Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

OpenAIRE

More, Arun Punaji; Nagdawane, Ramkrishna Panchamrao; Gangurde, Aniket K

2013-01-01

Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR) has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence...

Risk factors associated with multidrug resistant tuberculosis among ...

African Journals Online (AJOL)

Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

High prevalence of multidrug resistant tuberculosis in Djibouti: a retrospective study.

Science.gov (United States)

Boyer-Cazajous, Géraldine; Martinaud, Christophe; Déhan, Céline; Hassan, Mohammed Osman; Gaas, Yassin; Chenilleau-Vidal, Marie-Caroline; Soler, Charles

2014-02-13

The Republic of Djibouti is an African country that exhibits one of the highest incidence rate of tuberculosis in the world. The aim of this study was to evaluate the prevalence of multidrug-resistant tuberculosis among new cases. We studied retrospectively every tuberculosis case diagnosed over a 12-month period in patients hospitalized at the French Military Hospital of Bouffard. During this period, 1,274 samples from 675 patients were tested. We isolated 266 mycobacteria corresponding to 180 cases of tuberculosis. Thirty-three were fully susceptible and 57% met the tuberculosis criteria, with 46% primary resistance. No extensively-drug-resistant tuberculosis was found. Our results highlight a major concern about the situation in this part of the world.

Indolcarboxamide is a preclinical candidate for treating multidrug-resistant tuberculosis.

Science.gov (United States)

Rao, Srinivasa P S; Lakshminarayana, Suresh B; Kondreddi, Ravinder R; Herve, Maxime; Camacho, Luis R; Bifani, Pablo; Kalapala, Sarath K; Jiricek, Jan; Ma, Ng L; Tan, Bee H; Ng, Seow H; Nanjundappa, Mahesh; Ravindran, Sindhu; Seah, Peck G; Thayalan, Pamela; Lim, Siao H; Lee, Boon H; Goh, Anne; Barnes, Whitney S; Chen, Zhong; Gagaring, Kerstin; Chatterjee, Arnab K; Pethe, Kevin; Kuhen, Kelli; Walker, John; Feng, Gu; Babu, Sreehari; Zhang, Lijun; Blasco, Francesca; Beer, David; Weaver, Margaret; Dartois, Veronique; Glynne, Richard; Dick, Thomas; Smith, Paul W; Diagana, Thierry T; Manjunatha, Ujjini H

2013-12-04

New chemotherapeutic compounds against multidrug-resistant Mycobacterium tuberculosis (Mtb) are urgently needed to combat drug resistance in tuberculosis (TB). We have identified and characterized the indolcarboxamides as a new class of antitubercular bactericidal agent. Genetic and lipid profiling studies identified the likely molecular target of indolcarboxamides as MmpL3, a transporter of trehalose monomycolate that is essential for mycobacterial cell wall biosynthesis. Two lead candidates, NITD-304 and NITD-349, showed potent activity against both drug-sensitive and multidrug-resistant clinical isolates of Mtb. Promising pharmacokinetic profiles of both compounds after oral dosing in several species enabled further evaluation for efficacy and safety. NITD-304 and NITD-349 were efficacious in treating both acute and chronic Mtb infections in mouse efficacy models. Furthermore, dosing of NITD-304 and NITD-349 for 2 weeks in exploratory rat toxicology studies revealed a promising safety margin. Finally, neither compound inhibited the activity of major cytochrome P-450 enzymes or the hERG (human ether-a-go-go related gene) channel. These results suggest that NITD-304 and NITD-349 should undergo further development as a potential treatment for multidrug-resistant TB.

Health system factors influencing management of multidrug-resistant tuberculosis in four European Union countries - learning from country experiences

Directory of Open Access Journals (Sweden)

Gerard de Vries

2017-04-01

Full Text Available Abstract Background In the European Union and European Economic Area only 38% of multidrug-resistant tuberculosis patients notified in 2011 completed treatment successfully at 24 months’ evaluation. Socio-economic factors and patient factors such as demographic characteristics, behaviour and attitudes are associated with treatment outcomes. Characteristics of healthcare systems also affect health outcomes. This study was conducted to identify and better understand the contribution of health system components to successful treatment of multidrug-resistant tuberculosis. Methods We selected four European Union countries to provide for a broad range of geographical locations and levels of treatment success rates of the multidrug-resistant tuberculosis cohort in 2009. We conducted semi-structured interviews following a conceptual framework with representatives from policy and planning authorities, healthcare providers and civil society organisations. Responses were organised according to the six building blocks of the World Health Organization health systems framework. Results In the four included countries, Austria, Bulgaria, Spain, and the United Kingdom, the following healthcare system factors were perceived as key to achieving good treatment results for patients with multidrug-resistant tuberculosis: timely diagnosis of drug-resistant tuberculosis; financial systems that ensure access to a full course of treatment and support for multidrug-resistant tuberculosis patients; patient-centred approaches with strong intersectoral collaboration that address patients’ emotional and social needs; motivated and dedicated healthcare workers with sufficient mandate and means to support patients; and cross-border management of multidrug-resistant tuberculosis to secure continuum of care between countries. Conclusion We suggest that the following actions may improve the success of treatment for multidrug-resistant tuberculosis patients: deployment of

Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Alya Putri Khairani

2017-09-01

Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

Clarithromycin increases linezolid exposure in multidrug-resistant tuberculosis patients

NARCIS (Netherlands)

Bolhuis, Mathieu S.; van Altena, Richard; van Soolingen, Dick; de Lange, Wiel C. M.; Uges, Donald R. A.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

2013-01-01

The use of linezolid for the treatment of multidrug-resistant tuberculosis is limited by dose-and time-dependent toxicity. Recently, we reported a case of pharmacokinetic drug drug interaction between linezolid and clarithromycin that resulted in increased linezolid exposure. The aim of this

Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

Directory of Open Access Journals (Sweden)

Arun P. More

2013-03-01

Full Text Available Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence ofcombined resistance to first and second-line anti-tuberculosis drugs is remarkably high. The isolates of M. tuberculosiswas identified and subjected to drug susceptibility testing. The patterns of drug susceptibility of isolates of M. tuberculosisduring the periods 2000 and 2004 were compared with drug susceptibility patterns of the organisms during theperiod 2008 to 2011.Results: The 260 isolates identified as M. tuberculosis show mean drug resistance prevalence of 45.6% for more than anytwo drugs and the MDR rate as 37% in the years 2000 to 2004 whereas 305 isolates of the organism show mean drugresistance prevalence of 30.2% and the MDR rate as 25% in the years 2008 to 2011.Conclusion: The researcher found that, though the prevalence of multidrug resistance to the drugs tested is remarkablyhigh, it has come down noticeably during the past seven years due to efforts of State Government and strict implementationof treatment guidelines of WHO by the physicians. J Microbiol Infect Dis 2013; 3(1: 12-17Key words: MDR-TB, XDR-TB, DOTS, drug-resistance prevalence rate.

Bedaquiline in the multidrug-resistant tuberculosis treatment: Belarus experience

Directory of Open Access Journals (Sweden)

Alena Skrahina

2016-01-01

Conclusion: Our interim results on safety and effectiveness of bedaquiline-containing regimens in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB patients are encouraging. They will add value to understanding role and place of this new anti-TB drug in M/XDR-TB treatment.

Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

NARCIS (Netherlands)

Sagwa, Evans

2017-01-01

Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil

Directory of Open Access Journals (Sweden)

Geisa Fregona

Full Text Available ABSTRACT OBJECTIVE To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. METHODS This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis – from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. RESULTS In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24–14.05 and re-entry after abandonment (OR = 3.91; 95%CI 1.81–8.43], smoking (OR = 3.93; 95%CI 1.98–7.79, and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15–8.99. CONCLUSIONS The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo.

Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

NARCIS (Netherlands)

Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

2014-01-01

Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

Conspicuous multidrug-resistant Mycobacterium tuberculosis cluster strains do not trespass country borders in Latin America and Spain.

Science.gov (United States)

Ritacco, Viviana; Iglesias, María-José; Ferrazoli, Lucilaine; Monteserin, Johana; Dalla Costa, Elis R; Cebollada, Alberto; Morcillo, Nora; Robledo, Jaime; de Waard, Jacobus H; Araya, Pamela; Aristimuño, Liselotte; Díaz, Raúl; Gavin, Patricia; Imperiale, Belen; Simonsen, Vera; Zapata, Elsa M; Jiménez, María S; Rossetti, Maria L; Martin, Carlos; Barrera, Lucía; Samper, Sofia

2012-06-01

Multidrug-resistant Mycobacterium tuberculosis strain diversity in Ibero-America was examined by comparing extant genotype collections in national or state tuberculosis networks. To this end, genotypes from over 1000 patients with multidrug-resistant tuberculosis diagnosed from 2004 through 2008 in Argentina, Brazil, Chile, Colombia, Venezuela and Spain were compared in a database constructed ad hoc. Most of the 116 clusters identified by IS6110 restriction fragment length polymorphism were small and restricted to individual countries. The three largest clusters, of 116, 49 and 25 patients, were found in Argentina and corresponded to previously documented locally-epidemic strains. Only 13 small clusters involved more than one country, altogether accounting for 41 patients, of whom 13 were, in turn, immigrants from Latin American countries different from those participating in the study (Peru, Ecuador and Bolivia). Most of these international clusters belonged either to the emerging RD(Rio) LAM lineage or to the Haarlem family of M. tuberculosis and four were further split by country when analyzed with spoligotyping and rifampin resistance-conferring mutations, suggesting that they did not represent ongoing transnational transmission events. The Beijing genotype accounted for 1.3% and 10.2% of patients with multidrug-resistant tuberculosis in Latin America and Spain, respectively, including one international cluster of two cases. In brief, Euro-American genotypes were widely predominant among multidrug-resistant M. tuberculosis strains in Ibero-America, reflecting closely their predominance in the general M. tuberculosis population in the region, and no evidence was found of acknowledged outbreak strains trespassing country borders. Copyright © 2011 Elsevier B.V. All rights reserved.

T cell-based tracking of multidrug resistant tuberculosis infection after brief exposure.

Science.gov (United States)

Richeldi, Luca; Ewer, Katie; Losi, Monica; Bergamini, Barbara M; Roversi, Pietro; Deeks, Jonathan; Fabbri, Leonardo M; Lalvani, Ajit

2004-08-01

Molecular epidemiology indicates significant transmission of Mycobacterium tuberculosis after casual contact with infectious tuberculosis cases. We investigated M. tuberculosis transmission after brief exposure using a T cell-based assay, the enzyme-linked-immunospot (ELISPOT) for IFN-gamma. After childbirth, a mother was diagnosed with sputum smear-positive multidrug-resistant tuberculosis. Forty-one neonates and 47 adults were present during her admission on the maternity unit; 11 weeks later, all underwent tuberculin skin testing (TST) and ELISPOT. We correlated test results with markers of exposure to the index case. The participants, who were asymptomatic and predominantly had no prior tuberculosis exposure, had 6.05 hours mean exposure (range: 0-65 hours) to the index case. Seventeen individuals, including two newborns, were ELISPOT-positive, and ELISPOT results correlated significantly with three of four predefined measures of tuberculosis exposure. For each hour sharing room air with the index case, the odds of a positive ELISPOT result increased by 1.05 (95% CI: 1.02-1.09, p = 0.003). Only four adults were TST-positive and TST results did not correlate with exposure. Thus, ELISPOT, but not TST, suggested quite extensive nosocomial transmission of multidrug-resistant M. tuberculosis after brief exposure. These results help to explain the apparent importance of casual contact for tuberculosis transmission, and may have implications for prevention.

Previous treatment, sputum-smear nonconversion, and suburban living: The risk factors of multidrug-resistant tuberculosis among Malaysians.

Science.gov (United States)

Mohd Shariff, Noorsuzana; Shah, Shamsul Azhar; Kamaludin, Fadzilah

2016-03-01

The number of multidrug-resistant tuberculosis patients is increasing each year in many countries all around the globe. Malaysia has no exception in facing this burdensome health problem. We aimed to investigate the factors that contribute to the occurrence of multidrug-resistant tuberculosis among Malaysian tuberculosis patients. An unmatched case-control study was conducted among tuberculosis patients who received antituberculosis treatments from April 2013 until April 2014. Cases are those diagnosed as pulmonary tuberculosis patients clinically, radiologically, and/or bacteriologically, and who were confirmed to be resistant to both isoniazid and rifampicin through drug-sensitivity testing. On the other hand, pulmonary tuberculosis patients who were sensitive to all first-line antituberculosis drugs and were treated during the same time period served as controls. A total of 150 tuberculosis patients were studied, of which the susceptible cases were 120. Factors found to be significantly associated with the occurrence of multidrug-resistant tuberculosis are being Indian or Chinese (odds ratio 3.17, 95% confidence interval 1.04-9.68; and odds ratio 6.23, 95% confidence interval 2.24-17.35, respectively), unmarried (odds ratio 2.58, 95% confidence interval 1.09-6.09), living in suburban areas (odds ratio 2.58, 95% confidence interval 1.08-6.19), are noncompliant (odds ratio 4.50, 95% confidence interval 1.71-11.82), were treated previously (odds ratio 8.91, 95% confidence interval 3.66-21.67), and showed positive sputum smears at the 2nd (odds ratio 7.00, 95% confidence interval 2.46-19.89) and 6th months of treatment (odds ratio 17.96, 95% confidence interval 3.51-91.99). Living in suburban areas, positive sputum smears in the 2nd month of treatment, and was treated previously are factors that independently contribute to the occurrence of multidrug-resistant tuberculosis. Those with positive smears in the second month of treatment, have a history of previous

Amikacin Concentrations Predictive of Ototoxicity in Multidrug-Resistant Tuberculosis Patients.

Science.gov (United States)

Modongo, Chawangwa; Pasipanodya, Jotam G; Zetola, Nicola M; Williams, Scott M; Sirugo, Giorgio; Gumbo, Tawanda

2015-10-01

Aminoglycosides, such as amikacin, are used to treat multidrug-resistant tuberculosis. However, ototoxicity is a common problem and is monitored using peak and trough amikacin concentrations based on World Health Organization recommendations. Our objective was to identify clinical factors predictive of ototoxicity using an agnostic machine learning method. We used classification and regression tree (CART) analyses to identify clinical factors, including amikacin concentration thresholds that predicted audiometry-confirmed ototoxicity among 28 multidrug-resistant pulmonary tuberculosis patients in Botswana. Amikacin concentrations were measured for all patients. The quantitative relationship between predictive factors and the probability of ototoxicity were then identified using probit analyses. The primary predictors of ototoxicity on CART analyses were cumulative days of therapy, followed by cumulative area under the concentration-time curve (AUC), which improved on the primary predictor by 87%. The area under the receiver operating curve was 0.97 on the test set. Peak and trough were not predictors in any tree. When algorithms were forced to pick peak and trough as primary predictors, the area under the receiver operating curve fell to 0.46. Probit analysis revealed that the probability of ototoxicity increased sharply starting after 6 months of therapy to near maximum at 9 months. A 10% probability of ototoxicity occurred with a threshold cumulative AUC of 87,232 days · mg · h/liter, while that of 20% occurred at 120,000 days · mg · h/liter. Thus, cumulative amikacin AUC and duration of therapy, and not peak and trough concentrations, should be used as the primary decision-making parameters to minimize the likelihood of ototoxicity in multidrug-resistant tuberculosis. Copyright © 2015, Modongo et al.

Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

Directory of Open Access Journals (Sweden)

Yonatan Moges Mesfin

Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

Molecular Genetic Analysis of Multi-drug Resistance in Indian Isolates of Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Noman Siddiqi

1998-09-01

Full Text Available A total of 116 isolates from patients attending the out-patient department at the All India Institute of Medical Sciences, New Delhi and the New Delhi Tuberculosis Centre, New Delhi, India were collected. They were analyzed for resistance to drugs prescribed in the treatment for tuberculosis. The drug resistance was initially determined by microbiological techniques. The Bactec 460TB system was employed to determine the type and level of resistance in each isolate. The isolates were further characterized at molecular level. The multi-drug loci corresponding to rpo b, gyr A, kat G were studied for mutation(s by the polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP technique. The SSCP positive samples were sequenced to characterize the mutations in rpo b, and gyr A loci. While previously reported mutations in the gyr A and rpo b loci were found to be present, several novel mutations were also scored in the rpo b locus. Interestingly, analysis of the gyr A locus showed the presence of point mutation(s that could not be detected by PCR-SSCP. Furthermore, rifampicin resistance was found to be an important marker for checking multi-drug resistance (MDR in clinical isolates of Mycobacterium tuberculosis. This is the first report on molecular genetic analysis of MDR tuberculosis one from India, highlights the increasing incidence of MDR in the Indian isolates of M. tuberculosis.

Time to sputum conversion in multidrug-resistant tuberculosis patients in Armenia: retrospective cohort study

Directory of Open Access Journals (Sweden)

Arax Hovhannesyan

2012-06-01

Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5-17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.

Time to sputum conversion in multidrug-resistant tuberculosis patients in Armenia: retrospective cohort study

Directory of Open Access Journals (Sweden)

Arax Hovhannesyan

2012-01-01

Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5- 17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.

Drug resistance detection and mutation patterns of multidrug resistant tuberculosis strains from children in Delhi

Directory of Open Access Journals (Sweden)

Jyoti Arora

2017-06-01

Full Text Available A total of 312 sputum samples from pediatric patients presumptive of multidrug resistant tuberculosis were tested for the detection of drug resistance using the GenoTypeMTBDRplus assay. A total of 193 (61.8% patients were smear positive and 119 (38.1% were smear negative by Ziehl–Neelsen staining. Line probe assay (LPA was performed for 208 samples/cultures (193 smear positive samples and 15 cultures from smear negative samples. Valid results were obtained from 198 tests. Of these, 125/198 (63.1% were sensitive to both rifampicin (RIF and isoniazid (INH. 73/198 (36.9% were resistant to at least INH/RIF, out of which 49 (24.7% were resistant to both INH and RIF (multidrug resistant. Children with tuberculosis are often infected by someone close to them, so strengthening of contact tracing in the program may help in early diagnosis to identify additional cases within the household. There is a need to evaluate newer diagnostic assays which have a high sensitivity in the case of smear negative samples, additional samples other than sputum among young children not able to expectorate, and also to fill the gap between estimated and reported cases under the program.

Clinical Concentrations of Thioridazine Kill Intracellular Multidrug-Resistant Mycobacterium tuberculosis

Science.gov (United States)

Ordway, Diane; Viveiros, Miguel; Leandro, Clara; Bettencourt, Rosário; Almeida, Josefina; Martins, Marta; Kristiansen, Jette E.; Molnar, Joseph; Amaral, Leonard

2003-01-01

The phenothiazines chlorpromazine (CPZ) and thioridazine (TZ) have equal in vitro activities against antibiotic-sensitive and -resistant Mycobacterium tuberculosis. These compounds have not been used as anti-M. tuberculosis agents because their in vitro activities take place at concentrations which are beyond those that are clinically achievable. In addition, chronic administration of CPZ produces frequent severe side effects. Because CPZ has been shown to enhance the killing of intracellular M. tuberculosis at concentrations in the medium that are clinically relevant, we have investigated whether TZ, a phenothiazine whose negative side effects are less frequent and serious than those associated with CPZ, kills M. tuberculosis organisms that have been phagocytosed by human macrophages, which have nominal killing activities against these bacteria. Both CPZ and TZ killed intracellular antibiotic-sensitive and -resistant M. tuberculosis organisms when they were used at concentrations in the medium well below those present in the plasma of patients treated with these agents. These concentrations in vitro were not toxic to the macrophage, nor did they affect in vitro cellular immune processes. TZ thus appears to be a serious candidate for the management of a freshly diagnosed infection of pulmonary tuberculosis or as an adjunct to conventional antituberculosis therapy if the patient originates from an area known to have a high prevalence of multidrug-resistant M. tuberculosis isolates. Nevertheless, we must await the outcomes of clinical trials to determine whether TZ itself may be safely and effectively used as an antituberculosis agent. PMID:12604522

The value of microscopic-observation drug susceptibility assay in the diagnosis of tuberculosis and detection of multidrug resistance.

Science.gov (United States)

Sertel Şelale, Denİz; Uzun, Meltem

2018-01-01

Inexpensive, rapid, and reliable tests for detecting the presence and drug susceptibility of Mycobacterium tuberculosis complex (MTBC) are urgently needed to control the transmission of tuberculosis. In this study, we aimed to assess the accuracy and speed of the microscopic-observation drug susceptibility (MODS) assay in the identification of MTBC and detection of multidrug resistance. Sputum samples from patients suspected to have tuberculosis were simultaneously tested with MODS and conventional culture [Löwenstein-Jensen (LJ) culture, BACTEC MGIT™ 960 (MGIT) system], and drug susceptibility testing (MGIT system) methods. A total of 331 sputum samples were analyzed. Sensitivity and specificity of MODS assay for detection of MTBC strains were 96% and 98.8%, respectively. MODS assay detected multidrug resistant MTBC isolates with 92.3% sensitivity and 96.6% specificity. Median time to culture positivity was similar for MGIT (8 days) and MODS culture (8 days), but was significantly longer with LJ culture (20 days) (p tuberculosis and detection of multidrug resistance. © 2017 APMIS. Published by John Wiley & Sons Ltd.

Aggressive Regimens for Multidrug-Resistant Tuberculosis Reduce Recurrence

Science.gov (United States)

Franke, Molly F.; Appleton, Sasha C.; Mitnick, Carole D.; Furin, Jennifer J.; Bayona, Jaime; Chalco, Katiuska; Shin, Sonya; Murray, Megan; Becerra, Mercedes C.

2013-01-01

Background. Recurrent tuberculosis disease occurs within 2 years in as few as 1% and as many as 29% of individuals successfully treated for multidrug-resistant (MDR) tuberculosis. A better understanding of treatment-related factors associated with an elevated risk of recurrent tuberculosis after cure is urgently needed to optimize MDR tuberculosis therapy. Methods. We conducted a retrospective cohort study among adults successfully treated for MDR tuberculosis in Peru. We used multivariable Cox proportional hazards regression analysis to examine whether receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion from positive to negative was associated with a reduced rate of recurrent tuberculosis. Results. Among 402 patients, the median duration of follow-up was 40.5 months (interquartile range, 21.2–53.4). Receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion was associated with a lower risk of recurrent tuberculosis (hazard ratio, 0.40 [95% confidence interval, 0.17–0.96]; P = .04). A baseline diagnosis of diabetes mellitus also predicted recurrent tuberculosis (hazard ratio, 10.47 [95% confidence interval, 2.17–50.60]; P = .004). Conclusions. Individuals who received an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion experienced a lower rate of recurrence after cure. Efforts to ensure that an aggressive regimen is accessible to all patients with MDR tuberculosis, such as minimization of sequential ineffective regimens, expanded drug access, and development of new MDR tuberculosis compounds, are critical to reducing tuberculosis recurrence in this population. Patients with diabetes mellitus should be carefully managed during initial treatment and followed closely for recurrent disease. PMID:23223591

Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

Science.gov (United States)

Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

2012-06-01

Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

Unusual Complication of Multidrug Resistant Tuberculosis

Directory of Open Access Journals (Sweden)

Prerna Sharma

2017-01-01

Full Text Available Introduction. Capreomycin is a second-line drug often used for multidrug-resistant tuberculosis which can result in nephrotoxic effects similar to other aminoglycosides. We describe a case of capreomycin induced Bartter-like syndrome with hypocalcemic tetany. Case Report. 23-year-old female patient presented with carpopedal spasms and tingling sensations in hands. Patient was being treated with capreomycin for two months for tuberculosis. On further investigation, hypocalcemia, hyponatremia, hypomagnesemia, hypokalemia, and hypochloremic metabolic alkalosis were noted. Vitamin D and serum PTH levels were within normal limits. Hypercalciuria was confirmed by urine calcium/creatinine ratio. Calcium, potassium, and magnesium supplementation was given and capreomycin was discontinued. Electrolytes normalized in two days after cessation of capreomycin with no further abnormalities on repeat investigations. Discussion. Aminoglycosides can result in renal tubular dysfunction leading to Fanconi syndrome, Bartter syndrome, and distal tubular acidosis. Impaired mitochondrial function in the tubular cells has been hypothesized as the possible cause of these tubulopathies. Acquired Bartter-like syndrome phenotypically resembles autosomal dominant type 5 Bartter syndrome. Treatment consists of correction of electrolyte abnormalities, indomethacin, and potassium-sparing diuretics. Prompt diagnosis and treatment of severe dyselectrolytemia are warranted in patients on aminoglycoside therapy.

A case of multidrug-resistant monoarticular joint tuberculosis in a renal transplant recipient.

Science.gov (United States)

Regmi, A; Singh, P; Harford, A

2014-01-01

Tuberculosis (TB) is a common opportunistic infection after renal transplantation. The risk of TB in renal transplant recipients is reported to be 20 to 74 times higher than in the general population. Although extrapulmonary TB occurs frequently, isolated ankle joint TB is a rare form of extrapulmonary TB infection. It is often difficult to diagnose because of its atypical presentation; management is complex, especially with multidrug-resistant TB, the need for a prolonged course of therapy, and the risks of drug interactions and drug toxicity. We report herein a case of a 60-year-old female renal allograft recipient who developed multidrug-resistant ankle joint TB 11 months after her deceased donor renal transplantation. She presented to the emergency department with escalating pain and swelling of the left ankle, difficulty in ambulation, and a low-grade fever. An x-ray of the ankle revealed an effusion and soft tissue swelling. A synovial fluid culture was performed which tested positive for acid fast bacilli which grew a multidrug-resistant form of Mycobacterium tuberculosis. She was initially treated with isoniazid, rifampin, ethambutol, and pyrazinamide; then therapy was tailored secondary to the resistant nature of the organism. She received a combination of extensive debridement of the joint and institution of second-line anti-TB therapy with pyrazinamide, ethambutol, moxifloxacin, and ethionamide. To our knowledge, no other cases of multidrug-resistant TB have been reported in the literature after renal transplantation. This case shows both an atypical presentation of TB and the difficulties in managing a transplant patient with this disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Animal experiment and clinical preliminary application of percutaneous 70% ethanol injection therapy in multi-drug resistant pulmonary tuberculosis

International Nuclear Information System (INIS)

Liu Fuquan; Yue Zhendong; Gao Shunyu; Li YanSheng; Wei Guobin; Guo Weiyi; Chen Xijun; Li Baoyu

2004-01-01

Objective: To evaluate the clinical value of percutaneous injection of 70% ethanol in the treatment of multidrug resistant pulmonary tuberculosis. Methods: Percutaneous and transcatheter absolute ethanol, 70% ethanol, and 60% meglucamine diatrizoate(or distilled water) injection into the lung (25 cases) and the bronchi (25 cases) of healthy rabbits were performed, respectively.All specimens were studied with pathology. On the base of animals experiment, thirty-five patients with multi-drug resistant pulmonary tuberculosis were treated with percutaneous 70% ethanol injection. Every patient was treated by the same way for 1-3 times. Results: Pathological findings of the specimens of pulmonary tissue showed nonspecific inflammation, necrosis, and fibrosis. The chief pathological changes with percutaneous or transcatheter 70% ethanol injection were slighter than those with absolute ethanol injection. Pathological findings of the specimens of bronchi showed slight mucosal edema, nonspecific inflammation, and focal cytonecrosis. Recovery of the damaged bronchial mucosa occurred within 14-30 days after the treatment. All patients with multi-drug resistant pulmonary tuberculosis were followed up for 6 to 33 months. The sputum bacterial conversion to negative rate was 100% within 6 months after the treatment. Cavity closing, shrinking, and no changing rate were 47.1% (16/34), 50.0% (17/34), and 2.9% (1/34), respectively. Radiographic improvement rate was 94.3 % (33/35). No severe complications and adverse reactions occurred. Conclusion: Percutaneous 70% ethanol injection is safe, effective, and easy to perform in the treatment of multi-drug resistant pulmonary tuberculosis. (authors)

Transmission of Multidrug-Resistant and Drug-Susceptible Tuberculosis within Households: A Prospective Cohort Study

Science.gov (United States)

Grandjean, Louis; Gilman, Robert H.; Martin, Laura; Soto, Esther; Castro, Beatriz; Lopez, Sonia; Coronel, Jorge; Castillo, Edith; Alarcon, Valentina; Lopez, Virginia; San Miguel, Angela; Quispe, Neyda; Asencios, Luis; Dye, Christopher; Moore, David A. J.

2015-01-01

Background The “fitness” of an infectious pathogen is defined as the ability of the pathogen to survive, reproduce, be transmitted, and cause disease. The fitness of multidrug-resistant tuberculosis (MDRTB) relative to drug-susceptible tuberculosis is cited as one of the most important determinants of MDRTB spread and epidemic size. To estimate the relative fitness of drug-resistant tuberculosis cases, we compared the incidence of tuberculosis disease among the household contacts of MDRTB index patients to that among the contacts of drug-susceptible index patients. Methods and Findings This 3-y (2010–2013) prospective cohort household follow-up study in South Lima and Callao, Peru, measured the incidence of tuberculosis disease among 1,055 household contacts of 213 MDRTB index cases and 2,362 household contacts of 487 drug-susceptible index cases. A total of 35/1,055 (3.3%) household contacts of 213 MDRTB index cases developed tuberculosis disease, while 114/2,362 (4.8%) household contacts of 487 drug-susceptible index patients developed tuberculosis disease. The total follow-up time for drug-susceptible tuberculosis contacts was 2,620 person-years, while the total follow-up time for MDRTB contacts was 1,425 person-years. Using multivariate Cox regression to adjust for confounding variables including contact HIV status, contact age, socio-economic status, and index case sputum smear grade, the hazard ratio for tuberculosis disease among MDRTB household contacts was found to be half that for drug-susceptible contacts (hazard ratio 0.56, 95% CI 0.34–0.90, p = 0.017). The inference of transmission in this study was limited by the lack of genotyping data for household contacts. Capturing incident disease only among household contacts may also limit the extrapolation of these findings to the community setting. Conclusions The low relative fitness of MDRTB estimated by this study improves the chances of controlling drug-resistant tuberculosis. However, fitter

Comparison of the pharmacokinetics of two dosage regimens of linezolid in multidrug-resistant and extensively drug-resistant tuberculosis patients.

NARCIS (Netherlands)

Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der

2010-01-01

BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

Comparison of the Pharmacokinetics of Two Dosage Regimens of Linezolid in Multidrug-Resistant and Extensively Drug-Resistant Tuberculosis Patients

NARCIS (Netherlands)

Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.

2010-01-01

Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

Features of Cytokine Regulation in Multidrug-Resistant Tuberculosis Depending on Severity of Endogenous Intoxication

Directory of Open Access Journals (Sweden)

L.D. Todoriko

2016-02-01

Conclusions. Comprehensive assessment of integral indices of endogenous intoxication and level of certain pro- and anti-inflammatory cytokines in the blood plasma of patients with MDR TB shows a moderate endogenous intoxication, break down of the cellular component of the immune reactivity due to the formation of conditions for the development of Mycobacterium tuberculosis resistance, with further growth of cytotoxic hypoxia and activation of systemic inflammatory response syndrome. Analysis of plasma concentration of IL-6, IL-10 and IL-18 in patients with multidrug-resistance proved, that their level depends on the nature of Mycobacterium tuberculosis resistance.

The function of the thyroid gland in patients with multi-drug resistant tuberculosis

Directory of Open Access Journals (Sweden)

S. L. Matveyeva

2017-08-01

Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDRTB remains a health problem for many countries in the world. The share of MDRTB is 10–30% among newly diagnosed cases and 20–70% among relapses and treatment failure. The aim of the study is to define the side effects of second line drugs used in the treatment of MDRTB on thyroid function. Methods In 30 patients with multidrug resistant tuberculosis, echostructure of thyroid was studied by ultrasound imaging method. Indices of thyroid function: plasma levels of free thyroxin, thyroid stimulating hormone were studied before chemotherapy initiated, at the end of intensive phase and after the treatment finished. Results Decreasing of thyroid function under antituberculosis chemotherapy was approved. Monitoring and correction of thyroid function during antituberculosis chemotherapy was suggested. Conclusion Patients with MDRTB taking ethionamide and PAS are at increased risk for hypothyroidism and goiter, and therefore require monitoring of thyroid function at all stages of antituberculosis chemotherapy for its timely correction.

Topicality of the problem of combined course of multi-drug resistant pulmonary tuberculosis with diabetes mellitus

Directory of Open Access Journals (Sweden)

O. M. Raznatovska

2017-08-01

Full Text Available According to the World Health Organization, today in the world among the infectious chronic diseases one of the leading places and causes of death is multi-drug resistant tuberculosis of the lungs, and chronic non-communicable diseases – diabetes mellitus. The situation is complicated by the fact that the number of patients with combined course of these two heavy separate illnesses that complicate each other increases. It is established that with increasing severity of diabetes mellitus, tuberculosis process in the lungs becomes more complicate and deteriorates, and vice versa, the specific process complicates the course of diabetes mellitus, contributing to the development of diabetic complications. Against this background, the effectiveness of treatment of patients suffering from multi-drug resistant tuberculosis of the lungs in our country remains very low, mainly due to the toxic adverse reactions to antimycobacterial drugs of the reserve line, and in the case of adding diabetes mellitus, it deteriorates even more. The aim of this study was to review the scientific literature to determine the relevance of the study of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus and perspectives of innovative methods of diagnosis of diabetes mellitus. Early diagnosis of pre-diabetes, and autoimmune diseases will allow the use of timely correction techniques that prevents the development of diabetes mellitus, depending on its type, and in the future the development of serious irreversible processes, allow timely applying appropriate methods of correction of the revealed violations. Results. Very little amount of work is dedicated to the problem of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus, regardless of its type, the theme is relevant for today, in Ukraine there are no data regarding its study. This combined course of very difficult in the treatment diseases requires

Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

OpenAIRE

Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

2018-01-01

Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

Multidrug-resistant tuberculosis in Lithuania – Still a long way ahead

Directory of Open Access Journals (Sweden)

Greta Musteikienė

2016-01-01

Full Text Available Despite the recent advances in the diagnosis of tuberculosis, treatment of the disease, for the most part, remains the same as it was half a century ago. In recent years only two new anti-tuberculosis drugs have been approved by the European Medicines Agency and Food and Drug Administration. Though the prevalence of this disease is slowly decreasing all over Europe, new challenges appear. One of them is multidrug-resistant tuberculosis (MDR-TB. This problem is especially prominent in Lithuania, which is one of the 27 high MDR-TB burden countries in the world and falls behind neighboring countries in terms of the prevalence of the disease. The objective of this paper was to review the situation of tuberculosis and MDR-TB in Lithuania, and current available methods of treatment, control and diagnosis of this disease.

Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis : An Individual Patient Data Metaanalysis

NARCIS (Netherlands)

Fox, Gregory J.; Mitnick, Carole D.; Benedetti, Andrea; Chan, Edward D.; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S.; Menzies, Dick; van der Werf, Tjip S.

2016-01-01

Background. Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual

Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

NARCIS (Netherlands)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-01-01

Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper

Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

Directory of Open Access Journals (Sweden)

Mohd Zakihalani A. Halim

2016-03-01

Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

Limited Sampling Strategies for Therapeutic Drug Monitoring of Linezolid in Patients With Multidrug-Resistant Tuberculosis

NARCIS (Netherlands)

Alffenaar, Jan-Willem C.; Kosterink, Jos G. W.; van Altena, Richard; van der Werf, Tjip S.; Uges, Donald R. A.; Proost, Johannes H.

Introduction: Linezolid is a potential drug for the treatment of multidrug-resistant tuberculosis but its use is limited because of severe adverse effects such as anemia, thrombocytopenia, and peripheral neuropathy. This study aimed to develop a model for the prediction of linezolid area. under the

Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

International Nuclear Information System (INIS)

Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

2015-01-01

Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

Enhancement of antibiotic activity by efflux inhibitors against multidrug resistant Mycobacterium tuberculosis clinical isolates from Brazil

Directory of Open Access Journals (Sweden)

Tatiane eCoelho

2015-04-01

Full Text Available Drug resistant tuberculosis continues to increase and new approaches for its treatment are necessary. The identification of M. tuberculosis clinical isolates presenting efflux as part of their resistant phenotype has a major impact in tuberculosis treatment. In this work, we used a checkerboard procedure combined with the tetrazolium microplate-based assay (TEMA to study single combinations between antituberculosis drugs and efflux inhibitors (EIs against multidrug resistant M. tuberculosis clinical isolates using the fully susceptible strain H37Rv as reference. Efflux activity was studied on a real-time basis by a fluorometric method that uses ethidium bromide as efflux substrate. Quantification of efflux pump genes mRNA transcriptional levels were performed by RT-qPCR. The fractional inhibitory concentrations (FIC indicated synergistic activity for the interactions between isoniazid, rifampicin, amikacin, ofloxacin, and ethidium bromide plus the EIs verapamil, thioridazine and chlorpromazine. The FICs ranged from 0.25, indicating a four-fold reduction on the MICs, to 0.015, 64-fold reduction. The detection of active efflux by real-time fluorometry showed that all strains presented intrinsic efflux activity that contributes to the overall resistance which can be inhibited in the presence of the EIs. The quantification of the mRNA levels of the most important efflux pump genes on these strains shows that they are intrinsically predisposed to expel toxic compounds as the exposure to subinhibitory concentrations of antibiotics were not necessary to increase the pump mRNA levels when compared with the non-exposed counterpart. The results obtained in this study confirm that the intrinsic efflux activity contributes to the overall resistance in multidrug resistant clinical isolates of M. tuberculosis and that the inhibition of efflux pumps by the EIs can enhance the clinical effect of antibiotics that are their substrates.

The socioeconomic impact of multidrug resistant tuberculosis on patients: results from Ethiopia, Indonesia and Kazakhstan

NARCIS (Netherlands)

van den Hof, Susan; Collins, David; Hafidz, Firdaus; Beyene, Demissew; Tursynbayeva, Aigul; Tiemersma, Edine

2016-01-01

One of the main goals of the post-2015 global tuberculosis (TB) strategy is that no families affected by TB face catastrophic costs. We revised an existing TB patient cost measurement tool to specifically also measure multi-drug resistant (MDR) TB patients' costs and applied it in Ethiopia,

Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

Directory of Open Access Journals (Sweden)

U D Gupta

2015-01-01

Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

Genitourinary and pulmonary multidrug resistant Mycobacterium tuberculosis infection in an Asian elephant (Elephas maximus).

Science.gov (United States)

Dumonceaux, Genevieve A; St Leger, Judy; Olsen, John H; Burton, Michael S; Ashkin, David; Maslow, Joel N

2011-12-01

A female Asian elephant (Elephas maximus) developed vaginal and trunk discharge. Cultures were positive for pan-susceptible Mycobacterium tuberculosis. Isoniazid and pyrazinamide were given rectally and monitored by serum levels. After being trained at 10 mo to accept oral dosing, treatment was changed and rifampin was added. Oral medications were administered for another 10 mo. A year after completion of therapy, the vaginal discharge increased and cultures yielded M. tuberculosis, resistant to isoniazid and rifampin. Treatment with oral ethambutol, pyrazinamide, and enrofloxacin and intramuscular amikacin was initiated. Although followup cultures became negative, adverse reactions to medications precluded treatment completion. Due to public health concerns related to multidrug resistant M. tuberculosis (MDR-TB), the elephant was euthanized. Postmortem smears from the lung, peribronchial, and abdominal lymph nodes yielded acid-fast bacteria, although cultures were negative. This case highlights important considerations in the treatment of M. tuberculosis in animals and the need for a consistent approach to diagnosis, treatment, and follow-up.

High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

Science.gov (United States)

Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

2016-06-01

Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

Dried blood spot analysis for therapeutic drug monitoring of linezolid in patients with multidrug-resistant tuberculosis

NARCIS (Netherlands)

Vu, D H; Bolhuis, M S; Koster, R A; Greijdanus, B; de Lange, W C M; van Altena, R; Brouwers, J R B J; Uges, D R A; Alffenaar, J W C

2012-01-01

Linezolid is a promising antimicrobial agent for the treatment of multidrug-resistant tuberculosis (MDR-TB), but its use is limited by toxicity. Therapeutic drug monitoring (TDM) may help to minimize toxicity while adequate drug exposure is maintained. Conventional plasma sampling and monitoring

Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil.

Science.gov (United States)

Fregona, Geisa; Cosme, Lorrayne Belique; Moreira, Cláudia Maria Marques; Bussular, José Luis; Dettoni, Valdério do Valle; Dalcolmo, Margareth Pretti; Zandonade, Eliana; Maciel, Ethel Leonor Noia

2017-04-27

To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin) in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis - from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24-14.05) and re-entry after abandonment (OR = 3.91; 95%CI 1.81-8.43)], smoking (OR = 3.93; 95%CI 1.98-7.79), and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15-8.99). The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo. Analisar a prevalência e fatores associados à tuberculose resistente

A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study.

NARCIS (Netherlands)

Walker, Timothy M; Merker, Matthias; Knoblauch, Astrid M; Helbling, Peter; Schoch, Otto D; van der Werf, Marieke J; Kranzer, Katharina; Fiebig, Lena; Kröger, Stefan; Haas, Walter; Hoffmann, Harald; Indra, Alexander; Egli, Adrian; Cirillo, Daniela M; Robert, Jérôme; Rogers, Thomas R; Groenheit, Ramona; Mengshoel, Anne T; Mathys, Vanessa; Haanperä, Marjo; Soolingen, Dick van; Niemann, Stefan; Böttger, Erik C; Keller, Peter M

2018-01-01

The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan.

Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.

Science.gov (United States)

Lhadon, Tenzin; Jullien, Sophie

2018-04-20

Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.

Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

Science.gov (United States)

Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

Dominant incidence of multidrug and extensively drug-resistant specific Mycobacterium tuberculosis clones in Osaka Prefecture, Japan.

Directory of Open Access Journals (Sweden)

Aki Tamaru

Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.

Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

Science.gov (United States)

Coban, Ahmet Yilmaz; Uzun, Meltem

2013-01-01

Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA) in detecting isoniazid (INH) and rifampicin (RIF) resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results. PMID:24402143

Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

Directory of Open Access Journals (Sweden)

Ahmet Yilmaz Coban

2013-12-01

Full Text Available Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA in detecting isoniazid (INH and rifampicin (RIF resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV, negative predictive value (NPV and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results.

In vitro screening of snake venom against multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Sujay Kumar Bhunia

2015-12-01

Full Text Available The re-emergence of multidrug-resistant tuberculosis (MDR-TB has brought to light the importance of screening effective novel drugs. In the present study, in vitro activities of different snake (Naja naja, Bungarus fasciatus, Daboia russelli russelli, Naja kaouthia venoms have been investigated against clinical isolate of MDR-TB strains. The treatment with all the venoms inhibited the mycobacterial growth for at least a week in common and two of them (Naja naja and Naja kaouthia showed significantly longer inhibition up to two weeks against the MDR-TB strain with single dose and a repetition of those two venoms exhibited inhibition up to more than four weeks.

Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

Science.gov (United States)

Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2014-10-01

There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Multidrug-resistant tuberculosis: Rapid molecular detection with MTBDRplus® assay in clinical samples

Directory of Open Access Journals (Sweden)

Rita Macedo

2009-05-01

Full Text Available Nowadays, the greatest concern of tuberculosis control programmes is the appearance of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis. Rapid determination of drug resistance in clinical samples, with Mycobacterium tuberculosis complex (MTC, is the prerequisite for initiating effective chemotherapy, ensuring successful treatment of the patient and preventing further spread of drugresistant isolates.The aim of our study was to determine the sensitivity of the new MTBDRplus® assay in comparison to culture, identification and classic DST, directly from smear-positive clinical specimens.A total of 68 smear-positive sputum specimens were processed by both the classical mycobacteriological methods and the molecular assay, MTBDRplus®.MTBDRplus® assay allowed an accurate identification of MTC species by detection of the specific band in all samples, from which we also isolated and identified MTC strains by culture methods. In the samples from which we isolated susceptible strains (63.2%, wild type patterns were found using MTBDRplus® assay. The samples from which we isolated resistant strains (36.8% showed specific mutations associated with the correspondent resistant phenotype.Our study indicated that this assay allows rapid detection of resistance, always in agreement with classic methods. Resumo: Uma das principais problematicas no controlo da tuberculose e o aparecimento de casos de tuberculose multirresistente (TB-MR e tuberculose extensivamente resistente (TB-XDR. A deteccao precoce da resistencia a farmacos, directamente a partir de amostras respiratorias, e essencial para que se assegure o tratamento atempado, adequado e eficaz da tuberculose, bem como para prevenir a disseminacao destes casos de especial gravidade.O nosso objectivo foi avaliar a sensibilidade e comparar os resultados obtidos com um metodo de genetica molecular disponivel comercialmente – MTBDRplus® – e o isolamento

A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study

NARCIS (Netherlands)

Walker, T.M.; Merker, M.; Knoblauch, A.M.; Helbling, P.; Schoch, O.D.; Werf, M.J. van der; Kranzer, K.; Fiebig, L.; Kroger, S.; Haas, W.; Hoffmann, H.; Indra, A.; Egli, A.; Cirillo, D.M.; Robert, J.; Rogers, T.R.; Groenheit, R.; Mengshoel, A.T.; Mathys, V.; Haanpera, M.; Soolingen, D.V.; Niemann, S.; Bottger, E.C.; Keller, P.M.; Ingen, J. van; Wagner-Wiening, C.; Witschi, M.

2018-01-01

BACKGROUND: The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan. METHODS: On April 29 and May 30, 2016,

Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

Science.gov (United States)

Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

2012-03-01

Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

[Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Peru].

Science.gov (United States)

Torres, Julio; Sardón, Victoria; Soto, Mirtha G; Anicama, Rolado; Arroyo-Hernández, Hugo; Munayco, César V

2011-01-01

We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB) cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS). Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months). A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

Multidrug Resistant Tuberculosis involving the Clavicle, Spine and Ribs

Directory of Open Access Journals (Sweden)

H Krishnan

2011-03-01

Full Text Available This report describes an unusual case of multidrug resistant tuberculosis (MDR-TB, involving the right clavicle and multicentric aytpical spine involvement without any neurological deficit. The female patient presented with acute onset of right clavicular pain associated with a one-month history of lower backache with constitutional symptoms. The clavicular lesion and MRI spine findings were highly suggestive of TB. Anti TB drugs (ATD were started empirically as Sabah, Malaysia the patient’s home, is an endemic area for TB. Despite, 2 months of ATD administration, the patient did not respond well clinically and developed left sided chest wall abscesses arising from the left 3rd and 6th ribs. She was then treated for MDR-TB infection and has responded well to this treatment.

Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

Science.gov (United States)

Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

2016-01-01

Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12

Science.gov (United States)

Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted

2012-01-01

SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962

Surgical Face Masks Worn by Patients with Multidrug-Resistant Tuberculosis

Science.gov (United States)

Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A.; van der Walt, Martie; Nardell, Edward A.

2012-01-01

Rationale: Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. Objectives: We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Methods: Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Measurements and Main Results: Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68–85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31–51%), representing a 56% (95% CI, 33–70.5%) decreased risk of TB transmission when patients used masks. Conclusions: Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients. PMID:22323300

Clinical Validation of the Analysis of Linezolid and Clarithromycin in Oral Fluid of Patients with Multidrug-Resistant Tuberculosis

NARCIS (Netherlands)

Bolhuis, M. S.; van Altena, R.; van Hateren, K.; de Lange, W. C. M.; Greijdanus, B.; Uges, D. R. A.; Kosterink, J. G. W.; van der Werf, T. S.; Alffenaar, J. W. C.

Linezolid plays an increasingly important role in the treatment of multidrug-resistant tuberculosis (MDR-TB). However, patients should be carefully monitored due to time-and dose-dependent toxicity. Clarithromycin plays a more modest role. Therapeutic drug monitoring may contribute to assessment of

Type 2 diabetes mellitus and its influence in the development of multidrug resistance tuberculosis in patients from southeastern Mexico.

Science.gov (United States)

Pérez-Navarro, Lucia Monserrat; Fuentes-Domínguez, Francisco Javier; Zenteno-Cuevas, Roberto

2015-01-01

To determine the factors associated with the presence of pulmonary tuberculosis in patients with type 2 diabetes mellitus and the effect in the development of drug and multi-drug resistance, in a population with tuberculosis from the southeast of Mexico. This is a case-control study including 409 individuals, 146 with the binomial tuberculosis-type 2 diabetes mellitus and 263 individuals with tuberculosis. Demographic, epidemiological and outcome variables were collected. Risks were calculated. The factors associated with the presence of type 2 diabetes mellitus were age ≥35years, (OR=9.7; CI: 5.2-17.8), previous contact with a person infected with tuberculosis (OR=1.7; CI: 1.1-3.1). Body mass index ≥25 kg/m(2) (OR=2.2; CI: 1.1-4.3), and inherited family history of diabetes (OR=5.4; CI: 3.2-9.2). It was also found that patients with tuberculosis-type 2 diabetes mellitus presented a 4.7-fold (CI: 1.4-11.3) and 3.5-fold (CI: 1.1-11.1) higher risk of developing drug- and multidrug resistance tuberculosis, respectively. By last, individuals with tuberculosis-type 2 diabetes had a 2.3-fold (CI: 1.5-4.1) greater chance of persisting as tuberculosis-positive by the second month of treatment, delaying the resolution of the tuberculosis infection. Type 2 diabetes exerts a strong influence on the presentation and evolution of tuberculosis within the analyzed population and displays remarkable particularities, necessitating the development of dedicated tuberculosis-diabetes surveillance systems that consider the particular epidemiological characteristics of the population affected. Copyright © 2015 Elsevier Inc. All rights reserved.

How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

NARCIS (Netherlands)

Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

2013-01-01

Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

Clusters of Multidrug-Resistant Mycobacterium tuberculosis Cases, Europe

Science.gov (United States)

Kremer, Kristin; Heersma, Herre; Van Soolingen, Dick

2009-01-01

Molecular surveillance of multidrug-resistant tuberculosis (MDR TB) was implemented in Europe as case reporting in 2005. For all new MDR TB cases detected from January 2003 through June 2007, countries reported case-based epidemiologic data and DNA fingerprint patterns of MDR TB strains when available. International clusters were detected and analyzed. From 2003 through mid-2007 in Europe, 2,494 cases of MDR TB were reported from 24 European countries. Epidemiologic and molecular data were linked for 593 (39%) cases, and 672 insertion sequence 6110 DNA fingerprint patterns were reported from 19 countries. Of these patterns, 288 (43%) belonged to 18 European clusters; 7 clusters (242/288 cases, 84%) were characterized by strains of the Beijing genotype family, including the largest cluster (175/288 cases, 61%). Both clustering and the Beijing genotype were associated with strains originating in eastern European countries. Molecular cluster detection contributes to identification of transmission profile, risk factors, and control measures. PMID:19624920

Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

[Multidrug-resistant tuberculosis: challenges of a global emergence].

Science.gov (United States)

Comolet, T

2015-10-01

Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.

Outbreak of multidrug-resistant tuberculosis in two secondary schools.

Science.gov (United States)

Miravet Sorribes, Luis; Arnedo Pena, Alberto; Bellido Blasco, Juan B; Romeu García, María Angeles; Gil Fortuño, María; García Sidro, Patricia; Cortés Miró, Pascual

2016-02-01

To describe an outbreak of multidrug-resistant tuberculosis (MDR-TB) in two schools This was a prospective, observational study of an outbreak of MDR-TB in 2 schools located in the towns of Onda and Nules, in the Spanish province of Castellon, from the moment of detection in November 2008 until November 2014, including patient follow-up and contact tracing. Five cases of MDR-TB were diagnosed. Overall attack rate was 0.9%, and among the contacts traced, 66 had latent tuberculous infection, with an infection rate of 14.4%. Molecular characterization of the 5M. tuberculosis isolates was performed by restriction fragment length polymorphism (RFLP) analysis of the IS6110 sequence. In all 5 patients, cultures were negative at 4-month follow-up, showing the efficacy of the treatment given. No recurrence has been reported to date. In the context of globalization and the increased prevalence of MDR-TB, outbreaks such as the one presented here are only to be expected. Contact tracing, strict follow-up of confirmed cases, the availability of fast diagnostic techniques to avoid treatment delay, and chemoprophylaxis, together with the molecular characterization of strains, are still essential. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

Drug-resistant tuberculosis--current dilemmas, unanswered questions, challenges, and priority needs.

Science.gov (United States)

Zumla, Alimuddin; Abubakar, Ibrahim; Raviglione, Mario; Hoelscher, Michael; Ditiu, Lucica; McHugh, Timothy D; Squire, S Bertel; Cox, Helen; Ford, Nathan; McNerney, Ruth; Marais, Ben; Grobusch, Martin; Lawn, Stephen D; Migliori, Giovanni-Battista; Mwaba, Peter; O'Grady, Justin; Pletschette, Michel; Ramsay, Andrew; Chakaya, Jeremiah; Schito, Marco; Swaminathan, Soumya; Memish, Ziad; Maeurer, Markus; Atun, Rifat

2012-05-15

Tuberculosis was declared a global emergency by the World Health Organization (WHO) in 1993. Following the declaration and the promotion in 1995 of directly observed treatment short course (DOTS), a cost-effective strategy to contain the tuberculosis epidemic, nearly 7 million lives have been saved compared with the pre-DOTS era, high cure rates have been achieved in most countries worldwide, and the global incidence of tuberculosis has been in a slow decline since the early 2000s. However, the emergence and spread of multidrug-resistant (MDR) tuberculosis, extensively drug-resistant (XDR) tuberculosis, and more recently, totally drug-resistant tuberculosis pose a threat to global tuberculosis control. Multidrug-resistant tuberculosis is a man-made problem. Laboratory facilities for drug susceptibility testing are inadequate in most tuberculosis-endemic countries, especially in Africa; thus diagnosis is missed, routine surveillance is not implemented, and the actual numbers of global drug-resistant tuberculosis cases have yet to be estimated. This exposes an ominous situation and reveals an urgent need for commitment by national programs to health system improvement because the response to MDR tuberculosis requires strong health services in general. Multidrug-resistant tuberculosis and XDR tuberculosis greatly complicate patient management within resource-poor national tuberculosis programs, reducing treatment efficacy and increasing the cost of treatment to the extent that it could bankrupt healthcare financing in tuberculosis-endemic areas. Why, despite nearly 20 years of WHO-promoted activity and >12 years of MDR tuberculosis-specific activity, has the country response to the drug-resistant tuberculosis epidemic been so ineffectual? The current dilemmas, unanswered questions, operational issues, challenges, and priority needs for global drug resistance screening and surveillance, improved treatment regimens, and management of outcomes and prevention of DR

Linezolid in multidrug-resistant tuberculosis

NARCIS (Netherlands)

Bolhuis, Mathieu

2015-01-01

Tuberculose is een potentieel dodelijke infectieziekte die wordt veroorzaakt door de bacterie Mycobacterium tuberculosis. Een deel van de tuberculosepatiënten is besmet met multiresistente tuberculose. In het geval van multiresistente tuberculose is de bacterie resistent tegen de twee belangrijkste

Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

Directory of Open Access Journals (Sweden)

Navisha Dookie

2016-10-01

Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

Science.gov (United States)

Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

2017-07-01

Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

Hearing loss in children treated for multidrug-resistant tuberculosis.

Science.gov (United States)

Seddon, James A; Thee, Stephanie; Jacobs, Kayleen; Ebrahim, Adam; Hesseling, Anneke C; Schaaf, H Simon

2013-04-01

The aminoglycosides and polypeptides are vital drugs for the management of multidrug-resistant (MDR) tuberculosis (TB). Both classes of drug cause hearing loss. We aimed to determine the extent of hearing loss in children treated for MDR-TB. In this retrospective study, children (Hearing was assessed and classified using audiometry and otoacoustic emissions. Ninety-four children were included (median age: 43 months). Of 93 tested, 28 (30%) were HIV-infected. Twenty-three (24%) children had hearing loss. Culture-confirmed, as opposed to presumed, diagnosis of TB was a risk factor for hearing loss (OR: 4.12; 95% CI: 1.13-15.0; p = 0.02). Seven of 11 (64%) children classified as having hearing loss using audiometry had progression of hearing loss after finishing the injectable drug. Hearing loss is common in children treated for MDR-TB. Alternative drugs are required for the treatment of paediatric MDR-TB. Copyright © 2012 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Infection control, genetic assessment of drug resistance and drug susceptibility testing in the current management of multidrug/extensively-resistant tuberculosis (M/XDR-TB) in Europe

DEFF Research Database (Denmark)

Bothamley, Graham H.; Lange, Christoph; Albrecht, Dirk

2017-01-01

AIM: Europe has the highest documented caseload and greatest increase in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB) of all World Health Organization (WHO) regions. This survey examines how recommendations for M/XDR-TB management are being implemented. METHODS: TBNET is a pan...

Feasibility, diagnostic accuracy, and effectiveness of decentralised use of the Xpert MTB/RIF test for diagnosis of tuberculosis and multidrug resistance: a multicentre implementation study

NARCIS (Netherlands)

Boehme, Catharina C.; Nicol, Mark P.; Nabeta, Pamela; Michael, Joy S.; Gotuzzo, Eduardo; Tahirli, Rasim; Gler, Ma Tarcela; Blakemore, Robert; Worodria, William; Gray, Christen; Huang, Laurence; Caceres, Tatiana; Mehdiyev, Rafail; Raymond, Lawrence; Whitelaw, Andrew; Sagadevan, Kalaiselvan; Alexander, Heather; Albert, Heidi; Cobelens, Frank; Cox, Helen; Alland, David; Perkins, Mark D.

2011-01-01

The Xpert MTB/RIF test (Cepheid, Sunnyvale, CA, USA) can detect tuberculosis and its multidrug-resistant form with very high sensitivity and specificity in controlled studies, but no performance data exist from district and subdistrict health facilities in tuberculosis-endemic countries. We aimed to

Hypothyroidism during second-line treatment of multidrug-resistant tuberculosis: a prospective study.

Science.gov (United States)

Bares, R; Khalid, N; Daniel, H; Dittmann, H; Reimold, M; Gallwitz, B; Schmotzer, C

2016-07-01

Hypothyroidism is an adverse effect of certain anti-tuberculosis drugs. This is a prospective study of the frequency and possible pathomechanisms associated with hypothyroidism due to second-line treatment of multidrug-resistant tuberculosis. Fifty human immunodeficiency virus negative patients and 20 controls were included. All participants underwent ultrasonography of the thyroid and measurement of thyroid stimulating hormone (TSH). TSH levels were checked every 3 months. If hypothyroidism was present, T3, T4 and thyroid peroxidase autoantibodies were measured, and imaging extended to scintigraphy and repeated ultrasonography. Before treatment, 7 patients (14%) and 1 control (5%) were hypothyreotic. During the first 6 months of treatment, TSH levels increased in 41 patients (82%), 39 (78%) had values above the normal range and 19 (38%) had overt hypothyroidism. As none of the patients had signs of autoimmune thyroiditis, interaction with anti-tuberculosis drugs was assumed to be the cause of hypothyroidism. Nine patients died during treatment, all of whom had developed hypothyroidism. In seven, the metabolic situation at their death was known, and they had become euthyreotic following levothyroxine substitution. TSH levels should be checked before initiating anti-tuberculosis treatment and after 3 and 6 months to start timely replacement of levothyroxine. Further studies are needed to elucidate the exact pathomechanism involved in hypothyroidism and whether hypothyroidism can be used as predictor of treatment failure.

Risk factors and timing of default from treatment for non-multidrug-resistant tuberculosis in Moldova.

Science.gov (United States)

Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T

2013-03-01

The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.

Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

NARCIS (Netherlands)

Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

2013-01-01

A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

Science.gov (United States)

Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

2015-01-01

Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

Science.gov (United States)

Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

2015-02-01

Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

Multidrug-resistant pulmonary tuberculosis in Los Altos, Selva and Norte regions, Chiapas, Mexico.

Science.gov (United States)

Sánchez-Pérez, H J; Díaz-Vázquez, A; Nájera-Ortiz, J C; Balandrano, S; Martín-Mateo, M

2010-01-01

To analyse the proportion of multidrug-resistant tuberculosis (MDR-TB) in cultures performed during the period 2000-2002 in Los Altos, Selva and Norte regions, Chiapas, Mexico, and to analyse MDR-TB in terms of clinical and sociodemographic indicators. Cross-sectional study of patients with pulmonary tuberculosis (PTB) from the above regions. Drug susceptibility testing results from two research projects were analysed, as were those of routine sputum samples sent in by health personnel for processing (n = 114). MDR-TB was analysed in terms of the various variables of interest using bivariate tests of association and logistic regression. The proportion of primary MDR-TB was 4.6% (2 of 43), that of secondary MDR-TB was 29.2% (7/24), while among those whose history of treatment was unknown the proportion was 14.3% (3/21). According to the logistic regression model, the variables most highly associated with MDR-TB were as follows: having received anti-tuberculosis treatment previously, cough of >3 years' duration and not being indigenous. The high proportion of MDR cases found in the regions studied shows that it is necessary to significantly improve the control and surveillance of PTB.

Impact of drug resistance on the tuberculosis treatment outcome

Directory of Open Access Journals (Sweden)

E. Lesnic

2017-03-01

Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will

Extensively and Pre-Extensively Drug Resistant Tuberculosis in Clinical Isolates of Multi-Drug Resistant Tuberculosis Using Classical Second Line Drugs (Levofloxacin and Amikacin)

International Nuclear Information System (INIS)

Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.

2015-01-01

Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)

Prevalence of drug resistant tuberculosis in Arsi Zone, Ethiopia ...

African Journals Online (AJOL)

Background: Wide spread of occurrence of multi-drug resistance tuberculosis is becoming a major challenge to effective tuberculosis control. Thus, it is imperative to monitor the sensitivity of anti-TB drugs regularly. Objective: To determine the prevalence resistance to anti-TB drugs in a well established control program area ...

Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

NARCIS (Netherlands)

Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

2010-01-01

This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

A novel automatic molecular test for detection of multidrug resistance tuberculosis in sputum specimen: A case control study.

Science.gov (United States)

Li, Qiang; Ou, Xi C; Pang, Yu; Xia, Hui; Huang, Hai R; Zhao, Bing; Wang, Sheng F; Zhao, Yan L

2017-07-01

MiniLab tuberculosis (ML TB) assay is a new automatic diagnostic tool for diagnosis of multidrug resistance tuberculosis (MDR-TB). This study was conducted with aims to know the performance of this assay. Sputum sample from 224 TB suspects was collected from tuberculosis suspects seeking medical care at Beijing Chest hospital. The sputum samples were directly used for smear and ML TB test. The left sputum sample was used to conduct Xpert MTB/RIF, Bactec MGIT culture and drug susceptibility test (DST). All discrepancies between the results from DST, molecular and phenotypic methods were confirmed by DNA Sequencing. The sensitivity and specificity of ML TB test for detecting MTBC from TB suspects were 95.1% and 88.9%, respectively. The sensitivity for smear negative TB suspects was 64.3%. For detection of RIF resistance, the sensitivity and specificity of ML TB test were 89.2% and 95.7%, respectively. For detection of INH resistance, the sensitivity and specificity of ML TB test were 78.3% and 98.1%, respectively. ML TB test showed similar performance to Xpert MTB/RIF for detection of MTBC and RIF resistance. In addition, ML TB also had good performance for INH resistance detection. Copyright © 2017. Published by Elsevier Ltd.

Strong In Vitro Activities of Two New Rifabutin Analogs against Multidrug-Resistant Mycobacterium tuberculosis ▿ †

Science.gov (United States)

García, Ana-Belén; Palacios, Juan J.; Ruiz, María-Jesús; Barluenga, José; Aznar, Fernando; Cabal, María-Paz; García, José María; Díaz, Natalia

2010-01-01

Two new rifabutin analogs, RFA-1 and RFA-2, show high in vitro antimycobacterial activities against Mycobacterium tuberculosis. MIC values of RFA-1 and RFA-2 were ≤0.02 μg/ml against rifamycin-susceptible strains and 0.5 μg/ml against a wide selection of multidrug-resistant strains, compared to ≥50 μg/ml for rifampin and 10 μg/ml for rifabutin. Molecular dynamic studies indicate that the compounds may exert tighter binding to mutants of RNA polymerase that have adapted to the rifamycins. PMID:20855731

Drug resistance in Mexico: results from the National Survey on Drug-Resistant Tuberculosis.

Science.gov (United States)

Bojorquez-Chapela, I; Bäcker, C E; Orejel, I; López, A; Díaz-Quiñonez, A; Hernández-Serrato, M I; Balandrano, S; Romero, M; Téllez-Rojo Solís, M M; Castellanos, M; Alpuche, C; Hernández-Ávila, M; López-Gatell, H

2013-04-01

To present estimations obtained from a population-level survey conducted in Mexico of prevalence rates of mono-, poly- and multidrug-resistant strains among newly diagnosed cases of pulmonary tuberculosis (TB), as well as the main factors associated with multidrug resistance (combined resistance to isoniazid and rifampicin). Study data came from the National Survey on TB Drug Resistance (ENTB-2008), a nationally representative survey conducted during 2008-2009 in nine states with a stratified cluster sampling design. Samples were obtained for all newly diagnosed cases of pulmonary TB in selected sites. Drug susceptibility testing (DST) was performed for anti-tuberculosis drugs. DST results were obtained for 75% of the cases. Of these, 82.2% (95%CI 79.5-84.7) were susceptible to all drugs. The prevalence of multidrug-resistant TB (MDR-TB) was estimated at 2.8% (95%CI 1.9-4.0). MDR-TB was associated with previous treatment (OR 3.3, 95%CI 1.1-9.4). The prevalence of drug resistance is relatively low in Mexico. ENTB-2008 can be used as a baseline for future follow-up of drug resistance.

Multidrug resistant to extensively drug resistant tuberculosis: What is ...

Indian Academy of Sciences (India)

Prakash

The modern, ... World Health Organization is based on a four-drug regimen ... Better management and control of tuberculosis specially drug resistant TB by experienced and qualified .... a comprehensive approach including the major DOTS.

Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

Science.gov (United States)

Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

2005-01-01

The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

Drug-resistant tuberculosis: emerging treatment options

Directory of Open Access Journals (Sweden)

Adhvaryu MR

2011-12-01

Full Text Available Meghna Adhvaryu1, Bhasker Vakharia21Department of Biotechnology, SRK Institute of Computer Education and Applied Sciences, 2R&D, Bhuma Research in Ayurvedic and Herbal Medicine, Surat, Gujarat, IndiaAbstract: Multidrug-resistant tuberculosis has emerged worldwide, with an increasing incidence due to failure of implementation of apparently effective first-line antituberculous therapy as well as primary infection with drug-resistant strains. Failure of current therapy is attributed to a long duration of treatment leading to nonadherence and irregular therapy, lack of patient education about the disease, poverty, irregular supply by care providers, drug–drug interactions in patients coinfected with human immunodeficiency virus (HIV, inadequate regulations causing market overlap and irresponsible drug usage in the private sector, and lack of research, with no addition of new drugs in the last four decades. Present standards of care for the treatment of drug-susceptible tuberculosis, multidrug-resistant tuberculosis, tuberculosis-HIV coinfection, and latent tuberculosis infection are all unsatisfactory. Since 2000, the World Health Organization (WHO has focused on drug development for tuberculosis, as well as research in all relevant aspects to discover new regimens by 2015 and to eliminate tuberculosis as a public health concern by 2050. As a result, some 20 promising compounds from 14 groups of drugs have been discovered. Twelve candidates from eight classes are currently being evaluated in clinical trials. Ongoing research should prioritize identification of novel targets and newer application of existing drugs, discovery of multitargeted drugs from natural compounds, strengthening host factors by immunopotentiation with herbal immunomodulators, as well as protective vaccines before and after exposure, consideration of surgical measures when indicated, development of tools for rapid diagnosis, early identification of resistant strains, and

Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

Science.gov (United States)

Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

2017-11-06

Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

Cutaneous squamous cell carcinoma in lupus vulgaris caused by drug resistant Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Muthu S Kumaran

2017-01-01

Full Text Available Tuberculosis (TB is still a major public health problem in the world, with many factors contributing to this burden, including poor living conditions, overcrowding, poverty, malnutrition, illiteracy, and rapid spread of human immunodeficiency virus infection. Cutaneous tuberculosis is a less common form of extrapulmonary tuberculosis, and in this paucibacillary form the diagnosis depends on histopathology, tuberculin positivity, and response to treatment. The diagnosis is even more difficult in cases with drug resistant Mycobacterium tuberculosis due to lack of awareness and lack of facilities to diagnose drug resistant tuberculosis. In this article, we describe an unusual case of multidrug resistant lupus vulgaris (LV, in a 34-year-old male who responded to anti-tubercular treatment (ATT initially, but developed recurrent disease which failed to respond to standard four-drug ATT; subsequently, tissue culture showed growth of multidrug resistant M. tuberculosis. Subsequently, he also developed cutaneous squamous cell carcinoma. This article aims to exemplify a grave complication that can occur in long-standing case of LV, the limitations faced by clinicians in developing countries where tuberculosis is endemic, and classical methods of proving drug resistance are generally unavailable or fail.

Genotypic diversity of multidrug-, quinolone- and extensively drug-resistant Mycobacterium tuberculosis isolates in Thailand.

Science.gov (United States)

Disratthakit, Areeya; Meada, Shinji; Prammananan, Therdsak; Thaipisuttikul, Iyarit; Doi, Norio; Chaiprasert, Angkana

2015-06-01

Drug-resistant tuberculosis (TB), which includes multidrug-resistant (MDR-TB), quinolone-resistant (QR-TB) and extensively drug-resistant tuberculosis (XDR-TB), is a serious threat to TB control. We aimed to characterize the genotypic diversity of drug-resistant TB clinical isolates collected in Thailand to establish whether the emergence of drug-resistant TB is attributable to transmitted resistance or acquired resistance. We constructed the first molecular phylogeny of MDR-TB (n=95), QR-TB (n=69) and XDR-TB (n=28) in Thailand based on spoligotyping and proposed 24-locus multilocus variable-number of tandem repeat analysis (MLVA). Clustering analysis was performed using the unweighted pair group method with arithmetic mean. Spoligotyping identified the Beijing strain (SIT1) as the most predominant genotype (n=139; 72.4%). The discriminatory power of 0.9235 Hunter-Gaston Discriminatory Index (HGDI) with the 15-locus variable-number tandem repeats of mycobacterial interspersed repetitive units typing was improved to a 0.9574 HGDI with proposed 24-locus MLVA, thereby resulting in the subdivision of a large cluster of Beijing strains (SIT1) into 17 subclusters. We identified the spread of drug-resistant TB clones caused by three different MLVA types in the Beijing strain (SIT1) and a specific clone of XDR-TB caused by a rare genotype, the Manu-ancestor strain (SIT523). Overall, 49.5% of all isolates were clustered. These findings suggest that a remarkable transmission of drug-resistant TB occurred in Thailand. The remaining 50% of drug-resistant TB isolates were unique genotypes, which may have arisen from the individual acquisition of drug resistance. Our results suggest that transmitted and acquired resistance have played an equal role in the emergence of drug-resistant TB. Further characterization of whole genome sequences of clonal strains could help to elucidate the mycobacterial genetic factors relevant for drug resistance, transmissibility and virulence

Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

Directory of Open Access Journals (Sweden)

Carole D Mitnick

Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

Perfil de sensibilidade e fatores de risco associados à resistência do Mycobacterium tuberculosis, em centro de referência de doenças infecto-contagiosas de Minas Gerais Multidrug-resistant Mycobacterium tuberculosis at a referral center for infectious diseases in the state of Minas Gerais, Brazil: sensitivity profile and related risk factors

Directory of Open Access Journals (Sweden)

Márcia Beatriz de Souza

2006-10-01

Full Text Available OBJETIVO: Estudar os fatores determinantes da multirresistência do Mycobacterium tuberculosis às drogas tuberculostáticas em centro de referência de doenças infecto-contagiosas do Estado de Minas Gerais, Hospital Eduardo de Menezes. MÉTODOS: Estudo tipo caso-controle, retrospectivo, realizado de setembro de 2000 a janeiro de 2004. Nesse período, 473 culturas com crescimento de M. tuberculosis relativas a 313 pacientes foram analisadas quanto ao perfil de sensibilidade, no Laboratório Central de Minas Gerais. Foram selecionados os casos multirresistentes definidos como resistência a pelo menos rifampicina e isoniazida, depois de pareados com o grupo controle de pacientes com tuberculose sensível a todas as drogas na razão de 1:3. A associação dos dados demográficos e clínicos foi feita por análise estatística uni e multivariada. RESULTADOS: Durante o período de estudo, doze casos de tuberculose multirresistente foram identificados (3,83%. Na análise univariada, a tuberculose multirresistente foi mais comum no sexo masculino, em pacientes com baciloscopia de escarro positiva, pacientes com cavitações maiores que 4 cm de diâmetro e pacientes com um ou mais tratamentos prévios para tuberculose (p = 0,10. Após a análise multivariada somente o tratamento anterior para tuberculose permaneceu estatisticamente significativo (p = 0,0374, com odds ratio de 14,36 (1,96 - 176,46. CONCLUSÃO: O fator de risco que se mostrou independentemente associado ao desenvolvimento de tuberculose multirresistente neste estudo foi a presença de um ou mais tratamentos prévios para tuberculose.OBJECTIVE: To assess the determining factors for Mycobacterium tuberculosis multidrug resistance at a referral center for infectious diseases in the state of Minas Gerais, Brazil. METHODS: A retrospective case-control study was conducted using data collected from September of 2000 to January of 2004. During this period, 473 cultures presenting growth of M

[Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

Science.gov (United States)

Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

2014-01-01

Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

Directory of Open Access Journals (Sweden)

Hyun Lee

2017-12-01

Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

Status of drug-resistant tuberculosis in China: A systematic review and meta-analysis.

Science.gov (United States)

Zhang, Jingya; Gou, Haimei; Hu, Xuejiao; Hu, Xin; Shang, Mengqiao; Zhou, Juan; Zhou, Yi; Ye, Yuanxin; Song, Xingbo; Lu, Xiaojun; Chen, Xuerong; Ying, Binwu; Wang, Lanlan

2016-06-01

We conducted a systematic review and meta-analysis on drug-resistant tuberculosis in China to provide useful data for tuberculosis (TB) surveillance and treatment. Several databases, including PubMed, Embase, and the Chinese Biological Medical Database, were systematically searched between January 1, 1999, and August 31, 2015, using strict inclusion and exclusion criteria. The corresponding drug-resistant TB prevalence between the new and previously treated cases was significantly different in almost all of the economic regions. The Eastern coastal region is the most developed economic region with the lowest total drug-resistant TB prevalence (any drug resistance: 28%; 95% confidence interval [CI], 25%-32%; multidrug resistance: 9%; 95% CI, 8%-12%) and the lowest number of new cases (any drug resistance: 21%; 95% CI, 19%-23%; multidrug resistance: 4%; 95% CI, 3%-5%). The Northwest is the least developed area with the lowest drug-resistant TB prevalence for previously treated cases (any drug resistance: 45%; 95% CI, 36%-55%; multidrug resistance: 17%; 95% CI, 11%-26%). The prevalence (multidrug and first-line drug resistance) exhibited a downward trend from 1996-2014. The extensively drug-resistant prevalence in China was 3% (95% CI, 2%-5%) in this review. Overall, the status of drug-resistant tuberculosis in China is notably grim and exhibits regional epidemiologic characteristics. We are in urgent need of several comprehensive and effective control efforts to reverse this situation. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Multidrug resistant tuberculosis in prisons located in former Soviet countries: A systematic review.

Directory of Open Access Journals (Sweden)

Maxwell Droznin

Full Text Available A systematic literature review was performed to investigate the occurrence of multidrug-resistant tuberculosis (MDR TB in prisons located in countries formerly part of the Soviet Union.A systematic search of published studies reporting MDR TB occurrence in prisons located in former Soviet countries was conducted by probing PubMed and Cumulative Index Nursing and Allied Health Literature for articles that met predetermined inclusion criteria.Seventeen studies were identified for systematic review. Studies were conducted in six different countries. Overall, prevalence of MDR TB among prisoners varied greatly between studies. Our findings suggest a high prevalence of MDR TB in prisons of Post-Soviet states with percentages as high as 16 times more than the worldwide prevalence estimated by the WHO in 2014.All studies suggested a high prevalence of MDR TB in prison populations in Post-Soviet states.

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

Directory of Open Access Journals (Sweden)

Zakham F

2013-11-01

Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

International Nuclear Information System (INIS)

Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok; Koh, Won-Jung; Kwon, O Jung; Kang, Eun Young; Kim, Seonwoo

2006-01-01

The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

Energy Technology Data Exchange (ETDEWEB)

Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea); Koh, Won-Jung; Kwon, O Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea); Kang, Eun Young [Korea University Guro Hospital, Department of Diagnostic Radiology, Korea University College of Medicine, Seoul (Korea); Kim, Seonwoo [Sungkyunkwan University School of Medicine, Biostatistics Unit of the Samsung Biomedical Research Institute, Samsung Medical Center, Seoul (Korea)

2006-09-15

The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it

Directory of Open Access Journals (Sweden)

Sven Hoffner

2016-01-01

Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.

Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.

Science.gov (United States)

Hoffner, Sven

2016-12-01

Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.

Concordance of programmatic and laboratory-based multidrug-resistant tuberculosis treatment outcomes in Peru.

Science.gov (United States)

Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C

2012-01-01

Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.

Pattern of intensive phase treatment outcomes of multi-drug resistant ...

African Journals Online (AJOL)

Pattern of intensive phase treatment outcomes of multi-drug resistant tuberculosis in University of Port Harcourt Treatment Centre: a review of records from ... Data on patients' age, sex, HIV status, treatment outcomes were extracted from the hospital book records into a computer data sheet at the UPTH treatment centre.

Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

Science.gov (United States)

Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

2015-01-01

While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

Soluble Urokinase Plasminogen Activator Receptor Levels in Tuberculosis Patients at High Risk for Multidrug Resistance

Directory of Open Access Journals (Sweden)

Tri Yudani Mardining Raras

2012-01-01

Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.

Serum vitamin d level and susceptibility to multidrug-resistant tuberculosis among household contacts

Science.gov (United States)

Herlina, N.; Sinaga, B. Y. M.; Siagian, P.; Mutiara, E.

2018-03-01

Low levels of vitamin D is a predisposing factor for Multidrug-resistant tuberculosis. Family members in contact with the patient are also at risk of infection. Currently, there is no study that compares vitamin D levels between MDR-TB patients and household contact. This study aims to identify the association between level vitamin D within MDR-TB occurrence. This was a case-control study, with the number of samples in each group (MDR-TB) patients and household contactswere40 people. Each member of each group was checked for vitamin D levels using enzyme-linked immunosorbent assay (ELISA) technique. Statistical analysis was by using Chi-Square analysis using SPSS. Mean levels of vitamin D in MDR-TB patients were 32.21, household contact 31.7. There was anosignificant association between vitamin D levels and MDR-TB occurrence (p=1.0).No significant associationbetween vitamin D level with theMDR-TB occurrence.

Drug-resistant tuberculosis: time for visionary political leadership.

Science.gov (United States)

Abubakar, Ibrahim; Zignol, Matteo; Falzon, Dennis; Raviglione, Mario; Ditiu, Lucica; Masham, Susan; Adetifa, Ifedayo; Ford, Nathan; Cox, Helen; Lawn, Stephen D; Marais, Ben J; McHugh, Timothy D; Mwaba, Peter; Bates, Matthew; Lipman, Marc; Zijenah, Lynn; Logan, Simon; McNerney, Ruth; Zumla, Adam; Sarda, Krishna; Nahid, Payam; Hoelscher, Michael; Pletschette, Michel; Memish, Ziad A; Kim, Peter; Hafner, Richard; Cole, Stewart; Migliori, Giovanni Battista; Maeurer, Markus; Schito, Marco; Zumla, Alimuddin

2013-06-01

Two decades ago, WHO declared tuberculosis a global emergency, and invested in the highly cost-effective directly observed treatment short-course programme to control the epidemic. At that time, most strains of Mycobacterium tuberculosis were susceptible to first-line tuberculosis drugs, and drug resistance was not a major issue. However, in 2013, tuberculosis remains a major public health concern worldwide, with prevalence of multidrug-resistant (MDR) tuberculosis rising. WHO estimates roughly 630 000 cases of MDR tuberculosis worldwide, with great variation in the frequency of MDR tuberculosis between countries. In the past 8 years, extensively drug-resistant (XDR) tuberculosis has emerged, and has been reported in 84 countries, heralding the possibility of virtually untreatable tuberculosis. Increased population movement, the continuing HIV pandemic, and the rise in MDR tuberculosis pose formidable challenges to the global control of tuberculosis. We provide an overview of the global burden of drug-resistant disease; discuss the social, health service, management, and control issues that fuel and sustain the epidemic; and suggest specific recommendations for important next steps. Visionary political leadership is needed to curb the rise of MDR and XDR tuberculosis worldwide, through sustained funding and the implementation of global and regional action plans. Copyright © 2013 World Health Organization. Published by Elsevier Ltd/Inc/BV. All rights reserved. Published by Elsevier Ltd. All rights reserved.

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Directory of Open Access Journals (Sweden)

Stefan Niemann

2009-10-01

Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Science.gov (United States)

Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

2009-10-12

Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

OpenAIRE

Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

2016-01-01

Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

The diarylquinoline TMC207 for multidrug-resistant tuberculosis

NARCIS (Netherlands)

Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin; Patientia, Ramonde; Rustomjee, Roxana; Page-Shipp, Liesl; Pistorius, Christoffel; Krause, Rene; Bogoshi, Mampedi; Churchyard, Gavin; Venter, Amour; Allen, Jenny; Palomino, Juan Carlos; de Marez, Tine; van Heeswijk, Rolf P. G.; Lounis, Nacer; Meyvisch, Paul; Verbeeck, Johan; Parys, Wim; de Beule, Karel; Andries, Koen; Mc Neeley, David F.

2009-01-01

BACKGROUND: The diarylquinoline TMC207 offers a new mechanism of antituberculosis action by inhibiting mycobacterial ATP synthase. TMC207 potently inhibits drug-sensitive and drug-resistant Mycobacterium tuberculosis in vitro and shows bactericidal activity in patients who have drug-susceptible

Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

Science.gov (United States)

Ramazanzadeh, Rashid; Roshani, Daem; Shakib, Pegah; Rouhi, Samaneh

2015-01-01

Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis) can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB) in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR) in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012) that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10). Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20%) with negative MDR-TB and in China in 2010 (0.8%), respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%).0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family. PMID:25767526

Applicability of the shorter ‘Bangladesh regimen’ in high multidrug-resistant tuberculosis settings

Directory of Open Access Journals (Sweden)

Giovanni Sotgiu

2017-03-01

Full Text Available In spite of the recent introduction of two new drugs (delamanid and bedaquiline and a few repurposed compounds to treat multidrug-resistant and extensively drug-resistant tuberculosis (MDR- and XDR-TB, clinicians are facing increasing problems in designing effective regimens in severe cases. Recently a 9 to 12-month regimen (known as the ‘Bangladesh regimen’ proved to be effective in treating MDR-TB cases. It included an initial phase of 4 to 6 months of kanamycin, moxifloxacin, prothionamide, clofazimine, pyrazinamide, high-dose isoniazid, and ethambutol, followed by 5 months of moxifloxacin, clofazimine, pyrazinamide, and ethambutol. However, recent evidence from Europe and Latin America identified prevalences of resistance to the first-line drugs in this regimen (ethambutol and pyrazinamide exceeding 60%, and of prothionamide exceeding 50%. Furthermore, the proportions of resistance to the two most important pillars of the regimen – quinolones and kanamycin – were higher than 40%. Overall, only 14 out of 348 adult patients (4.0% were susceptible to all of the drugs composing the regimen, and were therefore potentially suitable for the ‘shorter regimen’. A shorter, cheaper, and well-tolerated MDR-TB regimen is likely to impact the number of patients treated and improve adherence if prescribed to the right patients through the systematic use of rapid MTBDRsl testing.

Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

Science.gov (United States)

Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

2007-12-01

Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

Carbapenems to Treat Multidrug and Extensively Drug-Resistant Tuberculosis: A Systematic Review.

Science.gov (United States)

Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Tiberi, Simon; Esposito, Susanna; Dore, Simone; Spanevello, Antonio; Migliori, Giovanni Battista

2016-03-12

Carbapenems (ertapenem, imipenem, meropenem) are used to treat multidrug-resistant (MDR-) and extensively drug-resistant tuberculosis (XDR-TB), even if the published evidence is limited, particularly when it is otherwise difficult to identify the recommended four active drugs to be included in the regimen. No systematic review to date has ever evaluated the efficacy, safety, and tolerability of carbapenems. A search of peer-reviewed, scientific evidence was carried out, aimed at evaluating the efficacy/effectiveness, safety, and tolerability of carbapenem-containing regimens in individuals with pulmonary/extra-pulmonary disease which was bacteriologically confirmed as M/XDR-TB. We used PubMed to identify relevant full-text, English manuscripts up to the 20 December 2015, excluding editorials and reviews. Seven out of 160 studies satisfied the inclusion criteria: two on ertapenem, one on imipenem, and four on meropenem, all published between 2005 and 2016. Of seven studies, six were retrospective, four were performed in a single center, two enrolled children, two had a control group, and six reported a proportion of XDR-TB cases higher than 20%. Treatment success was higher than 57% in five studies with culture conversion rates between 60% and 94.8%. The safety and tolerability is very good, with the proportion of adverse events attributable to carbapenems below 15%.

Increasing incidence of fluoroquinolone-resistant Mycobacterium tuberculosis in Mumbai, India.

Science.gov (United States)

Agrawal, D; Udwadia, Z F; Rodriguez, C; Mehta, A

2009-01-01

Tertiary referral centre, private hospital, Mumbai, India. To analyse the incidence of fluoroquinolone (FQ) resistant Mycobacterium tuberculosis (TB) in our laboratory from 1995 to 2004. Retrospective review and analysis of the drug susceptibility test records of all M. tuberculosis culture-positive samples from our Microbiology Department from 1995 to 2004. FQ resistance has increased exponentially in our laboratory, from 3% in 1996 to 35% in 2004. The incidence of multidrug-resistant tuberculosis has also increased during the same period, from 33% in 1995 to 56% in 2004. The incidence of FQ-resistant M. tuberculosis is gradually increasing to alarming levels. This may be due to widespread use of this vital group of drugs in the treatment of community-acquired infections. We urge that these broad spectrum antibiotics be used judiciously, and ideally be reserved for treatment of resistant TB in TB-endemic areas.

Changing patterns and trends of multidrug-resistant tuberculosis at referral centre in Northern India: A 4-year experience

Directory of Open Access Journals (Sweden)

A K Maurya

2013-01-01

Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.

Resistance patterns, prevalence, and predictors of fluoroquinolones resistance in multidrug resistant tuberculosis patients

Directory of Open Access Journals (Sweden)

Nafees Ahmad

2016-01-01

Conclusion: The high degree of drug resistance observed, particularly to fluoroquinolones, is alarming. We recommend the adoption of more restrictive policies to control non-prescription sale of fluoroquinolones, its rational use by physicians, and training doctors in both private and public–private mix sectors to prevent further increase in fluoroquinolones resistant Mycobacterium tuberculosis strains.

A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Andréa Gobetti Vieira Coelho

2012-09-01

Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

Effectiveness of a novel cellular therapy to treat multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Aliaksandr Skrahin

2016-08-01

Full Text Available Introduction: We urgently need novel treatments for multidrug-resistant tuberculosis (MDR-TB. Autologous mesenchymal stromal cell (MSC infusion is one such possibility due to its potential to repair damaged lung tissue and boost immune responses. We aimed to assess the effectiveness of MSC to improve outcomes among MDR-TB patients. Methods: We analyzed outcomes for 108 Belarussian MDR-TB patients receiving chemotherapy. Thirty-six patients (“cases” also had MSCs extracted, cultured and re-infused (average time from chemotherapy start to infusion was 49 days; another 36 patients were “study controls”. We identified another control group: 36 patients from the Belarussian surveillance database (“surveillance controls” 1:1 matched to cases. Results: Of the cases, 81% had successful outcomes versus 42% of surveillance controls and 39% of study controls. Successful outcome odds were 6.5 (95% Confidence Interval: 1.2–36.2, p=0.032 times greater for cases than surveillance controls (age-adjusted. Radiological improvement was more likely in cases than study controls. Culture analysis prior to infusion demonstrated a poorer initial prognosis in cases, yet despite this they had better outcomes than the control groups. Conclusion: MSC treatment could vastly improve outcomes for MDR-TB patients. Our findings could revolutionize therapy options and have strong implications for future directions of MDR-TB therapy research. Keywords: Mesenchymal stromal cells, Extensively drug resistant, Outcomes, Treatment

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

Science.gov (United States)

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

Comparative analysis of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis – Epidemiology and predictive factors

Directory of Open Access Journals (Sweden)

Ana Sofia Vilariça

2008-11-01

Full Text Available Introduction: Extensively drug-resistant tuberculosis (XDR-TB is defined as a form of multidrug-resistant tuberculosis (MDR-TB with additional resistance to fluoroquinolones and at least one of the injectable drugs used in tuberculosis treatment: amikacin, kanamycin and capreomycin. It was classified by WHO as a serious threat to tuberculosis (TB control, with world-wide consequences, taking on the proportions of a real pandemic in some regions. Aim: To compare patients with XDR-TB versus other MDR-TB profiles with regard to epidemiological and demographic characteristics, aetiopathogenic factors and inhospital outcomes. Methods: Patients admitted to Pulido Valente Hospital (Pulmonology Service III in the period ranging from April 1999 to June 2007 with MDR-TB diagnosis microbiologically confirmed. The following variables were evaluated: gender, age, race, forms of TB presentation, treatment groups, resistance profile, immigrant status, number and duration of previous treatments, WHO classification, HIV co-infection, alcoholism and/or drug addiction, average length of hospital stay and inhospital mortality.Statistical analysis was performed using the SPSS (Statistical Package for the Social Sciences, version 15.0. In categorical variables, the statistical differences between groups were evaluated by the Chisquare test and numeric variables using the T-test. Logistical regression analysis was used to build the predictive model of XDR-TB existence (dependent variable, which included the following independent variables: WHO classification, HIV co-infection, immigrant status, alcoholism and/or drug addiction and number and duration of previous treatments. Results: We recorded 132 patients with MDR-TB, of which 69 (52.3% were XDR-TB. Statistically significant differences were observed in the following variables: race (black race was associated with XDRTB in 74% of cases versus 46% of the Caucasian race; WHO classification (patients with retreatment

Drug resistance pattern of M. tuberculosis in category II treatment failure pulmonary tuberculosis patients

Directory of Open Access Journals (Sweden)

Fahmida Rahman

2013-01-01

Full Text Available This study was designed to determine the extent of drug resistance of M. tuberculosis (MTB isolated from category II treatment failure pulmonary tuberculosis (PTB patients. A total of 100 Ziehl-Neelsen (Z-N smear positive category II failure PTB patients were included in this study. Sputum culture was done in Lowenstein-Jensen (L-J media. Conventional proportion method on Lowenstein-Jensen (L-J media was used to determine the drug susceptibility of M. tuberculosis to isoniazid (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA. Out of 100 sputum samples, a total of 87 samples were positive by culture. Drug susceptibility test (DST revealed that 82 (94.25% isolates were resistant to one or more anti -TB drugs. Resistance to isoniazide (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA was 94.25%, 82.75%, 29.90% and 3.45% respectively. Among these isolates, 79.31% and 3.45% isolates were multi-drug resistant (MDR and extended drug resistant (XDR M. tuberculosis respectively. High rate of anti-tubercular drug resistance was observed among the category II treatment failure TB patients. Ibrahim Med. Coll. J. 2013; 7(1: 9-11

Drug-resistant tuberculosis in Sindh

International Nuclear Information System (INIS)

Almani, S.A.; Memon, N.M.; Qureshi, A.F.

2002-01-01

Objective: To assess the prevalence of primary and secondary drug resistance amongst the clinical isolates of M.tuberculosis, to identify risk factors and how to overcome this problem. Design: A case series of 50 indoor patients with sputum smear-positive pulmonary tuberculosis. Place and duration of Study: Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, Sindh, (Pakistan) from January 1999 to December 2000. Patients and methods: Four first line anti-tuberculous drugs rifampicine, ethambutol and streptomycin were tested for sensitivity pattern. Results: Twelve (26.66%) were sensitive to all four drugs, 12(26.66%) were resistant to one drug, 14 (31.11%) were resistant to two drugs, 2 (4.44%) were resistant to three drugs, and 5(11.11%) were resistant to all four drugs. Resistance to isoniazid was the most common in 27 cases (60%) with primary resistance in 6(13.33%) and secondary resistance in 21(46.66%), followed by resistance to streptomycin in 17 cases (37.77%) with primary resistance in 5(11.11%) and secondary resistance in 12 (26.66%). Resistance to ethambutol in 10 cases (22.22%) and rifampicine in 11 (24.44%) and all cases were secondary. Similarly multi-drugs resistance (MRD) TB was found in 11(24.44%) isolates. Conclusion: This study showed high prevalence of drug resistance among clinical isolates of M. tuberculosis. Their is a need to establish centers at number of places with adequate facilities for susceptibility testing so that the resistant pattern could be ascertained and treatment regimens tailored accordingly. (author)

Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis: An Individual Patient Data Metaanalysis.

Science.gov (United States)

Fox, Gregory J; Mitnick, Carole D; Benedetti, Andrea; Chan, Edward D; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S; Menzies, Dick; Ahuja, S; Ashkin, D; Avendaño, M; Banerjee, R; Bauer, M; Burgos, M; Centis, R; Cobelens, F; Cox, H; D'Ambrosio, L; de Lange, W C M; DeRiemer, K; Enarson, D; Falzon, D; Flanagan, K; Flood, J; Gandhi, N; Garcia-Garcia, L; Granich, R M; Hollm-Delgado, M G; Holtz, T H; Hopewell, P; Iseman, M; Jarlsberg, L G; Kim, H R; Lancaster, J; Lange, C; Leimane, V; Leung, C C; Li, J; Menzies, D; Migliori, G B; Narita, M; Nathanson, E; Odendaal, R; O'Riordan, P; Pai, M; Palmero, D; Park, S K; Pena, J; Pérez-Guzmán, C; Ponce-de-Leon, A; Quelapio, M I D; Quy, H T; Riekstina, V; Royce, S; Salim, M; Schaaf, H S; Seung, K J; Shah, L; Shean, K; Sifuentes-Osornio, J; Sotgiu, G; Strand, M J; Sung, S W; Tabarsi, P; Tupasi, T E; Vargas, M H; van Altena, R; van der Walt, M; van der Werf, T S; Westenhouse, J; Yew, W W

2016-04-01

Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual patient data metaanalysis to evaluate the effectiveness of surgery as adjunctive therapy for MDR-tuberculosis. Individual patient data, was obtained from the authors of 26 cohort studies, identified from 3 systematic reviews of MDR-tuberculosis treatment. Data included the clinical characteristics and medical and surgical therapy of each patient. Primary analyses compared treatment success (cure and completion) to a combined outcome of failure, relapse, or death. The effects of all forms of resection surgery, pneumonectomy, and partial lung resection were evaluated. A total of 4238 patients from 18 surgical studies and 2193 patients from 8 nonsurgical studies were included. Pulmonary resection surgery was performed on 478 patients. Partial lung resection surgery was associated with improved treatment success (adjusted odds ratio [aOR], 3.0; 95% confidence interval [CI], 1.5-5.9; I(2)R, 11.8%), but pneumonectomy was not (aOR, 1.1; 95% CI, .6-2.3; I(2)R, 13.2%). Treatment success was more likely when surgery was performed after culture conversion than before conversion (aOR, 2.6; 95% CI, 0.9-7.1; I(2)R, 0.2%). Partial lung resection, but not pneumonectomy, was associated with improved treatment success among patients with MDR-tuberculosis. Although improved outcomes may reflect patient selection, partial lung resection surgery after culture conversion may improve treatment outcomes in patients who receive optimal medical therapy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Diabetes is Associated with Severe Adverse Events in Multidrug-Resistant Tuberculosis.

Science.gov (United States)

Muñoz-Torrico, Marcela; Caminero-Luna, José; Migliori, Giovanni Battista; D'Ambrosio, Lia; Carrillo-Alduenda, José Luis; Villareal-Velarde, Héctor; Torres-Cruz, Alfredo; Flores-Vergara, Héctor; Martínez-Mendoza, Dina; García-Sancho, Cecilia; Centis, Rosella; Salazar-Lezama, Miguel Ángel; Pérez-Padilla, Rogelio

2017-05-01

Diabetes mellitus (DM), a very common disease in Mexico, is a well-known risk factor for tuberculosis (TB). However, it is not known by which extent DM predisposes to adverse events (AE) to anti-TB drugs and/or to worse outcomes in patients with multidrug-resistant (MDR-TB) and extensively drug-resistant TB (XDR-TB). The main objective of this study was to describe the outcomes of TB treatment, the impact of DM and the prevalence of AE in a cohort of patients with MDR-/XDR pulmonary TB treated at the national TB referral centre in Mexico City. Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%), 11 with pre-XDR-TB (12.2%) and 6 (6.7%) with XDR-TB, including 49 (54.4%) with DM, and 3 with Human Immunodeficiency Virus (HIV) co-infection (3.3%). In 98% of patients, diagnosis was made by culture and drug susceptibility testing, while in a single case the diagnosis was made by a molecular test. The presence of DM was associated with an increased risk of serious drug-related AEs, such as nephrotoxicity (Odds Ratio [OR]=6.5; 95% Confidence Interval [95% CI]: 1.9-21.8) and hypothyroidism (OR=8.8; 95% CI: 1.8-54.2), but not for a worse outcome. Our data suggest that DM does not impact second-line TB treatment outcomes, but patients with DM have a higher risk of developing serious AEs to drug-resistant TB treatment, such as nephrotoxicity and hypothyroidism. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India

Directory of Open Access Journals (Sweden)

Fahmiya Leena Yacoob

2016-01-01

Full Text Available In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days as compared to solid and liquid cultures (35.6 days and 13.5 days, resp..

Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India.

Science.gov (United States)

Yacoob, Fahmiya Leena; Philomina Jose, Beena; Karunakaran Lelitha, Sarada Devi; Sreenivasan, Sreelatha

2016-01-01

In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days) as compared to solid and liquid cultures (35.6 days and 13.5 days, resp.).

Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

Directory of Open Access Journals (Sweden)

Rashid Ramazanzadeh

2015-01-01

Full Text Available Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012 that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10. Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20% with negative MDR-TB and in China in 2010 (0.8%, respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%.0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family.

Improved Survival and Cure Rates With Concurrent Treatment for Multidrug-Resistant Tuberculosis-Human Immunodeficiency Virus Coinfection in South Africa.

Science.gov (United States)

Brust, James C M; Shah, N Sarita; Mlisana, Koleka; Moodley, Pravi; Allana, Salim; Campbell, Angela; Johnson, Brent A; Master, Iqbal; Mthiyane, Thuli; Lachman, Simlatha; Larkan, Lee-Megan; Ning, Yuming; Malik, Amyn; Smith, Jonathan P; Gandhi, Neel R

2018-04-03

Mortality in multidrug-resistant (MDR) tuberculosis-human immunodeficiency virus (HIV) coinfection has historically been high, but most studies predated the availability of antiretroviral therapy (ART). We prospectively compared survival and treatment outcomes in MDR tuberculosis-HIV-coinfected patients on ART to those in patients with MDR tuberculosis alone. This observational study enrolled culture-confirmed MDR tuberculosis patients with and without HIV in South Africa between 2011 and 2013. Participants received standardized MDR tuberculosis and HIV regimens and were followed monthly for treatment response, adverse events, and adherence. The primary outcome was survival. Among 206 participants, 150 were HIV infected, 131 (64%) were female, and the median age was 33 years (interquartile range [IQR], 26-41). Of the 191 participants with a final MDR tuberculosis outcome, 130 (73%) were cured or completed treatment, which did not differ by HIV status (P = .50). After 2 years, CD4 count increased a median of 140 cells/mm3 (P = .005), and 64% had an undetectable HIV viral load. HIV-infected and HIV-uninfected participants had high rates of survival (86% and 94%, respectively; P = .34). The strongest risk factor for mortality was having a CD4 count ≤100 cells/mm3 (adjusted hazards ratio, 15.6; 95% confidence interval, 4.4-55.6). Survival and treatment outcomes among MDR tuberculosis-HIV individuals receiving concurrent ART approached those of HIV-uninfected patients. The greatest risk of death was among HIV-infected individuals with CD4 counts ≤100 cells/mm3. These findings provide critical evidence to support concurrent treatment of MDR tuberculosis and HIV.

Mycobacterial diversity causing multi- and extensively drug-resistant tuberculosis in Djibouti, Horn of Africa.

Science.gov (United States)

Millán-Lou, M I; Ollé-Goig, J E; Tortola, M T; Martin, C; Samper, S

2016-02-01

On detecting a high prevalence of multidrug-resistant tuberculosis (TB) in Djibouti, 32 Mycobacterium tuberculosis isolates of patients hospitalised in the TB referral centre of the capital were genotyped. A high variety of M. tuberculosis lineages, including lineage 1, Indo-Oceanic, lineage 2, East-Asian, lineage 3, East-African Indian and lineage 4, Euro-American, were detected.

Surgical face masks worn by patients with multidrug-resistant tuberculosis: impact on infectivity of air on a hospital ward.

Science.gov (United States)

Dharmadhikari, Ashwin S; Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A; van der Walt, Martie; Nardell, Edward A

2012-05-15

Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68-85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31-51%), representing a 56% (95% CI, 33-70.5%) decreased risk of TB transmission when patients used masks. Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients.

Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis

Directory of Open Access Journals (Sweden)

Anthony L. Byrne

2017-07-01

Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.

SURGERY FOR DRUG-RESISTANT DESTRUCTIVE PULMONARY TUBERCULOSIS

Directory of Open Access Journals (Sweden)

S. N. Skornyakov

2015-01-01

Full Text Available The paper presents the experience in surgically treating 145 patients with destructive, mainly fibrocavernous pulmonary tuberculosis. All the patients completed treatment. In the preoperative preparation, particular emphasis is laid on the promptest determination of a spectrum of pathogen susceptibility/resistance, individualized chemotherapy, and collapse therapy options. Postoperative complications occurred in 27 (18.6% patients, fatal outcomes in 4 (2.7%. The former were recorded most frequently after pneumonectomy in 13 (37.1% cases, the later were seen in 3 (8.6%. Sputum culture conversion was generally achieved in 111 (78% patients, particularly in 97 (78.2% patients with multidrug-resistant tuberculosis and in 14 (66.7% with a broad drug resistance in the pathogen. Out of the 64 patients followed up for more than 3 years, 48 (75.0% were in clinical and bacteriological remission.

Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

Directory of Open Access Journals (Sweden)

Tafsina Haque Aurin

Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

Surgical aspects of pulmonary tuberculosis: an update.

Science.gov (United States)

Dewan, Ravindra Kumar; Pezzella, A Thomas

2016-10-01

Tuberculosis remains a major global medical challenge and concern. In the world's population of over 7.4 billion people, 8.6 million are estimated to be infected with Mycobacterium tuberculosis; another 2.2 billion have latent tuberculosis. There is an annual incidence of 16,000 new cases in the USA and 7-8 million new cases worldwide, of which 440,000 are multidrug-resistant or extensively multidrug-resistant, mainly in developing countries or emerging economies. According to the World Health Organization, the incidence of tuberculosis is 133 cases per 100,000 of the population; 3.3% new cases are drug resistant and 20% are already treated cases. Of the drug-resistant cases, 9.7% are extensively drug-resistant. The annual global mortality attributable to tuberculosis is over 1.3 million people. The association with HIV/AIDS in 430,000 people has compounded the global concern and challenge. This review presents the historical indications for surgical treatment of tuberculosis, reviews the current literature and clinical experience, and collates this into increased awareness and contemporary understanding of the indications and need for surgery in primary active tuberculosis, adjuvant surgical therapy for multidrug-resistant tuberculosis, and the complications of chronic tuberculosis sequelae or previous tuberculosis surgery. © The Author(s) 2016.

Whole genome sequencing reveals complex evolution patterns of multidrug-resistant Mycobacterium tuberculosis Beijing strains in patients.

Directory of Open Access Journals (Sweden)

Matthias Merker

Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and

Responding to the multidrug-resistant tuberculosis crisis: mainstreaming programmatic management to the Philippine National Tuberculosis Programme.

Science.gov (United States)

Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E

2010-06-01

The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.

Converging risk factors but no association between HIV infection and multidrug-resistant tuberculosis in Kazakhstan.

Science.gov (United States)

van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S

2013-04-01

Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.

Drug resistance patterns in pulmonary tuberculosis

International Nuclear Information System (INIS)

Khoharo, H.K.; Shaikh, I.A.

2011-01-01

Objective: To determine the resistance patterns of mycobacterium tuberculosis (MTB) isolates among category I and II patients of pulmonary tuberculosis. Methods: This cross sectional study was conducted at the Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, from November 2008 to September 2009. Patients were divided into category I and II. The sputa were collected, stained with Ziehl-Nielsen (Z-N) staining and ultimately inoculated on Lowenstein-Jensen (L-J) media for six weeks. Out of 890 pulmonary tuberculosis (PTB) patients, the growth was obtained in 285 cases. The Drug sensitivity testing (DST) for Isoniazid (INH), Rifampicin (RIF), Ethambutol (EMB) Pyrazinamide (PZA) and Streptomycin (SM) were performed. The data was analyzed on SPSS 10.0. A p-value of <0.05 was taken as significant. Result: Out of 285 cases, 176 (61.75%) were male and 109 (38.24%) female. The mean age was 37 +- 19.90 years. The DST showed drug sensitive and drug resistant isolates in 80 (28.05%) and 205 (71.92%) cases respectively (p=0.001). The drug resistant tuberculosis (DR-TB) rates for individual drugs; INH, RIF, EMB, PZA and SM were 51,22%, 15.4%, 13.33%, 9%12, and 3.85% respectively (p=0.03). The MDR-TB isolates were detected in 120 (42.10%) cases, including 5 (5.88%) in category I and 115 (57.50%) in category II patients (p=0.0001). Conclusion: Drug resistant and multidrug resistant tuberculosis was observed mainly in category II patients. However, primary MDR was also observed in category I patients and reflects dissemination of MDR cases within the community. (author)

Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

Directory of Open Access Journals (Sweden)

Stellah G Mpagama

Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana

NARCIS (Netherlands)

Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

2016-01-01

OBJECTIVE/BACKGROUND: Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays

Phenothiazines as a solution for multidrug resistant tuberculosis

DEFF Research Database (Denmark)

Kristiansen, Jette E; Dastidar, Sujata G; Palchoudhuri, Shauroseni

2015-01-01

Historically, multiplicity of actions in synthetic compounds is a rule rather than exception. The science of non-antibiotics evolved in this background. From the antimalarial and antitrypanosomial dye methylene blue, chemically similar compounds, the phenothiazines, were developed. The phenothiaz...... thioridazine and its (-) form to be combined with other antitubercular drugs to treat infections by drug-resistant strains of Mycobacterium tuberculosis and try to eradicate this deadly disease. [Int Microbiol 2015; 18(1):1-12]....

A Prospective Study of Tuberculosis Drug Susceptibility in Sabah, Malaysia, and an Algorithm for Management of Isoniazid Resistance

Science.gov (United States)

Rashid Ali, Muhammad Redzwan S.; Parameswaran, Uma; William, Timothy; Bird, Elspeth; Wilkes, Christopher S.; Lee, Wai Khew; Yeo, Tsin Wen; Anstey, Nicholas M.; Ralph, Anna P.

2015-01-01

Introduction. The burden of tuberculosis is high in eastern Malaysia, and rates of Mycobacterium tuberculosis drug resistance are poorly defined. Our objectives were to determine M. tuberculosis susceptibility and document management after receipt of susceptibility results. Methods. Prospective study of adult outpatients with smear-positive pulmonary tuberculosis (PTB) in Sabah, Malaysia. Additionally, hospital clinicians accessed the reference laboratory for clinical purposes during the study. Results. 176 outpatients were enrolled; 173 provided sputum samples. Mycobacterial culture yielded M. tuberculosis in 159 (91.9%) and nontuberculous Mycobacterium (NTM) in three (1.7%). Among outpatients there were no instances of multidrug resistant M. tuberculosis (MDR-TB). Seven people (4.5%) had isoniazid resistance (INH-R); all were switched to an appropriate second-line regimen for varying durations (4.5–9 months). Median delay to commencement of the second-line regimen was 13 weeks. Among 15 inpatients with suspected TB, 2 had multidrug resistant TB (one extensively drug resistant), 2 had INH-R, and 4 had NTM. Conclusions. Current community rates of MDR-TB in Sabah are low. However, INH-resistance poses challenges, and NTM is an important differential diagnosis in this setting, where smear microscopy is the usual diagnostic modality. To address INH-R management issues in our setting, we propose an algorithm for the treatment of isoniazid-resistant PTB. PMID:25838829

Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

International Nuclear Information System (INIS)

Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam

2013-01-01

Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

Energy Technology Data Exchange (ETDEWEB)

Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam, E-mail: bestlala@yahoo.com [Chronic Respiratory Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of)

2013-03-15

Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

[Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

Science.gov (United States)

Zhang, Lei-lei; Jin, Hua

2015-12-01

Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

Multidrug-Resistant Candida

DEFF Research Database (Denmark)

Arendrup, Maiken Cavling; Patterson, Thomas F

2017-01-01

Invasive Candida infections remain an important cause of morbidity and mortality, especially in hospitalized and immunocompromised or critically ill patients. A limited number of antifungal agents from only a few drug classes are available to treat patients with these serious infections. Resistance...... can be either intrinsic or acquired. Resistance mechanisms are not exchanged between Candida; thus, acquired resistance either emerges in response to an antifungal selection pressure in the individual patient or, more rarely, occur due to horizontal transmission of resistant strains between patients....... Although multidrug resistance is uncommon, increasing reports of multidrug resistance to the azoles, echinocandins, and polyenes have occurred in several Candida species, most notably Candida glabrata and more recently Candida auris. Drivers are overall antifungal use, subtherapeutic drug levels at sites...

MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis

Science.gov (United States)

REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG

2015-01-01

Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150

Characterization of extensively drug-resistant Mycobacterium tuberculosis in Nepal.

Science.gov (United States)

Poudel, Ajay; Maharjan, Bhagwan; Nakajima, Chie; Fukushima, Yukari; Pandey, Basu D; Beneke, Antje; Suzuki, Yasuhiko

2013-01-01

The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global control of TB. Although molecular characterization of drug resistance-associated mutations in multidrug-resistant isolates in Nepal has been made, mutations in XDR isolates and their genotypes have not been reported previously. In this study, we identified and characterized 13 XDR Mycobacterium tuberculosis isolates from clinical isolates in Nepal. The most prevalent mutations involved in rifampicin, isoniazid, ofloxacin, and kanamycin/capreomycin resistance were Ser531Leu in rpoB gene (92.3%), Ser315Thr in katG gene (92.3%), Asp94Gly in gyrA gene (53.9%) and A1400G in rrs gene (61.5%), respectively. Spoligotyping and multilocus sequence typing revealed that 69% belonged to Beijing family, especially modern types. Further typing with 26-loci variable number of tandem repeats suggested the current spread of XDR M. tuberculosis. Our result highlights the need to reinforce the TB policy in Nepal with regard to control and detection strategies. Copyright © 2012 Elsevier Ltd. All rights reserved.

Possible impact of the standardized Category IV regimen on multidrug-resistant tuberculosis patients in Mumbai.

Science.gov (United States)

Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S

2016-01-01

Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.

Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

Science.gov (United States)

Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

2015-03-01

To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

Knowledge and Attitude about Multidrug-Resistant Tuberculosis among Healthcare Workers in Public Health Centres

Directory of Open Access Journals (Sweden)

Bony Wiem Lestari

2016-12-01

Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.

Drug-resistant spinal tuberculosis

Directory of Open Access Journals (Sweden)

Anil K Jain

2018-01-01

Full Text Available Drug-resistant spinal tuberculosis (TB is an emerging health problem in both developing and developed countries. In this review article, we aim to define management protocols for suspicion, diagnosis, and treatment of such patients. Spinal TB is a deep-seated paucibacillary lesion, and the demonstration of acid-fast bacilli on Ziehl-Neelsen staining is possible only in 10%–30% of cases. Drug resistance is suspected in patients showing the failure of clinicoradiological improvement or appearance of a fresh lesion of osteoarticular TB while on anti tubercular therapy (ATT for a minimum period of 5 months. The conventional culture of Mycobacterium tuberculosis remains the gold standard for both bacteriological diagnosis and drug sensitivity testing (DST; however, the high turn around time of 2–6 weeks for detection with added 3 weeks for DST is a major limitation. To overcome this problem, rapid culture methods and molecular methods have been introduced. From a public health perspective, reducing the period between diagnosis and treatment initiation has direct benefits for both the patient and the community. For all patients of drug-resistant spinal TB, a complete Drug-O-Gram should be prepared which includes details of all drugs, their doses, and duration. Patients with confirmed multidrug-resistant TB strains should receive a regimen with at least five effective drugs, including pyrazinamide and one injectable. Patients with resistance to additional antitubercular drugs should receive individualized ATT as per their DST results.

Pharmacokinetics and Dosing of Levofloxacin in Children Treated for Active or Latent Multidrug-resistant Tuberculosis, Federated States of Micronesia and Republic of the Marshall Islands.

Science.gov (United States)

Mase, Sundari R; Jereb, John A; Gonzalez, Daniel; Martin, Fatma; Daley, Charles L; Fred, Dorina; Loeffler, Ann M; Menon, Lakshmy R; Bamrah Morris, Sapna; Brostrom, Richard; Chorba, Terence; Peloquin, Charles A

2016-04-01

In the Federated States of Micronesia and then the Republic of the Marshall Islands (RMI), levofloxacin pharmacokinetics were studied in children receiving directly observed once-daily regimens (10 mg/kg, age >5 years; 15-20 mg/kg, age ≤5 years) for either multidrug-resistant tuberculosis disease or latent infection after multidrug-resistant tuberculosis exposure, to inform future dosing strategies. Blood samples were collected at 0 (RMI only), 1, 2 and 6 hours (50 children, aged 6 months to 15 years) after oral levofloxacin at >6 weeks of treatment. Clinical characteristics and maximal drug concentration (Cmax) of levofloxacin, elimination half-life and area under the curve from 0 to 24 hours (AUC0-24 hours × μg/mL) were correlated to determine the optimal dosage and to examine associations. Population pharmacokinetics and target attainment were modeled. With results from the Federated States of Micronesia, dosages were increased in RMI toward the target Cmax for Mycobacterium tuberculosis, 8-12 µg/mL. Cmax correlated linearly with per-weight dosage. Neither Cmax nor half-life was associated with gender, age, body mass index, concurrent medications or predose meals. At levofloxacin dosage of 15-20 mg/kg, Cmax ≥8 µg/mL was observed, and modeling corroborated a high target attainment across the ratio of the area under the free concentration versus time curve to minimum inhibitory concentration (fAUCss,0-24/MIC) values. Levofloxacin dosage should be 15-20 mg/kg for Cmax ≥8 µg/mL and a high target attainment across fAUCss,0-24/MIC values in children ≥2 years of age.

Primary drug resistance in a region with high burden of tuberculosis. A critical problem.

Science.gov (United States)

Villa-Rosas, Cecilia; Laniado-Laborín, Rafael; Oceguera-Palao, Lorena

2015-01-01

To determine rates of drug resistance in new cases of pulmonary tuberculosis in a region with a high burden of the disease. New case suspects were referred for drug susceptibility testing. 28.9% of new cases were resistant to at least one first line drug; 3.9% had a multidrug-resistant strain, 15.6% a monoresistant strain and 9.4% a polyresistant strain. Our rate of drug resistant tuberculosis in new cases is very high; this has important clinical implications, since even monoresistance can have a negative impact on the outcome of new cases treated empirically with a six month regimen.

Resistant plasmid profile analysis of multidrug resistant Escherichia ...

African Journals Online (AJOL)

Background: Multi-drug resistant Escherichia coli has become a major threat and cause of many urinary tract infections (UTIs) in Abeokuta, Nigeria. Objectives: This study was carried out to determine the resistant plasmids of multidrug resistant Escherichia coli isolated from (Urinary tract infections)UTIs in Abeokuta.

Integration of HIV testing in tuberculosis drug resistance surveillance in Kazakhstan and Kenya

NARCIS (Netherlands)

Klinkenberg, E.; van den Hof, S.; Tursynbayeva, A.; Kipruto, H.; Wahogo, J.; Pak, S.; Kutwa, A.; L'Herminez, R.

2012-01-01

In Kenya and Kazakhstan, integration of human immunodeficiency virus (HIV) testing results into the routine surveillance of multidrug-resistant tuberculosis (MDR-TB) proved feasible and useful. The integration process improved overall data quality and data validation capacity, and integrated data

A PROSPECTIVE, OBSERVATIONAL STUDY OF ADVERSE REACTIONS TO DRUG REGIME FOR MULTI-DRUG RESISTANT PULMONARY TUBERCULOSIS IN CENTRAL INDIA.

Directory of Open Access Journals (Sweden)

Dr. Rohan C. Hire

2014-09-01

Full Text Available Abstract Objective: 1 To assess the adverse drug reactions of second line anti-tubercular drugs used to treat Multi-drug resistant Tuberculosis (MDR TB in central India on the basis of causality, severity and avoidability scales. 2 To study the relationship of type of MDR TB (primary or secondary and presence of diabetes mellitus (DM with mean smear conversion time. Material and Methods: A prospective, observational study was carried out on diagnosed multidrug resistant tuberculosis patients enrolled for DOTS‑Plus regimen at TB and Chest Disease Department from January to December 2012. They were followed for 9 months thereafter and encountered adverse drug reactions (ADRs were noted along with the time of sputum conversion. The data were analysed by Chi-square or Fisher’s exact test and unpaired student’s‘t’ test. Results: Total 64 ADRs were reported in 55 patients out of total 110 patients (n = 110. As per the Naranjo causality assessment of ADRs, 7 patients had “definite” causal relation, 45 had “probable” causal relation and 3 had “possible” causal relation with drugs of DOTS Plus regime. As per the Hartwig’s severity assessment scale, there were total 7 ADRs in Level 1, 6 in Level 2, 33 in Level 3 and 9 in Level 4. Hallas avoidability assessment scale divided the ADRs as 3 being “Definitely avoidable”, 26 “Possibly avoidable”, 23 “Not avoidable” and 3 “unevaluable”. . Mean sputum smear conversion time is significantly higher in patients with secondary type than that of primary type of MDR TB (p = 0.0001 and in patients with DM than those without DM (p <0.0001. Conclusion: ADRs were common in patients of MDR TB on DOTs-Plus drug regime. It was due to lack of availability of safer and equally potent drugs in DOTs-Plus drug regime compared to DOTS regime in non-resistant TB. The frequency and severity of ADRs can be reduced by strict vigilance about known and unknown ADRs, monitoring their laboratory and

Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

KAUST Repository

Dalla Costa, Elis R.; Vasconcelos, Sidra E. G.; Esteves, Leonardo S.; Gomes, Harrison M.; Gomes, Lia L.; Almeida da Silva, Pedro; Perdigã o, Joã o; Portugal, Isabel; Viveiros, Miguel; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Rastogi, Nalin; Unis, Gisela; Rossetti, Maria Lucia R.; Suffys, Philip Noel

2015-01-01

We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

KAUST Repository

Dalla Costa, Elis R.

2015-09-23

We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

Natural infection of guinea pigs exposed to patients with highly drug-resistant tuberculosis

Science.gov (United States)

Dharmadhikari, Ashwin S.; Basaraba, Randall J.; Van Der Walt, Martie L.; Weyer, Karin; Mphahlele, Matsie; Venter, Kobus; Jensen, Paul A.; First, Melvin W.; Parsons, Sydney; McMurray, David N.; Orme, Ian M.; Nardell, Edward A.

2012-01-01

A natural TB infection model using guinea pigs may provide useful information for investigating differences in transmission efficiency and establishment of active disease by clinical TB strains in a highly susceptible host under controlled environmental conditions. We sought to examine the capacity of naturally transmitted multidrug-resistant M. tuberculosis to establish infection and produce active disease in guinea pigs. Guinea pigs were continuously exposed for 4 months to the exhaust air of a 6-bed multidrug-resistant tuberculosis inpatient hospital ward in South Africa. Serial tuberculin skin test reactions were measured to determine infection. All animals were subsequently evaluated for histologic disease progression at necropsy. Although 75% of the 362 exposed guinea pigs had positive skin test reactions [≥6mm], only 12% had histopathologic evidence of active disease. Reversions (≥ 6 mm change) in skin test reactivity were seen in 22% of animals, exclusively among those with reactions of 6 to 13 mm. Only two of 86 guinea pigs with reversion had histological evidence of disease compared to 47% (31/66) of guinea pigs with large, non-reverting reactions. Immunosuppression of half the guinea pigs across all skin test categories did not significantly accelerate disease progression. In guinea pigs that reverted a skin test, a second positive reaction in 27 (33%) of them strongly suggested re-infection due to ongoing exposure. These results show that a large majority of guinea pigs naturally exposed to human-source strains of multidrug-resistant tuberculosis became infected, but that many resolved their infection and a large majority failed to progress to detectable disease. PMID:21478054

Primary drug resistance in a region with high burden of tuberculosis. A critical problem

Directory of Open Access Journals (Sweden)

Cecilia Villa-Rosas

2015-03-01

Full Text Available Objective. To determine rates of drug resistance in new cases of pulmonary tuberculosis in a region with a high burden of the disease. Materials and methods. New case suspects were referred for drug susceptibility testing. Results. 28.9% of new cases were resistant to at least one first line drug; 3.9% had a multidrug-resistant strain, 15.6% a monoresistant strain and 9.4% a polyresistant strain. Conclusion. Our rate of drug resistant tuberculosis in new cases is very high; this has important clinical implications, since even monoresistance can have a negative impact on the outcome of new cases treated empirically with a six month regimen.

Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

Science.gov (United States)

Agyeman, Akosua Adom; Ofori-Asenso, Richard

2016-06-22

Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

First insights into circulating Mycobacterium tuberculosis complex lineages and drug resistance in Guinea

Science.gov (United States)

Ejo, Mebrat; Gehre, Florian; Barry, Mamadou Dian; Sow, Oumou; Bah, Nene Mamata; Camara, Mory; Bah, Boubacar; Uwizeye, Cecile; Nduwamahoro, Elie; Fissette, Kristina; Rijk, Pim De; Merle, Corinne; Olliaro, Piero; Burgos, Marcos; Lienhardt, Christian; Rigouts, Leen; de Jong, Bouke C.

2015-01-01

In this study we assessed first-line anti-tuberculosis drug resistance and the genotypic distribution of Mycobacterium tuberculosis complex (MTBC) isolates that had been collected from consecutive new tuberculosis patients enrolled in two clinical trials conducted in Guinea between 2005 and 2010. Among the total 359 MTBC strains that were analyzed in this study, 22.8% were resistant to at least one of the first line anti-tuberculosis drugs, including 2.5% multidrug resistance and 17.5% isoniazid resistance, with or without other drugs. In addition, further characterization of isolates from a subset of the two trials (n = 184) revealed a total of 80 different spoligotype patterns, 29 “orphan” and 51 shared patterns. We identified the six major MTBC lineages of human relevance, with predominance of the Euro-American lineage. In total, 132 (71.7%) of the strains were genotypically clustered, and further analysis (using the DESTUS model) suggesting significantly faster spread of LAM10_CAM family (p = 0.00016). In conclusion, our findings provide a first insight into drug resistance and the population structure of the MTBC in Guinea, with relevance for public health scientists in tuberculosis control programs. PMID:26004194

Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

Directory of Open Access Journals (Sweden)

Irwan Supriyanto

2017-08-01

Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

Treatment of extensively drug-resistant tuberculosis and role of the pharmacist.

Science.gov (United States)

Mitrzyk, Beatriz Manzor

2008-10-01

Abstract Outbreaks of extensively drug-resistant tuberculosis (XDR-TB) in developing countries and recent headlines of an American traveling with a resistant variant of tuberculosis have brought XDR-TB into the spotlight. The World Health Organization and the United States Centers for Disease Control and Prevention have identified XDR-TB as a serious public health threat and are mandating increased efforts at control of tuberculosis. Although XDR-TB is believed to be no more infectious than other variants of tuberculosis, infection with and spread of XDR-TB are concerning because of the ineffectiveness, toxicity, and cost of the available tuberculosis treatment options. Pharmacists may not be aware of the recent trends in tuberculosis resistance or of the impact that they can have on educating the public about this disease. To gain a better understanding of this disease and the potential roles for pharmacists in public health awareness of tuberculosis and in the care of patients with and at risk for this disease, we undertook an extensive search of the Internet, including Web sites of tuberculosis advocacy groups, and of MEDLINE from January 1968-March 2008. Currently, XDR-TB infection is uncommon in the United States, but if history is any indication, there is a high potential for an outbreak or epidemic. The XDR-TB variant has emerged from mismanaging multidrug-resistant tuberculosis, treating tuberculosis with too few drugs, using less effective second-line drugs, and not educating patients about the dangers of nonadherence. With only limited hopes of a novel effective drug combination regimen, use of available antimycobacterial drugs needs to be optimized. Pharmacists can be key players in the prevention and treatment of tuberculosis by promoting adherence, assessing patients for risk factors for resistant disease, providing information about disease control and prevention, and monitoring for effectiveness, adverse effects, and drug interactions.

Association between Multidrug-Resistant Tuberculosis and Risk Factors in China: Applying Partial Least Squares Path Modeling.

Directory of Open Access Journals (Sweden)

Yun-Xia Liu

Full Text Available Multidrug-resistant tuberculosis (MDR-TB resulting from various factors has raised serious public health concerns worldwide. Identifying the ecological risk factors associated with MDR-TB is critical to its prevention and control. This study aimed to explore the association between the development of MDR-TB and the risk factors at the group-level (ecological risk factors in China.Data on MDR-TB in 120 counties were obtained from the National Tuberculosis Information Management System, and data on risk-factor variables were extracted from the Health Statistical Yearbook, provincial databases, and the meteorological bureau of each province (municipality. Partial Least Square Path Modeling was used to detect the associations.The median proportion of MDR-TB in new TB cases was 3.96% (range, 0-39.39%. Six latent factors were extracted from the ecological risk factors, which explained 27.60% of the total variance overall in the prevalence of MDR-TB. Based on the results of PLS-PM, TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors were all associated with the risk of MDR-TB, but socioeconomic factors were not significant.The development of MDR-TB was influenced by TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors. Such information may help us to establish appropriate public health intervention strategies to prevent and control MDR-TB and yield benefits to the entire public health system in China.

Variation and risk factors of drug resistant tuberculosis in sub-Saharan Africa: a systematic review and meta-analysis

NARCIS (Netherlands)

Lukoye, Deus; Ssengooba, Willy; Musisi, Kenneth; Kasule, George W.; Cobelens, Frank G. J.; Joloba, Moses; Gomez, Gabriela B.

2015-01-01

Prevalence of multidrug resistant tuberculosis (MDR-TB), defined as in vitro resistance to both rifampicin and isoniazid with or without resistance to other TB drugs, in sub-Saharan Africa (SSA) is reportedly low compared to other regions. These estimates are based on data reported to the World

Managing a case of extensively drug-resistant (XDR) pulmonary tuberculosis in Singapore.

Science.gov (United States)

Phua, Chee Kiang; Chee, Cynthia B E; Chua, Angeline P G; Gan, Suay Hong; Ahmed, Aneez D B; Wang, Yee Tang

2011-03-01

Extensively drug-resistant tuberculosis (XDR-TB) is an emerging global health risk. We present the first case report of XDR-TB in Singapore. A 41-year-old Indonesian lady with previously treated pulmonary tuberculosis presented with chronic cough. Her sputum was strongly acid-fast bacilli positive and grew Mycobacterium tuberculosis complex resistant to first and second-line TB medications. She received 5 months of intensive multidrug treatment without sputum smear conversion. She then underwent resection of the diseased lung. The total cost incurred amounted to over S$100,000. She achieved sputum smear/culture conversion post-surgery, but will require further medical therapy for at least 18 months. XDRTB is poorly responsive to therapy and extremely expensive to manage. Its prevention by strict compliance to therapy is paramount.

Multidrug-resistant tuberculosis treatment failure detection depends on monitoring interval and microbiological method

Science.gov (United States)

White, Richard A.; Lu, Chunling; Rodriguez, Carly A.; Bayona, Jaime; Becerra, Mercedes C.; Burgos, Marcos; Centis, Rosella; Cohen, Theodore; Cox, Helen; D'Ambrosio, Lia; Danilovitz, Manfred; Falzon, Dennis; Gelmanova, Irina Y.; Gler, Maria T.; Grinsdale, Jennifer A.; Holtz, Timothy H.; Keshavjee, Salmaan; Leimane, Vaira; Menzies, Dick; Milstein, Meredith B.; Mishustin, Sergey P.; Pagano, Marcello; Quelapio, Maria I.; Shean, Karen; Shin, Sonya S.; Tolman, Arielle W.; van der Walt, Martha L.; Van Deun, Armand; Viiklepp, Piret

2016-01-01

Debate persists about monitoring method (culture or smear) and interval (monthly or less frequently) during treatment for multidrug-resistant tuberculosis (MDR-TB). We analysed existing data and estimated the effect of monitoring strategies on timing of failure detection. We identified studies reporting microbiological response to MDR-TB treatment and solicited individual patient data from authors. Frailty survival models were used to estimate pooled relative risk of failure detection in the last 12 months of treatment; hazard of failure using monthly culture was the reference. Data were obtained for 5410 patients across 12 observational studies. During the last 12 months of treatment, failure detection occurred in a median of 3 months by monthly culture; failure detection was delayed by 2, 7, and 9 months relying on bimonthly culture, monthly smear and bimonthly smear, respectively. Risk (95% CI) of failure detection delay resulting from monthly smear relative to culture is 0.38 (0.34–0.42) for all patients and 0.33 (0.25–0.42) for HIV-co-infected patients. Failure detection is delayed by reducing the sensitivity and frequency of the monitoring method. Monthly monitoring of sputum cultures from patients receiving MDR-TB treatment is recommended. Expanded laboratory capacity is needed for high-quality culture, and for smear microscopy and rapid molecular tests. PMID:27587552

Multidrug Resistance in Infants and Children

Directory of Open Access Journals (Sweden)

Gian Maria Pacifici

2018-02-01

Full Text Available Bacterial infections may cause disease and death. Infants and children are often subject to bacterial infections. Antimicrobials kill bacteria protecting the infected patients andreducing the risk of morbidity and mortality caused by bacteria. The antibiotics may lose their antibacterial activity when they become resistant to a bacteria. The resistance to different antibiotics in a bacteria is named multidrug-resistance. Gram-negative bacilli, especially Escherichia coli, Klebsiella, Enterobacter, Salmonella, Shigella, Pseudomonas, Streptococcus, and Haemophilus influenzae type b, may become resistant. Amikacin ampicillin, amoxicillin, amoxiclav, cefuroxime, cefotaxime, ceftazidime, cefoperazone tetracycline, chloramphenicol, ciprofloxacin, and gentamicin may cause bacterial-resistance. Resistance to bacteria for several pathogens makes complications in the treatment of infections caused by them. Salmonella strains may become resistant to ampicillin, cephalotin, ceftriaxone, gentamicin, amikacin, trimethoprim-sulfamethoxazole, chloramphenicol, and tetracycline. Shigella strains may become resistant to ampicillin, cotrimoxazole, chloramphenicol, and streptomycin. Multidrug-resistance of Streptococcus pneumoniae may be due to β-lactams, macrolides, tetracycline, chloramphenicol, and trimethoprim-sulfamethoxazole. Multidrug-resistance of Pseudomonas aeruginosa may become resistant to β-lactams, chloramphenicol, trimethoprim-sulfamethoxazole, and tetracycline. The antibacterial activity against Haemophilus strains may occur with ampicillin, sulbactam-ampicillin, trimethoprim-sulfamethoxazole, gentamicin, chloramphenicol, and ciprofloxacin. Multidrug-resistance of the Klebsiella species may be due with ampicillin, cefotaxime, cefuroxime, co-amxilav, mezlocillin, chloramphenicol, gentamicin, and ceftazidime. Multidrug-resistance of Escherichia coli may be caused by ampicillin, cotrimoxazole, chloramphenicol, ceftriaxone, and ceftazidime. Vibrio

The Prevalence of Drug-Resistant Tuberculosis in Mainland China: An Updated Systematic Review and Meta-Analysis.

Science.gov (United States)

Duan, Qionghong; Chen, Zi; Chen, Cong; Zhang, Zhengbin; Lu, Zhouqin; Yang, Yalong; Zhang, Lin

2016-01-01

In recent years, drug resistant tuberculosis (DR-TB) particularly the emergence of multi-drug-resistant tuberculosis (MDR-TB) has become a major public health issue. The most recent study regarding the prevalence of drug-resistant tuberculosis in mainland China was a meta-analysis published in 2011, and the subjects from the included studies were mostly enrolled before 2008, thus making it now obsolete. Current data on the national prevalence of DR-TB is needed. This review aims to provide a comprehensive and up-to-date assessment of the status of DR-TB epidemic in mainland China. A systematic review and meta-analysis of studies regarding the prevalence of drug-resistant tuberculosis in mainland China was performed. Pubmed/MEDLINE, EMBASE, the Cochrane central database, the Chinese Biomedical Literature Database and the China National Knowledge Infrastructure Database were searched for studies relevant to drug-resistant tuberculosis that were published between January 1, 2012 and May 18, 2015. Comprehensive Meta-Analysis (V2.2, Biostat) software was used to analyse the data. A total of fifty-nine articles, published from 2012 to 2015, were included in our review. The result of this meta-analysis demonstrated that among new cases, the rate of resistance to any drug was 20.1% (18.0%-22.3%; n/N = 7203/34314) and among retreatment cases, the rate was 49.8% (46.0%-53.6%; n/N = 4155/8291). Multi-drug resistance among new and retreatment cases was 4.8% (4.0%-5.7%; n/N = 2300/42946) and 26.3% (23.1%-29.7%; n/N = 3125/11589) respectively. The results were significantly heterogeneous (pdrug resistance patterns were found by subgroup analysis according to geographic areas, subject enrolment time, and methods of drug susceptibility test (DST). The prevalence of resistance to any drug evidently dropped for both new and retreatment cases, and multi-drug resistance declined among new cases but became more prevalent among retreatment cases compared to the data before 2008

Mutations in DNA repair genes are associated with the Haarlem lineage of Mycobacterium tuberculosis independently of their antibiotic resistance.

Science.gov (United States)

Olano, Juanita; López, Beatriz; Reyes, Alejandro; Lemos, María del Pilar; Correa, Nidia; Del Portillo, Patricia; Barrera, Lucia; Robledo, Jaime; Ritacco, Viviana; Zambrano, María Mercedes

2007-11-01

The analysis of the DNA repair genes ogt and ung was carried out in 117 Mycobacterium tuberculosis clinical isolates from Argentina and Colombia in order to explore correlation between mutations in these genes and multi-drug resistance. With the exception of two Beijing family isolates, the rest of the strains harbored either two wild-type or two mutant alleles with identical single nucleotide polymorphisms (SNPs) in each gene (ogt44 and ung501). These ogt44 and ung501 mutations were not associated with multi-drug resistance and occurred simultaneously in circulating Haarlem genotype M. tuberculosis strains. We therefore propose the use of these markers as tools in phylogenetic and epidemiologic studies.

[Immigrants treated for tuberculosis in Mazovian Center for Treatment of Lung Diseases and Tuberculosis in Otwock].

Science.gov (United States)

Jagodziński, Jacek; Zielonka, Tadeusz M

2010-01-01

Migration of population contributes to the transmission of tuberculosis (TB), particularly multidrug-resistant tuberculosis. In the countries of Western Europe, the immigrants' inflow contributes to the deterioration of the epidemiological situation. Majority of newly detected TB cases in some countries were affirmed among immigrant and foreign born population. In Poland, this problem has not been investigated up to 2005. The aim of the study was the assessment of the occurrence of tuberculosis in foreigners treated in the Mazovian Centre for Treatment of Lung Diseases and Tuberculosis in Otwock. This work had a retrospective character. The number of cases of tuberculosis in foreigners admitted between 2002 and 2007 was calculated from the data base of the Mazovian Centre for Treatment of Lung Diseases and Tuberculosis; 125 patients, whose basic demographic data, bacteriological status and the radiological changes suggested TB, were included in the study. The foreigners made up to 0.5-1.7% all tuberculosis cases treated in Mazovian Centre for Treatment of Lung Diseases and Tuberculosis. Among confirmed cases, twenty four nationalities were seen. Nationals of the Russian Federation (coming from the Republic of Chechnya) formed the biggest group (24%), followed by the Vietnamese (21%) and the Ukrainians (12%). Most of all cases were young men (77%; average age - 34 years). Children made up to 12% of all cases. Tuberculosis of lungs was predominating, and there were culture confirmed extrapulmonary locations in 13.6% of cases. Bacteriological confirmation was achieved in 53% of cases, but up to 22.7% cases were resistant to one of the antituberculosis medicines and 13.6% was multidrug-resistant. Despite the fact, that foreigners made up a small proportion among all the patient treated for tuberculosis in Mazovia, their number systematically increases. High proportion of multidrug-resistant tuberculosis reported in foreign-born cases is a concern.

Performance of Four Transport and Storage Systems for Molecular Detection of Multidrug-Resistant Tuberculosis

Science.gov (United States)

Rabodoarivelo, Marie Sylvianne; Imperiale, Bélen; andrianiavomikotroka, Rina; Brandao, Angela; Kumar, Parveen; Singh, Sarman; Ferrazoli, Lucilaine; Morcillo, Nora; Rasolofo, Voahangy; Palomino, Juan Carlos; Vandamme, Peter; Martin, Anandi

2015-01-01

Background Detection of drug-resistant tuberculosis is essential for the control of the disease but it is often hampered by the limitation of transport and storage of samples from remote locations to the reference laboratory. We performed a retrospective field study to evaluate the performance of four supports enabling the transport and storage of samples to be used for molecular detection of drug resistance using the GenoType MTBDRplus. Methods Two hundred Mycobacterium tuberculosis strains were selected and spotted on slides, FTA cards, GenoCards, and in ethanol. GenoType MTBDRplus was subsequently performed with the DNA extracted from these supports. Sensitivity and specificity were calculated and compared to the results obtained by drug susceptibility testing. Results For all supports, the overall sensitivity and specificity for detection of resistance to RIF was between 95% and 100%, and for INH between 95% and 98%. Conclusion The four transport and storage supports showed a good sensitivity and specificity for the detection of resistance to RIF and INH in M. tuberculosis strains using the GenoType MTBDRplus. These supports can be maintained at room temperature and could represent an important alternative cost-effective method useful for rapid molecular detection of drug-resistant TB in low-resource settings. PMID:26431352

Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

Science.gov (United States)

Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

2013-01-01

Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

[Morphological signs of inflammatory activity in different clinical forms of drug-resistant pulmonary tuberculosis].

Science.gov (United States)

Elipashev, A A; Nikolsky, V O; Shprykov, A S

to determine whether the activity of tuberculous inflammation is associated with different clinical forms of drug-resistant pulmonary tuberculosis. The material taken from 310 patients operated on in 2010-2015 were retrospectively examined. The patients underwent economical lung resections of limited extent (typical and atypical ones of up to 3 segments) for circumscribed forms of tuberculosis with bacterial excretion. A study group consisted of 161 (51.9%) patients with drug-resistant variants of pulmonary tuberculosis. A control group included 149 (48.1%) patients with preserved susceptibility of Mycobacterium tuberculosis to anti-TB drugs. The activity of specific changes in tuberculosis was morphologically evaluated in accordance with the classification proposed by B.M. Ariel in 1998. The highest activity of fourth-to-fifth degree specific inflammation, including that outside the primary involvement focus, was obtained in the drug-resistant pulmonary tuberculosis group due to the predominance of patients with cavernous and fibrous-cavernous tuberculosis versus those in whom the susceptibility to chemotherapeutic agents was preserved. A macroscopic study showed that the primary lesion focus had a median size in one-half of the all the examinees; but large tuberculomas, caverns, and fibrous caverns over 4 cm in diameter were multiple and detected in the drug-resistant pulmonary tuberculosis group. Multidrug resistance was observed in more than 60% of the patients with fibrous-cavernous pulmonary tuberculosis, extensive drug resistance was seen in those with cavernous tuberculosis, which is an aggravating factor. The data obtained from the morphological study of the intraoperative material can specify the clinical form of tuberculosis and evaluate the efficiency of preoperative specific therapy. The highest activity of specific inflammation was observed in patients with multiple drug-resistant pulmonary tuberculosis, the prevalence of third-to-fourth degree

MIRU-VNTR typing of drug-resistant tuberculosis isolates in Greece.

Science.gov (United States)

Rovina, Nikoletta; Karabela, Simona; Constantoulakis, Pantelis; Michou, Vassiliki; Konstantinou, Konstantinos; Sgountzos, Vassileios; Roussos, Charis; Poulakis, Nikolaos

2011-08-01

The increasing immigration rate in Greece from countries with a high prevalence of Mycobacterium tuberculosis (MTB) and multidrug-resistant tuberculosis (MDR-TB) may have an impact οn the number of MDR-TB cases in Greece. The aim of this study was to genotypically characterize the MTB isolates from patients with pulmonary drug-resistant tuberculosis (DR-TB) in Greece, and to determine whether there is any association between the prevalent genotypes and drug resistance. Fifty-three drug-resistant MTB strains isolated from culture specimens of clinical material from native Greeks and immigrant patients with pulmonary tuberculosis were genotyped using the mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR) method. The phylogenetically distinct groups of isolates identified were: the Beijing (34%), the LAM (11%), the Haarlem (24.5%), the Uganda I (9.4%), the Ural (3.8%), the Delhi/CAS (9.4%) and the Cameroon (3.8%) families. Greek patients were more likely to have monoresistant and polyresistant TB with the most prevalent isolates belonging to the Haarlem family. Among foreign-born patients with MDR-TB, the most prevalent genotypes belonged to the Beijing family. MIRU-VNTR rapidly obtained clinically useful genotyping data, by characterizing clonal MTB heterogeneity in the isolated strains. Our results underline the need for more effective antituberculosis control programs in order to control the expansion of DR-TB in Greece.

Clinical and Drug Resistance Characteristics of New Pediatric Tuberculosis Cases in Northern China.

Science.gov (United States)

Wang, Ting; Dong, Fang; Li, Qin-Jing; Yin, Qing-Qin; Song, Wen-Qi; Mokrousov, Igor; Jiao, Wei-Wei; Shen, A-Dong

2018-05-09

The aim of this study was to evaluate the clinical features and characteristics of drug resistance in newly diagnosed pediatric tuberculosis (TB) patients in northern China. Mycobacterium tuberculosis isolates were collected from September 2010 to October 2016 at the Beijing Children's Hospital. Patients were divided into two groups (resistant to at least one drug and pan-susceptible) according to drug susceptibility testing (DST) results. A total of 132 new cases, mainly from northern China (87.9%), were included in the study. The median age was 1.9 years (1 month-15 years). Resistance to at least one drug was detected in Mycobacterium tuberculosis isolates from 33 (25%) cases. Eight cases of multidrug-resistant TB (MDR-TB) (6.1%) were detected. The two groups did not differ in clinical presentations (disease site, fever >2 weeks, and cough >2 weeks) or in chest imaging (lesion location, lymphadenitis [mediastinal], and pleural effusion). The rate of Mycobacterium tuberculosis drug resistance in new pediatric TB cases was as high as in the new adult patients surveyed in the national drug resistance survey conducted in 2007. No significant difference was observed in clinical features between patients infected with drug-resistant and drug-susceptible strains. Routine DST is important for prescribing effective antituberculosis treatment regimens.

High levels of multidrug resistant tuberculosis in new and treatment-failure patients from the Revised National Tuberculosis Control Programme in an urban metropolis (Mumbai in Western India

Directory of Open Access Journals (Sweden)

Nicol Mark

2009-06-01

Full Text Available Abstract Background India, China and Russia account for more than 62% of multidrug resistant tuberculosis (MDRTB globally. Within India, locations like urban metropolitan Mumbai with its burgeoning population and high incidence of TB are suspected to be a focus for MDRTB. However apart from sporadic surveys at watched sites in the country, there has been no systematic attempt by the Revised National Tuberculosis Control Programme (RNTCP of India to determine the extent of MDRTB in Mumbai that could feed into national estimates. Drug susceptibility testing (DST is not routinely performed as a part of programme policy and public health laboratory infrastructure, is limited and poorly equipped to cope with large scale testing. Methods From April 2004 to January 2007 we determined the extent of drug resistance in 724 {493 newly diagnosed, previously untreated and 231 first line treatment failures (sputum-smear positive at the fifth month after commencement of therapy} cases of pulmonary tuberculosis drawn from the RNTCP in four suboptimally performing municipal wards of Mumbai. The observations were obtained using a modified radiorespirometric Buddemeyer assay and validated by the Swedish Institute for Infectious Disease Control, Stockholm, a supranational reference laboratory. Data was analyzed utilizing SPSS 10.0 and Epi Info 2002. Results This study undertaken for the first time in RNTCP outpatients in Mumbai reveals a high proportion of MDRTB strains in both previously untreated (24% and treatment-failure cases (41%. Amongst new cases, resistance to 3 or 4 drug combinations (amplified drug resistance including isoniazid (H and rifampicin (R, was greater (20% than resistance to H and R alone (4% at any point in time during the study. The trend for monoresistance was similar in both groups remaining highest to H and lowest to R. External quality control revealed good agreement for H and R resistance (k = 0.77 and 0.76 respectively. Conclusion

High levels of multidrug resistant tuberculosis in new and treatment-failure patients from the Revised National Tuberculosis Control Programme in an urban metropolis (Mumbai) in Western India.

Science.gov (United States)

D'souza, Desiree T B; Mistry, Nerges F; Vira, Tina S; Dholakia, Yatin; Hoffner, Sven; Pasvol, Geoffrey; Nicol, Mark; Wilkinson, Robert J

2009-06-29

India, China and Russia account for more than 62% of multidrug resistant tuberculosis (MDRTB) globally. Within India, locations like urban metropolitan Mumbai with its burgeoning population and high incidence of TB are suspected to be a focus for MDRTB. However apart from sporadic surveys at watched sites in the country, there has been no systematic attempt by the Revised National Tuberculosis Control Programme (RNTCP) of India to determine the extent of MDRTB in Mumbai that could feed into national estimates. Drug susceptibility testing (DST) is not routinely performed as a part of programme policy and public health laboratory infrastructure, is limited and poorly equipped to cope with large scale testing. From April 2004 to January 2007 we determined the extent of drug resistance in 724 {493 newly diagnosed, previously untreated and 231 first line treatment failures (sputum-smear positive at the fifth month after commencement of therapy)} cases of pulmonary tuberculosis drawn from the RNTCP in four suboptimally performing municipal wards of Mumbai. The observations were obtained using a modified radiorespirometric Buddemeyer assay and validated by the Swedish Institute for Infectious Disease Control, Stockholm, a supranational reference laboratory. Data was analyzed utilizing SPSS 10.0 and Epi Info 2002. This study undertaken for the first time in RNTCP outpatients in Mumbai reveals a high proportion of MDRTB strains in both previously untreated (24%) and treatment-failure cases (41%). Amongst new cases, resistance to 3 or 4 drug combinations (amplified drug resistance) including isoniazid (H) and rifampicin (R), was greater (20%) than resistance to H and R alone (4%) at any point in time during the study. The trend for monoresistance was similar in both groups remaining highest to H and lowest to R. External quality control revealed good agreement for H and R resistance (k = 0.77 and 0.76 respectively). Levels of MDRTB are much higher in both previously

The fourth national anti-tuberculosis drug resistance survey in Viet Nam.

Science.gov (United States)

Nhung, N V; Hoa, N B; Sy, D N; Hennig, C M; Dean, A S

2015-06-01

Viet Nam's Fourth National Anti-Tuberculosis Drug Resistance Survey was conducted in 2011. To determine the prevalence of resistance to the four main first-line anti-tuberculosis drugs in Viet Nam. Eighty clusters were selected using a probability proportion to size approach. Drug susceptibility testing (DST) against the four main first-line anti-tuberculosis drugs was performed. A total of 1629 smear-positive tuberculosis (TB) patients were eligible for culture. Of these, DST results were available for 1312 patients, including 1105 new TB cases, 195 previously treated TB cases and 12 cases with an unknown treatment history. The proportion of cases with resistance to any drug was 32.7% (95%CI 29.1-36.5) among new cases and 54.2% (95%CI 44.3-63.7) among previously treated cases. The proportion of multidrug-resistant TB (MDR-TB) cases was 4.0% (95%CI 2.5-5.4) in new cases and 23.3 (95%CI 16.7-29.9) in previously treated cases. The fourth drug resistance survey in Viet Nam found that the proportion of MDR-TB among new and previously treated cases was not significantly different from that in the 2005 survey. The National TB Programme should prioritise the detection and treatment of MDR-TB to reduce transmission of MDR-TB in the community.

Tuberculosis relapse in Vietnam is significantly associated with Mycobacterium tuberculosis Beijing genotype infections

NARCIS (Netherlands)

Huyen, Mai N. T.; Buu, Tran N.; Tiemersma, Edine; Lan, Nguyen T. N.; Dung, Nguyen H.; Kremer, Kristin; Soolingen, Dick V.; Cobelens, Frank G. J.

2013-01-01

In Vietnam, the Mycobacterium tuberculosis Beijing genotype is associated with multi-drug resistance and is emerging. A possible explanation for this genotype's success is an increased rate of relapse. In a prospective cohort study, isolates from patients with smear-positive tuberculosis were

Mycobacterium tuberculosis, Beijing genotype strains not associated with radiological presentation of pulmonary tuberculosis

NARCIS (Netherlands)

Borgdorff, Martien W.; van Deutekom, Henk; de Haas, Petra E. W.; Kremer, Kristin; van Soolingen, Dick

2004-01-01

Mycobacterium tuberculosis strains of the Beijing genotype have been involved in various outbreaks of multidrug-resistant tuberculosis. Some studies suggest that the infection with the Beijing genotype is associated with a different host immune response. Since this might also lead to a different

Altered membrane permeability in multidrug resistant Escherichia ...

African Journals Online (AJOL)

PRECIOUS

2009-11-02

Nov 2, 2009 ... involvement during the transport of β - lactams in multidrug resistant Escherichia coli isolated from extra-intestinal infections. Also, the ... lactam resistance in multidrug resistant E. coli in ESBL and non-ESBL isolates. .... and decreased susceptibility to carbapenems, particularly ertapenem (Perez et al.,.

Assessment of trends of ofloxacin resistance in Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

J S Verma

2011-01-01

Full Text Available Purpose: Ofloxacin (OFX is one of the potent fluoroquinolone (FQ recommended to treat MDR-TB. Over a decade, the preexposure of this drug for the treatment of other bacterial infections has resulted in acquisition of FQ resistance among Mycobacterium tuberculosis strains. Considering this possibility, a study was undertaken in a tertiary care center in the capital city (India to assess the drug resistance trends of OFX among susceptible and multidrug resistant (MDR strains of M. tuberculosis. Materials and Methods: A total of 102 M. tuberculosis isolates (47 susceptible to first-line drugs and 55 MDR isolates were screened for susceptibility testing of OFX with a critical concentration of 2 μg/ml by Lowenstein Jensen (LJ proportion method. Results: The results showed 40 (85.1% isolates among 47 susceptible isolates and 34 (61.8% isolates among 55 MDR isolates, were found to be susceptible to OFX. Fisher′s exact test showed significant P-value (0.0136 demonstrating 1.377 fold (95% confidence interval increased risk to become resistant to OFX than susceptible isolates. These finding shows decreased OFX susceptibility is not only limited to MDR isolates but also increasingly seen in susceptible strains as a result of drug abuse. Conclusions: Our finding were not alarming, but highlights the general risk of acquiring resistance to OFX, jeopardizing the potential for these drugs to be used as second-line anti-TB agents in the management of drug-resistant TB and creating incurable TB strains .

[Resistance to first-line drugs and major genotypic lineages of Mycobacterium tuberculosis in the 3 French Department of the Americas: Profiles, evolution, and trends (1995-2011)].

Science.gov (United States)

Millet, J; Berchel, M; Prudenté, F; Streit, E; Bomer, A-G; Schuster, F; Vanhomwegen, J; Paasch, D; Galbert, I; Valery, E; Aga, R; Rastogi, N

2014-05-01

This is the first overview on resistant and multidrug resistant isolates of Mycobacterium tuberculosis circulating in the French Department of the Americas (Guadeloupe, Martinique, and French Guiana) over 17 years (January 1995-December 2011). A total of 1,239 cases were studied: 1,199 new cases (primary and multidrug resistance of 11.8 and 1.6% respectively), and 40 persistent (defined as cases with a previous history of positive culture over 6 months interval and whose spoligotypes remain unchanged), in which significantly higher proportions of resistance to at least isoniazid (22.5%, P = 0.002), rifampicin (20.0%, P < 0.001), and multidrug resistance (17.5%, P < 0.001) were observed as compared to new cases. The 281 spoligotypes obtained showed the presence of five major lineages, T (29.9%), LAM (23.9%), Haarlem (22.1%), EAI (7.1%), and X (6.7%). Two of these lineages, X and LAM, predominate among resistant and multidrug resistant isolates respectively (X: 10.5% of resistant isolates, P = 0.04; LAM: 42.3% of multidrug resistant isolates, P = 0.02). Four of the 19 major spoligo-profiles, corresponding to SIT 20, 64, 45, and 46, were significantly associated with drug resistance. Among them, genotype SIT 20, associated with monoresistance to isoniazid and multidrug resistance, would be actively and persistently in circulation, since 1999, in French Guiana, department in which one may also observe the presence of strains of M. tuberculosis phylogeographically associated to Guiana and Suriname (SIT 131 and SIT 1340).

Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

OpenAIRE

Marie Sylvianne Rabodoarivelo; A Brandao; M C Cergole Novella; A G C. Bombonatte; B Imperiale; N Rakotosamimanana; N Morcillo; V Rasolofo; J C Palomino; A Martin

2018-01-01

Background: In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. Methods: This was a multicenter study. Molecular detection of ...

Beijing Lineage of MDR Mycobacterium tuberculosis in Bulgaria, 2007-2011

NARCIS (Netherlands)

Panaiotov, Stefan; Bachiyska, Elizabeta; Yordanova, Stanislava; Atanasova, Yuliana; Brankova, Nadia; Levterova, Viktoria; Sengstake, Sarah; Anthony, Richard; Bergval, Indra; Sola, Christophe; Kantardjiev, Todor

2014-01-01

To assess the spread of the Mycobacterium tuberculosis Beijing genotype among patients with multidrug-resistant and extensively resistant tuberculosis in Bulgaria, we genotyped 188 (72%) of 261 microbiologically confirmed resistant isolates obtained during 2007-2011. The estimated prevalence of the

Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

Science.gov (United States)

Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

2016-07-01

Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

Drug-resistant tuberculosis in HIV-infected patients in a national referral hospital, Phnom Penh, Cambodia.

Science.gov (United States)

Walls, Genevieve; Bulifon, Sophie; Breysse, Serge; Daneth, Thol; Bonnet, Maryline; Hurtado, Northan; Molfino, Lucas

2015-01-01

There are no recent data on the prevalence of drug-resistant tuberculosis (DR TB) in Cambodia. We aim to describe TB drug resistance amongst adults with pulmonary and extra-pulmonary TB and human immunodeficiency virus (HIV) co-infection in a national referral hospital in Phnom Penh, Cambodia. Between 22 November 2007 and 30 November 2009, clinical specimens from HIV-infected patients suspected of having TB underwent routine microscopy, Mycobacterium tuberculosis culture, and drug susceptibility testing. Laboratory and clinical data were collected for patients with positive M. tuberculosis cultures. M. tuberculosis was cultured from 236 HIV-infected patients. Resistance to any first-line TB drug occurred in 34.7% of patients; 8.1% had multidrug resistant tuberculosis (MDR TB). The proportion of MDR TB amongst new patients and previously treated patients was 3.7 and 28.9%, respectively (pCambodia may be higher than previously recognised, particularly amongst HIV-infected patients. Additional prevalence studies are needed. This study also illustrates the feasibility and utility of analysis of non-respiratory specimens in the diagnosis of TB, even in low-resource settings, and suggests that extra-pulmonary specimens should be included in TB diagnostic algorithms.

Acid-fast bacilli culture positivity and drug resistance in abdominal tuberculosis in Mumbai, India.

Science.gov (United States)

Samant, Hrishikesh; Desai, Devendra; Abraham, Philip; Joshi, Anand; Gupta, Tarun; Rodrigues, Camilla; George, Siji

2014-09-01

Culture positivity for Mycobacterium tuberculosis complex (MTB) in abdominal tuberculosis (TB) using Lowenstein Jensen medium and Bactec system varies from 25 % to 36 %. Data on the prevalence of drug resistance in primary abdominal TB is scant. Our aim was to study the acid-fast bacilli (AFB) culture positivity rate in primary abdominal TB using Bactec Mycobacterial Growth Indicator Tubes (MGIT) system and the prevalence of drug resistance in these patients. Records of patients with abdominal TB (diagnosed on clinical features, endoscopy, histology, microbiology) seen during the period 2008 to 2013 were retrieved from the Gastroenterology and Microbiology departments. Patients with extra-abdominal TB (five pulmonary, two nodal), adnexal (one), and HIV (one) were excluded from analysis. Of 61 patients, 31 (50.8 %) had a positive AFB culture. In the 30 culture-negative patients, histology showed non-caseating granulomas in 25 patients. Drug sensitivity pattern was analyzed in 18 patients; resistance was detected in eight (14.3 % of all patients and 44.4 % of patients in whom drug sensitivity was done) including three (5.4 % of all subjects and 16.6 % in whom drug sensitivity was available) who were multidrug-resistant. The rate of AFB culture positivity in primary abdominal TB was 50.8 % using Bactec MGIT. Likelihood of drug resistance was seen in 14.3 %, of whom 5.4 % were multidrug-resistant.

Development of a three component complex to increase isoniazid efficacy against isoniazid resistant and nonresistant Mycobacterium tuberculosis.

Science.gov (United States)

Manning, Thomas; Plummer, Sydney; Baker, Tess; Wylie, Greg; Clingenpeel, Amy C; Phillips, Dennis

2015-10-15

The bacterium responsible for causing tuberculosis has evolved resistance to antibiotics used to treat the disease, resulting in new multidrug resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug resistant M. tuberculosis (XDR-TB) strains. Analytical techniques (1)H and (13)C Nuclear Magnetic Resonance (NMR), Fourier Transform-Ion Cyclotron Resonance with Electrospray Ionization (FT-ICR/ESI), and Matrix Assisted Laser Desorption Ionization-Mass Spectrometry (MALDI-TOF-MS) were used to study different aspects of the Cu(II)-polyethylene glycol (PEG-3350)-sucrose-isoniazid and Cu(II)-polyethylene glycol (PEG3350)-glucose-isoniazid complexes. The Cu(II) cation, sucrose or glucose, and the aggregate formed by PEG primarily serve as a composite drug delivery agent for the frontline antibiotic, however the improvement in MIC values produced with the CU-PEG-SUC-INH complex suggest an additional effect. Several Cu-PEG-SUC-INH complex variations were tested against INH resistant and nonresistant strains of M. tuberculosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

International Nuclear Information System (INIS)

Centeno Urena, Yadel

2014-01-01

A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

Directory of Open Access Journals (Sweden)

Philly O'Riordan

2008-09-01

Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Perú Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Perú

Directory of Open Access Journals (Sweden)

Julio Torres

2011-09-01

Full Text Available Se describe la evolución y las características de los casos de un conglomerado de tuberculosis multidrogorresistente (MDR ocurrido el año 2001, en un centro educativo localizado en una zona urbano marginal del distrito de Ica, Perú. Se identificó 15 escolares que estuvieron relacionados entre ellos antes de enfermar de tuberculosis. El promedio de edad fue 15 años. Doce casos fueron MDR y siete fueron resistentes a las cinco drogas de primera línea (RHEZS, cinco de los casos recibieron tres diferentes esquemas de tratamiento antituberculoso; el tiempo promedio de tratamiento antituberculoso fue de 37 meses (mínimo 21 y máximo 59 meses. Trece casos curaron y dos fallecieron. El presente estudio documenta un conglomerado de casos de TB-MDR en un centro educativo que, por los vínculos epidemiológicos y la simultaneidad en que aparecieron, podría tratarse de un probable brote de TB-MDR, con un desenlace satisfactorio luego de un tratamiento prolongado.We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS. Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months. A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

Multidrug-resistant tuberculosis in Moldova and the Former Yugoslav Republic of Macedonia: The importance of health system governance

Directory of Open Access Journals (Sweden)

R. Gregory Thomas-Reilly

2016-04-01

Full Text Available Aim: Multidrug-resistant tuberculosis (MDR-TB arises where treatment is interrupted or inadequate, when patients are treated inappropriately, or when an individual has impaired immune function, which can lead to a rapid progression from infection with an MDR-strain to disease. This study examines the role of health systems in amplifying or preventing the development of MDR-TB. Methods: We present two comparative studies, which were undertaken in The Former Yugoslav Republic of Macedonia (TFYR Macedonia and Moldova. Results: The findings reveal several health systems-level factors that contribute to the different rates of MDR-TB observed in these two countries, including: pre-existing burden of disease; organization of the health system, with the existence of parallel systems; power dynamics among policy makers and disease programmes; and the accountability & effectiveness of programme oversight. Conclusions: The findings do not offer a universal template for health system reform but do identify specific factors that may be contributing to the epidemic and are worthy of further attention in the two countries.

Peripheral neuropathy in a diabetic child treated with linezolid for multidrug-resistant tuberculosis: a case report and review of the literature.

Science.gov (United States)

Swaminathan, Aravind; du Cros, Philipp; Seddon, James A; Mirgayosieva, Shamsiya; Asladdin, Rajabov; Dusmatova, Zulfiya

2017-06-12

Extensively drug-resistant (XDR) tuberculosis (TB) and multidrug resistant (MDR)-TB with additional resistance to injectable agents or fluoroquinolones are challenging to treat due to lack of available, effective drugs. Linezolid is one of the few drugs that has shown promise in treating these conditions. Long-term linezolid use is associated with toxicities such as peripheral and optic neuropathies. Diabetes mellitus (DM), especially when uncontrolled, can also result in peripheral neuropathy. The global burden of DM is increasing, and DM has been associated with a three-fold increased risk of developing TB disease. TB and DM can be a challenging combination to treat. DM can inhibit the host immune response to tuberculosis infection; and TB and some anti-TB drugs can worsen glycaemic control. A child experiencing neuropathy that is a possible complication of both DM and linezolid used to treat TB has not been reported previously. We report peripheral neuropathy in a 15-year-old boy with type 1 DM, diagnosed with MDR-TB and additional resistance to injectable TB medications. The boy was treated with a linezolid-based regimen, but after 8 months developed peripheral neuropathy. It was unclear whether the neuropathy was caused by the DM or the linezolid therapy. He had clinical improvement following cessation of linezolid and was declared cured following 21 months of treatment. Following completion of treatment, nerve conduction studies demonstrated significant improvement in neuropathy. To the best of our knowledge, this is the first case of peripheral neuropathy reported in a diabetic child on long-term linezolid therapy for tuberculosis. This case study underlines the importance of stringent follow-up for side effects of linezolid, especially when associated with co-morbidity such as DM that increases the chances of adverse effects. The presence of both DM and TB should alert a physician to strive for optimal glycaemic control to minimize the risk of

Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

Science.gov (United States)

Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

2017-11-01

BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

A programmed release multi-drug implant fabricated by three-dimensional printing technology for bone tuberculosis therapy

International Nuclear Information System (INIS)

Wu Weigang; Zheng Qixin; Guo Xiaodong; Sun Jianhua; Liu Yudong

2009-01-01

In the world, bone tuberculosis is still very difficult to treat and presents a challenge to clinicians. In this study, we utilized 3D printing technology to fabricate a programmed release multi-drug implant for bone tuberculosis therapy. The construction of the drug implant was a multi-layered concentric cylinder divided into four layers from the center to the periphery. Isoniazid and rifampicin were distributed individually into the different layers in a specific sequence of isoniazid-rifampicin-isoniazid-rifampicin. The drug release assays in vitro and in vivo showed that isoniazid and rifampicin were released orderly from the outside to the center to form the multi-drug therapeutic alliance, and the peak concentrations of drugs were detected in sequence at 8 to 12 day intervals. In addition, no negative effect on the proliferation of rabbit bone marrow mesenchymal stem cells was detected during the cytocompatibility assay. Due to its ideal pharmacologic action and cytocompatibility, the programmed release multi-drug implant with a complex construction fabricated by 3D printing technology could be of interest in prevention and treatment of bone tuberculosis.

A programmed release multi-drug implant fabricated by three-dimensional printing technology for bone tuberculosis therapy

Energy Technology Data Exchange (ETDEWEB)

Wu Weigang; Zheng Qixin; Guo Xiaodong; Sun Jianhua; Liu Yudong, E-mail: Zheng-qx@163.co [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China)

2009-12-15

In the world, bone tuberculosis is still very difficult to treat and presents a challenge to clinicians. In this study, we utilized 3D printing technology to fabricate a programmed release multi-drug implant for bone tuberculosis therapy. The construction of the drug implant was a multi-layered concentric cylinder divided into four layers from the center to the periphery. Isoniazid and rifampicin were distributed individually into the different layers in a specific sequence of isoniazid-rifampicin-isoniazid-rifampicin. The drug release assays in vitro and in vivo showed that isoniazid and rifampicin were released orderly from the outside to the center to form the multi-drug therapeutic alliance, and the peak concentrations of drugs were detected in sequence at 8 to 12 day intervals. In addition, no negative effect on the proliferation of rabbit bone marrow mesenchymal stem cells was detected during the cytocompatibility assay. Due to its ideal pharmacologic action and cytocompatibility, the programmed release multi-drug implant with a complex construction fabricated by 3D printing technology could be of interest in prevention and treatment of bone tuberculosis.

Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Veigas, Bruno; Baptista, Pedro V; Machado, Diana; Couto, Isabel; Viveiros, Miguel; Perdigao, Joao; Portugal, Isabel

2010-01-01

Tuberculosis (TB) is one of the leading causes of infection in humans, causing high morbility and mortality all over the world. The rate of new cases of multidrug resistant tuberculosis (MDRTB) continues to increase, and since these infections are very difficult to manage, they constitute a serious health problem. In most cases, drug resistance in Mycobacterium tuberculosis has been related to mutations in several loci within the pathogen's genome. The development of fast, cheap and simple screening methodologies would be of paramount relevance for the early detection of these mutations, essential for the timely and effective diagnosis and management of MDRTB patients. The use of gold nanoparticles derivatized with thiol-modified oligonucleotides (Au-nanoprobes) has led to new approaches in molecular diagnostics. Based on the differential non-cross-linking aggregation of Au-nanoprobes, we were able to develop a colorimetric method for the detection of specific sequences and to apply this approach to pathogen identification and single base mutations/single nucleotide polymorphisms (SNP) discrimination. Here we report on the development of Au-nanoprobes for the specific identification of SNPs within the beta subunit of the RNA polymerase (rpoB locus), responsible for resistance to rifampicin in over 95% of rifampicin resistant M. tuberculosis strains.

Au-nanoprobes for detection of SNPs associated with antibiotic resistance in Mycobacterium tuberculosis

Energy Technology Data Exchange (ETDEWEB)

Veigas, Bruno; Baptista, Pedro V [CIGMH, Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal); Machado, Diana; Couto, Isabel; Viveiros, Miguel [Unidade de Micobacterias, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa (IHMT/UNL) (Portugal); Perdigao, Joao; Portugal, Isabel, E-mail: pmvb@fct.unl.pt [Centro de Patogenese Molecular/URIA, Faculdade de Farmacia, Universidade de Lisboa, Lisboa (Portugal)

2010-10-15

Tuberculosis (TB) is one of the leading causes of infection in humans, causing high morbility and mortality all over the world. The rate of new cases of multidrug resistant tuberculosis (MDRTB) continues to increase, and since these infections are very difficult to manage, they constitute a serious health problem. In most cases, drug resistance in Mycobacterium tuberculosis has been related to mutations in several loci within the pathogen's genome. The development of fast, cheap and simple screening methodologies would be of paramount relevance for the early detection of these mutations, essential for the timely and effective diagnosis and management of MDRTB patients. The use of gold nanoparticles derivatized with thiol-modified oligonucleotides (Au-nanoprobes) has led to new approaches in molecular diagnostics. Based on the differential non-cross-linking aggregation of Au-nanoprobes, we were able to develop a colorimetric method for the detection of specific sequences and to apply this approach to pathogen identification and single base mutations/single nucleotide polymorphisms (SNP) discrimination. Here we report on the development of Au-nanoprobes for the specific identification of SNPs within the beta subunit of the RNA polymerase (rpoB locus), responsible for resistance to rifampicin in over 95% of rifampicin resistant M. tuberculosis strains.

MULTIDRUG-RESISTANT TUBERCULOSIS

African Journals Online (AJOL)

Kurt

health, with the focus of DOTS programmes on cure of infectious TB patients and prevention of drug resistance. ... Despite highly effective drugs and disease control strategies, morbidity and mortality .... notification and registration system.

Multi-clonal evolution of multi-drug-resistant/extensively drug-resistant Mycobacterium tuberculosis in a high-prevalence setting of Papua New Guinea for over three decades

Science.gov (United States)

Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan

2018-01-01

An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751

Trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of extrapulmonary tuberculosis cases in referral hospitals in northern India

Directory of Open Access Journals (Sweden)

A K Maurya

2012-01-01

Full Text Available Background: Drug-resistant tuberculosis is one of major current challenges to global public health. The transmission of resistant strains is increasing as a burden of multidrug-resistant tuberculosis (MDR-TB patients in extra pulmonary tuberculosis (EPTB cases in India. Aim and Objectives: The aim was to study trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of EPTB in referral hospitals in northern India. Study Design and Setting: A prospectively observational study and referral medical institutions in northern India. Materials and Methods: All EPTB specimens were processed for Ziehl Neelsen staining, BACTEC culture and BACTEC NAP test for Mycobacterium tuberculosis complex. All M. tuberculosis complex isolates were performed for radiometric-based drug susceptibility pattern against streptomycin, isoniazid, rifampicin and ethambutol using the 1% proportion method. Results: We found that 165/756 (20.5% isolates were identified as M. tuberculosis complex by the NAP test. We observed that 39.9% were resistant to first-line antitubercular drugs. The resistance rate was higher in previously treated patients: H (30.3%, R (16.3%, E (15.7% and S (16.3%. MDR-TB was observed in 13.4%, but, in new cases, this was 11.4% and 19.1% of the previously treated patients (P<0.05. Conclusion: MDR-TB is gradually increased in EPTB cases and predominant resistance to previous treated cases of EPTB. The molecular drug sensitivity test (DST method can be an early decision for chemotherapy in MDR-TB patients. The International Standards of TB Care need to be used by the RNTCP and professional medical associations as a tool to improve TB care in the country.

Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

Science.gov (United States)

Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

2018-03-01

New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

Expression of multidrug resistance proteins in retinoblastoma

Directory of Open Access Journals (Sweden)

Swati Shukla

2017-11-01

Full Text Available AIM: To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS: Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS: Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1 expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION: Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

Expression of multidrug resistance proteins in retinoblastoma.

Science.gov (United States)

Shukla, Swati; Srivastava, Arpna; Kumar, Sunil; Singh, Usha; Goswami, Sandeep; Chawla, Bhavna; Bajaj, Mandeep Singh; Kashyap, Seema; Kaur, Jasbir

2017-01-01

To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

Expression of multidrug resistance proteins in retinoblastoma

Science.gov (United States)

Shukla, Swati; Srivastava, Arpna; Kumar, Sunil; Singh, Usha; Goswami, Sandeep; Chawla, Bhavna; Bajaj, Mandeep Singh; Kashyap, Seema; Kaur, Jasbir

2017-01-01

AIM To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy. PMID:29181307

Impact of Infection Control Measures to Control an Outbreak of Multidrug-Resistant Tuberculosis in a Human Immunodeficiency Virus Ward, Peru

Science.gov (United States)

Ticona, Eduardo; Huaroto, Luz; Kirwan, Daniela E.; Chumpitaz, Milagros; Munayco, César V.; Maguiña, Mónica; Tovar, Marco A.; Evans, Carlton A.; Escombe, Roderick; Gilman, Robert H.

2016-01-01

Multidrug-resistant tuberculosis (MDRTB) rates in a human immunodeficiency virus (HIV) care facility increased by the year 2000—56% of TB cases, eight times the national MDRTB rate. We reported the effect of tuberculosis infection control measures that were introduced in 2001 and that consisted of 1) building a respiratory isolation ward with mechanical ventilation, 2) triage segregation of patients, 3) relocation of waiting room to outdoors, 4) rapid sputum smear microscopy, and 5) culture/drug–susceptibility testing with the microscopic-observation drug-susceptibility assay. Records pertaining to patients attending the study site between 1997 and 2004 were reviewed. Six hundred and fifty five HIV/TB–coinfected patients (mean age 33 years, 79% male) who attended the service during the study period were included. After the intervention, MDRTB rates declined to 20% of TB cases by the year 2004 (P = 0.01). Extremely limited access to antiretroviral therapy and specific MDRTB therapy did not change during this period, and concurrently, national MDRTB prevalence increased, implying that the infection control measures caused the fall in MDRTB rates. The infection control measures were estimated to have cost US$91,031 while preventing 97 MDRTB cases, potentially saving US$1,430,026. Thus, this intervention significantly reduced MDRTB within an HIV care facility in this resource-constrained setting and should be cost-effective. PMID:27621303

Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

Science.gov (United States)

Ramachandran, Rajeswari; Muniyandi, M

2018-03-01

Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

Multidrug resistance in enteric and other gram-negative bacteria.

Science.gov (United States)

George, A M

1996-05-15

In Gram-negative bacteria, multidrug resistance is a term that is used to describe mechanisms of resistance by chromosomal genes that are activated by induction or mutation caused by the stress of exposure to antibiotics in natural and clinical environments. Unlike plasmid-borne resistance genes, there is no alteration or degradation of drugs or need for genetic transfer. Exposure to a single drug leads to cross-resistance to many other structurally and functionally unrelated drugs. The only mechanism identified for multidrug resistance in bacteria is drug efflux by membrane transporters, even though many of these transporters remain to be identified. The enteric bacteria exhibit mostly complex multidrug resistance systems which are often regulated by operons or regulons. The purpose of this review is to survey molecular mechanisms of multidrug resistance in enteric and other Gram-negative bacteria, and to speculate on the origins and natural physiological functions of the genes involved.

Xpert MTB/RIF Ultra for detection of Mycobacterium tuberculosis and rifampicin resistance: a prospective multicentre diagnostic accuracy study.

Science.gov (United States)

Dorman, Susan E; Schumacher, Samuel G; Alland, David; Nabeta, Pamela; Armstrong, Derek T; King, Bonnie; Hall, Sandra L; Chakravorty, Soumitesh; Cirillo, Daniela M; Tukvadze, Nestani; Bablishvili, Nino; Stevens, Wendy; Scott, Lesley; Rodrigues, Camilla; Kazi, Mubin I; Joloba, Moses; Nakiyingi, Lydia; Nicol, Mark P; Ghebrekristos, Yonas; Anyango, Irene; Murithi, Wilfred; Dietze, Reynaldo; Lyrio Peres, Renata; Skrahina, Alena; Auchynka, Vera; Chopra, Kamal Kishore; Hanif, Mahmud; Liu, Xin; Yuan, Xing; Boehme, Catharina C; Ellner, Jerrold J; Denkinger, Claudia M

2018-01-01

The Xpert MTB/RIF assay is an automated molecular test that has improved the detection of tuberculosis and rifampicin resistance, but its sensitivity is inadequate in patients with paucibacillary disease or HIV. Xpert MTB/RIF Ultra (Xpert Ultra) was developed to overcome this limitation. We compared the diagnostic performance of Xpert Ultra with that of Xpert for detection of tuberculosis and rifampicin resistance. In this prospective, multicentre, diagnostic accuracy study, we recruited adults with pulmonary tuberculosis symptoms presenting at primary health-care centres and hospitals in eight countries (South Africa, Uganda, Kenya, India, China, Georgia, Belarus, and Brazil). Participants were allocated to the case detection group if no drugs had been taken for tuberculosis in the past 6 months or to the multidrug-resistance risk group if drugs for tuberculosis had been taken in the past 6 months, but drug resistance was suspected. Demographic information, medical history, chest imaging results, and HIV test results were recorded at enrolment, and each participant gave at least three sputum specimen on 2 separate days. Xpert and Xpert Ultra diagnostic performance in the same sputum specimen was compared with culture tests and drug susceptibility testing as reference standards. The primary objectives were to estimate and compare the sensitivity of Xpert Ultra test with that of Xpert for detection of smear-negative tuberculosis and rifampicin resistance and to estimate and compare Xpert Ultra and Xpert specificities for detection of rifampicin resistance. Study participants in the case detection group were included in all analyses, whereas participants in the multidrug-resistance risk group were only included in analyses of rifampicin-resistance detection. Between Feb 18, and Dec 24, 2016, we enrolled 2368 participants for sputum sampling. 248 participants were excluded from the analysis, and 1753 participants were distributed to the case detection group (n=1439

SUSCEPTIBILITY OF RIFAMPICIN-ISONIAZID RESISTANT MYCOBACTERIUM TUBERCULOSIS ISOLATES AGAINST LEVOFLOXACIN

Directory of Open Access Journals (Sweden)

A. H. Kurniawan

2016-01-01

Full Text Available Background: Tuberculosis (TB is a high burden disease in Indonesia with multidrug-resistant (MDR TB incidence started to increase. Treatment success of MDR-TB globally was low in number than it was targeted which was especially caused by fluoroquinolone resistance. One of the fluoroquinolone is levofloxacin, an antibiotic that has been widely used irrationally as antimicrobial treatment. Therefore, this study investigated the sensitivity and MBC of MDR Mycobacterium tuberculosis isolates against Levofloxacin. Method: The susceptibility test for MDR-Mycobacterium tuberculosis on levofloxacin by standard method with levofloxacin were on concentrations 0,5 μg/ml, 1 μg/ml, and 2 μg/ml. Sample of 8 strains MDR-Mycobacterium tuberculosis were cultured with each concentrations on Middlebrook 7H9 for 1 week incubation. Next, each of the incubated concentration was subcultured on solid media Middlebrook 7H10 for 3 weeks incubation. Colonized agar plates after 3 weeks incubation were confirmed with acid-fast stain. Results: On MB 7H10 with levofloxacin concentration 2 μg/ml showed bactericidal effect 100% by no MDR Mycobacterium tuberculosis colony grew (0/8 while the MB 7H10 with levofloxacin concentration 1 μg/ml and 0,5 μg/ml showed the bactericidal effect 37,5% and 25% respectively. The colonized agar plate implied that the MDR Mycobacterium tuberculosis with levofloxacin concentration 1 μg/ml (5/8 and 0,5 μg/ml (6/8 grew well. Conclusion: Levofloxacin concentration 2 μg/ml was susceptible on MDR Mycobacterium tuberculosis. The concentration 2 μg/ml of levofloxacin could be considered as MBC.

Combating highly resistant emerging pathogen Mycobacterium abscessus and Mycobacterium tuberculosis with novel salicylanilide esters and carbamates.

Science.gov (United States)

Baranyai, Zsuzsa; Krátký, Martin; Vinšová, Jarmila; Szabó, Nóra; Senoner, Zsuzsanna; Horváti, Kata; Stolaříková, Jiřina; Dávid, Sándor; Bősze, Szilvia

2015-08-28

In the Mycobacterium genus over one hundred species are already described and new ones are periodically reported. Species that form colonies in a week are classified as rapid growers, those requiring longer periods (up to three months) are the mostly pathogenic slow growers. More recently, new emerging species have been identified to lengthen the list, all rapid growers. Of these, Mycobacterium abscessus is also an intracellular pathogen and it is the most chemotherapy-resistant rapid-growing mycobacterium. In addition, the cases of multidrug-resistant Mycobacterium tuberculosis infection are also increasing. Therefore there is an urgent need to find new active molecules against these threatening strains. Based on previous results, a series of salicylanilides, salicylanilide 5-chloropyrazinoates and carbamates was designed, synthesized and characterised. The compounds were evaluated for their in vitro activity on M. abscessus, susceptible M. tuberculosis H37Rv, multidrug-resistant (MDR) M. tuberculosis MDR A8, M. tuberculosis MDR 9449/2006 and on the extremely-resistant Praha 131 (XDR) strains. All derivatives exhibited a significant activity with minimum inhibitory concentrations (MICs) in the low micromolar range. Eight salicylanilide carbamates and two salicylanilide esters exhibited an excellent in vitro activity on M. abscessus with MICs from 0.2 to 2.1 μM, thus being more effective than ciprofloxacin and gentamicin. This finding is potentially promising, particularly, as M. abscessus is a threateningly chemotherapy-resistant species. M. tuberculosis H37Rv was inhibited with MICs from 0.2 μM, and eleven compounds have lower MICs than isoniazid. Salicylanilide esters and carbamates were found that they were effective also on MDR and XDR M. tuberculosis strains with MICs ≥1.0 μM. The in vitro cytotoxicity (IC50) was also determined on human MonoMac-6 cells, and selectivity index (SI) of the compounds was established. In general, salicylanilide

Social support received by multidrug-resistant tuberculosis patients and related factors: a cross-sectional study in Zhejiang Province, People's Republic of China

Directory of Open Access Journals (Sweden)

Chen B

2016-06-01

Full Text Available Bin Chen,1 Yin Peng,1 Lin Zhou,1 Chengliang Chai,1 Hui-Chi Yeh,2 Songhua Chen,1 Fei Wang,1 Mingwu Zhang,1 Tieniu He,1 Xiaomeng Wang1 1Department of Tuberculosis Control and Prevention, Zhejiang Provincial Center for Disease Control and Prevention, Binjiang District, Hangzhou, People’s Republic of China; 2Politics & International Relations, Social Sciences, University of Southampton, Southampton, UK Objectives: The objective of this study is to assess the social support received by patients diagnosed with multidrug-resistant tuberculosis (MDR-TB in Zhejiang Province, People’s Republic of China and the factors that may have influenced it. Methods: A total of 220 MDR-TB patients participated in the questionnaire-based survey, and the data from 212 valid questionnaires were analyzed. The respondents reported their sociodemographic status, disease features, and attitudes toward the disease. The social support rating scale was used to measure the patients’ social support scores. An Independent Samples t-test, one-way analysis of variance, and a multiple linear regression model were used to analyze the related factors for the social support scores. Result: The average social support score of each MDR-TB patient was 32.56±7.86. Participants who were single, widowed or divorced, retired, and had fewer family members and lower family income were found to have lower social support scores. Participants unwilling to disclose their disease tended to have less social support (31.59<34.23, P=0.010. Participants who perceived great help from health care workers reported higher social support rating scale scores than those who perceived no help (35.36>29.89, P=0.014. Conclusion: MDR-TB patients in Zhejiang Province were shown to have a low level of social support. Patients who were not married, had smaller families, and lower family income received less social support, suggesting that family harmony could be an important source of social support. Patients�

Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

Science.gov (United States)

Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

2018-01-01

Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

Double trouble: Prevalence and factors associated with tuberculosis and diabetes comorbidity in Bangladesh

NARCIS (Netherlands)

Sarker, M.; Barua, M.; Guerra, F.; Saha, A.; Aftab, A.; Latif, A.H.M.; Islam, S.; Islam, A.

2016-01-01

Background: Diabetes among tuberculosis patients increases the risk of tuberculosis treatment failure, death, and development of multidrug-resistant tuberculosis. Yet, there is no data is available in Bangladesh on the prevalence of diabetes among tuberculosis patients. The objective of the current

Previous treatment, sputum-smear nonconversion, and suburban living: The risk factors of multidrugresistant tuberculosis among Malaysians

Directory of Open Access Journals (Sweden)

Noorsuzana Mohd Shariff

2016-01-01

Full Text Available The number of multidrug-resistant tuberculosis patients is increasing each year in many countries all around the globe. Malaysia has no exception in facing this burdensome health problem. We aimed to investigate the factors that contribute to the occurrence of multidrug-resistant tuberculosis among Malaysian tuberculosis patients. An unmatched case-control study was conducted among tuberculosis patients who received antituberculosis treatments from April 2013 until April 2014. Cases are those diagnosed as pulmonary tuberculosis patients clinically, radiologically, and/or bacteriologically, and who were confirmed to be resistant to both isoniazid and rifampicin through drug-sensitivity testing. On the other hand, pulmonary tuberculosis patients who were sensitive to all first-line antituberculosis drugs and were treated during the same time period served as controls. A total of 150 tuberculosis patients were studied, of which the susceptible cases were 120. Factors found to be significantly associated with the occurrence of multidrug-resistant tuberculosis are being Indian or Chinese (odds ratio 3.17, 95% confidence interval 1.04–9.68; and odds ratio 6.23, 95% confidence interval 2.24–17.35, respectively, unmarried (odds ratio 2.58, 95% confidence interval 1.09–6.09, living in suburban areas (odds ratio 2.58, 95% confidence interval 1.08–6.19, are noncompliant (odds ratio 4.50, 95% confidence interval 1.71–11.82, were treated previously (odds ratio 8.91, 95% confidence interval 3.66–21.67, and showed positive sputum smears at the 2nd (odds ratio 7.00, 95% confidence interval 2.46–19.89 and 6th months of treatment (odds ratio 17.96, 95% confidence interval 3.51–91.99. Living in suburban areas, positive sputum smears in the 2nd month of treatment, and was treated previously are factors that independently contribute to the occurrence of multidrug-resistant tuberculosis. Those with positive smears in the second month of treatment

Sequential analysis as a tool for detection of amikacin ototoxicity in the treatment of multidrug-resistant tuberculosis.

Science.gov (United States)

Vasconcelos, Karla Anacleto de; Frota, Silvana Maria Monte Coelho; Ruffino-Netto, Antonio; Kritski, Afrânio Lineu

2018-04-01

To investigate early detection of amikacin-induced ototoxicity in a population treated for multidrug-resistant tuberculosis (MDR-TB), by means of three different tests: pure-tone audiometry (PTA); high-frequency audiometry (HFA); and distortion-product otoacoustic emission (DPOAE) testing. This was a longitudinal prospective cohort study involving patients aged 18-69 years with a diagnosis of MDR-TB who had to receive amikacin for six months as part of their antituberculosis drug regimen for the first time. Hearing was assessed before treatment initiation and at two and six months after treatment initiation. Sequential statistics were used to analyze the results. We included 61 patients, but the final population consisted of 10 patients (7 men and 3 women) because of sequential analysis. Comparison of the test results obtained at two and six months after treatment initiation with those obtained at baseline revealed that HFA at two months and PTA at six months detected hearing threshold shifts consistent with ototoxicity. However, DPOAE testing did not detect such shifts. The statistical method used in this study makes it possible to conclude that, over the six-month period, amikacin-associated hearing threshold shifts were detected by HFA and PTA, and that DPOAE testing was not efficient in detecting such shifts.

Multidrug resistance in Lactococcus lactis

NARCIS (Netherlands)

Bolhuis, Hendrik

1996-01-01

Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

The Potential Impact of Up-Front Drug Sensitivity Testing on India's Epidemic of Multi-Drug Resistant Tuberculosis.

Directory of Open Access Journals (Sweden)

Kuldeep Singh Sachdeva

Full Text Available In India as elsewhere, multi-drug resistance (MDR poses a serious challenge in the control of tuberculosis (TB. The End TB strategy, recently approved by the world health assembly, aims to reduce TB deaths by 95% and new cases by 90% between 2015 and 2035. A key pillar of this approach is early diagnosis of tuberculosis, including use of higher-sensitivity diagnostic testing and universal rapid drug susceptibility testing (DST. Despite limitations of current laboratory assays, universal access to rapid DST could become more feasible with the advent of new and emerging technologies. Here we use a mathematical model of TB transmission, calibrated to the TB epidemic in India, to explore the potential impact of a major national scale-up of rapid DST. To inform key parameters in a clinical setting, we take GeneXpert as an example of a technology that could enable such scale-up. We draw from a recent multi-centric demonstration study conducted in India that involved upfront Xpert MTB/RIF testing of all TB suspects.We find that widespread, public-sector deployment of high-sensitivity diagnostic testing and universal DST appropriately linked with treatment could substantially impact MDR-TB in India. Achieving 75% access over 3 years amongst all cases being diagnosed for TB in the public sector alone could avert over 180,000 cases of MDR-TB (95% CI 44187 - 317077 cases between 2015 and 2025. Sufficiently wide deployment of Xpert could, moreover, turn an increasing MDR epidemic into a diminishing one. Synergistic effects were observed with assumptions of simultaneously improving MDR-TB treatment outcomes. Our results illustrate the potential impact of new and emerging technologies that enable widespread, timely DST, and the important effect that universal rapid DST in the public sector can have on the MDR-TB epidemic in India.

Tuberculosis--triumph and tragedy.

Science.gov (United States)

Singh, M M

2003-03-01

Tuberculosis has been making havoc worldwide with an 11.9 million cases to be involved by the year 2005. In India, about 2 million cases are infected every year. Regarding triumphs and tragedies in the control of tuberculosis some points as follows are discussed. (1) Tuberculosis Control Programmes from National Tuberculosis Programme (NTP) to Revised National Tuberculosis Control Programme (RNTCP) and Directly Observed Treatment, Short course (DOTS). (2) Problem of multidrug resistance (MDR) tuberculosis and (3) HIV and tuberculosis. DOTS being largely based on Indian research. It is now being applied worldwide. MDR is strictly a man made problem. Poor prescriptions, poor case management, lack of coordinated education and haphazard treatment research result in drug resistance. Treatment of MDR is difficult. The drug acceptability, tolerance and toxicity have to be considered. HIV and tuberculosis form a deadly duo. They mean more cases, more costs and more national losses.

Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition.

Science.gov (United States)

Morales, Eva; Cots, Francesc; Sala, Maria; Comas, Mercè; Belvis, Francesc; Riu, Marta; Salvadó, Margarita; Grau, Santiago; Horcajada, Juan P; Montero, Maria Milagro; Castells, Xavier

2012-05-23

We aimed to assess the hospital economic costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. A retrospective study of all hospital admissions between January 1, 2005, and December 31, 2006 was carried out in a 420-bed, urban, tertiary-care teaching hospital in Barcelona (Spain). All patients with a first positive clinical culture for P. aeruginosa more than 48 h after admission were included. Patient and hospitalization characteristics were collected from hospital and microbiology laboratory computerized records. According to antibiotic susceptibility, isolates were classified as non-resistant, resistant and multi-drug resistant. Cost estimation was based on a full-costing cost accounting system and on the criteria of clinical Activity-Based Costing methods. Multivariate analyses were performed using generalized linear models of log-transformed costs. Cost estimations were available for 402 nosocomial incident P. aeruginosa positive cultures. Their distribution by antibiotic susceptibility pattern was 37.1% non-resistant, 29.6% resistant and 33.3% multi-drug resistant. The total mean economic cost per admission of patients with multi-drug resistant P. aeruginosa strains was higher than that for non-resistant strains (15,265 vs. 4,933 Euros). In multivariate analysis, resistant and multi-drug resistant strains were independently predictive of an increased hospital total cost in compared with non-resistant strains (the incremental increase in total hospital cost was more than 1.37-fold and 1.77-fold that for non-resistant strains, respectively). P. aeruginosa multi-drug resistance independently predicted higher hospital costs with a more than 70% increase per admission compared with non-resistant strains. Prevention of the nosocomial emergence and spread of antimicrobial resistant microorganisms is essential to limit the strong economic impact.

The making of a public health problem: multi-drug resistant tuberculosis in India.

Science.gov (United States)

Engel, Nora C

2013-07-01

This paper examines how actors construct the public problem of multi-drug resistant tuberculosis (MDR-TB) in India. MDR-TB has been framed by the World Health Organization as a pressing, global public health problem. The responses to MDR-TB are complicated as treatment takes longer and is more expensive than routine TB treatment. This is particularly problematic in countries, such as India, with high patient loads, a large and unregulated private sector, weak health systems and potentially high numbers of MDR-TB cases. This paper analyses how actors struggle for control over ownership, causal theories and political responsibility of the public problem of MDR-TB in India. It combines Gusfield's theory on the construction of public problems with insights from literature on the social construction of diseases and on medical social control. It highlights that there are flexible definitions of public problems, which are negotiated among actor groups and which shift over time. The Indian government has shifted its policy in recent years and acknowledged that MDR-TB needs to be dealt with within the TB programme. The study results reveal how the policy shift happened, why debates on the construction of MDR-TB as a public problem in India continue, and why actors with alternative theories than the government do not succeed in their lobbying efforts. Two main arguments are put forward. First, the construction of the public problem of MDR-TB in India is a social and political process. The need for representative data, international influence and politics define what is controllable. Second, the government seems to be anxious to control the definition of India's MDR-TB problem. This impedes an open, critical and transparent discussion on the definition of the public problem of MDR-TB, which is important in responding flexibly to emerging public health challenges.

Transmission pattern of drug-resistant tuberculosis and its implication for tuberculosis control in eastern rural China.

Directory of Open Access Journals (Sweden)

Yi Hu

Full Text Available OBJECTIVE: Transmission patterns of drug-resistant Mycobacterium tuberculosis (MTB may be influenced by differences in socio-demographics, local tuberculosis (TB endemicity and efficaciousness of TB control programs. This study aimed to investigate the impact of DOTS on the transmission of drug-resistant TB in eastern rural China. METHODS: We conducted a cross-sectional study of all patients diagnosed with drug-resistant TB over a one-year period in two rural Chinese counties with varying lengths of DOTS implementation. Counties included Deqing, with over 11 years' DOTS implementation and Guanyun, where DOTS was introduced 1 year prior to start of this study. We combined demographic, clinical and epidemiologic information with IS6110-based restricted fragment length polymorphism (RFLP and Spoligotyping analysis of MTB isolates. In addition, we conducted DNA sequencing of resistance determining regions to first-line anti-tuberculosis agents. RESULTS: Of the 223 drug-resistant isolates, 73(32.7% isolates were identified with clustered IS6110RFLP patterns. The clustering proportion among total drug-resistant TB was higher in Guanyun than Deqing (26/101.vs.47/122; p,0.04, but not significantly different among the 53 multidrug-resistant isolates (10/18.vs.24/35; p,0.35. Patients with cavitary had increased risk of clustering in both counties. In Guanyun, patients with positive smear test or previous treatment history had a higher clustering proportion. Beijing genotype and isolates resistant to isoniazid and/or rifampicin were more likely to be clustered. Of the 73 patients with clustered drug-resistant isolates, 71.2% lived in the same or neighboring villages. Epidemiological link (household and social contact was confirmed in 12.3% of the clustered isolates. CONCLUSION: Transmission of drug-resistant TB in eastern rural China is characterized by small clusters and limited geographic spread. Our observations highlight the need for supplementing DOTS

Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

Science.gov (United States)

Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

2017-10-01

Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

Phenotypic and genotypic analysis of anti-tuberculosis drug resistance in Mycobacterium tuberculosis isolates in Myanmar.

Science.gov (United States)

Aung, Wah Wah; Ei, Phyu Win; Nyunt, Wint Wint; Swe, Thyn Lei; Lwin, Thandar; Htwe, Mi Mi; Kim, Kyung Jun; Lee, Jong Seok; Kim, Chang Ki; Cho, Sang Nae; Song, Sun Dae; Chang, Chulhun L

2015-09-01

Tuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar. We determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid). Of 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01). The results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.

Risk factors and mortality associated with default from multidrug-resistant tuberculosis treatment.

Science.gov (United States)

Franke, Molly F; Appleton, Sasha C; Bayona, Jaime; Arteaga, Fernando; Palacios, Eda; Llaro, Karim; Shin, Sonya S; Becerra, Mercedes C; Murray, Megan B; Mitnick, Carole D

2008-06-15

Completing treatment for multidrug-resistant (MDR) tuberculosis (TB) may be more challenging than completing first-line TB therapy, especially in resource-poor settings. The objectives of this study were to (1) identify risk factors for default from MDR TB therapy (defined as prolonged treatment interruption), (2) quantify mortality among patients who default from treatment, and (3) identify risk factors for death after default from treatment. We performed a retrospective chart review to identify risk factors for default from MDR TB therapy and conducted home visits to assess mortality among patients who defaulted from such therapy. Sixty-seven (10.0%) of 671 patients defaulted from MDR TB therapy. The median time to treatment default was 438 days (interquartile range, 152-710 days), and 27 (40.3%) of the 67 patients who defaulted from treatment had culture-positive sputum at the time of default. Substance use (hazard ratio, 2.96; 95% confidence interval, 1.56-5.62; P = .001), substandard housing conditions (hazard ratio, 1.83; 95% confidence interval, 1.07-3.11; P = .03), later year of enrollment (hazard ratio, 1.62, 95% confidence interval, 1.09-2.41; P = .02), and health district (P = .02) predicted default from therapy in a multivariable analysis. Severe adverse events did not predict default from therapy. Forty-seven (70.1%) of 67 patients who defaulted from therapy were successfully traced; of these, 25 (53.2%) had died. Poor bacteriologic response, default, low education level, and diagnosis with a psychiatric disorder significantly predicted death after default in a multivariable analysis. The proportion of patients who defaulted from MDR TB treatment was relatively low. The large proportion of patients who had culture-positive sputum at the time of treatment default underscores the public health importance of minimizing treatment default. Prognosis for patients who defaulted from therapy was poor. Interventions aimed at preventing treatment default may

Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition

Directory of Open Access Journals (Sweden)

Morales Eva

2012-05-01

Full Text Available Abstract Background We aimed to assess the hospital economic costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. Methods A retrospective study of all hospital admissions between January 1, 2005, and December 31, 2006 was carried out in a 420-bed, urban, tertiary-care teaching hospital in Barcelona (Spain. All patients with a first positive clinical culture for P. aeruginosa more than 48 h after admission were included. Patient and hospitalization characteristics were collected from hospital and microbiology laboratory computerized records. According to antibiotic susceptibility, isolates were classified as non-resistant, resistant and multi-drug resistant. Cost estimation was based on a full-costing cost accounting system and on the criteria of clinical Activity-Based Costing methods. Multivariate analyses were performed using generalized linear models of log-transformed costs. Results Cost estimations were available for 402 nosocomial incident P. aeruginosa positive cultures. Their distribution by antibiotic susceptibility pattern was 37.1% non-resistant, 29.6% resistant and 33.3% multi-drug resistant. The total mean economic cost per admission of patients with multi-drug resistant P. aeruginosa strains was higher than that for non-resistant strains (15,265 vs. 4,933 Euros. In multivariate analysis, resistant and multi-drug resistant strains were independently predictive of an increased hospital total cost in compared with non-resistant strains (the incremental increase in total hospital cost was more than 1.37-fold and 1.77-fold that for non-resistant strains, respectively. Conclusions P. aeruginosa multi-drug resistance independently predicted higher hospital costs with a more than 70% increase per admission compared with non-resistant strains. Prevention of the nosocomial emergence and spread of antimicrobial resistant microorganisms is essential to limit the strong economic impact.

Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

Science.gov (United States)

Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

2018-02-27

The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

Genotypes of Mycobacterium tuberculosis in patients at risk of drug resistance in Bolivia.

Science.gov (United States)

Monteserin, Johana; Camacho, Mirtha; Barrera, Lucía; Palomino, Juan Carlos; Ritacco, Viviana; Martin, Anandi

2013-07-01

Bolivia ranks among the 10 Latin American countries with the highest rates of tuberculosis (TB) and multidrug resistant (MDR) TB. In view of this, and of the lacking information on the population structure of Mycobacterium tuberculosis in the country, we explored genotype associations with drug resistance and clustering by analyzing isolates collected in 2010 from 100 consecutive TB patients at risk of drug resistance in seven of the nine departments in which Bolivia is divided. Fourteen isolates were MDR, 29 had other drug resistance profiles, and 57 were pansusceptible. Spoligotype family distribution was: Haarlem 39.4%, LAM 26.3%, T 22.2%, S 2.0%, X 1.0%, orphan 9.1%, with very low intra-family diversity and absence of Beijing genotypes. We found 66 different MIRU-VNTR patterns; the most frequent corresponded to Multiple Locus Variable Analysis (MLVA) MtbC15 patterns 860, 372 and 873. Twelve clusters, each with identical MIRU-VNTR and spoligotypes, gathered 35 patients. We found no association of genotype with drug resistant or MDR-TB. Clustering associated with SIT 50 and the H3 subfamily to which it belongs (pBolivia. However, results should be taken cautiously because the sample is small and includes a particular subset of M. tuberculosis population. Copyright © 2013 Elsevier B.V. All rights reserved.

Impact of diabetes on treatment outcomes and long-term survival in multidrug-resistant tuberculosis.

Science.gov (United States)

Kang, Young Ae; Kim, Song Yee; Jo, Kyung-Wook; Kim, Hee Jin; Park, Seung-Kyu; Kim, Tae-Hyung; Kim, Eun Kyung; Lee, Ki Man; Lee, Sung Soon; Park, Jae Seuk; Koh, Won-Jung; Kim, Dae Yun; Shim, Tae Sun

2013-01-01

Few studies have investigated the impact of diabetes mellitus (DM), a globally increasing metabolic disease, on treatment outcomes and long-term survival in patients with multidrug-resistant forms of tuberculosis (MDR-TB). We analyzed outcomes in a large cohort to assess the impact of DM on treatment outcomes of patients with MDR-TB. MDR-TB patients newly diagnosed or retreated between 2000 and 2002 and followed for 8-11 years were retrospectively analyzed with respect to the effect of DM as a comorbidity on their treatment outcome and long-term survival. Of 1,407 patients with MDR-TB, 239 (17.0%) had coexisting DM. The mean age and body mass index were higher in MDR-TB patients with DM [MDR-TBDM(+)] than in those without DM [MDR-TBDM(-)]. Patients with MDR-TB and a comorbidity of DM had a significantly lower treatment success rate than those without a history of DM (36.0 vs. 47.2%, p = 0.002). In addition, DM was the negative predictor for MDR-TB treatment success in multivariate analyses [odds ratio 0.51, 95% confidence interval (CI) 0.26-0.99]. Mean survival times were also lower in MDR-TBDM(+) than in MDR-TBDM(-) patients (102 vs. 114 months, p = 0.001), with DM as a significant predictor of poor long-term survival in multivariate analyses (hazard ratio 1.59, 95% CI 1.01-2.50). Among MDR-TB patients, DM was a relatively common comorbidity. In patients undergoing treatment for MDR-TB and followed for 8-11 years, it was found to be independently associated with an increased risk of both treatment failure and death. Copyright © 2013 S. Karger AG, Basel.

plasmid mediated resistance in multidrug resistant bacteria isolated

African Journals Online (AJOL)

User

PLASMID MEDIATED RESISTANCE IN MULTIDRUG RESISTANT BACTERIA. ISOLATED FROM CHILDREN WITH SUSPECTED SEPTICAEMIA IN ZARIA,. NIGERIA. AbdulAziz, Z. A.,1* Ehinmidu, J. O.,1 Adeshina, G. O.,1 Pala, Y. Y2., Yusuf, S. S2. and. Bugaje, M. A.3. 1Department of Pharmaceutics and Pharmaceutical ...

Resistance patterns and trends of extensively drug-resistant tuberculosis: 5-year experience

Directory of Open Access Journals (Sweden)

Amresh Kumar Singh

2013-12-01

Full Text Available Objective:Extensively drug-resistant tuberculosis (XDR-TB strains were emerged when multidrug-resistant TB (MDR- TB was inadequately treated. Inadequate treatment of MDR-TB cases may result in additional resistance especially non-XDR-TB and then XDR-TB. The aim of this study was to know the prevalence, resistance patterns and trends of the XDR-TB strains among the MDR-TB at a tertiary care hospital in Lucknow, India Methods: A total of 430 Mycobacterium isolates were underwent NAP test and TB MPT64 Ag test for the identification of Mycobacterium tuberculosis complex (MTBC. Drug-susceptibility test (DST was performed over MTBC for the first line drugs by 1% proportion method (Bactec and for the second-line drugs by 1% proportion method (Lowenstein- Jensen media. The XDR-TB status was further confirmed by line probe assay (GenoType® MTBDRsl assay. Results: Among the 430 isolates of mycobacterium, 365 (84.9% were MTBC and 139 (38.1% were MDR-TB respectively. Further 97 MDR-TB from “highly suspected drug resistant-TB (DR-TB” cases among MDR-TB were tested with second line drugs in which 15 (15.5% XDR-TB and 82 (84.5% were non-XDR-TB. Regarding XDR-TB status, using the 1% proportion method a 100% agreement was seen with the GenoType® MTBDRsl assay. Resistance patterns of XDR-TB were as; 10/15 (66.7% as isoniazid + rifampicin + ciprofloxacin + amikacin resistance and 5/15 (33.3% as isoniazid + rifampicin + ciprofloxacin + amikacin + kanamycin resistance. Conclusion:The prevalence of XDR-TB was 15.5% among MDR-TB. Hence laboratory testing of “highly suspected drug resistant-TB” isolates should be done for both first and second line drugs simultaneously especially in developing countries.J Microbiol Infect Dis 2013;3(4: 169-175

Proteomic analysis of drug-resistant Mycobacterium tuberculosis by one-dimensional gel electrophoresis and charge chromatography.

Science.gov (United States)

Yari, Shamsi; Hadizadeh Tasbiti, Alireza; Ghanei, Mostafa; Shokrgozar, Mohammad Ali; Fateh, Abolfazl; Mahdian, Reza; Yari, Fatemeh; Bahrmand, Ahmadreza

2017-01-01

Multidrug-resistant tuberculosis (MDR-TB) is a form of TB caused by Mycobacterium tuberculosis (M. tuberculosis) that do not respond to, at least, isoniazid and rifampicin, the two most powerful, first-line (or standard) anti-TB drugs. Novel intervention strategies for eliminating this disease were based on finding proteins that can be used for designing new drugs or new and reliable kits for diagnosis. The aim of this study was to compare the protein profiles of MDR-TB with sensitive isolates. Proteomic analysis of M. tuberculosis MDR-TB and sensitive isolates was obtained with ion exchange chromatography coupled with MALDI-TOF-TOF (matrix-assisted laser desorption/ionization) in order to identify individual proteins that have different expression in MDR-TB to be used as a drug target or diagnostic marker for designing valuable TB vaccines or TB rapid tests. We identified eight proteins in MDR-TB isolates, and analyses showed that these proteins are absent in M. tuberculosis-sensitive isolates: (Rv2140c, Rv0009, Rv1932, Rv0251c, Rv2558, Rv1284, Rv3699 and MMP major membrane proteins). These data will provide valuable clues in further investigation for suitable TB rapid tests or drug targets against drug-resistant and sensitive M. tuberculosis isolates.

Retrospective study of tolerability and efficacy of linezolid in patients with multidrug-resistant tuberculosis (1998-2014).

Science.gov (United States)

Ramírez-Lapausa, Marta; Pascual Pareja, José Francisco; Carrillo Gómez, Raquel; Martínez-Prieto, Mónica; González-Ruano Pérez, Patricia; Noguerado Asensio, Arturo

2016-02-01

Although linezolid is known to be effective when used as an adjunct therapy in the treatment of patients with multidrug-resistant tuberculosis (MDR-TB), the clinical experience is limited. In this study the efficacy and adverse effects of linezolid treatment were evaluated. A retrospective study of tolerability and efficacy of linezolid in MDR-TB patients was performed in Madrid, Spain. Demographic characteristics, microbiological and clinical features and data on treatment tolerability were collected. Regimens were constructed with a target of prescribing, at least, five anti-tuberculosis agents likely to be effective. Linezolid, at a dosage of 1200 or 600 mg daily, was included to complete the treatment if no other sensitive drugs were available. Vitamin B6 was used to reduce toxicity. Treatment outcome and clinical status at last contact were compared between patients with linezolid-containing regimens and with those without linezolid-containing regimens. During the period 1998-2014, 55 patients with MDR-TB received treatment. In 21 of these patients, linezolid was added. The median of linezolid administration was 23.9 months (IQT 13.1-24.7). Patients using linezolid showed a greater resistance to drugs, with a median of 6 (IQR 5-7) compared with those who did not use it, with a median of 4 drugs (IQR 3-5) (plinezolid group (73.5 days) did not differ significantly from those in the non-linezolid group (61 days) (p=0.29). There were no significant differences in the outcomes of the two patient groups. There were no reported adverse events in 81% of patients assigned to linezolid therapy. Only four patients developed toxicity attributed to linezolid. The most serious adverse event in these patients was anemia observed in the two patients treated with 1200 mg per day. One of them also developed moderate paresthesia. In both cases the dosage was reduced to 600 mg per day, with improvement of the anemia and paresthesias. No patients stopped linezolid therapy. A daily

Multidrug resistance in tumour cells: characterisation of the multidrug resistant cell line K562-Lucena 1

Directory of Open Access Journals (Sweden)

VIVIAN M. RUMJANEK

2001-03-01

Full Text Available Multidrug resistance to chemotherapy is a major obstacle in the treatment of cancer patients. The best characterised mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein. However, the resistance process is multifactorial. Studies of multidrug resistance mechanisms have relied on the analysis of cancer cell lines that have been selected and present cross-reactivity to a broad range of anticancer agents. This work characterises a multidrug resistant cell line, originally selected for resistance to the Vinca alkaloid vincristine and derived from the human erythroleukaemia cell K562. This cell line, named Lucena 1, overexpresses P-glycoprotein and have its resistance reversed by the chemosensitisers verapamil, trifluoperazine and cyclosporins A, D and G. Furthermore, we demonstrated that methylene blue was capable of partially reversing the resistance in this cell line. On the contrary, the use of 5-fluorouracil increased the resistance of Lucena 1. In addition to chemotherapics, Lucena 1 cells were resistant to ultraviolet A radiation and hydrogen peroxide and failed to mobilise intracellular calcium when thapsigargin was used. Changes in the cytoskeleton of this cell line were also observed.A resistência a múltiplos fármacos é o principal obstáculo no tratamento de pacientes com câncer. O mecanismo responsável pela resistência múltipla mais bem caracterizado envolve a expressão do produto do gene MDR-1, a glicoproteína P. Entretanto, o processo de resistência tem fatores múltiplos. Estudos de mecanismos de resistência m��ltipla a fármacos têm dependido da análise de linhagens celulares tumorais que foram selecionadas e apresentam reatividade cruzada a uma ampla faixa de agentes anti-tumorais. Este trabalho caracteriza uma linhagem celular com múltipla resistência a fármacos, selecionada originalmente pela resistência ao alcalóide de Vinca vincristina e derivado

Evaluation of the geneXpert MTB/RIF assay for early diagnosis of tuberculosis and detection of rifampicin resistance in pulmonary and extrapulmonary specimens

Directory of Open Access Journals (Sweden)

Ali Albay

2016-09-01

Conclusion: GeneXpert MTB / RIF test is an effectual automated molecular diagnostic technique with its successful and reliable performance in early diagnosis of tuberculosis and detecting multi-drug resistant strains. [Cukurova Med J 2016; 41(3.000: 548-553

Molecular Characterization of the Resistance of Mycobacterium ...

African Journals Online (AJOL)

Purpose: To characterize the resistance of Mycobacterium tuberculosis to second line drugs using a line probe assay. Methods: Multi-drug resistant strains of Mycobacterium tuberculosis isolated between December 2008 and December 2009 were tested for resistance to fluoroquinolones and second-line injectable drugs ...

A Faropenem, Linezolid, and Moxifloxacin Regimen for Both Drug-Susceptible and Multidrug-Resistant Tuberculosis in Children: FLAME Path on the Milky Way.

Science.gov (United States)

Deshpande, Devyani; Srivastava, Shashikant; Nuermberger, Eric; Pasipanodya, Jotam G; Swaminathan, Soumya; Gumbo, Tawanda

2016-11-01

 The regimen of linezolid and moxifloxacin was found to be efficacious in the hollow fiber system model of pediatric intracellular tuberculosis. However, its kill rate was slower than the standard 3-drug regimen of isoniazid, rifampin, and pyrazinamide. We wanted to examine the effect of adding a third oral agent, faropenem, to this dual combination.  We performed a series of studies in the hollow fiber system model of intracellular Mycobacterium tuberculosis, by mimicking pediatric pharmacokinetics of each antibiotic. First, we varied the percentage of time that faropenem persisted above minimum inhibitory concentration (T MIC ) on the moxifloxacin-linezolid regimen. After choosing the best faropenem exposure, we performed experiments in which we varied the moxifloxacin and linezolid doses in the triple regimen. Finally, we performed longer-duration therapy validation experiments. Bacterial burden was quantified using both colony-forming units per milliliter (CFU/mL) and time to positivity (TTP). Kill slopes were modeled using exponential regression.  TTP was a more sensitive measure of bacterial burden than CFU/mL. A faropenem T MIC > 62% was associated with steepest microbial kill slope. Regimens of standard linezolid and moxifloxacin plus faropenem T MIC > 60%, as well as higher-dose moxifloxacin, achieved slopes equivalent to those of the standard regimen based by both TTP and CFU/mL over 28 days of treatment.  We have developed an oral faropenem-linezolid-moxifloxacin (FLAME) regimen that is free of first-line drugs. The regimen could be effective against both multidrug-resistant and drug-susceptible tuberculosis in children. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

[Impact of fluoroquinolone use on multidrug-resistant bacteria emergence].

Science.gov (United States)

Nseir, S; Ader, F; Marquette, C-H; Durocher, A

2005-01-01

During the last two decades, fluoroquinolone use has significantly increased in Europe and in the USA. This could be explained by the arrival of newer fluoroquinolones with antipneumoccal activity. Increased use of fluoroquinolones is associated with higher rates of bacterial resistance to these antibiotics. Resistance of Gram-negative bacilli to fluoroquinolones is increasing in industrialized countries. In addition, fluoroquinolone use has been identified as a risk factor for colonization and infection to methicillin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumanni, extending-spectrum beta-lactamase producing Gram negative bacilli, and multidrug-resistant bacteria. Nosocomial infections due to multidrug-resistant bacteria are associated with higher mortality and morbidity rates. This could be related to more frequent inappropriate initial antibiotic treatment in these patients. Limiting the use of fluoroquinolones, limiting the duration of treatment with fluoroquinolones, and using appropriate dosage of these antibiotics could be suggested to reduce resistance to these antibiotics and to reduce the emergence of multidrug-resistant bacteria.

Survival of civilian and prisoner drug-sensitive, multi- and extensive drug- resistant tuberculosis cohorts prospectively followed in Russia.

Directory of Open Access Journals (Sweden)

Yanina Balabanova

Full Text Available OBJECTIVE AND METHODS: A long-term observational study was conducted in Samara, Russia to assess the survival and risk factors for death of a cohort of non-multidrug resistant tuberculosis (non-MDRTB and multidrug resistant tuberculosis (MDRTB civilian and prison patients and a civilian extensive drug-resistant tuberculosis (XDRTB cohort. RESULTS: MDRTB and XDRTB rates of 54.8% and 11.1% were identified in the region. Half (50% of MDRTB patients and the majority of non-MDRTB patients (71% were still alive at 5 years. Over half (58% of the patients died within two years of establishing a diagnosis of XDRTB. In the multivariate analysis, retreatment (HR = 1.61, 95%CI 1.04, 2.49 and MDRTB (HR = 1.67, 95%CI 1.17, 2.39 were significantly associated with death within the non-MDR/MDRTB cohort. The effect of age on survival was relatively small (HR = 1.01, 95%CI 1.00, 1.02. No specific factor affected survival of XDRTB patients although median survival time for HIV-infected versus HIV-negative patients from this group was shorter (185 versus 496 days. The majority of MDRTB and XDRTB strains (84% and 92% respectively strains belonged to the Beijing family. Mutations in the rpoB (codon 531 in 81/92; 88.8%, katG (mutation S315T in 91/92, 98.9% and inhA genes accounted for most rifampin and isoniazid resistance respectively, mutations in the QRDR region of gyrA for most fluroquinolone resistance (68/92; 73.5%. CONCLUSIONS: Alarmingly high rates of XDRTB exist. Previous TB treatment cycles and MDR were significant risk factors for mortality. XDRTB patients' survival is short especially for HIV-infected patients. Beijing family strains comprise the majority of drug-resistant strains.

First and second line drug resistance among treatment naïve pulmonary tuberculosis patients in a district under Revised National Tuberculosis Control Programme (RNTCP in New Delhi

Directory of Open Access Journals (Sweden)

Vithal Prasad Myneedu

2015-12-01

Full Text Available There is limited information of level of drug resistance to first-line and second line anti-tuberculosis agents in treatment naïve pulmonary tuberculosis (PTB patients from the Indian region. Therefore, the present prospective study was conducted to determine the antimicrobial susceptibility to first-line and second line anti-TB drug resistance in such patients. Sputum samples from consecutive treatment naïve PTB cases registered in Lala Ram Sarup (LRS district, under RNTCP containing 12 Directly Observed Treatment Centre’s (DOTS, were enrolled using cluster sampling technology. A total of 453 samples were received from July 2011 to June 2012. All samples were cultured on solid medium followed by drug susceptibility to first and second line anti-tubercular drugs as per RNTCP guidelines. Primary multi-drug resistance (MDR was found to be 18/453; (4.0%. Extensively drug resistance (XDR was found in one strain (0.2%, which was found to be resistant to other antibiotics. Data of drug resistant tuberculosis among treatment naïve TB patients are lacking in India. The presence of XDR-TB and high MDR-TB in small population studied, calls for conducting systematic multi-centric surveillance across the country.

Mycobacterium tuberculosis Complex Genotype Diversity and Drug Resistance Profiles in a Pediatric Population in Mexico

Directory of Open Access Journals (Sweden)

Mercedes Macías Parra

2011-01-01

Full Text Available The aim of this study was to determine the frequency of drug resistance and the clonality of genotype patterns in M. tuberculosis clinical isolates from pediatric patients in Mexico (n=90 patients from 19 states; time period—January 2002 to December 2003. Pulmonary disease was the most frequent clinical manifestation (71%. Children with systemic tuberculosis (TB were significantly younger compared to patients with localized TB infections (mean 7.7±6.2 years versus 15±3.4 years P=0.001. Resistance to any anti-TB drug was detected in 24/90 (26.7% of the isolates; 21/90 (23.3% and 10/90 (11.1% were resistant to Isoniazid and Rifampicin, respectively, and 10/90 (11.1% strains were multidrug-resistant (MDR. Spoligotyping produced a total of 55 different patterns; 12/55 corresponded to clustered isolates (n=47, clustering rate of 52.2%, and 43/55 to unclustered isolates (19 patterns were designated as orphan by the SITVIT2 database. Database comparison led to designation of 36 shared types (SITs; 32 SITs (n=65 isolates matched a preexisting shared type in SITVIT2, whereas 4 SITs (n=6 isolates were newly created. Lineage classification based on principal genetic groups (PGG revealed that 10% of the strains belonged to PGG1 (Bovis and Manu lineages. Among PGG2/3 group, the most predominant clade was the Latin-American and Mediterranean (LAM in 27.8% of isolates, followed by Haarlem and T lineages. The number of single drug-resistant (DR and multidrug-resistant (MDR-TB isolates in this study was similar to previously reported in studies from adult population with risk factors. No association between the spoligotype, age, region, or resistance pattern was observed. However, contrary to a study on M. tuberculosis spoligotyping in Acapulco city that characterized a single cluster of SIT19 corresponding to the EAI2-Manila lineage in 70 (26% of patients, not a single SIT19 isolate was found in our pediatric patient population. Neither did we find any

Multidrug-Resistant Tuberculosis and Its Association with Adrenal Insufficiency: Assessment with the Low-Dose ACTH Stimulation Test

Directory of Open Access Journals (Sweden)

René Rodríguez-Gutiérrez

2016-01-01

Full Text Available Background. Multidrug-resistant tuberculosis (MDR-TB is a major public health care concern that affects the life of millions of people around the world. The association of tuberculosis and adrenal insufficiency is well known; however, it is thought to be less prevalent every time. A spike in TB incidence and a lack of evidence of this association in patients with MDR-TB call for reassessment of an illness (adrenal dysfunction that if not diagnosed could seriously jeopardize patients’ health. Objective. To determine the prevalence of adrenocortical insufficiency in patients with MDR-TB using the low-dose (1 μg ACTH stimulation test at baseline and at 6–12 months of follow-up after antituberculosis treatment and culture conversion. Methods. A total of 48 men or women, aged ≥18 years (HIV-negative patients diagnosed with pulmonary MDR-TB were included in this prospective observational study. Blood samples for serum cortisol were taken at baseline and 30 and 60 minutes after 1 μg ACTH stimulation at our tertiary level university hospital before and after antituberculosis treatment. Results. Forty-seven percent of subjects had primary MDR-TB; 43.8% had type 2 diabetes; none were HIV-positive. We found at enrollment 2 cases (4.2% of adrenal insufficiency taking 500 nmol/L as the standard cutoff point value and 4 cases (8.3% alternatively, using 550 nmol/L. After antituberculosis intensive phase drug-treatment and a negative mycobacterial culture (10.2±3.6 months adrenocortical function was restored in all cases. Conclusions. In patients with MDR-TB, using the low-dose ACTH stimulation test, a low prevalence of mild adrenal insufficiency was observed. After antituberculosis treatment adrenal function was restored in all cases. Given the increasing and worrying epidemic of MDR-TB these findings have important clinical implications that may help clinicians and patients make better decisions when deciding to test for adrenocortical

Drug-resistant tuberculosis in HIV-infected patients in a national referral hospital, Phnom Penh, Cambodia

Directory of Open Access Journals (Sweden)

Genevieve Walls

2015-01-01

Full Text Available Background and objective: There are no recent data on the prevalence of drug-resistant tuberculosis (DR TB in Cambodia. We aim to describe TB drug resistance amongst adults with pulmonary and extra-pulmonary TB and human immunodeficiency virus (HIV co-infection in a national referral hospital in Phnom Penh, Cambodia. Design: Between 22 November 2007 and 30 November 2009, clinical specimens from HIV-infected patients suspected of having TB underwent routine microscopy, Mycobacterium tuberculosis culture, and drug susceptibility testing. Laboratory and clinical data were collected for patients with positive M. tuberculosis cultures. Results: M. tuberculosis was cultured from 236 HIV-infected patients. Resistance to any first-line TB drug occurred in 34.7% of patients; 8.1% had multidrug resistant tuberculosis (MDR TB. The proportion of MDR TB amongst new patients and previously treated patients was 3.7 and 28.9%, respectively (p<0.001. The diagnosis of MDR TB was made after death in 15.8% of patients; in total 26.3% of patients with MDR TB died. The diagnosis of TB was established by culture of extra-pulmonary specimens in 23.6% of cases. Conclusions: There is significant resistance to first-line TB drugs amongst new and previously treated TB–HIV co-infected patients in Phnom Penh. These data suggest that the prevalence of DR TB in Cambodia may be higher than previously recognised, particularly amongst HIV-infected patients. Additional prevalence studies are needed. This study also illustrates the feasibility and utility of analysis of non-respiratory specimens in the diagnosis of TB, even in low-resource settings, and suggests that extra-pulmonary specimens should be included in TB diagnostic algorithms.

[Establishment of human multidrug-resistant lung carcinoma cell line (D6/MVP)].

Science.gov (United States)

Ma, Sheng-lin; Feng, Jian-guo; Gu, Lin-hui; Ling, Yu-tian

2003-03-01

To establish human multidrug-resistant lung carcinoma cell line (D6/MVP) with its characteristics studied. Intermittent administration of high-dose MMC, VDS and DDP (MVP) was used to induce human lung carcinoma cell line (D6) to a multidrug-resistant variety (D6/MVP). MTT assay was used to study the multidrug resistance of D6/MVP to multianticarcinogen. Flow cytometry was used to study the cell cycle distribution and the expression of P-gp, multidrug resistance-associated protein (MRP) and GSH/GST. 1. D6/MVP was resistant to many anti-tumor agents, with the IC(50) 13.3 times higher and the drug resistance 2 - 6 times higher than D6, 2. The multiplication time of D6/MVP was prolonged and the cell number of S-phase decreased while that of G1- and G(2)-phase increased and 3. The expression of P-gp and MRP was enhanced significantly (96.2% vs 51.7%), but the expression of GSH/GST kept stable. D6/MVP is a multidrug-resistant cell line possessing the basic characteristics of drug-resistance.

Multidrug-Resistant Candida: Epidemiology, Molecular Mechanisms, and Treatment.

Science.gov (United States)

Arendrup, Maiken Cavling; Patterson, Thomas F

2017-08-15

Invasive Candida infections remain an important cause of morbidity and mortality, especially in hospitalized and immunocompromised or critically ill patients. A limited number of antifungal agents from only a few drug classes are available to treat patients with these serious infections. Resistance can be either intrinsic or acquired. Resistance mechanisms are not exchanged between Candida; thus, acquired resistance either emerges in response to an antifungal selection pressure in the individual patient or, more rarely, occur due to horizontal transmission of resistant strains between patients. Although multidrug resistance is uncommon, increasing reports of multidrug resistance to the azoles, echinocandins, and polyenes have occurred in several Candida species, most notably Candida glabrata and more recently Candida auris. Drivers are overall antifungal use, subtherapeutic drug levels at sites of infection/colonization, drug sequestration in the biofilm matrix, and, in the setting of outbreaks, suboptimal infection control. Moreover, recent research suggests that DNA mismatch repair gene mutations may facilitate acquisition of resistance mutations in C. glabrata specifically. Diagnosis of antifungal-resistant Candida infections is critical to the successful management of patients with these infections. Reduction of unnecessary use of antifungals via antifungal stewardship is critical to limit multidrug resistance emergence. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

Directory of Open Access Journals (Sweden)

Marie Sylvianne Rabodoarivelo

2018-01-01

Full Text Available Background: In low-income countries, rapid detection of tuberculosis (TB drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF and isoniazid (INH resistance. Methods: This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. Results: From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Conclusion: Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study.

Science.gov (United States)

Rabodoarivelo, Marie Sylvianne; Brandao, A; Cergole Novella, M C; C Bombonatte, A G; Imperiale, B; Rakotosamimanana, N; Morcillo, N; Rasolofo, V; Palomino, J C; Martin, A

2018-01-01

In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

Radiologic diagnosis of lung tuberculosis

International Nuclear Information System (INIS)

Eisenhuber, E.; Mostbeck, G.; Bankier, A.; Stadler, A.; Rumetshofer, R.

2007-01-01

The radiologic knowledge of tuberculosis-associated lung disease is an essential tool in the clinical diagnosis of tuberculosis. Chest radiography is the primary imaging method, but the importance of CT is still increasing, as CT is more sensitive in the detection of cavitation, of hilar and mediastinal lymphadenopathie, of endobronchial spread and of complications in the course of the disease. In addition, CT has been proven as a valuable technique in the assessment of tuberculosis activity, especially in patients where M. tuberculosis has not been detected in the sputum or in patients with multidrug-resistant tuberculosis. Depending on the immune status of the patient, the morphologic spectrum of tuberculosis is quite variable. Early diagnosis of tuberculosis is essential to prevent further spread of the disease. (orig.) [de

[Tuberculosis and drug-resistance tuberculosis in prisoners. Colombia, 2010-2012].

Science.gov (United States)

Gómez, Ingrid T; Llerena, Claudia R; Zabaleta, Angie P

2015-01-01

To characterize tuberculosis drug-resistance using anti-tuberculosis drug-sensitivity tests in Colombian prisoners. Descriptive-retrospective analyses were performed on cases of tuberculosis in prisoners. Samples were evaluated by the National Reference Laboratory. Conditions like gender, TB/VIH co-infection and drug-resistance were evaluated. Anti-tuberculosis drug-sensitivity tests were carried out on 72 prisoners. Results showed a distribution of 90.7 % of cases in males and 9.3 % of cases in females. 12 % of cases were TB/VIH co-infections, 94 % of the cases had not received any anti-tuberculosis treatment before, six isolates were drug-resistant corresponding to 8.8 % of total cases, and two cases were multi drug-resistant representing 1.3 % of the cases. Of the drug-resistant cases, 83.3 % were TB/VIH co-infected. Previously treated cases corresponded to 5.6 % of the total cases analyzed. One case with TB/VIH co-infection and rifampicin resistance was observed, representing 1.3 % of the total cases. The government must create a clear policy for prisoners in Colombia, because a high rate of disease in prisoners was observed. In addition, the results showed an association between drug-resistance and TB/VIH co-infection. Overcrowding and low quality of life in penitentiaries could become an important public health problem.

Antimicrobial Activity of Actinomycetes Against Multidrug Resistant ...

African Journals Online (AJOL)

Antimicrobial Activity of Actinomycetes Against Multidrug Resistant Staphylococcus aureus, E. coli and Various Other Pathogens. ... Purpose: The rapid emergence of drug resistance among pathogenic bacteria, especially multidrugresistant bacteria, underlines the need to look for new antibiotics. Methods: In the present ...

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

Multidrug resistance in pediatric urinary tract infections.

Science.gov (United States)

Gaspari, Romolo J; Dickson, Eric; Karlowsky, James; Doern, Gary

2006-01-01

Urinary tract infections (UTIs) represent a common infection in the pediatric population. Escherichia coli is the most common uropathogen in children, and antimicrobial resistance in this species complicates the treatment of pediatric UTIs. Despite the impact of resistance on empiric antibiotic choice, there is little data on multidrug resistance in pediatric patients. In this paper, we describe characteristics of multidrug-resistant E. coli in pediatric patients using a large national database of uropathogens antimicrobial sensitivities. Antimicrobial susceptibility patterns to commonly prescribed antibiotics were performed on uropathogens isolated from children presenting to participating hospitals between 1999 and 2001. Data were analyzed separately for four pediatric age groups. Single and multidrug resistance to ampicillin, amoxicillin-clavulanate, cefazolin, ciprofloxacin, nitrofurantoin, and trimethoprim-sulfamethoxazole (TMP-SMX) were performed on all specimens. There were a total of 11,341 E. coli urine cultures from 343 infants (0-4 weeks), 1,801 toddlers (5 weeks-24 months), 6,742 preteens (2-12 years), and 2,455 teens (13-17 years). E. coli resistance to ampicillin peaked in toddlers (52.8%) but was high in preteens (52.1%), infants (50.4%), and teens (40.6%). Resistance to two or more antibiotics varied across age groups, with toddlers (27%) leading preteens (23.1%), infants (21%), and teens (15.9%). Resistance to three or more antibiotics was low in all age groups (range 3.1-5.2%). The most common co-resistance in all age groups was ampicillin/TMP-SMZ. In conclusion, less than half of all pediatric UTIs are susceptible to all commonly used antibiotics. In some age groups, there is a significant percentage of co-resistance between the two most commonly used antibiotics (ampicillin and TMP-SMZ).

Emergence of fluoroquinolone resistance among drug resistant tuberculosis patients at a tertiary care facility in Karachi, Pakistan.

Science.gov (United States)

Zaidi, Syed Mohammad Asad; Haseeb, Abdul; Habib, Shifa Salman; Malik, Amyn; Khowaja, Saira; SaifUllah, Nausheen; Rizvi, Nadeem

2017-07-25

Pakistan is classified as one of the high multi-drug resistant tuberculosis (MDR-TB) burden countries. A poorly regulated private sector, over-prescription of antibiotics and self-medication has led to augmented rates of drug-resistance in the country. Pakistan's first national anti-tuberculosis drug resistance survey identified high prevalence of fluoroquinolone resistance among MDR-TB patients. Further institutional evidence of fluoroquinolone drug-resistance can support re-evaluation of treatment regimens as well as invigorate efforts to control antibiotic resistance in the country. In this study, data for drug-susceptibility testing (DST) was retrospectively analyzed for a total of 133 patients receiving MDR-TB treatment at the Chest Department of Jinnah Postgraduate Medical Center, Karachi, Pakistan. Frequency analyses for resistance patterns was carried out and association of fluoroquinolone (ofloxacin) resistance with demographics and past TB treatment category were assessed. Within first-line drugs, resistance to isoniazid was detected in 97.7% of cases, followed by rifampicin (96.9%), pyrazinamide (86.4%), ethambutol (69.2%) and streptomycin (64.6%). Within second-line drugs, ofloxacin resistance was detected in 34.6% of cases. Resistance to ethionamide and amikacin was 2.3% and 1.6%, respectively. Combined resistance of oflaxacin and isoniazid was detected in 33.9% of cases. Age, gender and past TB treatment category were not significantly associated with resistance to ofloxacin. Fluoroquinolone resistance was observed in an alarmingly high proportion of MDR-TB cases. Our results suggest caution in their use for empirical management of MDR-TB cases and recommended treatment regimens for MDR-TB may require re-evaluation. Greater engagement of private providers and stringent pharmacy regulations are urgently required.

Tailoring Cytotoxicity of Antimicrobial Peptidomimetics with High Activity against Multidrug-Resistant Escherichia coli

DEFF Research Database (Denmark)

Jahnsen, Rasmus D; Sandberg-Schaal, Anne; Vissing, Karina Juul

2014-01-01

Infections with multidrug-resistant pathogens are an increasing concern for public health. Recently, subtypes of peptide-peptoid hybrids were demonstrated to display potent activity against multidrug-resistant Gram-negative bacteria. Here, structural variation of these antibacterial peptidomimetics...... cells. Thus, lead compounds with a high selectivity toward killing of clinically important multidrug-resistant E. coli were identified....

Genome sequence of Mycobacterium yongonense RT 955-2015 isolate from a patient misdiagnosed with multi-drug resistant tuberculosis: first clinical isolate in Tanzania.

Science.gov (United States)

Mnyambwa, Nicholaus Peter; Kim, Dong-Jin; Ngadaya, Esther; Chun, Jongsik; Ha, Sung-Min; Petrucka, Pammla; Addo, Kennedy Kwasi; Kazwala, Rudovick R; Mfinanga, Sayoki G

2018-04-24

Mycobacterium yongonense is a recently described novel species belonging to Mycobacterium avium complex which is the most prevalent etiology of non-tuberculous mycobacteria associated with pulmonary infections, and posing tuberculosis diagnostic challenges in high-burden, resource-constrained settings. We used whole genome shotgun sequencing and comparative microbial genomic analyses to characterize the isolate from a patient diagnosed with multi-drug resistant tuberculosis (MDR-TB) after relapse. We present a genome sequence of the first case of M. yongonense (M. yongonense RT 955-2015) in Tanzania. Sequence analysis revealed that the RT 955-2015 strain had a high similarity to M. yongonense 05-1390(T) (98.74%) and M. chimaera DSM 44623(T) (98%). Its 16S rRNA showed similarity to M. paraintracellulare KCTC 290849(T) (100%); M. intracellulare ATCC 13950(T) (100%); M. chimaera DSM 44623(T) (99.9%); and M. yongonense 05-1390(T) (98%). The strain had a substantially different rpoB sequence from that of M. yongonense 05-1390 (95.16%) but exhibited a sequence closely related to M. chimaera DSM 44623(T) (99.86%), M. intracellulare ATCC 13950(T) (99.53%), and M. paraintracellulare KCTC 290849(T) (99.53%). In light of the OrthoANI algorithm, and phylogenetic analysis, we conclude that the isolate was M. yongonense Type II genotype, which is an indication that the patient was misdiagnosed with TB/MDR-TB and received inappropriate treatment. Copyright © 2018. Published by Elsevier Ltd.

Psychosocial wellbeing of patients with multidrug resistant tuberculosis voluntarily confined to long-term hospitalisation in Nigeria

Science.gov (United States)

Oladimeji, Olanrewaju; Ushie, Boniface Ayanbekongshie; Udoh, Ekerette Emmanuel; Oladimeji, Kelechi Elizabeth; Ige, Olusoji Mayowa; Obasanya, Olusegun; Lekharu, Daisy; Atilola, Olayinka; Lawson, Lovett; Eltayeb, Osman; Gidado, Mustapha; Tsoka-Gwegweni, Joyce M; Ihekweazu, Chikwe A; Chasela, Charles S

2016-01-01

Background and objective Patient isolation, which is a widely successful treatment strategy for tuberculosis (TB), has been suspected to have effects on patient psychosocial wellbeing. We assessed the psychosocial wellbeing of multidrug resistant TB (MDR-TB) patients in voluntary and isolated long-term hospitalisation in Nigeria. Methods 98 accessible and consenting patients in four drug-resistant treatment centres (University College Hospital and Government Chest Hospital, Ibadan; Mainland Hospital, Lagos, and Lawrence Henshaw Memorial Hospital, Calabar) were enrolled in this study. Data were collected using an 18-item psychosocial wellbeing questionnaire including sociodemographic characteristics. We used descriptive statistics to present demographic characteristics; the χ2 test was used to assess associations between psychosocial wellbeing and independent variables and the relationship was modelled using logistic regression. Results The mean age of respondents was 36.1±11.9 years and 63% were males. Respondents had been in hospital an average of 4.5±1.9 months. Females had more psychosocial concerns compared with males. The most common concerns recorded among respondents were concern that people will get to know that the respondent had a bad type of TB (70%), discontent with being separated from and longing for the company of their marital partner (72%), concerns that they may have taken too many drugs (73%), and displeasure with being unable to continue to engage in their usual social and economic activities (75%). Respondents who were employed had eight times the odds of having more psychosocial concerns than the median number among respondents. Respondents who were supported by their own families during hospitalisation experienced a lower burden of psychosocial concerns compared with those who were supported by third parties. Conclusions Prolonged hospitalisation resulted in significant psychosocial burden for the MDR-TB patients in our study centres

Prevalence of drug-resistant tuberculosis and imputed burden in South Africa: a national and sub-national cross-sectional survey.

Science.gov (United States)

Ismail, Nazir Ahmed; Mvusi, Lindiwe; Nanoo, Ananta; Dreyer, Andries; Omar, Shaheed V; Babatunde, Sanni; Molebatsi, Thabo; van der Walt, Martie; Adelekan, Adeboye; Deyde, Varough; Ihekweazu, Chikwe; Madhi, Shabir A

2018-04-20

Globally, per-capita, South Africa reports a disproportionately high number of cases of multidrug-resistant (MDR) tuberculosis and extensively drug-resistant (XDR) tuberculosis. We sought to estimate the prevalence of resistance to tuberculosis drugs in newly diagnosed and retreated patients with tuberculosis provincially and nationally, and compared these with the 2001-02 estimates. A cross-sectional survey was done between June 15, 2012-June 14, 2014, using population proportionate randomised cluster sampling in the nine provinces in South Africa. 343 clusters were included, ranging between 31 and 48 per province. A patient was eligible for inclusion in the survey if he or she presented as a presumptive case during the intake period at a drug resistance survey enrolling facility. Consenting participants (≥18 years old) completed a questionnaire and had a sputum sample tested for resistance to first-line and second-line drugs. Analysis was by logistic regression with robust SEs, inverse probability weighted against routine data, and estimates were derived using a random effects model. 101 422 participants were tested in 2012-14. Nationally, the prevalence of MDR tuberculosis was 2·1% (95% CI 1·5-2·7) among new tuberculosis cases and 4·6% (3·2-6·0) among retreatment cases. The provincial point prevalence of MDR tuberculosis ranged between 1·6% (95% CI 0·9-2·9) and 5·1% (3·7-7·0). Overall, the prevalence of rifampicin-resistant tuberculosis (4·6%, 95% CI 3·5-5·7) was higher than the prevalence of MDR tuberculosis (2·8%, 2·0-3·6; p=0·01). Comparing the current survey with the previous (2001-02) survey, the overall MDR tuberculosis prevalence was 2·8% versus 2·9% and prevalance of rifampicin-resistant tuberculosis was 3·4% versus 1·8%, respectively. The prevalence of isoniazid mono-resistant tuberculosis was above 5% in all provinces. The prevalence of ethionamide and pyrazinamide resistance among MDR tuberculosis cases was 44·7% (95% CI 25

Multidrug-resistant tuberculosis patients’ views of interventions to reduce treatment loss to follow-up

Science.gov (United States)

Tupasi, T.; Garfin, A. M. C. G.; Mangan, J. M.; Orillaza-Chi, R.; Naval, L. C.; Balane, G. I.; Basilio, R.; Golubkov, A.; Joson, E. S.; Lew, W-J.; Lofranco, V.; Mantala, M.; Pancho, S.; Sarol, J. N.; Blumberg, A.; Burt, D.; Kurbatova, E. V.

2017-01-01

SUMMARY SETTING Patients who initiated treatment for multi-drug-resistant tuberculosis (MDR-TB) at 15 Programmatic Management of Drug-resistant Tuberculosis (PMDT) health facilities in the Philippines between July and December 2012. OBJECTIVES To describe patients’ views of current interventions, and suggest changes likely to reduce MDR-TB loss to follow-up. METHODS In-depth interviews were conducted between April and July 2014 with MDR-TB patients who were undergoing treatment, had finished treatment at the time of the interview (controls), or had been lost to follow-up (LTFU). Responses were thematically analyzed. RESULTS Interviews were conducted with 182 patients who were undergoing or had completed treatment and 91 LTFU patients. Views and suggestions could be thematically categorized as approaches to facilitate adherence or address barriers to adherence. The top themes were the need for transportation assistance or improvements to the current transportation assistance program, food assistance, and difficulties patients encountered related to their medications. These themes were addressed by respectively 63%, 60%, and 32% of the participants. CONCLUSIONS A more patient-centered approach is needed to improve MDR-TB treatment adherence. Programs should strive to provide assistance that considers patient preferences, is adequate to cover actual costs or needs, and is delivered in a timely, uninterrupted manner. PMID:28157461

Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

International Nuclear Information System (INIS)

Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

2017-01-01

Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

Mutual Impact of Diabetes Mellitus and Tuberculosis in China.

Science.gov (United States)

Cheng, Jun; Zhang, Hui; Zhao, Yan Lin; Wang, Li Xia; Chen, Ming Ting

2017-05-01

China has a double burden of diabetes mellitus and tuberculosis, and many studies have been carried out on the mutual impact of these two diseases. This paper systematically reviewed studies conducted in China covering the mutual impact of epidemics of diabetes and tuberculosis, the impact of diabetes on multi-drug resistant tuberculosis and on the tuberculosis clinical manifestation and treatment outcome, the yields of bi-directional screening, and economic evaluation for tuberculosis screening among diabetes patients. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Higher Desolvation Energy Reduces Molecular Recognition in Multi-Drug Resistant HIV-1 Protease

Directory of Open Access Journals (Sweden)

Ladislau C. Kovari

2012-05-01

Full Text Available Designing HIV-1 protease inhibitors that overcome drug-resistance is still a challenging task. In this study, four clinical isolates of multi-drug resistant HIV-1 proteases that exhibit resistance to all the US FDA-approved HIV-1 protease inhibitors and also reduce the substrate recognition ability were examined. A multi-drug resistant HIV-1 protease isolate, MDR 769, was co-crystallized with the p2/NC substrate and the mutated CA/p2 substrate, CA/p2 P1’F. Both substrates display different levels of molecular recognition by the wild-type and multi-drug resistant HIV-1 protease. From the crystal structures, only limited differences can be identified between the wild-type and multi-drug resistant protease. Therefore, a wild-type HIV-1 protease and four multi-drug resistant HIV-1 proteases in complex with the two peptides were modeled based on the crystal structures and examined during a 10 ns-molecular dynamics simulation. The simulation results reveal that the multi-drug resistant HIV-1 proteases require higher desolvation energy to form complexes with the peptides. This result suggests that the desolvation of the HIV-1 protease active site is an important step of protease-ligand complex formation as well as drug resistance. Therefore, desolvation energy could be considered as a parameter in the evaluation of future HIV-1 protease inhibitor candidates.

Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol.

Science.gov (United States)

Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

2016-10-17

Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This evaluation is innovative as it combines patient and health system costs, as well as operational modelling in assessing the impact. An economic evaluation nested in a clinical trial with 2 arms will be performed at 4 facilities. The primary outcome measure is incremental cost to the health system of the study regimen compared with the control regimen. Secondary outcome measures are mean incremental costs incurred by patients by treatment outcome; patient costs by category (direct medical costs, transport, food and accommodation costs, and cost of guardians/accompanying persons and lost time); health systems cost by category and drugs; and costs related to serious adverse events. The study has been evaluated and approved by the Ethics Advisory Group of the International Union Against Tuberculosis and Lung Disease; South African Medical Research Ethics Committee; Wits Health Consortium Protocol Review Committee; University of the Witwatersrand Human Research Ethics Committee; University of Kwazulu-Natal Biomedical Research Ethics Committee; St Peter TB Specialized Hospital Ethical Review Committee; AHRI-ALERT Ethical Review Committee, and all participants will provide written informed consent. The results of the economic evaluation will be published in a peer-reviewed journal. ISRCTN78372190. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis.

Science.gov (United States)

Tacconelli, Evelina; Carrara, Elena; Savoldi, Alessia; Harbarth, Stephan; Mendelson, Marc; Monnet, Dominique L; Pulcini, Céline; Kahlmeter, Gunnar; Kluytmans, Jan; Carmeli, Yehuda; Ouellette, Marc; Outterson, Kevin; Patel, Jean; Cavaleri, Marco; Cox, Edward M; Houchens, Chris R; Grayson, M Lindsay; Hansen, Paul; Singh, Nalini; Theuretzbacher, Ursula; Magrini, Nicola

2018-03-01

The spread of antibiotic-resistant bacteria poses a substantial threat to morbidity and mortality worldwide. Due to its large public health and societal implications, multidrug-resistant tuberculosis has been long regarded by WHO as a global priority for investment in new drugs. In 2016, WHO was requested by member states to create a priority list of other antibiotic-resistant bacteria to support research and development of effective drugs. We used a multicriteria decision analysis method to prioritise antibiotic-resistant bacteria; this method involved the identification of relevant criteria to assess priority against which each antibiotic-resistant bacterium was rated. The final priority ranking of the antibiotic-resistant bacteria was established after a preference-based survey was used to obtain expert weighting of criteria. We selected 20 bacterial species with 25 patterns of acquired resistance and ten criteria to assess priority: mortality, health-care burden, community burden, prevalence of resistance, 10-year trend of resistance, transmissibility, preventability in the community setting, preventability in the health-care setting, treatability, and pipeline. We stratified the priority list into three tiers (critical, high, and medium priority), using the 33rd percentile of the bacterium's total scores as the cutoff. Critical-priority bacteria included carbapenem-resistant Acinetobacter baumannii and Pseudomonas aeruginosa, and carbapenem-resistant and third-generation cephalosporin-resistant Enterobacteriaceae. The highest ranked Gram-positive bacteria (high priority) were vancomycin-resistant Enterococcus faecium and meticillin-resistant Staphylococcus aureus. Of the bacteria typically responsible for community-acquired infections, clarithromycin-resistant Helicobacter pylori, and fluoroquinolone-resistant Campylobacter spp, Neisseria gonorrhoeae, and Salmonella typhi were included in the high-priority tier. Future development strategies should focus on

Prevalence and factors associated with tuberculosis treatment ...

African Journals Online (AJOL)

2014-03-01

Mar 1, 2014 ... health care, HIV co-infection and multi-drug resistant tuberculosis (MDRTB) are ... and default, are a public health concern as they are at risk for clinical ..... national recording systems in Brazil, 2003-2008. PLoS. One 2012 ...

Draft genome sequence of a multidrug-resistant Chryseobacterium indologenes isolate from Malaysia

Directory of Open Access Journals (Sweden)

Choo Yee Yu

2016-03-01

Full Text Available Chryseobacterium indologenes is an emerging pathogen which poses a threat in clinical healthcare setting due to its multidrug-resistant phenotype and its common association with nosocomial infections. Here, we report the draft genome of a multidrug-resistant C. indologenes CI_885 isolated in 2014 from Malaysia. The 908,704-kb genome harbors a repertoire of putative antibiotic resistance determinants which may elucidate the molecular basis and underlying mechanisms of its resistant to various classes of antibiotics. The genome sequence has been deposited in DDBJ/EMBL/GenBank under the accession number LJOD00000000. Keywords: Chryseobacterium indologenes, Genome, Multi-drug resistant, blaIND, Next generation sequencing

Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

Science.gov (United States)

ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

2012-01-01

To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

Effectiveness and safety of imipenem/clavulanate and linezolid to treat multidrug and extensively drug-resistant tuberculosis at a referral hospital in Brazil.

Science.gov (United States)

Arbex, M A; Bonini, E H; Kawakame Pirolla, G; D'Ambrosio, L; Centis, R; Migliori, G B

Evidence on effectiveness, safety, and tolerability of imipenem/clavulanate (IC) and linezolid containing regimens to treat multidrug-resistant (MDR-) and extensively drug-resistant tuberculosis (XDR-TB) is scarce. The aim of this observational study is to evaluate the therapeutic contribution of IC and linezolid to manage MDR/XDR-TB cases at the reference centre of São Paulo state, Brazil. Twelve patients (9 males, 1 HIV positive in antiretroviral treatment, 4 MDR, 8 XDR) were treated with IC, 11 of them within linezolid-containing regimens. They all were previously treated with treatment failure, for a median (IQR, interquartile range) of 4.5 (2-6.5) times, having a severe resistance pattern (median number of resistances: 7 (5-8)) and being sputum smear and culture positive. IC and linezolid were prescribed at the dose of 1000mg/day and 600mg/day, respectively. The overall exposure was (median (IQR)) 419 (375.5-658) days for IC and 678 (392-720) days for linezolid. All of them converted their sputum (time to sputum conversion; 60 (37.5-90) days) and culture (75 (60-135) days), and 7 were cured while 5 are still on treatment with a gradually improving clinical picture. While no adverse events were reported for IC, 2 minor side effects, only, were attributed to linezolid (17%); in both cases the drug was re-started without further problems. Our study suggests that IC and linezolid-containing regimens can be used safely and with satisfactory outcomes in reference centres to treat MDR/XDR-TB patients. Copyright © 2016 Sociedade Portuguesa de Pneumologia. Published by Elsevier España, S.L.U. All rights reserved.

Recent developments in the epidemiology and management of tuberculosis – new solutions to old problems?

Directory of Open Access Journals (Sweden)

Thaiss WM

2012-01-01

Full Text Available Wolfgang M Thaiss1, Cornelius C Thaiss2, Christoph A Thaiss31Christian-Albrechts-Universty, Kiel, 2Ludwig-Maximilians-University, Munich, Germany; 3Yale University School of Medicine, New Haven, CT, USAAbstract: Tuberculosis is an ancient human disease that is still a major cause of death and one of the most challenging public health problems worldwide. After decades of stagnancy, new public–private partnerships to fight the disease and the increasing awareness of a vicious circle between the tuberculosis epidemic and the obstruction of economic development have fuelled recent progress in our understanding of the disease. As a result, new strategies to improve management and treatment of tuberculosis have been initiated. At the same time, however, the devastating effect of human immunodeficiency virus on tuberculosis susceptibility and the rapid expansion of multidrug-resistant (MDR tuberculosis threaten to undermine the advances made by tuberculosis management programs. With an estimated 9 million new cases annually, tuberculosis affects a higher number of individuals worldwide than ever before. Here, recent developments in the epidemiology and management of tuberculosis are summarized and an overview is provided of emerging strategies to combat this ancient scourge.Keywords: tuberculosis, epidemiology, management, multidrug resistance, vaccine

Drug Resistance of Mycobacterium tuberculosis Complex among ...

African Journals Online (AJOL)

BACKGROUND: In Burkina Faso, there is no recent data about the level of drug resistance in Mycobacterium tuberculosis strains among newly diagnosed tuberculosis cases. OBJECTIVE: To provide an update of the primary drug resistance of mycobacterium tuberculosis among patients in Burkina faso. METHODS: ...

The emergence and outbreak of multidrug-resistant typhoid fever in China.

Science.gov (United States)

Yan, Meiying; Li, Xinlan; Liao, Qiaohong; Li, Fang; Zhang, Jing; Kan, Biao

2016-06-22

Typhoid fever remains a severe public health problem in developing countries. The emergence of resistant typhoid, particularly multidrug-resistant typhoid infections, highlights the necessity of monitoring the resistance characteristics of this invasive pathogen. In this study, we report a typhoid fever outbreak caused by multidrug-resistant Salmonella enterica serovar Typhi strains with an ACSSxtT pattern. Resistance genes conferring these phenotypes were harbored by a large conjugative plasmid, which increases the threat of Salmonella Typhi and thus requires close surveillance for dissemination of strains containing such genes.

Alarming levels of drug-resistant tuberculosis in HIV-infected patients in metropolitan Mumbai, India.

Science.gov (United States)

Isaakidis, Petros; Das, Mrinalini; Kumar, Ajay M V; Peskett, Christopher; Khetarpal, Minni; Bamne, Arun; Adsul, Balkrishna; Manglani, Mamta; Sachdeva, Kuldeep Singh; Parmar, Malik; Kanchar, Avinash; Rewari, B B; Deshpande, Alaka; Rodrigues, Camilla; Shetty, Anjali; Rebello, Lorraine; Saranchuk, Peter

2014-01-01

Drug-resistant tuberculosis (DR-TB) is a looming threat to tuberculosis control in India. However, no countrywide prevalence data are available. The burden of DR-TB in HIV-co-infected patients is likewise unknown. Undiagnosed and untreated DR-TB among HIV-infected patients is a major cause of mortality and morbidity. We aimed to assess the prevalence of DR-TB (defined as resistance to any anti-TB drug) in patients attending public antiretroviral treatment (ART) centers in greater metropolitan Mumbai, India. A cross-sectional survey was conducted among adults and children ART-center attendees. Smear microscopy, culture and drug-susceptibility-testing (DST) against all first and second-line TB-drugs using phenotypic liquid culture (MGIT) were conducted on all presumptive tuberculosis patients. Analyses were performed to determine DR-TB prevalence and resistance patterns separately for new and previously treated, culture-positive TB-cases. Between March 2013 and January 2014, ART-center attendees were screened during 14135 visits, of whom 1724 had presumptive TB. Of 1724 attendees, 72 (4%) were smear-positive and 202 (12%) had a positive culture for Mycobacterium tuberculosis. Overall DR-TB was diagnosed in 68 (34%, 95% CI: 27%-40%) TB-patients. The proportions of DR-TB were 25% (29/114) and 44% (39/88) among new and previously treated cases respectively. The patterns of DR-TB were: 21% mono-resistant, 12% poly-resistant, 38% multidrug-resistant (MDR-TB), 21% pre-extensively-drug-resistant (MDR-TB plus resistance to either a fluoroquinolone or second-line injectable), 6% extensively drug-resistant (XDR-TB) and 2% extremely drug-resistant TB (XDR-TB plus resistance to any group-IV/V drug). Only previous history of TB was significantly associated with the diagnosis of DR-TB in multivariate models. The burden of DR-TB among HIV-infected patients attending public ART-centers in Mumbai was alarmingly high, likely representing ongoing transmission in the community and

Alarming levels of drug-resistant tuberculosis in HIV-infected patients in metropolitan Mumbai, India.

Directory of Open Access Journals (Sweden)

Petros Isaakidis

Full Text Available BACKGROUND: Drug-resistant tuberculosis (DR-TB is a looming threat to tuberculosis control in India. However, no countrywide prevalence data are available. The burden of DR-TB in HIV-co-infected patients is likewise unknown. Undiagnosed and untreated DR-TB among HIV-infected patients is a major cause of mortality and morbidity. We aimed to assess the prevalence of DR-TB (defined as resistance to any anti-TB drug in patients attending public antiretroviral treatment (ART centers in greater metropolitan Mumbai, India. METHODS: A cross-sectional survey was conducted among adults and children ART-center attendees. Smear microscopy, culture and drug-susceptibility-testing (DST against all first and second-line TB-drugs using phenotypic liquid culture (MGIT were conducted on all presumptive tuberculosis patients. Analyses were performed to determine DR-TB prevalence and resistance patterns separately for new and previously treated, culture-positive TB-cases. RESULTS: Between March 2013 and January 2014, ART-center attendees were screened during 14135 visits, of whom 1724 had presumptive TB. Of 1724 attendees, 72 (4% were smear-positive and 202 (12% had a positive culture for Mycobacterium tuberculosis. Overall DR-TB was diagnosed in 68 (34%, 95% CI: 27%-40% TB-patients. The proportions of DR-TB were 25% (29/114 and 44% (39/88 among new and previously treated cases respectively. The patterns of DR-TB were: 21% mono-resistant, 12% poly-resistant, 38% multidrug-resistant (MDR-TB, 21% pre-extensively-drug-resistant (MDR-TB plus resistance to either a fluoroquinolone or second-line injectable, 6% extensively drug-resistant (XDR-TB and 2% extremely drug-resistant TB (XDR-TB plus resistance to any group-IV/V drug. Only previous history of TB was significantly associated with the diagnosis of DR-TB in multivariate models. CONCLUSION: The burden of DR-TB among HIV-infected patients attending public ART-centers in Mumbai was alarmingly high, likely representing

Study of multidrug resistance and radioresistance

International Nuclear Information System (INIS)

Kang, Yoon Koo; Yoo, Young Do

1999-04-01

We investigated the mechanism of 5-FU, adriamycin, radiation resistance in Korean gastric cancer cells. First we investigated the relation between Rb and multidrug resistance. Rb stable transfectants exhibited 5- to 10- fold more resistance to adriamycin than the control cells. These Rb transfectants showed increased MDR1 expression. We also investigated up-regulation in radiation-resistant tumor tissues. HSP27, MRP-8, GST, and NKEF-B were up-regulated in radiation resistant tumor. Expression of NKEF-B was also increased by radiation exposure in Head and Neck cells. These results demonstrated that NKEF-B is a stress response protein and it may have an important role in radiation resistance

A Salmonella nanoparticle mimic overcomes multidrug resistance in tumours.

Science.gov (United States)

Mercado-Lubo, Regino; Zhang, Yuanwei; Zhao, Liang; Rossi, Kyle; Wu, Xiang; Zou, Yekui; Castillo, Antonio; Leonard, Jack; Bortell, Rita; Greiner, Dale L; Shultz, Leonard D; Han, Gang; McCormick, Beth A

2016-07-25

Salmonella enterica serotype Typhimurium is a food-borne pathogen that also selectively grows in tumours and functionally decreases P-glycoprotein (P-gp), a multidrug resistance transporter. Here we report that the Salmonella type III secretion effector, SipA, is responsible for P-gp modulation through a pathway involving caspase-3. Mimicking the ability of Salmonella to reverse multidrug resistance, we constructed a gold nanoparticle system packaged with a SipA corona, and found this bacterial mimic not only accumulates in tumours but also reduces P-gp at a SipA dose significantly lower than free SipA. Moreover, the Salmonella nanoparticle mimic suppresses tumour growth with a concomitant reduction in P-gp when used with an existing chemotherapeutic drug (that is, doxorubicin). On the basis of our finding that the SipA Salmonella effector is fundamental for functionally decreasing P-gp, we engineered a nanoparticle mimic that both overcomes multidrug resistance in cancer cells and increases tumour sensitivity to conventional chemotherapeutics.

Multidrug resistant bacteria isolated from septic arthritis in horses

Directory of Open Access Journals (Sweden)

Rodrigo G. Motta

Full Text Available ABSTRACT: Septic arthritis is a debilitating joint infectious disease of equines that requires early diagnosis and immediate therapeutic intervention to prevent degenerative effects on the articular cartilage, as well as loss of athletic ability and work performance of the animals. Few studies have investigated the etiological complexity of this disease, as well as multidrug resistance of isolates. In this study, 60 horses with arthritis had synovial fluid samples aseptically collected, and tested by microbiological culture and in vitro susceptibility test (disk diffusion using nine antimicrobials belonging to six different pharmacological groups. Bacteria were isolated in 45 (75.0% samples, as follows: Streptococcus equi subsp. equi (11=18.3%, Escherichia coli (9=15.0%, Staphylococcus aureus (6=10.0%, Streptococcus equi subsp. zooepidemicus (5=8.3%, Staphylococcus intermedius (2=3.3%, Proteus vulgaris (2=3.3%, Trueperella pyogenes (2=3.3%, Pseudomonas aeruginosa (2=3.3%, Klebsiella pneumoniae (1=1.7%, Rhodococcus equi (1=1.7%, Staphylococcus epidermidis (1=1.7%, Klebsiella oxytoca (1=1.7%, Nocardia asteroides (1=1.7%, and Enterobacter cloacae (1=1.7%. Ceftiofur was the most effective drug (>70% efficacy against the pathogens in the disk diffusion test. In contrast, high resistance rate (>70% resistance was observed to penicillin (42.2%, enrofloxacin (33.3%, and amikacin (31.2%. Eleven (24.4% isolates were resistant to three or more different pharmacological groups and were considered multidrug resistant strains. The present study emphasizes the etiological complexity of equine septic arthritis, and highlights the need to institute treatment based on the in vitro susceptibility pattern, due to the multidrug resistance of isolates. According to the available literature, this is the first report in Brazil on the investigation of the etiology. of the septic arthritis in a great number of horses associated with multidrug resistance of the isolates.

CD44-engineered mesoporous silica nanoparticles for overcoming multidrug resistance in breast cancer

International Nuclear Information System (INIS)

Wang, Xin; Liu, Ying; Wang, Shouju; Shi, Donghong; Zhou, Xianguang; Wang, Chunyan; Wu, Jiang; Zeng, Zhiyong; Li, Yanjun; Sun, Jing; Wang, Jiandong; Zhang, Longjiang; Teng, Zhaogang; Lu, Guangming

2015-01-01

Graphical abstract: - Highlights: • CD44-engineered mesoporous silica nanoparticles are synthesized. • The mechanism of CD44-engineered mesoporous silica nanoparticles is revealed. • This new delivery system increased the drug accumulation in vitro and in vivo. • This new delivery system offers an effective approach to treat multidrug resistance. - Abstract: Multidrug resistance is a major impediment for the successful chemotherapy in breast cancer. CD44 is over-expressed in multidrug resistant human breast cancer cells. CD44 monoclonal antibody exhibits anticancer potential by inhibiting proliferation and regulating P-glycoprotein-mediated drug efflux activity in multidrug resistant cells. Thereby, CD44 monoclonal antibody in combination with chemotherapeutic drug might be result in enhancing chemosensitivity and overcoming multidrug resistance. The purpose of this study is to investigate the effects of the CD44 monoclonal antibody functionalized mesoporous silica nanoparticles containing doxorubicin on human breast resistant cancer MCF-7 cells. The data showed that CD44-modified mesoporous silica nanoparticles increased cytotoxicity and enhanced the downregulation of P-glycoprotein in comparison to CD44 antibody. Moreover, CD44-engineered mesoporous silica nanoparticles provided active target, which promoted more cellular uptake of DOX in the resistant cells and more retention of DOX in tumor tissues than unengineered counterpart. Animal studies of the resistant breast cancer xenografts demonstrated that CD44-engineered drug delivery system remarkably induced apoptosis and inhibited the tumor growth. Our results indicated that the CD44-engineered mesoporous silica nanoparticle-based drug delivery system offers an effective approach to overcome multidrug resistance in human breast cancer

MarA-like regulator of multidrug resistance in Yersinia pestis.

Science.gov (United States)

Udani, Rupa A; Levy, Stuart B

2006-09-01

MarA47(Yp) from Yersinia pestis, showing 47% identity to Escherichia coli MarA in its N terminus, caused resistance to antibiotics and to organic solvents when expressed in both E. coli and Y. pestis. Resistance was linked to increased expression of the AcrAB multidrug efflux pump. In four of five spontaneous multidrug-resistant mutants of Y. pestis independently selected by growth on tetracycline, the marA47(Yp) gene was overexpressed. The findings suggest that marA47(Yp) is a marA ortholog in Y. pestis.

Molecular characterization of multidrug-resistant Shigella spp. of food origin.

Science.gov (United States)

Ahmed, Ashraf M; Shimamoto, Tadashi

2015-02-02

Shigella spp. are the causative agents of food-borne shigellosis, an acute enteric infection. The emergence of multidrug-resistant clinical isolates of Shigella presents an increasing challenge for clinicians in the treatment of shigellosis. Several studies worldwide have characterized the molecular basis of antibiotic resistance in clinical Shigella isolates of human origin, however, to date, no such characterization has been reported for Shigella spp. of food origin. In this study, we characterized the genetic basis of multidrug resistance in Shigella spp. isolated from 1600 food samples (800 meat products and 800 dairy products) collected from different street venders, butchers, retail markets, and slaughterhouses in Egypt. Twenty-four out of 27 Shigella isolates (88.9%) showed multidrug resistance phenotypes to at least three classes of antimicrobials. The multidrug-resistant Shigella spp. were as follows: Shigella flexneri (66.7%), Shigella sonnei (18.5%), and Shigella dysenteriae (3.7%). The highest resistance was to streptomycin (100.0%), then to kanamycin (95.8%), nalidixic acid (95.8%), tetracycline (95.8%), spectinomycin (93.6%), ampicillin (87.5%), and sulfamethoxazole/trimethoprim (87.5%). PCR and DNA sequencing were used to screen and characterize integrons and antibiotic resistance genes. Our results indicated that 11.1% and 74.1% of isolates were positive for class 1 and class 2 integrons, respectively. Beta-lactamase-encoding genes were identified in 77.8% of isolates, and plasmid-mediated quinolone resistance genes were identified in 44.4% of isolates. These data provide useful information to better understand the molecular basis of antimicrobial resistance in Shigella spp. To the best of our knowledge, this is the first report of the molecular characterization of antibiotic resistance in Shigella spp. isolated from food. Copyright © 2014 Elsevier B.V. All rights reserved.

Effectiveness and safety of imipenem/clavulanate and linezolid to treat multidrug and extensively drug-resistant tuberculosis at a referral hospital in Brazil

Directory of Open Access Journals (Sweden)

M.A. Arbex

2016-11-01

Full Text Available Evidence on effectiveness, safety, and tolerability of imipenem/clavulanate (IC and linezolid containing regimens to treat multidrug-resistant (MDR- and extensively drug-resistant tuberculosis (XDR-TB is scarce. The aim of this observational study is to evaluate the therapeutic contribution of IC and linezolid to manage MDR/XDR-TB cases at the reference centre of São Paulo state, Brazil. Twelve patients (9 males, 1 HIV positive in antiretroviral treatment, 4 MDR, 8 XDR were treated with IC, 11 of them within linezolid-containing regimens. They all were previously treated with treatment failure, for a median (IQR, interquartile range of 4.5 (2–6.5 times, having a severe resistance pattern (median number of resistances: 7 (5–8 and being sputum smear and culture positive. IC and linezolid were prescribed at the dose of 1000 mg/day and 600 mg/day, respectively. The overall exposure was (median (IQR 419 (375.5–658 days for IC and 678 (392–720 days for linezolid. All of them converted their sputum (time to sputum conversion; 60 (37.5–90 days and culture (75 (60–135 days, and 7 were cured while 5 are still on treatment with a gradually improving clinical picture.While no adverse events were reported for IC, 2 minor side effects, only, were attributed to linezolid (17%; in both cases the drug was re-started without further problems. Our study suggests that IC and linezolid-containing regimens can be used safely and with satisfactory outcomes in reference centres to treat MDR/XDR-TB patients. Keywords: MDR-TB, XDR-TB, Imipenem, Linezolid, Effectiveness, Safety, Tolerability

Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

Directory of Open Access Journals (Sweden)

Anand Kumar Maurya

2013-01-01

Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

Therapeutic vaccines for tuberculosis-A systematic review

NARCIS (Netherlands)

Gröschel, Matthias I.; Prabowo, Satria A.; Cardona, Pere-Joan; Stanford, John L.; van der Werf, Tjip S.

2014-01-01

For eradication of tuberculosis (TB) by 2050, the declared aim of the Stop TB Partnership, novel treatment strategies are indispensable. The emerging epidemic of multi-drug resistant (MDR) TB has fuelled the debate about TB vaccines, as increasing numbers of patients can no longer be cured by

Potential strategies for the eradication of multidrug-resistant Gram-negative bacterial infections.

Science.gov (United States)

Huwaitat, Rawan; McCloskey, Alice P; Gilmore, Brendan F; Laverty, Garry

2016-07-01

Antimicrobial resistance is one of the leading threats to society. The increasing burden of multidrug-resistant Gram-negative infection is particularly concerning as such bacteria are demonstrating resistance to nearly all currently licensed therapies. Various strategies have been hypothesized to treat multidrug-resistant Gram-negative infections including: targeting the Gram-negative outer membrane; neutralization of lipopolysaccharide; inhibition of bacterial efflux pumps and prevention of protein folding. Silver and silver nanoparticles, fusogenic liposomes and nanotubes are potential strategies for extending the activity of licensed, Gram-positive selective, antibiotics to Gram-negatives. This may serve as a strategy to fill the current void in pharmaceutical development in the short term. This review outlines the most promising strategies that could be implemented to solve the threat of multidrug-resistant Gram-negative infections.

Effect of a comprehensive programme to provide universal access to care for sputum-smear-positive multidrug-resistant tuberculosis in China: a before-and-after study.

Science.gov (United States)

Li, Renzhong; Ruan, Yunzhou; Sun, Qiang; Wang, Xiexiu; Chen, Mingting; Zhang, Hui; Zhao, Yanlin; Zhao, Jin; Chen, Cheng; Xu, Caihong; Su, Wei; Pang, Yu; Cheng, Jun; Chi, Junying; Wang, Qian; Fu, Yunting; Huan, Shitong; Wang, Lixia; Wang, Yu; Chin, Daniel P

2015-04-01

China has a quarter of all patients with multidrug-resistant tuberculosis (MDRTB) worldwide, but less than 5% are in quality treatment programmes. In a before-and-after study we aimed to assess the effect of a comprehensive programme to provide universal access to diagnosis, treatment, and follow-up for MDRTB in four Chinese cities (population 18 million). We designated city-level hospitals in each city to diagnose and treat MDRTB. All patients with smear-positive pulmonary tuberculosis diagnosed in Center for Disease Control (CDC) clinics and hospitals were tested for MDRTB with molecular and conventional drug susceptibility tests. Patients were treated with a 24 month treatment package for MDRTB based on WHO guidelines. Outpatients were referred to the CDC for directly observed therapy. We capped total treatment package cost at US$4644. Insurance reimbursement and project subsidies limited patients' expenses to 10% of charges for services within the package. We compared data from a 12 month programme period (2011) to those from a retrospective survey of all patients with MDRTB diagnosed in the same cities during a baseline period (2006-09). 243 patients were diagnosed with MDRTB or rifampicin-resistant tuberculosis during the 12 month programme period compared with 92 patients (equivalent to 24 per year) during the baseline period. 172 (71%) of 243 individuals were enrolled in the programme. Time from specimen collection for resistance testing to treatment initiation decreased by 90% (from median 139 days [IQR 69-207] to 14 days [10-21]), the proportion of patients who started on appropriate drug regimen increased 2·7 times (from nine [35%] of 26 patients treated to 166 [97%] of 172), and follow-up by the CDC after initial hospitalisation increased 24 times (from one [4%] of 23 patients to 163 [99%] of 164 patients). 6 months after starting treatment, the proportion of patients remaining on treatment increased ten times (from two [8%] of 26 patients to 137 [80

Mutation of Rv2887, a marR-like gene, confers Mycobacterium tuberculosis resistance to an imidazopyridine-based agent.

Science.gov (United States)

Winglee, Kathryn; Lun, Shichun; Pieroni, Marco; Kozikowski, Alan; Bishai, William

2015-11-01

Drug resistance is a major problem in Mycobacterium tuberculosis control, and it is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M. tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor) family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

International Nuclear Information System (INIS)

Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

2004-01-01

To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

Directory of Open Access Journals (Sweden)

Ejaz Qadeer

2017-05-01

Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

Photoexcited quantum dots for killing multidrug-resistant bacteria

Science.gov (United States)

Courtney, Colleen M.; Goodman, Samuel M.; McDaniel, Jessica A.; Madinger, Nancy E.; Chatterjee, Anushree; Nagpal, Prashant

2016-05-01

Multidrug-resistant bacterial infections are an ever-growing threat because of the shrinking arsenal of efficacious antibiotics. Metal nanoparticles can induce cell death, yet the toxicity effect is typically nonspecific. Here, we show that photoexcited quantum dots (QDs) can kill a wide range of multidrug-resistant bacterial clinical isolates, including methicillin-resistant Staphylococcus aureus, carbapenem-resistant Escherichia coli, and extended-spectrum β-lactamase-producing Klebsiella pneumoniae and Salmonella typhimurium. The killing effect is independent of material and controlled by the redox potentials of the photogenerated charge carriers, which selectively alter the cellular redox state. We also show that the QDs can be tailored to kill 92% of bacterial cells in a monoculture, and in a co-culture of E. coli and HEK 293T cells, while leaving the mammalian cells intact, or to increase bacterial proliferation. Photoexcited QDs could be used in the study of the effect of redox states on living systems, and lead to clinical phototherapy for the treatment of infections.

Emergence of Extensively Drug Resistant Tuberculosis

Centers for Disease Control (CDC) Podcasts

Extensively drug-resistant tuberculosis (XDR TB) outbreaks have been reported in South Africa, and strains have been identified on 6 continents. Dr. Peter Cegielski, team leader for drug-resistant TB with the Division of Tuberculosis Elimination at CDC, comments on a multinational team's report on this emerging global public health threat.

High incidence of multidrug-resistant strains of methicill inresistant ...

African Journals Online (AJOL)

Infections of methicillin-resistant Staphylococcus aureus (MRSA) are becoming an increasingly concerning clinical problem. The aim of this study was to assess the development of multidrug resistant strains of MRSA from clinical samples andpossibilities for reducing resistance. This study included a total of seventy-five (75) ...

Multidrug-resistant hepatocellular carcinoma cells are enriched for ...

African Journals Online (AJOL)

Chemotherapy is a main treatment for cancer, while multidrug-resistance is the main reason for chemotherapy failure, and tumor relapse and metastasis. Cancer stem cells or cancer stem-like cells (CSCs) are a small subset of cancer cells, which may be inherently resistant to the cytotoxic effect of chemotherapy.

Progression of chronic pulmonary tuberculosis in mice intravenously infected with ethambutol resistant Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Srivastava S

2008-01-01

Full Text Available Purpose: Ethambutol (EMB is an important first line drug, however little information on its molecular mechanism of resistance and pathogenicity of resistant isolates is available. Present work was designed to study virulence of the EMB resistant M. tuberculosis strains and the host responses in-vivo on infection of EMB resistant M. tuberculosis using Balb/c mouse model of infection. Methods: Three groups of Balb/c mice (female, age 4-6 wk; 21 mice in each group were infected intravenously with 106 CFU of M. tuberculosis H37Rv and two EMB resistant clinical isolates. Age and sex matched control animals were mock inoculated with Middlebrook 7H9 broth alone. At 10, 20, 30, 40, 50, 60, and 70 days post-infection three animals from each group were sacrificed by cervical dislocation and lung tissue was collected for further analysis. Results: Infection with EMB resistant M. tuberculosis led to progressive and chronic disease with significantly high bacillary load (p=0.02. Massive infiltration and exacerbated lung pathology with increased expression of IFN-γ and TNF-α was observed in lungs of mice infected with EMB resistant strains. The present study suggests that infection with EMB resistant M. tuberculosis leads to chronic infection with subsequent loss of lung function, bacterial persistence with elevated expression of TNF-α resulting in increased lung pathology. Conclusion: These findings highlight that EMB resistant M. tuberculosis regulates host immune response differentially and its pathogenicity is different from drug sensitive strains of M. tuberculosis.

Linezolid susceptibility in Helicobacter pylori, including strains with multidrug resistance.

Science.gov (United States)

Boyanova, Lyudmila; Evstatiev, Ivailo; Gergova, Galina; Yaneva, Penka; Mitov, Ivan

2015-12-01

Only a few studies have evaluated Helicobacter pylori susceptibility to linezolid. The aim of the present study was to assess linezolid susceptibility in H. pylori, including strains with double/multidrug resistance. The susceptibility of 53 H. pylori strains was evaluated by Etest and a breakpoint susceptibility testing method. Helicobacter pylori resistance rates were as follows: amoxicillin, 1.9%; metronidazole, 37.7%; clarithromycin, 17.0%; tetracycline, 1.9%; levofloxacin, 24.5%; and linezolid (>4 mg/L), 39.6%. The linezolid MIC50 value was 31.2-fold higher than that of clarithromycin and 10.5-fold higher than that of levofloxacin; however, 4 of 11 strains with double/multidrug resistance were linezolid-susceptible. The MIC range of the oxazolidinone agent was larger (0.125-64 mg/L) compared with those in the previous two reports. The linezolid resistance rate was 2.2-fold higher in metronidazole-resistant strains and in strains resistant to at least one antibiotic compared with the remaining strains. Briefly, linezolid was less active against H. pylori compared with clarithromycin and levofloxacin, and linezolid resistance was linked to resistance to metronidazole as well as to resistance to at least one antibiotic. However, linezolid activity against some strains with double/multidrug resistance may render the agent appropriate to treat some associated H. pylori infections following in vitro susceptibility testing of the strains. Clinical trials are required to confirm this suggestion. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene

NARCIS (Netherlands)

van Veen, HW; Callaghan, R; Soceneantu, L; Sardini, A; Konings, WN; Higgins, CF

1998-01-01

Bacteria have developed many fascinating antibiotic-resistance mechanisms(1,2). A protein in Lactococcus lactis, LmrA, mediates antibiotic resistance by extruding amphiphilic compounds from the inner leaflet of the cytoplasmic membrane(3,4). Unlike other known bacterial multidrug-resistance

Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

Science.gov (United States)

Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

2017-02-01

Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural measurements and cell line studies of the copper-PEG-Rifampicin complex against Mycobacterium tuberculosis.

Science.gov (United States)

Manning, Thomas; Mikula, Rachel; Wylie, Greg; Phillips, Dennis; Jarvis, Jackie; Zhang, Fengli

2015-02-01

The bacterium responsible for tuberculosis is increasing its resistance to antibiotics resulting in new multidrug-resistant Mycobacterium tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB). In this study, several analytical techniques including NMR, FT-ICR, MALDI-MS, LC-MS and UV/Vis are used to study the copper-Rifampicin-Polyethylene glycol (PEG-3350) complex. The copper (II) cation is a carrier for the antibiotic Rifampicin as well as nutrients for the bacterium. The NIH-NIAID cell line containing several Tb strains (including antibiotic resistant strains) is tested against seven copper-PEG-RIF complex variations. Copyright © 2014 Elsevier Ltd. All rights reserved.

The social determinants of tuberculosis and their association with TB ...

African Journals Online (AJOL)

Progress made in TB control through the implementation of the DOTS strategy, has been retarded by factors such as poverty, the HIV pandemic and the advent of multidrug resistant tuberculosis. There is currently an increasing shift in TB control ...

Multidrug Resistant Acinetobacter Infection and Their Antimicrobial ...

African Journals Online (AJOL)

Background: Acinetobacter baumannii, a non-glucose fermenting Gram negative bacillus, has emerged in the last three decades as a major etiological agent of hospital-associated infections giving rise to significant morbidity and mortality particularly in immunocompromised patients. Multidrug resistant A. baumannii ...

Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

Science.gov (United States)

Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

2017-06-01

In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

Risk factors associated with default from multi- and extensively drug-resistant tuberculosis treatment, Uzbekistan: a retrospective cohort analysis.

Science.gov (United States)

Lalor, Maeve K; Greig, Jane; Allamuratova, Sholpan; Althomsons, Sandy; Tigay, Zinaida; Khaemraev, Atadjan; Braker, Kai; Telnov, Oleksander; du Cros, Philipp

2013-01-01

The Médecins Sans Frontières project of Uzbekistan has provided multidrug-resistant tuberculosis treatment in the Karakalpakstan region since 2003. Rates of default from treatment have been high, despite psychosocial support, increasing particularly since programme scale-up in 2007. We aimed to determine factors associated with default in multi- and extensively drug-resistant tuberculosis patients who started treatment between 2003 and 2008 and thus had finished approximately 2 years of treatment by the end of 2010. A retrospective cohort analysis of multi- and extensively drug-resistant tuberculosis patients enrolled in treatment between 2003 and 2008 compared baseline demographic characteristics and possible risk factors for default. Default was defined as missing ≥60 consecutive days of treatment (all drugs). Data were routinely collected during treatment and entered in a database. Potential risk factors for default were assessed in univariate analysis using chi-square test and in multivariate analysis with logistic regression. 20% (142/710) of patients defaulted after a median of 6 months treatment (IQR 2.6-9.9). Factors associated with default included severity of resistance patterns (pre-extensively drug-resistant/extensively drug-resistant tuberculosis adjusted odds ratio 0.52, 95%CI: 0.31-0.86), previous default (2.38, 1.09-5.24) and age >45 years (1.77, 1.10-2.87). The default rate was 14% (42/294) for patients enrolled 2003-2006 and 24% (100/416) for 2007-2008 enrolments (p = 0.001). Default from treatment was high and increased with programme scale-up. It is essential to ensure scale-up of treatment is accompanied with scale-up of staff and patient support. A successful first course of tuberculosis treatment is important; patients who had previously defaulted were at increased risk of default and death. The protective effect of severe resistance profiles suggests that understanding disease severity or fear may motivate against default. Targeted

[Antimicrobial therapy in severe infections with multidrug-resistant Gram-negative bacterias].

Science.gov (United States)

Duszyńska, Wiesława

2010-01-01

Multidrug-resistant Gram-negative bacteria pose a serious and rapidly emerging threat to patients in healthcare settings, and are especially prevalent and problematic in intensive therapy units. Recently, the emergence of pandrug-resistance in Gram-negative bacteria poses additional concerns. This review examines the clinical impact and epidemiology of multidrug-resistant Gram-negative bacteria as a cause of increased morbidity and mortality among ITU patients. Beta-lactamases, cephalosporinases and carbapenemases play the most important role in resistance to antibiotics. Despite the tendency to increased resistance, carbapenems administered by continuous infusion remain the most effective drugs in severe sepsis. Drug concentration monitoring, albeit rarely used in practice, is necessary to ensure an effective therapeutic effect.

Drug efflux proteins in multidrug resistant bacteria

NARCIS (Netherlands)

vanVeen, HW; Konings, WN

Bacteria contain an array of transport proteins in their cytoplasmic membrane. Many of these proteins play an important role in conferring resistance to toxic compounds. The multidrug efflux systems encountered in prokaryotic cells are very similar to those observed in eukaryotic cells. Therefore, a

Bacterial Multidrug Efflux Pumps: Much More Than Antibiotic Resistance Determinants.

Science.gov (United States)

Blanco, Paula; Hernando-Amado, Sara; Reales-Calderon, Jose Antonio; Corona, Fernando; Lira, Felipe; Alcalde-Rico, Manuel; Bernardini, Alejandra; Sanchez, Maria Blanca; Martinez, Jose Luis

2016-02-16

Bacterial multidrug efflux pumps are antibiotic resistance determinants present in all microorganisms. With few exceptions, they are chromosomally encoded and present a conserved organization both at the genetic and at the protein levels. In addition, most, if not all, strains of a given bacterial species present the same chromosomally-encoded efflux pumps. Altogether this indicates that multidrug efflux pumps are ancient elements encoded in bacterial genomes long before the recent use of antibiotics for human and animal therapy. In this regard, it is worth mentioning that efflux pumps can extrude a wide range of substrates that include, besides antibiotics, heavy metals, organic pollutants, plant-produced compounds, quorum sensing signals or bacterial metabolites, among others. In the current review, we present information on the different functions that multidrug efflux pumps may have for the bacterial behaviour in different habitats as well as on their regulation by specific signals. Since, in addition to their function in non-clinical ecosystems, multidrug efflux pumps contribute to intrinsic, acquired, and phenotypic resistance of bacterial pathogens, the review also presents information on the search for inhibitors of multidrug efflux pumps, which are currently under development, in the aim of increasing the susceptibility of bacterial pathogens to antibiotics.

Effect of methylglyoxal on multidrug-resistant Pseudomonas aeruginosa

Directory of Open Access Journals (Sweden)

Katsuhiko eHayashi

2014-04-01

Full Text Available Honey has a complex chemistry, and its broad-spectrum antimicrobial activity varies with floral source, climate, and harvesting conditions. Methylglyoxal was identified as the dominant antibacterial component of manuka honey. Although it has been known that methylglyoxal has antibacterial activity against gram-positive bacteria, including methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus, there is not much information describing its activity against gram-negative bacteria. In this study, we report the effect of methylglyoxal against multidrug-resistant Pseudomonas aeruginosa (MDRP using 53 clinically isolated strains. We also assessed the effect of deleting the five multidrug efflux systems in P. aeruginosa, as well as the efflux systems in Escherichia coli and Salmonella enterica serovar Typhimurium, on MICs of methylglyoxal. Our results indicate that methylglyoxal inhibits the growth of MDRP at concentrations of 128–512 µg/ml (1.7–7.1 mM and is not recognized by drug efflux systems.

Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

Directory of Open Access Journals (Sweden)

Bowers Jolene R

2012-01-01

Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

Regulation of Three Virulence Strategies of Mycobacterium tuberculosis: A Success Story

Science.gov (United States)

van Dam, Jesse C. J.; Martins dos Santos, Vitor A. P.

2018-01-01

Tuberculosis remains one of the deadliest diseases. Emergence of drug-resistant and multidrug-resistant M. tuberculosis strains makes treating tuberculosis increasingly challenging. In order to develop novel intervention strategies, detailed understanding of the molecular mechanisms behind the success of this pathogen is required. Here, we review recent literature to provide a systems level overview of the molecular and cellular components involved in divalent metal homeostasis and their role in regulating the three main virulence strategies of M. tuberculosis: immune modulation, dormancy and phagosomal rupture. We provide a visual and modular overview of these components and their regulation. Our analysis identified a single regulatory cascade for these three virulence strategies that respond to limited availability of divalent metals in the phagosome. PMID:29364195

Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

Directory of Open Access Journals (Sweden)

Ana Teresa P. Carvalho

2014-01-01

Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

Epidemiologic analysis: Prophylaxis and multidrug-resistance in surgery

Directory of Open Access Journals (Sweden)

H. Solís-Téllez

2017-04-01

Conclusions: The prophylactic guidelines are not strictly adhered to in our environment. There was a significant association between the development of nosocomial infections from multidrug-resistant germs and admission to the intensive care unit.

The secondary resistome of multidrug-resistant Klebsiella pneumoniae.

Science.gov (United States)

Jana, Bimal; Cain, Amy K; Doerrler, William T; Boinett, Christine J; Fookes, Maria C; Parkhill, Julian; Guardabassi, Luca

2017-02-15

Klebsiella pneumoniae causes severe lung and bloodstream infections that are difficult to treat due to multidrug resistance. We hypothesized that antimicrobial resistance can be reversed by targeting chromosomal non-essential genes that are not responsible for acquired resistance but essential for resistant bacteria under therapeutic concentrations of antimicrobials. Conditional essentiality of individual genes to antimicrobial resistance was evaluated in an epidemic multidrug-resistant clone of K. pneumoniae (ST258). We constructed a high-density transposon mutant library of >430,000 unique Tn5 insertions and measured mutant depletion upon exposure to three clinically relevant antimicrobials (colistin, imipenem or ciprofloxacin) by Transposon Directed Insertion-site Sequencing (TraDIS). Using this high-throughput approach, we defined three sets of chromosomal non-essential genes essential for growth during exposure to colistin (n = 35), imipenem (n = 1) or ciprofloxacin (n = 1) in addition to known resistance determinants, collectively termed the "secondary resistome". As proof of principle, we demonstrated that inactivation of a non-essential gene not previously found linked to colistin resistance (dedA) restored colistin susceptibility by reducing the minimum inhibitory concentration from 8 to 0.5 μg/ml, 4-fold below the susceptibility breakpoint (S ≤ 2 μg/ml). This finding suggests that the secondary resistome is a potential target for developing antimicrobial "helper" drugs that restore the efficacy of existing antimicrobials.

Virulence and genomic feature of multidrug resistant Campylobacter jejuni isolated from broiler chicken

Directory of Open Access Journals (Sweden)

Haihong Hao

2016-10-01

Full Text Available The aim of this study was to reveal the molecular mechanism involved in multidrug resistance and virulence of Campylobacter jejuni isolated from broiler chickens. The virulence of six multidrug resistant C. jejuni was determined by in vitro and in vivo methods. The de novo whole genome sequencing technology and molecular biology methods were used to analyze the genomic features associated with the multidrug resistance and virulence of a selected isolate (C. jejuni 1655. The comparative genomic analyses revealed a large number of single nucleotide polymorphisms, deletions, rearrangements, and inversions in C. jejuni 1655 compared to reference C. jejuni genomes. The co-emergence of Thr-86-Ile mutation in gyrA gene, A2075G mutation in 23S rRNA gene, tetO, aphA and aadE genes and pTet plasmid in C. jejuni 1655 contributed its multidrug resistance to fluoroquinolones, macrolides, tetracycline and aminoglycosides. The combination of multiple virulence genes may work together to confer the relative higher virulence in C. jejuni 1655. The co-existence of mobile gene elements (e.g. pTet and CRISPR-Cas system in C. jejuni 1655 may play an important role in the gene transfer and immune defense. The present study provides basic information of phenotypic and genomic features of C. jejuni 1655, a strain recently isolated from a chicken displaying multidrug resistance and relatively high level of virulence.

Altered membrane permeability in multidrug resistant Escherichia ...

African Journals Online (AJOL)

The study was conducted with the objective of examining the outer membrane proteins and their involvement during the transport of β - lactams in multidrug resistant Escherichia coli isolated from extra-intestinal infections. Also, the response of gram negative bacterial biomembrane alteration was studied using extended ...

Mutations in rpoB and katG genes of multidrug resistant ...

African Journals Online (AJOL)

Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

High Rate of Hypothyroidism in Multidrug-Resistant Tuberculosis Patients Co-Infected with HIV in Mumbai, India

Science.gov (United States)

Andries, Aristomo; Isaakidis, Petros; Das, Mrinalini; Khan, Samsuddin; Paryani, Roma; Desai, Chitranjan; Dalal, Alpa; Mansoor, Homa; Verma, Reena; Fernandes, Dolorosa; Sotgiu, Giovanni; Migliori, Giovanni B.; Saranchuk, Peter

2013-01-01

Background Adverse events (AEs) among HIV-infected patients with multidrug-resistant tuberculosis (MDR-TB) receiving anti-TB and antiretroviral treatments (ART) are under-researched and underreported. Hypothyroidism is a common AE associated with ethionamide, p-aminosalicylic acid (PAS), and stavudine. The aim of this study was to determine the frequency of and risk factors associated with hypothyroidism in HIV/MDR-TB co-infected patients. Methods This was a prospective, observational cohort study, using routine laboratory data in a Médecins Sans Frontières (MSF) clinic in collaboration with Sewri TB Hospital, Mumbai, India. Hypothyroidism was defined as a thyroid stimulating hormone (TSH) result >10 mIU/L at least once during treatment. Patients having a baseline result and one additional result after 3 months were eligible for enrolment. Results Between October 2006 and March 2013, 116 patients were enrolled, 69 of whom were included. The median (IQR) age was 38 years (34-43) and 61% were male. By March 2013, 37/69 (54%) had hypothyroidism after at least 90 days of treatment. Age, gender, CD4 counts and stavudine-based ART were not associated with the occurrence of hypothyroidism in multivariate models. The co-administration of PAS and ethionamide was found to double the risk of hypothyroidism (RR: 1.93, 95% CI: 1.06-3.54). Discussion High rate of hypothyroidism was recorded in a Mumbai cohort of MDR-TB/HIV co-infected patients on treatment. This is a treatable and reversible AE, however, it may go undiagnosed in the absence of regular monitoring. Care providers should not wait for clinical symptoms, as this risks compromising treatment adherence. Simple, affordable and reliable point-of-care tools for measuring TSH are needed, especially in high MDR-TB burden countries. Our findings suggest the need for TSH screening at baseline, three months, six months, and every six months thereafter for HIV-infected patients on MDR-TB treatment regimens containing PAS and

Is there a rationale for pulmonary rehabilitation following successful chemotherapy for tuberculosis?

Science.gov (United States)

Muñoz-Torrico, Marcela; Rendon, Adrian; Centis, Rosella; D'Ambrosio, Lia; Fuentes, Zhenia; Torres-Duque, Carlos; Mello, Fernanda; Dalcolmo, Margareth; Pérez-Padilla, Rogelio; Spanevello, Antonio; Migliori, Giovanni Battista

2016-01-01

ABSTRACT The role of tuberculosis as a public health care priority and the availability of diagnostic tools to evaluate functional status (spirometry, plethysmography, and DLCO determination), arterial blood gases, capacity to perform exercise, lesions (chest X-ray and CT), and quality of life justify the effort to consider what needs to be done when patients have completed their treatment. To our knowledge, no review has ever evaluated this topic in a comprehensive manner. Our objective was to review the available evidence on this topic and draw conclusions regarding the future role of the "post-tuberculosis treatment" phase, which will potentially affect several million cases every year. We carried out a non-systematic literature review based on a PubMed search using specific keywords (various combinations of the terms "tuberculosis", "rehabilitation", "multidrug-resistant tuberculosis", "pulmonary disease", "obstructive lung disease", and "lung volume measurements"). The reference lists of the most important studies were retrieved in order to improve the sensitivity of the search. Manuscripts written in English, Spanish, and Russian were selected. The main areas of interest were tuberculosis sequelae following tuberculosis diagnosis and treatment; "destroyed lung"; functional evaluation of sequelae; pulmonary rehabilitation interventions (physiotherapy, long-term oxygen therapy, and ventilation); and multidrug-resistant tuberculosis.The evidence found suggests that tuberculosis is definitively responsible for functional sequelae, primarily causing an obstructive pattern on spirometry (but also restrictive and mixed patterns), and that there is a rationale for pulmonary rehabilitation. We also provide a list of variables that should be discussed in future studies on pulmonary rehabilitation in patients with post-tuberculosis sequelae. PMID:27812638

Evolutionary history and global spread of the Mycobacterium tuberculosis Beijing lineage.

OpenAIRE

Merker Matthias; Blin Camille; Mona Stefano; Duforet-Frebourg Nicolas; Lecher Sophie; Willery Eve; Blum Michael G B; Rüsch-Gerdes Sabine; Mokrousov Igor; Aleksic Eman; Allix-Béguec Caroline; Antierens Annick; Augustynowicz-Kopec Ewa; Ballif Marie; Barletta Francesca

2015-01-01

International audience; Mycobacterium tuberculosis strains of the Beijing lineage are globally distributed and are associated with the massive spread of multidrug-resistant (MDR) tuberculosis in Eurasia. Here we reconstructed the biogeographical structure and evolutionary history of this lineage by genetic analysis of 4,987 isolates from 99 countries and whole-genome sequencing of 110 representative isolates. We show that this lineage initially originated in the Far East, from where it radiat...

Worldwide Endemicity of a Multidrug-Resistant Staphylococcus capitis Clone Involved in Neonatal Sepsis.

Science.gov (United States)

Butin, Marine; Martins-Simões, Patricia; Rasigade, Jean-Philippe; Picaud, Jean-Charles; Laurent, Frédéric

2017-03-01

A multidrug-resistant Staphylococcus capitis clone, NRCS-A, has been isolated from neonatal intensive care units in 17 countries throughout the world. S. capitis NRCS-A prevalence is high in some neonatal intensive care units in France. These data highlight the worldwide endemicity and epidemiologic relevance of this multidrug-resistant, coagulase-negative staphylococci clone.

Emergence of Extensively Drug Resistant Tuberculosis

Centers for Disease Control (CDC) Podcasts

2007-03-01

Extensively drug-resistant tuberculosis (XDR TB) outbreaks have been reported in South Africa, and strains have been identified on 6 continents. Dr. Peter Cegielski, team leader for drug-resistant TB with the Division of Tuberculosis Elimination at CDC, comments on a multinational team's report on this emerging global public health threat.  Created: 3/1/2007 by Emerging Infectious Diseases.   Date Released: 3/26/2007.

Clinical characteristics, drug resistance, and treatment outcomes among tuberculosis patients with diabetes in Peru.

Science.gov (United States)

Magee, M J; Bloss, E; Shin, S S; Contreras, C; Huaman, H Arbanil; Ticona, J Calderon; Bayona, J; Bonilla, C; Yagui, M; Jave, O; Cegielski, J P

2013-06-01

Diabetes is a risk factor for active tuberculosis (TB). Data are limited regarding the association between diabetes and TB drug resistance and treatment outcomes. We examined characteristics of TB patients with and without diabetes in a Peruvian cohort at high risk for drug-resistant TB. Among TB patients with diabetes (TB-DM), we studied the association between diabetes clinical/management characteristics and TB drug resistance and treatment outcomes. During 2005-2008, adults with suspected TB with respiratory symptoms in Lima, Peru, who received rapid drug susceptibility testing (DST), were prospectively enrolled and followed during treatment. Bivariate and Kaplan-Meier analyses were used to examine the relationships of diabetes characteristics with drug-resistant TB and TB outcomes. Of 1671 adult TB patients enrolled, 186 (11.1%) had diabetes. TB-DM patients were significantly more likely than TB patients without diabetes to be older, have had no previous TB treatment, and to have a body mass index (BMI) >18.5 kg/m(2) (pdiabetes, and 12% and 28%, respectively, among TB-DM patients. Among 149 TB-DM patients with DST results, 104 (69.8%) had drug-susceptible TB and 45 (30.2%) had drug-resistant TB, of whom 29 had multidrug-resistant TB. There was no association between diabetes characteristics and drug-resistant TB. Of 136 TB-DM patients with outcome information, 107 (78.7%) had a favorable TB outcome; active diabetes management was associated with a favorable outcome. Diabetes was common in a cohort of TB patients at high risk for drug-resistant TB. Despite prevalent multidrug-resistant TB among TB-DM patients, the majority had a favorable TB treatment outcome. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Multidrug efflux pumps at the crossroad between antibiotic resistance and bacterial virulence

Directory of Open Access Journals (Sweden)

Manuel Alcalde-Rico

2016-09-01

Full Text Available Multidrug efflux pumps can be involved in bacterial resistance to antibiotics at different levels. Some efflux pumps are constitutively expressed at low levels and contribute to intrinsic resistance. In addition, their overexpression may allow higher levels of resistance. This overexpression can be transient, in the presence of an effector (phenotypic resistance, or constitutive when mutants in the regulatory elements of the expression of efflux pumps are selected (acquired resistance. Efflux pumps are present in all cells, from human to bacteria and are highly conserved, which indicates that they are ancient elements in the evolution of different organisms. Consequently, it has been suggested that, besides antibiotic resistance, bacterial multidrug efflux pumps would likely contribute to other relevant process of the microbial physiology. In the current article, we discuss some specific examples of the role that efflux pumps may have in the bacterial virulence of animals' and plants' pathogens, including the processes of intercellular communication. Based in these evidences, we propose that efflux pumps are at the crossroad between resistance and virulence of bacterial pathogens. Consequently, the comprehensive study of multidrug efflux pumps requires addressing these functions, which are of relevance for the bacterial-host interactions during infection.

Multidrug Efflux Pumps at the Crossroad between Antibiotic Resistance and Bacterial Virulence.

Science.gov (United States)

Alcalde-Rico, Manuel; Hernando-Amado, Sara; Blanco, Paula; Martínez, José L

2016-01-01

Multidrug efflux pumps can be involved in bacterial resistance to antibiotics at different levels. Some efflux pumps are constitutively expressed at low levels and contribute to intrinsic resistance. In addition, their overexpression may allow higher levels of resistance. This overexpression can be transient, in the presence of an effector (phenotypic resistance), or constitutive when mutants in the regulatory elements of the expression of efflux pumps are selected (acquired resistance). Efflux pumps are present in all cells, from human to bacteria and are highly conserved, which indicates that they are ancient elements in the evolution of different organisms. Consequently, it has been suggested that, besides antibiotic resistance, bacterial multidrug efflux pumps would likely contribute to other relevant processes of the microbial physiology. In the current article, we discuss some specific examples of the role that efflux pumps may have in the bacterial virulence of animals' and plants' pathogens, including the processes of intercellular communication. Based in these evidences, we propose that efflux pumps are at the crossroad between resistance and virulence of bacterial pathogens. Consequently, the comprehensive study of multidrug efflux pumps requires addressing these functions, which are of relevance for the bacterial-host interactions during infection.

Performance of the Abbott RealTime MTB RIF/INH resistance assay when used to test Mycobacterium tuberculosis specimens from Bangladesh

Directory of Open Access Journals (Sweden)

Kostera J

2018-05-01

Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance

FIND Tuberculosis Strain Bank: a Resource for Researchers and Developers Working on Tests To Detect Mycobacterium tuberculosis and Related Drug Resistance.

Science.gov (United States)

Tessema, Belay; Nabeta, Pamela; Valli, Eloise; Albertini, Audrey; Collantes, Jimena; Lan, Nguyen Huu; Romancenco, Elena; Tukavdze, Nestani; Denkinger, Claudia M; Dolinger, David L

2017-04-01

The spread of multidrug-resistant (MDR) tuberculosis (TB) and extensively drug-resistant (XDR) TB hampers global efforts in the fight against tuberculosis. To enhance the development and evaluation of diagnostic tests quickly and efficiently, well-characterized strains and samples from drug-resistant tuberculosis patients are necessary. In this project, the Foundation for Innovative New Diagnostics (FIND) has focused on the collection, characterization, and storage of such well-characterized reference materials and making them available to researchers and developers. The collection is being conducted at multiple centers in Southeast Asia, South America, Eastern Europe, and soon the sub-Saharan Africa regions. Strains are characterized for their phenotypic resistances and MICs to first-line drugs (FLDs) and second-line drugs (SLDs) using the automated MGIT 960 system following validated procedures and WHO criteria. Analysis of resistance-associated mutations is done by whole-genome sequencing (WGS) using the Illumina NextSeq system. Mycobacterial interspersed repetitive-unit-variable-number tandem-repeat analysis and WGS are used to determine strain lineages. All strains are maintained frozen at -80°C ± 10°C as distinct mother and daughter lots. All strains are extensively quality assured. The data presented here represent an analysis of the initial part of the collection. Currently, the bank contains 118 unique strains with extracted genomic DNA and matched sputum, serum, and plasma samples and will be expanded to a minimum of 1,000 unique strains over the next 3 years. Analysis of the current strains by phenotypic resistance testing shows 102 (86.4%), 10 (8.5%), and 6 (5.1%) MDR, XDR, and mono/poly resistant strains, respectively. Two of the strains are resistant to all 11 drugs that were phenotypically tested. WGS mutation analysis revealed FLD resistance-associated mutations in the rpoB , katG , inhA , embB , embA , and pncA genes; SLD resistance in the gyr

Drug-resistance in chronic tuberculosis cases in Southern Nigeria ...

African Journals Online (AJOL)

Nigeria has a high burden of tuberculosis but the drug resistant situationwas previously unknown. This report evaluates the firstline drug resistance and associated factors among chronic tuberculosis cases from the tuberculosis control programme in South south and South east zones ofNigeria. Descriptive study of chronic ...

Antifolate resistance mediated by the multidrug resistance proteins MRP1 and MRP2

NARCIS (Netherlands)

Hooijberg, J. H.; Broxterman, H. J.; Kool, M.; Assaraf, Y. G.; Peters, G. J.; Noordhuis, P.; Scheper, R. J.; Borst, P.; Pinedo, H. M.; Jansen, G.

1999-01-01

Transfection of multidrug resistance proteins (MRPs) MRP1 and MRP2 in human ovarian carcinoma 2008 cells conferred a marked level of resistance to short-term (1-4 h) exposure to the polyglutamatable antifolates methotrexate (MTX; 21-74-fold), ZD1694 (4-138-fold), and GW1843 (101-156-fold). Evidence

Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

Directory of Open Access Journals (Sweden)

Nestani Tukvadze

Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

Multi-drug resistant Ewingella Americana

International Nuclear Information System (INIS)

Bukhari, Syed Z.; Ashshi, Ahmad M.; Hussain, Waleed M.; Fatani, Mohammad I.

2008-01-01

We report a case of pneumonia due to multi-drug resistant Ewingella Americana in a young patient admitted in the Intensive Care Unit of Hera General Hospital, Makkah, Saudi Arabia with severe head injury in a road traffic accident. He was an Indonesian pilgrim who had traveled to the Kingdom of Saudi Arabia to perform Hajj in December 2007. Ewingella Americana was identified to be the pathogen of pneumonia with clinical signs and symptoms along with positive radiological findings. (author)

Tuberculosis drug resistance in the Western Cape | Weyer | South ...

African Journals Online (AJOL)

Objectives: Drug resistance is a serious problem in the treatment of tuberculosis and a threat to successful tuberculosis control programmes. Local health workers have expressed concern that the increasing tuberculosis epidemic in the Western Cape is partly attributable to drug resistance. The aim of this study was to ...

Disinfectant-susceptibility of multi-drug-resistant Mycobacterium tuberculosis isolated in Japan

Directory of Open Access Journals (Sweden)

Noriko Shinoda

2016-02-01

Full Text Available Abstract Background Multi-drug-resistant Mycobacterium tuberculosis has been an important problem in public health around the world. However, limited information about disinfectant-susceptibility of multi-drug-resistant strain of M. tuberculosis was available. Findings We studied susceptibility of several Japanese isolates of multi-drug-resistant M. tuberculosis against disinfectants, which are commonly used in clinical and research laboratories. We selected a laboratory reference strain (H37Rv and eight Japanese isolates, containing five drug-susceptible strains and three multi-drug-resistant strains, and determined profiles of susceptibility against eight disinfectants. The M. tuberculosis strains were distinguished into two groups by the susceptibility profile. There was no relationship between multi-drug-resistance and disinfectant-susceptibility in the M. tuberculosis strains. Cresol soap and oxydol were effective against all strains we tested, regardless of drug resistance. Conclusions Disinfectant-resistance is independent from multi-drug-resistance in M. tuberculosis. Cresol soap and oxydol were effective against all strains we tested, regardless of drug resistance.

Adaptation and evolution of drug-resistant Mycobacterium tuberculosis

NARCIS (Netherlands)

Bergval, I.L.

2013-01-01

Many studies have been conducted on drug resistance and the evolution of Mycobacterium tuberculosis. Notwithstanding, many molecular mechanisms facilitating the emergence, adaptation and spread of drug-resistant tuberculosis have yet to be discovered. This thesis reports studies of the adaptive

Bacillus subtilis from Soybean Food Shows Antimicrobial Activity for Multidrug-Resistant Acinetobacter baumannii by Affecting the adeS Gene.

Science.gov (United States)

Wang, Tieshan; Su, Jianrong

2016-12-28

Exploring novel antibiotics is necessary for multidrug-resistant pathogenic bacteria. Because the probiotics in soybean food have antimicrobial activities, we investigated their effects on multidrug-resistant Acinetobacter baumannii . Nineteen multidrug-resistant A. baumannii strains were clinifcally isolated as an experimental group and 11 multidrug-sensitive strains as controls. The growth rates of all bacteria were determined by using the analysis for xCELLigence Real-Time Cell. The combination of antibiotics showed synergistic effects on the strains in the control group but no effect on the strains in the experimental group. Efflux pump gene adeS was absent in all the strains from the control group, whereas it exists in all the strains from the experimental group. Furthermore, all the strains lost multidrug resistance when an adeS inhibitor was used. One strain of probiotics isolated from soybean food showed high antimicrobial activity for multidrug-resistant A. baumannii . The isolated strain belongs to Bacillus subtilis according to 16S RNA analysis. Furthermore, E. coli showed multidrug resistance when it was transformed with the adeS gene from A. baumannii whereas the resistant bacteria could be inhibited completely by isolated Bacillus subtilis . Thus, probiotics from soybean food provide potential antibiotics against multidrug-resistant pathogenic bacteria.

Candida auris: An emerging multidrug-resistant pathogen

Directory of Open Access Journals (Sweden)

David Sears

2017-10-01

Full Text Available Candida aurisis an emerging multidrug-resistant pathogen that can be difficult to identify using traditional biochemical methods. C. auris is capable of causing invasive fungal infections, particularly among hospitalized patients with significant medical comorbidities. Echinocandins are the empiric drugs of choice for C. auris, although not all isolates are susceptible and resistance may develop on therapy. Nosocomial C. auris outbreaks have been reported in a number of countries and aggressive infection control measures are paramount to stopping transmission.

Prevalence and risk factors for carriage of multi-drug resistant Staphylococci in healthy cats and dogs

Science.gov (United States)

Regula, Gertraud; Petrini, Orlando; Zinsstag, Jakob; Schelling, Esther

2013-01-01

We investigated the distribution of commensal staphylococcal species and determined the prevalence of multi-drug resistance in healthy cats and dogs. Risk factors associated with the carriage of multi-drug resistant strains were explored. Isolates from 256 dogs and 277 cats were identified at the species level using matrix-assisted laser desorption ionisation-time of flight mass spectrometry. The diversity of coagulase-negative Staphylococci (CNS) was high, with 22 species in dogs and 24 in cats. Multi-drug resistance was frequent (17%) and not always associated with the presence of the mecA gene. A stay in a veterinary clinic in the last year was associated with an increased risk of colonisation by multi-drug resistant Staphylococci (OR = 2.4, 95% CI: 1.1~5.2, p value LRT = 0.04). When identifying efficient control strategies against antibiotic resistance, the presence of mechanisms other than methicillin resistance and the possible role of CNS in the spread of resistance determinants should be considered. PMID:23820161

Multidrug resistant shigella flexneri infection simulating intestinal intussusception

Directory of Open Access Journals (Sweden)

Srirangaraj Sreenivasan

2016-01-01

Full Text Available Shigella enteritis remains an important cause of mortality and morbidity in all age groups, in developing as well as developed countries. Owing to the emerging resistance to multiple antibiotics among Shigella spp., it has been recognized as a major global public health concern and warrants constant monitoring of its resistance pattern. We report a case of segmental ileitis caused by non.-ESBL producing multidrug resistant Shigella flexneri in an infant clinically mimicking intussusception, which was effectively treated by ceftriaxone.

Overview of drug-resistant tuberculosis worldwide

Directory of Open Access Journals (Sweden)

Ali A Velayati

2016-01-01

Full Text Available Even in the 21st century, we are losing the battle against eradication of tuberculosis (TB. In 2015, 9.6 million people were estimated to have fallen ill with TB, of which 1.5 million people died. This is the real situation despite the well-structured treatment programs and availability of effective treatment options since the 1950s. The high mortality rate has been associated with other risk factors, such as the HIV epidemic, underlying diseases, and decline of socioeconomic standards. Furthermore, the problem of drug resistance that was recognized in the early days of the chemotherapeutic era raises serious concerns. Although resistance to a single agent is the most common type, resistance to multiple agents is less frequent but of greater concern. The World Health Organization estimated approximately 5% of all new TB cases involved multidrug-resistant (MDR-TB. The estimation for MDR-TB is 3.3% for new cases, and 20.5% for previously treated cases. Failure to identify and appropriately treat MDR-TB patients has led to more dangerous forms of resistant TB. Based on World Health Organization reports, 5% of global TB cases are now considered to be extensively drug resistant (XDR, defined as MDR with additional resistance to both fluoroquinolones and at least one second-line injectable drug. XDR-TB had been reported by 105 countries by 2015. An estimated 9.7% of people with MDR-TB have XDR-TB. More recently, another dangerous form of TB bacillus was identified, which was named totally drug resistant (TDR-TB or extremely drug resistant TB. These strains were resistant to all first- and second-line anti-TB drugs. Collectively, it is accepted that 2% of MDR-TB strains turn to be TDR-TB. This number, however, may not reflect the real situation, as many laboratories in endemic TB countries do not have proper facilities and updated protocols to detect the XDR or TDR-TB strains. Nevertheless, existing data emphasize the need for additional control

Individualized treatment of multidrug-resistant tuberculosis using therapeutic drug monitoring

Directory of Open Access Journals (Sweden)

Mathieu S Bolhuis

2016-01-01

Conclusion: TDM is highly valuable to individualize and optimize treatment of complex MDR-TB patients. TDM is routinely applied in Tuberculosis Center Beatrixoord, and high success rates for treatment of MDR-TB patients have been achieved. DBS and LSS make implementation of TDM feasible, even in low- and middle-income countries.

Primary drug-resistant tuberculosis in Hanoi, Viet Nam: present status and risk factors.

Directory of Open Access Journals (Sweden)

Nguyen Thi Le Hang

Full Text Available INTRODUCTION: Resistance of Mycobacterium tuberculosis (MTB to anti-tuberculosis (TB drugs presents a serious challenge to TB control worldwide. We investigated the status of drug resistance, including multidrug-resistant (MDR TB, and possible risk factors among newly diagnosed TB patients in Hanoi, the capital of Viet Nam. METHODS: Clinical and epidemiological information was collected from 506 newly diagnosed patients with sputum smear- and culture-positive TB, and 489 (96.6% MTB isolates were subjected to conventional drug susceptibility testing, spoligotyping, and 15-locus variable numbers of tandem repeats typing. Adjusted odds ratios (aORs were calculated to analyze the risk factors for primary drug resistance. RESULTS: Of 489 isolates, 298 (60.9% were sensitive to all drugs tested. Resistance to isoniazid, rifampicin, streptomycin, ethambutol, and MDR accounted for 28.2%, 4.9%, 28.2%, 2.9%, and 4.5%, respectively. Of 24 isolates with rifampicin resistance, 22 (91.7% were MDR and also resistant to streptomycin, except one case. Factors associated with isoniazid resistance included living in old urban areas, presence of the Beijing genotype, and clustered strains [aOR = 2.23, 95% confidence interval (CI 1.15-4.35; 1.91, 1.18-3.10; and 1.69, 1.06-2.69, respectively. The Beijing genotype was also associated with streptomycin resistance (aOR = 2.10, 95% CI 1.29-3.40. Human immunodeficiency virus (HIV coinfection was associated with rifampicin resistance and MDR (aOR = 5.42, 95% CI 2.07-14.14; 6.23, 2.34-16.58, respectively. CONCLUSION: Isoniazid and streptomycin resistance was observed in more than a quarter of TB patients without treatment history in Hanoi. Transmission of isoniazid-resistant TB among younger people should be carefully monitored in urban areas, where Beijing strains and HIV coinfection are prevalent. Choosing an optimal treatment regimen on the basis of the results of drug susceptibility tests and monitoring of treatment

Developments and strategies for inhaled antibiotic drugs in tuberculosis therapy : A critical evaluation

NARCIS (Netherlands)

Hoppentocht, M; Hagedoorn, P; Frijlink, H W; de Boer, A H

2014-01-01

Inhaled antibiotics have been a valuable tool in treating pulmonary infections in cystic fibrosis patients for decades, and the pulmonary route is now becoming increasingly interesting for other infectious diseases like tuberculosis too. Especially with multidrug and extensively drug-resistant

Anti-tuberculosis activities of the crude methanolic extract and ...

African Journals Online (AJOL)

Summary: Tuberculosis (TB) is of great public health burden globally especially in developing countries of Africa and Asia . Current TB regimen involves multiple therapies and of long duration leading to poor patient adherence. There is also the challenge of multidrug resistant TB. Hence, there is a need for discovery of new ...

Antimicrobial resistance determinant microarray for analysis of multi-drug resistant isolates

Science.gov (United States)

Taitt, Chris Rowe; Leski, Tomasz; Stenger, David; Vora, Gary J.; House, Brent; Nicklasson, Matilda; Pimentel, Guillermo; Zurawski, Daniel V.; Kirkup, Benjamin C.; Craft, David; Waterman, Paige E.; Lesho, Emil P.; Bangurae, Umaru; Ansumana, Rashid

2012-06-01

The prevalence of multidrug-resistant infections in personnel wounded in Iraq and Afghanistan has made it challenging for physicians to choose effective therapeutics in a timely fashion. To address the challenge of identifying the potential for drug resistance, we have developed the Antimicrobial Resistance Determinant Microarray (ARDM) to provide DNAbased analysis for over 250 resistance genes covering 12 classes of antibiotics. Over 70 drug-resistant bacteria from different geographic regions have been analyzed on ARDM, with significant differences in patterns of resistance identified: genes for resistance to sulfonamides, trimethoprim, chloramphenicol, rifampin, and macrolide-lincosamidesulfonamide drugs were more frequently identified in isolates from sources in Iraq/Afghanistan. Of particular concern was the presence of genes responsible for resistance to many of the last-resort antibiotics used to treat war traumaassociated infections.

Overcoming cellular multidrug resistance using classical nanomedicine formulations

Czech Academy of Sciences Publication Activity Database

Kunjachan, S.; Blauz, A.; Möckel, D.; Theek, B.; Kiessling, F.; Etrych, Tomáš; Ulbrich, K.; van Bloois, L.; Storm, G.; Bartosz, G.; Rychlik, B.; Lammers, T.

2012-01-01

Roč. 45, č. 4 (2012), s. 421-428 ISSN 0928-0987 R&D Projects: GA AV ČR IAA400500806 Institutional research plan: CEZ:AV0Z40500505 Keywords : cancer * nanomedicine * multidrug resistance Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.987, year: 2012

Detecting Mutations in the Mycobacterium tuberculosis Pyrazinamidase Gene pncA to Improve Infection Control and Decrease Drug Resistance Rates in Human Immunodeficiency Virus Coinfection

Science.gov (United States)

Dudley, Matthew Z.; Sheen, Patricia; Gilman, Robert H.; Ticona, Eduardo; Friedland, Jon S.; Kirwan, Daniela E.; Caviedes, Luz; Rodriguez, Richard; Cabrera, Lilia Z.; Coronel, Jorge; Grandjean, Louis; Moore, David A. J.; Evans, Carlton A.; Huaroto, Luz; Chávez-Pérez, Víctor; Zimic, Mirko

2016-01-01

Hospital infection control measures are crucial to tuberculosis (TB) control strategies within settings caring for human immunodeficiency virus (HIV)–positive patients, as these patients are at heightened risk of developing TB. Pyrazinamide (PZA) is a potent drug that effectively sterilizes persistent Mycobacterium tuberculosis bacilli. However, PZA resistance associated with mutations in the nicotinamidase/pyrazinamidase coding gene, pncA, is increasing. A total of 794 patient isolates obtained from four sites in Lima, Peru, underwent spoligotyping and drug resistance testing. In one of these sites, the HIV unit of Hospital Dos de Mayo (HDM), an isolation ward for HIV/TB coinfected patients opened during the study as an infection control intervention: circulating genotypes and drug resistance pre- and postintervention were compared. All other sites cared for HIV-negative outpatients: genotypes and drug resistance rates from these sites were compared with those from HDM. HDM patients showed high concordance between multidrug resistance, PZA resistance according to the Wayne method, the two most common genotypes (spoligotype international type [SIT] 42 of the Latino American-Mediterranean (LAM)-9 clade and SIT 53 of the T1 clade), and the two most common pncA mutations (G145A and A403C). These associations were absent among community isolates. The infection control intervention was associated with 58–92% reductions in TB caused by SIT 42 or SIT 53 genotypes (odds ratio [OR] = 0.420, P = 0.003); multidrug-resistant TB (OR = 0.349, P < 0.001); and PZA-resistant TB (OR = 0.076, P < 0.001). In conclusion, pncA mutation typing, with resistance testing and spoligotyping, was useful in identifying a nosocomial TB outbreak and demonstrating its resolution after implementation of infection control measures. PMID:27928075

Understanding institutional stakeholders’ perspectives on multidrug-resistant bacterial organism at the end of life: a qualitative study

Science.gov (United States)

Heckel, Maria; Herbst, Franziska A; Adelhardt, Thomas; Tiedtke, Johanna M; Sturm, Alexander; Stiel, Stephanie; Ostgathe, Christoph

2017-01-01

Background Information lacks about institutional stakeholders’ perspectives on management approaches of multidrug-resistant bacterial organism in end-of-life situations. The term “institutional stakeholder” includes persons in leading positions with responsibility in hospitals’ multidrug-resistant bacterial organism management. They have great influence on how strategies on multidrug-resistant bacterial organism management approaches in institutions of the public health system are designed. This study targeted institutional stakeholders’ individual perspectives on multidrug-resistant bacterial organism colonization or infection and isolation measures at the end of life. Methods Between March and December 2014, institutional stakeholders of two study centers, a German palliative care unit and a geriatric ward, were queried in semistructured interviews. Interviews were audiotaped, transcribed verbatim, and analyzed qualitatively with the aid of the software MAXQDA for qualitative data analysis using principles of Grounded Theory. In addition, two external stakeholders were interviewed to enrich data. Results Key issues addressed by institutional stakeholders (N=18) were the relevance of multidrug-resistant bacterial organism in palliative and geriatric care, contradictions between hygiene principles and patients’ and family caregivers’ needs and divergence from standards, frame conditions, and reflections on standardization of multidrug-resistant bacterial organism end-of-life care procedures. Results show that institutional stakeholders face a dilemma between their responsibility in protecting third persons and ensuring patients’ quality of life. Until further empirical evidence establishes a clear multidrug-resistant bacterial organism management approach in end-of-life care, stakeholders suggest a case-based approach. Conclusion The institutional stakeholders’ perspectives and their suggestion of a case-based approach advance the development

Understanding institutional stakeholders' perspectives on multidrug-resistant bacterial organism at the end of life: a qualitative study.

Science.gov (United States)

Heckel, Maria; Herbst, Franziska A; Adelhardt, Thomas; Tiedtke, Johanna M; Sturm, Alexander; Stiel, Stephanie; Ostgathe, Christoph

2017-01-01

Information lacks about institutional stakeholders' perspectives on management approaches of multidrug-resistant bacterial organism in end-of-life situations. The term "institutional stakeholder" includes persons in leading positions with responsibility in hospitals' multidrug-resistant bacterial organism management. They have great influence on how strategies on multidrug-resistant bacterial organism management approaches in institutions of the public health system are designed. This study targeted institutional stakeholders' individual perspectives on multidrug-resistant bacterial organism colonization or infection and isolation measures at the end of life. Between March and December 2014, institutional stakeholders of two study centers, a German palliative care unit and a geriatric ward, were queried in semistructured interviews. Interviews were audiotaped, transcribed verbatim, and analyzed qualitatively with the aid of the software MAXQDA for qualitative data analysis using principles of Grounded Theory. In addition, two external stakeholders were interviewed to enrich data. Key issues addressed by institutional stakeholders (N=18) were the relevance of multidrug-resistant bacterial organism in palliative and geriatric care, contradictions between hygiene principles and patients' and family caregivers' needs and divergence from standards, frame conditions, and reflections on standardization of multidrug-resistant bacterial organism end-of-life care procedures. Results show that institutional stakeholders face a dilemma between their responsibility in protecting third persons and ensuring patients' quality of life. Until further empirical evidence establishes a clear multidrug-resistant bacterial organism management approach in end-of-life care, stakeholders suggest a case-based approach. The institutional stakeholders' perspectives and their suggestion of a case-based approach advance the development process of a patient-, family-, staff-, and institutional

Extended spectrum of antibiotic susceptibility for tuberculosis, Djibouti.

Science.gov (United States)

Bouzid, Fériel; Astier, Hélène; Osman, Djaltou Aboubaker; Javelle, Emilie; Hassan, Mohamed Osman; Simon, Fabrice; Garnotel, Eric; Drancourt, Michel

2018-02-01

In the Horn of Africa, there is a high prevalence of tuberculosis that is reported to be partly driven by multidrug-resistant (MDR) Mycobacterium tuberculosis strictu sensu strains. We conducted a prospective study to investigate M. tuberculosis complex species causing tuberculosis in Djibouti, and their in vitro susceptibility to standard anti-tuberculous antibiotics in addition to clofazimine, minocycline, chloramphenicol and sulfadiazine. Among the 118 mycobacteria isolates from 118 successive patients with suspected pulmonary tuberculosis, 111 strains of M. tuberculosis, five Mycobacterium canettii, one 'Mycobacterium simulans' and one Mycobacterium kansasii were identified. Drug-susceptibility tests performed on the first 78 isolates yielded nine MDR M. tuberculosis isolates. All isolates were fully susceptible to clofazimine, minocycline and chloramphenicol, and 75 of 78 isolates were susceptible to sulfadiazine. In the Horn of Africa, patients with confirmed pulmonary tuberculosis caused by an in vitro susceptible strain may benefit from anti-leprosy drugs, sulfamides and phenicol antibiotics. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Community-acquired multidrug-resistant Gram-negative bacterial infective endocarditis.

Science.gov (United States)

Naha, Sowjanya; Naha, Kushal; Acharya, Vasudev; Hande, H Manjunath; Vivek, G

2014-08-05

We describe two cases of bacterial endocarditis secondary to multidrug-resistant Gram-negative organisms. In both cases, the diagnosis was made in accordance with the modified Duke's criteria and confirmed by histopathological analysis. Furthermore, in both instances there were no identifiable sources of bacteraemia and no history of contact with hospital or other medical services prior to the onset of symptoms. The patients were managed in similar fashion with prolonged broad-spectrum antibiotic therapy and surgical intervention and made complete recoveries. These cases highlight Gram-negative organisms as potential agents for endocarditis, as well as expose the dissemination of such multidrug-resistant bacteria into the community. The application of an integrated medical and surgical approach and therapeutic dilemmas encountered in managing these cases are described. 2014 BMJ Publishing Group Ltd.

Effect of biocides on biofilms of some multidrug resistant clinical ...

African Journals Online (AJOL)

The ability of Escherichia coli and Klebsiella aerogenes to form biofilms was most affected. There was little inhibition of biofilm formation by the biocides on Staphylococcus aureus. This study has shown a relationship between biocide and multidrug resistance. Keywords: Biocides, Multi drug resistance, sodium hypochlorite, ...

In vitro drug susceptibility of Mycobacterium tuberculosis for amikacin, kanamycin and capreomycin.

NARCIS (Netherlands)

Dijkstra, J A; van der Laan, T; Akkerman, O W; Bolhuis, M S; de Lange, W C M; Kosterink, J G W; van der Werf, T S; Alffenaar, J W C; van Soolingen, D

2018-01-01

Amikacin, kanamycin and capreomycin are listed among the most important 2nd line drugs for multidrug resistant tuberculosis. Although amikacin and kanamycin are administered in the same dose and show the same pharmacokinetics, they have different WHO breakpoints suggesting that the two drugs have a

Factors Associated with Tuberculosis and Rifampicin-Resistant Tuberculosis amongst Symptomatic Patients in India: A Retrospective Analysis.

Directory of Open Access Journals (Sweden)

Sreenivas Achuthan Nair

Full Text Available Tuberculosis remains a major public health challenge for India. Various studies have documented different levels of TB and multi-drug resistant (MDR TB among diverse groups of the population. In view of renewed targets set under the End TB strategy by 2035, there is an urgent need for TB diagnosis to be strengthened. Drawing on data from a recent, multisite study, we address key questions for TB diagnosis amongst symptomatics presenting for care: are there subgroups of patients that are more likely than others, to be positive for TB? In turn, amongst these positive cases, are there factors-apart from treatment history-that may be predictive for multi-drug resistance?We used data from a multi-centric prospective demonstration study, conducted from March 2012 to December 2013 in 18 sub-district level TB programme units (TUs in India and covering a population of 8.8 million. In place of standard diagnostic tests, upfront Xpert MTB/RIF testing was offered to all presumptive TB symptomatics. Here, using data from this study, we used logistic regression to identify association between risk factors and TB and Rifampicin-Resistant TB among symptomatics enrolled in the study.We find that male gender; history of TB treatment; and adult age compared with either children or the elderly are risk factors associated with high TB detection amongst symptomatics, across the TUs. While treatment history is found be a significant risk factor for rifampicin-resistant TB, elderly (65+ yrs people have significantly lower risk than other age groups. However, pediatric TB cases have no less risk of rifampicin resistance as compared with adults (OR 1.23 (95% C.I. 0.85-1.76. Similarly, risk of rifampicin resistance among both the genders was the same. These patterns applied across the study sites involved. Notably in Mumbai, amongst those patients with microbiological confirmation of TB, female patients showed a higher risk of having MDR-TB than male patients.Our results

Intensive-phase treatment outcomes among hospitalized multidrug-resistant tuberculosis patients: results from a nationwide cohort in Nigeria.

Directory of Open Access Journals (Sweden)

Olanrewaju Oladimeji

Full Text Available BACKGROUND: Nigeria is faced with a high burden of Human Immunodeficiency Virus (HIV infection and multidrug-resistant tuberculosis (MDR-TB. Treatment outcomes among MDR-TB patients registered across the globe have been poor, partly due to high loss-to-follow-up. To address this challenge, MDR-TB patients in Nigeria are hospitalized during the intensive-phase(IP of treatment (first 6-8 months and are provided with a package of care including standardized MDR-TB treatment regimen, antiretroviral therapy (ART and cotrimoxazole prophylaxis (CPT for HIV-infected patients, nutritional and psychosocial support. In this study, we report the end-IP treatment outcomes among them. METHODS: In this retrospective cohort study, we reviewed the patient records of all bacteriologically-confirmed MDR-TB patients admitted for treatment between July 2010 and October 2012. RESULTS: Of 162 patients, 105(65% were male, median age was 34 years and 28(17% were HIV-infected; all 28 received ART and CPT. Overall, 138(85% were alive and culture negative at the end of IP, 24(15% died and there was no loss-to-follow-up. Mortality was related to low CD4-counts at baseline among HIV-positive patients. The median increase in body mass index among those documented to be underweight was 2.6 kg/m2 (p<0.01 and CD4-counts improved by a median of 52 cells/microL among the HIV-infected patients (p<0.01. CONCLUSIONS: End-IP treatment outcomes were exceptional compared to previously published data from international cohorts, thus confirming the usefulness of a hospitalized model of care. However, less than five percent of all estimated 3600 MDR-TB patients in Nigeria were initiated on treatment during the study period. Given the expected scale-up of MDR-TB care, the hospitalized model is challenging to sustain and the national TB programme is contemplating to move to ambulatory care. Hence, we recommend using both ambulatory and hospitalized approaches, with the latter being reserved

The lactococcal secondary multidrug transporter LmrP confers resistance to lincosamides, macrolides, streptogramins and tetracyclines

NARCIS (Netherlands)

Putman, M; van Veen, HW; Degener, JE; Konings, WN

2001-01-01

The active efflux of toxic compounds by (multi)drug transporters is one of the mechanisms that bacteria have developed to resist cytotoxic drugs. The authors describe the role of the lactococcal secondary multidrug transporter LmrP in the resistance to a broad range of clinically important

Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

Science.gov (United States)

Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

2018-05-31

Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

Directory of Open Access Journals (Sweden)

Chen Tingfu

2010-07-01

Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

New drugs and perspectives for new anti-tuberculosis regimens

Directory of Open Access Journals (Sweden)

S. Tiberi

2018-03-01