducibility along a clinically meaningful range. The intra-assay RSD% of low, medium, and high quality control samples (QC) were 1.93, 2.44, and 1.90, respectively, while the inter-assay RSD% were 3.74, 5.65, and 3.30, respectively. The mean recovery was 96.84%. This method was then utilized to measure levofloxacin concentrations from patients' plasma samples from a retrospective cohort of consecutive enrolled subjects treated for MDR-TB at the national TB hospital in Tanzania during 5/3/2013-8/31/2015. Plasma was collected at 2 hours after levofloxacin administration, the time of estimated peak concentration (eCmax) treatment. Forty-one MDR-TB patients had plasma available and 39 had traceable programmatic outcomes. Only 13 (32%) patients had any plasma concentration that reached the lower range of the expected literature derived Cmax with the median eCmax being 5.86 (3.33-9.08 μg/ml). Using Classification and Regression Tree analysis, an eCmax ≥7.55 μg/mL was identified as the threshold which best predicted cure. Analyzing this CART derived threshold on treatment outcome, the time to sputum culture conversion was 38.3 ± 22.7 days vs. 47.8 ± 26.5 days (p = 0.27) and a greater proportion were cured, in 10 out of 15 (66.7%) vs. 6 out of 18 (33.3%) (p

  13. Effect of Introducing Xpert MTB/RIF to Test and Treat Individuals at Risk of Multidrug-Resistant Tuberculosis in Kazakhstan: A Prospective Cohort Study.

    Directory of Open Access Journals (Sweden)

    Sanne Christine van Kampen

    Full Text Available Xpert MTB/RIF (Xpert was piloted in Kazakhstan to detect tuberculosis (TB and rifampicin resistance (RR-TB among individuals at risk of multidrug-resistant (MDR- TB. This study assessed the performance of Xpert compared to conventional diagnostic methods, RR-TB case detection among various risk groups, treatment initiation and time to diagnosis and treatment.Eligible individuals were tested with Xpert, smear microscopy, culture and drug-susceptibility testing (DST at the national TB reference laboratory and three provincial laboratories. Data was collected prospectively from August 2012 to May 2013 from routine laboratory and treatment registers.A total of 5,611 Xpert tests were performed mostly targeting contacts of MDR-TB patients, 'other' presumptive MDR-TB patients, and retreatment cases (26%, 24% and 22%, respectively. Compared to phenotypic DST, the positive predictive value of Xpert to detect RR-TB was 93.1% and 96.4% and the negative predictive value was 94.6% and 92.7% using solid and liquid culture media, respectively. RR-TB detection was highest among (former prisoners, retreatment cases, people living with HIV/AIDS (PLWHA, and TB patients with positive smears after intensive phase of treatment (59%, 58%, 54% and 53% among TB positives, respectively. 88.9% of RR-TB patients were registered to have started second-line TB treatment. Median time to diagnosis with Xpert was 0.0 days (IQR 0.0-1.0, time from diagnosis to start of first-line treatment 3.0 days (IQR 1.0-7.0, and to start of second-line treatment 7.0 days (IQR 4.0-16.Compared to conventional culture and DST, Xpert had a shorter result turn-around-time and excellent concordance to detect RR-TB. Time from sputum collection to start of second-line treatment was reduced to one week. The yield of Xpert could be maximized by increasing referrals from penitentiary and HIV centers to TB centers.

  14. Alcohol, hospital discharge, and socioeconomic risk factors for default from multidrug resistant tuberculosis treatment in rural South Africa: a retrospective cohort study.

    Science.gov (United States)

    Kendall, Emily A; Theron, Danie; Franke, Molly F; van Helden, Paul; Victor, Thomas C; Murray, Megan B; Warren, Robin M; Jacobson, Karen R

    2013-01-01

    Default from multidrug-resistant tuberculosis (MDR-TB) treatment remains a major barrier to cure and epidemic control. We sought to identify patient risk factors for default from MDR-TB treatment and high-risk time periods for default in relation to hospitalization and transition to outpatient care. We retrospectively analyzed a cohort of 225 patients who initiated MDR-TB treatment between 2007 through 2010 at a rural TB hospital in the Western Cape Province, South Africa. Fifty percent of patients were cured or completed treatment, 27% defaulted, 14% died, 4% failed treatment, and 5% transferred out. Recent alcohol use was common (63% of patients). In multivariable proportional hazards regression, older age (hazard ratio [HR]= 0.97 [95% confidence interval 0.94-0.99] per year of greater age), formal housing (HR=0.38 [0.19-0.78]), and steady employment (HR=0.41 [0.19-0.90]) were associated with decreased risk of default, while recent alcohol use (HR=2.1 [1.1-4.0]), recent drug use (HR=2.0 [1.0-3.6]), and Coloured (mixed ancestry) ethnicity (HR=2.3 [1.1-5.0]) were associated with increased risk of default (PDefaults occurred throughout the first 18 months of the two-year treatment course but were especially frequent among alcohol users after discharge from the initial four-to-five-month in-hospital phase of treatment, with the highest default rates occurring among alcohol users within two months of discharge. Default rates during the first two months after discharge were also elevated for patients who received care from mobile clinics. Among patients who were not cured or did not complete MDR-TB treatment, the majority defaulted from treatment. Younger, economically-unstable patients and alcohol and drug users were particularly at risk. For alcohol users as well as mobile-clinic patients, the early outpatient treatment phase is a high-risk period for default that could be targeted in efforts to increase treatment completion rates.

  15. Pathways to multidrug-resistant tuberculosis diagnosis and treatment initiation: a qualitative comparison of patients' experiences in the era of rapid molecular diagnostic tests.

    Science.gov (United States)

    Naidoo, Pren; van Niekerk, Margaret; du Toit, Elizabeth; Beyers, Nulda; Leon, Natalie

    2015-10-28

    Although new molecular diagnostic tests such as GenoType MTBDRplus and Xpert® MTB/RIF have reduced multidrug-resistant tuberculosis (MDR-TB) treatment initiation times, patients' experiences of diagnosis and treatment initiation are not known. This study aimed to explore and compare MDR-TB patients' experiences of their diagnostic and treatment initiation pathway in GenoType MTBDRplus and Xpert® MTB/RIF-based diagnostic algorithms. The study was undertaken in Cape Town, South Africa where primary health-care services provided free TB diagnosis and treatment. A smear, culture and GenoType MTBDRplus diagnostic algorithm was used in 2010, with Xpert® MTB/RIF phased in from 2011-2013. Participants diagnosed in each algorithm at four facilities were purposively sampled, stratifying by age, gender and MDR-TB risk profiles. We conducted in-depth qualitative interviews using a semi-structured interview guide. Through constant comparative analysis we induced common and divergent themes related to symptom recognition, health-care access, testing for MDR-TB and treatment initiation within and between groups. Data were triangulated with clinical information and health visit data from a structured questionnaire. We identified both enablers and barriers to early MDR-TB diagnosis and treatment. Half the patients had previously been treated for TB; most recognised recurring symptoms and reported early health-seeking. Those who attributed symptoms to other causes delayed health-seeking. Perceptions of poor public sector services were prevalent and may have contributed both to deferred health-seeking and to patient's use of the private sector, contributing to delays. However, once on treatment, most patients expressed satisfaction with public sector care. Two patients in the Xpert® MTB/RIF-based algorithm exemplified its potential to reduce delays, commencing MDR-TB treatment within a week of their first health contact. However, most patients in both algorithms experienced

  16. Multidrug resistant pulmonary tuberculosis treatment regimens and patient outcomes: an individual patient data meta-analysis of 9,153 patients.

    Directory of Open Access Journals (Sweden)

    Shama D Ahuja

    Full Text Available Treatment of multidrug resistant tuberculosis (MDR-TB is lengthy, toxic, expensive, and has generally poor outcomes. We undertook an individual patient data meta-analysis to assess the impact on outcomes of the type, number, and duration of drugs used to treat MDR-TB.Three recent systematic reviews were used to identify studies reporting treatment outcomes of microbiologically confirmed MDR-TB. Study authors were contacted to solicit individual patient data including clinical characteristics, treatment given, and outcomes. Random effects multivariable logistic meta-regression was used to estimate adjusted odds of treatment success. Adequate treatment and outcome data were provided for 9,153 patients with MDR-TB from 32 observational studies. Treatment success, compared to failure/relapse, was associated with use of: later generation quinolones, (adjusted odds ratio [aOR]: 2.5 [95% CI 1.1-6.0], ofloxacin (aOR: 2.5 [1.6-3.9], ethionamide or prothionamide (aOR: 1.7 [1.3-2.3], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.3 [1.3-3.9], and three or more likely effective drugs in the continuation phase (aOR: 2.7 [1.7-4.1]. Similar results were seen for the association of treatment success compared to failure/relapse or death: later generation quinolones, (aOR: 2.7 [1.7-4.3], ofloxacin (aOR: 2.3 [1.3-3.8], ethionamide or prothionamide (aOR: 1.7 [1.4-2.1], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.7 [1.9-3.9], and three or more likely effective drugs in the continuation phase (aOR: 4.5 [3.4-6.0].In this individual patient data meta-analysis of observational data, improved MDR-TB treatment success and survival were associated with use of certain fluoroquinolones, ethionamide, or prothionamide, and greater total number of effective drugs. However, randomized trials are urgently needed to optimize MDR-TB treatment. Please see later in the article for the Editors' Summary.

  17. Effect of Introducing Xpert MTB/RIF to Test and Treat Individuals at Risk of Multidrug-Resistant Tuberculosis in Kazakhstan: A Prospective Cohort Study.

    Science.gov (United States)

    van Kampen, Sanne Christine; Tursynbayeva, Aigul; Koptleuova, Aliya; Murzakhmetova, Zauresh; Murzabekova, Zauresh; Bigalieva, Lyazzat; Aubakirova, Moldir; Pak, Svetlana; van den Hof, Susan

    2015-01-01

    Xpert MTB/RIF (Xpert) was piloted in Kazakhstan to detect tuberculosis (TB) and rifampicin resistance (RR-)TB among individuals at risk of multidrug-resistant (MDR-) TB. This study assessed the performance of Xpert compared to conventional diagnostic methods, RR-TB case detection among various risk groups, treatment initiation and time to diagnosis and treatment. Eligible individuals were tested with Xpert, smear microscopy, culture and drug-susceptibility testing (DST) at the national TB reference laboratory and three provincial laboratories. Data was collected prospectively from August 2012 to May 2013 from routine laboratory and treatment registers. A total of 5,611 Xpert tests were performed mostly targeting contacts of MDR-TB patients, 'other' presumptive MDR-TB patients, and retreatment cases (26%, 24% and 22%, respectively). Compared to phenotypic DST, the positive predictive value of Xpert to detect RR-TB was 93.1% and 96.4% and the negative predictive value was 94.6% and 92.7% using solid and liquid culture media, respectively. RR-TB detection was highest among (former) prisoners, retreatment cases, people living with HIV/AIDS (PLWHA), and TB patients with positive smears after intensive phase of treatment (59%, 58%, 54% and 53% among TB positives, respectively). 88.9% of RR-TB patients were registered to have started second-line TB treatment. Median time to diagnosis with Xpert was 0.0 days (IQR 0.0-1.0), time from diagnosis to start of first-line treatment 3.0 days (IQR 1.0-7.0), and to start of second-line treatment 7.0 days (IQR 4.0-16). Compared to conventional culture and DST, Xpert had a shorter result turn-around-time and excellent concordance to detect RR-TB. Time from sputum collection to start of second-line treatment was reduced to one week. The yield of Xpert could be maximized by increasing referrals from penitentiary and HIV centers to TB centers.

  18. Towards understanding the drivers of policy change: a case study of infection control policies for multi-drug resistant tuberculosis in South Africa.

    Science.gov (United States)

    Saidi, Trust; Salie, Faatiema; Douglas, Tania S

    2017-05-30

    Explaining policy change is one of the central tasks of contemporary policy analysis. In this article, we examine the changes in infection control policies for multi-drug resistant tuberculosis (MDR-TB) in South Africa from the time the country made the transition to democracy in 1994, until 2015. We focus on MDR-TB infection control and refer to decentralised management as a form of infection control. Using Kingdon's theoretical framework of policy streams, we explore the temporal ordering of policy framework changes. We also consider the role of research in motivating policy changes. Policy documents addressing MDR-TB in South Africa over the period 1994 to 2014 were extracted. Literature on MDR-TB infection control in South Africa was extracted from PubMed using key search terms. The documents were analysed to identify the changes that occurred and the factors driving them. During the period under study, five different policy frameworks were implemented. The policies were meant to address the overwhelming challenge of MDR-TB in South Africa, contextualised by high prevalence of HIV infection, that threatened to undermine public health programmes and the success of antiretroviral therapy rollouts. Policy changes in MDR-TB infection control were supported by research evidence and driven by the high incidence and complexity of the disease, increasing levels of dissatisfaction among patients, challenges of physical, human and financial resources in public hospitals, and the ideologies of the political leadership. Activists and people living with HIV played an important role in highlighting the importance of MDR-TB as well as exerting pressure on policymakers, while the mass media drew public attention to infection control as both a cause of and a solution to MDR-TB. The critical factors for policy change for infection control of MDR-TB in South Africa were rooted in the socioeconomic and political environment, were supported by extensive research, and can be framed

  19. Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

    Science.gov (United States)

    Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

    2018-02-27

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

  20. First insights into circulating Mycobacterium tuberculosis complex lineages and drug resistance in Guinea

    Science.gov (United States)

    Ejo, Mebrat; Gehre, Florian; Barry, Mamadou Dian; Sow, Oumou; Bah, Nene Mamata; Camara, Mory; Bah, Boubacar; Uwizeye, Cecile; Nduwamahoro, Elie; Fissette, Kristina; Rijk, Pim De; Merle, Corinne; Olliaro, Piero; Burgos, Marcos; Lienhardt, Christian; Rigouts, Leen; de Jong, Bouke C.

    2015-01-01

    In this study we assessed first-line anti-tuberculosis drug resistance and the genotypic distribution of Mycobacterium tuberculosis complex (MTBC) isolates that had been collected from consecutive new tuberculosis patients enrolled in two clinical trials conducted in Guinea between 2005 and 2010. Among the total 359 MTBC strains that were analyzed in this study, 22.8% were resistant to at least one of the first line anti-tuberculosis drugs, including 2.5% multidrug resistance and 17.5% isoniazid resistance, with or without other drugs. In addition, further characterization of isolates from a subset of the two trials (n = 184) revealed a total of 80 different spoligotype patterns, 29 “orphan” and 51 shared patterns. We identified the six major MTBC lineages of human relevance, with predominance of the Euro-American lineage. In total, 132 (71.7%) of the strains were genotypically clustered, and further analysis (using the DESTUS model) suggesting significantly faster spread of LAM10_CAM family (p = 0.00016). In conclusion, our findings provide a first insight into drug resistance and the population structure of the MTBC in Guinea, with relevance for public health scientists in tuberculosis control programs. PMID:26004194

  1. Proteins with complex architecture as potential targets for drug design: a case study of Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Bálint Mészáros

    2011-07-01

    Full Text Available Lengthy co-evolution of Homo sapiens and Mycobacterium tuberculosis, the main causative agent of tuberculosis, resulted in a dramatically successful pathogen species that presents considerable challenge for modern medicine. The continuous and ever increasing appearance of multi-drug resistant mycobacteria necessitates the identification of novel drug targets and drugs with new mechanisms of action. However, further insights are needed to establish automated protocols for target selection based on the available complete genome sequences. In the present study, we perform complete proteome level comparisons between M. tuberculosis, mycobacteria, other prokaryotes and available eukaryotes based on protein domains, local sequence similarities and protein disorder. We show that the enrichment of certain domains in the genome can indicate an important function specific to M. tuberculosis. We identified two families, termed pkn and PE/PPE that stand out in this respect. The common property of these two protein families is a complex domain organization that combines species-specific regions, commonly occurring domains and disordered segments. Besides highlighting promising novel drug target candidates in M. tuberculosis, the presented analysis can also be viewed as a general protocol to identify proteins involved in species-specific functions in a given organism. We conclude that target selection protocols should be extended to include proteins with complex domain architectures instead of focusing on sequentially unique and essential proteins only.

  2. Molecular Epidemiology of Mycobacterium Tuberculosis Strains in ...

    African Journals Online (AJOL)

    Doroudchi M, Kremer K, Basiri EA, Kadivar MR,. Van Soolingen D, Ghaderi AA. IS6110‑RFLP and spoligotyping of Mycobacterium tuberculosis isolates in Iran. Scand J Infect. Dis 2000;32:663‑8. 13. Farnia P, Masjedi MR, Mirsaeidi M, Mohammadi F,. Jallaledin‑Ghanavi, Vincent V, et al. Prevalence of Haarlem I and Beijing ...

  3. Microevolution of Mycobacterium tuberculosis in a tuberculosis patient.

    NARCIS (Netherlands)

    Al-Hajoj, S.A.; Akkerman, O.; Parwati, I.; Al-Gamdi, S.; Rahim, Z.; Soolingen, D. van; Ingen, J. van; Supply, P.; Zanden, A.G. van der

    2010-01-01

    Five Mycobacterium tuberculosis isolates were obtained from three body sites from a Dutch patient. The isolates displayed a single genotype by 24-locus MIRU-VNTR typing (except for a single locus not amplified from one isolate) but were differentiated by small variations in IS6110 fingerprints,

  4. Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Veigas, Bruno; Baptista, Pedro V; Machado, Diana; Couto, Isabel; Viveiros, Miguel; Perdigao, Joao; Portugal, Isabel

    2010-01-01

    Tuberculosis (TB) is one of the leading causes of infection in humans, causing high morbility and mortality all over the world. The rate of new cases of multidrug resistant tuberculosis (MDRTB) continues to increase, and since these infections are very difficult to manage, they constitute a serious health problem. In most cases, drug resistance in Mycobacterium tuberculosis has been related to mutations in several loci within the pathogen's genome. The development of fast, cheap and simple screening methodologies would be of paramount relevance for the early detection of these mutations, essential for the timely and effective diagnosis and management of MDRTB patients. The use of gold nanoparticles derivatized with thiol-modified oligonucleotides (Au-nanoprobes) has led to new approaches in molecular diagnostics. Based on the differential non-cross-linking aggregation of Au-nanoprobes, we were able to develop a colorimetric method for the detection of specific sequences and to apply this approach to pathogen identification and single base mutations/single nucleotide polymorphisms (SNP) discrimination. Here we report on the development of Au-nanoprobes for the specific identification of SNPs within the beta subunit of the RNA polymerase (rpoB locus), responsible for resistance to rifampicin in over 95% of rifampicin resistant M. tuberculosis strains.

  5. Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Veigas, Bruno; Baptista, Pedro V [CIGMH, Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal); Machado, Diana; Couto, Isabel; Viveiros, Miguel [Unidade de Micobacterias, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa (IHMT/UNL) (Portugal); Perdigao, Joao; Portugal, Isabel, E-mail: pmvb@fct.unl.pt [Centro de Patogenese Molecular/URIA, Faculdade de Farmacia, Universidade de Lisboa, Lisboa (Portugal)

    2010-10-15

    Tuberculosis (TB) is one of the leading causes of infection in humans, causing high morbility and mortality all over the world. The rate of new cases of multidrug resistant tuberculosis (MDRTB) continues to increase, and since these infections are very difficult to manage, they constitute a serious health problem. In most cases, drug resistance in Mycobacterium tuberculosis has been related to mutations in several loci within the pathogen's genome. The development of fast, cheap and simple screening methodologies would be of paramount relevance for the early detection of these mutations, essential for the timely and effective diagnosis and management of MDRTB patients. The use of gold nanoparticles derivatized with thiol-modified oligonucleotides (Au-nanoprobes) has led to new approaches in molecular diagnostics. Based on the differential non-cross-linking aggregation of Au-nanoprobes, we were able to develop a colorimetric method for the detection of specific sequences and to apply this approach to pathogen identification and single base mutations/single nucleotide polymorphisms (SNP) discrimination. Here we report on the development of Au-nanoprobes for the specific identification of SNPs within the beta subunit of the RNA polymerase (rpoB locus), responsible for resistance to rifampicin in over 95% of rifampicin resistant M. tuberculosis strains.

  6. Phenotypic and genotypic analysis of anti-tuberculosis drug resistance in Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aung, Wah Wah; Ei, Phyu Win; Nyunt, Wint Wint; Swe, Thyn Lei; Lwin, Thandar; Htwe, Mi Mi; Kim, Kyung Jun; Lee, Jong Seok; Kim, Chang Ki; Cho, Sang Nae; Song, Sun Dae; Chang, Chulhun L

    2015-09-01

    Tuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar. We determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid). Of 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01). The results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.

  7. Progression to active tuberculosis, but not transmission, varies by Mycobacterium tuberculosis lineage in The Gambia

    NARCIS (Netherlands)

    de Jong, Bouke C.; Hill, Philip C.; Aiken, Alex; Awine, Timothy; Antonio, Martin; Adetifa, Ifedayo M.; Jackson-Sillah, Dolly J.; Fox, Annette; Deriemer, Kathryn; Gagneux, Sebastien; Borgdorff, Martien W.; McAdam, Keith P. W. J.; Corrah, Tumani; Small, Peter M.; Adegbola, Richard A.

    2008-01-01

    BACKGROUND: There is considerable variability in the outcome of Mycobacterium tuberculosis infection. We hypothesized that Mycobacterium africanum was less likely than M. tuberculosis to transmit and progress to tuberculosis disease. METHODS: In a cohort study of patients with tuberculosis and their

  8. 21 CFR 866.3370 - Mycobacterium tuberculosis immunofluorescent reagents.

    Science.gov (United States)

    2010-04-01

    ... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents... used to identify Mycobacterium tuberculosis directly from clinical specimens. The identification aids...

  9. Virulence factors of the Mycobacterium tuberculosis complex

    Science.gov (United States)

    Forrellad, Marina A.; Klepp, Laura I.; Gioffré, Andrea; Sabio y García, Julia; Morbidoni, Hector R.; Santangelo, María de la Paz; Cataldi, Angel A.; Bigi, Fabiana

    2013-01-01

    The Mycobacterium tuberculosis complex (MTBC) consists of closely related species that cause tuberculosis in both humans and animals. This illness, still today, remains to be one of the leading causes of morbidity and mortality throughout the world. The mycobacteria enter the host by air, and, once in the lungs, are phagocytated by macrophages. This may lead to the rapid elimination of the bacillus or to the triggering of an active tuberculosis infection. A large number of different virulence factors have evolved in MTBC members as a response to the host immune reaction. The aim of this review is to describe the bacterial genes/proteins that are essential for the virulence of MTBC species, and that have been demonstrated in an in vivo model of infection. Knowledge of MTBC virulence factors is essential for the development of new vaccines and drugs to help manage the disease toward an increasingly more tuberculosis-free world. PMID:23076359

  10. Buoyant density of Mycobacterium tuberculosis: implications for sputum processing

    NARCIS (Netherlands)

    den Hertog, A. L.; Klatser, P. R.; Anthony, R. M.

    2009-01-01

    A tuberculosis (TB) research laboratory in the Netherlands. The concentration of Mycobacterium tuberculosis cells from sputum is almost universally performed by centrifugation after chemical liquefaction. These methods are thus dependent on the effective sedimentation of mycobacterial cells, and the

  11. Characterization of a Mycobacterium leprae antigen related to the secreted Mycobacterium tuberculosis protein MPT32

    NARCIS (Netherlands)

    Wieles, B.; van Agterveld, M.; Janson, A.; Clark-Curtiss, J.; Rinke de Wit, T.; Harboe, M.; Thole, J.

    1994-01-01

    Secreted proteins may serve as major targets in the immune response to mycobacteria. To identify potentially secreted Mycobacterium leprae antigens, antisera specific for culture filtrate proteins of Mycobacterium tuberculosis were used to screen a panel of recombinant antigens selected previously

  12. Dominant incidence of multidrug and extensively drug-resistant specific Mycobacterium tuberculosis clones in Osaka Prefecture, Japan.

    Directory of Open Access Journals (Sweden)

    Aki Tamaru

    Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.

  13. Mycobacterium tuberculosis effectors interfering host apoptosis signaling.

    Science.gov (United States)

    Liu, Minqiang; Li, Wu; Xiang, Xiaohong; Xie, Jianping

    2015-07-01

    Tuberculosis remains a serious human public health concern. The coevolution between its pathogen Mycobacterium tuberculosis and human host complicated the way to prevent and cure TB. Apoptosis plays subtle role in this interaction. The pathogen endeavors to manipulate the apoptosis via diverse effectors targeting key signaling nodes. In this paper, we summarized the effectors pathogen used to subvert the apoptosis, such as LpqH, ESAT-6/CFP-10, LAMs. The interplay between different forms of cell deaths, such as apoptosis, autophagy, necrosis, is also discussed with a focus on the modes of action of effectors, and implications for better TB control.

  14. Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Perú Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Perú

    Directory of Open Access Journals (Sweden)

    Julio Torres

    2011-09-01

    Full Text Available Se describe la evolución y las características de los casos de un conglomerado de tuberculosis multidrogorresistente (MDR ocurrido el año 2001, en un centro educativo localizado en una zona urbano marginal del distrito de Ica, Perú. Se identificó 15 escolares que estuvieron relacionados entre ellos antes de enfermar de tuberculosis. El promedio de edad fue 15 años. Doce casos fueron MDR y siete fueron resistentes a las cinco drogas de primera línea (RHEZS, cinco de los casos recibieron tres diferentes esquemas de tratamiento antituberculoso; el tiempo promedio de tratamiento antituberculoso fue de 37 meses (mínimo 21 y máximo 59 meses. Trece casos curaron y dos fallecieron. El presente estudio documenta un conglomerado de casos de TB-MDR en un centro educativo que, por los vínculos epidemiológicos y la simultaneidad en que aparecieron, podría tratarse de un probable brote de TB-MDR, con un desenlace satisfactorio luego de un tratamiento prolongado.We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS. Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months. A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

  15. [Characterization of clinical isolates of Mycobacterium tuberculosis from HIV positive individuals in Colombia, 2012].

    Science.gov (United States)

    Castro, Claudia; Ricardo, Alba; Zabaleta, Angie; Llerena, Claudia; Puerto, Gloria

    2017-01-24

    One third of the increase in tuberculosis cases is attributed to the spread of HIV. In 2012, 1,397 HIV-associated tuberculosis cases were reported in Colombia, i.e., 11.8% of the total cases. Molecular epidemiology tools help to understand the transmission of tuberculosis. To characterize clinical isolates of Mycobacterium tuberculosis derived from HIV-infected individuals, received at the Laboratorio Nacional de Referencia in the Instituto Nacional de Salud. This was a descriptive observational study. We analyzed 63 isolates of M. tuberculosis from HIV-infected individuals. Identification, drug susceptibility and genotyping assays were performed. Of the new cases evaluated, three (5.0%) were resistant to isoniazid combined with streptomycin; two (3.3%) to rifampicin, and one (1.6%) to isoniazid. Previously treated cases were sensitive. No multidrug resistance was evident. Among the predominant genotypes, 20 isolates were (31.7%) LAM9, eight (12.7%), H1, and seven (11.1%), T1. Nineteen isolates corresponded to orphan patterns. One single grouping was observed among tested isolates. We found no statistically significantdifference between the proportions of the antituberculous drug resistance and genotypes. We found resistant isolates to the most powerful drugs, rifampicin and isoniazid, among new cases, showing the transmission of resistant strains. Genetic families of M. tuberculosis LAM9, T1 and H1 correspond to those described in the general population. We detected no active transmission among studied isolates. More comprehensive studies are needed to assess the real situation of HIV associated tuberculosis in the country regarding sensitivity and transmission.

  16. Predominance of Central Asian and European families among Mycobacterium tuberculosis isolates in Kashmir Valley, India.

    Science.gov (United States)

    Bashir, Gulnaz; Wani, Tehmeena; Sharma, Pragya; Katoch, V M; Lone, Rubina; Shah, Azra; Katoch, Kiran; Kakru, D K; Chauhan, Devendra Singh

    2017-10-01

    As there are no data available regarding the strains of Mycobacterium tuberculosis circulating in Kashmir Valley, India, the current study aimed at describing the genetic diversity of M. tuberculosis strains in this region, by spoligotyping and 12-locus-based MIRU-VNTR typing (Mycobacterial Interspersed Repetitive Unit-Variable Number Tandem Repeat). Sputa from 207 smear positive cases with newly diagnosed pulmonary tuberculosis were subjected to culture for M. tuberculosis. Eighty-five isolates confirmed as M. tuberculosis were subjected to drug susceptibility testing and molecular typing by spoligotyping and MIRU-VNTRs. Drug susceptibility results of 72 isolates revealed 76.3% as fully sensitive while 5.5% as multidrug resistant (MDR). Spoligotyping of 85 isolates detected 42 spoligotypes with 50 isolates (58.8%) clustered into seven spoligotypes. SIT26/CAS1_Del was the major spoligotype (23, 27%) followed by SIT127/H4 (12, 14.1%); CAS lineage (37.6%) was predominant, followed by Haarlem (25.8%) and ill-defined T clade (23.5%). MIRU-VNTR analysis displayed 82 MIRU patterns from 85 strains, including 3 small clusters and 79 unique. MIRU 26 was found to be the most discriminatory locus. Kashmir Valley has CAS as the predominant lineage of M. tuberculosis similar to the rest of the Indian sub-continent, while it is peculiar in having Euro American lineages such as Haarlem and ill-defined T clade. Copyright © 2017 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.

  17. Genotypes of Mycobacterium tuberculosis in patients at risk of drug resistance in Bolivia.

    Science.gov (United States)

    Monteserin, Johana; Camacho, Mirtha; Barrera, Lucía; Palomino, Juan Carlos; Ritacco, Viviana; Martin, Anandi

    2013-07-01

    Bolivia ranks among the 10 Latin American countries with the highest rates of tuberculosis (TB) and multidrug resistant (MDR) TB. In view of this, and of the lacking information on the population structure of Mycobacterium tuberculosis in the country, we explored genotype associations with drug resistance and clustering by analyzing isolates collected in 2010 from 100 consecutive TB patients at risk of drug resistance in seven of the nine departments in which Bolivia is divided. Fourteen isolates were MDR, 29 had other drug resistance profiles, and 57 were pansusceptible. Spoligotype family distribution was: Haarlem 39.4%, LAM 26.3%, T 22.2%, S 2.0%, X 1.0%, orphan 9.1%, with very low intra-family diversity and absence of Beijing genotypes. We found 66 different MIRU-VNTR patterns; the most frequent corresponded to Multiple Locus Variable Analysis (MLVA) MtbC15 patterns 860, 372 and 873. Twelve clusters, each with identical MIRU-VNTR and spoligotypes, gathered 35 patients. We found no association of genotype with drug resistant or MDR-TB. Clustering associated with SIT 50 and the H3 subfamily to which it belongs (pBolivia. However, results should be taken cautiously because the sample is small and includes a particular subset of M. tuberculosis population. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. First Insight into a Nationwide Genotypic Diversity of Mycobacterium tuberculosis among Previously Treated Pulmonary Tuberculosis Cases in Benin, West Africa.

    Science.gov (United States)

    Affolabi, Dissou; Sanoussi, N'Dira; Codo, Sergio; Sogbo, Fréderic; Wachinou, Prudence; Massou, Faridath; Kehinde, Aderemi; Anagonou, Séverin

    2017-01-01

    Molecular studies on tuberculosis (TB) are rare in low-resource countries like Benin, where data on molecular study on previously treated TB cases is unavailable. From January to December 2014, all smear- and culture-positive previously treated pulmonary TB patients from all TB clinics were systematically recruited. Drug susceptibility testing and spoligotyping were performed on all isolates. Of the 100 patients recruited, 71 (71.0%) were relapse cases and 24 (24.0%) were failure cases, while 5 (5.0%) were default cases. Resistance rate to any first-line drug was 40.0%, while 12.0% of strains were multidrug-resistant (MDR) and no strain was extensively drug-resistant (XDR). A total of 40 distinct spoligotypes were found to be corresponding to a genotypic diversity of 40.0%. ST61 was the most predominant spoligotype with prevalence of 33.0%. In all, 31 single spoligotypes and nine clusters were observed with 2 to 33 strains per cluster giving a clustering rate of 69.0%. Euro-American (Lineage 4) was the most prevalent lineage (74.0%) and Lineage 2 was associated with resistance to streptomycin. This first insight into genetic diversity of previously treated pulmonary TB patients in Benin showed a relatively high genetic diversity of Mycobacterium tuberculosis .

  19. First Insight into a Nationwide Genotypic Diversity of Mycobacterium tuberculosis among Previously Treated Pulmonary Tuberculosis Cases in Benin, West Africa

    Directory of Open Access Journals (Sweden)

    Dissou Affolabi

    2017-01-01

    Full Text Available Background. Molecular studies on tuberculosis (TB are rare in low-resource countries like Benin, where data on molecular study on previously treated TB cases is unavailable. Materials and Methods. From January to December 2014, all smear- and culture-positive previously treated pulmonary TB patients from all TB clinics were systematically recruited. Drug susceptibility testing and spoligotyping were performed on all isolates. Results. Of the 100 patients recruited, 71 (71.0% were relapse cases and 24 (24.0% were failure cases, while 5 (5.0% were default cases. Resistance rate to any first-line drug was 40.0%, while 12.0% of strains were multidrug-resistant (MDR and no strain was extensively drug-resistant (XDR. A total of 40 distinct spoligotypes were found to be corresponding to a genotypic diversity of 40.0%. ST61 was the most predominant spoligotype with prevalence of 33.0%. In all, 31 single spoligotypes and nine clusters were observed with 2 to 33 strains per cluster giving a clustering rate of 69.0%. Euro-American (Lineage 4 was the most prevalent lineage (74.0% and Lineage 2 was associated with resistance to streptomycin. Conclusion. This first insight into genetic diversity of previously treated pulmonary TB patients in Benin showed a relatively high genetic diversity of Mycobacterium tuberculosis.

  20. Beta-lactamases of Mycobacterium tuberculosis and Mycobacterium kansasii.

    Science.gov (United States)

    Segura, C; Salvadó, M

    1997-09-01

    Re-emergence of infectious diseases caused by mycobacteria as well as the emergence of multiresistant strains of Mycobacterium has promoted the research on the use of beta-lactames in the treatment of such diseases. Mycobacteria produce beta-lactamases: M. tuberculosis produces a wide-spectrum beta-lactamase whose behaviour mimicks those of Gram-negative bacteria. M. kansasii produces also beta-lactamase which can be inhibited by clavulanic acid. An overview on beta-lactamases from both species is reported.

  1. Risk factors for Mycobacterium tuberculosis infection among children in Greenland

    DEFF Research Database (Denmark)

    Søborg, Bolette; Andersen, Aase Bengaard; Melbye, Mads

    2011-01-01

    To examine the risk factors for Mycobacterium tuberculosis infection (MTI) among Greenlandic children for the purpose of identifying those at highest risk of infection.......To examine the risk factors for Mycobacterium tuberculosis infection (MTI) among Greenlandic children for the purpose of identifying those at highest risk of infection....

  2. DNA repair in Mycobacterium tuberculosis revisited.

    Science.gov (United States)

    Dos Vultos, Tiago; Mestre, Olga; Tonjum, Tone; Gicquel, Brigitte

    2009-05-01

    Our understanding of Mycobacterium tuberculosis DNA repair mechanisms is still poor compared with that of other bacterial organisms. However, the publication of the first complete M. tuberculosis genome sequence 10 years ago boosted the study of DNA repair systems in this organism. A first step in the elucidation of M. tuberculosis DNA repair mechanisms was taken by Mizrahi and Andersen, who identified homologs of genes involved in the reversal or repair of DNA damage in Escherichia coli and related organisms. Genes required for nucleotide excision repair, base excision repair, recombination, and SOS repair and mutagenesis were identified. Notably, no homologs of genes involved in mismatch repair were identified. Novel characteristics of the M. tuberculosis DNA repair machinery have been found over the last decade, such as nonhomologous end joining, the presence of Mpg, ERCC3 and Hlr - proteins previously presumed to be produced exclusively in mammalian cells - and the recently discovered bifunctional dCTP deaminase:dUTPase. The study of these systems is important to develop therapeutic agents that can counteract M. tuberculosis evolutionary changes and to prevent adaptive events resulting in antibiotic resistance. This review summarizes our current understanding of the M. tuberculosis DNA repair system.

  3. Phenotypic assays for Mycobacterium tuberculosis infection.

    Science.gov (United States)

    Song, Ok-Ryul; Deboosere, Nathalie; Delorme, Vincent; Queval, Christophe J; Deloison, Gaspard; Werkmeister, Elisabeth; Lafont, Frank; Baulard, Alain; Iantomasi, Raffaella; Brodin, Priscille

    2017-10-01

    Tuberculosis (TB) is still a major global threat, killing more than one million persons each year. With the constant increase of Mycobacterium tuberculosis strains resistant to first- and second-line drugs, there is an urgent need for the development of new drugs to control the propagation of TB. Although screenings of small molecules on axenic M. tuberculosis cultures were successful for the identification of novel putative anti-TB drugs, new drugs in the development pipeline remains scarce. Host-directed therapy may represent an alternative for drug development against TB. Indeed, M. tuberculosis has multiple specific interactions within host phagocytes, which may be targeted by small molecules. In order to enable drug discovery strategies against microbes residing within host macrophages, we developed multiple fluorescence-based HT/CS phenotypic assays monitoring the intracellular replication of M. tuberculosis as well as its intracellular trafficking. What we propose here is a population-based, multi-parametric analysis pipeline that can be used to monitor the intracellular fate of M. tuberculosis and the dynamics of cellular events such as phagosomal maturation (acidification and permeabilization), zinc poisoning system or lipid body accumulation. Such analysis allows the quantification of biological events considering the host-pathogen interplay and may thus be derived to other intracellular pathogens. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

  4. Proteomic analysis of drug-resistant Mycobacterium tuberculosis by one-dimensional gel electrophoresis and charge chromatography.

    Science.gov (United States)

    Yari, Shamsi; Hadizadeh Tasbiti, Alireza; Ghanei, Mostafa; Shokrgozar, Mohammad Ali; Fateh, Abolfazl; Mahdian, Reza; Yari, Fatemeh; Bahrmand, Ahmadreza

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB) is a form of TB caused by Mycobacterium tuberculosis (M. tuberculosis) that do not respond to, at least, isoniazid and rifampicin, the two most powerful, first-line (or standard) anti-TB drugs. Novel intervention strategies for eliminating this disease were based on finding proteins that can be used for designing new drugs or new and reliable kits for diagnosis. The aim of this study was to compare the protein profiles of MDR-TB with sensitive isolates. Proteomic analysis of M. tuberculosis MDR-TB and sensitive isolates was obtained with ion exchange chromatography coupled with MALDI-TOF-TOF (matrix-assisted laser desorption/ionization) in order to identify individual proteins that have different expression in MDR-TB to be used as a drug target or diagnostic marker for designing valuable TB vaccines or TB rapid tests. We identified eight proteins in MDR-TB isolates, and analyses showed that these proteins are absent in M. tuberculosis-sensitive isolates: (Rv2140c, Rv0009, Rv1932, Rv0251c, Rv2558, Rv1284, Rv3699 and MMP major membrane proteins). These data will provide valuable clues in further investigation for suitable TB rapid tests or drug targets against drug-resistant and sensitive M. tuberculosis isolates.

  5. Radiometric diagnosis of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Laszlo, A.

    1986-01-01

    The results of this study confirm that rapid radiometric diagnostic tests such as the NAP selective inhibition test for the M. tuberculosis complex followed by the radiometric drug susceptibility tests are extremely reliable and compare favourably with conventional methodologies. This study also shows that referred cultures growing on solid medium can be processed by radiometric procedures without prior subculture. This circumstance by itself shortens the time needed for reporting. (Auth.)

  6. Multidrug resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Bolhuis, Hendrik

    1996-01-01

    Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

  7. Immune Responses Involved in Mycobacterium Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Roghayeh Teimourpour

    2016-09-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.

  8. A comparative modeling and molecular docking study on Mycobacterium tuberculosis targets involved in peptidoglycan biosynthesis.

    Science.gov (United States)

    Fakhar, Zeynab; Naiker, Suhashni; Alves, Claudio N; Govender, Thavendran; Maguire, Glenn E M; Lameira, Jeronimo; Lamichhane, Gyanu; Kruger, Hendrik G; Honarparvar, Bahareh

    2016-11-01

    An alarming rise of multidrug-resistant Mycobacterium tuberculosis strains and the continuous high global morbidity of tuberculosis have reinvigorated the need to identify novel targets to combat the disease. The enzymes that catalyze the biosynthesis of peptidoglycan in M. tuberculosis are essential and noteworthy therapeutic targets. In this study, the biochemical function and homology modeling of MurI, MurG, MraY, DapE, DapA, Alr, and Ddl enzymes of the CDC1551 M. tuberculosis strain involved in the biosynthesis of peptidoglycan cell wall are reported. Generation of the 3D structures was achieved with Modeller 9.13. To assess the structural quality of the obtained homology modeled targets, the models were validated using PROCHECK, PDBsum, QMEAN, and ERRAT scores. Molecular dynamics simulations were performed to calculate root mean square deviation (RMSD) and radius of gyration (Rg) of MurI and MurG target proteins and their corresponding templates. For further model validation, RMSD and Rg for selected targets/templates were investigated to compare the close proximity of their dynamic behavior in terms of protein stability and average distances. To identify the potential binding mode required for molecular docking, binding site information of all modeled targets was obtained using two prediction algorithms. A docking study was performed for MurI to determine the potential mode of interaction between the inhibitor and the active site residues. This study presents the first accounts of the 3D structural information for the selected M. tuberculosis targets involved in peptidoglycan biosynthesis.

  9. Clustering of Mycobacterium tuberculosis strains from foreign-born patients in Korea.

    Science.gov (United States)

    Jeon, Christie Y; Kang, Heeyoon; Kim, Mihye; Murray, Megan B; Kim, Heejin; Cho, Eun Hee; Park, Young Kil

    2011-12-01

    Information on drug resistance and transmission patterns of tuberculosis (TB) in foreign-born patients is lacking in Asia where immigration is increasing. We examined the drug-resistance profiles of 288 Mycobacterium tuberculosis isolates from foreign-born patients in South Korea, and assessed for potential transmission in the host country by analysing their IS6110 genotypes, as well as those of 4780 strains from native Korean TB patients. The prevalence of multidrug-resistant (MDR) TB was 9.7% and 42% among new and previously treated patients, respectively. Chinese nationality was associated with MDR TB (OR(China)=3.0, 95% CI 1.1-9.3). Of the 288 strains, 51 (17.7%) formed 31 clusters, of which 22 were identical to strains from native Koreans. A number of strains belonged to the K family, subtypes known to occur endemically in Korea. MDR TB was common, and clustering patterns showed potential cross-cultural transmission among foreign-born TB patients. Further molecular epidemiological studies of all isolates in the area are needed to determine the extent of international TB transmission in Asia. © 2011 SGM

  10. Vigilancia de la resistencia de Mycobacterium tuberculosis a las drogas antituberculosas en Cuba, 1995-1998.

    Directory of Open Access Journals (Sweden)

    Ernesto Montoro

    2004-06-01

    Full Text Available La vigilancia de la resistencia a fármacos a través del cultivo y de las pruebas de susceptibilidad in vitro permite conocer la magnitud regional y mundial de la resistencia en tuberculosis. En el presente trabajo se determinó la prevalencia de la resistencia a fármacos antituberculosos en Cuba, durante el periodo 1995-1998 en casos nuevos y en aquéllos que han recibido tratamiento previo. Los resultados incluidos en este estudio forman parte de los dos proyectos mundiales organizados por la OMS/UICTER. La resistencia a los medicamentos se evaluó usando el método de las proporciones en 1.379 cepas de Mycobacterium tuberculosis a los fármacos de primera línea (isoniacida, rifampicina, estreptomicina y etambutol. La resistencia en casos nuevos fue del 8,3% y 6,5% y la resistencia múltiple a fármacos (multidrug-resistance, MDR fue del 0,7% y 0% en el primer y segundo estudio, respectivamente. Estos resultados permitieron demostrar la escasa circulación de cepas MDR en Cuba; se reconoció a nivel mundial el buen funcionamiento del Programa Nacional de Control y el éxito de la aplicación en nuestro país de la estrategia del tratamiento estrictamente supervisado desde 1971.

  11. Emerging peak on the phylogeographic landscape of Mycobacterium tuberculosis in West Asia: Definitely smoke, likely fire.

    Science.gov (United States)

    Mokrousov, Igor; Shitikov, Egor; Skiba, Yuriy; Kolchenko, Sergey; Chernyaeva, Ekaterina; Vyazovaya, Anna

    2017-11-01

    To date, a major attention was justly given to the global lineages of Mycobacterium tuberculosis. Here, we demonstrated an importance of the minor ones, on an example of intriguing and underestimated NEW-1 family that belongs to Euro-American lineage (lineage 4). Analysis of the global WGS/NGS datasets (5715 strains) identified 2235 strains of Lineage 4 and 66 strains of sublineage L4.5. This latter is marked with RD122 genomic deletion and includes NEW-1 family. Phylogenomic analysis confirmed a separate position of the NEW-1 family that we tentatively designate L4.5.1/Iran. We propose an evolution/migration scenario starting with origin of L4.5 1000-1300 ya in China, subsequent origin of the pre-NEW-1 intermediate genotype in Tibet, further migration to Xinjiang/Uyghur, and finally to Iran since 800 ya (origin of NEW-1), possibly, via expansion of the Mongol Yuan empire. Analysis of longitudinal phylogeographic datasets revealed a sharp increase in prevalence of NEW-1 strains in Iran and its eastwards neighbors in the last 20years; most alarmingly, it is accompanied with significant association with multidrug resistance (MDR). Ongoing migration, especially, Afghan refugees flows to developed countries emphasize a risk of the wider spread of the epidemic MDR subtype within NEW-1 family that we coin as emerging resistant clone of M. tuberculosis in West Asia. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. First baseline of circulating genotypic lineages of Mycobacterium tuberculosis in patients from the brazilian borders with Argentina and Paraguay.

    Science.gov (United States)

    Machado, Luzia Neri C; Marcondes, Nadir R; Leite, Clarice Q Fijimura; Santos, Adolfo C Barreto; Pavan, Fernando Rogério; Baldin, Vanessa Pietrowski; Castilho, Aline Lemes; Siqueira, Vera Lúcia D; Baeza, Lilian Cristiane; Berghs, Henri; Cardoso, Rosilene Fressatti

    2014-01-01

    At the triple border Brazil/Paraguay/Argentina there is easy mobility from one city to another for economic and tourism activities. This constant and fast population mobility is mainly to visit Iguazu Falls, in the Iguazu River, on the border of the Brazilian state of Paraná and the Argentina. As the incidence of tuberculosis is high in this setting, our study aimed to establish a first baseline of circulating genotypic lineages of Mycobacterium tuberculosis. This study included 120 patients from 10 cities in southwestern Paraná, Brazil with pulmonary symptoms, from July 2009 to July 2011. Information about sex, age, clinical features and address was collected by reviewing the national tuberculosis notification database. Of these, 96 (80%) isolates were identified as M. tuberculosis and 22 (22.9%) were drug resistant (20, 20.8% INH mono-resistant and 2, 2.1% multidrug-resistant). All isolates were subjected to genotyping by Spoligotyping and MIRU-VNTR typing. The distribution of the isolates analyzed by spoligotyping revealed 30 distinct patterns. The four mainly detected clades were Latin American and Mediterranean (LAM), ill-defined T, Haarlem (H) and S. The MIRU-VNTR showed 85 distinct patterns. Spoligotyping combined to MIRU-VNTR allowed 90 distinct patterns. Our study demonstrated that there is significant molecular diversity in circulating M. tuberculosis, with predominance of the LAM and T clades in cities of southwestern Paraná, Brazil, bordering Argentina and Paraguay.

  13. Mycobacterium Tuberculosis Pyomyositis in an Infant

    Science.gov (United States)

    Malik, ZA; Shehab, M

    2013-01-01

    Mycobacterium tuberculosis is endemic to many parts of the world. It may have variable clinical presentations, especially in the pediatric age group. Presented here is the case of a 9-month old infant who was referred for infectious disease opinion when his thigh induration failed to improve after surgical drainage and a course of oral antibiotic therapy. Mycobacterial PCR on the operative sample fluid was found to be positive; and mycobacterial culture grew M. tuberculosis. He received 9 months of treatment with anti-TB medications, with excellent results and complete recovery. This is the first report of TB pyomyositis in an infant; and highlights the need to have a high index of suspicion for unusual organisms when conventional therapy fails to demonstrate expected results. PMID:23919207

  14. Consequences of genomic diversity in Mycobacterium tuberculosis

    Science.gov (United States)

    Coscolla, Mireia; Gagneux, Sebastien

    2014-01-01

    The causative agent of human tuberculosis, Mycobacterium tuberculosis complex (MTBC), comprises seven phylogenetically distinct lineages associated with different geographical regions. Here we review the latest findings on the nature and amount of genomic diversity within and between MTBC lineages. We then review recent evidence for the effect of this genomic diversity on mycobacterial phenotypes measured experimentally and in clinical settings. We conclude that overall, the most geographically widespread Lineage 2 (includes Beijing) and Lineage 4 (also known as Euro-American) are more virulent than other lineages that are more geographically restricted. This increased virulence is associated with delayed or reduced pro-inflammatory host immune responses, greater severity of disease, and enhanced transmission. Future work should focus on the interaction between MTBC and human genetic diversity, as well as on the environmental factors that modulate these interactions. PMID:25453224

  15. Detection of mycobacterium tuberculosis in clinical samples by smear and culture

    International Nuclear Information System (INIS)

    Aftab, R.; Amjad, F.; Khurshid, R.

    2009-01-01

    A retrospective study was carried out in order to compare the smear stained by ZN and Lowenstein-Jensen (U) medium for the detection of Mycobacterium in clinical samples from different categories. Study Design: Laboratory based, Retrospective. Place and Duration: Sir Ganga Ram Hospital Fatima Jinnah Medical College, Lahore over a 5 year period between Jan 2001 and June 2006. Material and Methods: A total of 798 clinical samples were collected from patients of both sexes and all ages with a provisional diagnosis of tuberculosis. A Ziehl-Neelsen stain (ZN) and culture on U medium was performed for the detection of Mycobacterium. The specimen categories were sputum, pus, lymph node aspirate, urine and endometrial curetting. Results: Out of 5 types of 798 specimens received over a period of five years, only 46.3%) (n=369) were respiratory whereas the remaining 53.7% (n=429) were non respiratory tract category samples including sputum, pus, lymph node aspirate, urine and endometrial curetting. All were examined for the presence of acid-fast-bacilli (AFB) in ZN smear. Among these 3.578% gave a positive ZN stain while 11.65% were positive on culture. Out of a total of 369 respiratory tract category samples, 38 (10.3%) sputum samples were positive for AFB on both ZN and culture. Among the non respiratory tract category, 47 (28.2%) pus, 26 (31%) LN aspirate, 5 (15.6%) urine, 5 (3.42%) endometrial curetting were reported positive. Only 15.16% of clinical samples belonging to 5 different categories of specimens received from patients of both sexes with a provisional diagnosis of tuberculosis, tested positive for Mycobacterium by both ZN stain smear and culture on U medium. Among these, 3.57% were positive for AFB on ZN smear and 11.65% were positive on culture on U medium. Conclusion: These conventional techniques have proved to be reliable testing tools for detection of Mycobacterium tuberculosis in our settings but there is an urgent need to promote the use of Biotic and

  16. Characterization of Mycobacterium tuberculosis nicotinamidase/pyrazinamidase.

    Science.gov (United States)

    Zhang, Hua; Deng, Jiao-Yu; Bi, Li-Jun; Zhou, Ya-Feng; Zhang, Zhi-Ping; Zhang, Cheng-Gang; Zhang, Ying; Zhang, Xian-En

    2008-02-01

    The nicotinamidase/pyrazinamidase (PncA) of Mycobacterium tuberculosis is involved in the activation of the important front-line antituberculosis drug pyrazinamide by converting it into the active form, pyrazinoic acid. Mutations in the pncA gene cause pyrazinamide resistance in M. tuberculosis. The properties of M. tuberculosis PncA were characterized in this study. The enzyme was found to be a 20.89 kDa monomeric protein. The optimal pH and temperature of enzymatic activity were pH 7.0 and 40 degrees C, respectively. Inductively coupled plasma-optical emission spectrometry revealed that the enzyme was an Mn(2+)/Fe(2+)-containing protein with a molar ratio of [Mn(2+)] to [Fe(2+)] of 1 : 1; furthermore, the external addition of either type of metal ion had no apparent effect on the wild-type enzymatic activity. The activity of the purified enzyme was determined by HPLC, and it was shown that it possessed similar pyrazinamidase and nicotinamidase activity, by contrast with previous reports. Nine PncA mutants were generated by site-directed mutagenesis. Determination of the enzymatic activity and metal ion content suggested that Asp8, Lys96 and Cys138 were key residues for catalysis, and Asp49, His51, His57 and His71 were essential for metal ion binding. Our data show that M. tuberculosis PncA may bind metal ions in a manner different from that observed in the case of Pyrococcus horikoshii PncA.

  17. Automatic identification of tuberculosis mycobacterium

    Directory of Open Access Journals (Sweden)

    Cicero Ferreira Fernandes Costa Filho

    Full Text Available Introduction According to the Global TB control report of 2013, “Tuberculosis (TB remains a major global health problem. In 2012, an estimated 8.6 million people developed TB and 1.3 million died from the disease. Two main sputum smear microscopy techniques are used for TB diagnosis: Fluorescence microscopy and conventional microscopy. Fluorescence microscopy is a more expensive diagnostic method because of the high costs of the microscopy unit and its maintenance. Therefore, conventional microscopy is more appropriate for use in developing countries. Methods This paper presents a new method for detecting tuberculosis bacillus in conventional sputum smear microscopy. The method consists of two main steps, bacillus segmentation and post-processing. In the first step, the scalar selection technique was used to select input variables for the segmentation classifiers from four color spaces. Thirty features were used, including the subtractions of the color components of different color spaces. In the post-processing step, three filters were used to separate bacilli from artifact: a size filter, a geometric filter and a Rule-based filter that uses the components of the RGB color space. Results In bacillus identification, an overall sensitivity of 96.80% and an error rate of 3.38% were obtained. An image database with 120-sputum-smear microscopy slices of 12 patients with objects marked as bacillus, agglomerated bacillus and artifact was generated and is now available online. Conclusions The best results were obtained with a support vector machine in bacillus segmentation associated with the application of the three post-processing filters.

  18. Immunological crossreactivity of the Mycobacterium leprae CFP-10 with its homologue in Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, A.; van Meijgaarden, K. E.; Franken, K. L. M. C.; Wieles, B.; Arend, S. M.; Faber, W. R.; Naafs, B.; Ottenhoff, T. H. M.

    2004-01-01

    Mycobacterium tuberculosis culture filtrate protein-10 (CFP-10) (Rv3874) is considered a promising antigen for the immunodiagnosis of tuberculosis (TB) together with early secreted antigens of M. tuberculosis (ESAT-6). Both ESAT-6 and CFP-10 are encoded by the RD1 region that is deleted from all

  19. Unanticipated Mycobacterium tuberculosis complex culture inhibition by immune modulators, immune suppressants, a growth enhancer, and vitamins A and D: clinical implications.

    Science.gov (United States)

    Greenstein, Robert J; Su, Liya; Shahidi, Azra; Brown, William D; Clifford, Anya; Brown, Sheldon T

    2014-09-01

    The development of novel antibiotics to treat multidrug-resistant (MDR) tuberculosis is time-consuming and expensive. Multiple immune modulators, immune suppressants, anti-inflammatories, and growth enhancers, and vitamins A and D, inhibit Mycobacterium avium subspecies paratuberculosis (MAP) in culture. We studied the culture inhibition of Mycobacterium tuberculosis complex by these agents. Biosafety level two M. tuberculosis complex (ATCC 19015 and ATCC 25177) was studied in radiometric Bactec or MGIT culture. Agents evaluated included clofazimine, methotrexate, 6-mercaptopurine, cyclosporine A, rapamycin, tacrolimus, monensin, and vitamins A and D. All the agents mentioned above caused dose-dependent inhibition of the M. tuberculosis complex. There was no inhibition by the anti-inflammatory 5-aminosalicylic acid, which causes bacteriostatic inhibition of MAP. We conclude that, at a minimum, studies with virulent M. tuberculosis are indicated with the agents mentioned above, as well as with the thioamide 5-propothiouricil, which has previously been shown to inhibit the M. tuberculosis complex in culture. Our data additionally emphasize the importance of vitamins A and D in treating mycobacterial diseases. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Efflux pumps of Mycobacterium tuberculosis play a significant role in antituberculosis activity of potential drug candidates.

    Science.gov (United States)

    Balganesh, Meenakshi; Dinesh, Neela; Sharma, Sreevalli; Kuruppath, Sanjana; Nair, Anju V; Sharma, Umender

    2012-05-01

    Active efflux of drugs mediated by efflux pumps that confer drug resistance is one of the mechanisms developed by bacteria to counter the adverse effects of antibiotics and chemicals. To understand these efflux mechanisms in Mycobacterium tuberculosis, we generated knockout (KO) mutants of four efflux pumps of the pathogen belonging to different classes. We measured the MICs and kill values of two different compound classes on the wild type (WT) and the efflux pump (EP) KO mutants in the presence and absence of the efflux inhibitors verapamil and l-phenylalanyl-l-arginyl-β-naphthylamide (PAβN). Among the pumps studied, the efflux pumps belonging to the ABC (ATP-binding cassette) class, encoded by Rv1218c, and the SMR (small multidrug resistance) class, encoded by Rv3065, appear to play important roles in mediating the efflux of different chemical classes and antibiotics. Efflux pumps encoded by Rv0849 and Rv1258c also mediate the efflux of these compounds, but to a lesser extent. Increased killing is observed in WT M. tuberculosis cells by these compounds in the presence of either verapamil or PAβN. The efflux pump KO mutants were more susceptible to these compounds in the presence of efflux inhibitors. We have shown that these four efflux pumps of M. tuberculosis play a vital role in mediating efflux of different chemical scaffolds. Inhibitors of one or several of these efflux pumps could have a significant impact in the treatment of tuberculosis. The identification and characterization of Rv0849, a new efflux pump belonging to the MFS (major facilitator superfamily) class, are reported.

  1. Mycobacterium tuberculosis phosphoribosylpyrophosphate synthetase: biochemical features of a crucial enzyme for mycobacterial cell wall biosynthesis.

    Directory of Open Access Journals (Sweden)

    Anna P Lucarelli

    Full Text Available The selection and soaring spread of Mycobacterium tuberculosis multidrug-resistant (MDR-TB and extensively drug-resistant strains (XDR-TB is a severe public health problem. Currently, there is an urgent need for new drugs for tuberculosis treatment, with novel mechanisms of action and, moreover, the necessity to identify new drug targets. Mycobacterial phosphoribosylpyrophosphate synthetase (MtbPRPPase is a crucial enzyme involved in the biosynthesis of decaprenylphosphoryl-arabinose, an essential precursor for the mycobacterial cell wall biosynthesis. Moreover, phosphoribosylpyrophosphate, which is the product of the PRPPase catalyzed reaction, is the precursor for the biosynthesis of nucleotides and of some amino acids such as histidine and tryptophan. In this context, the elucidation of the molecular and functional features of MtbPRPPase is mandatory. MtbPRPPase was obtained as a recombinant form, purified to homogeneity and characterized. According to its hexameric form, substrate specificity and requirement of phosphate for activity, the enzyme proved to belong to the class I of PRPPases. Although the sulfate mimicked the phosphate, it was less effective and required higher concentrations for the enzyme activation. MtbPRPPase showed hyperbolic response to ribose 5-phosphate, but sigmoidal behaviour towards Mg-ATP. The enzyme resulted to be allosterically activated by Mg(2+ or Mn(2+ and inhibited by Ca(2+ and Cu(2+ but, differently from other characterized PRPPases, it showed a better affinity for the Mn(2+ and Cu(2+ ions, indicating a different cation binding site geometry. Moreover, the enzyme from M. tuberculosis was allosterically inhibited by ADP, but less sensitive to inhibition by GDP. The characterization of M. tuberculosis PRPPase provides the starting point for the development of inhibitors for antitubercular drug design.

  2. Variable host-pathogen compatibility in Mycobacterium tuberculosis.

    NARCIS (Netherlands)

    Gagneux, Sebastien; DeRiemer, Kathryn; Van, Tran; Kato-Maeda, Midori; Jong, Bouke C de; Narayanan, Sujatha; Nicol, Mark; Niemann, Stefan; Kremer, Kristin; Gutierrez, M Cristina; Hilty, Markus; Hopewell, Philip C; Small, Peter M

    2006-01-01

    Mycobacterium tuberculosis remains a major cause of morbidity and mortality worldwide. Studies have reported human pathogens to have geographically structured population genetics, some of which have been linked to ancient human migrations. However, no study has addressed the potential evolutionary

  3. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains

    KAUST Repository

    Coll, Francesc; McNerney, Ruth; Guerra-Assunç ã o, José Afonso; Glynn, Judith R.; Perdigã o, Joã o; Viveiros, Miguel; Portugal, Isabel; Pain, Arnab; Martin, Nigel; Clark, Taane G.

    2014-01-01

    Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed

  4. Drug susceptibility testing of Mycobacterium tuberculosis to fluoroquinolones

    DEFF Research Database (Denmark)

    Johansen, I S; Larsen, A R; Sandven, P

    2003-01-01

    In the first attempt to establish a quality assurance programme for susceptibility testing of Mycobacterium tuberculosis to fluoroquinolones, 20 strains with different fluoroquinolone susceptibility patterns were distributed by the Supranational Reference Laboratory in Stockholm to the other...

  5. Bloodstream Infections with Mycobacterium tuberculosis among HIV patients

    Centers for Disease Control (CDC) Podcasts

    This podcast looks at bloodstream infections with Mycobacterium tuberculosis and other pathogens among outpatients infected with HIV in Southeast Asia. CDC health scientist Kimberly McCarthy discusses the study and why bloodstream infections occur in HIV-infected populations.

  6. In vitro drug susceptibility of Mycobacterium tuberculosis for amikacin, kanamycin and capreomycin.

    NARCIS (Netherlands)

    Dijkstra, J A; van der Laan, T; Akkerman, O W; Bolhuis, M S; de Lange, W C M; Kosterink, J G W; van der Werf, T S; Alffenaar, J W C; van Soolingen, D

    2018-01-01

    Amikacin, kanamycin and capreomycin are listed among the most important 2nd line drugs for multidrug resistant tuberculosis. Although amikacin and kanamycin are administered in the same dose and show the same pharmacokinetics, they have different WHO breakpoints suggesting that the two drugs have a

  7. Development of a three component complex to increase isoniazid efficacy against isoniazid resistant and nonresistant Mycobacterium tuberculosis.

    Science.gov (United States)

    Manning, Thomas; Plummer, Sydney; Baker, Tess; Wylie, Greg; Clingenpeel, Amy C; Phillips, Dennis

    2015-10-15

    The bacterium responsible for causing tuberculosis has evolved resistance to antibiotics used to treat the disease, resulting in new multidrug resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug resistant M. tuberculosis (XDR-TB) strains. Analytical techniques (1)H and (13)C Nuclear Magnetic Resonance (NMR), Fourier Transform-Ion Cyclotron Resonance with Electrospray Ionization (FT-ICR/ESI), and Matrix Assisted Laser Desorption Ionization-Mass Spectrometry (MALDI-TOF-MS) were used to study different aspects of the Cu(II)-polyethylene glycol (PEG-3350)-sucrose-isoniazid and Cu(II)-polyethylene glycol (PEG3350)-glucose-isoniazid complexes. The Cu(II) cation, sucrose or glucose, and the aggregate formed by PEG primarily serve as a composite drug delivery agent for the frontline antibiotic, however the improvement in MIC values produced with the CU-PEG-SUC-INH complex suggest an additional effect. Several Cu-PEG-SUC-INH complex variations were tested against INH resistant and nonresistant strains of M. tuberculosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Genetic diversity of the Mycobacterium tuberculosis East African–Indian family in three tropical Asian countries

    Directory of Open Access Journals (Sweden)

    Yih-Yuan Chen

    2017-12-01

    Full Text Available Background: The Beijing lineage of Mycobacterium tuberculosis (MTB is the most predominant MTB strain in Asian countries and is spreading worldwide, however, the East African–Indian (EAI lineage is also particularly prevalent in many tropical Asian countries. The evolutionary relationships among MTB EAI isolates from Taiwan and those of tropical Asian countries remain unknown. Methods: The EAI strains collected from patients in Taiwan were analyzed using spacer oligonucleotide typing and mycobacterial interspersed repetitive unit–variable number of tandem repeats (MIRU-VNTR typing, and compared with published profiles from Cambodia and Singapore to investigate potential epidemiological linkages. Results: Among the three countries, the EAI lineage was most prevalent in Cambodia (60%; Singapore, 25.62%; and Taiwan, 21.85%, having also the highest rates of multidrug resistance and lowest rates of clustering of MTB isolates. We describe a convenient method using seven selected MIRU-VNTR loci for first-line typing to discriminate Beijing and EAI lineages. A potential epidemiological linkage in these tropical Asian countries is also discussed based on a minimum-spanning tree constructed using 24 MIRU-VNTR loci of MTB EAI strains. Conclusion: This study identified evolutionary relationships among MTB EAI isolates from Taiwan and those of two other tropical Asian countries, Cambodia and Singapore. Keywords: East African–Indian family, Mycobacterium tuberculosis, tropical Asian countries

  9. Ambulatory Multi-Drug Resistant Tuberculosis Treatment Outcomes in a Cohort of HIV-Infected Patients in a Slum Setting in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Cox, Helen S.; Varghese, Bhanumati; Montaldo, Chiara; Da Silva, Esdras; Mansoor, Homa; Ladomirska, Joanna; Sotgiu, Giovanni; Migliori, Giovanni B.; Pontali, Emanuele; Saranchuk, Peter; Rodrigues, Camilla; Reid, Tony

    2011-01-01

    Background India carries one quarter of the global burden of multi-drug resistant TB (MDR-TB) and has an estimated 2.5 million people living with HIV. Despite this reality, provision of treatment for MDR-TB is extremely limited, particularly for HIV-infected individuals. Médecins Sans Frontières (MSF) has been treating HIV-infected MDR-TB patients in Mumbai since May 2007. This is the first report of treatment outcomes among HIV-infected MDR-TB patients in India. Methods HIV-infected patients with suspected MDR-TB were referred to the MSF-clinic by public Antiretroviral Therapy (ART) Centers or by a network of community non-governmental organizations. Patients were initiated on either empiric or individualized second-line TB-treatment as per WHO recommendations. MDR-TB treatment was given on an ambulatory basis and under directly observed therapy using a decentralized network of providers. Patients not already receiving ART were started on treatment within two months of initiating MDR-TB treatment. Results Between May 2007 and May 2011, 71 HIV-infected patients were suspected to have MDR-TB, and 58 were initiated on treatment. MDR-TB was confirmed in 45 (78%), of which 18 (40%) were resistant to ofloxacin. Final treatment outcomes were available for 23 patients; 11 (48%) were successfully treated, 4 (17%) died, 6 (26%) defaulted, and 2 (9%) failed treatment. Overall, among 58 patients on treatment, 13 (22%) were successfully treated, 13 (22%) died, 7 (12%) defaulted, two (3%) failed treatment, and 23 (40%) were alive and still on treatment at the end of the observation period. Twenty-six patients (45%) experienced moderate to severe adverse events, requiring modification of the regimen in 12 (20%). Overall, 20 (28%) of the 71 patients with MDR-TB died, including 7 not initiated on treatment. Conclusions Despite high fluoroquinolone resistance and extensive prior second-line treatment, encouraging results are being achieved in an ambulatory MDR-T- program in a slum setting in India. Rapid scale-up of both ART and second-line treatment for MDR-TB is needed to ensure survival of co-infected patients and mitigate this growing epidemic. PMID:22145022

  10. The Use Of Rap-PCR In Studying Mycobacterium tuberculosis ...

    African Journals Online (AJOL)

    Mycobacterium tuberculosis is the second leading cause of death from infectious agent. This study sought to detect M. tuberculosis genes, which were specifically expressed, or upregulated during intracellular infection of. J774 murine macrophages; as such genes may be potential targets for novel drug action. J774 murine ...

  11. Advances in the Laboratory Diagnosis of Mycobacterium Tuberculosis

    African Journals Online (AJOL)

    Mycobacterium tuberculosis (MTB), the agent of human tuberculosis remains a leading cause of mortality globally. Its resurgence during the last two decades is a reflection of its opportunistic relationship with HIV. The challenges associated with the disease are enormous and often debilitating. The role of clinical and ...

  12. Adaptation and evolution of drug-resistant Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Bergval, I.L.

    2013-01-01

    Many studies have been conducted on drug resistance and the evolution of Mycobacterium tuberculosis. Notwithstanding, many molecular mechanisms facilitating the emergence, adaptation and spread of drug-resistant tuberculosis have yet to be discovered. This thesis reports studies of the adaptive

  13. Benzothiazinones kill Mycobacterium tuberculosis by blocking arabinan synthesis

    DEFF Research Database (Denmark)

    Makarov, Vadim; Manina, Giulia; Mikusova, Katarina

    2009-01-01

    New drugs are required to counter the tuberculosis (TB) pandemic. Here, we describe the synthesis and characterization of 1,3-benzothiazin-4-ones (BTZs), a new class of antimycobacterial agents that kill Mycobacterium tuberculosis in vitro, ex vivo, and in mouse models of TB. Using genetics...

  14. Management of latent Mycobacterium tuberculosis infection: WHO guidelines for low tuberculosis burden countries

    NARCIS (Netherlands)

    Getahun, Haileyesus; Matteelli, Alberto; Abubakar, Ibrahim; Aziz, Mohamed Abdel; Baddeley, Annabel; Barreira, Draurio; den Boon, Saskia; Borroto Gutierrez, Susana Marta; Bruchfeld, Judith; Burhan, Erlina; Cavalcante, Solange; Cedillos, Rolando; Chaisson, Richard; Chee, Cynthia Bin-Eng; Chesire, Lucy; Corbett, Elizabeth; Dara, Masoud; Denholm, Justin; de Vries, Gerard; Falzon, Dennis; Ford, Nathan; Gale-Rowe, Margaret; Gilpin, Chris; Girardi, Enrico; Go, Un-Yeong; Govindasamy, Darshini; D Grant, Alison; Grzemska, Malgorzata; Harris, Ross; Horsburgh, C. Robert; Ismayilov, Asker; Jaramillo, Ernesto; Kik, Sandra; Kranzer, Katharina; Lienhardt, Christian; LoBue, Philip; Lönnroth, Knut; Marks, Guy; Menzies, Dick; Migliori, Giovanni Battista; Mosca, Davide; Mukadi, Ya Diul; Mwinga, Alwyn; Nelson, Lisa; Nishikiori, Nobuyuki; Oordt-Speets, Anouk; Rangaka, Molebogeng Xheedha; Reis, Andreas; Rotz, Lisa; Sandgren, Andreas; Sañé Schepisi, Monica; Schünemann, Holger J.; Sharma, Surender Kumar; Sotgiu, Giovanni; Stagg, Helen R.; Sterling, Timothy R.; Tayeb, Tamara; Uplekar, Mukund; van der Werf, Marieke J.; Vandevelde, Wim; van Kessel, Femke; van't Hoog, Anna; Varma, Jay K.; Vezhnina, Natalia; Voniatis, Constantia; Vonk Noordegraaf-Schouten, Marije; Weil, Diana; Weyer, Karin; Wilkinson, Robert John; Yoshiyama, Takashi; Zellweger, Jean Pierre; Raviglione, Mario

    2015-01-01

    Latent tuberculosis infection (LTBI) is characterised by the presence of immune responses to previously acquired Mycobacterium tuberculosis infection without clinical evidence of active tuberculosis (TB). Here we report evidence-based guidelines from the World Health Organization for a public health

  15. The cell envelope glycoconjugates of Mycobacterium tuberculosis

    Science.gov (United States)

    Angala, Shiva Kumar; Belardinelli, Juan Manuel; Huc-Claustre, Emilie; Wheat, William H.; Jackson, Mary

    2015-01-01

    Tuberculosis (TB) remains the second most common cause of death due to a single infectious agent. The cell envelope of Mycobacterium tuberculosis (Mtb), the causative agent of the disease in humans, is a source of unique glycoconjugates and the most distinctive feature of the biology of this organism. It is the basis of much of Mtb pathogenesis and one of the major causes of its intrinsic resistance to chemotherapeutic agents. At the same time, the unique structures of Mtb cell envelope glycoconjugates, their antigenicity and essentiality for mycobacterial growth provide opportunities for drug, vaccine, diagnostic and biomarker development, as clearly illustrated by recent advances in all of these translational aspects. This review focuses on our current understanding of the structure and biogenesis of Mtb glycoconjugates with particular emphasis on one of most intriguing and least understood aspect of the physiology of mycobacteria: the translocation of these complex macromolecules across the different layers of the cell envelope. It further reviews the rather impressive progress made in the last ten years in the discovery and development of novel inhibitors targeting their biogenesis. PMID:24915502

  16. Determination of in vitro synergy between linezolid and other antimicrobial agents against Mycobacterium tuberculosis isolates.

    Science.gov (United States)

    Zou, Lin; Liu, Min; Wang, Yufeng; Lu, Jie; Pang, Yu

    2015-12-01

    In this study, our objective was to explore the potential in vitro synergy between linezolid (LZD) and six other anti-TB drugs in Mycobacterium tuberculosis strains, especially multidrug-resistant tuberculosis (MDR-TB) strains. Among the different combinations, the LZD-clarithromycin (CLA) combination showed the best synergism, which was observed in 85% (34/40) of 40 isolates. In addition, one (2.5%) and twenty-one (52.5%) of 40 isolates showed synergism for the LZD-levofloxcin (LEV) and LZD-moxifloxacin (MOX) combinations, respectively, and the difference in the proportion of synergy between these two combinations was significantly different (P synergy against non-MDR group seemed higher than that against MDR group in each combination, while the significant difference was only observed in the LZD-EMB combination (P = 0.046). In conclusion, our findings demonstrate that LZD shows the synergistic activity against both non-MDR and MDR M. tuberculosis strains when in combination with CLA, EMB, MOX, amikacin and clofazimine, indicating that LZD may be considered as a promising component involving the regimen for the treatment of MDR-TB. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. A snapshot of genetic lineages of Mycobacterium tuberculosis in Ireland over a two-year period, 2010 and 2011.

    LENUS (Irish Health Repository)

    Fitzgibbon, M M

    2013-01-01

    Mycobacterial interspersed repetitive-unit-variable-number tandem repeat typing alone was used to investigate the genetic lineages among 361 Mycobacterium tuberculosis strains circulating in Ireland over a two-year period, 2010 and 2011. The majority of isolates, 63% (229\\/361), belonged to lineage 4 (Euro-American), while lineages 1 (Indo-Oceanic), 2 (East-Asian) and 3 (East-African–Indian) represented 12% of isolates each (42\\/361, 45\\/361, and 45\\/361, respectively). Sub-lineages Beijing (lineage 2), East-African–Indian (lineage 1) and Delhi\\/central-Asian (lineage 3) predominated among foreign-born cases, while a higher proportion of Euro-American lineages were identified among cases born in Ireland. Eighteen molecular clusters involving 63 tuberculosis (TB) cases were identified across four sub-lineages of lineage 4. While the mean cluster size was 3.5 TB cases, the largest cluster (involving 12 Irish-born cases) was identified in the Latin American–Mediterranean sub-lineage. Clustering of isolates was higher among Irish-born TB cases (47 of 63 clustered cases), whereas only one cluster (3\\/63) involved solely foreign-born individuals. Four multidrug-resistant cases identified during this period represented lineages 2 and 4. This study provides the first insight into the structure of the M. tuberculosis population in Ireland.

  18. Surgical aspects of pulmonary tuberculosis: an update.

    Science.gov (United States)

    Dewan, Ravindra Kumar; Pezzella, A Thomas

    2016-10-01

    Tuberculosis remains a major global medical challenge and concern. In the world's population of over 7.4 billion people, 8.6 million are estimated to be infected with Mycobacterium tuberculosis; another 2.2 billion have latent tuberculosis. There is an annual incidence of 16,000 new cases in the USA and 7-8 million new cases worldwide, of which 440,000 are multidrug-resistant or extensively multidrug-resistant, mainly in developing countries or emerging economies. According to the World Health Organization, the incidence of tuberculosis is 133 cases per 100,000 of the population; 3.3% new cases are drug resistant and 20% are already treated cases. Of the drug-resistant cases, 9.7% are extensively drug-resistant. The annual global mortality attributable to tuberculosis is over 1.3 million people. The association with HIV/AIDS in 430,000 people has compounded the global concern and challenge. This review presents the historical indications for surgical treatment of tuberculosis, reviews the current literature and clinical experience, and collates this into increased awareness and contemporary understanding of the indications and need for surgery in primary active tuberculosis, adjuvant surgical therapy for multidrug-resistant tuberculosis, and the complications of chronic tuberculosis sequelae or previous tuberculosis surgery. © The Author(s) 2016.

  19. Altered membrane permeability in multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... involvement during the transport of β - lactams in multidrug resistant Escherichia coli isolated from extra-intestinal infections. Also, the ... lactam resistance in multidrug resistant E. coli in ESBL and non-ESBL isolates. .... and decreased susceptibility to carbapenems, particularly ertapenem (Perez et al.,.

  20. Mycobacterium tuberculosis has diminished capacity to counteract redox stress induced by elevated levels of endogenous superoxide.

    Science.gov (United States)

    Tyagi, Priyanka; Dharmaraja, Allimuthu T; Bhaskar, Ashima; Chakrapani, Harinath; Singh, Amit

    2015-07-01

    Mycobacterium tuberculosis (Mtb) has evolved protective and detoxification mechanisms to maintain cytoplasmic redox balance in response to exogenous oxidative stress encountered inside host phagocytes. In contrast, little is known about the dynamic response of this pathogen to endogenous oxidative stress generated within Mtb. Using a noninvasive and specific biosensor of cytoplasmic redox state of Mtb, we for first time discovered a surprisingly high sensitivity of this pathogen to perturbation in redox homeostasis induced by elevated endogenous reactive oxygen species (ROS). We synthesized a series of hydroquinone-based small molecule ROS generators and found that ATD-3169 permeated mycobacteria to reliably enhance endogenous ROS including superoxide radicals. When Mtb strains including multidrug-resistant (MDR) and extensively drug-resistant (XDR) patient isolates were exposed to this compound, a dose-dependent, long-lasting, and irreversible oxidative shift in intramycobacterial redox potential was detected. Dynamic redox potential measurements revealed that Mtb had diminished capacity to restore cytoplasmic redox balance in comparison with Mycobacterium smegmatis (Msm), a fast growing nonpathogenic mycobacterial species. Accordingly, Mtb strains were extremely susceptible to inhibition by ATD-3169 but not Msm, suggesting a functional linkage between dynamic redox changes and survival. Microarray analysis showed major realignment of pathways involved in redox homeostasis, central metabolism, DNA repair, and cell wall lipid biosynthesis in response to ATD-3169, all consistent with enhanced endogenous ROS contributing to lethality induced by this compound. This work provides empirical evidence that the cytoplasmic redox poise of Mtb is uniquely sensitive to manipulation in steady-state endogenous ROS levels, thus revealing the importance of targeting intramycobacterial redox metabolism for controlling TB infection. Copyright © 2015 The Authors. Published by

  1. Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance.

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with

  2. Molecular typing of mycobacterium tuberculosis isolates circulating in Jiangsu Province, China

    Directory of Open Access Journals (Sweden)

    Dong Haiyan

    2011-10-01

    Full Text Available Abstract Background Globally, China is the second place with high burden of tuberculosis (TB. To explore the characteristics of the pathogens of Mycobacterium tuberculosis (MTB circulating in this area is helpful for understanding and controlling the spread of the strains. Recent developments in molecular biology have allowed prompt identification and tracking specific strains of MTB spreading through the population. Methods Spacer-oligonucleotide typing (spoligotyping and mycobacterial interspersed repetitive units variable number tandem repeat (MIRU-VNTR were performed in combination to yield specific genetic profiles of 260 MTB strains isolated from 30 counties of Jiangsu province in China between June and July 2010. The spoligotyping results were in comparison to the world Spoligotyping Database of Institute Pasteur de Guadeloupe (SpolDB4. Drug susceptibility test (DST was performed on all strains by proportion method on Lowenstein-Jensen (LJ culture media. Results Based on the spoligotyping method, 246 strains displayed known patterns and 14 were absent in the database. Predominant spoligotypes belonged to the Beijing family (80.4%. By using the 24-loci VNTR typing scheme, 224 different patterns were identified, including 20 clusters and 204 unique patterns. The largest clade comprised 195 strains belonging to the Beijing family. The combination of spoligotyping and 24-loci MIRU-VNTR demonstrated maximal discriminatory power. Furthermore, we observed a significant association between Beijing family strains and drug-resistant phenotypes. The Beijing family strains presented increased risks for developing multi-drug resistant TB, with the OR (95% CI of 11.07(1.45-84.50. Conclusions The present study demonstrated that Beijing family isolates were the most prevalent strains circulating in Jiangsu province of China. The utility of spoligotyping in combination with 24-loci MIRU-VNTR might be a useful tool for epidemiological analysis of MTB

  3. Microbe Profile: Mycobacterium tuberculosis: Humanity's deadly microbial foe.

    Science.gov (United States)

    Gordon, Stephen V; Parish, Tanya

    2018-04-01

    Mycobacterium tuberculosis is an expert and deadly pathogen, causing the disease tuberculosis (TB) in humans. It has several notable features: the ability to enter non-replicating states for long periods and cause latent infection; metabolic remodelling during chronic infection; a thick, waxy cell wall; slow growth rate in culture; and intrinsic drug resistance and antibiotic tolerance. As a pathogen, M. tuberculosis has a complex relationship with its host, is able to replicate inside macrophages, and expresses diverse immunomodulatory molecules. M. tuberculosis currently causes over 1.8 million deaths a year, making it the world's most deadly human pathogen.

  4. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  5. The transcriptional regulatory network of Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Joaquín Sanz

    Full Text Available Under the perspectives of network science and systems biology, the characterization of transcriptional regulatory (TR networks beyond the context of model organisms offers a versatile tool whose potential remains yet mainly unexplored. In this work, we present an updated version of the TR network of Mycobacterium tuberculosis (M.tb, which incorporates newly characterized transcriptional regulations coming from 31 recent, different experimental works available in the literature. As a result of the incorporation of these data, the new network doubles the size of previous data collections, incorporating more than a third of the entire genome of the bacterium. We also present an exhaustive topological analysis of the new assembled network, focusing on the statistical characterization of motifs significances and the comparison with other model organisms. The expanded M.tb transcriptional regulatory network, considering its volume and completeness, constitutes an important resource for diverse tasks such as dynamic modeling of gene expression and signaling processes, computational reliability determination or protein function prediction, being the latter of particular relevance, given that the function of only a small percent of the proteins of M.tb is known.

  6. Análise comparativa entre tuberculose multirresistente e tuberculose extensivamente resistente - Epidemiologia e factores preditivos Comparative analysis of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis - Epidemiology and predictive factors

    Directory of Open Access Journals (Sweden)

    Ana Sofia Vilariça

    2008-12-01

    ,3% eram TBXDR. Observaram -se diferenças estatisticamente significativas nas seguintes variáveis: raça (a raça negra esteve associada a TBXDR em 74% dos casos versus 46% da raça caucasiana; classificação OMS (doentes com retratamento por insucesso terapêutico, interrupção do tratamento ou recidiva constituíram 69,5% dos casos de TBXDR versus 44,5 % dos casos não TBXDR; duração média dos tratamentos anteriores (4,2 meses para os casos de TBXDR versus 2,8 meses para os casos não TBXDR; coinfecção VIH/SIDA (doentes com coinfecção VIH constituíram 65,2% dos casos de TB XDR versus 42,9% dos casos não TBXDR e mortalidade (33,3% nos doentes com TBXDR versus 14,3% nos doentes não TBXDR. Conclusões: As variáveis com valor preditivo para o diagnóstico de TBXDR versus não TBXDR foram: presença de infecção VIH (risco relativo [RR] para TBXDR de 2,5; intervalo de confiança [IC], 1,24 - 5,05; maior duração média dos tratamentos anteriores ([RR] para TB XDR de 1,2; [IC], 1,11 -2,30 .Introduction: Extensively drug-resistant tuberculosis (XDR-TB is defined as a form of multidrug-resistant tuberculosis (MDR-TB with additional resistance to fluoroquinolones and at least one of the injectable drugs used in tuberculosis treatment: amikacin, kanamycin and capreomycin. It was classified by WHO as a serious threat to tuberculosis (TB control, with world-wide consequences, taking on the proportions of a real pandemic in some regions. Aim: To compare patients with XDR-TB versus other MDR-TB profiles with regard to epidemiological and demographic characteristics, aetiopathogenic factors and inhospital outcomes. Methods: Patients admitted to Pulido Valente Hospital (Pulmonology Service III in the period ranging from April 1999 to June 2007 with MDR-TB diagnosis microbiologically confirmed. The following variables were evaluated: gender, age, race, forms of TB presentation, treatment groups, resistance profile, immigrant status, number and duration of previous

  7. A Case of False-Positive Mycobacterium tuberculosis Caused by Mycobacterium celatum

    Directory of Open Access Journals (Sweden)

    Edward Gildeh

    2016-01-01

    Full Text Available Mycobacterium celatum is a nontuberculous mycobacterium shown to cause symptoms similar to pulmonary M. tuberculosis. Certain strains have been shown to cross-react with the probes used to detect M. tuberculosis, making this a diagnostic challenge. We present a 56-year-old gentleman who developed signs and symptoms of lung infection with computed tomography scan of the chest showing right lung apex cavitation. Serial sputum samples were positive for acid-fast bacilli and nucleic acid amplification testing identified M. tuberculosis ribosomal RNA, resulting in treatment initiation. Further testing with high performance liquid chromatography showed a pattern consistent with M. celatum. This case illustrates the potential for M. celatum to mimic M. tuberculosis in both its clinical history and laboratory testing due to the identical oligonucleotide sequence contained in both. An increasing number of case reports suggest that early reliable differentiation could reduce unnecessary treatment and public health intervention associated with misdiagnosed tuberculosis.

  8. Immune responses to the Mycobacterium tuberculosis-specific antigen ESAT-6 signal subclinical infection among contacts of tuberculosis patients

    DEFF Research Database (Denmark)

    Doherty, T Mark; Demissie, Abebech; Olobo, Joseph

    2002-01-01

    Diagnosis of latent Mycobacterium tuberculosis infection is considered essential for tuberculosis control but is hampered by the lack of specific reagents. We report that strong recognition of tuberculosis complex-specific antigen ESAT-6 by healthy household contacts of tuberculosis patients...... correlates with the subsequent development of active tuberculosis during a 2-year follow-up period....

  9. Susceptibility of Mycobacterium tuberculosis to sulfamethoxazole, trimethoprim and their combination over a 12 year period in Taiwan.

    Science.gov (United States)

    Huang, Tsi-Shu; Kunin, Calvin M; Yan, Bo-Shiun; Chen, Yao-Shen; Lee, Susan Shin-Jung; Syu, Wan

    2012-03-01

    This study was designed to determine the susceptibility of clinical isolates of multidrug-resistant (MDR) and non-MDR Mycobacterium tuberculosis to sulfamethoxazole, trimethoprim and trimethoprim/sulfamethoxazole over a 12 year period in Taiwan. We examined a total of 117 clinical isolates of M. tuberculosis collected from Southern Taiwan, 116 from 1995 to 2006 and an extensively drug-resistant (XDR) isolate in 2009. These included 28 isolates susceptible to all four first-line agents, 52 MDR isolates and 36 isolates with a mixed combination of drug resistance patterns other than MDR and 1 XDR isolate. Sulfamethoxazole inhibited 80% growth of all 117 isolates regardless of their susceptibility to the first-line agents at an MIC(90) of 9.5 mg/L. The concentration required to inhibit 99% growth was 38 mg/L. There were no significant changes in the MIC(50) or MIC(90) of sulfamethoxazole over a 12 year period. All 117 isolates were resistant to trimethoprim at >8 mg/L. The combination of trimethoprim/sulfamethoxazole at a ratio of 1:19 had no additive or synergistic effects. Sulfamethoxazole inhibited the growth of clinical isolates of M. tuberculosis at achievable concentrations in plasma after oral administration. Susceptibility to sulfamethoxazole remained constant over a 12 year period. Trimethoprim was inactive against M. tuberculosis and trimethoprim/sulfamethoxazole provided no additional activity. Although the current and prior studies demonstrate that sulfamethoxazole is active against M. tuberculosis the search needs to continue for more active, lipid-soluble sulphonamides that are better absorbed into tissues and have improved therapeutic efficacy.

  10. First baseline of circulating genotypic lineages of Mycobacterium tuberculosis in patients from the brazilian borders with Argentina and Paraguay.

    Directory of Open Access Journals (Sweden)

    Luzia Neri C Machado

    Full Text Available BACKGROUND: At the triple border Brazil/Paraguay/Argentina there is easy mobility from one city to another for economic and tourism activities. This constant and fast population mobility is mainly to visit Iguazu Falls, in the Iguazu River, on the border of the Brazilian state of Paraná and the Argentina. As the incidence of tuberculosis is high in this setting, our study aimed to establish a first baseline of circulating genotypic lineages of Mycobacterium tuberculosis. METHODOLOGY/PRINCIPAL FINDINGS: This study included 120 patients from 10 cities in southwestern Paraná, Brazil with pulmonary symptoms, from July 2009 to July 2011. Information about sex, age, clinical features and address was collected by reviewing the national tuberculosis notification database. Of these, 96 (80% isolates were identified as M. tuberculosis and 22 (22.9% were drug resistant (20, 20.8% INH mono-resistant and 2, 2.1% multidrug-resistant. All isolates were subjected to genotyping by Spoligotyping and MIRU-VNTR typing. The distribution of the isolates analyzed by spoligotyping revealed 30 distinct patterns. The four mainly detected clades were Latin American and Mediterranean (LAM, ill-defined T, Haarlem (H and S. The MIRU-VNTR showed 85 distinct patterns. Spoligotyping combined to MIRU-VNTR allowed 90 distinct patterns. CONCLUSIONS/SIGNIFICANCE: Our study demonstrated that there is significant molecular diversity in circulating M. tuberculosis, with predominance of the LAM and T clades in cities of southwestern Paraná, Brazil, bordering Argentina and Paraguay.

  11. Wild-type MIC distributions for aminoglycoside and cyclic polypeptide antibiotics used for treatment of Mycobacterium tuberculosis infections.

    Science.gov (United States)

    Juréen, P; Angeby, K; Sturegård, E; Chryssanthou, E; Giske, C G; Werngren, J; Nordvall, M; Johansson, A; Kahlmeter, G; Hoffner, S; Schön, T

    2010-05-01

    The aminoglycosides and cyclic polypeptides are essential drugs in the treatment of multidrug-resistant tuberculosis, underscoring the need for accurate and reproducible drug susceptibility testing (DST). The epidemiological cutoff value (ECOFF) separating wild-type susceptible strains from non-wild-type strains is an important but rarely used tool for indicating susceptibility breakpoints against Mycobacterium tuberculosis. In this study, we established wild-type MIC distributions on Middlebrook 7H10 medium for amikacin, kanamycin, streptomycin, capreomycin, and viomycin using 90 consecutive clinical isolates and 21 resistant strains. Overall, the MIC variation between and within runs did not exceed +/-1 MIC dilution step, and validation of MIC values in Bactec 960 MGIT demonstrated good agreement. Tentative ECOFFs defining the wild type were established for all investigated drugs, including amikacin and viomycin, which currently lack susceptibility breakpoints for 7H10. Five out of seven amikacin- and kanamycin-resistant isolates were classified as susceptible to capreomycin according to the current critical concentration (10 mg/liter) but were non-wild type according to the ECOFF (4 mg/liter), suggesting that the critical concentration may be too high. All amikacin- and kanamycin-resistant isolates were clearly below the ECOFF for viomycin, and two of them were below the ECOFF for streptomycin, indicating that these two drugs may be considered for treatment of amikacin-resistant strains. Pharmacodynamic indices (peak serum concentration [Cmax]/MIC) were more favorable for amikacin and viomycin compared to kanamycin and capreomycin. In conclusion, our data emphasize the importance of establishing wild-type MIC distributions for improving the quality of drug susceptibility testing against Mycobacterium tuberculosis.

  12. Wild-Type MIC Distributions for Aminoglycoside and Cyclic Polypeptide Antibiotics Used for Treatment of Mycobacterium tuberculosis Infections▿

    Science.gov (United States)

    Juréen, P.; Ängeby, K.; Sturegård, E.; Chryssanthou, E.; Giske, C. G.; Werngren, J.; Nordvall, M.; Johansson, A.; Kahlmeter, G.; Hoffner, S.; Schön, T.

    2010-01-01

    The aminoglycosides and cyclic polypeptides are essential drugs in the treatment of multidrug-resistant tuberculosis, underscoring the need for accurate and reproducible drug susceptibility testing (DST). The epidemiological cutoff value (ECOFF) separating wild-type susceptible strains from non-wild-type strains is an important but rarely used tool for indicating susceptibility breakpoints against Mycobacterium tuberculosis. In this study, we established wild-type MIC distributions on Middlebrook 7H10 medium for amikacin, kanamycin, streptomycin, capreomycin, and viomycin using 90 consecutive clinical isolates and 21 resistant strains. Overall, the MIC variation between and within runs did not exceed ±1 MIC dilution step, and validation of MIC values in Bactec 960 MGIT demonstrated good agreement. Tentative ECOFFs defining the wild type were established for all investigated drugs, including amikacin and viomycin, which currently lack susceptibility breakpoints for 7H10. Five out of seven amikacin- and kanamycin-resistant isolates were classified as susceptible to capreomycin according to the current critical concentration (10 mg/liter) but were non-wild type according to the ECOFF (4 mg/liter), suggesting that the critical concentration may be too high. All amikacin- and kanamycin-resistant isolates were clearly below the ECOFF for viomycin, and two of them were below the ECOFF for streptomycin, indicating that these two drugs may be considered for treatment of amikacin-resistant strains. Pharmacodynamic indices (peak serum concentration [Cmax]/MIC) were more favorable for amikacin and viomycin compared to kanamycin and capreomycin. In conclusion, our data emphasize the importance of establishing wild-type MIC distributions for improving the quality of drug susceptibility testing against Mycobacterium tuberculosis. PMID:20237102

  13. Drug susceptibility of Mycobacterium tuberculosis in a rural area of Bangladesh and its relevance to the national treatment regimens.

    Science.gov (United States)

    Van Deun, A; Aung, K J; Chowdhury, S; Saha, S; Pankaj, A; Ashraf, A; Rigouts, L; Fissette, K; Portaels, F

    1999-02-01

    Greater Mymensingh District, a rural area of Bangladesh, at the start of the National Tuberculosis Programme (NTP). To determine the prevalence of initial and acquired drug resistance of Mycobacterium tuberculosis, and to assess the appropriateness of the NTP's standard regimens. Sampling of pre-treatment sputum from all newly registered smear-positive cases in five centres covering the area. Culture and susceptibility testing in a supra-national reference laboratory. Initial resistance to isoniazid (H) was 5.4%, and to rifampicin (R) 0.5%. Acquired H and R resistance were 25.9% and 7.4%, respectively. Multidrug resistance (MDR) was observed in one new case only and in 5.6% of previously treated patients. Changing the present NTP indication for retreatment regimen to one month of previous H intake would increase coverage of H-resistant cases from 52% to 89%, adding 6% to drug costs. The prevalence of drug resistance is surprisingly low in Bangladesh, but could rise with improving economic conditions. The NTP regimens for smear-positive cases are appropriate, all the more so since the human immunodeficiency virus is virtually absent. Indications for the retreatment regimen should be extended to include all patients treated for at least one month with any drug. The NTP regimen for smear-negative cases runs the risk of leading to MDR under present field conditions.

  14. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients

    Directory of Open Access Journals (Sweden)

    Daniel Eklund

    2013-01-01

    Full Text Available The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB, the bacterium responsible for tuberculosis (TB, has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth.

  15. Intraocular manifestations of mycobacterium tuberculosis: A review of the literature

    Directory of Open Access Journals (Sweden)

    Lauren A. Dalvin

    2017-05-01

    Full Text Available Mycobacterium tuberculosis: is most commonly associated with pulmonary infection. However, tuberculosis (TB can also affect the eye. TB can affect nearly any tissue in the eye, and a high index of suspicion is required for accurate diagnosis, as many of the intraocular manifestations of TB can mimic other, more common diseases. Correct diagnosis is critical because systemic anti-tuberculosis treatment may be required, and vision loss or even loss of the affected eye can occur without proper treatment. Thus, it is important for ophthalmologists and infectious disease specialists to work together to accurately diagnose and treat intraocular TB. This article reports the various known presentations of intraocular TB and reviews important elements of diagnosis and treatment. Keywords: Mycobacterium, Tuberculosis, Choroidal granuloma, Retinal vasculitis

  16. Diversity and evolution of drug resistance mechanisms in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Al-Saeedi M

    2017-10-01

    Full Text Available Mashael Al-Saeedi, Sahal Al-Hajoj Department of Infection and Immunity, Mycobacteriology Research Section, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia Abstract: Despite the efficacy of antibiotics to protect humankind against many deadly pathogens, such as Mycobacterium tuberculosis, nothing can prevent the emergence of drug-resistant strains. Several mechanisms facilitate drug resistance in M. tuberculosis including compensatory evolution, epistasis, clonal interference, cell wall integrity, efflux pumps, and target mimicry. In this study, we present recent findings relevant to these mechanisms, which can enable the discovery of new drug targets and subsequent development of novel drugs for treatment of drug-resistant M. tuberculosis. Keywords: Mycobacterium tuberculosis, antibiotic resistance, compensatory evolution, epistasis, efflux pumps, fitness cost

  17. A Mycobacterium tuberculosis cluster demonstrating the use of genotyping in urban tuberculosis control

    NARCIS (Netherlands)

    G. de Vries (Gerard); R.M. van Hest (Reinier); C.C.A. Burdo (Conny); D. van Soolingen (Dick); J.H. Richardus (Jan Hendrik)

    2009-01-01

    textabstractBackground: DNA fingerprinting of Mycobacterium tuberculosis isolates offers better opportunities to study links between tuberculosis (TB) cases and can highlight relevant issues in urban TB control in low-endemic countries. Methods: A medium-sized molecular cluster of TB cases with

  18. Real-Time Measurement of Host Bioenergetics During Mycobacterium Tuberculosis Infection

    Science.gov (United States)

    2015-05-01

    AWARD NUMBER: W81XWH-13-1-0149 TITLE: “Real-Time Measurement of Host Bioenergetics During Mycobacterium Tuberculosis Infection...successfully adapted metabolic flux analysis using a Seahorse XF96 metabolic flux analyzer to study Mycobacterium tuberculosis energy metabolism in an...Mycobacterium tuberculosis function. In: Systems Biology of Tuberculosis . Editors: J McFadden, D Beste and A Kierzek. 2013. Springer, New York, NY. 2

  19. Clonal expansion across the seas as seen through CPLP-TB database: A joint effort in cataloguing Mycobacterium tuberculosis genetic diversity in Portuguese-speaking countries

    KAUST Repository

    Perdigão, João

    2018-03-18

    Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.

  20. Clonal expansion across the seas as seen through CPLP-TB database: A joint effort in cataloguing Mycobacterium tuberculosis genetic diversity in Portuguese-speaking countries

    KAUST Repository

    Perdigã o, Joã o; Silva, Carla; Diniz, Jaciara; Pereira, Catarina; Machado, Diana; Ramos, Jorge; Silva, Hugo; Abilleira, Fernanda; Brum, Clarice; Reis, Ana J.; Macedo, Maí ra; Scaini, Joã o L.; Silva, Ana B.; Esteves, Leonardo; Macedo, Rita; Maltez, Fernando; Clemente, Sofia; Coelho, Elizabeth; Viegas, Sofia; Rabna, Paulo; Rodrigues, Amabé lia; Taveira, Nuno; Jordao, Luí sa; Kritski, Afrâ nio; e Silva, José Lapa; Mokrousov, Igor; Couvin, David; Rastogi, Nalin; Couto, Isabel; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; von Groll, Andrea; Dalla-Costa, Elis R.; Rossetti, Maria Lú cia; da Silva, Pedro E.A.; Viveiros, Miguel; Portugal, Isabel

    2018-01-01

    Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space.To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends.

  1. Nicotine Impairs Macrophage Control of Mycobacterium tuberculosis.

    Science.gov (United States)

    Bai, Xiyuan; Stitzel, Jerry A; Bai, An; Zambrano, Cristian A; Phillips, Matthew; Marrack, Philippa; Chan, Edward D

    2017-09-01

    Pure nicotine impairs macrophage killing of Mycobacterium tuberculosis (MTB), but it is not known whether the nicotine component in cigarette smoke (CS) plays a role. Moreover, the mechanisms by which nicotine impairs macrophage immunity against MTB have not been explored. To neutralize the effects of nicotine in CS extract, we used a competitive inhibitor to the nicotinic acetylcholine receptor (nAChR)-mecamylamine-as well as macrophages derived from mice with genetic disruption of specific subunits of nAChR. We also determined whether nicotine impaired macrophage autophagy and whether nicotine-exposed T regulatory cells (Tregs) could subvert macrophage anti-MTB immunity. Mecamylamine reduced the CS extract increase in MTB burden by 43%. CS extract increase in MTB was also significantly attenuated in macrophages from mice with genetic disruption of either the α7, β2, or β4 subunit of nAChR. Nicotine inhibited autophagosome formation in MTB-infected THP-1 cells and primary murine alveolar macrophages, as well as increased the intracellular MTB burden. Nicotine increased migration of THP-1 cells, consistent with the increased number of macrophages found in the lungs of smokers. Nicotine induced Tregs to produce transforming growth factor-β. Naive mouse macrophages co-cultured with nicotine-exposed Tregs had significantly greater numbers of viable MTB recovered with increased IL-10 production and urea production, but no difference in secreted nitric oxide as compared with macrophages cocultured with unexposed Tregs. We conclude that nicotine in CS plays an important role in subverting macrophage control of MTB infection.

  2. Multidrug resistance in amoebiasis patients.

    Science.gov (United States)

    Bansal, Devendra; Sehgal, Rakesh; Chawla, Yogesh; Malla, Nancy; Mahajan, R C

    2006-08-01

    Amoebiasis, caused by Entamoeba sp. a protozoan parasite, is a major public health problem in tropical and subtropical countries. The symptomatic patients are treated by specific chemotherapy. However, there are reports of treatment failure in some cases suggesting the possibility of drug resistance. The present study was therefore planned to assess the presence and expression of mRNA of multidrug resistance (MDR) gene in clinical isolates of Entamoeba histolytica and E. dispar. Forty five clinical isolates of Entamoeba sp. [E. histolytica (15) and E. dispar (30)] were maintained in polyxenic followed by monoxenic medium. DNA and total RNA were extracted from clinical isolates of Entamoeba sp. and from sensitive strain of E. histolytica (HM1: IMSS) and subjected to polymerase chain reaction (PCR) and multiplex reverse transcription (RT)-PCR techniques. The 344 bp segment of E. histolytica DNA was seen by PCR using primers specific to EhPgp1 in all clinical isolates and sensitive strain of E. histolytica. Over expression of EhPgp1 was observed only in resistant mutant of E. histolytica; however, transcription of EhPgp1 was not seen in any clinical isolates and sensitive strain of E. histolytica. The findings of the present study indicate that, so far, drug resistance in clinical isolates of E. histolytica does not seem to be a major problem in this country. However, susceptibility of clinical isolates of E. histolytica against various antiamoebic drugs needs to be investigated for better management.

  3. The draft genome of Mycobacterium aurum , a potential model organism for investigating drugs against Mycobacterium tuberculosis and Mycobacterium leprae

    Directory of Open Access Journals (Sweden)

    Jody Phelan

    2015-01-01

    Full Text Available Mycobacterium aurum (M. aurum is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02 Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related to 96.2% for rrs (streptomycin, capreomycin. We observed two homologous genes encoding the catalase-peroxidase enzyme (katG that is associated with resistance to isoniazid. Similarly, two emb B homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum , this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae.

  4. The draft genome of Mycobacterium aurum, a potential model organism for investigating drugs against Mycobacterium tuberculosis and Mycobacterium leprae

    KAUST Repository

    Phelan, Jody

    2015-06-04

    Mycobacterium aurum (M. aurum) is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02 Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related) to 96.2% for rrs (streptomycin, capreomycin). We observed two homologous genes encoding the catalase-peroxidase enzyme (katG) that is associated with resistance to isoniazid. Similarly, two embB homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum, this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae.

  5. The draft genome of Mycobacterium aurum, a potential model organism for investigating drugs against Mycobacterium tuberculosis and Mycobacterium leprae

    KAUST Repository

    Phelan, Jody; Maitra, Arundhati; McNerney, Ruth; Nair, Mridul; Gupta, Antima; Coll, Francesc; Pain, Arnab; Bhakta, Sanjib; Clark, Taane G.

    2015-01-01

    Mycobacterium aurum (M. aurum) is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02 Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related) to 96.2% for rrs (streptomycin, capreomycin). We observed two homologous genes encoding the catalase-peroxidase enzyme (katG) that is associated with resistance to isoniazid. Similarly, two embB homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum, this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae.

  6. The draft genome of Mycobacterium aurum, a potential model organism for investigating drugs against Mycobacterium tuberculosis and Mycobacterium leprae.

    Science.gov (United States)

    Phelan, Jody; Maitra, Arundhati; McNerney, Ruth; Nair, Mridul; Gupta, Antima; Coll, Francesc; Pain, Arnab; Bhakta, Sanjib; Clark, Taane G

    2015-09-01

    Mycobacterium aurum (M. aurum) is an environmental mycobacteria that has previously been used in studies of anti-mycobacterial drugs due to its fast growth rate and low pathogenicity. The M. aurum genome has been sequenced and assembled into 46 contigs, with a total length of 6.02Mb containing 5684 annotated protein-coding genes. A phylogenetic analysis using whole genome alignments positioned M. aurum close to Mycobacterium vaccae and Mycobacterium vanbaalenii, within a clade related to fast-growing mycobacteria. Large-scale genomic rearrangements were identified by comparing the M. aurum genome to those of Mycobacterium tuberculosis and Mycobacterium leprae. M. aurum orthologous genes implicated in resistance to anti-tuberculosis drugs in M. tuberculosis were observed. The sequence identity at the DNA level varied from 68.6% for pncA (pyrazinamide drug-related) to 96.2% for rrs (streptomycin, capreomycin). We observed two homologous genes encoding the catalase-peroxidase enzyme (katG) that is associated with resistance to isoniazid. Similarly, two embB homologues were identified in the M. aurum genome. In addition to describing for the first time the genome of M. aurum, this work provides a resource to aid the use of M. aurum in studies to develop improved drugs for the pathogenic mycobacteria M. tuberculosis and M. leprae. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  7. Mycobacterium tuberculosis population in northwestern Russia: an update from Russian-EU/Latvian border region.

    Directory of Open Access Journals (Sweden)

    Igor Mokrousov

    Full Text Available This study aimed to characterize the population structure of Mycobacterium tuberculosis in Pskov oblast in northwestern Russia, to view it in the geographical context, to compare drug resistance properties across major genetic families. Ninety M. tuberculosis strains from tuberculosis (TB patients, permanent residents in Pskov oblast were subjected to LAM-specific IS6110-PCR and spoligotyping, followed by comparison with SITVITWEB and MIRU-VNTRplus databases. The Beijing genotype (n = 40 was found the most prevalent followed by LAM (n = 18, T (n = 13, Haarlem (n = 10, Ural (n = 5, and Manu2 (n = 1; the family status remained unknown for 3 isolates. The high rate of Beijing genotype and prevalence of LAM family are similar to those in the other Russian settings. A feature specific for M. tuberculosis population in Pskov is a relatively higher rate of Haarlem and T types. Beijing strains were further typed with 12-MIRU (followed by comparison with proprietary global database and 3 hypervariable loci QUB-3232, VNTR-3820, VNTR-4120. The 12-MIRU typing differentiated 40 Beijing strains into 14 types (HGI = 0.82 while two largest types were M2 (223325153533 prevalent throughout former USSR and M11 (223325173533 prevalent in Russia and East Asia. The use of 3 hypervariable loci increased a discrimination of the Beijing strains (18 profiles, HGI = 0.89. Both major families Beijing and LAM had similar rate of MDR strains (62.5 and 55.6%, respectively that was significantly higher than in other strains (21.9%; P = 0.001 and 0.03, respectively. The rpoB531 mutations were more frequently found in Beijing strains while LAM drug resistant strains mainly harbored rpoB516 and inhA -15 mutations. Taken together with a high rate of multidrug resistance among Beijing strains from new TB cases (79.3% versus 44.4% in LAM, these findings suggest the critical impact of the Beijing genotype on the current situation with MDR-TB in the

  8. Mycobacterium tuberculosis infection of domesticated Asian elephants, Thailand.

    OpenAIRE

    2011-01-01

    Four Asian elephants were confirmed to be infected with Mycobacterium tuberculosis by bacterial culture, other diagnostic procedures, and sequencing of 16S–23S rDNA internal transcribed spacer region, 16S rRNA, and gyrase B gene sequences. Genotyping showed that the infectious agents originated from 4 sources in Thailand. To identify infections, a combination of diagnostic assays is essential.

  9. Siderocalin inhibits the intracellular replication of Mycobacterium tuberculosis in macrophages

    DEFF Research Database (Denmark)

    Johnson, Erin E; Srikanth, Chittur V; Sandgren, Andreas

    2010-01-01

    Siderocalin is a secreted protein that binds to siderophores to prevent bacterial iron acquisition. While it has been shown to inhibit the growth of Mycobacterium tuberculosis (M.tb) in extracellular cultures, its effect on this pathogen within macrophages is not clear. Here, we show that sideroc...

  10. Transmission of Mycobacterium tuberculosis Undetected by Tuberculin Skin Testing

    Czech Academy of Sciences Publication Activity Database

    Anderson, S. T.; Williams, A. J.; Brown, J. R.; Newton, S. M.; Šimšová, Marcela; Nicol, M. P.; Šebo, Peter; Levin, M.; Wilkinson, R. J.; Wilkinson, K. A.

    2006-01-01

    Roč. 173, - (2006), s. 1038-1042 ISSN 1073-449X R&D Projects: GA AV ČR IAA5020406 Institutional research plan: CEZ:AV0Z50200510 Keywords : adenylate cyclase * diagnostic tests and procedures * mycobacterium tuberculosis Subject RIV: EE - Microbiology, Virology Impact factor: 9.091, year: 2006

  11. Structural studies on Mycobacterium tuberculosis RecA

    Indian Academy of Sciences (India)

    Structures of crystals of Mycobacterium tuberculosis RecA, grown and analysed under different conditions, provide insights into hitherto underappreciated details of molecular structure and plasticity. In particular, they yield information on the invariant and variable features of the geometry of the P-loop, whose binding to ATP ...

  12. Modern lineages of Mycobacterium tuberculosis in Addis Ababa ...

    African Journals Online (AJOL)

    Background: The genotyping of Mycobacterium tuberculosis strains is important to have unique insights into the dissemination dynamics and evolutionary genetics of this pathogen and for TB control as it allows the detection of suspected outbreaks and the tracing of transmission chains. Objective: To characterize M.

  13. Beijing/W genotype Mycobacterium tuberculosis and drug resistance.

    NARCIS (Netherlands)

    Glynn, Judith R; Kremer, Kristin; Borgdorff, Martien W; Rodriguez, Mar Pujades; Soolingen, Dick van

    2006-01-01

    Beijing/W genotype Mycobacterium tuberculosis is widespread, may be increasing, and may have a predilection for drug resistance. Individual-level data on >29,000 patients from 49 studies in 35 countries were combined to assess the Beijing genotype's prevalence worldwide, trends over time and with

  14. The transmission of Mycobacterium tuberculosis in high burden settings

    NARCIS (Netherlands)

    Yates, Tom A.; Khan, Palwasha Y.; Knight, Gwenan M.; Taylor, Jonathon G.; McHugh, Timothy D.; Lipman, Marc; White, Richard G.; Cohen, Ted; Cobelens, Frank G.; Wood, Robin; Moore, David A. J.; Abubakar, Ibrahim

    2016-01-01

    Unacceptable levels of Mycobacterium tuberculosis transmission are noted in high burden settings and a renewed focus on reducing person-to-person transmission in these communities is needed. We review recent developments in the understanding of airborne transmission. We outline approaches to measure

  15. A case of Manila type Mycobacterium tuberculosis infection in Japan

    Science.gov (United States)

    Usami, Osamu; Nakajima, Chie; Endo, Shiro; Inomata, Shinya; Kanamori, Hajime; Hirakata, Yoichi; Uchiyama, Bine; Kaku, Mitsuo; Suzuki, Yasuhiko; Hattori, Toshio

    2015-01-01

    Key Clinical Message A 76-year-old Japanese woman contracted a Mycobacterium tuberculosis (TB, Manila type) infection in Japan, despite never having traveled. However, her son was treated for TB in the Philippines 3 years before he stayed at her house. Spoligotyping allows us to identify the TB genotype and identify the route of infection. PMID:26273455

  16. Deciphering the biology of Mycobacterium tuberculosis from thecomplete genome sequence

    DEFF Research Database (Denmark)

    Cole, S.T.; Krogh, Anders Stærmose

    1998-01-01

    Countless millions of people have died from tuberculosis, a chronic infectious disease caused by the tubercle bacillus. The complete genome sequence of the best-characterized strain of Mycobacterium tuberculosis, H37Rv, has been determined and analysed in order to improve our understanding....... tuberculosis differs radically from other bacteria in that a very large portion of its coding capacity is devoted to the production of enzymes involved in lipogenesis and lipolysis, and to two new families of glycine-rich proteins with a repetitive structure that may represent a source of antigenic variation....

  17. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  18. Antibacterial Activity of Medicinal Aqueous Plant Extracts against Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Muna Mohammed Buzayan

    2012-09-01

    Full Text Available Tuberculosis (TB remains a serious health problem in many regions of the world, and the development of resistance to antibiotics by this microbe created the need for new drugs to replace those which have lost effectiveness. This study assesses the medicinal anti-Mycobacterium tuberculosis properties of natural products obtained from plants collected from Eastern Libya. In this study aqueous extracts of nine different plants were assayed for their Mycobacterium tuberculosis inhibitory activity using the BACTEC MGIT960 susceptibility test method. The aqueous extracts of Ceratonia siliqua L, Helichrysum stoechas (L. Moench and Thymus algeriensis did not show any activity against M. tuberculosis in different concentrations. The aqueous extract of Marrubium vulgare L. from Syria showed high activity against M. tuberculosis. Marrubium alysson L., Marrubium vulgare L., Pistacia lentiscus L, Quercus coccifera L, Thymus capitatus (L. Hoffm. & Link, showed varying degrees of activity against M. tuberculosis. The results of this study show that aqueous extracts from six different medicinal plants have different effects against M. tuberculosis in vitro.

  19. Activity of moxifloxacin and linezolid against Mycobacterium tuberculosis in combination with potentiator drugs verapamil, timcodar, colistin and SQ109.

    Science.gov (United States)

    de Knegt, Gerjo J; van der Meijden, Aart; de Vogel, Corné P; Aarnoutse, Rob E; de Steenwinkel, Jurriaan E M

    2017-03-01

    Current treatment for tuberculosis (TB) is complicated by the emergence of multidrug resistant TB (MDR-TB). As a result, there is an urgent need for new powerful anti-TB regimens and novel strategies. In this study, we aimed to potentiate a moxifloxacin + linezolid backbone as treatment for MDR-TB with the efflux pump inhibitors verapamil and timcodar as well as with drugs that act on mycobacterial cell wall stability such as colistin and SQ109. Using a time-kill kinetics assay, the activities of moxifloxacin, linezolid, verapamil, timcodar, colistin and SQ109 as single drugs against Mycobacterium tuberculosis were evaluated. In addition, the activity of the moxifloxacin + linezolid backbone in combination with one of the potentiator drugs was assessed. As little as 0.125 mg/L moxifloxacin achieved 99% killing of M. tuberculosis after 6 days of exposure. Linezolid showed moderate killing but 99% killing was not achieved. Verapamil, timcodar and colistin only resulted in killing with the highest concentrations tested but 99% killing was not achieved. SQ109 resulted in complete elimination after 1 day of exposure to 256 mg/L and in 99% elimination after 6 days of exposure to 1 mg/L. Furthermore, colistin added to the moxifloxacin + linezolid backbone resulted in increased elimination, whereas verapamil, timcodar and SQ109 showed no added value to the backbone. This finding that colistin potentiates the activity of the moxifloxacin + linezolid backbone against M. tuberculosis suggests its potential role in further studies on the applicability of a moxifloxacin + linezolid treatment of MDR-TB. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  20. Mutation of Rv2887, a marR-like gene, confers Mycobacterium tuberculosis resistance to an imidazopyridine-based agent.

    Science.gov (United States)

    Winglee, Kathryn; Lun, Shichun; Pieroni, Marco; Kozikowski, Alan; Bishai, William

    2015-11-01

    Drug resistance is a major problem in Mycobacterium tuberculosis control, and it is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M. tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor) family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Evaluation of the effect of Pulicaria gnaphalodes and Perovskia abrotanoides essential oil extracts against Mycobacterium tuberculosis strains

    Directory of Open Access Journals (Sweden)

    Fereshte Hozoorbakhsh

    2016-01-01

    Full Text Available Background: Mycobacterium tuberculosis (MTB is the causative agent of tuberculosis (TB, which remains one of the major public health problems in the world. The increasing incidence of multidrug-resistant tuberculosis (MDR-TB and extensively drug-resistant tuberculosis (XDR-TB worldwide highlights the urgent need to search for alternative antimycobacterial agents. More and more people in developing countries utilize traditional medicine for their major primary health care needs. It has been determined that the medicinal plants Pulicaria gnaphalodes and Perovskia abrotanoides possess strong antibacterial effect. Materials and Methods: In this study, the antimycobacterial effects of P. gnaphalodes and P. abrotanoides essential oil on MTB were examined. Essential oil was prepared from P. gnaphalodes aerial parts and P. abrotanoides flower. The effects of six different concentrations (20 μg/ml, 40 μg/ml, 80 μg/ml, 160 μg/ml, 320 μg/ml, and 640 μg/ml were examined against sensitive isolates of MTB and MTB H37Rv (ATCC 27294. Results: The results showed that P. gnaphalodes and P. abrotanoides essential oil extracts have strong inhibitory effects on MTB. This activity for P. gnaphalodes was observed from very low (4% to good (70.9% effect; meanwhile, this activity for P. abrotanoides was observed from very low (4% to strong (86% effect. Conclusion: The mean of inhibition percentage for P. gnaphalodes and P. abrotanoides in 640 μg/ml was 58.1% and 76.2%, respectively. So, P. abrotanoides plant is more effective against MTB than P. gnaphalodes. Identification of the effective fraction against MTB is a further step to be studied.

  2. Characterization of drug susceptibility of Mycobacterium tuberculosis isolated from new cases of tuberculosis concurrent with HIV infection

    Directory of Open Access Journals (Sweden)

    G. V. Panov

    2015-01-01

    Full Text Available The paper characterizes drug susceptibility in Mycobacterium tuberculosis isolated from new cases of tuberculosis concurrent with HIV infection. The investigators have studied the spectrum of drug resistance in Mycobacterium tuberculosis isolated from new cases of tuberculosis concurrent with and without HIV infection (172 and 309 clinical isolates, respectively. There are differences in the rate of primary drug resistance to antituberculosis drugs in patients with and without HIV infection (59 and 43.5% of the cases, respectively. The HIV-infected have also shown high rifampicin resistance rates in Mycobacterium tuberculosis (41.7%. The reasons for these differences are as yet unknown and call for further investigation.

  3. Siderocalin inhibits the intracellular replication of Mycobacterium tuberculosis in macrophages

    DEFF Research Database (Denmark)

    Johnson, Erin E; Srikanth, Chittur V; Sandgren, Andreas

    2010-01-01

    Siderocalin is a secreted protein that binds to siderophores to prevent bacterial iron acquisition. While it has been shown to inhibit the growth of Mycobacterium tuberculosis (M.tb) in extracellular cultures, its effect on this pathogen within macrophages is not clear. Here, we show that sideroc......Siderocalin is a secreted protein that binds to siderophores to prevent bacterial iron acquisition. While it has been shown to inhibit the growth of Mycobacterium tuberculosis (M.tb) in extracellular cultures, its effect on this pathogen within macrophages is not clear. Here, we show...... findings are consistent with an important role for siderocalin in protection against M.tb infection and suggest that exogenously administered siderocalin may have therapeutic applications in tuberculosis....

  4. Comparative genomics of archived pyrazinamide resistant Mycobacterium tuberculosis complex isolates from Uganda

    Science.gov (United States)

    Bovine tuberculosis is a ‘neglected zoonosis’ and its contribution to the proportion of Mycobacterium tuberculosis complex infections in humans is unknown. A retrospective study on archived Mycobacterium tuberculosis complex (MTC) isolates from a reference laboratory in Uganda was undertaken to iden...

  5. Investigating the metabolic capabilities of Mycobacterium tuberculosis H37Rv using the in silico strain iNJ661 and proposing alternative drug targets

    Directory of Open Access Journals (Sweden)

    Palsson Bernhard Ø

    2007-06-01

    Full Text Available Abstract Background: Mycobacterium tuberculosis continues to be a major pathogen in the third world, killing almost 2 million people a year by the most recent estimates. Even in industrialized countries, the emergence of multi-drug resistant (MDR strains of tuberculosis hails the need to develop additional medications for treatment. Many of the drugs used for treatment of tuberculosis target metabolic enzymes. Genome-scale models can be used for analysis, discovery, and as hypothesis generating tools, which will hopefully assist the rational drug development process. These models need to be able to assimilate data from large datasets and analyze them. Results: We completed a bottom up reconstruction of the metabolic network of Mycobacterium tuberculosis H37Rv. This functional in silico bacterium, iNJ661, contains 661 genes and 939 reactions and can produce many of the complex compounds characteristic to tuberculosis, such as mycolic acids and mycocerosates. We grew this bacterium in silico on various media, analyzed the model in the context of multiple high-throughput data sets, and finally we analyzed the network in an 'unbiased' manner by calculating the Hard Coupled Reaction (HCR sets, groups of reactions that are forced to operate in unison due to mass conservation and connectivity constraints. Conclusion: Although we observed growth rates comparable to experimental observations (doubling times ranging from about 12 to 24 hours in different media, comparisons of gene essentiality with experimental data were less encouraging (generally about 55%. The reasons for the often conflicting results were multi-fold, including gene expression variability under different conditions and lack of complete biological knowledge. Some of the inconsistencies between in vitro and in silico or in vivo and in silico results highlight specific loci that are worth further experimental investigations. Finally, by considering the HCR sets in the context of known

  6. Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis

    OpenAIRE

    Young, Douglas B.; Comas, I?aki; de Carvalho, Luiz P. S.

    2015-01-01

    Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii, and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms (SNPs) with predicted impact on protein function and transcriptional regulation...

  7. Pattern of intensive phase treatment outcomes of multi-drug resistant ...

    African Journals Online (AJOL)

    Pattern of intensive phase treatment outcomes of multi-drug resistant tuberculosis in University of Port Harcourt Treatment Centre: a review of records from ... Data on patients' age, sex, HIV status, treatment outcomes were extracted from the hospital book records into a computer data sheet at the UPTH treatment centre.

  8. Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

    NARCIS (Netherlands)

    Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

    2013-01-01

    A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

  9. Immune responses to the Mycobacterium tuberculosis-specific antigen ESAT-6 signal subclinical infection among contacts of tuberculosis patients

    DEFF Research Database (Denmark)

    Doherty, T Mark; Demissie, Abebech; Olobo, Joseph

    2002-01-01

    Diagnosis of latent Mycobacterium tuberculosis infection is considered essential for tuberculosis control but is hampered by the lack of specific reagents. We report that strong recognition of tuberculosis complex-specific antigen ESAT-6 by healthy household contacts of tuberculosis patients...

  10. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie

    2016-10-01

    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  11. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana

    Directory of Open Access Journals (Sweden)

    Justice K Boakye-Appiah

    2016-01-01

    Conclusion: These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting.

  12. Risk Factors for Multidrug-resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Cleopas Martin Rumende

    2018-04-01

    Diabetes mellitus has been a well-known risk factor for TB in the past. The global convergence of the accelerating type 2 DM pandemic, high TB prevalence and drug-resistant TB during the past couple of decades has become a serious challenge to clinicians worldwide. Over the past few years, some studies have shown that the treatment failure rate is higher in TB patients with DM as comorbidity. Moreover, there is significant association between DM an MDR-TB. There is higher chance of TB bacilli persistence to be present in sputum of pulmonary TB patient with DM than TB-only patient after 5 months treatment, and this persistence made it necessary for more longer treatment. Presence of DM in TB patients cause a longer period for sputum conversion, therefore it may become a major cause of poor treatment outcome in TB patients. Previous studies showed that a major mechanism for the emergence of drugs resistance in TB bacilli is random mutation in the bacterial genome and the pressure of selection by anti-TB drugs. Pulmonary TB in diabetic patients usually show higher mycobacterial loads at the initiation of treatment, hence they may have higher chance of bacillary mutation and the emergence of MDR-TB with the presenting of higher bacterial loads, longer treatment is needed to clear the bacteria. Therefore, it is not suprising that a higher chance of MDR-TB patients could be find in those patients. A pharmacokinetic study noted that plasma levels of rifampicin were 53% lower in TB patients with diabetes, which might affect treatment outcomes. Inadequate immune respons of the host may also be important in this negative effect of diabetes. Depressed production of IFN-γ in diabetic patients is related to decreasing immune response to TB infection. Reduction of IL-12 response to mycobacterial stimulation in leukocytes from TB with diabetic patients suggest a compromise of innate immune response.

  13. Triple valve endocarditis by mycobacterium tuberculosis. A case report

    Directory of Open Access Journals (Sweden)

    Shaikh Quratulain

    2012-09-01

    Full Text Available Abstract Background Granulomas caused by Mycobacterium Tuberculosis have been observed at autopsy in the heart, pre-dominantly in the myocardium and endocardium, but rarely involving the coronary vessels and valvular structures. Mycobacterium tuberculosis valvular endocarditis is extremely rare, with most reports coming from autopsy series. Case presentation We report the case of a 17 year old immunocompetent girl who presented with history of fever, malaise, foot gangrene and a left sided hemiparesis. On investigation she was found to have infective endocarditis involving the aortic, mitral and tricuspid valves. She had developed a right middle cerebral artery stroke. She underwent dual valve replacement and tricuspid repair. The vegetations showed granulomatous inflammation but blood cultures and other biological specimen cultures were negative for any organisms. She was started on antituberculous treatment and anticoagulation. Conclusion This is the first reported case of triple valve endocarditis by Mycobacterium Tuberculosis in an immunocompetent host. Especially important is the fact that the right heart is involved which has been historically described in the setting of intravenous drug abuse. This implies that Tuberculosis should be considered in cases of culture negative endocarditis in endemic areas like Pakistan even in immunocompetent hosts.

  14. Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates

    KAUST Repository

    Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M.; van Helden, Paul D.; van der Merwe, Ruben G.; Gey van Pittius, Nicolaas C.; Pain, Arnab; Sampson, Samantha L.; Tabb, David L.

    2017-01-01

    Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach we identified 59 peptides containing single amino acid variants, which covered ~9% of all total coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e. large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

  15. Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates

    KAUST Repository

    Heunis, Tiaan

    2017-08-18

    Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach we identified 59 peptides containing single amino acid variants, which covered ~9% of all total coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e. large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

  16. Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

    Science.gov (United States)

    Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

    2017-10-06

    Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

  17. Tuberculosis patients co-infected with Mycobacterium bovis and Mycobacterium tuberculosis in an urban area of Brazil.

    Science.gov (United States)

    Silva, Marcio Roberto; Rocha, Adalgiza da Silva; da Costa, Ronaldo Rodrigues; de Alencar, Andrea Padilha; de Oliveira, Vania Maria; Fonseca Júnior, Antônio Augusto; Sales, Mariana Lázaro; Issa, Marina de Azevedo; Filho, Paulo Martins Soares; Pereira, Omara Tereza Vianello; dos Santos, Eduardo Calazans; Mendes, Rejane Silva; Ferreira, Angela Maria de Jesus; Mota, Pedro Moacyr Pinto Coelho; Suffys, Philip Noel; Guimarães, Mark Drew Crosland

    2013-05-01

    In this cross-sectional study, mycobacteria specimens from 189 tuberculosis (TB) patients living in an urban area in Brazil were characterised from 2008-2010 using phenotypic and molecular speciation methods (pncA gene and oxyR pseudogene analysis). Of these samples, 174 isolates simultaneously grew on Löwenstein-Jensen (LJ) and Stonebrink (SB)-containing media and presented phenotypic and molecular profiles of Mycobacterium tuberculosis, whereas 12 had molecular profiles of M. tuberculosis based on the DNA analysis of formalin-fixed paraffin wax-embedded tissue samples (paraffin blocks). One patient produced two sputum isolates, the first of which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, and the second of which only grew on SB media and presented phenotypic profiles of Mycobacterium bovis. One patient provided a bronchial lavage isolate, which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, but had molecular profiles of M. bovis from paraffin block DNA analysis, and one sample had molecular profiles of M. tuberculosis and M. bovis identified from two distinct paraffin blocks. Moreover, we found a low prevalence (1.6%) of M. bovis among these isolates, which suggests that local health service procedures likely underestimate its real frequency and that it deserves more attention from public health officials.

  18. Tuberculosis patients co-infected with Mycobacterium bovis and Mycobacterium tuberculosis in an urban area of Brazil

    Directory of Open Access Journals (Sweden)

    Marcio Roberto Silva

    2013-05-01

    Full Text Available In this cross-sectional study, mycobacteria specimens from 189 tuberculosis (TB patients living in an urban area in Brazil were characterised from 2008-2010 using phenotypic and molecular speciation methods (pncA gene and oxyR pseudogene analysis. Of these samples, 174 isolates simultaneously grew on Löwenstein-Jensen (LJ and Stonebrink (SB-containing media and presented phenotypic and molecular profiles of Mycobacterium tuberculosis, whereas 12 had molecular profiles of M. tuberculosis based on the DNA analysis of formalin-fixed paraffin wax-embedded tissue samples (paraffin blocks. One patient produced two sputum isolates, the first of which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, and the second of which only grew on SB media and presented phenotypic profiles of Mycobacterium bovis. One patient provided a bronchial lavage isolate, which simultaneously grew on LJ and SB media and presented phenotypic and molecular profiles of M. tuberculosis, but had molecular profiles of M. bovis from paraffin block DNA analysis, and one sample had molecular profiles of M. tuberculosis and M. bovis identified from two distinct paraffin blocks. Moreover, we found a low prevalence (1.6% of M. bovis among these isolates, which suggests that local health service procedures likely underestimate its real frequency and that it deserves more attention from public health officials.

  19. [Increased IL-4 production in response to virulent Mycobacterium tuberculosis in tuberculosis patients with advanced disease].

    Science.gov (United States)

    Ordway, Diane J; Martins, Marta S; Costa, Leonor M; Freire, Mónica S; Arroz, Maria J; Dockrell, Hazel M; Ventura, Fernando A

    2005-01-01

    The study was designed to compare immune responses to Mycobacterium tuberculosis bacilli and antigens in healthy Portuguese subjects and pulmonary tuberculosis patients (TB), and to correlate immune status with clinical severity of tuberculosis disease. PBMC were cultured and stimulated with live and killed M. tuberculosis H37Rv and purified protein derivative (PPD) and lymphoproliferation and production of IFN-gamma and IL-5/IL-4 by these cultures were evaluated by the use of ELISA and multi-parameter flow cytometry. PBMC from 30 tuberculosis patients demonstrated significantly reduced amounts of proliferation and IFN-gamma when stimulated with live M. tuberculosis compared the control group. Of 15 tuberculosis patients tested for intracellular IL-4 following stimulation with M. tuberculosis, 7 showed greatly increased IL-4 production in CD8+ and gammadelta+ T cells. Tuberculosis patients demonstrated an increase of intracellular IL-4 after PBMC were stimulated with live M. tuberculosis in the CD4+ phenotype, but more notably in CD8+ and gammadelta TCR+ subsets. Increased production of IL-4 in tuberculosis patients was primarily in individuals with advanced involvement of lung parenchymal with high bacterial loads in sputum. These results suggest that an alteration in type 1 and type 2 cytokine balance can occur in patients with tuberculosis at an advanced clinical stage of disease.

  20. Metabolic principles of persistence and pathogenicity in Mycobacterium tuberculosis.

    Science.gov (United States)

    Ehrt, Sabine; Schnappinger, Dirk; Rhee, Kyu Y

    2018-04-24

    Metabolism was once relegated to the supply of energy and biosynthetic precursors, but it has now become clear that it is a specific mediator of nearly all physiological processes. In the context of microbial pathogenesis, metabolism has expanded outside its canonical role in bacterial replication. Among human pathogens, this expansion has emerged perhaps nowhere more visibly than for Mycobacterium tuberculosis, the causative agent of tuberculosis. Unlike most pathogens, M. tuberculosis has evolved within humans, which are both host and reservoir. This makes unrestrained replication and perpetual quiescence equally incompatible strategies for survival as a species. In this Review, we summarize recent work that illustrates the diversity of metabolic functions that not only enable M. tuberculosis to establish and maintain a state of chronic infection within the host but also facilitate its survival in the face of drug pressure and, ultimately, completion of its life cycle.

  1. Rifampicin resistance in Mycobacterium tuberculosis - rapid ...

    African Journals Online (AJOL)

    PH.D. T. C. VJCtor. PH.O. National Tuberculosis Research Programme, Pretoria ... together with. MDR profiles of clinical isolates of M. tuberculosis to assess ..... values in a population." This analysis ..... increased after the mid-1980s but the contribution of social science has ... Schall argues that this is a worst- case scenario ...

  2. Mycobacterium tuberculosis bacteremia detected by the Isolator lysis-centrifugation blood culture system.

    OpenAIRE

    Kiehn, T E; Gold, J W; Brannon, P; Timberger, R J; Armstrong, D

    1985-01-01

    Mycobacterium tuberculosis was detected by the Isolator lysis-centrifugation blood culture system from the blood of a patient with tuberculosis of the breast. The organism also grew on conventional laboratory media inoculated with pleural fluid from the patient.

  3. Tracing Mycobacterium tuberculosis transmission by whole genome sequencing in a high incidence setting

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Soborg, B; Koch, A

    2016-01-01

    In East Greenland, a dramatic increase of tuberculosis (TB) incidence has been observed in recent years. Classical genotyping suggests a genetically similar Mycobacterium tuberculosis (Mtb) strain population as cause, however, precise transmission patterns are unclear. We performed whole genome...

  4. Multi-clonal evolution of multi-drug-resistant/extensively drug-resistant Mycobacterium tuberculosis in a high-prevalence setting of Papua New Guinea for over three decades

    Science.gov (United States)

    Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan

    2018-01-01

    An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751

  5. Detecting Mutations in the Mycobacterium tuberculosis Pyrazinamidase Gene pncA to Improve Infection Control and Decrease Drug Resistance Rates in Human Immunodeficiency Virus Coinfection

    Science.gov (United States)

    Dudley, Matthew Z.; Sheen, Patricia; Gilman, Robert H.; Ticona, Eduardo; Friedland, Jon S.; Kirwan, Daniela E.; Caviedes, Luz; Rodriguez, Richard; Cabrera, Lilia Z.; Coronel, Jorge; Grandjean, Louis; Moore, David A. J.; Evans, Carlton A.; Huaroto, Luz; Chávez-Pérez, Víctor; Zimic, Mirko

    2016-01-01

    Hospital infection control measures are crucial to tuberculosis (TB) control strategies within settings caring for human immunodeficiency virus (HIV)–positive patients, as these patients are at heightened risk of developing TB. Pyrazinamide (PZA) is a potent drug that effectively sterilizes persistent Mycobacterium tuberculosis bacilli. However, PZA resistance associated with mutations in the nicotinamidase/pyrazinamidase coding gene, pncA, is increasing. A total of 794 patient isolates obtained from four sites in Lima, Peru, underwent spoligotyping and drug resistance testing. In one of these sites, the HIV unit of Hospital Dos de Mayo (HDM), an isolation ward for HIV/TB coinfected patients opened during the study as an infection control intervention: circulating genotypes and drug resistance pre- and postintervention were compared. All other sites cared for HIV-negative outpatients: genotypes and drug resistance rates from these sites were compared with those from HDM. HDM patients showed high concordance between multidrug resistance, PZA resistance according to the Wayne method, the two most common genotypes (spoligotype international type [SIT] 42 of the Latino American-Mediterranean (LAM)-9 clade and SIT 53 of the T1 clade), and the two most common pncA mutations (G145A and A403C). These associations were absent among community isolates. The infection control intervention was associated with 58–92% reductions in TB caused by SIT 42 or SIT 53 genotypes (odds ratio [OR] = 0.420, P = 0.003); multidrug-resistant TB (OR = 0.349, P < 0.001); and PZA-resistant TB (OR = 0.076, P < 0.001). In conclusion, pncA mutation typing, with resistance testing and spoligotyping, was useful in identifying a nosocomial TB outbreak and demonstrating its resolution after implementation of infection control measures. PMID:27928075

  6. Bloodstream Infections with Mycobacterium tuberculosis among HIV patients

    Centers for Disease Control (CDC) Podcasts

    2010-09-23

    This podcast looks at bloodstream infections with Mycobacterium tuberculosis and other pathogens among outpatients infected with HIV in Southeast Asia. CDC health scientist Kimberly McCarthy discusses the study and why bloodstream infections occur in HIV-infected populations.  Created: 9/23/2010 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 9/23/2010.

  7. Structural and Functional Studies of Phosphoenolpyruvate Carboxykinase from Mycobacterium tuberculosis

    Czech Academy of Sciences Publication Activity Database

    Machová, Iva; Snášel, Jan; Dostál, Jiří; Brynda, Jiří; Fanfrlík, Jindřich; Singh, M.; Tarábek, Ján; Vaněk, O.; Bednárová, Lucie; Pichová, Iva

    2015-01-01

    Roč. 10, č. 3 (2015), e0120682/1-e0120682/21 E-ISSN 1932-6203 R&D Projects: GA MŠk LO1302 EU Projects: European Commission(XE) 241587 - SYSTEMTB Institutional support: RVO:61388963 Keywords : crystal structure * noncovalent complexes * Mycobacterium tuberculosis * mechanism Subject RIV: CE - Biochemistry Impact factor: 3.057, year: 2015 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0120682

  8. Studium role fosfofruktokinasy A a B v metabolismu Mycobacterium tuberculosis

    Czech Academy of Sciences Publication Activity Database

    Machová, Iva; Snášel, Jan; Pichová, Iva

    2014-01-01

    Roč. 108, č. 5 (2014), s. 542 ISSN 0009-2770. [Mezioborové setkání mladých biologů, biochemiků a chemiků /14./. 13.05.2014-16.05.2014, Milovy] Grant - others:European Research Council(XE) FP7-245187 Institutional support: RVO:61388963 Keywords : Mycobacterium tuberculosis * phosphofructokinase Subject RIV: CE - Biochemistry

  9. Tumor necrosis factor blockers influence macrophage responses to Mycobacterium tuberculosis

    OpenAIRE

    HARRIS, JAMES; HARRIS, JAMES

    2008-01-01

    PUBLISHED umor necrosis factor (TNF)?? is a proinflammatory cytokine that mediates inflammation in response to various pathogens, including Mycobacterium tuberculosis, but is also a key factor in the pathogenesis of rheumatoid arthritis and other autoimmune diseases. Three TNF???suppressing drugs have been approved to treat selected autoimmune diseases; 2 are monoclonal antibodies against TNF?? (adalimumab and infliximab), and the other is a soluble TNF receptor/Fc fusion protein (etanerce...

  10. Lymphatic endothelial cells are a replicative niche for Mycobacterium tuberculosis

    Science.gov (United States)

    Lerner, Thomas R.; de Souza Carvalho-Wodarz, Cristiane; Repnik, Urska; Russell, Matthew R.G.; Borel, Sophie; Diedrich, Collin R.; Rohde, Manfred; Wainwright, Helen; Collinson, Lucy M.; Wilkinson, Robert J.; Griffiths, Gareth; Gutierrez, Maximiliano G.

    2016-01-01

    In extrapulmonary tuberculosis, the most common site of infection is within the lymphatic system, and there is growing recognition that lymphatic endothelial cells (LECs) are involved in immune function. Here, we identified LECs, which line the lymphatic vessels, as a niche for Mycobacterium tuberculosis in the lymph nodes of patients with tuberculosis. In cultured primary human LECs (hLECs), we determined that M. tuberculosis replicates both in the cytosol and within autophagosomes, but the bacteria failed to replicate when the virulence locus RD1 was deleted. Activation by IFN-γ induced a cell-autonomous response in hLECs via autophagy and NO production that restricted M. tuberculosis growth. Thus, depending on the activation status of LECs, autophagy can both promote and restrict replication. Together, these findings reveal a previously unrecognized role for hLECs and autophagy in tuberculosis pathogenesis and suggest that hLECs are a potential niche for M. tuberculosis that allows establishment of persistent infection in lymph nodes. PMID:26901813

  11. Performance of the Abbott RealTime MTB RIF/INH resistance assay when used to test Mycobacterium tuberculosis specimens from Bangladesh

    Directory of Open Access Journals (Sweden)

    Kostera J

    2018-05-01

    Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance

  12. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

    Science.gov (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

    2017-10-01

    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. High genetic diversity among Mycobacterium tuberculosis strains in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Taher Azimi

    2018-05-01

    Full Text Available Introduction: Tuberculosis (TB still remains an important public health problem in Iran. The genotyping of Mycobacterium tuberculosis isolates is expected to lead to a better understanding of M. tuberculosis transmission in Tehran, the most populated city of Iran. Materials and Methods: A total of 2300 clinical specimens were obtained from TB suspected patients who were referred to a TB center in Tehran from Jan 2014 to Dec 2016. Identification was performed using both conventional and molecular methods. The presence of resistance to rifampicin was examined by the GeneXpert MTB/RIF. The standard 15-locus mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR typing method was applied to genotype of clinical isolates. Results: Of 2300 specimens, 80 isolates were identified as M. tuberculosis by using biochemical and molecular tests. Of 80 M. tuberculosis isolates, 76 (95% had unique genotypic profiles and 4 (5% shared a profile with one or more other strains. Based on single loci variation (SLV 4 clonal complexes were observed. NEW-1 was found to be the most predominant lineage (22.5% followed by West African (1.25%, Central Asian (CAS/Delhi (1.25%, Bovis (1.25%, H37Rv (1.25% and multiple matches (1.25%. Loci MIRU10, MIRU26, MTUB21 and QUB26 were found as highly discriminative. No mutation was detected in the hotspot region of rifampicin by using GeneXpert MTB/RIF. Conclusions: Our study findings show that there was considerable genotypic diversity among M. tuberculosis isolates in Tehran. The 15-locus MIRU-VNTR showed high HGDI and could be used as a first-line genotyping method for epidemiological studies. Keywords: Mycobacterium tuberculosis, Genotyping, MIRU-VNTR, Tehran, Iran

  14. Biochemical Characterization of Mycobacterium tuberculosis DNA Repair Enzymes – Nfo, XthA and Nei2

    Directory of Open Access Journals (Sweden)

    Sailau Abeldenov

    2014-01-01

    Full Text Available Introduction: Tuberculosis (TB is a human disease caused by Mycobacterium tuberculosis (Mtb. Treatment of TB requires long-term courses of multi-drug therapies to eliminate subpopulations of bacteria, which sometimes persist against antibiotics. Therefore, understanding of the mechanism of Mtb antibiotic-resistance is extremely important. During infection, Mtb overcomes a variety of body defense mechanisms, including treatment with the reactive species of oxygen and nitrogen. The bases in DNA molecule are susceptible to the damages caused by reactive forms of intermediate compounds of oxygen and nitrogen. Most of this damage is repaired by the base excision repair (BER pathway. In this study, we aimed to biochemically characterize three Mtb DNA repair enzymes of BER pathway. Methods: XthA, nfo, and nei genes were identified in mycobacteria by homology search of genomic sequences available in the GenBank database. We used standard methods of genetic engineering  to clone and sequence Mtb genes, which coded Nfo, XthA and Nei2 repair enzymes. The protein products of Mtb genes were expressed and purified in Escherichia coli using affinity tags. The enzymatic activity of purified Nfo, XthA, and Nei2 proteins were measured using radioactively labeled DNA substrates containing various modified residues. Results: The genes end (Rv0670, xthA (Rv0427c, and nei (Rv3297 were PCR amplified using genomic DNA of Mtb H37Rv with primers that contain specific restriction sites. The amplified products were inserted into pET28c(+ expression vector in such a way that the recombinant proteins contain C-terminal histidine tags. The plasmid constructs were verified by sequencing and then transformed into the Escherichia coli BL21 (DE3 strain. Purification of recombinant proteins was performed using Ni2+ ions immobilized affinity column, coupled with the fast performance liquid chromatography machine AKTA. Identification of the isolated proteins was performed by

  15. Antimicrobial Activity of Actinomycetes Against Multidrug Resistant ...

    African Journals Online (AJOL)

    Antimicrobial Activity of Actinomycetes Against Multidrug Resistant Staphylococcus aureus, E. coli and Various Other Pathogens. ... Purpose: The rapid emergence of drug resistance among pathogenic bacteria, especially multidrugresistant bacteria, underlines the need to look for new antibiotics. Methods: In the present ...

  16. Altered membrane permeability in multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    The study was conducted with the objective of examining the outer membrane proteins and their involvement during the transport of β - lactams in multidrug resistant Escherichia coli isolated from extra-intestinal infections. Also, the response of gram negative bacterial biomembrane alteration was studied using extended ...

  17. Expression of multidrug resistance proteins in retinoblastoma

    Directory of Open Access Journals (Sweden)

    Swati Shukla

    2017-11-01

    Full Text Available AIM: To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS: Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS: Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1 expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION: Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

  18. Multidrug Resistant Acinetobacter Infection and Their Antimicrobial ...

    African Journals Online (AJOL)

    Background: Acinetobacter baumannii, a non-glucose fermenting Gram negative bacillus, has emerged in the last three decades as a major etiological agent of hospital-associated infections giving rise to significant morbidity and mortality particularly in immunocompromised patients. Multidrug resistant A. baumannii ...

  19. Expression of multidrug resistance proteins in retinoblastoma.

    Science.gov (United States)

    Shukla, Swati; Srivastava, Arpna; Kumar, Sunil; Singh, Usha; Goswami, Sandeep; Chawla, Bhavna; Bajaj, Mandeep Singh; Kashyap, Seema; Kaur, Jasbir

    2017-01-01

    To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

  20. Expression of multidrug resistance proteins in retinoblastoma

    Science.gov (United States)

    Shukla, Swati; Srivastava, Arpna; Kumar, Sunil; Singh, Usha; Goswami, Sandeep; Chawla, Bhavna; Bajaj, Mandeep Singh; Kashyap, Seema; Kaur, Jasbir

    2017-01-01

    AIM To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy. PMID:29181307

  1. Regulation of Three Virulence Strategies of Mycobacterium tuberculosis: A Success Story

    Science.gov (United States)

    van Dam, Jesse C. J.; Martins dos Santos, Vitor A. P.

    2018-01-01

    Tuberculosis remains one of the deadliest diseases. Emergence of drug-resistant and multidrug-resistant M. tuberculosis strains makes treating tuberculosis increasingly challenging. In order to develop novel intervention strategies, detailed understanding of the molecular mechanisms behind the success of this pathogen is required. Here, we review recent literature to provide a systems level overview of the molecular and cellular components involved in divalent metal homeostasis and their role in regulating the three main virulence strategies of M. tuberculosis: immune modulation, dormancy and phagosomal rupture. We provide a visual and modular overview of these components and their regulation. Our analysis identified a single regulatory cascade for these three virulence strategies that respond to limited availability of divalent metals in the phagosome. PMID:29364195

  2. Uracil excision repair in Mycobacterium tuberculosis cell-free extracts.

    Science.gov (United States)

    Kumar, Pradeep; Bharti, Sanjay Kumar; Varshney, Umesh

    2011-05-01

    Uracil excision repair is ubiquitous in all domains of life and initiated by uracil DNA glycosylases (UDGs) which excise the promutagenic base, uracil, from DNA to leave behind an abasic site (AP-site). Repair of the resulting AP-sites requires an AP-endonuclease, a DNA polymerase, and a DNA ligase whose combined activities result in either short-patch or long-patch repair. Mycobacterium tuberculosis, the causative agent of tuberculosis, has an increased risk of accumulating uracils because of its G + C-rich genome, and its niche inside host macrophages where it is exposed to reactive nitrogen and oxygen species, two major causes of cytosine deamination (to uracil) in DNA. In vitro assays to study DNA repair in this important human pathogen are limited. To study uracil excision repair in mycobacteria, we have established assay conditions using cell-free extracts of M. tuberculosis and M. smegmatis (a fast-growing mycobacterium) and oligomer or plasmid DNA substrates. We show that in mycobacteria, uracil excision repair is completed primarily via long-patch repair. In addition, we show that M. tuberculosis UdgB, a newly characterized family 5 UDG, substitutes for the highly conserved family 1 UDG, Ung, thereby suggesting that UdgB might function as backup enzyme for uracil excision repair in mycobacteria. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Rapid drug susceptibility test of mycobacterium tuberculosis by bioluminescence sensor

    Science.gov (United States)

    Lu, Bin; Xu, Shunqing; Chen, Zifei; Zhou, Yikai

    2001-09-01

    With the persisting increase of drug-resistant stains of M. Tuberculosis around the world, rapid and sensitive detection of antibiotic of M. Tuberculosis is becoming more and more important. In the present study, drug susceptibility of M. tuberculosis were detected by recombination mycobacteriophage combined with bioluminescence sensor. It is based on the use of recombination mycobacteriophage which can express firefly luciferase when it infects viable mycobacteria, and can effectively produce quantifiable photon. Meanwhile, in mycobacterium cells treated with active antibiotic, no light is observed. The emitted light is recorded by a bioluminscence sensor, so the result of drug-resistant test can be determined by the naked eye. 159 stains of M. tuberculosis were applied to this test on their resistant to rifampin, streptomycin and isoniazid. It is found that the agreement of this assay with Liewenstein- Jensen slat is: rifampin 95.60 percent, isoniazid 91.82 percent, streptomycin 88.68 percent, which showed that it is a fast and practical method to scene and detect drug resistant of mycobacterium stains.

  4. Distinct Spatiotemporal Dynamics of Peptidoglycan Synthesis between Mycobacterium smegmatis and Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Helene Botella

    2017-09-01

    Full Text Available Peptidoglycan (PG, a polymer cross-linked by d-amino acid-containing peptides, is an essential component of the bacterial cell wall. We found that a fluorescent d-alanine analog (FDAA incorporates chiefly at one of the two poles in Mycobacterium smegmatis but that polar dominance varies as a function of the cell cycle in Mycobacterium tuberculosis: immediately after cytokinesis, FDAAs are incorporated chiefly at one of the two poles, but just before cytokinesis, FDAAs are incorporated comparably at both. These observations suggest that mycobacterial PG-synthesizing enzymes are localized in functional compartments at the poles and septum and that the capacity for PG synthesis matures at the new pole in M. tuberculosis. Deeper knowledge of the biology of mycobacterial PG synthesis may help in discovering drugs that disable previously unappreciated steps in the process.

  5. Multidrug Resistance in Infants and Children

    Directory of Open Access Journals (Sweden)

    Gian Maria Pacifici

    2018-02-01

    Full Text Available Bacterial infections may cause disease and death. Infants and children are often subject to bacterial infections. Antimicrobials kill bacteria protecting the infected patients andreducing the risk of morbidity and mortality caused by bacteria. The antibiotics may lose their antibacterial activity when they become resistant to a bacteria. The resistance to different antibiotics in a bacteria is named multidrug-resistance. Gram-negative bacilli, especially Escherichia coli, Klebsiella, Enterobacter, Salmonella, Shigella, Pseudomonas, Streptococcus, and Haemophilus influenzae type b, may become resistant. Amikacin ampicillin, amoxicillin, amoxiclav, cefuroxime, cefotaxime, ceftazidime, cefoperazone tetracycline, chloramphenicol, ciprofloxacin, and gentamicin may cause bacterial-resistance. Resistance to bacteria for several pathogens makes complications in the treatment of infections caused by them. Salmonella strains may become resistant to ampicillin, cephalotin, ceftriaxone, gentamicin, amikacin, trimethoprim-sulfamethoxazole, chloramphenicol, and tetracycline. Shigella strains may become resistant to ampicillin, cotrimoxazole, chloramphenicol, and streptomycin. Multidrug-resistance of Streptococcus pneumoniae may be due to β-lactams, macrolides, tetracycline, chloramphenicol, and trimethoprim-sulfamethoxazole. Multidrug-resistance of Pseudomonas aeruginosa may become resistant to β-lactams, chloramphenicol, trimethoprim-sulfamethoxazole, and tetracycline. The antibacterial activity against Haemophilus strains may occur with ampicillin, sulbactam-ampicillin, trimethoprim-sulfamethoxazole, gentamicin, chloramphenicol, and ciprofloxacin. Multidrug-resistance of the Klebsiella species may be due with ampicillin, cefotaxime, cefuroxime, co-amxilav, mezlocillin, chloramphenicol, gentamicin, and ceftazidime. Multidrug-resistance of Escherichia coli may be caused by ampicillin, cotrimoxazole, chloramphenicol, ceftriaxone, and ceftazidime. Vibrio

  6. Molecular Analysis of Multi-Drug Resistance (MDR) in ...

    African Journals Online (AJOL)

    This review therefore brings to light some of the processes involved in molecular typing of Mycobacterium tuberculosis strains like the use of restriction fragment length polymorphism (RFLP) and spoligotyping, which have become valuable tools in the epidemiology of tuberculosis, identification of genotypes and ...

  7. Phenotypic and genomic comparison of Mycobacterium aurum and surrogate model species to Mycobacterium tuberculosis: implications for drug discovery.

    Science.gov (United States)

    Namouchi, Amine; Cimino, Mena; Favre-Rochex, Sandrine; Charles, Patricia; Gicquel, Brigitte

    2017-07-13

    Tuberculosis (TB) is caused by Mycobacterium tuberculosis and represents one of the major challenges facing drug discovery initiatives worldwide. The considerable rise in bacterial drug resistance in recent years has led to the need of new drugs and drug regimens. Model systems are regularly used to speed-up the drug discovery process and circumvent biosafety issues associated with manipulating M. tuberculosis. These include the use of strains such as Mycobacterium smegmatis and Mycobacterium marinum that can be handled in biosafety level 2 facilities, making high-throughput screening feasible. However, each of these model species have their own limitations. We report and describe the first complete genome sequence of Mycobacterium aurum ATCC23366, an environmental mycobacterium that can also grow in the gut of humans and animals as part of the microbiota. This species shows a comparable resistance profile to that of M. tuberculosis for several anti-TB drugs. The aims of this study were to (i) determine the drug resistance profile of a recently proposed model species, Mycobacterium aurum, strain ATCC23366, for anti-TB drug discovery as well as Mycobacterium smegmatis and Mycobacterium marinum (ii) sequence and annotate the complete genome sequence of this species obtained using Pacific Bioscience technology (iii) perform comparative genomics analyses of the various surrogate strains with M. tuberculosis (iv) discuss how the choice of the surrogate model used for drug screening can affect the drug discovery process. We describe the complete genome sequence of M. aurum, a surrogate model for anti-tuberculosis drug discovery. Most of the genes already reported to be associated with drug resistance are shared between all the surrogate strains and M. tuberculosis. We consider that M. aurum might be used in high-throughput screening for tuberculosis drug discovery. We also highly recommend the use of different model species during the drug discovery screening process.

  8. Collectin CL-LK Is a Novel Soluble Pattern Recognition Receptor for Mycobacterium tuberculosis

    DEFF Research Database (Denmark)

    Troegeler, Anthony; Lugo-Villarino, Geanncarlo; Hansen, Søren

    2015-01-01

    Understanding the molecular components of immune recognition of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, can help designing novel strategies to combat TB. Here, we identify collectin CL-LK as a novel soluble C-type lectin able to bind M. tuberculosis, and characterize mycobacte......Understanding the molecular components of immune recognition of the tuberculosis (TB) bacillus, Mycobacterium tuberculosis, can help designing novel strategies to combat TB. Here, we identify collectin CL-LK as a novel soluble C-type lectin able to bind M. tuberculosis, and characterize...

  9. Inactivation of Mycobacterium paratuberculosis and Mycobacterium tuberculosis in fresh soft cheese by gamma radiation

    International Nuclear Information System (INIS)

    Badr, Hesham M.

    2011-01-01

    The effectiveness of gamma irradiation on the inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese that prepared from artificially inoculated milk samples was studied. Irradiation at dose of 2 kGy was sufficient for the complete inactivation of these mycobacteria as they were not detected in the treated samples during storage at 4±1 o C for 15 days. Moreover, irradiation of cheese samples, that were prepared from un-inoculated milk, at this effective dose had no significant effects on their gross composition and contents from riboflavin, niacin and pantothenic acid, while significant decreases in vitamin A and thiamin were observed. In addition, irradiation of cheese samples had no significant effects on their pH and nitrogen fractions contents, except for the contents of ammonia, which showed a slight, but significant, increases due to irradiation. The analysis of cheese fats indicated that irradiation treatment induced significant increase in their oxidation parameters and contents from free fatty acids; however, the observed increases were relatively low. On the other hand, irradiation of cheese samples induced no significant alterations on their sensory properties. Thus, irradiation dose of 2 kGy can be effectively applied to ensure the safety of soft cheese with regards to these harmful mycobacteria. - Highlights: → We examined the effectiveness of gamma irradiation on inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese. → Irradiation at dose of 2 kGy was sufficient for complete inactivation of these mycobacteria. → Irradiation of cheese samples induced no significant alterations on their sensory properties.

  10. Inactivation of Mycobacterium paratuberculosis and Mycobacterium tuberculosis in fresh soft cheese by gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Badr, Hesham M., E-mail: heshambadr_aea@yahoo.co.uk [Atomic Energy Authority, Nuclear Research Center, Abou Zaabal, P.O. Box 13759 Cairo (Egypt)

    2011-11-15

    The effectiveness of gamma irradiation on the inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese that prepared from artificially inoculated milk samples was studied. Irradiation at dose of 2 kGy was sufficient for the complete inactivation of these mycobacteria as they were not detected in the treated samples during storage at 4{+-}1 {sup o}C for 15 days. Moreover, irradiation of cheese samples, that were prepared from un-inoculated milk, at this effective dose had no significant effects on their gross composition and contents from riboflavin, niacin and pantothenic acid, while significant decreases in vitamin A and thiamin were observed. In addition, irradiation of cheese samples had no significant effects on their pH and nitrogen fractions contents, except for the contents of ammonia, which showed a slight, but significant, increases due to irradiation. The analysis of cheese fats indicated that irradiation treatment induced significant increase in their oxidation parameters and contents from free fatty acids; however, the observed increases were relatively low. On the other hand, irradiation of cheese samples induced no significant alterations on their sensory properties. Thus, irradiation dose of 2 kGy can be effectively applied to ensure the safety of soft cheese with regards to these harmful mycobacteria. - Highlights: > We examined the effectiveness of gamma irradiation on inactivation of Mycobacterium paratuberculosis, Mycobacterium bovis and Mycobacterium tuberculosis in fresh soft cheese. > Irradiation at dose of 2 kGy was sufficient for complete inactivation of these mycobacteria. > Irradiation of cheese samples induced no significant alterations on their sensory properties.

  11. Molecular characterization of Mycobacterium tuberculosis isolates from Tehran, Iran by restriction fragment length polymorphism analysis and spoligotyping

    Directory of Open Access Journals (Sweden)

    Seifu Gizaw Feyisa

    2016-04-01

    Full Text Available Abstract: INTRODUCTION Characterization of Mycobacterium tuberculosis (MTB isolates by DNA fingerprinting has contributed to tuberculosis (TB control. The aim of this study was to determine the genetic diversity of MTB isolates from Tehran province in Iran. METHODS MTB isolates from 60 Iranian and 10 Afghan TB patients were fingerprinted by standard IS6110-restriction fragment length polymorphism (RFLP analysis and spoligotyping. RESULTS The copy number of IS6110 ranged from 10-24 per isolate. The isolates were classified into 22 clusters showing ≥ 80% similarity by RFLP analysis. Fourteen multidrug-resistant (MDR isolates were grouped into 4 IS6110-RFLP clusters, with 10 isolates [71% (95% CI: 45-89%] in 1 cluster, suggesting a possible epidemiological linkage. Eighteen Iranian isolates showed ≥ 80% similarity with Afghan isolates. There were no strains with identical fingerprints. Spoligotyping of 70 isolates produced 23 distinct patterns. Sixty (85.7% isolates were grouped into 13 clusters, while the remaining 10 isolates (14.2% were not clustered. Ural (formerly Haarlem4 (n = 22, 31.4% was the most common family followed by Central Asian strain (CAS (n = 18, 25.7% and T (n = 9, 12.8% families. Only 1strain was characterized as having the Beijing genotype. Among 60 Iranian and 10 Afghan MTB isolates, 25% (95% CI: 16-37 and 70% (95% CI: 39-89 were categorized as Ural lineage, respectively. CONCLUSIONS A higher prevalence of Ural family MTB isolates among Afghan patients than among Iranian patients suggests the possible transmission of this lineage following the immigration of Afghans to Iran.

  12. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients.

    Science.gov (United States)

    Eklund, Daniel; Persson, Hans Lennart; Larsson, Marie; Welin, Amanda; Idh, Jonna; Paues, Jakob; Fransson, Sven-Göran; Stendahl, Olle; Schön, Thomas; Lerm, Maria

    2013-03-01

    The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB), the bacterium responsible for tuberculosis (TB), has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs) from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL)-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha) and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth. Copyright © 2013 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  14. Human ULK1 Variation and Susceptibility to Mycobacterium tuberculosis Infection.

    Science.gov (United States)

    Horne, David J; Graustein, Andrew D; Shah, Javeed A; Peterson, Glenna; Savlov, Meg; Steele, Sergio; Narita, Masahiro; Hawn, Thomas R

    2016-10-15

    Unlike tuberculosis, few studies have evaluated a host genetic basis for variability in susceptibility to latent Mycobacterium tuberculosis infection (LTBI). We performed a candidate gene association study of autophagy-related genes and LTBI. We enrolled close contacts of individuals with pulmonary tuberculosis, assessed LTBI status, and determined clinical and sociodemographic risk factors for LTBI. In participants who self-identified as Asian or black, we compared haplotype-tagging single-nucleotide polymorphisms (SNPs) in ULK1 and GABARAP between cases (n = 143) and controls (n = 106). Using CRISPR/Cas9 in U937 monocytes, we investigated the effect of ULK1 deficiency on cytokine expression, autophagy, and M. tuberculosis replication. In Asian participants, we identified 2 ULK1 SNPs (rs12297124 and rs7300908) associated with LTBI. After adjustment for population admixture and clinical risk for LTBI, each rs12297124 minor allele conferred 80% reduction in LTBI risk (odds ratio, 0.18; 95% confidence interval, .07-.46). Compared with controls, ULK1-deficient cells exhibited decreased tumor necrosis factor secretion after stimulation with Toll-like receptor ligands and M. tuberculosis whole-cell lysate, increased M. tuberculosis replication, and decreased selective autophagy. These results demonstrate a strong association of rs12297124, a noncoding ULK1 SNP, with LTBI and a role for ULK1 regulation of TNF secretion, nonspecific and M. tuberculosis-induced autophagy, and M. tuberculosis replication in monocytes. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  15. Dendritic Cells Activate and Mature after Infection with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Mamo Gezahagne

    2011-07-01

    Full Text Available Abstract Background Dendritic cells (DCs can take up an array of different antigens, including microorganisms which they can process and present more effectively than any other antigen presenting cell. However, whether the interaction between the human DC and Mycobacterium tuberculosis represents a defense mechanism by the invaded host, or helping the invader to evade the defense mechanism of the host is still not clearly understood. Findings To analyze the interactions between M. tuberculosis and immune cells, human peripheral blood monocyte-derived immature DCs were infected with M. tuberculosis H37Rv wild type strain and flow cytometry was used to analyse cell surface expression markers. The ability of the M. tuberculosis infected DC to induce T cell proliferation using 5 and 6-carboxyfluorescein diacetate succinimidyl ester (CFSE dilution technique was also investigated. DCs were found to internalize the mycobacteria and show dose dependent infection and necrosis with different multiplicity of infection. Flow cytometry analysis of cell surface expression markers CD40, CD54, CD80, CD83, CD86 and HLA DR in infected DC revealed significant (p M. tuberculosis in comparison to immature DC with no stimulation. Lipopolysaccharide (LPS from Salmonella abortus equi, a known DC maturation agent, was used as a positive control and showed a comparable up regulation of cell surface markers as observed with M. tuberculosis infected DC. It was revealed that the M. tuberculosis infected DC induced T cell proliferation. Conclusion These data clearly demonstrate that M. tuberculosis induces activation and maturation of human monocyte-derived immature DC as well as induces T cell proliferation in vitro.

  16. Microbial sensor for drug susceptibility testing of Mycobacterium tuberculosis.

    Science.gov (United States)

    Zhang, Z-T; Wang, D-B; Li, C-Y; Deng, J-Y; Zhang, J-B; Bi, L-J; Zhang, X-E

    2018-01-01

    Drug susceptibility testing (DST) of clinical isolates of Mycobacterium tuberculosis is critical in treating tuberculosis. We demonstrate the possibility of using a microbial sensor to perform DST of M. tuberculosis and shorten the time required for DST. The sensor is made of an oxygen electrode with M. tuberculosis cells attached to its surface. This sensor monitors the residual oxygen consumption of M. tuberculosis cells after treatment with anti-TB drugs with glycerine as a carbon source. In principle, after drug pretreatment for 4-5 days, the response differences between the sensors made of drug-sensitive isolates are distinguishable from the sensors made of drug-resistant isolates. The susceptibility of the M. tuberculosis H37Ra strain, its mutants and 35 clinical isolates to six common anti-TB drugs: rifampicin, isoniazid, streptomycin, ethambutol, levofloxacin and para-aminosalicylic acid were tested using the proposed method. The results agreed well with the gold standard method (LJ) and were determined in significantly less time. The whole procedure takes approximately 11 days and therefore has the potential to inform clinical decisions. To our knowledge, this is the first study that demonstrates the possible application of a dissolved oxygen electrode-based microbial sensor in M. tuberculosis drug resistance testing. This study used the microbial sensor to perform DST of M. tuberculosis and shorten the time required for DST. The overall detection result of the microbial sensor agreed well with that of the conventional LJ proportion method and takes less time than the existing phenotypic methods. In future studies, we will build an O 2 electrode array microbial sensor reactor to enable a high-throughput drug resistance analysis. © 2017 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  17. Mixed metal oxide nanoparticles inhibit growth of Mycobacterium tuberculosis into THP-1 cells.

    Science.gov (United States)

    Jafari, A R; Mosavi, T; Mosavari, N; Majid, A; Movahedzade, F; Tebyaniyan, M; Kamalzadeh, M; Dehgan, M; Jafari, S; Arastoo, S

    2016-12-01

    Humans have been in a constant battle with tuberculosis (TB). Currently, overuse of antibiotics has resulted in the spread of multidrug-resistant Mycobacterium tuberculosis (MDR), leading to antibiotic ineffectiveness at controlling the spread of TB infection in host cells and especially macrophages. Additionally, the Mycobacterium tuberculosis (Mtb) has developed methods to evade the immune system and survive. With the discovery of nanoparticle (NP)-based drugs, it is necessary to research their anti-mycobacterial properties and bactericidal mechanisms. In this study, we synthesized mixed metal oxide NPs and tested their ability to inhibit Mtb growth into macrophages and investigated the cytotoxic effects of NPs in THP-1 cells. Silver (Ag) NPs and zinc oxide (ZnO) NPs were synthesized by chemical reduction and chemical deposition in aqueous solution, and the diffraction light scattering, scanning electron microscopy, transmission electron microscopy, and ultraviolet-visible light-absorption spectra were used to identify NP properties. Ag and ZnO NPs were mixed together at a ratio of 8 ZnO /2 Ag and diluted into Löwenstein-Jensen medium followed by the addition of bacteria and incubation for 28days at 37°C. The toxicity of NPs to THP-1 cells was assessed by MTT test, and macrophages were infected with Mtb for 4h at 37°C under 5% CO 2 . Nano-sized particles were estimated at ∼30-80nm, and the initial concentration of Ag NPs and ZnO NPs were estimated at ∼20ppm and ∼60ppm. The minimal inhibitory concentration ratio of 8 ZnO /2 Ag NPs against Mtb was detected at ∼1/32 of the initial concentration. Ag NPs in the range of concentrations exhibited no anti-Mtb effects, whereas ZnO NPs showed potent antibacterial activity at ∼1/128 of the initial concentration. ZnO NPs at all concentrations showed cytotoxic activity, whereas 100% of THP-1 cells remained viable in the presence of Ag NPs at ∼1/32 and ∼1/64 of the initial concentrations. However, at ratios of

  18. Interaction of Mycobacterium tuberculosis with human respiratory mucosa.

    Science.gov (United States)

    Middleton, A M; Chadwick, M V; Nicholson, A G; Dewar, A; Groger, R K; Brown, E J; Ratliff, T L; Wilson, R

    2002-01-01

    Endobronchial infection is associated with pulmonary tuberculosis in the majority of cases. We have investigated the adherence of Mycobacterium tuberculosis to the human respiratory mucosa. Organ cultures constructed with human tissue were infected with M. tuberculosis in the presence or absence of mycobacterial fibronectin attachment cell surface proteins and examined by scanning electron microscopy. M. tuberculosis adhered mainly to extracellular matrix (ECM) in areas of mucosal damage, but not to ciliated mucosa, intact extruded cells, basement membrane or collagen fibres. Bacteria also adhered to fibrous but not globular mucus and occasionally to healthy unciliated mucosa, open tight junctions and to extruded cells that had degenerated, exposing their contents. There was a significant reduction (pprotein (FAP) and M. bovis antigen 85B protein, in a concentration dependent manner. The combined effect of FAP and antigen 85B protein was significantly greater than either protein alone. Bacterial adherence to fibrous mucus was not influenced by fibronectin. We conclude that M. tuberculosis adheres to ECM in areas of mucosal damage at least in part via FAP and antigen 85B protein.

  19. Is IQG-607 a Potential Metallodrug or Metallopro-Drug With a Defined Molecular Target in Mycobacterium tuberculosis?

    Directory of Open Access Journals (Sweden)

    Bruno L. Abbadi

    2018-05-01

    Full Text Available The emergence of strains of Mycobacterium tuberculosis resistant to isoniazid (INH has underscored the need for the development of new anti-tuberculosis agents. INH is activated by the mycobacterial katG-encoded catalase-peroxidase, forming an acylpyridine fragment that is covalently attached to the C4 of NADH. This isonicotinyl-NAD adduct inhibits the activity of 2-trans-enoyl-ACP(CoA reductase (InhA, which plays a role in mycolic acid biosynthesis. A metal-based INH analog, Na3[FeII(CN5(INH]·4H2O, IQG-607, was designed to have an electronic redistribution on INH moiety that would lead to an intramolecular electron transfer to bypass KatG activation. HPLC and EPR studies showed that the INH moiety can be oxidized by superoxide or peroxide yielding similar metabolites and isonicotinoyl radical only when associated to IQG-607, thereby supporting redox-mediated drug activation as a possible mechanism of action. However, IQG-607 was shown to inhibit the in vitro activity of both wild-type and INH-resistant mutant InhA enzymes in the absence of KatG activation. IQG-607 given by the oral route to M. tuberculosis-infected mice reduced lung lesions. Experiments using early and late controls of infection revealed a bactericidal activity for IQG-607. HPLC and voltammetric methods were developed to quantify IQG-607. Pharmacokinetic studies showed short half-life, high clearance, moderate volume of distribution, and low oral bioavailability, which was not altered by feeding. Safety and toxic effects of IQG-607 after acute and 90-day repeated oral administrations in both rats and minipigs showed occurrence of mild to moderate toxic events. Eight multidrug-resistant strains (MDR-TB were resistant to IQG-607, suggesting an association between katG mutation and increasing MIC values. Whole genome sequencing of three spontaneous IQG-607-resistant strains harbored katG gene mutations. MIC measurements and macrophage infection experiments with a laboratorial

  20. Insights on the Emergence of Mycobacterium tuberculosis from the Analysis of Mycobacterium kansasii

    Science.gov (United States)

    Wang, Joyce; McIntosh, Fiona; Radomski, Nicolas; Dewar, Ken; Simeone, Roxane; Enninga, Jost; Brosch, Roland; Rocha, Eduardo P.; Veyrier, Frédéric J.; Behr, Marcel A.

    2015-01-01

    By phylogenetic analysis, Mycobacterium kansasii is closely related to Mycobacterium tuberculosis. Yet, although both organisms cause pulmonary disease, M. tuberculosis is a global health menace, whereas M. kansasii is an opportunistic pathogen. To illuminate the differences between these organisms, we have sequenced the genome of M. kansasii ATCC 12478 and its plasmid (pMK12478) and conducted side-by-side in vitro and in vivo investigations of these two organisms. The M. kansasii genome is 6,432,277 bp, more than 2 Mb longer than that of M. tuberculosis H37Rv, and the plasmid contains 144,951 bp. Pairwise comparisons reveal conserved and discordant genes and genomic regions. A notable example of genomic conservation is the virulence locus ESX-1, which is intact and functional in the low-virulence M. kansasii, potentially mediating phagosomal disruption. Differences between these organisms include a decreased predicted metabolic capacity, an increased proportion of toxin–antitoxin genes, and the acquisition of M. tuberculosis-specific genes in the pathogen since their common ancestor. Consistent with their distinct epidemiologic profiles, following infection of C57BL/6 mice, M. kansasii counts increased by less than 10-fold over 6 weeks, whereas M. tuberculosis counts increased by over 10,000-fold in just 3 weeks. Together, these data suggest that M. kansasii can serve as an image of the environmental ancestor of M. tuberculosis before its emergence as a professional pathogen, and can be used as a model organism to study the switch from an environmental opportunistic pathogen to a professional host-restricted pathogen. PMID:25716827

  1. Mycobacterium tuberculosis Complex Members Adapted to Wild and Domestic Animals.

    Science.gov (United States)

    Malone, Kerri M; Gordon, Stephen V

    2017-01-01

    The Mycobacterium tuberculosis complex (MTBC) is composed of several highly genetically related species that can be broadly classified into those that are human-host adapted and those that possess the ability to propagate and transmit in a variety of wild and domesticated animals. Since the initial description of the bovine tubercle bacillus, now known as Mycobacterium bovis, by Theobald Smith in the late 1800's, isolates originating from a wide range of animal hosts have been identified and characterized as M. microti, M. pinnipedii, the Dassie bacillus, M. mungi, M. caprae, M. orygis and M. suricattae. This chapter outlines the events resulting in the identification of each of these animal-adapted species, their close genetic relationships, and how genome-based phylogenetic analyses of species-specific variation amongst MTBC members is beginning to unravel the events that resulted in the evolution of the MTBC and the observed host tropism between the human- and animal-adapted member species.

  2. Multi-drug resistant Ewingella Americana

    International Nuclear Information System (INIS)

    Bukhari, Syed Z.; Ashshi, Ahmad M.; Hussain, Waleed M.; Fatani, Mohammad I.

    2008-01-01

    We report a case of pneumonia due to multi-drug resistant Ewingella Americana in a young patient admitted in the Intensive Care Unit of Hera General Hospital, Makkah, Saudi Arabia with severe head injury in a road traffic accident. He was an Indonesian pilgrim who had traveled to the Kingdom of Saudi Arabia to perform Hajj in December 2007. Ewingella Americana was identified to be the pathogen of pneumonia with clinical signs and symptoms along with positive radiological findings. (author)

  3. Multiplexed Quantitation of Intraphagocyte Mycobacterium tuberculosis Secreted Protein Effectors

    Directory of Open Access Journals (Sweden)

    Fadel Sayes

    2018-04-01

    Full Text Available Summary: The pathogenic potential of Mycobacterium tuberculosis largely depends on ESX secretion systems exporting members of the multigenic Esx, Esp, and PE/PPE protein families. To study the secretion and regulation patterns of these proteins while circumventing immune cross-reactions due to their extensive sequence homologies, we developed an approach that relies on the recognition of their MHC class II epitopes by highly discriminative T cell receptors (TCRs of a panel of T cell hybridomas. The latter were engineered so that each expresses a unique fluorescent reporter linked to specific antigen recognition. The resulting polychromatic and multiplexed imaging assay enabled us to measure the secretion of mycobacterial effectors inside infected host cells. We applied this novel technology to a large panel of mutants, clinical isolates, and host-cell types to explore the host-mycobacteria interplay and its impact on the intracellular bacterial secretome, which also revealed the unexpected capacity of phagocytes from lung granuloma to present mycobacterial antigens via MHC class II. : Sayes et al. develop an approach to express distinct fluorescent reporters that is based on the recognition of specific Mycobacterium tuberculosis MHC class II epitopes by highly discriminative T cell hybridomas. This multiplexed technology allows the study of secretion, subcellular location, and regulation patterns of these instrumental protein members. Keywords: mycobacterium tuberculosis, type VII secretion systems, intracellular bacteria, T-cell hybridomas, mycobacterial virulence factors, bacterial antigen presentation, lentiviral vectors, reporter T cells, in vivo antigen presentation, protein localization

  4. Mycobacterium tuberculosis whole genome sequencing and protein structure modelling provides insights into anti-tuberculosis drug resistance

    KAUST Repository

    Phelan, Jody; Coll, Francesc; McNerney, Ruth; Ascher, David B.; Pires, Douglas E. V.; Furnham, Nick; Coeck, Nele; Hill-Cawthorne, Grant A.; Nair, Mridul; Mallard, Kim; Ramsay, Andrew; Campino, Susana; Hibberd, Martin L.; Pain, Arnab; Rigouts, Leen; Clark, Taane G.

    2016-01-01

    of 144 Mycobacterium tuberculosis clinical isolates from The Special Programme for Research and Training in Tropical Diseases (TDR) collection sourced from 20 countries in four continents. A genome-wide approach was applied to 127 isolates to identify

  5. Diffuse Type Primary Mycobacterium Tuberculosis of the Breast: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyun A; Kang, Bong Joo; Kim, Sung Hun; Kim, Hnana; Lee, Ah Won [Seoul St. Mary' s Hospital, The Catholic University of Korea, Seoul (Korea, Republic of)

    2011-12-15

    Tuberculous mastitis is a rare manifestation of mycobacterium tuberculosis infection. It mimics inflammatory breast cancer or other pyogenic inflammations. In most of the tuberculous mastitis reports, coexisting or prior tuberculosis infection and secondary infection of the breast by direct spread via axillary or cervical lymphadenopathy, or hematogenous spread have been noted. We describe the mammographic and ultrasonographic findings of a case of diffuse type mycobacterium tuberculosis of the breast showing diffuse edema which was confirmed as tuberculosis through biopsy and had no evidence of old or concurrent pulmonary tuberculosis on chest computed tomography

  6. Improved method for testing susceptibility of Mycobacterium tuberculosis to pyrazinamide.

    OpenAIRE

    Butler, W R; Kilburn, J O

    1982-01-01

    The acid medium required to test susceptibility of Mycobacterium tuberculosis to pyrazinamide (PZA) is a major problem in obtaining reliable test results. Satisfactory growth is usually obtained on Middlebrook and Cohn 7H10 medium at pH 5.5 if albumin-dextrose-catalase (ADC) supplement rather than oleic acid-albumin-dextrose-catalase is used; however, some lots of ADC supplement still fail to support growth at this low pH. A rapid turbidimetric test was developed to determine the growth-suppo...

  7. Anti-Mycobacterium tuberculosis activity of fungus Phomopsis stipata

    Directory of Open Access Journals (Sweden)

    Karina Andrade de Prince

    2012-03-01

    Full Text Available Our purpose was to determine the anti-Mycobacterium tuberculosis activity of the metabolites produced by the endophitic fungus Phomopsis stipata (Lib. B. Sutton, (Diaporthaceae, cultivated in different media. The antimycobacterial activity was assessed through the Resazurin Microtiter Assay (REMA and the cytotoxicity test performed on macrophage cell line. The extracts derived from fungi grown on Corn Medium and Potato Dextrose Broth presented the smallest values of Minimum Inhibitory Concentration (MIC and low cytotoxicity, which implies a high selectivity index. This is the first report on the chemical composition and antitubercular activity of metabolites of P. stipata, as well as the influence of culture medium on these properties.

  8. Mycobacterium tuberculosis Genotype and Case Notification Rates, Rural Vietnam, 2003-2006

    NARCIS (Netherlands)

    Buu, T.N.; Huyen, M.N.T.; Lan, N.N.T.; Quy, H.T.; Hen, N.V.; Zignol, M.; Borgdorff, M.W.; van Soolingen, D.; Cobelens, F.G.J.

    2009-01-01

    Tuberculosis case notification rates (CNRs) for young adults in Vietnam are increasing. To determine whether this finding could reflect emergence of Mycobacterium tuberculosis Beijing genotype, we studied all new sputum smear-positive pulmonary tuberculosis patients registered for treatment in 3

  9. Identification of a novel 27-kDa protein from Mycobacterium tuberculosis culture fluid by a monoclonal antibody specific for the Mycobacterium tuberculosis complex

    NARCIS (Netherlands)

    Rambukkana, A.; Das, P. K.; Kolk, A. H.; Burggraaf, J. D.; Kuijper, S.; Harboe, M.

    1993-01-01

    Mycobacterium tuberculosis antigens inducing species-specific immune responses are likely to be particularly important for serodiagnosis or for skin testing of tuberculosis. In the present study, we describe the characterization of two novel monoclonal antibodies (MoAbs) A3h4 (IgG2a) and B5g1 (IgM)

  10. Mycobacterium tuberculosis Infection following Kidney Transplantation

    Directory of Open Access Journals (Sweden)

    Karima Boubaker

    2013-01-01

    Full Text Available Introduction and Aims. Post-transplant tuberculosis (TB is a problem in successful long-term outcome of renal transplantation recipients. Our objective was to describe the pattern and risk factors of TB infection and the prognosis in our transplant recipients. Patients and Methods. This study was a retrospective review of the records of 491 renal transplant recipients in our hospital during the period from January 1986 to December 2009. The demographic data, transplant characteristics, clinical manifestations, diagnostic criteria, treatment protocol, and long-term outcome of this cohort of patients were analyzed. Results. 16 patients (3,2% developed post-transplant TB with a mean age of 32,5 ± 12,7 (range: 13–60 years and a mean post-transplant period of 36,6months (range: 12,3 months–15,9 years. The forms of the diseases were pulmonary in 10/16 (62,6%, disseminated in 3/16 (18,7%, and extrapulmonary in 3/16 (18,7%. Graft dysfunction was observed in 7 cases (43,7% with tissue-proof acute rejection in 3 cases and loss of the graft in 4 cases. Hepatotoxicity developed in 3 patients (18,7% during treatment. Recurrences were observed in 4 cases after early stop of treatment. Two patients (12.5% died. Conclusion. Extra pulmonary and disseminated tuberculosis were observed in third of our patients. More than 9months of treatment may be necessary to prevent recurrence.

  11. Origins and properties of Mycobacterium tuberculosis isolates in London.

    Science.gov (United States)

    Dale, Jeremy W; Bothamley, Graham H; Drobniewski, Francis; Gillespie, Stephen H; McHugh, Timothy D; Pitman, Richard

    2005-06-01

    Using similarities of IS6110 banding patterns, isolates of Mycobacterium tuberculosis from a population-based study in London were assigned to 12 large groups termed 'superfamilies' (sfams). Analysis of patient data showed a marked geographical association in the distribution of these sfams. In particular, isolates from patients born in Europe were from different sfams than those born elsewhere, indicating that there had been relatively little transmission of tuberculosis in London from immigrant communities into the endogenous population. Multivariate analysis showed that certain sfams were significantly associated with pulmonary rather than extrapulmonary disease, or with sputum smear negativity, independently of country of birth or ethnicity, suggesting that the properties of the infecting organism play a role in the nature of the disease process.

  12. Gamma Interferon Release Assays for Detection of Mycobacterium tuberculosis Infection

    Science.gov (United States)

    Denkinger, Claudia M.; Kik, Sandra V.; Rangaka, Molebogeng X.; Zwerling, Alice; Oxlade, Olivia; Metcalfe, John Z.; Cattamanchi, Adithya; Dowdy, David W.; Dheda, Keertan; Banaei, Niaz

    2014-01-01

    SUMMARY Identification and treatment of latent tuberculosis infection (LTBI) can substantially reduce the risk of developing active disease. However, there is no diagnostic gold standard for LTBI. Two tests are available for identification of LTBI: the tuberculin skin test (TST) and the gamma interferon (IFN-γ) release assay (IGRA). Evidence suggests that both TST and IGRA are acceptable but imperfect tests. They represent indirect markers of Mycobacterium tuberculosis exposure and indicate a cellular immune response to M. tuberculosis. Neither test can accurately differentiate between LTBI and active TB, distinguish reactivation from reinfection, or resolve the various stages within the spectrum of M. tuberculosis infection. Both TST and IGRA have reduced sensitivity in immunocompromised patients and have low predictive value for progression to active TB. To maximize the positive predictive value of existing tests, LTBI screening should be reserved for those who are at sufficiently high risk of progressing to disease. Such high-risk individuals may be identifiable by using multivariable risk prediction models that incorporate test results with risk factors and using serial testing to resolve underlying phenotypes. In the longer term, basic research is necessary to identify highly predictive biomarkers. PMID:24396134

  13. Profiling the Proteome of Mycobacterium tuberculosis during Dormancy and Reactivation*

    Science.gov (United States)

    Gopinath, Vipin; Raghunandanan, Sajith; Gomez, Roshna Lawrence; Jose, Leny; Surendran, Arun; Ramachandran, Ranjit; Pushparajan, Akhil Raj; Mundayoor, Sathish; Jaleel, Abdul; Kumar, Ramakrishnan Ajay

    2015-01-01

    Tuberculosis, caused by Mycobacterium tuberculosis, still remains a major global health problem. The main obstacle in eradicating this disease is the ability of this pathogen to remain dormant in macrophages, and then reactivate later under immuno-compromised conditions. The physiology of hypoxic nonreplicating M. tuberculosis is well-studied using many in vitro dormancy models. However, the physiological changes that take place during the shift from dormancy to aerobic growth (reactivation) have rarely been subjected to a detailed investigation. In this study, we developed an in vitro reactivation system by re-aerating the virulent laboratory strain of M. tuberculosis that was made dormant employing Wayne's dormancy model, and compared the proteome profiles of dormant and reactivated bacteria using label-free one-dimensional LC/MS/MS analysis. The proteome of dormant bacteria was analyzed at nonreplicating persistent stage 1 (NRP1) and stage 2 (NRP2), whereas that of reactivated bacteria was analyzed at 6 and 24 h post re-aeration. Proteome of normoxially grown bacteria served as the reference. In total, 1871 proteins comprising 47% of the M. tuberculosis proteome were identified, and many of them were observed to be expressed differentially or uniquely during dormancy and reactivation. The number of proteins detected at different stages of dormancy (764 at NRP1, 691 at NRP2) and reactivation (768 at R6 and 983 at R24) was very low compared with that of the control (1663). The number of unique proteins identified during normoxia, NRP1, NRP2, R6, and R24 were 597, 66, 56, 73, and 94, respectively. We analyzed various biological functions during these conditions. Fluctuation in the relative quantities of proteins involved in energy metabolism during dormancy and reactivation was the most significant observation we made in this study. Proteins that are up-regulated or uniquely expressed during reactivation from dormancy offer to be attractive targets for therapeutic

  14. Mycobacterium tuberculosis Infection in a Domesticated Korean Wild Boar ( Sus scrofa coreanus).

    Science.gov (United States)

    Seo, Min-Goo; Ouh, In-Ohk; Kim, Munki; Lee, Jienny; Kim, Young-Hoan; Do, Jae-Cheul; Kwak, Dongmi

    2017-06-01

    Tuberculosis, a chronic progressive disease, has been reported in bovine, swine, and primate species. Here, we report the first case of Mycobacterium tuberculosis infection in a Korean wild boar ( Sus scrofa coreanus). The owners this domesticated boar brought it to the Gyeongbuk Veterinary Service Laboratory in Korea after it was found dead and severely emaciated. Demarcated yellowish white nodules were found around the larynx and retropharyngeal lymph node during necropsy. The lungs had diffuse fibrinous pleuritis, severe congestion, and scattered nodules. More nodules were found in the spleen. Tuberculosis is characterized by massive macrophage infiltration and central caseous necrosis; both characteristics were found in the lungs. Histopathologic examination revealed that the alveolar lumen had marked fibrosis and exudates. Examination of the fluid revealed extensive macrophage permeation. To confirm a Mycobacterium infection, PCR was performed using two primer sets specific to the rpoB gene of Mycobacterium; Mycobacterium was detected in the lungs and spleen. To identify the species of Mycobacterium, immunohistochemical evaluation was performed using antibodies against Mycobacterium tuberculosis and Mycobacterium bovis . The results revealed immunoreactivity against M. tuberculosis but not against M. bovis . The consumption of undercooked or raw meat from game animals may expose humans and other animals to sylvatic infection. Consequently, Koreans who ingest wild boar may be at risk of a tuberculosis infection. To reduce the risk of foodborne infection and maintain public health, continuous monitoring and control strategies are required.

  15. Is adipose tissue a place for Mycobacterium tuberculosis persistence?

    Directory of Open Access Journals (Sweden)

    Olivier Neyrolles

    Full Text Available BACKGROUND: Mycobacterium tuberculosis, the etiological agent of tuberculosis (TB, has the ability to persist in its human host for exceptionally long periods of time. However, little is known about the location of the bacilli in latently infected individuals. Long-term mycobacterial persistence in the lungs has been reported, but this may not sufficiently account for strictly extra-pulmonary TB, which represents 10-15% of the reactivation cases. METHODOLOGY/PRINCIPAL FINDINGS: We applied in situ and conventional PCR to sections of adipose tissue samples of various anatomical origins from 19 individuals from Mexico and 20 from France who had died from causes other than TB. M. tuberculosis DNA could be detected by either or both techniques in fat tissue surrounding the kidneys, the stomach, the lymph nodes, the heart and the skin in 9/57 Mexican samples (6/19 individuals, and in 8/26 French samples (6/20 individuals. In addition, mycobacteria could be immuno-detected in perinodal adipose tissue of 1 out of 3 biopsy samples from individuals with active TB. In vitro, using a combination of adipose cell models, including the widely used murine adipose cell line 3T3-L1, as well as primary human adipocytes, we show that after binding to scavenger receptors, M. tuberculosis can enter within adipocytes, where it accumulates intracytoplasmic lipid inclusions and survives in a non-replicating state that is insensitive to the major anti-mycobacterial drug isoniazid. CONCLUSIONS/SIGNIFICANCE: Given the abundance and the wide distribution of the adipose tissue throughout the body, our results suggest that this tissue, among others, might constitute a vast reservoir where the tubercle bacillus could persist for long periods of time, and avoid both killing by antimicrobials and recognition by the host immune system. In addition, M. tuberculosis-infected adipocytes might provide a new model to investigate dormancy and to evaluate new drugs for the treatment of

  16. Multidrug resistance in pediatric urinary tract infections.

    Science.gov (United States)

    Gaspari, Romolo J; Dickson, Eric; Karlowsky, James; Doern, Gary

    2006-01-01

    Urinary tract infections (UTIs) represent a common infection in the pediatric population. Escherichia coli is the most common uropathogen in children, and antimicrobial resistance in this species complicates the treatment of pediatric UTIs. Despite the impact of resistance on empiric antibiotic choice, there is little data on multidrug resistance in pediatric patients. In this paper, we describe characteristics of multidrug-resistant E. coli in pediatric patients using a large national database of uropathogens antimicrobial sensitivities. Antimicrobial susceptibility patterns to commonly prescribed antibiotics were performed on uropathogens isolated from children presenting to participating hospitals between 1999 and 2001. Data were analyzed separately for four pediatric age groups. Single and multidrug resistance to ampicillin, amoxicillin-clavulanate, cefazolin, ciprofloxacin, nitrofurantoin, and trimethoprim-sulfamethoxazole (TMP-SMX) were performed on all specimens. There were a total of 11,341 E. coli urine cultures from 343 infants (0-4 weeks), 1,801 toddlers (5 weeks-24 months), 6,742 preteens (2-12 years), and 2,455 teens (13-17 years). E. coli resistance to ampicillin peaked in toddlers (52.8%) but was high in preteens (52.1%), infants (50.4%), and teens (40.6%). Resistance to two or more antibiotics varied across age groups, with toddlers (27%) leading preteens (23.1%), infants (21%), and teens (15.9%). Resistance to three or more antibiotics was low in all age groups (range 3.1-5.2%). The most common co-resistance in all age groups was ampicillin/TMP-SMZ. In conclusion, less than half of all pediatric UTIs are susceptible to all commonly used antibiotics. In some age groups, there is a significant percentage of co-resistance between the two most commonly used antibiotics (ampicillin and TMP-SMZ).

  17. Activity of Scottish plant, lichen and fungal endophyte extracts against Mycobacterium aurum and Mycobacterium tuberculosis.

    Science.gov (United States)

    Gordien, Andréa Y; Gray, Alexander I; Ingleby, Kevin; Franzblau, Scott G; Seidel, Véronique

    2010-05-01

    With tuberculosis the leading bacterial killer worldwide and other mycobacterial diseases on the increase, the search for new antimycobacterial agents is timely. In this study, extracts from plants, lichens and fungal endophytes of Scottish provenance were screened for activity against Mycobacterium aurum and M. tuberculosis H(37)Rv. The best activity against M. aurum was observed for extracts of Juniperus communis roots and Cladonia arbuscula (MIC = 4 microg/mL), and a fungal endophyte isolated from Vaccinium myrtillus (MIC = 8 microg/mL). The best activity against M. tuberculosis was observed for extracts of C. arbuscula, Empetrum nigrum, J. communis roots, Calluna vulgaris aerial parts, Myrica gale roots and stems (93 to 99% inhibition at 100 microg/mL). Potent antitubercular activity (90 to 96% inhibition at 100 microg/mL) was also observed for the ethanol extracts of Xerocomus badius, Chalciporus piperatus, Suillus luteus and of endophytes isolated from C. vulgaris, E. nigrum, Vaccinium vitis-idaea and V. myrtillus. The results obtained this study provide, in part, some scientific basis for the traditional use of some of the selected plants in the treatment of tuberculosis. They also indicate that fungal endophytes recovered from Scottish plants are a source of antimycobacterial agents worthy of further investigation. Copyright (c) 2009 John Wiley & Sons, Ltd.

  18. Genetic Determinants of Drug Resistance in Mycobacterium tuberculosis and Their Diagnostic Value

    NARCIS (Netherlands)

    Farhat, M.R.; Sultana, R.; Iartchouk, O.; Bozeman, S.; Galagan, J.; Sisk, P.; Stolte, C.; Nebenzahl-Guimaraes, H.; Jacobson, K.; Sloutsky, A.; Kaur, D.; Posey, J.; Kreiswirth, B.N.; Kurepina, N.; Rigouts, L.; Streicher, E.M.; Victor, T.C.; Warren, R.M.; Soolingen, D. van; Murray, M.

    2016-01-01

    RATIONALE: The development of molecular diagnostics that detect both the presence of Mycobacterium tuberculosis in clinical samples and drug resistance-conferring mutations promises to revolutionize patient care and interrupt transmission by ensuring early diagnosis. However, these tools require the

  19. Supplementary Material for: Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA; Vos, M. de; Louw, GE; Merwe, RG van der; Dippenaar, A.; Streicher, EM; Abdallah, AM; Sampson, SL; Victor, TC; Dolby, T.; Simpson, JA; Helden, PD van; Warren, RM; Pain, Arnab

    2015-01-01

    Abstract Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug

  20. DIGITAL DETECTION SYSTEM DESIGN OF MYCOBACTERIUM TUBERCULOSIS THROUGH EXTRACTION OF SPUTUM IMAGE USING NEURAL NETWORK METHOD

    Directory of Open Access Journals (Sweden)

    Franky Arisgraha

    2012-01-01

    Full Text Available Tuberculosis (TBC is an dangerous disease and many people has been infected. One of many important steps to control TBC effectively and efficiently is by increasing case finding using right method and accurate diagnostic. One of them is to detect Mycobacterium Tuberculosis inside sputum. Conventional detection of Mycobacterium Tuberculosis inside sputum can need a lot of time, so digitally detection method of Mycobacterium Tuberculosis was designed as an effort to get better result of detection. This method was designed by using combination between digital image processing method and Neural Network method. From testing report that was done, Mycobacterium can be detected with successful value reach 77.5% and training error less than 5%.

  1. Genome-wide analysis of multi- and extensively drug-resistant Mycobacterium tuberculosis

    KAUST Repository

    Coll, Francesc; Phelan, Jody; Hill-Cawthorne, Grant A.; Nair, Mridul; Mallard, Kim; Ali, Shahjahan; Abdallah, Abdallah; Alghamdi, Saad; Alsomali, Mona; Ahmed, Abdallah O.; Portelli, Stephanie; Oppong, Yaa; Alves, Adriana; Bessa, Theolis Barbosa; Campino, Susana; Caws, Maxine; Chatterjee, Anirvan; Crampin, Amelia C.; Dheda, Keertan; Furnham, Nicholas; Glynn, Judith R.; Grandjean, Louis; Minh Ha, Dang; Hasan, Rumina; Hasan, Zahra; Hibberd, Martin L.; Joloba, Moses; Jones-Ló pez, Edward C.; Matsumoto, Tomoshige; Miranda, Anabela; Moore, David J.; Mocillo, Nora; Panaiotov, Stefan; Parkhill, Julian; Penha, Carlos; Perdigã o, Joã o; Portugal, Isabel; Rchiad, ‍ Zineb; Robledo, Jaime; Sheen, Patricia; Shesha, Nashwa Talaat; Sirgel, Frik A.; Sola, Christophe; Oliveira Sousa, Erivelton; Streicher, Elizabeth M.; Helden, Paul Van; Viveiros, Miguel; Warren, Robert M.; McNerney, Ruth; Pain, Arnab; Clark, Taane G.

    2018-01-01

    To characterize the genetic determinants of resistance to antituberculosis drugs, we performed a genome-wide association study (GWAS) of 6,465 Mycobacterium tuberculosis clinical isolates from more than 30 countries. A GWAS approach within a mixed

  2. Genotyping of ancient Mycobacterium tuberculosis strains reveals historic genetic diversity.

    Science.gov (United States)

    Müller, Romy; Roberts, Charlotte A; Brown, Terence A

    2014-04-22

    The evolutionary history of the Mycobacterium tuberculosis complex (MTBC) has previously been studied by analysis of sequence diversity in extant strains, but not addressed by direct examination of strain genotypes in archaeological remains. Here, we use ancient DNA sequencing to type 11 single nucleotide polymorphisms and two large sequence polymorphisms in the MTBC strains present in 10 archaeological samples from skeletons from Britain and Europe dating to the second-nineteenth centuries AD. The results enable us to assign the strains to groupings and lineages recognized in the extant MTBC. We show that at least during the eighteenth-nineteenth centuries AD, strains of M. tuberculosis belonging to different genetic groups were present in Britain at the same time, possibly even at a single location, and we present evidence for a mixed infection in at least one individual. Our study shows that ancient DNA typing applied to multiple samples can provide sufficiently detailed information to contribute to both archaeological and evolutionary knowledge of the history of tuberculosis.

  3. First molecular epidemiology study of Mycobacterium tuberculosis in Kiribati.

    Directory of Open Access Journals (Sweden)

    Eman Aleksic

    Full Text Available Tuberculosis incidence rates in Kiribati are among the highest in the Western Pacific Region, however the genetic diversity of circulating Mycobacterium tuberculosis complex strains (MTBC and transmission dynamics are unknown. Here, we analysed MTBC strains isolated from culture positive pulmonary tuberculosis (TB cases from the main TB referral centre between November 2007 and October 2009. Strain genotyping (IS6110 typing, spoligotyping, 24-loci MIRU-VNTR and SNP typing was performed and demographic information collected. Among 73 MTBC strains analysed, we identified seven phylogenetic lineages, dominated by Beijing strains (49%. Beijing strains were further differentiated in two main branches, Beijing-A (n = 8 and -B (n = 28, that show distinct genotyping patterns and are characterized by specific deletion profiles (Beijing A: only RD105, RD207 deleted; Beijing B: RD150 and RD181 additionally deleted. Many Kiribati strains (59% based on IS6110 typing of all strains occurred in clusters, suggesting ongoing local transmission. Beijing-B strains and over-crowded living conditions were associated with strain clustering (likely recent transmission, however little evidence of anti-tuberculous drug resistance was observed. We suggest enhanced case finding amongst close contacts and continued supervised treatment of all identified cases using standard first-line drugs to reduce TB burden in Kiribati. Beijing strains can be subdivided in different principle branches that might be associated with differential spreading patterns in the population.

  4. PolyTB: A genomic variation map for Mycobacterium tuberculosis

    KAUST Repository

    Coll, Francesc

    2014-02-15

    Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) is the second major cause of death from an infectious disease worldwide. Recent advances in DNA sequencing are leading to the ability to generate whole genome information in clinical isolates of M. tuberculosis complex (MTBC). The identification of informative genetic variants such as phylogenetic markers and those associated with drug resistance or virulence will help barcode Mtb in the context of epidemiological, diagnostic and clinical studies. Mtb genomic datasets are increasingly available as raw sequences, which are potentially difficult and computer intensive to process, and compare across studies. Here we have processed the raw sequence data (>1500 isolates, eight studies) to compile a catalogue of SNPs (n = 74,039, 63% non-synonymous, 51.1% in more than one isolate, i.e. non-private), small indels (n = 4810) and larger structural variants (n = 800). We have developed the PolyTB web-based tool (http://pathogenseq.lshtm.ac.uk/polytb) to visualise the resulting variation and important meta-data (e.g. in silico inferred strain-types, location) within geographical map and phylogenetic views. This resource will allow researchers to identify polymorphisms within candidate genes of interest, as well as examine the genomic diversity and distribution of strains. PolyTB source code is freely available to researchers wishing to develop similar tools for their pathogen of interest. 2014 Elsevier Ltd. All rights reserved.

  5. Mycobacterium tuberculosis Transcription Machinery: Ready To Respond to Host Attacks

    Science.gov (United States)

    Flentie, Kelly; Garner, Ashley L.

    2016-01-01

    Regulating responses to stress is critical for all bacteria, whether they are environmental, commensal, or pathogenic species. For pathogenic bacteria, successful colonization and survival in the host are dependent on adaptation to diverse conditions imposed by the host tissue architecture and the immune response. Once the bacterium senses a hostile environment, it must enact a change in physiology that contributes to the organism's survival strategy. Inappropriate responses have consequences; hence, the execution of the appropriate response is essential for survival of the bacterium in its niche. Stress responses are most often regulated at the level of gene expression and, more specifically, transcription. This minireview focuses on mechanisms of regulating transcription initiation that are required by Mycobacterium tuberculosis to respond to the arsenal of defenses imposed by the host during infection. In particular, we highlight how certain features of M. tuberculosis physiology allow this pathogen to respond swiftly and effectively to host defenses. By enacting highly integrated and coordinated gene expression changes in response to stress, M. tuberculosis is prepared for battle against the host defense and able to persist within the human population. PMID:26883824

  6. Comparison of the UDP-N-Acetylmuramate:l-Alanine Ligase Enzymes from Mycobacterium tuberculosis and Mycobacterium leprae

    Science.gov (United States)

    Mahapatra, Sebabrata; Crick, Dean C.; Brennan, Patrick J.

    2000-01-01

    In the peptidoglycan of Mycobacterium leprae, l-alanine of the side chain is replaced by glycine. When expressed in Escherichia coli, MurC (UDP-N-acetyl-muramate:l-alanine ligase) of M. leprae showed Km and Vmax for l-alanine and glycine similar to those of Mycobacterium tuberculosis MurC, suggesting that another explanation should be sought for the presence of glycine. PMID:11073931

  7. Comparison of the UDP-N-Acetylmuramate:l-Alanine Ligase Enzymes from Mycobacterium tuberculosis and Mycobacterium leprae

    OpenAIRE

    Mahapatra, Sebabrata; Crick, Dean C.; Brennan, Patrick J.

    2000-01-01

    In the peptidoglycan of Mycobacterium leprae, l-alanine of the side chain is replaced by glycine. When expressed in Escherichia coli, MurC (UDP-N-acetyl-muramate:l-alanine ligase) of M. leprae showed Km and Vmax for l-alanine and glycine similar to those of Mycobacterium tuberculosis MurC, suggesting that another explanation should be sought for the presence of glycine.

  8. Evaluation of the Mycobacterium tuberculosis SO2 vaccine using a natural tuberculosis infection model in goats.

    Science.gov (United States)

    Bezos, J; Casal, C; Álvarez, J; Roy, A; Romero, B; Rodríguez-Bertos, A; Bárcena, C; Díez, A; Juste, R; Gortázar, C; Puentes, E; Aguiló, N; Martín, C; de Juan, L; Domínguez, L

    2017-05-01

    The development of new vaccines against animal tuberculosis (TB) is a priority for improving the control and eradication of this disease, particularly in those species not subjected to compulsory eradication programmes. In this study, the protection conferred by the Mycobacterium tuberculosis SO 2 experimental vaccine was evaluated using a natural infection model in goats. Twenty-six goats were distributed in three groups: (1) 10 goats served as a control group; (2) six goats were subcutaneously vaccinated with BCG; and (3) 10 goats were subcutaneously vaccinated with SO 2 . Four months after vaccination, all groups were merged with goats infected with Mycobacterium bovis or Mycobacterium caprae, and tested over a 40 week period using a tuberculin intradermal test and an interferon-γ assay for mycobacterial reactivity. The severity of lesions was determined at post-mortem examination and the bacterial load in tissues were evaluated by culture. The two vaccinated groups had significantly lower lesion and bacterial culture scores than the control group (P<0.05); at the end of the study, the SO 2 vaccinated goats had the lowest lesion and culture scores. These results suggest that the SO 2 vaccine provides some protection against TB infection acquired from natural exposure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Comparative Genomics and Proteomic Analysis of Four Non-tuberculous Mycobacterium Species and Mycobacterium tuberculosis Complex : Occurrence of Shared Immunogenic Proteins

    NARCIS (Netherlands)

    Gcebe, Nomakorinte; Michel, Anita; Gey van Pittius, Nicolaas C; Rutten, Victor

    2016-01-01

    The Esx and PE/PPE families of proteins are among the most immunodominant mycobacterial antigens and have thus been the focus of research to develop vaccines and immunological tests for diagnosis of bovine and human tuberculosis, mainly caused by Mycobacterium bovis and Mycobacterium tuberculosis,

  10. Reversal of multidrug resistance by surfactants.

    Science.gov (United States)

    Woodcock, D. M.; Linsenmeyer, M. E.; Chojnowski, G.; Kriegler, A. B.; Nink, V.; Webster, L. K.; Sawyer, W. H.

    1992-01-01

    Cremophor EL, a pharmacologically inactive solubilising agent, has been shown to reverse multidrug resistance (MDR). Using flow cytometric evaluation of equilibrium intracellular levels of daunorubicin (DNR), we found that eight other surface active agents will also reverse MDR. All the active detergents contain polyethoxylated moieties but have no similarities in their hydrophobic components. The properties of three polyethoxylated surfactants that showed the lowest toxicities, Cremophor, Tween 80 and Solutol HS15, were examined in more detail. The concentrations of Tween 80 and Solutol required to reverse DNR exclusion were 10-fold lower than for Cremophor. However while concentrations greater than or equal to 1:10(2) of the former two surfactants resulted in breakdown of cells, even 1:10 of Cremophor did not lyse cells. Studies of the effects of Cremophor on the uptake and efflux of DNR in normal and MDR cell types showed that Cremophor increases intracellular DNR primarily by locking the rapid efflux from the cells. This blockage of drug efflux may be mediated by a substantial alteration in the fluidity of cell membranes induced by Cremophor, as shown by decreased fluorescence anisotropy of a membrane probe. Consistent with these data, coinjection of adriamycin plus Cremophor into mice carrying a multidrug resistant P388 transplantable tumour significantly increased the survival time of the mice compared with adriamycin treatment alone. PMID:1637678

  11. Prevalence of latent Mycobacterium tuberculosis infection in prisoners.

    Science.gov (United States)

    Navarro, Pedro Daibert de; Almeida, Isabela Neves de; Kritski, Afrânio Lineu; Ceccato, Maria das Graças; Maciel, Mônica Maria Delgado; Carvalho, Wânia da Silva; Miranda, Silvana Spindola de

    2016-01-01

    To determine the prevalence of and the factors associated with latent Mycobacterium tuberculosis infection (LTBI) in prisoners in the state of Minas Gerais, Brazil. This was a cross-sectional cohort study conducted in two prisons in Minas Gerais. Tuberculin skin tests were performed in the individuals who agreed to participate in the study. A total of 1,120 individuals were selected for inclusion in this study. The prevalence of LTBI was 25.2%. In the multivariate analysis, LTBI was associated with self-reported contact with active tuberculosis patients within prisons (adjusted OR = 1.51; 95% CI: 1.05-2.18) and use of inhaled drugs (adjusted OR = 1.48; 95% CI: 1.03-2.13). Respiratory symptoms were identified in 131 (11.7%) of the participants. Serological testing for HIV was performed in 940 (83.9%) of the participants, and the result was positive in 5 (0.5%). Two cases of active tuberculosis were identified during the study period. Within the prisons under study, the prevalence of LTBI was high. In addition, LTBI was associated with self-reported contact with active tuberculosis patients and with the use of inhaled drugs. Our findings demonstrate that it is necessary to improve the conditions in prisons, as well as to introduce strategies, such as chest X-ray screening, in order to detect tuberculosis cases and, consequently, reduce M. tuberculosis infection within the prison system. Determinar a prevalência e os fatores associados à infecção latente por Mycobacterium tuberculosis (ILTB) em pessoas privadas de liberdade no Estado de Minas Gerais. Estudo de coorte transversal realizado em duas penitenciárias em Minas Gerais. Foi realizada a prova tuberculínica nos indivíduos que aceitaram participar do estudo. Foram selecionados 1.120 indivíduos para a pesquisa. A prevalência da ILTB foi de 25,2%. Na análise multivariada, a ILTB esteve associada com relato de contato com caso de tuberculose ativa dentro da penitenciária (OR ajustada = 1,51; IC95%: 1

  12. Evaluation of Genetic Pattern of Non-Tuberculosis Mycobacterium Using VNTR Method

    Directory of Open Access Journals (Sweden)

    Noorozi J

    2011-06-01

    Full Text Available Background and Objectives: Epidemiological studies of Non-tuberculosis Mycobacterium is important because of the drug resistance pattern and worldwide dissemination of these organisms. One of genetic fingerprinting methods for epidemiological studies is VNTR (Variable Number Tandem Repeat. In this study genetic pattern of atypical Mycobacterium was evaluated by VNTR method for epidemiologic studies. Methods: 48 pulmonary and non pulmonary specimens separated from patients with the symptoms of pulmonary tuberculosis (PTB and identified as Non-tuberculosis Mycobacteriumby phenotypic and PCR-RFLP methods were selected for this study. Clinical samples and their standard strains were evaluated according to VNTR pattern using the 7 genetic loci including ETR-B. ETR-F. ETR-C. MPTR-A. ETR-A. ETR-E. ETR-D.Results: The results of VNTR method showed that none of the 7 loci had any polymorphism in the standard strains of atypical mycobacterium. Some of these variable number tandem repeat in 42 clinical samples of non-tuberculosis Mycobacterium were polymorphic while the PCR product (for any loci was not found in the remaining 6 specimens. Conclusion: Although the used genetic loci of this study were suitable for epidemiological studies of Mycobacterium tuberculosis, these loci were not able to determine the diversity of genetics of non-tuberculosis Mycobacterium Therefore, it seems necessary that other loci be studied using VNTR method.

  13. Trends of Mycobacterium bovis Isolation and First-Line Anti-tuberculosis Drug Susceptibility Profile: A Fifteen-Year Laboratory-Based Surveillance.

    Directory of Open Access Journals (Sweden)

    Miriam Bobadilla-del Valle

    2015-09-01

    Full Text Available Mycobacterium tuberculosis causes the majority of tuberculosis (TB cases in humans; however, in developing countries, human TB caused by M. bovis may be frequent but undetected. Human TB caused by M. bovis is considered a zoonosis; transmission is mainly through consumption of unpasteurized dairy products, and it is less frequently attributed to animal-to-human or human-to-human contact. We describe the trends of M. bovis isolation from human samples and first-line drug susceptibility during a 15-year period in a referral laboratory located in a tertiary care hospital in Mexico City.Data on mycobacterial isolates from human clinical samples were retrieved from the laboratory's database for the 2000-2014 period. Susceptibility to first-line drugs: rifampin, isoniazid, streptomycin (STR and ethambutol was determined. We identified 1,165 isolates, 73.7% were M. tuberculosis and 26.2%, M. bovis. Among pulmonary samples, 16.6% were M. bovis. The proportion of M. bovis isolates significantly increased from 7.8% in 2000 to 28.4% in 2014 (X(2trend, p<0.001. Primary STR resistance was higher among M. bovis compared with M. tuberculosis isolates (10.9% vs.3.4%, p<0.001. Secondary multidrug resistance (MDR rates were 38.5% and 34.4% for M. bovis and M. tuberculosis, respectively (p = 0.637. A rising trend of primary STR monoresistance was observed for both species (3.4% in 2000-2004 vs. 7.6% in 2010-2014; p = 0.02.There is a high prevalence and a rising trend of M. bovis isolates in our region. The proportion of pulmonary M. bovis isolates is higher than in previous reports. Additionally, we report high rates of primary anti-tuberculosis resistance and secondary MDR in both M. tuberculosis and M. bovis. This is one of the largest reports on drug susceptibility of M. bovis from human samples and shows a significant proportion of first-line anti-tuberculosis drug resistance.

  14. DETECTION OF MYCOBACTERIUM TUBERCULOSIS IN BLOOD FOR DIAGNOSIS OF GENERALISED TUBERCULOSIS IN HIV-POSITIVE PATIENTS

    Directory of Open Access Journals (Sweden)

    V. N. Zimina

    2017-01-01

    Full Text Available Objective: To study the informative value of the detection of mycobacteria in blood with the cultural method in patients with suspected tuberculous sepsis and to determine the most significant clinical and laboratory criteria for testing. Materials and methods: The investigation to detect M.tuberculosis was fulfilled in 159 HIV-positive patients with suspected tuberculosis sepsis. Blood culture was completed with culture medium Myco/F Lytic Culture Vials and analyzer BACTEC 9050. Results: Mycobacteria were detected in blood of 19 patients (11,9% of all patients: in 18 patients the growth of М. tuberculosis complex was detected (25,3% of all patients with diagnosed tuberculosis and in 1 patient it was Mycobacterium avium complex (0,6% of all patients. It was shown, that the probability of M.tuberculosis detection was especially associated with the severity of the disease, immunosupression (less than 100 cells/mkl, hemoglobin quantity less than 90 g/l (levels were determined through the seeking for the most significant cutoffs. It was not proofed, that meningoencephalitis develops more often in patients with proven bacteremia. There were no evident differences in detection frequency of mycobacteria in sputum between patients with tuberculous sepsis and without it.

  15. Expression of Mycobacterium smegmatis pyrazinamidase in Mycobacterium tuberculosis confers hypersensitivity to pyrazinamide and related amides.

    Science.gov (United States)

    Boshoff, H I; Mizrahi, V

    2000-10-01

    A pyrazinamidase (PZase)-deficient pncA mutant of Mycobacterium tuberculosis, constructed by allelic exchange, was used to investigate the effects of heterologous amidase gene expression on the susceptibility of this organism to pyrazinamide (PZA) and related amides. The mutant was highly resistant to PZA (MIC, >2,000 microg/ml), in accordance with the well-established role of pncA in the PZA susceptibility of M. tuberculosis (A. Scorpio and Y. Zhang, Nat. Med. 2:662-667, 1996). Integration of the pzaA gene encoding the major PZase/nicotinamidase from Mycobacterium smegmatis (H. I. M. Boshoff and V. Mizrahi, J. Bacteriol. 180:5809-5814, 1998) or the M. tuberculosis pncA gene into the pncA mutant complemented its PZase/nicotinamidase defect. In both pzaA- and pncA-complemented mutant strains, the PZase activity was detected exclusively in the cytoplasm, suggesting an intracellular localization for PzaA and PncA. The pzaA-complemented strain was hypersensitive to PZA (MIC, /=20 microg/ml) and was also sensitive to benzamide (MIC, 20 microg/ml), unlike the wild-type and pncA-complemented mutant strains, which were highly resistant to this amide (MIC, >500 microg/ml). This finding was consistent with the observation that benzamide is hydrolyzed by PzaA but not by PncA. Overexpression of PzaA also conferred sensitivity to PZA, nicotinamide, and benzamide on M. smegmatis (MIC, 150 microg/ml in all cases) and rendered Escherichia coli hypersensitive for growth at low pH.

  16. Resistant plasmid profile analysis of multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    Background: Multi-drug resistant Escherichia coli has become a major threat and cause of many urinary tract infections (UTIs) in Abeokuta, Nigeria. Objectives: This study was carried out to determine the resistant plasmids of multidrug resistant Escherichia coli isolated from (Urinary tract infections)UTIs in Abeokuta.

  17. Investigation of Susceptibility of Mycobacterium tuberculosis Complex Strains Isolated from Clinical Samples Against the First and Second-Line Anti-tuberculosis Drugs by the Sensititre MycoTB Plate Method

    Directory of Open Access Journals (Sweden)