WorldWideScience

Sample records for multi-ethnic asian population

  1. Validation study of the Leeds Dyspepsia Questionnaire in a multi-ethnic Asian population.

    Science.gov (United States)

    Mahadeva, Sanjiv; Chan, Wah-Kheong; Mohazmi, Mohammed; Sujarita, Ramanujam; Goh, Khean-Lee

    2011-11-01

    Outcome measures for clinical trials in dyspepsia require an assessment of symptom response. There is a lack of validated instruments assessing dyspepsia symptoms in the Asian region. We aimed to translate and validate the Leeds Dyspepsia Questionnaire (LDQ) in a multi-ethnic Asian population. A Malay and culturally adapted English version of the LDQ were developed according to established protocols. Psychometric evaluation was performed by assessing the validity, internal consistency, test-retest reliability and responsiveness of the instruments in both primary and secondary care patients. Between April and September 2010, both Malay (n=166) and Malaysian English (n=154) versions were assessed in primary and secondary care patients. Both language versions were found to be reliable (internal consistency was 0.80 and 0.74 (Cronbach's α) for Malay and English, respectively; spearman's correlation coefficient for test-retest reliability was 0.98 for both versions), valid (area under receiver operating curve for accuracy of diagnosing dyspepsia was 0.71 and 0.77 for Malay and English versions, respectively), discriminative (median LDQ score discriminated between primary and secondary care patients in Malay (11.0 vs 20.0, PAsian population with dyspepsia. © 2011 Journal of Gastroenterology and Hepatology Foundation and Blackwell Publishing Asia Pty Ltd.

  2. Chronic kidney disease, cardiovascular disease and mortality: A prospective cohort study in a multi-ethnic Asian population.

    Science.gov (United States)

    Lim, Cynthia C; Teo, Boon Wee; Ong, Peng Guan; Cheung, Carol Y; Lim, Su Chi; Chow, Khuan Yew; Meng, Chan Choon; Lee, Jeannette; Tai, E Shyong; Wong, Tien Y; Sabanayagam, Charumathi

    2015-08-01

    Few studies have examined the impact of chronic kidney disease (CKD) on adverse cardiovascular outcomes and deaths in Asian populations. We evaluated the associations of CKD with cardiovascular disease (CVD) and all-cause mortality in a multi-ethnic Asian population. Prospective cohort study of 7098 individuals who participated in two independent population-based studies involving Malay adults (n = 3148) and a multi-ethnic cohort of Chinese, Malay and Indian adults (n = 3950). CKD was assessed from CKD-EPI estimated glomerular filtration rate (eGFR) and urine albumin-to-creatinine ratio (UACR). Incident CVD (myocardial infarction, stroke and CVD mortality) and all-cause mortality were identified by linkage with national disease/death registries. Over a median follow-up of 4.3 years, 4.6% developed CVD and 6.1% died. Risks of both CVD and all-cause mortality increased with decreasing eGFR and increasing albuminuria (all p-trend <0.05). Adjusted hazard ratios (HR (95% confidence interval)) of CVD and all-cause mortality were: 1.54 (1.05-2.27) and 2.21 (1.67-2.92) comparing eGFR <45 vs ≥60; 2.81 (1.49-5.29) and 2.34 (1.28-4.28) comparing UACR ≥300 vs <30. The association between eGFR <60 and all-cause mortality was stronger among those with diabetes (p-interaction = 0.02). PAR of incident CVD was greater among those with UACR ≥300 (12.9%) and that of all-cause mortality greater among those with eGFR <45 (16.5%). In multi-ethnic Asian adults, lower eGFR and higher albuminuria were independently associated with incident CVD and all-cause mortality. These findings extend previously reported similar associations in Western populations to Asians and emphasize the need for early detection of CKD and intervention to prevent adverse outcomes. © The European Society of Cardiology 2014.

  3. Dietary Protein Intake in a Multi-ethnic Asian Population of Healthy Participants and Chronic Kidney Disease Patients.

    Science.gov (United States)

    Teo, Boon Wee; Toh, Qi Chun; Xu, Hui; Yang, Adonsia Y T; Lin, Tingxuan; Li, Jialiang; Lee, Evan J C

    2015-04-01

    Clinical practice guidelines recommend different levels of dietary protein intake in predialysis chronic kidney disease (CKD) patients. It is unknown how effectively these recommendations perform in a multi-ethnic Asian population, with varied cultural beliefs and diets. We assess the profi le of protein intake in a multi-ethnic Asian population, comparing healthy participants and CKD patients. We analysed the 24-hour urine collections of the Asian Kidney Disease Study (AKDS) and the Singapore Kidney Function Study (SKFS) to estimate total protein intake (TPI; g/day). We calculated ideal body weight (IDW; kg): 22.99 × height2 (m). Standard statistical tests were applied where appropriate, and linear regression was used to assess associations of continuous variables with protein intake. There were 232 CKD patients and 103 healthy participants with 35.5% diabetics. The mean TPI in healthy participants was 58.89 ± 18.42 and the mean TPI in CKD patients was 53.64 ± 19.39. By US National Kidney Foundation (NKF) guidelines, 29/232 (12.5%) of CKD patients with measured glomerular filtration rate (GFR) patients had TPI-IDW >0.75g/kg/ day. By American Dietetic Association (ADA) guidelines, 34.7% (44/127) of CKD patients with GFR patients with GFR protein intake of between 0.3 to 0.5 g/kg/day. A total of 21.9% (25/114) of diabetic CKD patients had protein intake between 0.8 to 0.9 g/kg/day. On average, the protein intake of most CKD patients exceeds the recommendations of guidelines. Diabetic CKD patients should aim to have higher protein intakes.

  4. Retinal Vein Occlusion in a Multi-Ethnic Asian Population: The Singapore Epidemiology of Eye Disease Study.

    Science.gov (United States)

    Koh, Victor; Cheung, Carol Y; Li, Xiang; Tian, Dechao; Wang, Jie Jin; Mitchell, Paul; Cheng, Ching-Yu; Wong, Tien Y

    2016-01-01

    To describe the prevalence of retinal vein occlusion (RVO) and its risk factors in a multi-ethnic Asian population. This population-based study of 10,033 participants (75.7% response rate) included Chinese, Indian and Malay persons aged 40 years and older. A comprehensive ophthalmic examination, standardized interviews and laboratory blood tests were performed. Digital fundus photographs were assessed for presence of RVO following the definitions used in the Blue Mountains Eye Study. Regression analysis models were constructed to study the relationship between ocular and systemic factors and RVO. Age-specific prevalence rates of RVO were applied to project the number of people affected in Asia from 2013 to 2040. The overall crude prevalence of RVO was 0.72% (n = 71; 95% confidence interval, CI, 0.54-0.87%). The crude prevalence of RVO was similar in Chinese, Indian and Malay participants (p = 0.865). In multivariable regression models, significant risk factors of RVO included increased age (odds ratio, OR, 1.03, 95% CI 1.01-1.06), hypertension (OR 3.65, 95% CI 1.61-8.31), increased serum creatinine (OR 1.04, 95% CI 1.01-1.06, per 10 mmol/L increase), history of heart attack (OR 2.25, 95% CI 1.11-4.54) and increased total cholesterol (OR 1.31, 95% CI 1.07-1.59, per 1 mmol/L increase). None of the ocular parameters were associated with RVO. RVO is estimated to affect up to 16 and 21 million people in Asia by 2020 and 2040, respectively. RVO was detected in 0.72% of a multi-ethnic Asian population aged 40-80 years in Singapore. The significant systemic risk factors of RVO are consistent with studies in white populations.

  5. Genotype 3 is the predominant hepatitis C genotype in a multi-ethnic Asian population in Malaysia.

    Science.gov (United States)

    Ho, Shiaw-Hooi; Ng, Kee-Peng; Kaur, Harvinder; Goh, Khean-Lee

    2015-06-01

    Genotypes of hepatitis C virus (HCV) are distributed differently across the world. There is a paucity of such data in a multi-ethnic Asian population like Malaysia. The objectives of this study were to determine the distribution of HCV genotypes between major ethnic groups and to ascertain their association with basic demographic variables like age and gender. This was a cross-sectional prospective study conducted from September 2007 to September 2013. Consecutive patients who were detected to have anti-HCV antibodies in the University of Malaya Medical Centre were included and tested for the presence of HCV RNA using Roche Cobas Amplicor Analyzer and HCV genotype using Roche single Linear Array HCV Genotyping strip. Five hundred and ninety-six subjects were found to have positive anti-HCV antibodies during this period of time. However, only 396 (66.4%) were HCV RNA positive and included in the final analysis. Our results showed that HCV genotype 3 was the predominant genotype with overall frequency of 61.9% followed by genotypes 1 (35.9%), 2 (1.8%) and 6 (0.5%). There was a slightly higher prevalence of HCV genotype 3 among the Malays when compared to the Chinese (P=0.043). No other statistical significant differences were observed in the distribution of HCV genotypes among the major ethnic groups. There was also no association between the predominant genotypes and basic demographic variables. In a multi-ethnic Asian society in Malaysia, genotype 3 is the predominant genotype among all the major ethnic groups with genotype 1 as the second commonest genotype. Both genotypes 2 and 6 are uncommon. Neither genotype 4 nor 5 was detected. There is no identification of HCV genotype according to ethnic origin, age and gender.

  6. Determinants of Breastfeeding Practices and Success in a Multi-Ethnic Asian Population.

    Science.gov (United States)

    Pang, Wei Wei; Aris, Izzuddin M; Fok, Doris; Soh, Shu-E; Chua, Mei Chien; Lim, Sok Bee; Saw, Seang-Mei; Kwek, Kenneth; Gluckman, Peter D; Godfrey, Keith M; van Dam, Rob M; Kramer, Michael S; Chong, Yap-Seng

    2016-03-01

    Many countries in Asia report low breastfeeding rates and the risk factors for early weaning are not well studied. We assessed the prevalence, duration, and mode of breastfeeding (direct or expressed) among mothers of three Asian ethnic groups. Participants were 1,030 Singaporean women recruited during early pregnancy. Data collected included early breastfeeding experiences, breastfeeding duration, and mode of breastfeeding. Full breastfeeding was defined as the intake of breast milk, with or without water. Cox regression models were used to identify factors associated with discontinuation of any and full breastfeeding. Logistic regression analyses assessed the association of ethnicity with mode of breastfeeding. At 6 months postpartum, the prevalence of any breastfeeding was 46 percent for Chinese mothers, 22 percent for Malay mothers, and 41 percent for Indian mothers; prevalence of full breastfeeding was 11, 2, and 5 percent, respectively. More Chinese mothers fed their infants expressed breast milk, instead of directly breastfeeding them, compared with the other two ethnic groups. Duration of any and full breastfeeding were positively associated with breastfeeding a few hours after birth, higher maternal age and education, and negatively associated with irregular breastfeeding frequency and being shown how to breastfeed. Adjusting for maternal education, breastfeeding duration was similar in the three ethnic groups, but ethnicity remained a significant predictor of mode of breastfeeding. The low rates and duration of breastfeeding in this population may be improved with breastfeeding education and support, especially in mothers with lower education. Further work is needed to understand the cultural differences in mode of feeding and its implications for maternal and infant health. © 2015 Wiley Periodicals, Inc.

  7. Development of a Semi-Quantitative Food Frequency Questionnaire to Assess the Dietary Intake of a Multi-Ethnic Urban Asian Population

    OpenAIRE

    Neelakantan, Nithya; Whitton, Clare; Seah, Sharna; Koh, Hiromi; Rebello, Salome A.; Lim, Jia Yi; Chen, Shiqi; Chan, Mei Fen; Chew, Ling; van Dam, Rob M.

    2016-01-01

    Assessing habitual food consumption is challenging in multi-ethnic cosmopolitan settings. We systematically developed a semi-quantitative food frequency questionnaire (FFQ) in a multi-ethnic population in Singapore, using data from two 24-h dietary recalls from a nationally representative sample of 805 Singapore residents of Chinese, Malay and Indian ethnicity aged 18–79 years. Key steps included combining reported items on 24-h recalls into standardized food groups, developing a food list fo...

  8. Assessment of muscle mass and its association with protein intake in a multi-ethnic Asian population: relevance in chronic kidney disease.

    Science.gov (United States)

    Teo, Boon Wee; Toh, Qi Chun; Chan, Xue Wei; Xu, Hui; Li, Jia Liang; Lee, Evan Jc

    2014-01-01

    Clinical practice guidelines recommend objective nutritional assessments in managing chronic kidney disease (CKD) patients but were developed while referencing to a North-American population. Specific recommendations for assessing muscle mass were suggested (mid-arm circumference, MAC; corrected mid-arm muscle area, cAMA; mid-arm muscle circumference, MAMC). This study aimed to assess correlation and association of these assessments with dietary protein intake in a multi-ethnic Asian population of healthy and CKD patients. We analyzed 24-hour urine collections of selected participants to estimate total protein intake (TPI; g/day). Ideal body weight (IDW; kg) was calculated and muscle assessments conducted. Analyses involved correlation and linear regression, taking significance at ppatients and 103 healthy participants comprising of 51.0% male, 38.5% Chinese, 29.6% Malay, 23.6% Indian, and 8.4% others. The mean TPI was 58.9 ± 18.4 g/day in healthy participants and 53.6 ± 19.4 g/day in CKD patients. When normalized to ideal body weight, TPI-IDW (g/kg/day) was similar in healthy and CKD participants. Overall, TPI was associated with MAC (r=0.372, ppatients. Total protein intake was associated with muscle assessments in all participants. TPI normalized to IDW should only be used in CKD patients.

  9. Prevalence of PALB2 mutations in breast cancer patients in multi-ethnic Asian population in Malaysia and Singapore.

    Science.gov (United States)

    Phuah, Sze Yee; Lee, Sheau Yee; Kang, Peter; Kang, In Nee; Yoon, Sook-Yee; Thong, Meow Keong; Hartman, Mikael; Sng, Jen-Hwei; Yip, Cheng Har; Taib, Nur Aishah Mohd; Teo, Soo-Hwang

    2013-01-01

    The partner and localizer of breast cancer 2 (PALB2) is responsible for facilitating BRCA2-mediated DNA repair by serving as a bridging molecule, acting as the physical and functional link between the breast cancer 1 (BRCA1) and breast cancer 2 (BRCA2) proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risks of developing breast cancer in various populations. We evaluated the contribution of PALB2 germline mutations in 122 Asian women with breast cancer, all of whom had significant family history of breast and other cancers. Further screening for nine PALB2 mutations was conducted in 874 Malaysian and 532 Singaporean breast cancer patients, and in 1342 unaffected Malaysian and 541 unaffected Singaporean women. By analyzing the entire coding region of PALB2, we found two novel truncating mutations and ten missense mutations in families tested negative for BRCA1/2-mutations. One additional novel truncating PALB2 mutation was identified in one patient through genotyping analysis. Our results indicate a low prevalence of deleterious PALB2 mutations and a specific mutation profile within the Malaysian and Singaporean populations.

  10. Development of a Semi-Quantitative Food Frequency Questionnaire to Assess the Dietary Intake of a Multi-Ethnic Urban Asian Population

    Directory of Open Access Journals (Sweden)

    Nithya Neelakantan

    2016-08-01

    Full Text Available Assessing habitual food consumption is challenging in multi-ethnic cosmopolitan settings. We systematically developed a semi-quantitative food frequency questionnaire (FFQ in a multi-ethnic population in Singapore, using data from two 24-h dietary recalls from a nationally representative sample of 805 Singapore residents of Chinese, Malay and Indian ethnicity aged 18–79 years. Key steps included combining reported items on 24-h recalls into standardized food groups, developing a food list for the FFQ, pilot testing of different question formats, and cognitive interviews. Percentage contribution analysis and stepwise regression analysis were used to identify foods contributing cumulatively ≥90% to intakes and individually ≥1% to intake variance of key nutrients, for the total study population and for each ethnic group separately. Differences between ethnic groups were observed in proportions of consumers of certain foods (e.g., lentil stews, 1%–47%; and pork dishes, 0%–50%. The number of foods needed to explain variability in nutrient intakes differed substantially by ethnic groups and was substantially larger for the total population than for separate ethnic groups. A 163-item FFQ covered >95% of total population intake for all key nutrients. The methodological insights provided in this paper may be useful in developing similar FFQs in other multi-ethnic settings.

  11. Development of a Semi-Quantitative Food Frequency Questionnaire to Assess the Dietary Intake of a Multi-Ethnic Urban Asian Population.

    Science.gov (United States)

    Neelakantan, Nithya; Whitton, Clare; Seah, Sharna; Koh, Hiromi; Rebello, Salome A; Lim, Jia Yi; Chen, Shiqi; Chan, Mei Fen; Chew, Ling; van Dam, Rob M

    2016-08-27

    Assessing habitual food consumption is challenging in multi-ethnic cosmopolitan settings. We systematically developed a semi-quantitative food frequency questionnaire (FFQ) in a multi-ethnic population in Singapore, using data from two 24-h dietary recalls from a nationally representative sample of 805 Singapore residents of Chinese, Malay and Indian ethnicity aged 18-79 years. Key steps included combining reported items on 24-h recalls into standardized food groups, developing a food list for the FFQ, pilot testing of different question formats, and cognitive interviews. Percentage contribution analysis and stepwise regression analysis were used to identify foods contributing cumulatively ≥90% to intakes and individually ≥1% to intake variance of key nutrients, for the total study population and for each ethnic group separately. Differences between ethnic groups were observed in proportions of consumers of certain foods (e.g., lentil stews, 1%-47%; and pork dishes, 0%-50%). The number of foods needed to explain variability in nutrient intakes differed substantially by ethnic groups and was substantially larger for the total population than for separate ethnic groups. A 163-item FFQ covered >95% of total population intake for all key nutrients. The methodological insights provided in this paper may be useful in developing similar FFQs in other multi-ethnic settings.

  12. Are symbols useful and culturally acceptable in health-state valuation studies? An exploratory study in a multi-ethnic Asian population

    Directory of Open Access Journals (Sweden)

    Hwee-Lin

    2008-10-01

    Full Text Available Hwee-Lin, Wee1, Shu-Chuen Li2, Xu-Hao Zhang1, Feng Xie3, David Feeny4, Nan Luo5, Yin-Bun Cheung6, David Machin7, Kok-Yong Fong8, Julian Thumboo81Department of Pharmacy, National University of Singapore (NUS, Singapore; 2Discipline of Pharmacy and Experimental Pharmacology, School of Biomedical Sciences, Faculty of Health, University of Newcastle, Newcastle, NSW, Australia; 3McMaster University, Hamilton, Ontario, Canada; 4Kaiser Permanente Northwest Center for Health Research, Portland, OR, USA; 5Department of Community, Occupational and Family Medicine, Yong Loo Lin School of Medicine, NUS, Singapore; 6Clinical Trials and Epidemiology Research Unit, Singapore; 7School of Health and Related Research, University of Sheffield, Sheffield, UK; 8Department of Rheumatology and Immunology, Singapore General Hospital, SingaporeBackground: Symbols have been used in health state valuation studies to help subjects distinguish the severity of various characteristics of a given health state. Symbols used in such studies need to be evaluated for their cross-cultural appropriateness because a given symbol may have different meanings or acceptability in different cultures, which may affect results of such studies.Objectives: To evaluate if using symbols to differentiate health states of different severity is useful and culturally acceptable in a multi-ethnic, urban Asian population.Methods: Using in-depth interviews with adult Chinese, Malay, and Indian Singaporeans conducted in English/mother-tongue, subjects were shown a health state with 6 levels (Health Utilities Index 3 vision, each displayed with a symbol, and asked (1a if symbols were useful in differentiating severity of each level (measured using dichotomous and 0–10 visual analog scale [VAS] scales or (1b offensive and (2 to assess 7 alternative sets of symbols.Results: Of 63 subjects (91% response rate, 18 (29% felt symbols were useful in differentiating severity of each level. Reported usefulness

  13. The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population

    Directory of Open Access Journals (Sweden)

    Vaingankar Janhavi

    2011-10-01

    Full Text Available Abstract Background Instruments to measure mental health and well-being are largely developed and often used within Western populations and this compromises their validity in other cultures. A previous qualitative study in Singapore demonstrated the relevance of spiritual and religious practices to mental health, a dimension currently not included in exiting multi-dimensional measures. The objective of this study was to develop a self-administered measure that covers all key and culturally appropriate domains of mental health, which can be applied to compare levels of mental health across different age, gender and ethnic groups. We present the item reduction and validation of the Positive Mental Health (PMH instrument in a community-based adult sample in Singapore. Methods Surveys were conducted among adult (21-65 years residents belonging to Chinese, Malay and Indian ethnicities. Exploratory and confirmatory factor analysis (EFA, CFA were conducted and items were reduced using item response theory tests (IRT. The final version of the PMH instrument was tested for internal consistency and criterion validity. Items were tested for differential item functioning (DIF to check if items functioned in the same way across all subgroups. Results: EFA and CFA identified six first-order factor structure (General coping, Personal growth and autonomy, Spirituality, Interpersonal skills, Emotional support, and Global affect under one higher-order dimension of Positive Mental Health (RMSEA = 0.05, CFI = 0.96, TLI = 0.96. A 47-item self-administered multi-dimensional instrument with a six-point Likert response scale was constructed. The slope estimates and strength of the relation to the theta for all items in each six PMH subscales were high (range:1.39 to 5.69, suggesting good discrimination properties. The threshold estimates for the instrument ranged from -3.45 to 1.61 indicating that the instrument covers entire spectrums for the six dimensions. The

  14. Patterns of physical activity in different domains and implications for intervention in a multi-ethnic Asian population: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Tai E Shyong

    2010-10-01

    Full Text Available Abstract Background The benefits of regular physical activity for quality of life and disease prevention have been well documented. Identification of low activity groups would facilitate interventional programs. Many studies have focussed on leisure time activity, which may not capture the spectrum of physical activity relevant to disease prevention. Furthermore, few studies have been conducted in urban Asian settings. Methods We evaluated physical activity in different domains (leisure time, occupational, household and transportation and its sociodemographic determinants in 4750 adult Chinese, Malay, and Asian Indian Singaporeans. Physical activity was assessed using locally validated questionnaires. Results Occupational and household activity contributed substantially more to total physical activity than leisure time or transportation activity. However, when only activity of at least moderate intensity was considered leisure time activity contributed most to total physical activity. Higher socio-economic status was associated with more leisure time activity, but less total physical activity due to reduced activity in the other domains. Chinese ethnicity was also associated with less total physical activity as a result of less activity in non-leisure time domains. Conclusions In assessing levels of physical activity and recommending changes, it is important to consider physical activity in different domains. Focus on leisure-time physical activity alone could identify the wrong groups for intervention and miss opportunities for increasing physical activity in populations.

  15. Reliability and validity of the English (Singapore) and Chinese (Singapore) versions of the Short-Form 36 version 2 in a multi-ethnic urban Asian population in Singapore.

    Science.gov (United States)

    Thumboo, Julian; Wu, Yi; Tai, E-Shyong; Gandek, Barbara; Lee, Jeannette; Ma, Stefan; Heng, Derrick; Wee, Hwee-Lin

    2013-11-01

    We aimed to evaluate the measurement properties of the Singapore English and Chinese versions of the Short-Form 36 version 2 (SF-36v2) Questionnaire, an improved version of the widely used SF-36, for assessing health-related quality of life (HRQoL) in a multi-ethnic urban Asian population in Singapore. SF-36v2 scores and data on medical history, demographic and lifestyle factors from the Singapore Prospective Study Programme were analyzed. Convergent and divergent validity, internal consistency, floor and ceiling effects, known group validity and factor structure of the SF-36v2 were assessed for the English and Chinese versions, respectively. Complete data for 4,917 participants (45.8 %) out of 10,747 eligible individuals were analyzed (survey language: 4,115 English and 802 Chinese). Item-scale correlations exceeded 0.4 for all items of the English SF-36v2 and for all except one item of the Chinese SF-36v2 (bathe and dress: item-scale correlation: 0.36). In the English SF-36v2, Cronbach's alpha exceeded 0.70 for all scales. In the Chinese SF-36v2, Cronbach's alpha exceeded 0.7 on all scales except social functioning (Cronbach's alpha: 0.68). For known groups validity, respondents with chronic medical conditions expectedly reported lower SF-36v2 score on most English and Chinese SF-36v2 scales. In confirmatory factor analysis, the Singapore three-component model was favored over the United States two-component and Japan three-component models. The English and Chinese SF-36v2 are valid and reliable for assessing HRQoL among English and Chinese-speaking Singaporeans. Test-retest reliability and responsiveness of the English and Chinese SF-36v2 in Singapore remain to be evaluated.

  16. Infant Feeding Practices in a Multi-Ethnic Asian Cohort: The GUSTO Study

    Directory of Open Access Journals (Sweden)

    Jia Ying Toh

    2016-05-01

    Full Text Available The optimal introduction of complementary foods provides infants with nutritionally balanced diets and establishes healthy eating habits. The documentation of infant feeding practices in multi-ethnic Asian populations is limited. In a Singapore cohort study (GUSTO, 842 mother-infant dyads were interviewed regarding their feeding practices when the infants were aged 9 and 12 months. In the first year, 20.5% of infants were given dietary supplements, while 5.7% took probiotics and 15.7% homeopathic preparations. At age 9 months, 45.8% of infants had seasonings added to their foods, increasing to 56.3% at 12 months. At age 12 months, 32.7% of infants were given blended food, although 92.3% had begun some form of self-feeding. Additionally, 87.4% of infants were fed milk via a bottle, while a third of them had food items added into their bottles. At both time points, more than a third of infants were provided sweetened drinks via the bottle. Infants of Indian ethnicity were more likely to be given dietary supplements, have oil and seasonings added to their foods and consumed sweetened drinks from the bottle (p < 0.001. These findings provide a better understanding of variations in infant feeding practices, so that healthcare professionals can offer more targeted and culturally-appropriate advice.

  17. The prevalence of urinary incontinence in pregnancy among a multi-ethnic population resident in Norway.

    Science.gov (United States)

    Bø, K; Pauck Øglund, G; Sletner, L; Mørkrid, K; Jenum, A K

    2012-10-01

    To investigate prevalence of urinary incontinence (UI) in a multi-ethnic population of pregnant women, and to analyse for possible associations of the known risk factors for UI in such a population. Population-based cross-sectional study. All pregnant women in three administrative city districts attending the Child Health Clinics. Out of 823 women identified in the [corrected] first trimester, 772 (94%) [corrected] agreed to participate in the study at 28 weeks of gestation. Inclusion criteria were: healthy women at 20 weeks of gestation or less and able to communicate in Norwegian, Arabic, English, Sorani, Somali, Tamil, Turkish, Urdu or Vietnamese. Differences between ethnic groups were tested by simple descriptive statistics. Associations were estimated by logistic regression analysis and presented as crude (cOR) and adjusted (aOR) odds ratios. Prevalence of UI as ascertained using the International Consultation on Incontinence Questionnaire-urinary incontinence-short form. Prevalence rates of UI at 28 weeks of gestation were 26% for women of African origin, 36% for women of Middle Eastern origin, 40% for women of East Asian origin, 43% for women of South Asian origin and 45% for women of European/North American origin. The difference was significant between women of African and European/North American origins (P = 0.011) and between women of African and South Asian origins (P = 0.035). Age (aOR 1.05; 95% CI 1.01-1.09) and parity (aOR 2.34; 95% CI 1.66-3.28) were positively associated with the prevalence of UI in pregnancy. Women of African origin had significantly reduced odds for UI (aOR 0.42; 95% CI 0.20-0.87). East Asian and African women reported the highest perceived impact of UI in pregnancy. A high prevalence of UI was found in a multi-ethnic pregnant population. © 2012 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2012 RCOG.

  18. Maternal Dietary Patterns and Gestational Diabetes Mellitus in a Multi-Ethnic Asian Cohort: The GUSTO Study

    Directory of Open Access Journals (Sweden)

    Jamie de Seymour

    2016-09-01

    Full Text Available Gestational Diabetes Mellitus (GDM is associated with an increased risk of perinatal morbidity and long term health issues for both the mother and offspring. Previous research has demonstrated associations between maternal diet and GDM development, but evidence in Asian populations is limited. The objective of our study was to examine the cross-sectional relationship between maternal dietary patterns during pregnancy and the risk of GDM in a multi-ethnic Asian cohort. Maternal diet was ascertained using 24-h dietary recalls from participants in the Growing up in Singapore towards healthy outcomes (GUSTO study—a prospective mother-offspring cohort, and GDM was diagnosed according to 1999 World Health Organisation guidelines. Dietary patterns were identified using factor analysis, and multivariate regression analyses performed to assess the association with GDM. Of 909 participants, 17.6% were diagnosed with GDM. Three dietary patterns were identified: a vegetable-fruit-rice-based-diet, a seafood-noodle-based-diet and a pasta-cheese-processed-meat-diet. After adjusting for confounding variables, the seafood-noodle-based-diet was associated with a lower likelihood of GDM (Odds Ratio (95% Confidence Interval = 0.74 (0.59, 0.93. The dietary pattern found to be associated with GDM in our study was substantially different to those reported previously in Western populations.

  19. Ethnic differences in fetal size and growth in a multi-ethnic population.

    Science.gov (United States)

    Sletner, Line; Rasmussen, Svein; Jenum, Anne Karen; Nakstad, Britt; Jensen, Odd Harald Rognerud; Vangen, Siri

    2015-09-01

    Impaired or excessive fetal growth is associated with adverse short- and long-term health outcomes that differ between ethnic groups. We explored ethnic differences in fetal size and growth from mid pregnancy until birth. Data are from the multi-ethnic STORK-Groruddalen study, a population-based, prospective cohort of 823 pregnant women and their offspring in Oslo, Norway. Measures were z-scores of estimated fetal weight (EFW), head circumference (HC), abdominal circumference (AC) and femur length (FL), in gestational week 24, 32 and 37, measured by ultrasound, and similar measures at birth. Differences in fetal size and growth were assessed using separate Linear Mixed Models including all four time points, with ethnic Europeans as reference. In week 24 South Asian fetuses had smaller AC, but larger FL than Europeans, and slightly lower EFW (-0.17 SD (-0.33, -0.01), p=0.04). Middle East/North African fetuses also had larger FL, but similar AC, and hence slightly higher EFW (0.18 (0.003, 0.36), p=0.05). Both groups had slower growth of AC, FL and EFW from this time until birth, and had -0.61 SD (-0.73, -0.49) and -0.28 SD (-0.41, -0.15) lower birth weight respectively. Ethnic East Asians, on the other hand, were smaller throughout pregnancy and had -0.58 SD (-0.82, -0.34) lower birth weight. Significant ethnic differences remained after adjusting for maternal factors. We observed ethnic differences in fetal size and body proportions already in gestational week 24, and in fetal growth from this time until birth, which were only partly explained by key maternal factors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. The relation between obesity and depressed mood in a multi-ethnic population. The HELIUS study.

    Science.gov (United States)

    Gibson-Smith, Deborah; Bot, Mariska; Snijder, Marieke; Nicolaou, Mary; Derks, Eske M; Stronks, Karien; Brouwer, Ingeborg A; Visser, Marjolein; Penninx, Brenda W J H

    2018-06-01

    To examine the association between obesity and depressed mood in a large multi-ethnic population and check for consistency in this association across six ethnic groups. Data of 21,030 persons (18-70 years) were sourced from the HELIUS study. Cross-sectional relationships between obesity measures [body mass index (kg/m 2 ) and waist circumference (cm)] and depressed mood (PHQ-9 score ≥ 10) were analysed. Consistency of associations was investigated across ethnic groups by interaction terms (ethnicity*obesity measures) in basic (age, sex, education) and fully (health behaviours and somatic health) adjusted models. Obesity was prevalent in all ethnic groups, but varied substantially. After sociodemographic adjustment, obesity measures were associated with increased odds of depressed mood but this was inconsistent across ethnic groups. Obesity (BMI ≥ 30 or highest waist circumference quartile) was strongly and significantly associated with depressed mood in the Dutch [Odds Ratio (OR) = 1.72; 95% Confidence intervals (CI) 1.24-2.40, and OR = 1.86; 95% CI 1.38-2.50], respectively, and African Surinamese (OR = 1.60; 95% CI 1.29-1.98 and OR = 1.59; 95% CI 1.27-2.00, respectively) but had a weaker, non-significant association in other ethnic groups (South-Asian Surinamese, Ghanaian, Moroccan, Turkish groups). Adjustment for health behaviours and somatic health had limited effect on this pattern. Obesity was associated with a higher risk of depressed mood. However, ethnic differences were found: the obesity-depressed mood association was strong in the Dutch and African Surinamese populations, but not in other ethnic groups. Future studies should explore whether differential normative values or pathophysiology across ethnic groups explain why the obesity-depression association is inconsistent across ethnic groups.

  1. Validation of the SQUASH Physical Activity Questionnaire in a Multi-Ethnic Population: The HELIUS Study.

    Directory of Open Access Journals (Sweden)

    M Nicolaou

    Full Text Available To investigate the reliability and validity of the SQUASH physical activity (PA questionnaire in a multi-ethnic population living in the Netherlands.We included participants from the HELIUS study, a population-based cohort study. In this study we included Dutch (n = 114, Turkish (n = 88, Moroccan (n = 74, South-Asian Surinamese (n = 98 and African Surinamese (n = 91 adults, aged 18-70 years. The SQUASH was self-administered twice to assess test-re-test reliability (mean interval 6-7 weeks and participants wore an accelerometer and heart rate monitor (Actiheart to enable assessment of construct validity.We observed low test-re-test reliability; Intra class correlation coefficients ranged from low (0.05 for moderate/high intensity PA in African Surinamese women to acceptable (0.78 for light intensity PA in Moroccan women. The discrepancy between self-reported and measured PA differed on the basis of the intensity of activity: self-reported light intensity PA was lower than measured but self-reported moderate/high intensity PA was higher than measured, with wide limits of agreement. The discrepancy between questionnaire and Actiheart measures of moderate intensity PA did not differ between ethnic minority and Dutch participants with correction for relevant confounders. Additionally, the SQUASH overestimated the number of participants meeting the Dutch PA norm; Cohen's kappas for the agreement were poor, the highest being 0.30 in Dutch women.We found considerable variation in the test-re-test reliability and validity of self-reported PA with no consistency based on ethnic origin. Our findings imply that the SQUASH does not provide a valid basis for comparison of PA between ethnic groups.

  2. Contribution of common PCSK1 genetic variants to obesity in 8,359 subjects from multi-ethnic American population.

    Science.gov (United States)

    Choquet, Hélène; Kasberger, Jay; Hamidovic, Ajna; Jorgenson, Eric

    2013-01-01

    Common PCSK1 variants (notably rs6232 and rs6235) have been shown to be associated with obesity in European, Asian and Mexican populations. To determine whether common PCSK1 variants contribute to obesity in American population, we conducted association analyses in 8,359 subjects using two multi-ethnic American studies: the Coronary Artery Risk Development in Young Adults (CARDIA) study and the Multi-Ethnic Study of Atherosclerosis (MESA). By evaluating the contribution of rs6232 and rs6235 in each ethnic group, we found that in European-American subjects from CARDIA, only rs6232 was associated with BMI (P = 0.006) and obesity (P = 0.018) but also increased the obesity incidence during the 20 years of follow-up (HR = 1.53 [1.07-2.19], P = 0.019). Alternatively, in African-American subjects from CARDIA, rs6235 was associated with BMI (P = 0.028) and obesity (P = 0.018). Further, by combining the two case-control ethnic groups from the CARDIA study in a meta-analysis, association between rs6235 and obesity risk remained significant (OR = 1.23 [1.05-1.45], P = 9.5×10(-3)). However, neither rs6232 nor rs6235 was associated with BMI or obesity in the MESA study. Interestingly, rs6232 was associated with BMI (P = 4.2×10(-3)) and obesity (P = 3.4×10(-3)) in the younger European-American group combining samples from the both studies [less than median age (53 years)], but not among the older age group (P = 0.756 and P = 0.935 for BMI and obesity, respectively). By combining all the case-control ethnic groups from CARDIA and MESA in a meta-analysis, we found no significant association for the both variants and obesity risk. Finally, by exploring the full PCSK1 locus, we observed that no variant remained significant after correction for multiple testing. These results indicate that common PCSK1 variants (notably rs6232 and rs6235) contribute modestly to obesity in multi-ethnic American population. Further, these results

  3. Alpha-Actinin-3 (ACTN3 R/X Gene Polymorphism and Physical Performance of Multi-Ethnic Malaysian Population

    Directory of Open Access Journals (Sweden)

    Hazwani Ahmad Yusof

    2016-09-01

    Full Text Available A disparity population data set in the current literature with limited reports among Asian samples and the inconsistent findings among different ethnic groups warrant further investigation on the association between alpha-actinin-3 (ACTN3 R/X gene polymorphism and human physical performance in Asian population. This study was designed to examine the association between ACTN3 R/X gene polymorphism and physical performance of multi-ethnic Malaysian population. One hundred eighty well-trained athletes (34 endurance, 41 strength, and 105 intermittent and 180 controls were drawn from four ethnic groups in Malaysia (Malay, Chinese, Indian, and Other Bumiputra. A sample of deoxyribonucleic acid (DNA was retrieved from a buccal swab from each participant and the ACTN3 R/X genotype was identified through polymerase chain reaction and restriction fragment length polymorphism analysis. The strength and endurance performances of the athletes were evaluated with maximal voluntary contraction and Yo-Yo intermittent recovery level 2 tests, respectively. The independent t-test, chi-square, multivariate, and one-way analysis of variance were used for data analysis. ACTN3 R/X alleles (p = 0.672 and genotype (p = 0.355 frequencies did not vary much between the multi-ethnic groups of Malaysian athletes. These small variations did not have any influence on handgrip strength (p = 0.334, leg strength (p = 0.256, and Yo-Yo intermittent recovery level 2 performance (p = 0.425 between these ethnic groups. The RR and XX genotypes were more frequent among strength and intermittent athletes, respectively. Athletes with the RR genotype had greater handgrip than those with the RX genotype (p = 0.031, but not different from athletes with the XX genotype (p = 0.228. Athletes with RR genotype also have a higher leg strength than those with the RX (p = 0.001 and XX genotype (p = 0.010. However, the endurance performance was similar among genotype groups (p = 0.385. The ACTN3 R

  4. Are Asians comfortable with discussing death in health valuation studies? A study in multi-ethnic Singapore.

    Science.gov (United States)

    Wee, Hwee-Lin; Li, Shu-Chuen; Xie, Feng; Zhang, Xu-Hao; Luo, Nan; Cheung, Yin-Bun; Machin, David; Fong, Kok-Yong; Thumboo, Julian

    2006-12-05

    To characterize ease in discussing death (EID) and its influence on health valuation in a multi-ethnic Asian population and to determine the acceptability of various descriptors of death and "pits"/"all-worst" in health valuation. In-depth interviews (English or mother-tongue) among adult Chinese, Malay and Indian Singaporeans selected to represent both genders and a wide range of ages/educational levels. Subjects rated using 0-10 visual analogue scales (VAS): (1) EID, (2) acceptability of 8 descriptors for death, and (3) appropriateness of "pits" and "all-worst" as descriptors for the worst possible health state. Subjects also valued 3 health states using VAS followed by time trade-off (TTO). The influence of sociocultural variables on EID and these descriptors was studied using univariable analyses and multiple linear regression (MLR). The influence of EID on VAS/TTO utilities with adjustment for sociocultural variables was assessed using MLR. Subjects (n = 63, 35% Chinese, 32% Malay, median age 44 years) were generally comfortable with discussing death (median EID: 8.0). Only education significantly influenced EID (p = 0.045). EID correlated weakly with VAS/TTO scores (range: VAS: -0.23 to 0.07; TTO: -0.14 to 0.11). All subjects felt "passed away", "departed" and "deceased" were most acceptable (median acceptability: 8.0) while "sudden death" and "immediate death" were least acceptable (median acceptability: 5.0). Subjects clearly preferred "all-worst" to "pits" (63% vs. 19%, p < 0.001). Singaporeans were generally comfortable with discussing death and had clear preferences for several descriptors of death and for "all-worst". EID is unlikely to influence health preference measurement in health valuation studies.

  5. The association of maternal vitamin D status with infant birth outcomes, postnatal growth and adiposity in the first 2 years of life in a multi-ethnic Asian population: the Growing Up in Singapore Towards healthy Outcomes (GUSTO) cohort study.

    Science.gov (United States)

    Ong, Yi Lin; Quah, Phaik Ling; Tint, Mya Thway; Aris, Izzuddin M; Chen, Ling Wei; van Dam, Rob M; Heppe, Denise; Saw, Seang-Mei; Godfrey, Keith M; Gluckman, Peter D; Chong, Yap Seng; Yap, Fabian; Lee, Yung Seng; Foong-Fong Chong, Mary

    2016-08-01

    Maternal vitamin D status during pregnancy has been associated with infant birth and postnatal growth outcomes, but reported findings have been inconsistent, especially in relation to postnatal growth and adiposity outcomes. In a mother-offspring cohort in Singapore, maternal plasma vitamin D was measured between 26 and 28 weeks of gestation, and anthropometric measurements were obtained from singleton offspring during the first 2 years of life with 3-month follow-up intervals to examine birth, growth and adiposity outcomes. Associations were analysed using multivariable linear regression. Of a total of 910 mothers, 13·2 % were vitamin D deficient (growth outcomes - weight-for-age z-scores, length-for-age z-scores, circumferences of the head, abdomen and mid-arm at birth or postnatally - and adiposity outcomes - BMI, and skinfold thickness (triceps, biceps and subscapular) at birth or postnatally. Maternal vitamin D status in pregnancy did not influence infant birth outcomes, postnatal growth and adiposity outcomes in this cohort, perhaps due to the low prevalence (1·6 % of the cohort) of severe maternal vitamin D deficiency (defined as of population.

  6. Dietary pattern derived by reduced rank regression and depressive symptoms in a multi-ethnic population: the HELIUS study.

    Science.gov (United States)

    Vermeulen, E; Stronks, K; Visser, M; Brouwer, I A; Snijder, M B; Mocking, R J T; Derks, E M; Schene, A H; Nicolaou, M

    2017-08-01

    To investigate the association of dietary patterns derived by reduced rank regression (RRR) with depressive symptoms in a multi-ethnic population. Cross-sectional data from the HELIUS study were used. In total, 4967 men and women (18-70 years) of Dutch, South-Asian Surinamese, African Surinamese, Turkish and Moroccan origin living in the Netherlands were included. Diet was measured using ethnic-specific food frequency questionnaires. Depressive symptoms were measured with the nine-item patient health questionnaire. By performing RRR in the whole population and per ethnic group, comparable dietary patterns were identified and therefore the dietary pattern for the whole population was used for subsequent analyses. We identified a dietary pattern that was strongly related to eicosapentaenoic acid+docosahexaenoic acid, folate, magnesium and zinc (response variables) and which was characterized by milk products, cheese, whole grains, vegetables, legumes, nuts, potatoes and red meat. After adjustment for confounders, a statistically significant inverse association was observed in the whole population (B: -0.03, 95% CI: -0.06, -0.00, P=0.046) and among Moroccan (B: -0.09, 95% CI: -0.13, -0.04, P=0.027) and South-Asian Surinamese participants (B: -0.05, 95% CI: -0.09, -0.01, P=dietary pattern and significant depressed mood in any of the ethnic groups. No consistent evidence was found that consumption of a dietary pattern, high in nutrients that are hypothesized to protect against depression, was associated with lower depressive symptoms across different ethnic groups.

  7. Dietary pattern derived by reduced rank regression and depressive symptoms in a multi-ethnic population: the HELIUS study

    NARCIS (Netherlands)

    Vermeulen, E.; Stronks, K.; Visser, M.; Brouwer, I. A.; Snijder, M. B.; Mocking, R. J. T.; Derks, E. M.; Schene, A. H.; Nicolaou, M.

    2017-01-01

    BACKGROUND/OBJECTIVES: To investigate the association of dietary patterns derived by reduced rank regression (RRR) with depressive symptoms in a multi-ethnic population. SUBJECTS/METHODS: Cross-sectional data from the HELIUS study were used. In total, 4967 men and women (18-70 years) of Dutch,

  8. Dietary pattern derived by reduced rank regression and depressive symptoms in a multi-ethnic population: the HELIUS study

    NARCIS (Netherlands)

    Vermeulen, E.; Stronks, K.; Visser, M.; Brouwer, I. A.; Snijder, M. B.; Mocking, R. J.T.; Derks, E. M.; Schene, A. H.; Nicolaou, M.

    BACKGROUND/OBJECTIVES: To investigate the association of dietary patterns derived by reduced rank regression (RRR) with depressive symptoms in a multi-ethnic population. SUBJECTS/METHODS: Cross-sectional data from the HELIUS study were used. In total, 4967 men and women (18-70 years) of Dutch,

  9. Recent gestational diabetes was associated with mothers stopping predominant breastfeeding earlier in a multi-ethnic population.

    Science.gov (United States)

    Baerug, Anne; Sletner, Line; Laake, Petter; Fretheim, Atle; Løland, Beate Fossum; Waage, Christin W; Birkeland, Kåre I; Jenum, Anne Karen

    2018-06-01

    It has previously been shown that breastfeeding may reduce the risk of type 2 diabetes in mothers with recent gestational diabetes mellitus (GDM). This study compared the cessation of predominant breastfeeding in mothers with and without recent GDM in a multi-ethnic population. From May 2008 to May 2010, healthy pregnant women attending antenatal care provided by community health services in Eastern Oslo, Norway were recruited. We included 616 women-58% non-Western-and interviewed and examined them at a mean of 15 and 28 weeks of gestation and 14 weeks' postpartum. Cox regression models examined the association between GDM, as assessed by the 2013 World Health Organization criteria, and breastfeeding cessation. Overall, 190 of the 616 (31%) mothers had GDM and they ended predominant breastfeeding earlier than mothers without GDM, with an adjusted hazard ratio (aHR) of 1.33 and 95% confidence interval (95% CI) of 1.01-1.77. Mothers of South Asian origin ended predominant breastfeeding earlier than Western European mothers in the adjusted analysis (aHR 1.53, 95% CI: 1.04-2.25), but Middle Eastern mothers did not. Recent gestational diabetes was associated with earlier cessation of predominant breastfeeding in Western European and non-Western women. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  10. Teaching handwashing with soap for schoolchildren in a multi-ethnic population in northern rural Vietnam.

    Science.gov (United States)

    Xuan, Le Thi Thanh; Rheinländer, Thilde; Hoat, Luu Ngoc; Dalsgaard, Anders; Konradsen, Flemming

    2013-04-24

    In Vietnam, initiatives have been started aimed at increasing the practice of handwashing with soap (HWWS) among primary schoolchildren. However, compliance remains low. This study aims to investigate responses to a teacher-centred participatory HWWS intervention in a multi-ethnic population of primary schoolchildren in northern rural Vietnam. This study was implemented in two phases: a formative research project over 5 months (July-November 2008) and an action research project with a school-based HWWS intervention study in two rural communes during 5 months (May, September-December 2010). Based upon knowledge from the formative research in 2008, schoolteachers from four selected schools in the study communes actively participated in designing and implementing a HWWS intervention. Qualitative data was collected during the intervention to evaluate the responses and reaction to the intervention of teachers, children and parents. This included semi-structured interviews with children (15), and their parents (15), focus group discussions (FGDs) with schoolchildren (32) and school staff (20) and observations during 15 HWWS involving children. Observations and interview data from children demonstrated that children were visibly excited and pleased with HWWS sessions where teachers applied active teaching methods including rewards, games and HWWS demonstrations. All children, schoolteachers and parents also viewed the HWWS intervention as positive and feasible, irrespective of ethnicity, gender of schoolchildren and background of schoolteachers. However, some important barriers were indicated for sustaining and transferring the HWWS practice to the home setting including limited emphasis on hygiene in the standard curriculum of schools, low priority and lack of time given to practical teaching methods and lack of guidance and reminding HWWS on a regular basis at home, in particular by highland parents, who spend most of their time working away from home in the fields

  11. Teaching handwashing with soap for schoolchildren in a multi-ethnic population in northern rural Vietnam

    Directory of Open Access Journals (Sweden)

    Le Thi Thanh Xuan

    2013-04-01

    Full Text Available Background: In Vietnam, initiatives have been started aimed at increasing the practice of handwashing with soap (HWWS among primary schoolchildren. However, compliance remains low. Objective: This study aims to investigate responses to a teacher-centred participatory HWWS intervention in a multi-ethnic population of primary schoolchildren in northern rural Vietnam. Design: This study was implemented in two phases: a formative research project over 5 months (July–November 2008 and an action research project with a school-based HWWS intervention study in two rural communes during 5 months (May, September–December 2010. Based upon knowledge from the formative research in 2008, schoolteachers from four selected schools in the study communes actively participated in designing and implementing a HWWS intervention. Qualitative data was collected during the intervention to evaluate the responses and reaction to the intervention of teachers, children and parents. This included semi-structured interviews with children (15, and their parents (15, focus group discussions (FGDs with schoolchildren (32 and school staff (20 and observations during 15 HWWS involving children. Results: Observations and interview data from children demonstrated that children were visibly excited and pleased with HWWS sessions where teachers applied active teaching methods including rewards, games and HWWS demonstrations. All children, schoolteachers and parents also viewed the HWWS intervention as positive and feasible, irrespective of ethnicity, gender of schoolchildren and background of schoolteachers. However, some important barriers were indicated for sustaining and transferring the HWWS practice to the home setting including limited emphasis on hygiene in the standard curriculum of schools, low priority and lack of time given to practical teaching methods and lack of guidance and reminding HWWS on a regular basis at home, in particular by highland parents, who spend most

  12. Level of colorectal cancer awareness: a cross sectional exploratory study among multi-ethnic rural population in Malaysia

    OpenAIRE

    Su, Tin Tin; Goh, Jun Yan; Tan, Jackson; Muhaimah, Abdul Rahim; Pigeneswaren, Yoganathan; Khairun, Nasirin Sallamun; Normazidah, Abdul Wahab; Tharisini, Devi Kunasekaran; Majid, Hazreen Abd

    2013-01-01

    Background This paper presents the level of colorectal cancer awareness among multi-ethnic rural population in Malaysia. Methods A rural-based cross sectional survey was carried out in Perak state in Peninsular Malaysia in March 2011. The survey recruited a population-representative sample using multistage sampling. Altogether 2379 participants were included in this study. Validated bowel/colorectal cancer awareness measure questionnaire was used to assess the level of colorectal cancer aware...

  13. Prevalence and causes of visual impairment in Asian and non-Hispanic white preschool children: Multi-ethnic Pediatric Eye Disease Study.

    Science.gov (United States)

    Tarczy-Hornoch, Kristina; Cotter, Susan A; Borchert, Mark; McKean-Cowdin, Roberta; Lin, Jesse; Wen, Ge; Kim, Jeniffer; Varma, Rohit

    2013-06-01

    To determine the prevalence and causes of decreased visual acuity (VA). Population-based cross-sectional study. Multi-ethnic sample of children 30 to 72 months of age identified in Los Angeles. All eligible children underwent a comprehensive ophthalmic evaluation including monocular VA testing, cover testing, cycloplegic autorefraction, fundus evaluation, and VA retesting with refractive correction. Decreased VA was defined as presenting or best-measured VA worse than 20/50 in children 30 to 47 months of age and worse than 20/40 for children 48 months of age and older. The prevalence and causes of decreased VA were determined, for both presenting and best-measured VA, in the better-seeing and the worse-seeing eyes. Prevalence and causes of decreased vision. Presenting VA was assessed in 1840 children and best-measured VA was assessed in 1886 children. Presenting VA was decreased in the worse eye of 4.2% of Asian children and of 3.6% of non-Hispanic white (NHW) children. Close to one-fourth of these cases had no identifiable cause, and 81% of these resolved on retesting. Decreased presenting VA in the worse eye with an identifiable ophthalmic cause was present in 3.4% of Asian children and in 2.6% of NHW children. Decreased presenting VA attributable to simple refractive error (myopia ≥ 0.5 diopters [D]; hyperopia ≥ 3.0 D; astigmatism ≥ 2.0 D or ≥ 1.5 D for children older than 36 months) was present in the worse eye of 2.3% of Asian children and of 1.4% of NHW children and in the better eye of 0.5% of Asian children and of 0.3% of NHW children. Decreased best-measured VA attributable to a cause was present in the worse eye of 1.2% of both Asian children and NHW children and in the better eye of 0.2% of Asian and of 0.3% of NHW children. Amblyopia related to refractive error was the most common cause, and was 10 times as common as ocular disease. Severe visual impairment was rare. Seventy percent of all decreased VA in Asian and NHW preschool children and

  14. The Relation Between Inflation in Type-I and Type-II Error Rate and Population Divergence in Genome-Wide Association Analysis of Multi-Ethnic Populations

    NARCIS (Netherlands)

    Derks, E. M.; Zwinderman, A. H.; Gamazon, E. R.

    2017-01-01

    Population divergence impacts the degree of population stratification in Genome Wide Association Studies. We aim to: (i) investigate type-I error rate as a function of population divergence (FST) in multi-ethnic (admixed) populations; (ii) evaluate the statistical power and effect size estimates;

  15. Correction of population stratification in large multi-ethnic association studies.

    Directory of Open Access Journals (Sweden)

    David Serre

    2008-01-01

    Full Text Available The vast majority of genetic risk factors for complex diseases have, taken individually, a small effect on the end phenotype. Population-based association studies therefore need very large sample sizes to detect significant differences between affected and non-affected individuals. Including thousands of affected individuals in a study requires recruitment in numerous centers, possibly from different geographic regions. Unfortunately such a recruitment strategy is likely to complicate the study design and to generate concerns regarding population stratification.We analyzed 9,751 individuals representing three main ethnic groups - Europeans, Arabs and South Asians - that had been enrolled from 154 centers involving 52 countries for a global case/control study of acute myocardial infarction. All individuals were genotyped at 103 candidate genes using 1,536 SNPs selected with a tagging strategy that captures most of the genetic diversity in different populations. We show that relying solely on self-reported ethnicity is not sufficient to exclude population stratification and we present additional methods to identify and correct for stratification.Our results highlight the importance of carefully addressing population stratification and of carefully "cleaning" the sample prior to analyses to obtain stronger signals of association and to avoid spurious results.

  16. Glaucoma in Asian Populations

    Science.gov (United States)

    ... Involved News About Us Donate In This Section Glaucoma In Asian Populations email Send this article to ... lower than in their Asian counterparts. Normal Tension Glaucoma affects Japanese Japanese populations, however, have a substantially ...

  17. Level of colorectal cancer awareness: a cross sectional exploratory study among multi-ethnic rural population in Malaysia.

    Science.gov (United States)

    Su, Tin Tin; Goh, Jun Yan; Tan, Jackson; Muhaimah, Abdul Rahim; Pigeneswaren, Yoganathan; Khairun, Nasirin Sallamun; Normazidah, Abdul Wahab; Tharisini, Devi Kunasekaran; Majid, Hazreen Abd

    2013-08-07

    This paper presents the level of colorectal cancer awareness among multi-ethnic rural population in Malaysia. A rural-based cross sectional survey was carried out in Perak state in Peninsular Malaysia in March 2011. The survey recruited a population-representative sample using multistage sampling. Altogether 2379 participants were included in this study. Validated bowel/colorectal cancer awareness measure questionnaire was used to assess the level of colorectal cancer awareness among study population. Analysis of variance (ANOVA) was done to identify socio-demographic variance of knowledge score on warning signs and risk factors of colorectal cancer. Among respondents, 38% and 32% had zero knowledge score for warning signs and risk factors respectively. Mean knowledge score for warning signs and risk factors were 2.89 (SD 2.96) and 3.49 (SD 3.17) respectively. There was a significant positive correlation between the knowledge score of warning signs and level of confidence in detecting a warning sign. Socio-demographic characteristics and having cancer in family and friends play important role in level of awareness. Level of awareness on colorectal cancer warning signs and risk factors in the rural population of Malaysia is very low. Therefore, it warrants an extensive health education campaign on colorectal cancer awareness as it is one of the commonest cancer in Malaysia. Health education campaign is urgently needed because respondents would seek medical attention sooner if they are aware of this problem.

  18. Level of colorectal cancer awareness: a cross sectional exploratory study among multi-ethnic rural population in Malaysia

    International Nuclear Information System (INIS)

    Su, Tin Tin; Goh, Jun Yan; Tan, Jackson; Muhaimah, Abdul Rahim; Pigeneswaren, Yoganathan; Khairun, Nasirin Sallamun; Normazidah, Abdul Wahab; Tharisini, Devi Kunasekaran; Majid, Hazreen Abd

    2013-01-01

    This paper presents the level of colorectal cancer awareness among multi-ethnic rural population in Malaysia. A rural-based cross sectional survey was carried out in Perak state in Peninsular Malaysia in March 2011. The survey recruited a population-representative sample using multistage sampling. Altogether 2379 participants were included in this study. Validated bowel/colorectal cancer awareness measure questionnaire was used to assess the level of colorectal cancer awareness among study population. Analysis of variance (ANOVA) was done to identify socio-demographic variance of knowledge score on warning signs and risk factors of colorectal cancer. Among respondents, 38% and 32% had zero knowledge score for warning signs and risk factors respectively. Mean knowledge score for warning signs and risk factors were 2.89 (SD 2.96) and 3.49 (SD 3.17) respectively. There was a significant positive correlation between the knowledge score of warning signs and level of confidence in detecting a warning sign. Socio-demographic characteristics and having cancer in family and friends play important role in level of awareness. Level of awareness on colorectal cancer warning signs and risk factors in the rural population of Malaysia is very low. Therefore, it warrants an extensive health education campaign on colorectal cancer awareness as it is one of the commonest cancer in Malaysia. Health education campaign is urgently needed because respondents would seek medical attention sooner if they are aware of this problem

  19. Multidimensional health locus of control and depressive symptoms in the multi-ethnic population of the Netherlands.

    Science.gov (United States)

    van Dijk, Tobias K; Dijkshoorn, Henriëtte; van Dijk, Ad; Cremer, Stephan; Agyemang, Charles

    2013-12-01

    Ethnic inequalities in health in Western societies are well-documented but poorly understood. We examined associations between health locus of control (HLC) and depressive symptoms among native and non-native Dutch people in the Netherlands. We used hierarchical multiple linear regression analyses on a representative sample of the multi-ethnic population of Amsterdam and The Hague (n = 10,302). HLC was measured with the multidimensional health locus of control scale. Depressive symptoms were measured with the Kessler Psychological Distress scale. Multivariate analyses showed that HLC contributes to ethnic differences in the prevalence of depressive symptoms. Respondents who scored high on external locus of control (PHLC) were more likely to have depressive symptoms than those with a low score on PHLC (β = 0.133, p locus of control (IHLC) were less likely to have depressive symptoms compared to those scoring low on IHLC (β = -0.134, p < 0.001). The associations were most pronounced among Turkish-Dutch and Moroccan-Dutch respondents. Our findings suggest that HLC contributes to ethnic inequalities in depressive symptoms, especially among Turkish and Moroccan ethnic groups. Professionals (e.g. clinicians and policy makers) need to take HLC into account when assessing and treating depression among ethnic minority groups, particularly in Turkish and Moroccan populations. Future research should look further into the associations within these groups.

  20. Ethnic differences in the prevalence of metabolic syndrome: results from a multi-ethnic population-based survey in Malaysia.

    Science.gov (United States)

    Rampal, Sanjay; Mahadeva, Sanjiv; Guallar, Eliseo; Bulgiba, Awang; Mohamed, Rosmawati; Rahmat, Ramlee; Arif, Mohamad Taha; Rampal, Lekhraj

    2012-01-01

    The prevalence of metabolic syndrome is increasing disproportionately among the different ethnicities in Asia compared to the rest of the world. This study aims to determine the differences in the prevalence of metabolic syndrome across ethnicities in Malaysia, a multi-ethnic country. In 2004, we conducted a national cross-sectional population-based study using a stratified two-stage cluster sampling design (N = 17,211). Metabolic syndrome was defined according to the International Diabetes Federation/National Heart, Lung and Blood Institute/American Heart Association (IDF/NHLBI/AHA-2009) criteria. Multivariate models were used to study the independent association between ethnicity and the prevalence of the metabolic syndrome. The overall mean age was 36.9 years, and 50.0% participants were female. The ethnic distribution was 57.0% Malay, 28.5% Chinese, 8.9% Indian and 5.0% Indigenous Sarawakians. The overall prevalence of the metabolic syndrome was 27.5%, with a prevalence of central obesity, raised triglycerides, low high density lipoprotein cholesterol, raised blood pressure and raised fasting glucose of 36.9%, 29.3%, 37.2%, 38.0% and 29.1%, respectively. Among those Malaysia was high, with marked differences across ethnicities. Ethnic Chinese had the lowest prevalence of metabolic syndrome, while ethnic Indians had the highest. Indigenous Sarawakians showed a marked increase in metabolic syndrome at young ages.

  1. Multiple independent genetic factors at NOS1AP modulate the QT interval in a multi-ethnic population.

    Directory of Open Access Journals (Sweden)

    Dan E Arking

    Full Text Available Extremes of electrocardiographic QT interval are associated with increased risk for sudden cardiac death (SCD; thus, identification and characterization of genetic variants that modulate QT interval may elucidate the underlying etiology of SCD. Previous studies have revealed an association between a common genetic variant in NOS1AP and QT interval in populations of European ancestry, but this finding has not been extended to other ethnic populations. We sought to characterize the effects of NOS1AP genetic variants on QT interval in the multi-ethnic population-based Dallas Heart Study (DHS, n = 3,072. The SNP most strongly associated with QT interval in previous samples of European ancestry, rs16847548, was the most strongly associated in White (P = 0.005 and Black (P = 3.6 x 10(-5 participants, with the same direction of effect in Hispanics (P = 0.17, and further showed a significant SNP x sex-interaction (P = 0.03. A second SNP, rs16856785, uncorrelated with rs16847548, was also associated with QT interval in Blacks (P = 0.01, with qualitatively similar results in Whites and Hispanics. In a previously genotyped cohort of 14,107 White individuals drawn from the combined Atherosclerotic Risk in Communities (ARIC and Cardiovascular Health Study (CHS cohorts, we validated both the second locus at rs16856785 (P = 7.63 x 10(-8, as well as the sex-interaction with rs16847548 (P = 8.68 x 10(-6. These data extend the association of genetic variants in NOS1AP with QT interval to a Black population, with similar trends, though not statistically significant at P<0.05, in Hispanics. In addition, we identify a strong sex-interaction and the presence of a second independent site within NOS1AP associated with the QT interval. These results highlight the consistent and complex role of NOS1AP genetic variants in modulating QT interval.

  2. Teaching handwashing with soap for schoolchildren in a multi-ethnic population in northern rural Vietnam

    DEFF Research Database (Denmark)

    Le Thi Thanh, Xuan; Rheinländer, Thilde; Luu Ngoc, Hoat

    2013-01-01

    -ethnic population of primary schoolchildren in northern rural Vietnam. Design: This study was implemented in two phases: a formative research project over 5 months (July-November 2008) and an action research project with a school-based HWWS intervention study in two rural communes during 5 months (May, September......-December 2010). Based upon knowledge from the formative research in 2008, schoolteachers from four selected schools in the study communes actively participated in designing and implementing a HWWS intervention. Qualitative data was collected during the intervention to evaluate the responses and reaction...

  3. Prevalence, types and awareness of glaucoma in a multi-ethnic population in rural China: the Yunnan Minority Eye Study.

    Science.gov (United States)

    Pan, Chen-Wei; Zhao, Chun-Hua; Yu, Min-Bin; Cun, Qing; Chen, Qin; Shen, Wei; Li, Jun; Xu, Jian-Gang; Yuan, Yuansheng; Zhong, Hua

    2016-11-01

    To determine the prevalence, types and awareness of glaucoma in a rural community in China and to examine possible ethnic variations. The Yunnan Minority Eye Study was a multi-ethnic community-based eye survey using random cluster sampling strategies. 2133 Bai, 2205 Han and 2208 Yi Chinese aged 50 years or older participated in this study. Glaucoma including primary open-angle glaucoma (POAG), primary angle-closure glaucoma (PACG) and secondary glaucoma was defined based on the International Society of Geographical and Epidemiological Ophthalmology criteria. The overall age-standardized prevalence of all glaucoma was 2.6% (95% confidence interval [CI]: 2.2-3.1%) in this population. It was 1.8% (95% CI: 1.1-1.9%) for POAG and 0.5% (95% CI: 0.9-1.6%) for PACG, respectively. Among 29 people with secondary glaucoma, 27 (93%) were blind in at least one eye. The presence of primary open-angle glaucoma was associated with male gender (odds ratio [OR] = 2.94; comparing men with women), Yi ethnicity (OR = 2.27; comparing Yi with Han people), higher IOP (OR = 1.09 per mmHg increase), and the presence of myopia (OR = 1.84). Of the 212 participants with glaucoma, only 38 (18%) were aware of the disease and had been diagnosed previously as having glaucoma or suspected glaucoma. Patients who were better educated tended to be aware of the disease. Significant ethnic difference in the prevalence of POAG was observed in this study. The low awareness of glaucoma highlights the pressing need to increase public awareness of this potentially blinding condition in rural China. © 2016 The Authors Ophthalmic & Physiological Optics © 2016 The College of Optometrists.

  4. Dietary Pattern Trajectories from 6 to 12 Months of Age in a Multi-Ethnic Asian Cohort.

    Science.gov (United States)

    Lim, Geraldine Huini; Toh, Jia Ying; Aris, Izzuddin M; Chia, Ai-Ru; Han, Wee Meng; Saw, Seang Mei; Godfrey, Keith M; Gluckman, Peter D; Chong, Yap-Seng; Yap, Fabian; Lee, Yung Seng; Kramer, Michael S; Chong, Mary Foong-Fong

    2016-06-15

    Little is known about the dietary patterns of Asian infants in the first year of life, nor of their associations with maternal socio-demographic factors. Based on the Growing Up in Singapore towards healthy Outcomes (GUSTO) mother-offspring cohort, cross-sectional dietary patterns were derived by factor analysis using 24-h recalls and food diaries of infants at 6-, 9- and 12-months of age. Dietary pattern trajectories were modeled by mapping similar dietary patterns across each age using multilevel mixed models. Associations with maternal socio-demographic variables, collected through questionnaires during pregnancy, were assessed using general linear models. In n = 486 infants, four dietary pattern trajectories were established from 6- to 12-months. Predominantly breastmilk: mainly breastmilk and less formula milk, rice porridge, vegetables, fruits and low-fat fish and meat, Easy-to-prepare foods: infant cereals, juices, cakes and biscuits and Noodles (in soup) and seafood: noodle and common accompaniments. In adjusted models, higher maternal education attainment was correlated with higher start scores on Predominantly breastmilk, but lowest education attainment increased its adherence over time. Older mothers had higher start scores on Easy-to-prepare foods, but younger mothers had increased adherence over time. Chinese mothers had higher start scores on Predominantly breastmilk but greater adherence to GUIDELINES over time, while Indian mothers had higher start scores on Easy-to-prepare foods but greater adherence to Predominantly breastmilk with time (p dietary patterns established during weaning are strongly influenced by maternal socio-demographic factors and remain stable over the first year of life.

  5. Family and home correlates of children's physical activity in a multi-ethnic population: the cross-sectional Child Heart and Health Study in England (CHASE).

    Science.gov (United States)

    McMinn, Alison M; van Sluijs, Esther M F; Nightingale, Claire M; Griffin, Simon J; Cook, Derek G; Owen, Chris G; Rudnicka, Alicja R; Whincup, Peter H

    2011-02-15

    The influence of the family and home environment on childhood physical activity (PA) and whether this differs between ethnic groups remains uncertain. This paper investigates associations between family and home factors and childhood PA in a multi-ethnic population and explores whether associations differ between ethnic groups. Cross-sectional study of 9-10 year-old schoolchildren, in which PA was objectively measured by Actigraph GT1 M accelerometers for ≤7 days to estimate average activity counts per minute (CPM). Information on 11 family and home environmental factors were collected from questionnaires. Associations between these factors and CPM were quantified using multi-level linear regression. Interactions with ethnicity were explored using likelihood ratio tests. 2071 children (mean ± SD age: 9.95 ± 0.38 years; 47.8% male) participated, including 25% white European, 28% black African-Caribbean, 24% South Asian, and 24% other ethnic origin. Family PA support and having a pet were associated with higher average CPM (adjusted mean difference: 6 (95%CI:1,10) and 13 (95%CI:3,23), respectively) while car ownership and having internet access at home were associated with lower average CPM (adjusted mean difference: -19 (95%CI:-30,-8) and -10 (95%CI:-19,0), respectively). These associations did not differ by ethnicity. Although the number of siblings showed no overall association with PA, there was some evidence of interaction with ethnicity (p for ethnicity interaction=0.04, 0.05 in a fully-adjusted model); a positive significant association with number of siblings was observed in white Europeans (per sibling CPM difference 10.3 (95% CI 1.7, 18.9)) and a positive non-significant association was observed in black African-Caribbeans (per sibling CPM difference: 3.5 (-4.2, 11.2)) while a negative, non-significant association was observed in South Asians (per sibling CPM difference -6.0 (-15.5, 3.4)). Some family and home environmental factors have modest

  6. 30-Year Trends in Stroke Rates and Outcome in Auckland, New Zealand (1981-2012: A Multi-Ethnic Population-Based Series of Studies.

    Directory of Open Access Journals (Sweden)

    Valery L Feigin

    Full Text Available Insufficient data exist on population-based trends in morbidity and mortality to determine the success of prevention strategies and improvements in health care delivery in stroke. The aim of this study was to determine trends in incidence and outcome (1-year mortality, 28-day case-fatality in relation to management and risk factors for stroke in the multi-ethnic population of Auckland, New Zealand (NZ over 30-years.Four stroke incidence population-based register studies were undertaken in adult residents (aged ≥15 years of Auckland NZ in 1981-1982, 1991-1992, 2002-2003 and 2011-2012. All used standard World Health Organization (WHO diagnostic criteria and multiple overlapping sources of case-ascertainment for hospitalised and non-hospitalised, fatal and non-fatal, new stroke events. Ethnicity was consistently self-identified into four major groups. Crude and age-adjusted (WHO world population standard annual incidence and mortality with corresponding 95% confidence intervals (CI were calculated per 100,000 people, assuming a Poisson distribution.5400 new stroke patients were registered in four 12 month recruitment phases over the 30-year study period; 79% were NZ/European, 6% Māori, 8% Pacific people, and 7% were of Asian or other origin. Overall stroke incidence and 1-year mortality decreased by 23% (95% CI 5%-31% and 62% (95% CI 36%-86%, respectively, from 1981 to 2012. Whilst stroke incidence and mortality declined across all groups in NZ from 1991, Māori and Pacific groups had the slowest rate of decline and continue to experience stroke at a significantly younger age (mean ages 60 and 62 years, respectively compared with NZ/Europeans (mean age 75 years. There was also a decline in 28-day stroke case fatality (overall by 14%, 95% CI 11%-17% across all ethnic groups from 1981 to 2012. However, there were significant increases in the frequencies of pre-morbid hypertension, myocardial infarction, and diabetes mellitus, but a reduction in

  7. 30-Year Trends in Stroke Rates and Outcome in Auckland, New Zealand (1981-2012): A Multi-Ethnic Population-Based Series of Studies.

    Science.gov (United States)

    Feigin, Valery L; Krishnamurthi, Rita V; Barker-Collo, Suzanne; McPherson, Kathryn M; Barber, P Alan; Parag, Varsha; Arroll, Bruce; Bennett, Derrick A; Tobias, Martin; Jones, Amy; Witt, Emma; Brown, Paul; Abbott, Max; Bhattacharjee, Rohit; Rush, Elaine; Suh, Flora Minsun; Theadom, Alice; Rathnasabapathy, Yogini; Te Ao, Braden; Parmar, Priya G; Anderson, Craig; Bonita, Ruth

    2015-01-01

    Insufficient data exist on population-based trends in morbidity and mortality to determine the success of prevention strategies and improvements in health care delivery in stroke. The aim of this study was to determine trends in incidence and outcome (1-year mortality, 28-day case-fatality) in relation to management and risk factors for stroke in the multi-ethnic population of Auckland, New Zealand (NZ) over 30-years. Four stroke incidence population-based register studies were undertaken in adult residents (aged ≥15 years) of Auckland NZ in 1981-1982, 1991-1992, 2002-2003 and 2011-2012. All used standard World Health Organization (WHO) diagnostic criteria and multiple overlapping sources of case-ascertainment for hospitalised and non-hospitalised, fatal and non-fatal, new stroke events. Ethnicity was consistently self-identified into four major groups. Crude and age-adjusted (WHO world population standard) annual incidence and mortality with corresponding 95% confidence intervals (CI) were calculated per 100,000 people, assuming a Poisson distribution. 5400 new stroke patients were registered in four 12 month recruitment phases over the 30-year study period; 79% were NZ/European, 6% Māori, 8% Pacific people, and 7% were of Asian or other origin. Overall stroke incidence and 1-year mortality decreased by 23% (95% CI 5%-31%) and 62% (95% CI 36%-86%), respectively, from 1981 to 2012. Whilst stroke incidence and mortality declined across all groups in NZ from 1991, Māori and Pacific groups had the slowest rate of decline and continue to experience stroke at a significantly younger age (mean ages 60 and 62 years, respectively) compared with NZ/Europeans (mean age 75 years). There was also a decline in 28-day stroke case fatality (overall by 14%, 95% CI 11%-17%) across all ethnic groups from 1981 to 2012. However, there were significant increases in the frequencies of pre-morbid hypertension, myocardial infarction, and diabetes mellitus, but a reduction in frequency

  8. 30-Year Trends in Stroke Rates and Outcome in Auckland, New Zealand (1981-2012): A Multi-Ethnic Population-Based Series of Studies

    Science.gov (United States)

    Feigin, Valery L.; Krishnamurthi, Rita V.; Barker-Collo, Suzanne; McPherson, Kathryn M.; Barber, P. Alan; Parag, Varsha; Arroll, Bruce; Bennett, Derrick A.; Tobias, Martin; Jones, Amy; Witt, Emma; Brown, Paul; Abbott, Max; Bhattacharjee, Rohit; Rush, Elaine; Suh, Flora Minsun; Theadom, Alice; Rathnasabapathy, Yogini; Te Ao, Braden; Parmar, Priya G.; Anderson, Craig; Bonita, Ruth

    2015-01-01

    Background Insufficient data exist on population-based trends in morbidity and mortality to determine the success of prevention strategies and improvements in health care delivery in stroke. The aim of this study was to determine trends in incidence and outcome (1-year mortality, 28-day case-fatality) in relation to management and risk factors for stroke in the multi-ethnic population of Auckland, New Zealand (NZ) over 30-years. Methods Four stroke incidence population-based register studies were undertaken in adult residents (aged ≥15 years) of Auckland NZ in 1981–1982, 1991–1992, 2002–2003 and 2011–2012. All used standard World Health Organization (WHO) diagnostic criteria and multiple overlapping sources of case-ascertainment for hospitalised and non-hospitalised, fatal and non-fatal, new stroke events. Ethnicity was consistently self-identified into four major groups. Crude and age-adjusted (WHO world population standard) annual incidence and mortality with corresponding 95% confidence intervals (CI) were calculated per 100,000 people, assuming a Poisson distribution. Results 5400 new stroke patients were registered in four 12 month recruitment phases over the 30-year study period; 79% were NZ/European, 6% Māori, 8% Pacific people, and 7% were of Asian or other origin. Overall stroke incidence and 1-year mortality decreased by 23% (95% CI 5%-31%) and 62% (95% CI 36%-86%), respectively, from 1981 to 2012. Whilst stroke incidence and mortality declined across all groups in NZ from 1991, Māori and Pacific groups had the slowest rate of decline and continue to experience stroke at a significantly younger age (mean ages 60 and 62 years, respectively) compared with NZ/Europeans (mean age 75 years). There was also a decline in 28-day stroke case fatality (overall by 14%, 95% CI 11%-17%) across all ethnic groups from 1981 to 2012. However, there were significant increases in the frequencies of pre-morbid hypertension, myocardial infarction, and diabetes

  9. Ethnic differences in the prevalence of metabolic syndrome: results from a multi-ethnic population-based survey in Malaysia.

    Directory of Open Access Journals (Sweden)

    Sanjay Rampal

    Full Text Available INTRODUCTION: The prevalence of metabolic syndrome is increasing disproportionately among the different ethnicities in Asia compared to the rest of the world. This study aims to determine the differences in the prevalence of metabolic syndrome across ethnicities in Malaysia, a multi-ethnic country. METHODS: In 2004, we conducted a national cross-sectional population-based study using a stratified two-stage cluster sampling design (N = 17,211. Metabolic syndrome was defined according to the International Diabetes Federation/National Heart, Lung and Blood Institute/American Heart Association (IDF/NHLBI/AHA-2009 criteria. Multivariate models were used to study the independent association between ethnicity and the prevalence of the metabolic syndrome. RESULTS: The overall mean age was 36.9 years, and 50.0% participants were female. The ethnic distribution was 57.0% Malay, 28.5% Chinese, 8.9% Indian and 5.0% Indigenous Sarawakians. The overall prevalence of the metabolic syndrome was 27.5%, with a prevalence of central obesity, raised triglycerides, low high density lipoprotein cholesterol, raised blood pressure and raised fasting glucose of 36.9%, 29.3%, 37.2%, 38.0% and 29.1%, respectively. Among those <40 years, the adjusted prevalence ratios for metabolic syndrome for ethnic Chinese, Indians, and Indigenous Sarawakians compared to ethnic Malay were 0.81 (95% CI 0.67 to 0.96, 1.42 (95% CI 1.19 to 1.69 and 1.37 (95% CI 1.08 to 1.73, respectively. Among those aged ≥40 years, the corresponding prevalence ratios were 0.86 (95% CI 0.79 to 0.92, 1.25 (95% CI 1.15 to 1.36, and 0.94 (95% CI 0.80, 1.11. The P-value for the interaction of ethnicity by age was 0.001. CONCLUSIONS: The overall prevalence of metabolic syndrome in Malaysia was high, with marked differences across ethnicities. Ethnic Chinese had the lowest prevalence of metabolic syndrome, while ethnic Indians had the highest. Indigenous Sarawakians showed a marked increase in metabolic

  10. The Relation Between Inflation in Type-I and Type-II Error Rate and Population Divergence in Genome-Wide Association Analysis of Multi-Ethnic Populations.

    Science.gov (United States)

    Derks, E M; Zwinderman, A H; Gamazon, E R

    2017-05-01

    Population divergence impacts the degree of population stratification in Genome Wide Association Studies. We aim to: (i) investigate type-I error rate as a function of population divergence (F ST ) in multi-ethnic (admixed) populations; (ii) evaluate the statistical power and effect size estimates; and (iii) investigate the impact of population stratification on the results of gene-based analyses. Quantitative phenotypes were simulated. Type-I error rate was investigated for Single Nucleotide Polymorphisms (SNPs) with varying levels of F ST between the ancestral European and African populations. Type-II error rate was investigated for a SNP characterized by a high value of F ST . In all tests, genomic MDS components were included to correct for population stratification. Type-I and type-II error rate was adequately controlled in a population that included two distinct ethnic populations but not in admixed samples. Statistical power was reduced in the admixed samples. Gene-based tests showed no residual inflation in type-I error rate.

  11. Conflicts between healthcare professionals and families of a multi-ethnic patient population during critical care: an ethnographic study.

    Science.gov (United States)

    Van Keer, Rose-Lima; Deschepper, Reginald; Francke, Anneke L; Huyghens, Luc; Bilsen, Johan

    2015-12-22

    Conflicts during communication in multi-ethnic healthcare settings is an increasing point of concern as a result of societies' increased ethno-cultural diversity. We can expect that conflicts are even more likely to arise in situations where difficult medical decisions have to be made, such as critical medical situations in hospital. However, in-depth research on this topic is rather scarce. During critical care patients are often unable to communicate. We have therefore investigated factors contributing to conflicts between healthcare professionals and family members from ethnic minority groups in critical medical situations in hospital. Ethnographic fieldwork was done in one intensive care unit of a multi-ethnic urban hospital in Belgium over 6 months (January 2014 to June 2014). Data were collected through negotiated interactive observation, in-depth interviews with healthcare professionals, from patients' medical records, and by making notes in a logbook. Data were analysed by using grounded theory procedures. Conflicts were essentially related to differences in participants' views on what constitutes 'good care' based on different care approaches. Healthcare professionals' views on good care were based predominantly on a biomedical care model, whereas families' views on good care were mainly inspired by a holistic lifeworld-oriented approach. Giving good care, from the healthcare professionals' point of view, included great attention to regulations, structured communication, and central decision making. On the other hand, good care from the families' point of view included seeking exhaustive information, and participating in end-of-life decision making. Healthcare professionals' biomedical views on offering good care were strengthened by the features of the critical care context whereas families' holistic views on offering good care were reinforced by the specific characteristics of families' ethno-familial care context, including their different ethno

  12. Ethnic differences in neonatal body composition in a multi-ethnic population and the impact of parental factors: a population-based cohort study.

    Directory of Open Access Journals (Sweden)

    Line Sletner

    Full Text Available BACKGROUND: Neonates from low and middle income countries (LAMIC tend to have lower birth weight compared with Western European (WE neonates. Parental height, BMI and maternal parity, age and educational level often differ according to ethnic background, and are associated with offspring birth weight. Less is known about how these factors affect ethnic differences in neonatal body composition. OBJECTIVES: To explore differences in neonatal body composition in a multi-ethnic population, and the impact of key parental factors on these differences. METHODS: A population-based cohort study of pregnant mothers, fathers and their offspring, living in Oslo, Norway. Gender- and gestational-specific z-scores were calculated for several anthropometric measurements, with the neonates of WE ethnic origin as reference. Mean z-scores for neonates with LAMIC origin, and their parents, are presented as outcome variables. RESULTS: 537 singleton, term neonates and their parents were included. All anthropometric measurements were smaller in neonates with LAMIC origin. Abdominal circumference and ponderal index differed the most from WE (mean z-score: -0.57 (95% CI:-0.69 to -0.44 and -0.54 (-0.66 to -0.44, and remained so after adjusting for parental size. Head circumference and skin folds differed less, and length the least (-0.21 (-0.35 to -0.07. These measures became comparable to WEs when adjusted for parental factors. CONCLUSIONS: LAMIC origin neonates were relatively "thin-fat", as indicated by reduced AC and ponderal index and relatively preserved length and skin folds, compared with neonates with WE origin. This phenotype may predispose to type 2 diabetes.

  13. ANXIETY AND DEPRESSION DURING PREGNANCY AND TEMPERAMENT IN EARLY INFANCY: FINDINGS FROM A MULTI-ETHNIC, ASIAN, PROSPECTIVE BIRTH COHORT STUDY.

    Science.gov (United States)

    Chong, Shang-Chee; Broekman, Birit Fp; Qiu, Anqi; Aris, Izzuddin M; Chan, Yiong Huak; Rifkin-Graboi, Anne; Law, Evelyn; Chee, Cornelia Yin Ing; Chong, Yap-Seng; Kwek, Kenneth Y C; Saw, Seang Mei; Gluckman, Peter D; Meaney, Michael J; Chen, Helen

    2016-09-01

    Maternal antenatal mood is associated with negative infant temperament. This link has not been substantiated in Asian populations. We evaluated the association between antenatal maternal mood and infant temperament among Asian mother-infant pairs. Antenatal maternal depression and anxiety were assessed using the Edinburgh Postnatal Depression Scale (J. Cox, J. Holden, & R. Sagovsky, 1987) and the State-Trait Anxiety Inventory (C. Spielberger, R. Gorsuch, R. Lushene, P. Vagg, & G. Jacobs, 1983), respectively, at 26 weeks of pregnancy and 3 months' postnatally. Infant temperament was evaluated with the Early Infant Temperament Questionnaire (B. Medoff-Cooper, W.B. Carey, & S.C. McDevitt, 1993) at 3 months. Factor analysis was performed to extract culturally relevant categories of temperamental traits. Linear regression was performed to examine the influences of antenatal maternal mood on the factor-model-derived infant temperament. Of the 609 mothers, 11% met risk criteria for depression, 17% for state-anxiety, and 19% for trait-anxiety during pregnancy. Factor analysis yielded three infant temperament factors: Emotionality and Attentional Regulation, Sensory Reactivity, and Regularity and Motor Expression, Cronbach's αs = 0.613, 0.712, and 0.752, respectively. Maternal antenatal state-anxiety, p emotionality and poor attentional regulation, especially among Chinese, whereas depression was not, p = .090. There was an association between maternal antenatal anxiety and negative infant temperamental traits in this Asian sample. © 2016 Michigan Association for Infant Mental Health.

  14. Variations in Duchenne muscular dystrophy course in a multi-ethnic UK population: potential influence of socio-economic factors.

    Science.gov (United States)

    Hufton, Margaret; Roper, Helen

    2017-08-01

    To explore variation in clinical course and steroid treatment in Duchenne muscular dystrophy (DMD) by ethnic origin and socio-economic status. In this longitudinal cohort study, clinical outcome was defined as age at loss of ambulation (LOA). Ages are presented as months for accurate calculation. Steroid use was reviewed against national guidelines. Kaplan-Meier survival analysis was used to determine probabilities over time of LOA. Log-rank test was used to evaluate comparisons between ethnic and socio-economic groups. From 2005 to 2014, 71 children were newly diagnosed with DMD. Complete data were available on 69, including 33 of white British heritage and 23 of South Asian heritage. Mean age at diagnosis (without known family history) was 45.7 months; white British ethnicity 42.1 months (range 14-86mo), South Asian ethnicity 50.2 months (range 5-98mo). Twenty-four males lost ambulation. Those of South Asian heritage lost ambulation earlier (mean LOA 105.8mo [8y 10mo]) than those of white British heritage (mean LOA 117.8mo [9y 10mo]): log-rank test score 0.012 (p<0.05). Those most deprived did worse: mean age at LOA 130.0 months (10y 10mo) for the top 20 per cent and 102.5 months (8y 6mo) in the lower 20 per cent: log-rank test score 0.035 (p<0.05). The most socially deprived were diagnosed earlier and started steroids earlier. Of those of South Asian heritage, 18 per cent declined steroids, compared with 9 per cent of white British heritage. Also, 44 per cent of those of South Asian heritage stopped steroids compared with 17 per cent of those of white British heritage. Patients from South Asian and deprived backgrounds had earlier LOA. Genetic disease modifiers are likely to be implicated, but social and cultural factors influence access to treatment. © 2017 Mac Keith Press.

  15. Time-location patterns of a diverse population of older adults: the Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air).

    Science.gov (United States)

    Spalt, Elizabeth W; Curl, Cynthia L; Allen, Ryan W; Cohen, Martin; Adar, Sara D; Stukovsky, Karen H; Avol, Ed; Castro-Diehl, Cecilia; Nunn, Cathy; Mancera-Cuevas, Karen; Kaufman, Joel D

    2016-06-01

    The primary aim of this analysis was to present and describe questionnaire data characterizing time-location patterns of an older, multiethnic population from six American cities. We evaluated the consistency of results from repeated administration of this questionnaire and between this questionnaire and other questionnaires collected from participants of the Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air). Participants reported spending most of their time inside their homes (average: 121 h/week or 72%). More than 50% of the participants reported spending no time in several of the location options, including at home outdoors, at work/volunteer/school locations indoors or outdoors, or in "other" locations outdoors. We observed consistency between self-reported time-location patterns from repeated administration of the time-location questionnaire and compared with other survey instruments. Comparisons with national cohorts demonstrated the differences in time-location patterns in the MESA Air cohort due to differences in demographics, but the data showed similar trends in patterns by age, gender, season, and employment status. This study was the first to explicitly examine the time-location patterns in an older, multiethnic population and the first to add data on Chinese participants. These data can be used to inform future epidemiological research of MESA Air and other studies that include diverse populations.

  16. Total physical activity might not be a good measure in the relationship with HDL cholesterol and triglycerides in a multi-ethnic population: a cross-sectional study

    Science.gov (United States)

    2011-01-01

    Background Evidence suggests that physical activity (PA) has a beneficial effect on high-density lipoprotein cholesterol (HDL) and triglycerides. However, observational studies show contrasting results for this association between different ethnic groups. It is unclear whether this is due to differences in the PA composition. The aim of this study was to assess the relationship of the total PA, along with its intensity and duration, with HDL and triglycerides in a multi-ethnic population. Methods The study population was sampled from the SUNSET study and included: 502 European- Dutch, 338 Hindustani-Surinamese, and 596 African-Surinamese participants living in Amsterdam, the Netherlands. We assessed PA with the SQUASH questionnaire. We calculated age-sex-adjusted betas, geometric mean ratios (GMRs), and prevalence ratios (PRs) to assess the relationship of PA with HDL and triglycerides. Results In the adjusted models, the highest total PA tertile compared to the lowest tertile was beneficially associated with HDL (beta: 0.08, 95% CI: 0.00, 0.16 and PR low HDL 0.59, 95% CI: 0.39, 0.88) and triglycerides (GMR: 0.93, 95% CI: 0.83, 1.03 and PR: 0.56, 95% CI: 0.29, 1.08) for the African-Surinamese. No statistically significant associations appeared for total PA among the European-Dutch and Hindustani-Surinamese. The adjusted models with the intensity score and HDL showed beneficial associations for the European-Dutch (beta: 0.06, 95% CI: 0.03, 0.10) and African-Surinamese (beta: 0.06, 0.02, 0.10), for log triglycerides for the European-Dutch (beta: -0.08, 95% CI: -0.12, 0.03), Hindustani-Surinamese (beta: -0.06, 95% CI: -0.16, 0.03), and African-Surinamese (beta: -0.04, 95% CI: -0.10, 0.01). Excepting HDL in African-Surinamese, the duration score was unrelated to HDL and triglycerides in any group. Conclusions Activity intensity related beneficially to blood lipids in almost every ethnic group. The activity duration was unrelated to blood lipids, while the total PA

  17. Total physical activity might not be a good measure in the relationship with HDL cholesterol and triglycerides in a multi-ethnic population: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    de Munter Jeroen SL

    2011-11-01

    Full Text Available Abstract Background Evidence suggests that physical activity (PA has a beneficial effect on high-density lipoprotein cholesterol (HDL and triglycerides. However, observational studies show contrasting results for this association between different ethnic groups. It is unclear whether this is due to differences in the PA composition. The aim of this study was to assess the relationship of the total PA, along with its intensity and duration, with HDL and triglycerides in a multi-ethnic population. Methods The study population was sampled from the SUNSET study and included: 502 European- Dutch, 338 Hindustani-Surinamese, and 596 African-Surinamese participants living in Amsterdam, the Netherlands. We assessed PA with the SQUASH questionnaire. We calculated age-sex-adjusted betas, geometric mean ratios (GMRs, and prevalence ratios (PRs to assess the relationship of PA with HDL and triglycerides. Results In the adjusted models, the highest total PA tertile compared to the lowest tertile was beneficially associated with HDL (beta: 0.08, 95% CI: 0.00, 0.16 and PR low HDL 0.59, 95% CI: 0.39, 0.88 and triglycerides (GMR: 0.93, 95% CI: 0.83, 1.03 and PR: 0.56, 95% CI: 0.29, 1.08 for the African-Surinamese. No statistically significant associations appeared for total PA among the European-Dutch and Hindustani-Surinamese. The adjusted models with the intensity score and HDL showed beneficial associations for the European-Dutch (beta: 0.06, 95% CI: 0.03, 0.10 and African-Surinamese (beta: 0.06, 0.02, 0.10, for log triglycerides for the European-Dutch (beta: -0.08, 95% CI: -0.12, 0.03, Hindustani-Surinamese (beta: -0.06, 95% CI: -0.16, 0.03, and African-Surinamese (beta: -0.04, 95% CI: -0.10, 0.01. Excepting HDL in African-Surinamese, the duration score was unrelated to HDL and triglycerides in any group. Conclusions Activity intensity related beneficially to blood lipids in almost every ethnic group. The activity duration was unrelated to blood lipids, while

  18. Screening of Peroxisome Proliferator-Activated Receptors (PPARs) α, γ and α Gene Polymorphisms for Obesity and Metabolic Syndrome Association in the Multi-Ethnic Malaysian Population.

    Science.gov (United States)

    Chia, Phee-Phee; Fan, Sook-Ha; Say, Yee-How

    2015-11-05

    This study aimed to investigate the association of peroxisome proliferator-activated receptor (PPAR) genes PPARα L162V, PPARγ2 C161T and PPARδ T294C single nucleotide polymorphisms (SNPs) with obesity and metabolic syndrome (Met-S) in a multi-ethnic population in Kampar, Malaysia. Socio-demographic data, anthropometric and biochemical measurements (plasma lipid profile, adiponectin and interleukin-6 [IL-6] levels) were taken from 307 participants (124 males; 180 obese; 249 Met-S; 97 Malays, 85 ethnic Chinese, 55 ethnic Indians). The overall minor allele frequencies were .08, .22 and .30 for PPAR α L162V, γ C161T, δ T294C, respectively. All SNPs were not associated with obesity, Met-S and obesity with/without Met-S by χ(2) analysis, ethnicity-stratified and logistic regression analyses. Nevertheless, participants with V162 allele of PPARα had significantly higher IL-6, while those with T161 allele of PPARγ2 had significantly lower HOMA-IR. All PPAR SNPs were not associated with obesity and Met-S in the suburban population of Kampar, Malaysia, where only PPARα V162 and PPARγ2 T161 alleles were associated with plasma IL-6 and HOMA-IR, respectively.

  19. CYP1A1 MspI Polymorphism and Cervical Carcinoma Risk in the Multi-Ethnic Population of Malaysia: a Case-Control Study.

    Science.gov (United States)

    Tan, Yee Hock; Sidik, Shiran Mohd; Syed Husain, Sharifah Noor Akmal; Lye, Munn Sann; Chong, Pei Pei

    2016-01-01

    Tobacco smoking is considered a risk factor for cervical cancer development due to the presence of tobacco based carcinogenic metabolites in cervical cells of female smokers. In this study, we investigated the role of the T3801C (MspI) polymorphism of CYP1A1, a gene encoding an enzyme necessary for the initiation of tobacco based carcinogen metabolism, on cervical cancer risk. The T to C substitution may alter CYP1A1 activities, potentially elevating cervical cancer risk. Since results of gene-disease association studies vary according to the study population, the multi-ethnic population of Malaysia provides an excellent representative cohort for identifying and comparing the cervical cancer risk among the 3 major ethnics in Southeast Asia in relation to CYP1A1 MspI polymorphism. A total of 195 Thin Prep Pap smear samples from HPV negative and cancer free females were randomly selected as controls while 106 formalin fixed paraffin embedded samples from females with invasive cervical cancer were randomly selected for the cases group. The polymorphisms were identified using restriction fragment length polymorphism (RFLP) PCR. We found no significant associations between CYP1A1 MspI polymorphism and cervical cancer in the general Malaysian female population. However, upon ethnic stratification, the variant C/C genotype was significantly associated with a 4.66-fold increase in cervical cancer risk in Malay females (95% CI= 1.21-17.9; p=0.03). No significant association was observed in the Chinese and Indian females. Additionally, there were no significant associations in the dominant model and allele frequency model analysis in both the general and ethnically stratified female population of Malaysia. Our findings suggest that the C/C genotype of CYP1A1 MspI polymorphism is associated with the development of cervical carcinoma in the Malay females of Malaysia.

  20. The effect of exercise on prescription on physical activity and wellbeing in a multi-ethnic female population: A controlled trial.

    Science.gov (United States)

    Gademan, Maaike G J; Deutekom, Marije; Hosper, Karen; Stronks, Karien

    2012-09-10

    In Western countries, individuals from multi-ethnic disadvantaged populations are less physically active than the Western population as a whole. This lack of physical activity (PA) may be one of the factors explaining disparities in health. Exercise on Prescription" (EoP), is an exercise program to which persons are referred by primary care. It has been developed to suit the needs of physically inactive women from diverse ethnic backgrounds living in deprived neighborhoods in the Netherlands. The effectiveness of this program has however, not yet been proven. A total of 514 women from diverse ethnic backgrounds were included in this study (192 EoP, 322 control group). Women in the EoP group participated in 18 sessions of supervised PA. The control group received care as usual. At baseline, 6 and 12 months the women attended an interview and a physical examination. Outcome measures were PA, BMI, weight circumference, fat percentage, oxygen uptake, mental well-being, subjective health and use of care. Of the participants 59% had a low educational level and 90% of the women were overweight or obese. Compliance was high, only 14% dropped out during the course of the program. Total PA did not change, PA during leisure time increased at 6 and at 12 months and PA during household activities increased at 12 months (PEoPvsControl < 0.05). EoP had no significant effect on the other outcome variables. EoP was successful in recruiting its target population and compliance was high. The effect of EoP on PA, health and mental well-being was limited. In this format EoP does not seem to be effective for increasing PA and the health status of non-Western migrant women. Dutch Trial register: NTR1294.

  1. Correlates of kidney stone disease differ by race in a multi-ethnic middle-aged population: The ARIC study

    NARCIS (Netherlands)

    S. Akoudad (Saloua); M. Szklo (Moyses); M.A. McAdams (Mara); T. Fulop (Tibor); C.A.M. Anderson (Cheryl); J. Coresh (Josef); A. Köttgen (Anna)

    2010-01-01

    textabstractObjective: To identify correlates of kidney stone disease in white and African American men and women in a population-based longitudinal study starting in four US communities, and to assess differences in correlates across racial groups. Methods: Between 1993 and 1995, 12,161 middle-aged

  2. Depressive symptoms in first-and second-generation migrants: a cross-sectional study of a multi-ethnic working population.

    Science.gov (United States)

    Sieberer, Marcel; Maksimovic, Sasa; Ersöz, Burcu; Machleidt, Wielant; Ziegenbein, Marc; Calliess, Iris T

    2012-11-01

    Migrants in Europe may suffer from depression more often than the native-born population of the particular host country. Reports about the prevalence of depression in migrants are, however, heterogeneous and the possible causes are the subject of controversial discussion. The aims of this study are to determine the incidence of depressiveness in a large multi-ethnic working population with and without a history of migration, and to investigate possible connections with migration status and acculturation criteria. The cross-sectional study asked 7062 employees of a university hospital to complete a self-rating questionnaire concerning socio-demographic data, migration status and indicators of acculturation. Depressiveness was assessed by means of the German version of the Center of Epidemiological Studies Depression Scale (CES-D). The response rate was 41.7% (N = 2932); 14.9% of the participants (n = 419) reported a history of migration, 275 (65.8%) of whom were first-generation (M1) and 143 (34.2%) second-generation (M2) migrants. According to the CES-D scores, 8.7% of non-migrants (n = 207) suffered from clinically relevant depressive symptoms, compared to 16% (n = 44) of the M1 group (OR = 2.10, 95% CI: 1.44-3.04, p rate of depressiveness (χ (2) = 16.68, p < .001). Our results suggest that first- and second-generation female migrants are more likely to suffer from depressiveness than non-migrant females. In this model a history of migration is shown to be an independent risk factor for depressiveness.

  3. Maternal life course socio-economic position and offspring body composition at birth in a multi-ethnic population.

    Science.gov (United States)

    Sletner, Line; Jenum, Anne Karen; Mørkrid, Kjersti; Vangen, Siri; Holme, Ingar M; Birkeland, Kåre I; Nakstad, Britt

    2014-09-01

    Size and body composition at birth may affect long-term health. Mean birthweight and body composition differ between ethnic groups living in Europe. We wanted to explore if this relates to differences in socio-economic conditions in country of origin and over the maternal life course. This is a population-based cohort study of healthy pregnant women living in Oslo, Norway. Data on maternal early life and present socio-economic position (SEP) were collected in early gestation, and SEP scores were extracted through two separate principal components analyses. The associations between maternal present SEP and four different offspring anthropometric measures at birth were assessed separately, stratified by maternal early life SEP (dichotomised score) and Human Development Index (HDI, a country-level socio-economic indicator) in the country of origin [high HDI (Reference), n = 287 and low HDI, n = 250]. A strong positive association between maternal present SEP and offspring birthweight was observed if maternal early life SEP was high, but not if maternal early life SEP was low (P countries had smaller abdominal circumference, possibly indicating less fat-free mass, regardless of maternal life course SEP. Our results suggest that there are transgenerational effects of maternal past socio-economic conditions on offspring size and body composition at birth that modify the associations with present socio-economic factors. © 2014 John Wiley & Sons Ltd.

  4. Complexities of holistic community-based participatory research for a low income, multi-ethnic population exposed to multiple built-environment stressors in Worcester, Massachusetts.

    Science.gov (United States)

    Downs, Timothy J; Ross, Laurie; Patton, Suzanne; Rulnick, Sarah; Sinha, Deb; Mucciarone, Danielle; Calvache, Maria; Parmenter, Sarah; Subedi, Rajendra; Wysokenski, Donna; Anderson, Erin; Dezan, Rebecca; Lowe, Kate; Bowen, Jennifer; Tejani, Amee; Piersanti, Kelly; Taylor, Octavia; Goble, Robert

    2009-11-01

    Low income, multi-ethnic communities in Main South/Piedmont neighborhoods of Worcester, Massachusetts are exposed to cumulative, chronic built-environment stressors, and have limited capacity to respond, magnifying their vulnerability to adverse health outcomes. "Neighborhood STRENGTH", our community-based participatory research (CBPR) project, comprised four partners: a youth center; an environmental non-profit; a community-based health center; and a university. Unlike most CBPR projects that are single topic-focused, our 'holistic', systems-based project targeted five priorities. The three research-focused/action-oriented components were: (1) participatory monitoring of indoor and outdoor pollution; (2) learning about health needs and concerns of residents through community-based listening sessions; (3) engaging in collaborative survey work, including a household vulnerability survey and an asthma prevalence survey for schoolchildren. The two action-focused/research-informed components were: (4) tackling persistent street trash and illegal dumping strategically; and (5) educating and empowering youth to promote environmental justice. We used a coupled CBPR-capacity building approach to design, vulnerability theory to frame, and mixed methods: quantitative environmental testing and qualitative surveys. Process and outcomes yielded important lessons: vulnerability theory helps frame issues holistically; having several topic-based projects yielded useful information, but was hard to manage and articulate to the public; access to, and engagement with, the target population was very difficult and would have benefited greatly from having representative residents who were paid at the partners' table. Engagement with residents and conflict burden varied highly across components. Notwithstanding, we built enabling capacity, strengthened our understanding of vulnerability, and are able to share valuable experiential knowledge.

  5. Associations between gestational diabetes mellitus and elevated HbA1c early postpartum in a multi-ethnic population.

    Science.gov (United States)

    Waage, Christin; Jenum, Anne Karen; Mdala, Ibrahimu; Berg, Jens Petter; Richardsen, Kåre; Birkeland, Kåre

    2017-04-01

    To investigate the prevalence of elevated HbA 1c 14 weeks postpartum in different ethnic groups and in women with and without gestational diabetes mellitus (GDM) in the index pregnancy and to explore demographic and biological factors from early pregnancy associated with elevated HbA 1c (HbA 1c ≥5.7% (≥39mmol/mol)) postpartum. From a cohort study in Oslo, Norway, we included 570 pregnant women, examined in gestational week 15, 28, and 14 weeks postpartum. The association between elevated HbA 1c and demographic and biological factors were assessed by logistic regression analyses. The prevalence of elevated HbA 1c postpartum was 23% in the total population, 15% among Western Europeans and 28% among women with ethnic minority background (p<0.01). In ethnic minorities elevated HbA 1c was found in 39% of women with recent GDM diagnosed by the World Health Organization 2013 criteria and in 21% of women without GDM (p<0.01), compared to 22% and 13% in Western Europeans (p=0.11). We found independent associations between elevated HbA 1c and ethnic minority background (OR 2.0, 95% CI 1.27, 3.18), and GDM (OR 2.04, 95% CI 1.35, 3.10) (p<0.01). The prevalence of elevated HbA 1c postpartum was 23%, and significantly higher among women with ethnic minority background irrespective of GDM. Copyright © 2016 Primary Care Diabetes Europe. Published by Elsevier Ltd. All rights reserved.

  6. Genome-Wide Study of Percent Emphysema on Computed Tomography in the General Population. The Multi-Ethnic Study of Atherosclerosis Lung/SNP Health Association Resource Study

    Science.gov (United States)

    Manichaikul, Ani; Hoffman, Eric A.; Smolonska, Joanna; Gao, Wei; Cho, Michael H.; Baumhauer, Heather; Budoff, Matthew; Austin, John H. M.; Washko, George R.; Carr, J. Jeffrey; Kaufman, Joel D.; Pottinger, Tess; Powell, Charles A.; Wijmenga, Cisca; Zanen, Pieter; Groen, Harry J. M.; Postma, Dirkje S.; Wanner, Adam; Rouhani, Farshid N.; Brantly, Mark L.; Powell, Rhea; Smith, Benjamin M.; Rabinowitz, Dan; Raffel, Leslie J.; Hinckley Stukovsky, Karen D.; Crapo, James D.; Beaty, Terri H.; Hokanson, John E.; Silverman, Edwin K.; Dupuis, Josée; O’Connor, George T.; Boezen, H. Marike; Rich, Stephen S.

    2014-01-01

    Rationale: Pulmonary emphysema overlaps partially with spirometrically defined chronic obstructive pulmonary disease and is heritable, with moderately high familial clustering. Objectives: To complete a genome-wide association study (GWAS) for the percentage of emphysema-like lung on computed tomography in the Multi-Ethnic Study of Atherosclerosis (MESA) Lung/SNP Health Association Resource (SHARe) Study, a large, population-based cohort in the United States. Methods: We determined percent emphysema and upper-lower lobe ratio in emphysema defined by lung regions less than −950 HU on cardiac scans. Genetic analyses were reported combined across four race/ethnic groups: non-Hispanic white (n = 2,587), African American (n = 2,510), Hispanic (n = 2,113), and Chinese (n = 704) and stratified by race and ethnicity. Measurements and Main Results: Among 7,914 participants, we identified regions at genome-wide significance for percent emphysema in or near SNRPF (rs7957346; P = 2.2 × 10−8) and PPT2 (rs10947233; P = 3.2 × 10−8), both of which replicated in an additional 6,023 individuals of European ancestry. Both single-nucleotide polymorphisms were previously implicated as genes influencing lung function, and analyses including lung function revealed independent associations for percent emphysema. Among Hispanics, we identified a genetic locus for upper-lower lobe ratio near the α-mannosidase–related gene MAN2B1 (rs10411619; P = 1.1 × 10−9; minor allele frequency [MAF], 4.4%). Among Chinese, we identified single-nucleotide polymorphisms associated with upper-lower lobe ratio near DHX15 (rs7698250; P = 1.8 × 10−10; MAF, 2.7%) and MGAT5B (rs7221059; P = 2.7 × 10−8; MAF, 2.6%), which acts on α-linked mannose. Among African Americans, a locus near a third α-mannosidase–related gene, MAN1C1 (rs12130495; P = 9.9 × 10−6; MAF, 13.3%) was associated with percent emphysema. Conclusions: Our results suggest that some genes previously identified as

  7. Metal mixtures in urban and rural populations in the US: The Multi-Ethnic Study of Atherosclerosis and the Strong Heart Study

    International Nuclear Information System (INIS)

    Pang, Yuanjie; Peng, Roger D.; Jones, Miranda R.; Francesconi, Kevin A.; Goessler, Walter; Howard, Barbara V.; Umans, Jason G.; Best, Lyle G.; Guallar, Eliseo

    2016-01-01

    Background: Natural and anthropogenic sources of metal exposure differ for urban and rural residents. We searched to identify patterns of metal mixtures which could suggest common environmental sources and/or metabolic pathways of different urinary metals, and compared metal-mixtures in two population-based studies from urban/sub-urban and rural/town areas in the US: the Multi-Ethnic Study of Atherosclerosis (MESA) and the Strong Heart Study (SHS). Methods: We studied a random sample of 308 White, Black, Chinese-American, and Hispanic participants in MESA (2000–2002) and 277 American Indian participants in SHS (1998–2003). We used principal component analysis (PCA), cluster analysis (CA), and linear discriminant analysis (LDA) to evaluate nine urinary metals (antimony [Sb], arsenic [As], cadmium [Cd], lead [Pb], molybdenum [Mo], selenium [Se], tungsten [W], uranium [U] and zinc [Zn]). For arsenic, we used the sum of inorganic and methylated species (∑As). Results: All nine urinary metals were higher in SHS compared to MESA participants. PCA and CA revealed the same patterns in SHS, suggesting 4 distinct principal components (PC) or clusters (∑As-U-W, Pb-Sb, Cd-Zn, Mo-Se). In MESA, CA showed 2 large clusters (∑As-Mo-Sb-U-W, Cd-Pb-Se-Zn), while PCA showed 4 PCs (Sb-U-W, Pb-Se-Zn, Cd-Mo, ∑As). LDA indicated that ∑As, U, W, and Zn were the most discriminant variables distinguishing MESA and SHS participants. Conclusions: In SHS, the ∑As-U-W cluster and PC might reflect groundwater contamination in rural areas, and the Cd-Zn cluster and PC could reflect common sources from meat products or metabolic interactions. Among the metals assayed, ∑As, U, W and Zn differed the most between MESA and SHS, possibly reflecting disproportionate exposure from drinking water and perhaps food in rural Native communities compared to urban communities around the US. - Highlights: • We identified and compared environmental sources of urinary metals in MESA and SHS.

  8. Metal mixtures in urban and rural populations in the US: The Multi-Ethnic Study of Atherosclerosis and the Strong Heart Study

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Yuanjie, E-mail: yuanjie.p@gmail.com [Departments of Epidemiology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205 (United States); Peng, Roger D., E-mail: rdpeng@jhu.edu [Departments of Biostatistics, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205 (United States); Jones, Miranda R., E-mail: mjone132@jhu.edu [Departments of Epidemiology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205 (United States); Francesconi, Kevin A., E-mail: kevin.francesconi@uni-graz.at [Institute of Chemistry -Analytical Chemistry, University of Graz, Graz 8010 (Austria); Goessler, Walter, E-mail: walter.goessler@uni-graz.at [Institute of Chemistry -Analytical Chemistry, University of Graz, Graz 8010 (Austria); Howard, Barbara V., E-mail: Barbara.V.Howard@Medstar.net [MedStar Health Research Institute, Hyattsville, MD 20782 (United States); Georgetown-Howard Universities Center for Clinical and Translational Science, Washington, DC 20057 (United States); Umans, Jason G., E-mail: jason.umans@gmail.com [MedStar Health Research Institute, Hyattsville, MD 20782 (United States); Georgetown-Howard Universities Center for Clinical and Translational Science, Washington, DC 20057 (United States); Best, Lyle G., E-mail: lbest@restel.com [Missouri Breaks Industries Research, Inc., Timber Lake, SD 57656 (United States); Guallar, Eliseo, E-mail: eguallar@jhu.edu [Departments of Epidemiology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205 (United States); Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205 (United States); Department of Medicine, Johns Hopkins School of Medicine, Baltimore, MD 21205 (United States); and others

    2016-05-15

    Background: Natural and anthropogenic sources of metal exposure differ for urban and rural residents. We searched to identify patterns of metal mixtures which could suggest common environmental sources and/or metabolic pathways of different urinary metals, and compared metal-mixtures in two population-based studies from urban/sub-urban and rural/town areas in the US: the Multi-Ethnic Study of Atherosclerosis (MESA) and the Strong Heart Study (SHS). Methods: We studied a random sample of 308 White, Black, Chinese-American, and Hispanic participants in MESA (2000–2002) and 277 American Indian participants in SHS (1998–2003). We used principal component analysis (PCA), cluster analysis (CA), and linear discriminant analysis (LDA) to evaluate nine urinary metals (antimony [Sb], arsenic [As], cadmium [Cd], lead [Pb], molybdenum [Mo], selenium [Se], tungsten [W], uranium [U] and zinc [Zn]). For arsenic, we used the sum of inorganic and methylated species (∑As). Results: All nine urinary metals were higher in SHS compared to MESA participants. PCA and CA revealed the same patterns in SHS, suggesting 4 distinct principal components (PC) or clusters (∑As-U-W, Pb-Sb, Cd-Zn, Mo-Se). In MESA, CA showed 2 large clusters (∑As-Mo-Sb-U-W, Cd-Pb-Se-Zn), while PCA showed 4 PCs (Sb-U-W, Pb-Se-Zn, Cd-Mo, ∑As). LDA indicated that ∑As, U, W, and Zn were the most discriminant variables distinguishing MESA and SHS participants. Conclusions: In SHS, the ∑As-U-W cluster and PC might reflect groundwater contamination in rural areas, and the Cd-Zn cluster and PC could reflect common sources from meat products or metabolic interactions. Among the metals assayed, ∑As, U, W and Zn differed the most between MESA and SHS, possibly reflecting disproportionate exposure from drinking water and perhaps food in rural Native communities compared to urban communities around the US. - Highlights: • We identified and compared environmental sources of urinary metals in MESA and SHS.

  9. Prevalence and Determinants of Suboptimal Vitamin D Levels in a Multiethnic Asian Population.

    Science.gov (United States)

    Man, Ryan Eyn Kidd; Li, Ling-Jun; Cheng, Ching-Yu; Wong, Tien Yin; Lamoureux, Ecosse; Sabanayagam, Charumathi

    2017-03-22

    This population-based cross-sectional study examined the prevalence and risk factors of suboptimal vitamin D levels (assessed using circulating 25-hydroxycholecalciferol (25(OH)D)) in a multi-ethnic sample of Asian adults. Plasma 25(OH)D concentration of 1139 Chinese, Malay and Indians (40-80 years) were stratified into normal (≥30 ng/mL), and suboptimal (including insufficiency and deficiency, 65 years), Malay and Indian ethnicities (compared to Chinese ethnicity), and higher body mass index, HbA1c, education and income levels were associated with suboptimal 25(OH)D concentration ( p < 0.05). In a population-based sample of Asian adults, approximately 75% had suboptimal 25(OH)D concentration. Targeted interventions and stricter reinforcements of existing guidelines for vitamin D supplementation are needed for groups at risk of vitamin D insufficiency/deficiency.

  10. Associations between disease awareness and health-related quality of life in a multi-ethnic Asian population.

    Science.gov (United States)

    Venkataraman, Kavita; Khoo, ChinMeng; Wee, Hwee Lin; Tan, Chuen Seng; Ma, Stefan; Heng, Derrick; Lee, Jeannette; Tai, E Shyong; Thumboo, Julian

    2014-01-01

    Health related quality of life (HRQoL) is an important dimension of individuals' well-being, and especially in chronic diseases like diabetes and hypertension. The objective of this study was to evaluate the contributions of disease process, comorbidities, medication or awareness of the disease to HRQoL in diabetes mellitus, hypertension and dyslipidemia. This was a cross-sectional study of 3514 respondents from the general community in Singapore, assessed for HRQoL, disease and comorbid conditions through self-report, clinical and laboratory investigations. HRQoL was assessed using SF-36 health survey version 2. For each condition, participants were categorized as having 1) no disease, 2) undiagnosed, 3) diagnosed, not taking medication, and 4) diagnosed, taking medication. Analysis used one-way ANOVA and multiple linear regression. Diagnosed disease was associated with lower physical health component summary (PCS) scores across all three conditions. After adjustment for comorbidities, this association remained significant only for those not on medication in diabetes (-2.7±1.2 points, p = 0.03) and dyslipidemia (-1.3±0.4 points, p = 0.003). Diagnosed hypertension (no medication -2.6±0.9 points, p = 0.002; medication -1.4±0.5 points, p = 0.004) and dyslipidemia (no medication -0.9±0.4 points, p = 0.03; medication -1.9±0.5 points, pmental health component summary (MCS) scores. Undiagnosed disease was associated with higher MCS in diabetes (2.4±1.0 points, p = 0.01) and dyslipidemia (0.8±0.4 points, p = 0.045), and PCS in hypertension (1.2±0.4 points, p = 0.004). Disease awareness was associated with lower HRQoL across the diseases studied, with PCS associations partially mediated by comorbidities. Equally importantly, undiagnosed disease was not associated with HRQoL deficits, which may partly explain why these individuals do not seek medical care.

  11. Socioeconomic and sociocultural determinants of psychological distress and quality of life among patients with psoriasis in a selected multi-ethnic Malaysian population.

    Science.gov (United States)

    Kwan, Zhenli; Bong, Yii Bonn; Tan, Leng Leng; Lim, Shu Xian; Yong, Adrian Sze Wai; Ch'ng, Chin Chwen; Tan, Maw Pin; Thevarajah, Suganthi; Ismail, Rokiah

    2017-02-01

    Patients with psoriasis may have increased risk of psychological comorbidities. This cross-sectional study aimed at determining associations between sociocultural and socioeconomic factors with the Depression Anxiety Stress Scale (DASS) scores and the Dermatology Life Quality Index (DLQI) scores. Adult patients with psoriasis were recruited from a Dermatology outpatient clinic via convenience sampling. Interviews were conducted regarding socio-demographic factors and willing subjects were requested to complete the DASS and DLQI questionnaires. The Pearson χ 2 test, Fisher's exact test and multivariate logistic regression were used for statistical analysis to determine independent predictors of depression, anxiety, stress and severe impairment of quality of life. Unadjusted analysis revealed that depression was associated with Indian ethnicity (p = .041) and severe impairment of quality of life was associated with Indian ethnicity (p = .032), higher education (p = .013), higher income (p = .042), and employment status (p = .014). Multivariate analysis revealed that Indian ethnicity was a predictor of depression (p = .024). For stress, tertiary level of education (p = .020) was an independent risk factor while a higher monthly income was a protective factor (p = .042). The ethnic Indians and Malays were significantly more likely than the ethnic Chinese to suffer reduced quality of life (p = .001 and p = .006 respectively) and subjects with tertiary education were more likely to have severe impairment of quality of life (p = .002). Our study was unique in determining sociocultural influences on psychological complications of psoriasis in a South East Asian population. This has provided invaluable insight into factors predictive of adverse effects of psoriasis on psychological distress and quality of life in our patient population. Future studies should devise interventions to specifically target at risk groups in the development of strategies to

  12. Management Options for Women at Risk for Inherited Breast Cancer in a Multi-Ethnic Health Plan Population: A Randomized Control Trial

    National Research Council Canada - National Science Library

    Schaefer, Catherine

    2001-01-01

    ... susceptibility, and sociodemographic factors, such as education and ethnicity; b) to conduct focus groups with Asian, Hispanic, African American, and White women to learn about possible differences in their attitudes concerning genetic testing...

  13. Birth data accessibility via primary care health records to classify health status in a multi-ethnic population of children: an observational study.

    Science.gov (United States)

    Bonner, Rachel; Bountziouka, Vassiliki; Stocks, Janet; Harding, Seeromanie; Wade, Angela; Griffiths, Chris; Sears, David; Fothergill, Helen; Slevin, Hannah; Lum, Sooky

    2015-01-22

    Access to reliable birth data (birthweight (BW) and gestational age (GA)) is essential for the identification of individuals who are at subsequent health risk. This study aimed to explore the feasibility of retrospectively collecting birth data for schoolchildren from parental questionnaires (PQ) and general practitioners (GPs) in primary care clinics, in inner city neighbourhoods with high density of ethnic minority and disadvantaged populations. Attempts were made to obtain birth data from parents and GPs for 2,171 London primary schoolchildren (34% White, 29% Black African origin, 25% South Asians, 12% Other) as part of a larger study of respiratory health. Information on BW and/or GA were obtained from parents for 2,052 (95%) children. Almost all parents (2,045) gave consent to access their children's health records held by GPs. On the basis of parental information, GPs of 1,785 children were successfully contacted, and GPs of 1,202 children responded. Birth data were retrieved for only 482 children (22% of 2,052). Missing birth data from GPs were associated with non-white ethnicity, non-UK born, English not the dominant language at home or socioeconomic disadvantage. Paired data were available in 376 children for BW and in 407 children for GA. No significant difference in BW or GA was observed between PQ and GP data, with data for primary schoolchildren yields high quality and rapid return of data, and it should be considered as a viable alternative in which there is limited access to birth records. It provides the potential to include children with an increased risk of health problems within epidemiological studies.

  14. Body mass index and retinopathy in Asian populations with diabetes mellitus.

    Science.gov (United States)

    Rooney, David; Lye, Weng Kit; Tan, Gavin; Lamoureux, Ecosse L; Ikram, Mohammad Kamran; Cheng, Ching-Yu; Kumari, Neelam; Zheng, Ying Feng; Mitchell, Paul; Wang, Jie Jin; Wong, Tien Y; Sabanayagam, Charumathi

    2015-02-01

    Body mass index (BMI) is an established risk factor for diabetes. However, the association between BMI and diabetic retinopathy (DR) has been inconclusive. We aimed to assess the association between BMI and DR in a large population-based sample of multi-ethnic Asian adults in Singapore. We examined 2,278 adults aged ≥40 years with diabetes who participated in three population-based studies conducted from 2004 to 2011: the Singapore Malay Eye Study, the Singapore Indian Eye Study, and the Singapore Chinese Eye Study. Retinal photographs taken from both eyes were graded for any and vision-threatening (VTDR) using the modified Airlie House Classification. BMI (kg/m(2)) was categorized into normal/underweight (<25), overweight (25-29.9), and obese (≥30). The prevalence rates of any and VTDR in the study population were 35.1 % and 9.1 %, respectively. The prevalence of any and VTDR decreased with increasing categories of BMI (P trend <0.001 and 0.005). In multivariable models adjusted for potential confounders, compared to those with normal weight, the odds ratio (95 % confidence interval) of any DR was 0.71 (0.57-0.88) for overweight and 0.70 (0.53-0.92) for obese. Corresponding estimates for VTDR were 0.84 (0.59-1.21) for overweight and 0.58 (0.35-0.94) for obese. The inverse association between BMI and any DR was consistently present when BMI was analyzed as a continuous variable and in analyses stratified by ethnicity and age. In a population-based sample of multi-ethnic Asian adults, BMI levels were inversely associated with any DR and VTDR.

  15. Measuring Multi-Ethnic Desegregation

    Science.gov (United States)

    Straus, Ryane McAuliffe

    2010-01-01

    This article proposes a new method for measuring school desegregation in multiracial districts, and uses the new method to measure the desegregation effects of magnet schools in Los Angeles. Rather than measuring desegregation between only two groups at a time, I compute the index of interracial exposure for Blacks, Whites, Latinos, and Asians.…

  16. Health Disparities and Relational Well-Being between Multi- and Mono-Ethnic Asian Americans

    Science.gov (United States)

    Zhang, Wei

    2013-01-01

    Focusing on Hawaii, a state with 21.3% of the population being multi-racial according to the 2010 U.S. Census, this study aims to examine the existence and nature of health disparities between mono- and multi-ethnic Asian Americans and the importance of Relational Well-Being in affecting the health of Asian Americans. A series of ordinary least…

  17. Management Options for Women at Risk for Inherited Breast Cancer in a Multi-ethnic Health Plan Population: A Randomized Control Trial

    National Research Council Canada - National Science Library

    Schaefer, Catherine

    1998-01-01

    ...-to-moderate risk women from minority populations. Resulting strategies will be usefully applied in the large, ethnically and economically diverse populations of health maintenance organizations from which increasing...

  18. Management Options for Women at Risk for Inherited Breast Cancer in a Multi-ethnic Health Plan Population: A Randomized Control Trial

    National Research Council Canada - National Science Library

    Hiatt, Robert

    1997-01-01

    ...-to-moderate risk women from minority populations. Resulting stategies will be usefully applied in the large, ethnically and economically diverse populations of health maintenance organizations from which increasing...

  19. Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

    OpenAIRE

    Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

    2014-01-01

    Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

  20. Prevalence of neuromyelitis optica spectrum disorder in the multi-ethnic Penang Island, Malaysia, and a review of worldwide prevalence.

    Science.gov (United States)

    Hor, Jyh Yung; Lim, Thien Thien; Chia, Yuen Kang; Ching, Yee Ming; Cheah, Chun Fai; Tan, Kenny; Chow, Han Bing; Arip, Masita; Eow, Gaik Bee; Easaw, P E Samuel; Leite, M Isabel

    2018-01-01

    Neuromyelitis optica spectrum disorder (NMOSD) occurs worldwide in all ethnicities. Recently, population-based studies have shown that NMOSD is more common among non-White populations. There is scarce data about NMOSD prevalence in South East Asian populations. (1) A population-based study was undertaken to estimate NMOSD prevalence in the multi-ethnic Penang Island, Malaysia, comprising Chinese, Malays, and Indians. Medical records of NMOSD patients followed up at the Penang General Hospital (the neurology referral centre in Penang Island) were reviewed. The 2015 diagnostic criteria of the International Panel for NMO Diagnosis were used for case ascertainment. (2) A review of population-based prevalence studies of NMOSD worldwide was carried out. PubMed and conference proceedings were searched for such studies. Of the 28 NMOSD patients, 14 were residents of Penang Island on prevalence day [13 (93%) Chinese and one (7%) Malay]. All 14 patients were females and aquaporin 4 seropositive. The prevalence of NMOSD in Penang Island was 1.99/100,000 population; according to ethnicities, the prevalence in Chinese was significantly higher than in Malays (3.31/100,000 vs 0.43/100,000, respectively, p = 0.0195). Based on our and other population-based studies, among Asians, East Asian origin populations (Chinese and Japanese) appear to have higher NMOSD prevalence than other Asian ethnic groups. Worldwide, Blacks seem to have the highest NMOSD prevalence. More studies in different geographical regions and ethnic groups will be useful to further inform about potential factors in NMOSD pathogenesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Gene-centric meta-analysis of lipid traits in African, East Asian and Hispanic populations.

    Directory of Open Access Journals (Sweden)

    Clara C Elbers

    Full Text Available Meta-analyses of European populations has successfully identified genetic variants in over 100 loci associated with lipid levels, but our knowledge in other ethnicities remains limited. To address this, we performed dense genotyping of ∼2,000 candidate genes in 7,657 African Americans, 1,315 Hispanics and 841 East Asians, using the IBC array, a custom ∼50,000 SNP genotyping array. Meta-analyses confirmed 16 lipid loci previously established in European populations at genome-wide significance level, and found multiple independent association signals within these lipid loci. Initial discovery and in silico follow-up in 7,000 additional African American samples, confirmed two novel loci: rs5030359 within ICAM1 is associated with total cholesterol (TC and low-density lipoprotein cholesterol (LDL-C (p = 8.8×10(-7 and p = 1.5×10(-6 respectively and a nonsense mutation rs3211938 within CD36 is associated with high-density lipoprotein cholesterol (HDL-C levels (p = 13.5×10(-12. The rs3211938-G allele, which is nearly absent in European and Asian populations, has been previously found to be associated with CD36 deficiency and shows a signature of selection in Africans and African Americans. Finally, we have evaluated the effect of SNPs established in European populations on lipid levels in multi-ethnic populations and show that most known lipid association signals span across ethnicities. However, differences between populations, especially differences in allele frequency, can be leveraged to identify novel signals, as shown by the discovery of ICAM1 and CD36 in the current report.

  2. Hypertension control in a large multi-ethnic cohort in Amsterdam, The Netherlands: the HELIUS study

    NARCIS (Netherlands)

    Agyemang, Charles; Kieft, Suzanne; Snijder, Marieke B.; Beune, Erik J.; van den Born, Bert-Jan; Brewster, Lizzy M.; Ujcic-Voortman, Joanne J.; Bindraban, Navin; van Montfrans, Gert; Peters, Ron J.; Stronks, Karien

    2015-01-01

    Hypertension is a major problem among European ethnic minority groups. We assessed the current situation of hypertension prevalence and its management among a multi-ethnic population in Amsterdam, The Netherlands. Data from the HELIUS study were used including 12,974 participants (1871 Ghanaian,

  3. Distribution of HPV genotypes in cervical cancer in multi- ethnic Malaysia.

    Science.gov (United States)

    Hamzi Abdul Raub, Sayyidi; Isa, Nurismah Md; Zailani, Hatta Ahmad; Omar, Baharudin; Abdullah, Mohamad Farouk; Mohd Amin, Wan Anna; Noor, Rushdan Md; Ayub, Mukarramah Che; Abidin, Zainal; Kassim, Fauziah; Vicknesh, Visvalingam; Zakaria, Zubaidah; Kamaluddin, Muhammad Amir; Tan, Geok Chin; Syed Husain, Sharifah Noor Akmal

    2014-01-01

    Cervical cancer is the third commonest type of cancer among women in Malaysia. Our aim was to determine the distribution of human papilloma virus (HPV) genotypes in cervical cancer in our multi-ethnic population. This was a multicentre study with a total of 280 cases of cervical cancer from 4 referral centres in Malaysia, studied using real-time polymerase chain reaction (qPCR) detection of 12 high risk-HPV genotypes. Overall HPV was detected in 92.5% of cases, in 95.9% of squamous cell carcinomas and 84.3%of adenocarcinomas. The five most prevalent high-risk HPV genotypes were HPV 16 (68.2%), 18 (40%), 58 (10.7%), 33 (10.4%) and 52 (10.4%). Multiple HPV infections were more prevalent (55.7%) than single HPV infections (36.8%). The percentage of HPV positive cases in Chinese, Malays and Indians were 95.5%, 91.9% and 80.0%, respectively. HPV 16 and 18 genotypes were the commonest in all ethnic groups. We found that the percentage of HPV 16 infection was significantly higher in Chinese (75.9%) compared to Malays (63.7%) and Indians (52.0%) (pMalaysia is similar to other Asian countries. Importantly, we found that different ethnic groups in Malaysia have different HPV genotype infection rates, which is a point to consider during the implementation of HPV vaccination.

  4. The specificity and the development of social-emotional competence in a multi-ethnic-classroom.

    Science.gov (United States)

    Petrowski, Katja; Herold, Ulf; Joraschky, Peter; von Wyl, Agnes; Cierpka, Manfred

    2009-05-28

    Ethnic diversity in schools increases due to globalization. Thus, the children's social-emotional competence development must be considered in the context of a multi-ethnic classroom. In this study, the social-emotional competence of 65 Asian-American and Latin-American children was observed at the beginning and the end of their kindergarten year. Initially, significant differences existed among these ethnic groups in respect to moral reasoning. Furthermore, the male children showed more dysregulated aggression but the female children implemented more moral reasoning than their male counterparts. These ethnic specificities did not disappear over the course of the year. In addition, a significant change in avoidance strategies as well as expressed emotions in the narrative took place over the course of one year. Ethnic specificity in social-emotional competence does exist independent of gender at the beginning as well as at the end of the kindergarten year in a multi-ethnic kindergarten classroom.

  5. BRCA2 Variants and cardiovascular disease in a multi-ethnic study

    Directory of Open Access Journals (Sweden)

    Zbuk Kevin

    2012-07-01

    Full Text Available Abstract Background Germline mutations of BRCA1/2 are associated with hereditary breast and ovarian cancer. Recent data suggests excess mortality in mutation carriers beyond that conferred by neoplasia, and recent in vivo and in vitro studies suggest a modulatory role for BRCA proteins in endothelial and cardiomyocyte function. We therefore tested the association of BRCA2 variants with clinical cardiovascular disease (CVD. Methods Using data from 1,170 individuals included in two multi-ethnic population-based studies (SHARE and SHARE-AP, the association between BRCA2 variants and CVD was evaluated. 15 SNPs in BRCA2 with minor allele frequencies (MAF > 0.01 had been previously genotyped using the cardiovascular gene-centric 50 k SNP array. 115 individuals (9.8% reported a CVD event, defined as myocardial infarction (MI, angina, silent MI, stroke, and angioplasty or coronary artery bypass surgery. Analyses were adjusted for age and sex. The SNPs rs11571836 and rs1799943 were subsequently genotyped using the MassARRAY platform in 1,045 cases of incident MI and 1,135 controls from the South Asian subset of an international case-control study of acute MI (INTERHEART, and rs11571836 was imputed in 4,686 cases and 4500 controls from the Pakistan Risk of Myocardial Infarction Study (PROMIS. Results Two BRCA2 SNPs, rs11571836 and rs1799943, both located in untranslated regions, were associated with lower risk of CVD (OR 0.47 p = 0.01 and OR 0.56 p = 0.03 respectively in the SHARE studies. Analysis by specific ethnicities demonstrated an association with CVD for both SNPs in Aboriginal People, and for rs11571836 only in South Asians. No association was observed in the European and Chinese subgroups. A non-significant trend towards an association between rs11571836 and lower risk of MI was observed in South Asians from INTERHEART [OR = 0.87 (95% CI: 0.75-1.01 p = 0.068], but was not evident in PROMIS [OR = 0.96 (95% CI: 0

  6. Association between number of doses per day, number of medications and patient's non-compliance, and frequency of readmissions in a multi-ethnic Asian population

    Directory of Open Access Journals (Sweden)

    Ming Ren Toh

    2014-01-01

    Conclusion: Complex medication regimen (i.e. multiple medications and multiple doses per day is a statistically significant predictor of number of readmissions. Simplifying therapeutic regimens with alternatives such as longer-acting or fixed-dose combination drugs may facilitate better patient adherence and reduce costly readmissions.

  7. Objectively Measured Patterns of Activities of Different Intensity Categories and Steps Taken Among Working Adults in a Multi-ethnic Asian Population.

    Science.gov (United States)

    Müller-Riemenschneider, Falk; Ng, Sheryl Hui Xian; Koh, David; Chu, Anne Hin Yee

    2016-06-01

    To objectively assess sedentary behavior (SB), light- and moderate-to-vigorous intensity physical activity (MVPA), and steps among Singaporean office-based workers across days of the week. A convenience sample of office-based employees of a public University was recruited. Time spent for SB, light-, and MVPA using different validated accelerometry counts per minute (CPM), and step count were determined. Depending on applied CPM for SB (less than 100, less than 150 and less than 200 CPM), 107 working adults spent between 69.2% and 76.4% of their daily wakeful time in SB. Time spent in SB and MVPA were higher on weekdays than weekends. The hourly analysis highlights patterns of greater SB during usual working hours on weekdays but not on weekends. SB at work contributes greatly toward total daily sitting time. Low PA levels and high SB levels were found on weekends.

  8. Hypertension control in a large multi-ethnic cohort in Amsterdam, The Netherlands: the HELIUS study.

    Science.gov (United States)

    Agyemang, Charles; Kieft, Suzanne; Snijder, Marieke B; Beune, Erik J; van den Born, Bert-Jan; Brewster, Lizzy M; Ujcic-Voortman, Joanne J; Bindraban, Navin; van Montfrans, Gert; Peters, Ron J; Stronks, Karien

    2015-03-15

    Hypertension is a major problem among European ethnic minority groups. We assessed the current situation of hypertension prevalence and its management among a multi-ethnic population in Amsterdam, The Netherlands. Data from the HELIUS study were used including 12,974 participants (1871 Ghanaian, 2184 African Surinamese, 2278 South-Asian Surinamese, 2277 Turkish, 2222 Moroccan and 2142 Dutch origin people), aged 18-70 years. Comparisons among groups were made using proportions and age-adjusted prevalence ratios (PRs). Hypertension prevalence ranged from 24% and 16% in Moroccan men and women to 52% and 62% in Ghanaian men and women. Except for Moroccan women, age-adjusted PR of hypertension was higher in all the ethnic minority groups than in Dutch. Among hypertensives, ethnic minority groups generally had higher levels of hypertension awareness and BP lowering treatment than Dutch. Moreover, prevalence rates for the prescription of more than one BP lowering drug were generally higher in African and South-Asian origin groups compared with Dutch origin people. By contrast, BP control levels were lower in all the ethnic groups than in Dutch, with control rates being significantly lower in Ghanaian men (26%, PR=0.49; 95% CI, 0.37-0.66) and women (45%, PR=0.64; 0.52-0.77), African-Surinamese men (30%, PR=0.61; 0.46-0.81) and women (45%, PR=0.72; 0.51-0.77), and South-Asian Surinamese men (43%, PR=0.77; 0.61-0.97) and women (47%, PR=0.76; 0.63-0.92) compared with Dutch men (53%) and women (61%). Our findings indicate poor BP control in ethnic minority groups despite the high treatment levels. More work is needed to unravel the potential factors contributing to the poor control in order to improve BP control in ethnic minority groups, particularly among African and South-Asian origin groups. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Vaccine hesitancy among parents in a multi-ethnic country, Malaysia.

    Science.gov (United States)

    Mohd Azizi, Fatin Shaheera; Kew, Yueting; Moy, Foong Ming

    2017-05-19

    Vaccine hesitancy is a threat in combating vaccine-preventable diseases. It has been studied extensively in the Western countries but not so among Asian countries. To assess the test-retest reliability of the Parent Attitudes about Childhood Vaccines (PACV) questionnaire in Malay language; to determine the prevalence of vaccine hesitancy among parents and its associations with parents' socio-demographic characteristics. Forward and backward translation of PACV in Malay language was carried out. The reliability of the Malay-PACV questionnaire was tested among parents with children. The same questionnaire was used to study vaccine hesitancy among parents in a tertiary hospital in Kuala Lumpur. Information pertaining to socio-demographic characteristics, sources of information regarding vaccination and vaccine hesitancy were collected. Associations between vaccine hesitancy with socio-demographic factors were tested using Multivariable Logistic Regression. The Spearman correlation coefficient and Cronbach alpha for total PACV was 0.79 (pvaccine hesitant. In the univariate analyses, vaccine hesitancy was associated with unemployed parents, parents who were younger, had fewer children and non-Muslim. In the multivariate model, pregnant mothers expecting their first child were four times more likely to be vaccine hesitant compared to those who already had one or more children (aOR: 3.91, 95% CI: 1.74-8.79) and unemployed parents were also more likely to be vaccine hesitant (aOR: 1.97, 95% CI: 1.08-3.59). The internet (65.6%) was the main source of information on vaccination followed by brochures (56.9%). The Malay-PACV questionnaire is reliable to be used. The prevalence of vaccine hesitancy among the multi-ethnic Malaysians was comparable with other populations. Pregnant mothers expecting their first child and unemployed parents were found to be more vaccine hesitant. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Genomic copy number variations in three Southeast Asian populations.

    Science.gov (United States)

    Ku, Chee-Seng; Pawitan, Yudi; Sim, Xueling; Ong, Rick T H; Seielstad, Mark; Lee, Edmund J D; Teo, Yik-Ying; Chia, Kee-Seng; Salim, Agus

    2010-07-01

    Research on the role of copy number variations (CNVs) in the genetic risk of diseases in Asian populations has been hampered by a relative lack of reference CNV maps for Asian populations outside the East Asians. In this article, we report the population characteristics of CNVs in Chinese, Malay, and Asian Indian populations in Singapore. Using the Illumina Human 1M Beadchip array, we identify 1,174 CNV loci in these populations that corroborated with findings when the same samples were typed on the Affymetrix 6.0 platform. We identify 441 novel loci not previously reported in the Database of Genomic Variations (DGV). We observe a considerable number of loci that span all three populations and were previously unreported, as well as population-specific loci that are quite common in the respective populations. From this we observe the distribution of CNVs in the Asian Indian population to be considerably different from the Chinese and Malay populations. About half of the deletion loci and three-quarters of duplication loci overlap UCSC genes. Tens of loci show population differentiation and overlap with genes previously known to be associated with genetic risk of diseases. One of these loci is the CYP2A6 deletion, previously linked to reduced susceptibility to lung cancer. (c) 2010 Wiley-Liss, Inc.

  11. FastStats: Health of Asian or Pacific Islander Population

    Science.gov (United States)

    ... Whooping Cough or Pertussis Family Life Marriage and Divorce Health Care and Insurance Access to Health Care ... 2015, table 1 [PDF – 2.7 MB] Leading causes of death for Asian or Pacific Islander population ...

  12. South Asian populations in Canada: migration and mental health

    Science.gov (United States)

    2014-01-01

    Background South Asian populations are the largest visible minority group in Canada; however, there is very little information on the mental health of these populations. The objective of this study was to determine the prevalence rates and characteristics of mental health outcomes for South Asian first-generation immigrant and second-generation Canadian-born populations. Methods The Canadian Community Health Survey (CCHS) 2011 was used to calculate the estimated prevalence rates of the following mental health outcomes: mood disorders, anxiety disorders, fair-poor self-perceived mental health status, and extremely stressful life stress. The characteristics associated with these four mental health outcomes were determined through multivariate logistic regression analysis of merged CCHS 2007–2011 data. Results South Asian Canadian-born (3.5%, 95% CI 3.4-3.6%) and South Asian immigrant populations (3.5%, 95% CI 3.5-3.5%) did not vary significantly in estimated prevalence rates of mood disorders. However, South Asian immigrants experienced higher estimated prevalence rates of diagnosed anxiety disorders (3.4%, 95% CI 3.4-3.5 vs. 1.1%, 95% CI 1.1-1.1%) and self-reported extremely stressful life stress (2.6%, 95% CI 2.6-2.7% vs. 2.4%, 95% CI 2.3-2.4%) compared to their Canadian-born counterparts. Lastly, South Asian Canadian-born populations had a higher estimated prevalence rate of poor-fair self-perceived mental health status (4.4%, 95% CI 4.3-4.5%) compared to their immigrant counterparts (3.4%, 95% CI 3.3-3.4%). Different profiles of mental health determinants emerged for South Asian Canadian-born and immigrant populations. Female gender, having no children under the age of 12 in the household, food insecurity, poor-fair self-rated health status, being a current smoker, immigrating to Canada before adulthood, and taking the CCHS survey in either English or French was associated with greater risk of negative mental health outcomes for South Asian immigrant

  13. Relationship between educational and occupational levels, and Chronic Kidney Disease in a multi-ethnic sample- The HELIUS study

    NARCIS (Netherlands)

    Adjei, David N.; Stronks, Karien; Adu, Dwomoa; Snijder, Marieke B.; Modesti, Pietro A.; Peters, Ron J. G.; Vogt, Liffert; Agyemang, Charles

    2017-01-01

    Ethnic minority groups in high-income countries are disproportionately affected by Chronic Kidney Disease (CKD) for reasons that are unclear. We assessed the association of educational and occupational levels with CKD in a multi-ethnic population. Furthermore, we assessed to what extent ethnic

  14. AHP 24: A Multi-ethnic Village in Northeast Tibet - History, Ritual, and Daily Life in Chu cha

    Directory of Open Access Journals (Sweden)

    Stobs stag lha སྟོབས་སྟག་ལྷ།

    2013-09-01

    Full Text Available Multi-ethnic Chu cha Village in Mchod rten thang Township, Dpa' ris Tibetan Autonomous County, Gansu Province, China is described in terms of location; population; clothing; language; religion; history; and personal, family, and community rituals. Photographs provide additional information.

  15. Folic acid knowledge and use in a multi-ethnic pregnancy cohort: the role of language proficiency

    NARCIS (Netherlands)

    van Eijsden, M.; van der Wal, M. F.; Bonsel, G. J.

    2006-01-01

    OBJECTIVE: To investigate the role of language proficiency as determinant of folic acid knowledge and use in a multi-ethnic pregnancy cohort. DESIGN: Prospective cohort study. SETTING AND POPULATION: Pregnant women from Amsterdam attending obstetric care for their first antenatal visit. Number

  16. Assessment of Cardiovascular Disease Risk in South Asian Populations

    Directory of Open Access Journals (Sweden)

    S. Monira Hussain

    2013-01-01

    Full Text Available Although South Asian populations have high cardiovascular disease (CVD burden in the world, their patterns of individual CVD risk factors have not been fully studied. None of the available algorithms/scores to assess CVD risk have originated from these populations. To explore the relevance of CVD risk scores for these populations, literature search and qualitative synthesis of available evidence were performed. South Asians usually have higher levels of both “classical” and nontraditional CVD risk factors and experience these at a younger age. There are marked variations in risk profiles between South Asian populations. More than 100 risk algorithms are currently available, with varying risk factors. However, no available algorithm has included all important risk factors that underlie CVD in these populations. The future challenge is either to appropriately calibrate current risk algorithms or ideally to develop new risk algorithms that include variables that provide an accurate estimate of CVD risk.

  17. Relationship between educational and occupational levels, and Chronic Kidney Disease in a multi-ethnic sample- The HELIUS study.

    Science.gov (United States)

    Adjei, David N; Stronks, Karien; Adu, Dwomoa; Snijder, Marieke B; Modesti, Pietro A; Peters, Ron J G; Vogt, Liffert; Agyemang, Charles

    2017-01-01

    Ethnic minority groups in high-income countries are disproportionately affected by Chronic Kidney Disease (CKD) for reasons that are unclear. We assessed the association of educational and occupational levels with CKD in a multi-ethnic population. Furthermore, we assessed to what extent ethnic inequalities in the prevalence of CKD were accounted for by educational and occupational levels. Cross-sectional analysis of baseline data from the Healthy Life in an Urban Setting (HELIUS) study of 21,433 adults (4,525 Dutch, 3,027 South-Asian Surinamese, 4,105 African Surinamese, 2,314 Ghanaians, 3,579 Turks, and 3,883 Moroccans) aged 18 to 70 years living in Amsterdam, the Netherlands. Three CKD outcomes were considered using the 2012 KDIGO (Kidney Disease: Improving Global Outcomes) severity of CKD classification. Comparisons between educational and occupational levels were made using logistic regression analyses. After adjustment for sex and age, low-level and middle-level education were significantly associated with higher odds of high to very high-risk of CKD in Dutch (Odds Ratio (OR) 2.10, 95% C.I., 1.37-2.95; OR 1.55, 95% C.I., 1.03-2.34). Among ethnic minority groups, low-level education was significantly associated with higher odds of high to very-high-risk CKD but only in South-Asian Surinamese (OR 1.58, 95% C.I., 1.06-2.34). Similar results were found for the occupational level in relation to CKD risk. The lower educational and occupational levels of ethnic minority groups partly accounted for the observed ethnic inequalities in CKD. Reducing CKD risk in ethnic minority populations with low educational and occupational levels may help to reduce ethnic inequalities in CKD and its related complications.

  18. Minneapolis Multi-Ethnic Curriculum Project--Migration Unit.

    Science.gov (United States)

    Minneapolis Public Schools, Minn. Dept. of Intergroup Education.

    The student booklet presents short chapters illustrating the migration unit of the Minneapolis Multi-Ethnic Curriculum Project for secondary schools. Sixteen brief chapters describe migration, immigration, and emigration in the United States. The first six chapters offer first person accounts of immigrants from Norway, Korea, Egypt, Hitler's…

  19. Multi-Ethnicity and Material Exchangesin Late Medieval Tallinn

    DEFF Research Database (Denmark)

    Naum, Magdalena

    2014-01-01

    his article examines the cultural and social dynamics of a multi-ethnic medieval town. Taking the lower town of Tallinn as a case study, this paper identifies the major urban ethnic groups living in the town and discusses their co-existence, self-definition, and processes of categorization...

  20. Aging in Multi-ethnic Malaysia.

    Science.gov (United States)

    Tey, Nai Peng; Siraj, Saedah Binti; Kamaruzzaman, Shahrul Bahyah Binti; Chin, Ai Vyrn; Tan, Maw Pin; Sinnappan, Glaret Shirley; Müller, Andre Matthias

    2016-08-01

    Multiethnic Malaysia provides a unique case study of divergence in population aging of different sociocultural subgroups within a country. Malaysia represents 3 major ethnicities in Asia-the Malay, Chinese, and Indian. The 3 ethnic groups are at different stages of population aging, as they have undergone demographic transition at different pace amidst rapid social and economic changes. Between 1991 and 2010, the Malaysian population aged 60 and over has more than doubled from about 1 million to 2.2 million, and this is projected to rise to about 7 million or 17.6% of the projected population of 40 million by 2040. In 2010, the aging index ranged from 22.8% among the Bumiputera (Malays and other indigenous groups), to 31.4% among the Indians and 55.0% among the Chinese. Population aging provides great challenges for Malaysia's social and economic development. The increasing prevalence of noncommunicable diseases in older adults, coupled with the erosion of the traditional family support system has increased demands on health care services with an overwhelming need for multidisciplinary and specialized geriatric care. Following the adoption of the National Policy for the Elderly in 1995, issues of population aging have gained increasing attention, especially among researchers. There is an urgent need to increase public awareness, develop infrastructure, as well as support action oriented research that will directly translate to comprehensive and cohesive social strategies, policies, and legislation to protect not just the current older Malaysians but the future of all Malaysians. © The Author 2015. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Multi-layered population structure in Island Southeast Asians

    Science.gov (United States)

    Mörseburg, Alexander; Pagani, Luca; Ricaut, Francois-Xavier; Yngvadottir, Bryndis; Harney, Eadaoin; Castillo, Cristina; Hoogervorst, Tom; Antao, Tiago; Kusuma, Pradiptajati; Brucato, Nicolas; Cardona, Alexia; Pierron, Denis; Letellier, Thierry; Wee, Joseph; Abdullah, Syafiq; Metspalu, Mait; Kivisild, Toomas

    2016-01-01

    The history of human settlement in Southeast Asia has been complex and involved several distinct dispersal events. Here, we report the analyses of 1825 individuals from Southeast Asia including new genome-wide genotype data for 146 individuals from three Mainland Southeast Asian (Burmese, Malay and Vietnamese) and four Island Southeast Asian (Dusun, Filipino, Kankanaey and Murut) populations. While confirming the presence of previously recognised major ancestry components in the Southeast Asian population structure, we highlight the Kankanaey Igorots from the highlands of the Philippine Mountain Province as likely the closest living representatives of the source population that may have given rise to the Austronesian expansion. This conclusion rests on independent evidence from various analyses of autosomal data and uniparental markers. Given the extensive presence of trade goods, cultural and linguistic evidence of Indian influence in Southeast Asia starting from 2.5 kya, we also detect traces of a South Asian signature in different populations in the region dating to the last couple of thousand years. PMID:27302840

  2. Validation of an Albuminuria Self-assessment Tool in the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Tanner, Rikki M; Woodward, Mark; Peralta, Carmen; Warnock, David G; Gutiérrez, Orlando; Shimbo, Daichi; Kramer, Holly; Katz, Ronit; Muntner, Paul

    2015-11-05

    We previously developed an 8-item self-assessment tool to identify individuals with a high probability of having albuminuria. This tool was developed and externally validated among non-Hispanic Whites and non-Hispanic Blacks. We sought to validate it in a multi-ethnic cohort that also included Hispanics and Chinese Americans. This is a cross-sectional study. Data were collected using standardized questionnaires and spot urine samples at a baseline examination in 2000-2002. The 8 items in the self-assessment tool include age, race, gender, current cigarette smoking, history of diabetes, hypertension, or stroke, and self-rated health. Of 6,814 community-dwelling adults aged 45-84 years participating in the Multi-Ethnic Study of Atherosclerosis (MESA), 6,542 were included in the primary analysis. Albuminuria was defined as urine albumin-to-creatinine ratio ≥ 30 mg/g at baseline. Among non-Hispanic Whites, non-Hispanic Blacks, Hispanics, and Chinese Americans, the prevalence of albuminuria was 6.0%, 11.3%, 11.6%, and 10.8%, respectively. The c-statistic for discriminating participants with and without albuminuria was .731 (95% CI: .692, .771), .728 (95% CI: .687, .761), .747 (95% CI: .709, .784), and .761 (95% CI: .699, .814) for non-Hispanic Whites, non-Hispanic Blacks, Hispanics, and Chinese Americans, respectively. The self-assessment tool over-estimated the probability of albuminuria for non-Hispanic Whites and Blacks, but was well-calibrated for Hispanics and Chinese Americans. The albuminuria self-assessment tool maintained good test characteristics in this large multi-ethnic cohort, suggesting it may be helpful for increasing awareness of albuminuria in an ethnically diverse population.

  3. Population characteristics and health care needs of Asian Pacific Americans.

    OpenAIRE

    Lin-Fu, J S

    1988-01-01

    Asian Pacific Americans are one of the smallest but fastest growing minority groups in the United States. Between 1970 and 1980, this population increased 142 percent, from 1.5 million to 3.7 million. This dramatic growth is due largely to a change in U.S. immigration policies in the mid-1960s and the continuous influx of refugees from Southeast Asia since 1975. Despite such sharp increase, Asian Pacific Americans remain one of the most poorly understood minorities, and their health care need...

  4. Does a High Sugar High Fat Dietary Pattern Explain the Unequal Burden in Prevalence of Type 2 Diabetes in a Multi-Ethnic Population in The Netherlands? The HELIUS Study

    NARCIS (Netherlands)

    Huisman, Merel J.; Soedamah-Muthu, Sabita S.; Vermeulen, Esther; Muilwijk, Mirthe; Snijder, Marieke B.; Nicolaou, Mary N.; van Valkengoed, Irene G. M.

    2018-01-01

    The risk for type 2 diabetes (T2D) in ethnic minorities in Europe is higher in comparison with their European host populations. The western dietary pattern, characterized by high amounts of sugar and saturated fat (HSHF dietary pattern), has been associated with a higher risk for T2D. Information on

  5. Does a high sugar high fat dietary pattern explain the unequal burden in prevalence of type 2 diabetes in a multi-ethnic population in the Netherlands? The HELIUS study

    NARCIS (Netherlands)

    Huisman, Merel J.; Soedamah-Muthu, Sabita S.; Vermeulen, Esther; Muilwijk, Mirthe; Snijder, Marieke B.; Nicolaou, Mary N.; Valkengoed, Van Irene G.M.

    2018-01-01

    The risk for type 2 diabetes (T2D) in ethnic minorities in Europe is higher in comparison with their European host populations. The western dietary pattern, characterized by high amounts of sugar and saturated fat (HSHF dietary pattern), has been associated with a higher risk for T2D. Information on

  6. Does a high sugar high fat dietary pattern explain the unequal burden in prevalence of type 2 diabetes in a multi-ethnic population in the Netherlands? : The Helius study

    NARCIS (Netherlands)

    Huisman, Merel; Soedamah-Muthu, S.S.; Vermeulen, Esther; Muilwijk, Mirthe; Snijder, Marieke; Nicolaou, Mary; Van Valkengoed, Irene

    2018-01-01

    The risk for type 2 diabetes (t2d) in ethnic minorities in europe is higher in comparison with their european host populations. The western dietary pattern, characterized by high amounts of sugar and saturated fat (hshf dietary pattern), has been associated with a higher risk for t2d. Information on

  7. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  8. Fasting Glucose GWAS Candidate Region Analysis across Ethnic Groups in the Multi-Ethnic Study of Atherosclerosis (MESA)

    OpenAIRE

    Rasmussen-Torvik, L. J.; Guo, X.; Bowden, D. W.; Bertoni, A. G.; Sale, M. M.; Yao, J.; Bluemke, D. A.; Goodarzi, M. O.; Chen, Y. I.; Vaidya, D.; Raffel, L. J.; Papanicolaou, G.J.; Meigs, J. B.; Pankow, J. S.

    2012-01-01

    Genetic variants associated with fasting glucose in European ancestry populations are increasingly well understood. However, the nature of the associations between these SNPs and fasting glucose in other racial and ethnic groups is unclear. We sought to examine regions previously identified to be associated with fasting glucose in Caucasian GWAS across multiple ethnicities in the Multi-Ethnic Study of Atherosclerosis (MESA). Non-diabetic MESA participants with fasting glucose measured at the ...

  9. Physical activity, sedentary behaviors and the incidence of type 2 diabetes mellitus: the Multi-Ethnic Study of Atherosclerosis (MESA)

    OpenAIRE

    Joseph, Joshua J; Echouffo-Tcheugui, Justin B; Golden, Sherita H; Chen, Haiying; Jenny, Nancy Swords; Carnethon, Mercedes R; Jacobs, David; Burke, Gregory L; Vaidya, Dhananjay; Ouyang, Pamela; Bertoni, Alain G

    2016-01-01

    Background: The association between physical activity (PA), sedentary behavior, and incident diabetes has been assessed in whites but is less well investigated in multiethnic populations. Objective: To assess the association between PA, sedentary behavior, and incident diabetes in the Multi-Ethnic Study of Atherosclerosis. Research design and methods Incident diabetes was assessed among adults without prevalent baseline diabetes (2000–2002) at 5 in-person examinations between 2002 and 2012. B...

  10. Zinc status in South Asian populations--an update.

    Science.gov (United States)

    Akhtar, Saeed

    2013-06-01

    This article attempts to highlight the prevalence of zinc deficiency and its health and economic consequences in South Asian developing countries and to shed light on possible approaches to combating zinc deficiency. A computer-based search was performed on PubMed, Google, and ScienceDirect.com to retrieve relevant scientific literature published between 2000 and 2012. The search yielded 194 articles, of which 71 were culled. Studies were further screened on the basis of population groups, age and sex, pregnancy, and lactation. The most relevant articles were included in the review. Cutoffs for serum zinc concentration defined for zinc deficiency were 65 microg/dL for males and females aged or = 10 years. Population segments from rural and urban areas of South Asian developing countries were included in the analysis. They comprised pregnant and lactating women, preschool and school children. The analysis reveals that zinc deficiency is high among children, pregnant and lactating women in India, Pakistan, Bangladesh, Sri Lanka, and Nepal. Diarrhoea has been established as a leading cause to intensify zinc deficiency in Bangladesh. Little has been done in Sri Lanka and Nepal to estimate the prevalence of zinc deficiency precisely. A substantial population segment of the South Asian developing countries is predisposed to zinc deficiency which is further provoked by increased requirements for zinc under certain physiological conditions. Supplementation, fortification, and dietary diversification are the most viable strategies to enhancing zinc status among various population groups.

  11. 12th meeting of Asian Parliamentarians on Population and Development.

    Science.gov (United States)

    1999-01-01

    At the 12th annual Asian Parliamentarians Meeting on Population and Development, co-sponsored by the Asian Population and Development Association (APDA) of Japan and the Philippine Legislative Committee on Population and Development (PLCPD), the adverse effect of population growth on economic development and the importance of improvements in women's status were central themes. Fukusaburo Maeda, President of APDA Japan, noted that an understanding of women's issues is key to solving global population problems. Numerous participants urged rapid implementation of plans outlined at recent conferences in Cairo and Beijing to empower women and involve them in all stages of the development process. Even issues of food security are linked to women's issues, since women are generally responsible for feeding their families. Participants voted to adopt the "Manila Resolution on Women, Gender, Population, and Development"--a call for social and economic empowerment of women and resources for gender-related programs. Dr. Patricia Licuanan, Chair of the UN Committee on the Status of Women, noted that men should not feel threatened by women holding positions of power; rather, they should welcome an equal partnership between men and women. In her closing address, Senator Leticia Ramos Shahani, Chair of PLCPD, stressed the importance of placing women's empowerment on various parliamentary agendas and commended APDA for its research and population-based surveys in Asia.

  12. Validity of the international physical activity questionnaire and the Singapore prospective study program physical activity questionnaire in a multiethnic urban Asian population

    Directory of Open Access Journals (Sweden)

    Tai E Shyong

    2011-10-01

    Full Text Available Abstract Background Physical activity patterns of a population remain mostly assessed by the questionnaires. However, few physical activity questionnaires have been validated in Asian populations. We previously utilized a combination of different questionnaires to assess leisure time, transportation, occupational and household physical activity in the Singapore Prospective Study Program (SP2. The International Physical Activity Questionnaire (IPAQ has been developed for a similar purpose. In this study, we compared estimates from these two questionnaires with an objective measure of physical activity in a multi-ethnic Asian population. Methods Physical activity was measured in 152 Chinese, Malay and Asian Indian adults using an accelerometer over five consecutive days, including a weekend. Participants completed both the physical activity questionnaire in SP2 (SP2PAQ and IPAQ long form. 43subjects underwent a second set of measurements on average 6 months later to assess reproducibility of the questionnaires and the accelerometer measurements. Spearman correlations were used to evaluate validity and reproducibility and correlations for validity were corrected for within-person variation of accelerometer measurements. Agreement between the questionnaires and the accelerometer measurements was also evaluated using Bland Altman plots. Results The corrected correlation with accelerometer estimates of energy expenditure from physical activity was better for the SP2PAQ (vigorous activity: r = 0.73; moderate activity: r = 0.27 than for the IPAQ (vigorous activity: r = 0.31; moderate activity: r = 0.15. For moderate activity, the corrected correlation between SP2PAQ and the accelerometer was higher for Chinese (r = 0.38 and Malays (r = 0.57 than for Indians (r = -0.09. Both questionnaires overestimated energy expenditure from physical activity to a greater extent at higher levels of physical activity than at lower levels of physical activity. The

  13. Implications of an ageing population in the Asian context.

    Science.gov (United States)

    Suyono, H

    1999-12-01

    Population aging is the increasing number and proportion of old persons aged 60 years and above in the developing countries and 65 years and above in the developed countries that exceeds 10% of the total population. In Asia, the last decade of the 20th century is marked by significant changes in the age structure due to the process of population aging. The implications of this aging population on the life of Asian countries has to be addressed since demographically the current situation is changing rapidly and there lie the future challenges that have to be answered. Due to the growing size of the elderly population, Asia will need better plans to prevent these elderly groups from turning into the socioeconomically vulnerable group of society. However, many governments are not prepared with effective policies, programs, and services that are particularly designed to care for the elderly. The provision of infrastructure and services, including education, employment, health and housing are necessary steps that need to be taken. Some of the suggested measures include: the Social Safety Net Programs; the implementation of the Association of Southeast Asian Nations Plan of Action on Rural Development and Poverty Eradication; and strengthen volunteerism and the role of private sector in human development. The role of the media in transmitting information concerning policies and programs intended to increase the welfare of the older persons is also very important.

  14. Secular Trends in the Incidence of Dementia in a Multi-Ethnic Community.

    Science.gov (United States)

    Noble, James M; Schupf, Nicole; Manly, Jennifer J; Andrews, Howard; Tang, Ming-Xin; Mayeux, Richard

    2017-10-03

    Determination of secular trends in cognitive aging is important for prioritization of resources, services, and research in aging populations. Prior studies have identified declining dementia incidence associated with changes in cardiovascular risk factors and increased educational attainment. However, few studies have examined these factors in multi-ethnic cohorts. To identify secular trends in the incidence rate of dementia in an elderly population. Participants in this study were drawn from the Washington Heights-Inwood Columbia Aging Project, a multi-ethnic cohort study of northern Manhattan residents aged 65 years and older. Cox proportional hazards models were used to examine differences in the incidence of dementia in cohorts recruited in 1992 and 1999, with age at dementia or age at last follow-up visit as the "time-to-event" variable. Overall, there was a 41% reduction in the hazard ratio for dementia among participants in the 1999 cohort compared with those in the 1992 cohort, adjusting for age, sex, race, and baseline memory complaints (HR = 0.59). The reduction in incidence was greatest among non-Hispanic Whites and African-Americans and lowest among Hispanic participants (HRs = 0.60, 0.52 and 0.64, respectively), and was associated with increases in level of educational attainment, especially among African-Americans. Reduction in incidence of dementia was also greater among persons 75 years or older than among younger participants (HR = 0.52 versus HR = 0.69). Our results support previous findings that secular trends in dementia incidence are changing, including in aging minority populations.

  15. "Ich kam unter die Schweizer": Teaching Switzerland as a Multi-Ethnic Society

    Science.gov (United States)

    Baumgartner, Karin

    2012-01-01

    This article describes a five-week module on "Switzerland as a multi-ethnic society" intended to counteract the popular image of Switzerland as a homogenous country concerned mostly with tourism, chocolate, and watches. Instead, the module treats Switzerland through topics such as the definition of identity in a multi-ethnic society, the…

  16. Census Snapshot: California's Asian/Pacific Islander LGB Population

    OpenAIRE

    Ramos, Christopher; Gates, Gary J

    2008-01-01

    This report provides a general overview of Asian and Pacific Islanders (API) in same-sex couples as well as the broader API lesbian, gay, and bisexual (LGB) population in California. We use data from the 2005/2006 American Community Survey (ACS), conducted by the U.S. Census Bureau, to compare the characteristics of APIs in same-sex couples to their different-sex married counterparts. In all cases, when this report describes characteristics of couples, the data source is the ACS. Whi...

  17. Knowledge of gestational diabetes among a multi-ethnic cohort in Australia.

    Science.gov (United States)

    Carolan, Mary; Steele, Cheryl; Margetts, Heather

    2010-12-01

    to explore knowledge about gestational diabetes (GDM) among a multi-ethnic sample of women who were receiving antenatal care in Melbourne, Australia. cross-sectional comparative survey. diabetes clinic located in a public hospital in Melbourne's Western suburbs. 143 pregnant women with GDM from Vietnamese, Indian, Filipino and Caucasian backgrounds. 200 questionnaires were distributed and 143 were returned (response rate 71.5%). There were statistically significant differences between ethnic groups in terms of educational level (p=0.001) and fluency in English (p=0.001). Educational levels, measured in completed years of schooling, were lowest among Vietnamese [mean 8.5 years, standard deviation (SD) 1.0], Filipino (mean 8.9 years, SD 1.5) and Caucasian [mean 10.2 years, SD 0.9] women. Indian women had a higher mean level of education (11.6 years, SD 0.9). Fluency in English was reported by 100% of Caucasian, Indian and Filipino women, but 53.3% of Vietnamese women required interpreter services. The women's answers varied with ethnicity and educational status. Vietnamese and Filipino women displayed the least knowledge about GDM and food values. Caucasian women also scored poorly on general knowledge about GDM. Indian women scored highest across all areas of interest. Vietnamese women had the poorest English skills and lowest educational levels, and were identified as the group at greatest risk of misunderstanding GDM. English language proficiency alone, however, was not associated with better comprehension of GDM in this study. Higher educational level was the only factor linked to increased comprehension. It is, therefore, important that new educational strategies are developed to address lower health literacy as well as cultural factors when caring for multi-ethnic populations with GDM. This approach may also serve to address lower levels of comprehension among Caucasian populations. Copyright © 2009. Published by Elsevier Ltd.

  18. Population structure of the Southeast Asian river catfish Mystus nemurus.

    Science.gov (United States)

    Usmani, S; Tan, S G; Siraj, S S; Yusoff, K

    2003-12-01

    A total of 143 microsatellites were isolated from Mystus nemurus using a 5' anchored polymerase chain reaction technique or the random amplified hybridization microsatellite method, the first set of microsatellite markers developed for the Southeast Asian river catfish. Twenty polymorphic microsatellite loci were used as markers for population characterization of M. nemurus from six different geographical locations in Malaysia (Perak, Kedah, Johor, UPM, Sarawak and Terengganu). The number of alleles per locus ranged from 2 to 11 with 6.3 as the average number of alleles per locus. Characterization of the populations showed relatively high levels of genetic variation compared with previous studies using allozyme markers. The highest genetic similarity was found between Perak and Kedah, while the highest genetic distance was found between Terengganu and Kedah. The majority of clustering was in accordance with geographical locations and the histories of the populations. Microsatellite analysis indicated that the Sarawak population might be genetically closer to the Peninsular Malaysian populations than has been previously shown by other molecular marker studies.

  19. Association between the FTO rs9939609 polymorphism and the metabolic syndrome in a non-Caucasian multi-ethnic sample

    DEFF Research Database (Denmark)

    Al-Attar, Salam A; Pollex, Rebecca L; Ban, Matthew R

    2008-01-01

    for the NCEP ATP III-defined MetS. Subgroup analysis showed that the association was particularly strong in men. The association was related to a higher proportion of rs9939609 A allele carriers meeting the waist circumference criterion; a higher proportion also met the HDL cholesterol criterion compared...... with wild-type homozygotes. CONCLUSION: Thus, the FTO rs9939609 SNP was associated with an increased risk for MetS in this multi-ethnic sample, confirming that the association extends to non-Caucasian population samples....

  20. Distribution of branchial anomalies in a paediatric Asian population.

    Science.gov (United States)

    Teo, Neville Wei Yang; Ibrahim, Shahrul Izham; Tan, Kun Kiaang Henry

    2015-04-01

    The objective of the present study was to review the distribution and incidence of branchial anomalies in an Asian paediatric population and highlight the challenges involved in the diagnosis of branchial anomalies. This was a retrospective chart review of all paediatric patients who underwent surgery for branchial anomalies in a tertiary paediatric hospital from August 2007 to November 2012. The clinical notes were correlated with preoperative radiological investigations, intraoperative findings and histology results. Branchial anomalies were classified based on the results of the review. A total of 28 children underwent surgery for 30 branchial anomalies during the review period. Two children had bilateral branchial anomalies requiring excision. Of the 30 branchial anomalies, 7 (23.3%) were first branchial anomalies, 5 (16.7%) were second branchial anomalies, 3 (10.0%) were third branchial anomalies, and 4 (13.3%) were fourth branchial anomalies (one of the four patients with fourth branchial anomalies had bilateral branchial anomalies). In addition, seven children had 8 (26.7%) branchial anomalies that were thought to originate from the pyriform sinus; however, we were unable to determine if these anomalies were from the third or fourth branchial arches. There was inadequate information on the remaining 3 (10.0%) branchial anomalies for classification. The incidence of second branchial anomalies appears to be lower in our Asian paediatric population, while that of third and fourth branchial anomalies was higher. Knowledge of embryology and the related anatomy of the branchial apparatus is crucial in the identification of the type of branchial anomaly.

  1. Correlates of occupational, leisure and total sitting time in working adults: results from the Singapore multi-ethnic cohort.

    Science.gov (United States)

    Uijtdewilligen, Léonie; Yin, Jason Dean-Chen; van der Ploeg, Hidde P; Müller-Riemenschneider, Falk

    2017-12-13

    Evidence on the health risks of sitting is accumulating. However, research identifying factors influencing sitting time in adults is limited, especially in Asian populations. This study aimed to identify socio-demographic and lifestyle correlates of occupational, leisure and total sitting time in a sample of Singapore working adults. Data were collected between 2004 and 2010 from participants of the Singapore Multi Ethnic Cohort (MEC). Medical exclusion criteria for cohort participation were cancer, heart disease, stroke, renal failure and serious mental illness. Participants who were not working over the past 12 months and without data on sitting time were excluded from the analyses. Multivariable regression analyses were used to examine cross-sectional associations of self-reported age, gender, ethnicity, marital status, education, smoking, caloric intake and moderate-to-vigorous leisure time physical activity (LTPA) with self-reported occupational, leisure and total sitting time. Correlates were also studied separately for Chinese, Malays and Indians. The final sample comprised 9384 participants (54.8% male): 50.5% were Chinese, 24.0% Malay, and 25.5% Indian. For the total sample, mean occupational sitting time was 2.71 h/day, mean leisure sitting time was 2.77 h/day and mean total sitting time was 5.48 h/day. Sitting time in all domains was highest among Chinese. Age, gender, education, and caloric intake were associated with higher occupational sitting time, while ethnicity, marital status and smoking were associated with lower occupational sitting time. Marital status, smoking, caloric intake and LTPA were associated with higher leisure sitting time, while age, gender and ethnicity were associated with lower leisure sitting time. Gender, marital status, education, caloric intake and LTPA were associated with higher total sitting time, while ethnicity was associated with lower total sitting time. Stratified analyses revealed different associations within

  2. Gender differences in smoking behaviors in an Asian population.

    Science.gov (United States)

    Tsai, Yi-Wen; Tsai, Tzu-I; Yang, Chung-Lin; Kuo, Ken N

    2008-01-01

    Gender-sensitive tobacco control policies are being challenged, and new directions are being sought because public health efforts have reduced cigarette consumption more substantially among men than among women. To better target women, it would help to identify the protective cultural factors that promote resiliency in women and discourage them from smoking. Whereas western cultures have generated a great deal of gender-specific research and programs on the prevention of smoking in women, Asian cultures have not. Taking a personal and sociocultural perspective, this study examines the effect of gender on smoking behaviors in Taiwan. In a 2004 cross-sectional random-sampled interview survey, 827 adult men and 90 adult women smokers in Taiwan were queried about the time they began smoking, maintenance of their habits, and their readiness to change. The male/female smoking rate ratio was 9.5 (45.7% vs. 4.8%). Men smoked significantly more cigarettes per day than women (18 vs. 11). We found Taiwanese women started smoking around 20 years old, much later than their western counterparts. We also found that whereas the smoking behavior of the men was very sensitive to social environment and structural factors, that of women revolved around their desire to control their weight and handle their emotions. Differences in the smoking behavior of men and women are a result of a different sociocultural environment and the life trajectories and social circumstances embedded within it. Comprehensive tobacco control policies need to be tailored to not just smoking behavior alone or one population alone but to the determinants of smoking behavior in specific groups, for example, women. Even when targeting women, some effort may be needed on targeting women of different ethnicities, for instance, Asian women in whom the prevalence is increasing at alarming rates.

  3. Comparison of exposure response relationship of atrasentan between North American and Asian populations

    DEFF Research Database (Denmark)

    Heerspink, Hiddo J L; Makino, Hirofumi; Andress, Dennis

    2017-01-01

    AIMS: The selective endothelin (ET) A receptor antagonist atrasentan has been shown to lower albuminuria in North American and Asian patients with type 2 diabetes and nephropathy. As drug responses to many drugs may differ between North American and Asian populations, we assessed the influence...... change in albuminuria. Bodyweight change, a proxy of fluid retention, was used as a safety endpoint. Pharmacodynamics were determined in Asians (N = 77) and North Americans (N = 134). Atrasentan plasma concentration was measured in 161 atrasentan-treated patients. RESULTS: Mean albuminuria reduction...... in Asian, compared to North American, patients was, respectively, -34.4% vs -26.3% for 0.75 mg/d ( P  = .44) and -48.0% vs -28.9% for 1.25 mg/d ( P  = .035). Bodyweight gain did not differ between North American and Asian populations. Atrasentan plasma concentrations were higher in Asians compared to North...

  4. Dimensions of Assertiveness in an Asian-American Student Population.

    Science.gov (United States)

    Fukuyama, Mary A.; Greenfield, Tom K.

    1983-01-01

    Analyzed components of assertiveness, assessed by the College Self-Expression Scale, for Asian-American (N=105) and Caucasian (N=135) students. Results showed a significant difference in full-scale assertion scores indicating lower levels of overall assertion in Asian Americans, interpreted as consistent with value differences between…

  5. Cardiometabolic risks profile of normal weight obese and multi-ethnic women in a developing country.

    Science.gov (United States)

    Moy, Foong Ming; Loh, Debbie Ann

    2015-07-01

    To determine the prevalence of normal weight obesity among multi-ethnic women in Peninsular Malaysia and examine its associations with cardiometabolic risks and lifestyle behaviours. This was a cross-sectional study involving women recruited via multi-stage sampling from six states in Malaysia. Anthropometric and body composition analysis were performed. Normal weight obese (NWO) was defined as normal body mass index for Asians and the highest tertile of % body fat (BF). Biochemical measurements included fasting lipid and blood glucose levels. Metabolic syndrome was diagnosed based on the Harmonization criteria. Participants completed self-reported questionnaires that included physical activity, smoking, alcohol consumption, fruit and vegetable intake and sleep duration. Body mass index, %BF, cardiometabolic risk factors, lifestyle behaviours. A total of 6854 women were recruited and the prevalence of NWO was 19.8% (95% CI: 17.3-22.5). NWO was more prevalent among the Indians and older women. NWO women had higher odds for abdominal obesity (OR: 2.64, 95% CI: 1.73-4.04), hypertriglyceridemia (2.51, 1.47-4.29) and hypertension (1.63, 1.15-2.31) compared to women with lower % body fat after adjusted for age and ethnicity. The prevalence of metabolic syndrome among NWO women was 5.4% (95% CI: 3.0-9.8). None of the lifestyle behaviours were significantly associated with NWO. Women with NWO had cardiometabolic abnormalities including abdominal obesity, dyslipidaemia and increased blood pressure. Health promotion efforts should include NWO women who may be oblivious of their deleterious health risks. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Comparison of exposure response relationship of atrasentan between North American and Asian populations

    NARCIS (Netherlands)

    Heerspink, Hiddo J. L.; Makino, Hirofumi; Andress, Dennis; Brennan, John J.; Correa-Rotter, Ricardo; Coll, Blai; Davis, Justin W.; Idler, Ken; Kohan, Donald E.; Liu, Mohan; Perkovic, Vlado; Remuzzi, Giuseppe; Tobe, Sheldon W.; Toto, Robert; Parving, Hans-Henrik; de Zeeuw, Dick

    Aims: The selective endothelin (ET) A receptor antagonist atrasentan has been shown to lower albuminuria in North American and Asian patients with type 2 diabetes and nephropathy. As drug responses to many drugs may differ between North American and Asian populations, we assessed the influence of

  7. Natural selection on HFE in Asian populations contributes to enhanced non-heme iron absorption.

    Science.gov (United States)

    Ye, Kaixiong; Cao, Chang; Lin, Xu; O'Brien, Kimberly O; Gu, Zhenglong

    2015-06-10

    HFE, a major regulator of iron (Fe) homeostasis, has been suggested to be under positive selection in both European and Asian populations. While the genetic variant under selection in Europeans (a non-synonymous mutation, C282Y) has been relatively well-studied, the adaptive variant in Asians and its functional consequences are still unknown. Identifying the adaptive HFE variants in Asians will not only elucidate the evolutionary history and the genetic basis of population difference in Fe status, but also assist the future practice of genome-informed dietary recommendation. Using data from the International HapMap Project, we confirmed the signatures of positive selection on HFE in Asian populations and identified a candidate adaptive haplotype that is common in Asians (52.35-54.71%) but rare in Europeans (5.98%) and Africans (4.35%). The T allele at tag SNP rs9366637 (C/T) captured 95.8% of this Asian-common haplotype. A significantly reduced HFE expression was observed in individuals carrying T/T at rs9366637 compared to C/C and C/T, indicating a possible role of gene regulation in adaptation. We recruited 57 women of Asian descent and measured Fe absorption using stable isotopes in those homozygous at rs9366637. We observed a 22% higher absorption in women homozygous for the Asian-common haplotype (T/T) compared to the control genotype (C/C). Additionally, compared with a group of age-matched Caucasian women, Asian women exhibited significantly elevated Fe absorption. Our results indicate parallel adaptation of HFE gene in Europeans and Asians with different genetic variants. Moreover, natural selection on HFE may have contributed to elevated Fe absorption in Asians. This study regarding population differences in Fe homeostasis has significant medical impact as high Fe level has been linked to an increased disease risk of metabolic syndromes.

  8. Multi-ethnic minority nurses' knowledge and practice of genetics and genomics.

    Science.gov (United States)

    Coleman, Bernice; Calzone, Kathleen A; Jenkins, Jean; Paniagua, Carmen; Rivera, Reynaldo; Hong, Oi Saeng; Spruill, Ida; Bonham, Vence

    2014-07-01

    Exploratory studies establishing how well nurses have integrated genomics into practice have demonstrated there remains opportunity for education. However, little is known about educational gaps in multi-ethnic minority nurse populations. The purpose of this study was to determine minority nurses' beliefs, practices, and competency in integrating genetics-genomics information into practice using an online survey tool. A cross-sectional survey with registered nurses (RNs) from the participating National Coalition of Ethnic Minority Organizations (NCEMNA). Two phases were used: Phase one had a sample of 27 nurses who determined the feasibility of an online approach to survey completion and need for tool revision. Phase two was a main survey with 389 participants who completed the revised survey. The survey ascertained the genomic knowledge, beliefs, and practice of a sample of multi-ethnic minority nurses who were members of associations comprising the NCEMNA. The survey was administered online. Descriptive survey responses were analyzed using frequencies and percentages. Categorical responses in which comparisons were analyzed used chi square tests. About 40% of the respondents held a master's degree (39%) and 42% worked in direct patient care. The majority of respondents (79%) reported that education in genomics was important. Ninety-five percent agreed or strongly agreed that family health history could identify at-risk families, 85% reported knowing how to complete a second- and third-generation family history, and 63% felt family history was important to nursing. Conversely, 50% of the respondents felt that their understanding of the genetics of common disease was fair or poor, supported by 54% incorrectly reporting they thought heart disease and diabetes are caused by a single gene variant. Only 30% reported taking a genetics course since licensure, and 94% reported interest in learning more about genomics. Eighty-four percent believed that their ethnic

  9. Clinical Outcome among Nasopharyngeal Cancer Patients in a Multi-Ethnic Society in Singapore.

    Directory of Open Access Journals (Sweden)

    Han Wen Mak

    Full Text Available Nasopharyngeal cancer (NPC is endemic among Chinese populations in Southeast Asia. However, the outcomes of non-Chinese NPC patients in Singapore are not well reported.To determine if non-Chinese NPC patients have a different prognosis and examine the clinical outcomes of NPC patients in a multi-ethnic society.Retrospective chart review of 558 NPC patients treated at a single academic tertiary hospital from 2002 to 2012. Survival and recurrence rates were analysed and predictive factors identified using the Kaplan-Meier method and Cox regression model.Our cohort comprised 409 males (73.3% and 149 females (26.7% with a median age of 52 years. There were 476 Chinese (85.3%, 57 Malays (10.2%, and 25 of other ethnic groups (4.5%. Non-Chinese patients were more likely to be associated with advanced nodal disease at initial presentation (p = 0.049, compared with the Chinese. However, there were no statistical differences in their overall survival (OS or disease specific survival (DSS (p = 0.934 and p = 0.857 respectively. The 3-year and 5-year cohort OS and DSS rates were 79.3%, 70.7%, and 83.2%, 77.4% respectively. Advanced age (p<0.001, N2 disease (p = 0.036, N3 disease (p<0.001, and metastatic disease (p<0.001 at presentation were independently associated with poor overall survival. N2 disease (p = 0.032, N3 disease (p<0.001 and metastatic disease (p<0.001 were also independently associated with poor DSS. No predictive factors were associated with loco-regional recurrence after definitive treatment. Advanced age (p = 0.044, N2 disease (p = 0.033 and N3 disease (p<0.001 were independently associated with distant relapse.In a multi-ethnic society in Singapore, non-Chinese are more likely to present with advanced nodal disease. This however did not translate into poorer survival outcomes. Older patients with N2 or N3 disease are associated with a higher risk of distant relapse and poor overall survival.

  10. Early menopause predicts future coronary heart disease and stroke: the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Wellons, Melissa; Ouyang, Pamela; Schreiner, Pamela J; Herrington, David M; Vaidya, Dhananjay

    2012-10-01

    Cardiovascular disease is the number one killer of women. Identifying women at risk of cardiovascular disease has tremendous public health importance. Early menopause is associated with increased cardiovascular disease events in some predominantly white populations, but not consistently. Our objective was to determine if self-reported early menopause (menopause at an age menopause (either natural menopause or surgical removal of ovaries at an age menopause. In survival curves, women with early menopause had worse coronary heart disease and stroke-free survival (log rank P = 0.008 and P = 0.0158). In models adjusted for age, race/ethnicity, Multi-ethnic Study Atherosclerosis site, and traditional cardiovascular disease risk factors, this risk for coronary heart disease and stroke remained (hazard ratio, 2.08; 95% CI, 1.17-3.70; and hazard ratio, 2.19; 95% CI, 1.11-4.32, respectively). Early menopause is positively associated with coronary heart disease and stroke in a multiethnic cohort, independent of traditional cardiovascular disease risk factors.

  11. Age-dependent dose coefficients for tritium in Asian populations

    International Nuclear Information System (INIS)

    Trivedi, A.

    1999-10-01

    The International Commission on Radiological Protection (ICRP) Publications 56 (1989) and 67 (1993) have prescribed the biokinetic models and age-dependent dose coefficients for tritiated water and organically bound tritium. The dose coefficients are computed from values selected to specify the anatomical, morphological and physiological characteristics of a three-month-old, one-year-old, five-year-old, 10-year-old, 15-year-old and adult (Reference Man) Caucasian living in North America and Western Europe. However, values for Reference Man and other age groups are not directly applicable to Asians, because of differences in race, custom, dietary habits and climatic conditions. An Asian Man model, including five age groups, has been proposed by Tanaka and Kawamura (1996, 1998) for use in internal dosimetry. The basic concept of the ICRP Reference Man and the system describing body composition in ICRP Publication 23 (1975) were used. Reference values for Asians were given for the body weight and height, the mass of soft tissue, the mass of body water and the daily fluid balance, and are used to compute the dose coefficients for tritium. The age-dependent dose coefficients for Asians for tritiated water intakes are smaller by 20 to 30% of the currently prescribed values (Trivedi, 1998). The reduction in the dose coefficient values is caused by the increased daily fluid balance among Asians. The dose coefficient for tritiated water is 1.4 x 10 -11 Sv Bq -1 for Asian Man compared to 2.0 x 10 -11 Sv Bq -1 for Reference Man. The dose coefficients for organically bound tritium are only marginally different from those of the ICRP values. The dose coefficient for organically bound tritium for Asian Man is 4.0 x 10 -11 Sv Bq -11 compared to 4.6 x 10 -11 Sv Bq -1 for Reference Man. (author)

  12. Age-dependent dose coefficients for tritium in Asian populations

    Energy Technology Data Exchange (ETDEWEB)

    Trivedi, A

    1999-10-01

    The International Commission on Radiological Protection (ICRP) Publications 56 (1989) and 67 (1993) have prescribed the biokinetic models and age-dependent dose coefficients for tritiated water and organically bound tritium. The dose coefficients are computed from values selected to specify the anatomical, morphological and physiological characteristics of a three-month-old, one-year-old, five-year-old, 10-year-old, 15-year-old and adult (Reference Man) Caucasian living in North America and Western Europe. However, values for Reference Man and other age groups are not directly applicable to Asians, because of differences in race, custom, dietary habits and climatic conditions. An Asian Man model, including five age groups, has been proposed by Tanaka and Kawamura (1996, 1998) for use in internal dosimetry. The basic concept of the ICRP Reference Man and the system describing body composition in ICRP Publication 23 (1975) were used. Reference values for Asians were given for the body weight and height, the mass of soft tissue, the mass of body water and the daily fluid balance, and are used to compute the dose coefficients for tritium. The age-dependent dose coefficients for Asians for tritiated water intakes are smaller by 20 to 30% of the currently prescribed values (Trivedi, 1998). The reduction in the dose coefficient values is caused by the increased daily fluid balance among Asians. The dose coefficient for tritiated water is 1.4 x 10{sup -11} Sv Bq{sup -1} for Asian Man compared to 2.0 x 10{sup -11} Sv Bq{sup -1} for Reference Man. The dose coefficients for organically bound tritium are only marginally different from those of the ICRP values. The dose coefficient for organically bound tritium for Asian Man is 4.0 x 10{sup -11} Sv Bq{sup -11} compared to 4.6 x 10{sup -11} Sv Bq{sup -1} for Reference Man. (author)

  13. Relationships between indices of obesity and its co-morbidities in multi-ethnic Singapore

    NARCIS (Netherlands)

    Deurenberg-Yap, M.; Chew, S.K.; Lin, V.F.; Tan, B.Y.; Staveren, van W.A.; Deurenberg, P.

    2001-01-01

    Paper Relationships between indices of obesity and its co-morbidities in multi-ethnic Singapore M Deurenberg-Yap1, S K Chew2, V F P Lin1, B Y Tan2, W A van Staveren3 and P Deurenberg3,4 1Research and Information Management, Health Promotion Board, Singapore 2Department of Epidemiology and Disease

  14. Profile: Asian Americans

    Science.gov (United States)

    ... and Data > Minority Population Profiles > Asian American Profile: Asian Americans Asian American Profile (Map of the US with the top 10 states displaying the largest Asian American population according to the Census Bureau) CA - ...

  15. Are immigrant enclaves healthy places to live? The Multi-ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Osypuk, Theresa L; Diez Roux, Ana V; Hadley, Craig; Kandula, Namratha R

    2009-07-01

    The growing size and changing composition of the foreign-born population in the USA highlights the importance of examining the health consequences of living in neighborhoods with higher proportions of immigrants. Using data from the Multi-ethnic Study of Atherosclerosis in four US cities, we examined whether neighborhood immigrant composition was associated with health behaviors (diet, physical activity) among Hispanic and Chinese Americans (n=1902). Secondarily we tested whether neighborhoods with high proportions of immigrants exhibited better or worse neighborhood quality, and whether these dimensions of neighborhood quality were associated with healthy behaviors. Neighborhood immigrant composition was defined based on the Census 2000 tract percent of foreign-born from Latin-America, and separately, percent foreign-born from China. After adjustment for age, gender, income, education, neighborhood poverty, and acculturation, living in a tract with a higher proportion of immigrants was associated with lower consumption of high-fat foods among Hispanics and Chinese, but with being less physically active among Hispanics. Residents in neighborhoods with higher proportions of immigrants reported better healthy food availability, but also worse walkability, fewer recreational exercise resources, worse safety, lower social cohesion, and lower neighborhood-based civic engagement. Associations of neighborhood immigrant composition with diet persisted after adjustment for reported neighborhood characteristics, and associations with physical activity were attenuated. Respondent-reported neighborhood healthy food availability, walkability, availability of exercise facilities and civic participation remained associated with behaviors after adjusting for immigrant composition and other covariates. Results show that living in an immigrant enclave is not monolithically beneficial and may have different associations with different health behaviors.

  16. Ethnic identity and socio-linguistic: Multi-ethnic conflicts in Kazakhstan

    Directory of Open Access Journals (Sweden)

    Antonio Manuel Lozano Martín

    2015-12-01

    Full Text Available Kazakhstan Republic is the ninth biggest country in territorial extension and it is also an important communication link between Eastern and Western countries because of its situation. The strong migration, both natural and forced movements since the 19th century, has influenced this country, has set it today as a melting pot of cultures and ethnic groups, having to live up to a total of 130 different ethnic groups. This circumstance has favored, from the Government of Kazakhstan, social policies, such as the creation of the «Assembly of peoples» where all ethnicities are represented, in order to try to establish a peaceful coexistence between different cultures which allows them to move from a multi-ethnic society to an inter-ethnic society. In this context is where the research is registered, the one which was commissioned by the Ministry of Culture of the Government of Kazakhstan to the Institute for Socio-Political Research, and to the authors of this article which have participated in this. The objective of this study was to detect those situations which we could call «significant multicultural situations» (Giménez 1997 in the daily reality of the population and which could be at the origin of the multicultural conflicts. In short, those conflict situations where the distinctive cultural component is the central axis in which the social agents, involved in the problem, take part. The results of this research are those which are intended to present to understand multicultural reality and can help social policies that are designed to be able to take the step towards «interculturality» of Kazakh society and obtain a peaceful coexistence based on respect for each other.

  17. Estimating Pesticide Exposure from Dietary Intake and Organic Food Choices: The Multi-Ethnic Study of Atherosclerosis (MESA)

    Science.gov (United States)

    Beresford, Shirley A.A.; Fenske, Richard A.; Fitzpatrick, Annette L.; Lu, Chensheng; Nettleton, Jennifer A.; Kaufman, Joel D.

    2015-01-01

    Background Organophosphate pesticide (OP) exposure to the U.S. population is dominated by dietary intake. The magnitude of exposure from diet depends partly on personal decisions such as which foods to eat and whether to choose organic food. Most studies of OP exposure rely on urinary biomarkers, which are limited by short half-lives and often lack specificity to parent compounds. A reliable means of estimating long-term dietary exposure to individual OPs is needed to assess the potential relationship with adverse health effects. Objectives We assessed long-term dietary exposure to 14 OPs among 4,466 participants in the Multi-Ethnic Study of Atherosclerosis, and examined the influence of organic produce consumption on this exposure. Methods Individual-level exposure was estimated by combining information on typical intake of specific food items with average OP residue levels on those items. In an analysis restricted to a subset of participants who reported rarely or never eating organic produce (“conventional consumers”), we assessed urinary dialkylphosphate (DAP) levels across tertiles of estimated exposure (n = 480). In a second analysis, we compared DAP levels across subgroups with differing self-reported organic produce consumption habits (n = 240). Results Among conventional consumers, increasing tertile of estimated dietary OP exposure was associated with higher DAP concentrations (p Fenske RA, Fitzpatrick AL, Lu C, Nettleton JA, Kaufman JD. 2015. Estimating pesticide exposure from dietary intake and organic food choices: the Multi-Ethnic Study of Atherosclerosis (MESA). Environ Health Perspect 123:475–483; http://dx.doi.org/10.1289/ehp.1408197 PMID:25650532

  18. RECORD-4 multicenter phase 2 trial of second-line everolimus in patients with metastatic renal cell carcinoma: Asian versus non-Asian population subanalysis.

    Science.gov (United States)

    Yang, Lin; Alyasova, Anna; Ye, Dingwei; Ridolfi, Antonia; Dezzani, Luca; Motzer, Robert J

    2018-02-17

    RECORD-4 assessed everolimus in patients with metastatic renal cell carcinoma (mRCC) who progressed after 1 prior anti-vascular endothelial growth factor (VEGF) or cytokine and reinforced the clinical benefit of second-line everolimus. Because of the high percentage of patients from China enrolled in RECORD-4 (41%) and some reported differences in responses to certain targeted agents between Chinese and Western patients, this subanalysis evaluated outcomes in Asian versus non-Asian patients. RECORD-4 enrolled patients with clear cell mRCC into 3 cohorts based on prior first-line therapy: sunitinib, other anti-VEGF (sorafenib, bevacizumab, pazopanib, other), or cytokines. Patients received everolimus 10 mg/d until progression of disease (RECIST, v1.0) or intolerance. Primary end point was progression-free survival per investigator review. Data cutoff was Sept 1, 2014. Among Asian (n = 55) versus non-Asian (n = 79) patients, 98% versus 84% had good/intermediate MSKCC prognosis; 73% versus 65% were men, and 85% versus 73% were < 65 years of age. All (100%) Asian patients were of Chinese ethnicity. Median duration of exposure was 5.5 mo for Asian and 6.0 mo for non-Asian patients. Among Asian versus non-Asian patients, median progression-free survival (months) was 7.4 versus 7.8 overall, 7.4 versus 4.0 with prior sunitinib, and 5.7 versus 9.2 with prior other anti-VEGFs. Clinical benefit rate was similar between populations: 74.5% (95% CI 61.0-85.3) for Asian patients and 74.7% (95% CI 63.6-83.8) for non-Asian patients. Most patients achieved stable disease as best overall response (Asian, 63.6%; non-Asian, 69.6%). Overall rate of grade 3/4 adverse events appeared similar for Asian (58%) and non-Asian patients (54%). This RECORD-4 subanalysis demonstrated comparable efficacy and adverse event profiles of second-line everolimus in Asian and non-Asian patients. Efficacy and safety outcomes by prior therapy should be interpreted with caution because of small

  19. Impact of classical risk factors of type 2 diabetes among Asian Indian, Chinese and Japanese populations.

    Science.gov (United States)

    He, L; Tuomilehto, J; Qiao, Q; Söderberg, S; Daimon, M; Chambers, J; Pitkäniemi, J

    2015-11-01

    This review investigated the population impact of major modifiable type 2 diabetes (T2D) risk factors, with special focus on native Asian Indians, to estimate population attributable risks (PARs) and compare them with estimates from Chinese and Japanese populations. Information was obtained on risk factors in 21,041 Asian Indian, 17,774 Chinese and 17,986 Japanese populations from multiple, large, cross-sectional studies (the DECODA project) of T2D. Crude and adjusted PARs were estimated for the major T2D risk factors. Age had the highest crude and adjusted PARs among Asian Indians and Chinese in contrast to waist-hip ratio among Japanese. After adjusting for age, the PAR for body mass index (BMI) in Asian Indians (41.4% [95% CI: 37.2%; 45.4%]) was second only to triglycerides (46.4% [95% CI: 39.5%; 52.8%]) compared with 35.8% [95% CI: 29.9%; 41.4%] in Japanese and 38.4% [95% CI: 33.5%; 43.2%] in Chinese people. The PAR for BMI adjusted for age, LDL and triglycerides (39.7% [95% CI: 31.6%; 47.2%]) was higher than for any other factor in Asian Indians, and was much higher than in the Chinese (16.8% [95% CI: 3.0%; 30.9%]) and Japanese (30.4% [95% CI: 17.5%; 42.2%]) populations. This review provides estimates of the association between major risk factors and prevalences of T2D among Asian populations by examining their PARs from large population-based samples. From a public-health point of view, the importance of BMI in Asian Indians is especially highlighted in comparison to the other Asian populations. Given these results and other recent findings on the causality link between BMI and T2D, it can be postulated that obesity may be involved in the aetiology of T2D through interaction with ethnic-specific genetic factors, although ethnicity itself is not a direct risk factor for T2D as people of all ethnic backgrounds develop diabetes. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Measuring culture: a critical review of acculturation and health in Asian immigrant populations.

    Science.gov (United States)

    Salant, Talya; Lauderdale, Diane S

    2003-07-01

    The number of studies examining how acculturation affects the health of Asian immigrants has increased in recent years. The proliferation of studies reflects the growing size and heterogeneity of Asian immigrant populations in the United States, Canada, Australia, New Zealand, and the United Kingdom. This paper compares various approaches to acculturation within the health literature on Asian immigrants by reviewing the literature in three-health domains (1) mental health (2) physical health and (3) health services use. The review critically examines the conceptualizations and measures of acculturation in these three domains and presents major findings. We observe that measurement difficulties posed by the experiences of heterogeneous Asian groups compound theoretical and disciplinary disparities between acculturation instruments. The extent to which conceptual and methodological critiques of acculturation studies in Hispanic populations apply to studies of Asian populations is also discussed. The critical review thus provides insights into the diverse ways that the relationship between culture and health is measured in this complicated and growing literature.

  1. Population health status of South Asian and African-Caribbean communities in the United Kingdom

    OpenAIRE

    Calvert, Melanie; Duffy, Helen; Freemantle, Nick; Davis, Russell; Lip, Gregory YH; Gill, Paramjit

    2012-01-01

    Abstract Background Population health status scores are routinely used to inform economic evaluation and evaluate the impact of disease and/or treatment on health. It is unclear whether the health status in black and minority ethnic groups are comparable to these population health status data. The aim of this study was to evaluate health-status in South Asian and African-Caribbean populations. Methods Cross-sectional study recruiting participants aged ≥ 45 years (September 2006 to July 2009) ...

  2. Population education in the school curriculum: a comparative analysis of the American and Asian models.

    Science.gov (United States)

    Okobiah, O S

    1981-02-01

    The content, strategies, and objectives of population education curriculum materials developed for use in school systems in a developed country (US) and in a developing country (Thailand) were compared. It was assumed that the objectives and strategies of population education developed in a specific country would reflect the way in which population matters were viewed by that country's policy makers and planners. In developed countries, population education is primarily an outgrowth of environmental concerns. In less developed countries population education is pursued mainly because of concerns about rapid population growth. The specific curriculum materials which were analyzed were the Population, Environmental-Ecological Education Project developed by the Missouri State Department of Education and the Population and Family Education Project developed in Bangkok. A conceptual framework for analyzing the content of the materials was developed. The framework included 5 major parameters. These parameters were 1) a description of the human population, 2) basic population concepts and processes, 3) population dynamics, 4) the causes and consequences of population change, and 5) population issues. Content analysis of the materials revealed that the content focus was similar for both of the curriculum materials. 74% of the Asian curricula and 73% of the US curricula focused on population issues and on the causes and consequences of population growth; however, the US materials emphasized environmental consequences and policies while the Asian materials emphasized family planning policies and the effects of population growth on family, community, sociocultural, and personal factors. Marked differences were revealed when the instructional strategies and course objectives of the materials were judged in reference to established educational standards of objectivity. All of the sampled instructional strategies in the US materials were judged as suitable for use in the formal

  3. The relationship between ethnicity and obesity in Asian and Pacific Islander populations: a literature review.

    Science.gov (United States)

    Davis, James; Busch, Jessica; Hammatt, Zoë; Novotny, Rachel; Harrigan, Rosanne; Grandinetti, Andrew; Easa, David

    2004-01-01

    The purpose of this literature review is to explore the potential relationship between ethnicity and obesity, and obesity-related risks, with a particular emphasis on disparities between Asian and Pacific Islander populations. We conducted a comprehensive search of available medical literature related to the rise of obesity in the United States, factors contributing to obesity, evidence-based clinical guidelines, and obesity and related risks as they occur in Hawaii. In conducting this search, we sought to illuminate obesity rates in Asians and Pacific Islanders in connection with various factors, such as diet and lifestyle, acculturation, and body image, as they occur in diverse cultural contexts. We found that the rates of obesity and related risks were highest in Native Hawaiians and Samoans. Based upon our review of the literature, we conclude that further research is necessary to address the relationship between ethnicity and obesity risk factors in Asian and Pacific Islander populations.

  4. A panel of 130 autosomal single-nucleotide polymorphisms for ancestry assignment in five Asian populations and in Caucasians.

    Science.gov (United States)

    Hwa, Hsiao-Lin; Lin, Chih-Peng; Huang, Tsun-Ying; Kuo, Po-Hsiu; Hsieh, Wei-Hsin; Lin, Chun-Yen; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

    2017-06-01

    Ancestry informative single-nucleotide polymorphism (AISNP) panels for differentiating between East and Southeast Asian populations are scarce. This study aimed to identify AISNPs for ancestry assignment of five East and Southeast Asian populations, and Caucasians. We analyzed 145 autosomal SNPs of the 627 DNA samples from individuals of six populations (234 Taiwanese Han, 91 Filipinos, 79 Indonesians, 60 Thais, 71 Vietnamese, and 92 Caucasians) using arrays. The multiple logistic regression model and a multi-tier approach were used for ancestry classification. We observed that 130 AISNPs were effective for classifying the ethnic origins with fair accuracy. Among the 130 AISNPs, 122 were useful for stratification between these five Asian populations and 64 were effective for differentiating between Caucasians and these Asian populations. For differentiation between Caucasians and Asians, an accuracy rate of 100% was achieved in these 627 subjects with 50 optimal AISNPs among the 64 effective SNPs. For classification of the five Asian populations, the accuracy rates of ancestry inference using 20 to 57 SNPs for each of the two Asian populations ranged from 74.1% to 100%. Another 14 degraded DNA samples with incomplete profiling were analyzed, and the ancestry of 12 (85.7%) of those subjects was accurately assigned. We developed a 130-AISNP panel for ethnic origin differentiation between the five East and Southeast Asian populations and Caucasians. This AISNP set may be helpful for individual ancestral assignment of these populations in forensic casework.

  5. Asian elephants in China: estimating population size and evaluating habitat suitability.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available We monitored the last remaining Asian elephant populations in China over the past decade. Using DNA tools and repeat genotyping, we estimated the population sizes from 654 dung samples collected from various areas. Combined with morphological individual identifications from over 6,300 elephant photographs taken in the wild, we estimated that the total Asian elephant population size in China is between 221 and 245. Population genetic structure and diversity were examined using a 556-bp fragment of mitochondrial DNA, and 24 unique haplotypes were detected from DNA analysis of 178 individuals. A phylogenetic analysis revealed two highly divergent clades of Asian elephants, α and β, present in Chinese populations. Four populations (Mengla, Shangyong, Mengyang, and Pu'Er carried mtDNA from the α clade, and only one population (Nangunhe carried mtDNA belonging to the β clade. Moreover, high genetic divergence was observed between the Nangunhe population and the other four populations; however, genetic diversity among the five populations was low, possibly due to limited gene flow because of habitat fragmentation. The expansion of rubber plantations, crop cultivation, and villages along rivers and roads had caused extensive degradation of natural forest in these areas. This had resulted in the loss and fragmentation of elephant habitats and had formed artificial barriers that inhibited elephant migration. Using Geographic Information System, Global Positioning System, and Remote Sensing technology, we found that the area occupied by rubber plantations, tea farms, and urban settlements had dramatically increased over the past 40 years, resulting in the loss and fragmentation of elephant habitats and forming artificial barriers that inhibit elephant migration. The restoration of ecological corridors to facilitate gene exchange among isolated elephant populations and the establishment of cross-boundary protected areas between China and Laos to secure

  6. Workplace Discrimination and Depressive Symptoms: A Study of Multi-Ethnic Hospital Employees

    OpenAIRE

    Hammond, Wizdom Powell; Gillen, Marion; Yen, Irene H.

    2010-01-01

    Workplace discrimination reports have recently increased in the U.S. Few studies have examined racial/ethnic differences and the mental health consequences of this exposure. We examined the association between self-reported workplace discrimination and depressive symptoms among a multi-ethnic sample of hospital employees. Data came from the prospective case–control Gradients of Occupational Health in Hospital Workers (GROW) study (N = 664). We used the Center for Epidemiological Studies Depre...

  7. Dysmenorrhea in a multiethnic population of adolescent Asian girls.

    Science.gov (United States)

    Wong, Li Ping; Khoo, Ee Ming

    2010-02-01

    To determine the prevalence of dysmenorrhea, its impact, and the treatment-seeking behavior of adolescent Asian girls. A cross-sectional study with 1092 girls from 15 public secondary schools and 3 ethnic groups in the Federal Territory of Kuala Lumpur, Malaysia. Overall, 74.5% of the girls who had reached menarche had dysmenorrhea; 51.7% of these girls reported that it affected their concentration in class; 50.2% that it restricted their social activities; 21.5% that it caused them to miss school; and 12.0% that it caused poor school performance. Ethnicity and form at school were significantly associated with the poor concentration, absenteeism, and restriction of social and recreational activities attributed to dysmenorrhea. Only 12.0% had consulted a physician, and 53.3% did nothing about their conditions. There were ethnic differences in the prevalence, impact, and management of dysmenorrhea. There is a need for culture-specific education regarding menstruation-related conditions in the school curriculum. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  8. Betel Nut Composition and Diabetes Mellitus in U.K. Asian Populations

    International Nuclear Information System (INIS)

    Spyrou, N.M.; Ridge, C.; Boucher, B.J.

    1999-01-01

    We have instigated a pilot study to investigate the trace element status of selected type 2 Diabetes Mellitus (DM) populations of Caucasians and South Asians living in southeast England and matched controls. As part of this program, betel nut-based chewing substances, some with and others without tobacco leaves incorporated, have been analyzed using instrumental neutron activation analysis

  9. Asian longhorned beetle, over the river and through the woods: habitat-dependent population spread

    Science.gov (United States)

    Alan J. Sawyer; William S. Panagakos; Audra E. Horner; Kevin J. Freeman

    2011-01-01

    The Asian longhorned beetle (ALB), Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae), is an introduced pest of hardwood trees in North America. This paper addresses population spread in open landscapes and wooded areas, with emphasis on recent findings from Staten Island, NY, and Worcester, MA.

  10. Evaluation of European Schizophrenia GWAS Loci in Asian Populations via Comprehensive Meta-Analyses.

    Science.gov (United States)

    Xiao, Xiao; Luo, Xiong-Jian; Chang, Hong; Liu, Zichao; Li, Ming

    2017-08-01

    Schizophrenia is a severe and highly heritable neuropsychiatric disorder. Recent genetic analyses including genome-wide association studies (GWAS) have implicated multiple genome-wide significant variants for schizophrenia among European populations. However, many of these risk variants were not largely validated in other populations of different ancestry such as Asians. To validate whether these European GWAS significant loci are associated with schizophrenia in Asian populations, we conducted a systematic literature search and meta-analyses on 19 single nucleotide polymorphisms (SNPs) in Asian populations by combining all available case-control and family-based samples, including up to 30,000 individuals. We employed classical fixed (or random) effects inverse variance weighted methods to calculate summary odds ratios (ORs) and 95 % confidence intervals (CIs). Among the 19 GWAS loci, we replicated the risk associations of nine markers (e.g., SNPs at VRK2, ITIH3/4, NDST3, NOTCH4) surpassing significance level (two-tailed P Asian replication samples and initial European GWAS findings, and the successful replications of these GWAS loci in a different ethnic group provide stronger evidence for their clinical associations with schizophrenia. Further studies, focusing on the molecular mechanisms of these GWAS significant loci, will become increasingly important for understanding of the pathogenesis to schizophrenia.

  11. Incidence of 'Candidatus Liberibacter asiaticus' in a Florida population of Asian citrus psyllid

    Science.gov (United States)

    A study was conducted to assess the incidence of a bacterium ‘Candidatus Liberibacter asiaticus’ in a Florida population of Asian citrus psyllid (ACP), Diaphorina citri. The bacterium is the presumed causal agent of Asiatic huanglongbing, a serious citrus disease also known as citrus greening or yel...

  12. Validity and reliability of the semi-quantitative self-report Home Food Availability Inventory Checklist (HFAI-C) in White and South Asian populations.

    Science.gov (United States)

    Bryant, Maria; LeCroy, Madison; Sahota, Pinki; Cai, Jianwen; Stevens, June

    2016-05-04

    Despite interest in the importance of the home food environment and its potential influence on children's diets and social norms, there remain few self-report checklist methods that have been validated against the gold standard of researcher-conducted inventories. This study aimed to assess the criterion validity and reliability of the 'Home Food Availability Inventory Checklist' (HFAI-C), a 39-item checklist including categories of fruit, vegetables, snacks and drinks. The HFAI-C was completed by 97 participants of White and Pakistani origin in the UK. Validity was determined by comparing participant-reported HFAI-C responses to data from researcher observations of home food availability using PABAK and weighted kappa statistics. The validity of measuring the amount of items (in addition to presence/absence) available was also determined. Test-retest reliability compared repeated administrations of the HFAI-C using intra-class correlation coefficients. Validity and reliability was fair to moderate overall. For validity, the average category-level PABAK ranged from 0.31 (95% CI: 0.25, 0.37) for vegetables to 0.44 (95% CI: 0.40, 0.49) for fruits. Assessment of the presence/absence of items demonstrated higher validity compared to quantity measurements. Reliability was increased when the HFAI-C was repeated close to the time of the first administration. For example, ICCs for reliability of the measurement of fruits were 0.52 (95%CI: 0.47, 0.56) if re-administered within 5 months, 0.58 (95% CI: 0.51, 0.64) within 30 days and 0.97 (95%CI: 0.94, 1.00) if re-administered on the same day. Overall, the HFAI-C demonstrated fair to moderate validity and reliability in a population of White and South Asian participants. This evaluation is consistent with previous work on other checklists in less diverse, more affluent populations. Our research supports the use of the HFAI-C as a useful, albeit imperfect, representation of researcher-conducted inventories. The feasibility of

  13. Diurnal Salivary Cortisol, Glycemia and Insulin Resistance: The Multi-Ethnic Study of Atherosclerosis

    Science.gov (United States)

    Joseph, Joshua J.; Wang, Xu; Spanakis, Elias; Seeman, Teresa; Wand, Gary; Needham, Belinda; Golden, Sherita Hill

    2015-01-01

    Summary Hypercortisolism is associated with insulin resistance (IR) and diabetes mellitus (DM); however, to our knowledge prior studies have not examined the association of diurnal cortisol curve features with measures of glycemia or IR in a population-based setting. Using log-transformed salivary cortisol data on 850 ethnically diverse men and women from the Multi-Ethnic Study of Atherosclerosis, we investigated the cross-sectional association of cortisol curve features with (1) glycemia in those with and without DM and (2) IR, in non-diabetic subjects. The log-transformed salivary cortisol curve features included wake-up cortisol, cortisol awakening response (CAR), early decline slope (30 minutes to 2 hours post-awakening), late decline slope (2 hours post-awakening to bedtime), overall decline slope (0 minutes to bedtime, excluding 30 minute cortisol), bedtime cortisol and total area under the curve (AUC). Overall, following multivariable adjustment, among those with diabetes mellitus (DM), early decline slope, overall decline slope, bedtime cortisol, and AUC were significantly and positively associated with a 5.4% (95% CI: 1.3, 9.7), 54.7% (95% CI: 12.4, 112.9), 4.0% (95% CI: 1.6, 6.4), and 6.8% (95% CI: 3.3, 10.4) higher HbA1c per 1 unit increase in log cortisol feature, respectively. Cortisol curve features were not associated with HbA1c among non-diabetic participants; however, wake-up cortisol and AUC were associated with a 8.2% lower (95% CI: −13.3, −2.7) and 7.9% lower (95% CI: −14.6, −0.6) log HOMA-IR, respectively. This was attenuated by adjustment for waist circumference. Among participants with DM, cortisol curve parameters suggestive of higher hypothalamic-pituitary-adrenal (HPA) axis activity and dysfunction were associated with higher HbA1c. In non-diabetic participants, greater HPA activity was paradoxically associated with lower insulin resistance. PMID:26356041

  14. Issues regarding the delivery of early intervention psychiatric services to the South Asian population in England.

    Science.gov (United States)

    Agius, Mark; Talwar, A; Murphy, S; Zaman, Rashid

    2010-06-01

    Little research has been done to ascertain how patients and families of South Asian origin access and use early intervention mental health services today. The aim of this retrospective study is to gain a better understanding of how well South Asian patients engage with standard psycho-social interventions. In June 2003 an audit was conducted amongst 75 patients from different ethnic groups in Luton. Measures of engagement with mental health services included; number of missed outpatient appointments over one year and compliance with medication regimes. The results of this audit showed that South Asian patients are more likely to miss appointments and refuse to take medication in comparison to their Caucasian or Afro- Caribbean counter-parts. Further analysis revealed that the Bangladeshi subgroup had missed more appointments and had a greater proportion of medication refusal in comparison to the other Asian subgroups. These results support the pioneering work by Dr Robin Pinto in the 1970s he observed that Asian patients perceive and utilise mental health services in a different way compared to the Caucasian population. The observations from our study depict the difficulties in engaging ethnic minority patients into existing services. Hence we argue that future interventions should be adapted and tailored to overcome cultural and language barriers with patients and their families.

  15. Latinos Need to Stay in Their Place: Differential Segregation in a Multi-Ethnic Suburb

    Directory of Open Access Journals (Sweden)

    Celia Lacayo

    2016-08-01

    Full Text Available While Latinos face high levels of segregation, there is scant research specifically addressing whites’ attitudes towards Latinos regarding their preferences. This study draws from 40 in-depth interviews with whites in Orange County California, an area with a large Latino and Asian population. I demonstrate that white respondents choose to segregate themselves from Latinos. Most studies have used Blumer’s group position theory to explain white attitudes and neighborhood preference towards Blacks. My findings supports Blumer’s group position theory by revealing why white respondents feel threatened by an increase in the Latino population. Yet, the Asian population has also grown, but white respondents convey positive sentiments towards Asians, and express they feel comfortable living and interacting with them. I argue that white respondents’ preferences with regards to integration are not solely based on the size of a group, but rather whether they characterize the group as inferior. Integration has been touted as an American principle. Yet, as the country becomes more diverse, this case study illustrates that white respondents prefer to share space with those they feel similar to, and consequently contribute to Latino segregation.

  16. Three-dimensional analysis of facial morphology in Brazilian population with Caucasian, Asian, and Black ethnicity

    Directory of Open Access Journals (Sweden)

    Ana Maria Bettoni Rodrigues da Silva

    2017-01-01

    Full Text Available Aim: To compare facial features related to the nose, lips and face between the Caucasian, Asian, and Black ethnicity in the Brazilian population by means of linear measurements and proportion indices obtained from the analysis of three-dimensional (3D images taken by 3D stereophotogrammetry. Materials and Methods: Thirty healthy subjects, being 10 Caucasians, 10 Blacks and 10 Asians had reference points (landmarks demarcated on their faces, 3D images were obtained (Vectra M3 and the following measurements were calculated: Facial proportion indices relative to the nose, lips and face. The statistical analysis was performed comparing the ethnic groups (one-way analysis of variance. Results: The Blacks and Asians showed the greatest difference in the face analysis (width, height of the lower face, upper face index and lower face index – P < 0.05. In the comparisons between groups, differences were verified to the mouth width and lower lip vermilion height. In the nose analysis, the biggest differences were obtained for the proportion indices, being that Caucasians versus Asians and Caucasians versus Blacks have showed the largest differences. Conclusion: This study found the presence of some similarities in the proportion indices of nose, lips and face between the ethnic groups of the Brazilian population, as well as some important differences that should be known to guide surgical and forensics procedures, among others.

  17. Distinct genetic alteration profiles of acute myeloid leukemia between Caucasian and Eastern Asian population.

    Science.gov (United States)

    Wei, Hui; Wang, Ying; Zhou, Chunlin; Lin, Dong; Liu, Bingcheng; Liu, Kaiqi; Qiu, Shaowei; Gong, Benfa; Li, Yan; Zhang, Guangji; Wei, Shuning; Gong, Xiaoyuan; Liu, Yuntao; Zhao, Xingli; Gu, Runxia; Mi, Yingchang; Wang, Jianxiang

    2018-02-10

    Racial and ethnic disparities in malignancies attract extensive attention. To investigate whether there are racial and ethnic disparities in genetic alteration between Caucasian and Eastern Asian population, data from several prospective AML trials were retrospectively analyzed in this study. We found that there were more patients with core binding factor (CBF) leukemia in Eastern Asian cohorts and there were different CBF leukemia constitutions between them. The ratios of CBF leukemia are 27.7, 22.1, 21.1, and 23.4%, respectively, in our (ChiCTR-TRC-10001202), another Chinese, Korean, and Japanese Eastern Asian cohorts, which are significantly higher than those in ECOG1900, MRC AML15, UK NCRI AML17, HOVON/SAKK AML-42, and German AML2003 (15.5, 12.5, 9.3, 10.2, and 12%, respectively). And CBFbeta-MYH11 occurred more prevalently in HOVON/SAKK AML- 42 and ECOG1900 trials (50.0 and 54.3% of CBF leukemia, respectively) than in Chinese and Japanese trials (20.1 and 20.8%, respectively). The proportion of FLT3-ITD mutation is 11.2% in our cohort, which is lower than that in MRC AML15 and UK NCRI AML17 (24.6 and 17.9%, respectively). Even after excluding the age bias, there are still different incidence rates of mutation between Caucasian and Eastern Asian population. These data suggest that there are racial and ethnic disparities in genetic alteration between Caucasian and Eastern Asian population.

  18. Population health status of South Asian and African-Caribbean communities in the United Kingdom.

    Science.gov (United States)

    Calvert, Melanie; Duffy, Helen; Freemantle, Nick; Davis, Russell; Lip, Gregory Y H; Gill, Paramjit

    2012-04-25

    Population health status scores are routinely used to inform economic evaluation and evaluate the impact of disease and/or treatment on health. It is unclear whether the health status in black and minority ethnic groups are comparable to these population health status data. The aim of this study was to evaluate health-status in South Asian and African-Caribbean populations. Cross-sectional study recruiting participants aged ≥ 45 years (September 2006 to July 2009) from 20 primary care centres in Birmingham, United Kingdom.10,902 eligible subjects were invited, 5,408 participated (49.6%). 5,354 participants had complete data (49.1%) (3442 South Asian and 1912 African-Caribbean). Health status was assessed by interview using the EuroQoL EQ-5D. The mean EQ-5D score in South Asian participants was 0.91 (standard deviation (SD) 0.18), median score 1 (interquartile range (IQR) 0.848 to 1) and in African-Caribbean participants the mean score was 0.92 (SD 0.18), median 1 (IQR 1 to 1). Compared with normative data from the UK general population, substantially fewer African-Caribbean and South Asian participants reported problems with mobility, usual activities, pain and anxiety when stratified by age resulting in higher average health status estimates than those from the UK population. Multivariable modelling showed that decreased health-related quality of life (HRQL) was associated with increased age, female gender and increased body mass index. A medical history of depression, stroke/transient ischemic attack, heart failure and arthritis were associated with substantial reductions in HRQL. The reported HRQL of these minority ethnic groups was substantially higher than anticipated compared to UK normative data. Participants with chronic disease experienced significant reductions in HRQL and should be a target for health intervention.

  19. Population health status of South Asian and African-Caribbean communities in the United Kingdom

    Directory of Open Access Journals (Sweden)

    Calvert Melanie

    2012-04-01

    Full Text Available Abstract Background Population health status scores are routinely used to inform economic evaluation and evaluate the impact of disease and/or treatment on health. It is unclear whether the health status in black and minority ethnic groups are comparable to these population health status data. The aim of this study was to evaluate health-status in South Asian and African-Caribbean populations. Methods Cross-sectional study recruiting participants aged ≥ 45 years (September 2006 to July 2009 from 20 primary care centres in Birmingham, United Kingdom.10,902 eligible subjects were invited, 5,408 participated (49.6%. 5,354 participants had complete data (49.1% (3442 South Asian and 1912 African-Caribbean. Health status was assessed by interview using the EuroQoL EQ-5D. Results The mean EQ-5D score in South Asian participants was 0.91 (standard deviation (SD 0.18, median score 1 (interquartile range (IQR 0.848 to 1 and in African-Caribbean participants the mean score was 0.92 (SD 0.18, median 1 (IQR 1 to 1. Compared with normative data from the UK general population, substantially fewer African-Caribbean and South Asian participants reported problems with mobility, usual activities, pain and anxiety when stratified by age resulting in higher average health status estimates than those from the UK population. Multivariable modelling showed that decreased health-related quality of life (HRQL was associated with increased age, female gender and increased body mass index. A medical history of depression, stroke/transient ischemic attack, heart failure and arthritis were associated with substantial reductions in HRQL. Conclusions The reported HRQL of these minority ethnic groups was substantially higher than anticipated compared to UK normative data. Participants with chronic disease experienced significant reductions in HRQL and should be a target for health intervention.

  20. Genetic Diversity Analysis of South and East Asian Duck Populations Using Highly Polymorphic Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Dongwon Seo

    2016-04-01

    Full Text Available Native duck populations have lower productivity, and have not been developed as much as commercials duck breeds. However, native ducks have more importance in terms of genetic diversity and potentially valuable economic traits. For this reason, population discriminable genetic markers are needed for conservation and development of native ducks. In this study, 24 highly polymorphic microsatellite (MS markers were investigated using commercial ducks and native East and South Asian ducks. The average polymorphic information content (PIC value for all MS markers was 0.584, indicating high discrimination power. All populations were discriminated using 14 highly polymorphic MS markers by genetic distance and phylogenetic analysis. The results indicated that there were close genetic relationships among populations. In the structure analysis, East Asian ducks shared more haplotypes with commercial ducks than South Asian ducks, and they had more independent haplotypes than others did. These results will provide useful information for genetic diversity studies in ducks and for the development of duck traceability systems in the market.

  1. Predictors and Barriers to Hepatitis B Screening in a Midwest Suburban Asian Population.

    Science.gov (United States)

    Cheng, Shanna; Li, Elton; Lok, Anna S

    2017-06-01

    Despite guidelines recommending hepatitis B virus (HBV) screening among the Asian population, not all Asians are screened. We assessed barriers to and factors predicting HBV screening in Michigan. Adults residing in Southeast Michigan self-identifying as Asian were surveyed at Asian grocery stores, restaurants, churches, and community events. 404 persons participated in the survey, 54 % were women, median age was 51 years, 63 % were Chinese, and 93.8 % were born outside the U.S. 181 (44.8 %) had not or could not recall having been screened for HBV. Of these, 89 % said their primary care physicians (PCP) had never brought up screening. Unscreened participants were more likely to think HBV is genetically inherited and cannot be treated than those who had been screened. They were also more likely to think they should avoid close contact with others, would bring shame to their families, and lose their job, if found to be infected with HBV. Among 223 (55.2 %) who had been screened, 48 % said their PCP had the greatest influence in their decision to be screened and 70.9 % said they were screened at a doctor's visit. Screened participants were more likely to know someone with HBV, have a PCP, and have health insurance. Logistic regression analysis showed knowing someone with HBV was the only predictor for screening. Despite guidelines for HBV screening, only half of the Asian Americans surveyed had been screened. Increasing awareness among PCPs is needed to increase HBV screening in this population.

  2. In the heartland of Eurasia: the multilocus genetic landscape of Central Asian populations

    Science.gov (United States)

    Martínez-Cruz, Begoña; Vitalis, Renaud; Ségurel, Laure; Austerlitz, Frédéric; Georges, Myriam; Théry, Sylvain; Quintana-Murci, Lluis; Hegay, Tatyana; Aldashev, Almaz; Nasyrova, Firuza; Heyer, Evelyne

    2011-01-01

    Located in the Eurasian heartland, Central Asia has played a major role in both the early spread of modern humans out of Africa and the more recent settlements of differentiated populations across Eurasia. A detailed knowledge of the peopling in this vast region would therefore greatly improve our understanding of range expansions, colonizations and recurrent migrations, including the impact of the historical expansion of eastern nomadic groups that occurred in Central Asia. However, despite its presumable importance, little is known about the level and the distribution of genetic variation in this region. We genotyped 26 Indo-Iranian- and Turkic-speaking populations, belonging to six different ethnic groups, at 27 autosomal microsatellite loci. The analysis of genetic variation reveals that Central Asian diversity is mainly shaped by linguistic affiliation, with Turkic-speaking populations forming a cluster more closely related to East-Asian populations and Indo-Iranian speakers forming a cluster closer to Western Eurasians. The scattered position of Uzbeks across Turkic- and Indo-Iranian-speaking populations may reflect their origins from the union of different tribes. We propose that the complex genetic landscape of Central Asian populations results from the movements of eastern, Turkic-speaking groups during historical times, into a long-lasting group of settled populations, which may be represented nowadays by Tajiks and Turkmen. Contrary to what is generally thought, our results suggest that the recurrent expansions of eastern nomadic groups did not result in the complete replacement of local populations, but rather into partial admixture. PMID:20823912

  3. Survey of maternal sleep practices in late pregnancy in a multi-ethnic sample in South Auckland, New Zealand.

    Science.gov (United States)

    Cronin, Robin S; Chelimo, Carol; Mitchell, Edwin A; Okesene-Gafa, Kara; Thompson, John M D; Taylor, Rennae S; Hutchison, B Lynne; McCowan, Lesley M E

    2017-06-17

    The Auckland Stillbirth study demonstrated a two-fold increased risk of late stillbirth for women who did not go to sleep on their left side. Two further studies have confirmed an increased risk of late stillbirth with supine sleep position. As sleep position is modifiable, we surveyed self-reported late pregnancy sleep position, knowledge about sleep position, and views about changing going-to-sleep position. Participants in this 2014 survey were pregnant women (n = 377) in their third trimester from South Auckland, New Zealand, a multi-ethnic and predominantly low socio-economic population. An ethnically-representative sample was obtained using random sampling. Multivariable logistic regression was performed to identify factors independently associated with non-left sided going-to-sleep position in late pregnancy. Respondents were 28 to 42 weeks' gestation. Reported going-to-sleep position in the last week was left side (30%), right side (22%), supine (3%), either side (39%) and other (6%). Two thirds (68%) reported they had received advice about sleep position. Non-left sleepers were asked if they would be able to change to their left side if it was better for their baby; 87% reported they would have little or no difficulty changing. Women who reported a non-left going-to-sleep position were more likely to be of Maori (aOR 2.64 95% CI 1.23-5.66) or Pacific (aOR 2.91 95% CI 1.46-5.78) ethnicity; had a lower body mass index (BMI) (aOR 0.93 95% CI 0.89-0.96); and were less likely to sleep on the left-hand side of the bed (aOR 3.29 95% CI 2.03-5.32). Maternal going-to-sleep position in the last week was side-lying in 91% of participants. The majority had received advice to sleep on their side or avoid supine sleep position. Sleeping on the left-hand side of the bed was associated with going-to-sleep on the left side. Most non-left sleepers reported their sleeping position could be modified to the left side suggesting a public health intervention about sleep

  4. Resilience of Historical Urban Multi-ethnic Settlement: Entrepreneurship and Religiosity Concept of Gresik City

    Science.gov (United States)

    Ariestadi, Dian; Antariksa; Dwi Wulandari, Lisa; Surjono

    2017-12-01

    Important aspects in continual development include economic and social developments, as well as environment protection. Social development aspect should concern political aspiration and local socio-culture as resilience of their local wisdom features. A review on urban resilience is more focused on economic and physical concepts, without developing the social concept. Objective of the study was to find out the resilience concept of Gresik City, which was the earliest description of a big trade port city in Indonesia, for example, Jakarta, Surabaya, and Semarang. The study applied morphology approach on spatial settings at historical urban multi-ethnic settlement through physical and non-physical observations, as well as validation through historical records and archives. The descriptive analysis of morphological pattern relates to activities on social, economic, and cultural aspects in order to obtain basic concept of social life. Morphological pattern of Gresik, which is dominated by multi-ethnic settlements, such as Arabs, Chinese, ex-Dutch-colonial, and the natives of Javanese and Madurese, has attracted traders from various nations and ethnics. History of the city as the center of Islamic learning and dissemination has formed the public of Gresik to have basic religious life, which is reflected on Islamic rituals. Settlement domination, which functions as household industries, craftsmanship, and small-scale trading, shows that entrepreneurship activities as socio-economy activities have highly supported daily religious ritual activities. Entrepreneurship and religiosity concept, which is formed and developed through long history of Gresik, represent the resilience of multi-ethnic societies at cities along the North Coast of Java.

  5. Knowledge, attitudes, and practices associated with menopause: a multi-ethnic, qualitative study in Singapore.

    Science.gov (United States)

    Mackey, Sandra; Teo, Stephanie Swee Hong; Dramusic, Vesna; Lee, Hwee Khim; Boughton, Maureen

    2014-05-01

    We explored knowledge, attitudes, and practices associated with the menopause transition particular to women in the multi-ethnic cultural context of Singapore. Fifty-eight Chinese, Malay, and Indian Singaporean women participated in interviews that were audiorecorded, transcribed verbatim, and analyzed using thematic analysis. Women from all three ethnicities described an attitude of acceptance surrounding menopause and the changes associated with it. While they thought it was important to be informed, they did not seek out information about menopause and did not view health professionals as useful sources of information. Management practices were diverse and rarely involved accessing health professionals.

  6. Estimating pesticide exposure from dietary intake and organic food choices: the Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Curl, Cynthia L; Beresford, Shirley A A; Fenske, Richard A; Fitzpatrick, Annette L; Lu, Chensheng; Nettleton, Jennifer A; Kaufman, Joel D

    2015-05-01

    Organophosphate pesticide (OP) exposure to the U.S. population is dominated by dietary intake. The magnitude of exposure from diet depends partly on personal decisions such as which foods to eat and whether to choose organic food. Most studies of OP exposure rely on urinary biomarkers, which are limited by short half-lives and often lack specificity to parent compounds. A reliable means of estimating long-term dietary exposure to individual OPs is needed to assess the potential relationship with adverse health effects. We assessed long-term dietary exposure to 14 OPs among 4,466 participants in the Multi-Ethnic Study of Atherosclerosis, and examined the influence of organic produce consumption on this exposure. Individual-level exposure was estimated by combining information on typical intake of specific food items with average OP residue levels on those items. In an analysis restricted to a subset of participants who reported rarely or never eating organic produce ("conventional consumers"), we assessed urinary dialkylphosphate (DAP) levels across tertiles of estimated exposure (n = 480). In a second analysis, we compared DAP levels across subgroups with differing self-reported organic produce consumption habits (n = 240). Among conventional consumers, increasing tertile of estimated dietary OP exposure was associated with higher DAP concentrations (p organic produce (p organic produce was associated with lower DAPs.

  7. Noncontrast cardiac computed tomography image-based vertebral bone mineral density: the Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Li, Dong; Mao, Song Shou; Khazai, Bahram; Hyder, Joseph A; Allison, Matthew; McClelland, Robyn; de Boer, Ian; Carr, J Jeffrey; Criqui, Michael H; Gao, Yanlin; Budoff, Matthew J

    2013-05-01

    Cardiac computer tomography (CT) image-based vertebral bone mineral density (BMD) assessment and the influence of cardiovascular disease risk factors on BMD have not been systematically evaluated, especially in a community-based, multiethnic population. A cross-sectional study design is used to determine if cardiac CT image is a reliable source to assess vertebral BMD, and a total of 2028 CT images were obtained from the Multi-Ethnic Study of Atherosclerosis, a large, diverse US cohort of adults 45 to 84 years of age. Cardiac CT image allows the rapid assessment of vertebral BMD and related fractures. The mean BMD was significantly higher in men compared with women for thoracic vertebrae (143.2 ± 41.2 vs 138.7 ± 42.7 mg/cm³, respectively, P = .014), as well as for lumbar vertebrae (125.0 ± 37.9 vs 117.2 ± 39.4 mg/cm³, respectively, P images to garner and assess vertebral BMD is a feasible and reliable method. Cardiac CT has the additional advantages of evaluate vertebral bone health while assessing cardiovascular disease risk with no extra cost or radiation exposure. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.

  8. Neighborhood built environment and cognition in non-demented older adults: The Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Besser, Lilah M; Rodriguez, Daniel A; McDonald, Noreen; Kukull, Walter A; Fitzpatrick, Annette L; Rapp, Stephen R; Seeman, Teresa

    2018-03-01

    Preliminary studies suggest that neighborhood social and built environment (BE) characteristics may affect cognition in older adults. Older adults are particularly vulnerable to the neighborhood environment due to a decreasing range of routine travel with increasing age. We examined if multiple neighborhood BE characteristics are cross-sectionally associated with cognition in a diverse sample of older adults, and if the BE-cognition associations vary by individual-level demographics. The sample included 4539 participants from the Multi-Ethnic Study of Atherosclerosis. Multivariable linear regression was used to examine the associations between five BE measures and four cognitive measures, and effect modification by individual-level education and race/ethnicity. In the overall sample, increasing social destination density, walking destination density, and intersection density were associated with worse overall cognition, whereas increasing proportion of land dedicated to retail was associated with better processing speed. Effect modification results suggest that the association between urban density and worse cognition may be limited to or strongest in those of non-white race/ethnicity. Although an increase in neighborhood retail destinations was associated with better cognition in the overall sample, these results suggest that certain BE characteristics in dense urban environments may have a disproportionately negative association with cognition in vulnerable populations. However, our findings must be replicated in longitudinal studies and other regional samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Trajectories of neighborhood poverty and associations with subclinical atherosclerosis and associated risk factors: the multi-ethnic study of atherosclerosis.

    Science.gov (United States)

    Murray, Emily T; Diez Roux, Ana V; Carnethon, Mercedes; Lutsey, Pamela L; Ni, Hanyu; O'Meara, Ellen S

    2010-05-15

    The authors used data from the Multi-Ethnic Study of Atherosclerosis and latent trajectory class modeling to determine patterns of neighborhood poverty over 20 years (1980-2000 residential history questionnaires were geocoded and linked to US Census data). Using these patterns, the authors examined 1) whether trajectories of neighborhood poverty were associated with differences in the amount of subclinical atherosclerosis (common carotid intimal-media thickness) and 2) associated risk factors (body mass index, hypertension, diabetes, current smoking) at baseline (January 2000-August 2002). The authors found evidence of 5 stable trajectory groups with differing levels of neighborhood poverty ( approximately 6%, 12%, 20%, 30%, and 45%) and 1 group with 29% poverty in 1980 and approximately 11% in 2000. Mostly for women, higher cumulative neighborhood poverty was generally significantly associated with worse cardiovascular outcomes. Trends generally persisted after adjustment for adulthood socioeconomic position and race/ethnicity, although they were no longer statistically significant. Among women who had moved during the 20 years, the long-term measure had stronger associations with outcomes (except smoking) than a single, contemporaneous measure. Results indicate that cumulative 20-year exposure to neighborhood poverty is associated with greater cardiovascular risk for women. In residentially mobile populations, single-point-in-time measures underestimate long-term effects.

  10. Thyroid cancer incidence among Asian immigrants to Ontario, Canada: A population-based cohort study.

    Science.gov (United States)

    Shah, Baiju R; Griffiths, Rebecca; Hall, Stephen F

    2017-09-01

    The highest rates of thyroid cancer are observed in Pacific Island nations as well as Australia and Asian countries bordering the Pacific. The objective of this study was to determine the risk for thyroid cancer among immigrants to Canada from Southeast and East Asia compared with immigrants from other regions and nonimmigrants. This was a population-based, longitudinal cohort study using health care administrative data to examine all residents of Ontario without pre-existing thyroid cancer. Individuals were followed from January 1997 or 5 years after they became eligible for health care coverage in Ontario, whichever came later. Patients were followed until March 2015 for incident-differentiated thyroid cancer, and then for recurrence. The study followed 14,659,733 individuals for a median of 17 years. Thyroid cancer incidence was 43.8 cases per 100,000 person-years among Southeast Asian immigrants, 28.6 cases per 100,000 person-years among East Asian immigrants, 21.5 cases per 100,000 person-years among other immigrants, and 14.5 cases per 100,000 person-years among nonimmigrants. Incidence was highest among immigrants from the Philippines (52.7 cases per 100,000 person-years), South Korea (33.5 cases per 100,000 person-years), and China (30.0 cases per 100,000 person-years). Adjusted hazard ratios for thyroid cancer compared with nonimmigrants were 2.66 (95% confidence interval, 2.48-2.84) for Southeast Asian immigrants, 1.87 (95% confidence interval, 1.75-2.00) for East Asian immigrants, and 1.51 (95% confidence interval, 1.45-1.57) for other immigrants. Immigrants were more likely to have papillary histology and stage I cancer. East Asian immigrants, but not Southeast Asian immigrants, had a lower risk of recurrence (hazard ratio, 0.73 [95% confidence interval, 0.57-0.94] and 1.01 [95% confidence interval, 0.81-1.26], respectively). Immigrants from Southeast and East Asia had markedly higher thyroid cancer incidence than nonimmigrants. At particularly elevated

  11. Plasma free amino acid profiles evaluate risk of metabolic syndrome, diabetes, dyslipidemia, and hypertension in a large Asian population

    OpenAIRE

    Yamaguchi, Natsu; Mahbub, MH; Takahashi, Hidekazu; Hase, Ryosuke; Ishimaru, Yasutaka; Sunagawa, Hiroshi; Amano, Hiroki; Kobayashi- Miura, Mikiko; Kanda, Hideyuki; Fujita, Yasuyuki; Yamamoto, Hiroshi; Yamamoto, Mai; Kikuchi, Shinya; Ikeda, Atsuko; Takasu, Mariko

    2017-01-01

    Background Recently, the association of plasma free amino acid (PFAA) profile and lifestyle-related diseases has been reported. However, few studies have been reported in large Asian populations, about the usefulness of PFAAs for evaluating disease risks. We examined the ability of PFAA profiles to evaluate lifestyle-related diseases in so far the largest Asian population. Methods We examined plasma concentrations of 19 amino acids in 8589 Japanese subjects, and determined the association wit...

  12. Architecture, space and power in historical multi-ethnic city Gresik

    Directory of Open Access Journals (Sweden)

    Ariestadi Dian

    2017-01-01

    Full Text Available The study of historical-morphology cities is conducted to discover the socio-cultural characteristics which influence the formation and development of spatial patterns and architecture. Gresik as the historical multi-ethnic city on the north coast of East Java, is known as a major trading port, the center spread of the Islamic religion, and the government city in the colonial era. This research has been made to know the morphological phenomenon of the historical city, by using a qualitative method. The result has shown: 1 the urban structure with the segregation of settlements based on ethnicity indicates the authority power to control its territory, 2 the building form which is dominated by colonial architecture shows the authority power to control the physical changes, 3 the courtyard-house concept which is widely applied in Kampung Arab indicates about the ethnic power to arrange the environment, and 4 the use of landhuis type and luxury mansions in Kampong Kemasan represents the power of successful people as government officials and entrepreneur. The spatial patterns and architecture of the historical multi-ethnic city - Gresik were influenced by the power aspects in the form of efforts to dominate each other and self-defense in the personal and communal levels.

  13. Usual populations, unusual individuals: insights into the behavior and management of Asian elephants in fragmented landscapes.

    Directory of Open Access Journals (Sweden)

    Nishant M Srinivasaiah

    Full Text Available BACKGROUND: A dearth in understanding the behavior of Asian elephants (Elephas maximus at the scale of populations and individuals has left important management issues, particularly related to human-elephant conflict (HEC, unresolved. Evaluation of differences in behavior and decision-making among individual elephants across groups in response to changing local ecological settings is essential to fill this gap in knowledge and to improve our approaches towards the management and conservation of elephants. METHODOLOGY/PRINCIPAL FINDINGS: We hypothesized certain behavioral decisions that would be made by Asian elephants as reflected in their residence time and movement rates, time-activity budgets, social interactions and group dynamics in response to resource availability and human disturbance in their habitat. This study is based on 200 h of behavioral observations on 60 individually identified elephants and a 184-km(2 grid-based survey of their natural and anthropogenic habitats within and outside the Bannerghatta National Park, southern India during the dry season. At a general population level, the behavioral decisions appeared to be guided by the gender, age and group-type of the elephants. At the individual level, the observed variation could be explained only by the idiosyncratic behaviors of individuals and that of their associating conspecific individuals. Recursive partitioning classification trees for residence time of individual elephants indicated that the primary decisions were taken by individuals, independently of their above-mentioned biological and ecological attributes. CONCLUSIONS/SIGNIFICANCE: Decision-making by Asian elephants thus appears to be determined at two levels, that of the population and, more importantly, the individual. Models based on decision-making by individual elephants have the potential to predict conflict in fragmented landscapes that, in turn, could aid in mitigating HEC. Thus, we must target individuals

  14. Simultaneous determination of seven informative Y chromosome SNPs to differentiate East Asian, European, and African populations.

    Science.gov (United States)

    Muro, Tomonori; Iida, Reiko; Fujihara, Junko; Yasuda, Toshihiro; Watanabe, Yukina; Imamura, Shinji; Nakamura, Hiroaki; Kimura-Kataoka, Kaori; Yuasa, Isao; Toga, Tomoko; Takeshita, Haruo

    2011-05-01

    Identification of the population origin of an individual is very useful for crime investigators who need to narrow down a suspect based on specimens left at a crime scene. Single nucleotide polymorphisms of the Y chromosome (Y-SNPs) are a class of markers of interest to forensic investigators because many of the markers indicate regional specificity, thus providing useful information about the geographic origin of a subject. We selected seven informative Y-SNPs (M168, M130, JST021355, M96, P126, P196, and P234) to differentiate the three major population groups (East Asian, European, and African) and used them to develop forensic application. SNP genotyping was carried out by multiplex PCR reaction and multiplex single base extension (MSBE) reaction followed by capillary electrophoresis of extension products. This method can be used to assign a haplogroup from both degraded male DNA samples and DNA samples containing a mixture of female and male DNA through PCR primers that generate small amplicons (less than about 150 bp) and are highly specific for targets on the Y chromosome. The allelic state of each marker was definitively determined from a total of 791 males from the three major population groups. As expected, samples from the three major population groups showed Y-haplogroups common in the region of provenance: Y haplogroups C, D, and O for East Asians; IJ and R1 for Europeans; and AB and E for Africans. Published by Elsevier Ireland Ltd.

  15. A Clinical Prediction Model for Postcardiac Surgery Atrial Fibrillation in an Asian Population.

    Science.gov (United States)

    Zhang, Wei; Liu, Weiling; Chew, Sophia T H; Shen, Liang; Ti, Lian Kah

    2016-08-01

    Postoperative atrial fibrillation (AF) is associated with increased morbidity, mortality, and resource utilization. Current prediction models for postoperative AF are based primarily on Western populations. In this study, we sought to develop a clinical prediction rule for postcardiac surgery AF for a multiethnic Asian population. Two thousand one hundred sixty-eight patients undergoing coronary artery bypass graft or valve surgery with cardiopulmonary bypass were prospectively enrolled in this observational study between August 2008 and July 2012 at Singapore's 2 national heart centers. Postoperative AF was defined as an irregularly irregular electrocardiogram rhythm without identifiable P wave after surgery and before hospital discharge that lasted more than an hour, or affected hemodynamics (ie, systolic blood pressure 120 minutes (OR, 1.92; 95% CI, 1.47-2.52, P Chinese ethnicity (Chinese versus Indian OR, 2.09; 95% CI, 1.28-3.41, P = 0.003) or Malay (Malay versus Indian OR, 2.43; 95% CI, 1.36-4.05, P = 0.002) to be independently associated with postoperative AF. The area under the receiver-operator characteristic curve of the model was 0.704 (95% CI, 0.674-0.734). Internal validation produced an area under the receiver-operator characteristic curve of 0.756 (95% CI, 0.690-0.821). Clinical risk factors for AF after cardiac surgery in an Asian population are similar to that reported from primarily Western populations, but specific ethnicity influences susceptibility.

  16. Omalizumab therapy for treatment of recalcitrant chronic spontaneous urticaria in an Asian population.

    Science.gov (United States)

    Kulthanan, Kanokvalai; Tuchinda, Papapit; Chularojanamontri, Leena; Likitwattananurak, Chayanee; Ungaksornpairote, Chanida

    2017-03-01

    There are limited data regarding omalizumab in the treatment of recalcitrant chronic spontaneous urticaria (CSU) in Asian populations. This study evaluated the effectiveness and the proper dosage of omalizumab for Asian CSU patients in a real-life setting. We retrospectively reviewed recalcitrant CSU patients seeking treatment at the Skin Allergy Clinic, Siriraj Hospital during the 3-year period. All patients were treated with omalizumab as an add-on therapy. Standard seven-day urticaria activity score (UAS7) and medication score were used to assess omalizumab response. Of 13 patients, 9 patients (70%) responded well to 150 mg omalizumab injection every month, whereas 4 patients requiring updosing to 300 mg. In the 150 mg group, one patient achieved complete symptom control without antihistamine intake. Most of them required antihistamines without prednisolone and ciclosporin. Onset of omalizumab was fast, usually within the first week. Though only two patients in the 300 mg group achieved complete absence of symptoms, ciclosporin and oral corticosteroids could be discontinued. No patients reported adverse effects. Omalizumab at an initial dosage of 150 mg was effective in the treatment of recalcitrant CSU among Asians. Updosing to 300 mg was required to achieve satisfactory outcomes.

  17. Iris pigmentation as a quantitative trait: variation in populations of European, East Asian and South Asian ancestry and association with candidate gene polymorphisms.

    Science.gov (United States)

    Edwards, Melissa; Cha, David; Krithika, S; Johnson, Monique; Cook, Gillian; Parra, Esteban J

    2016-03-01

    In this study, we present a new quantitative method to measure iris colour based on high-resolution photographs. We applied this method to analyse iris colour variation in a sample of individuals of East Asian, European and South Asian ancestry. We show that measuring iris colour using the coordinates of the CIELAB colour space uncovers a significant amount of variation that is not captured using conventional categorical classifications, such as 'brown', 'blue' or 'green'. We tested the association of a selected panel of polymorphisms with iris colour in each population group. Six markers showed significant associations with iris colour in the European sample, three in the South Asian sample and two in the East Asian sample. We also observed that the marker HERC2 rs12913832, which is the main determinant of 'blue' versus 'brown' iris colour in European populations, is also significantly associated with central heterochromia in the European sample. © 2015 The Authors. Pigment Cell & Melanoma Research Published by John Wiley & Sons Ltd.

  18. Diurnal Salivary Cortisol is Associated With Body Mass Index and Waist Circumference: The Multi-Ethnic Study of Atherosclerosis

    Science.gov (United States)

    Champaneri, Shivam; Xu, Xiaoqiang; Carnethon, Mercedes R.; Bertoni, Alain G.; Seeman, Teresa; DeSantis, Amy S.; Roux, Ana Diez; Shrager, Sandi; Golden, Sherita Hill

    2012-01-01

    Neuroendocrine abnormalities, such as activation of the hypothalamic-pituitary-adrenal (HPA) axis, are associated with obesity; however, few large-scale population-based studies have examined HPA axis and markers of obesity. We examined the cross-sectional association of the cortisol awakening response (CAR) and diurnal salivary cortisol curve with obesity. The Multi-Ethnic Study of Atherosclerosis (MESA) Stress Study includes 1,002 White, Hispanic, and Black men and women (mean age 65±9.8 years) who collected up to 18 salivary cortisol samples over 3 days. Cortisol profiles were modeled using regression spline models that incorporated random parameters for subject-specific effects. Cortisol curve measures included awakening cortisol, CAR (awakening to 30 minutes post-awakening), early decline (30 minutes to 2 hours post-awakening), late decline (2 hours post-awakening to bedtime), and the corresponding areas under the curve (AUC). Body-mass-index (BMI) and waist circumference (WC) were used to estimate adiposity. For the entire cohort, both BMI and WC were negatively correlated with awakening cortisol (p<0.05), AUC during awakening rise and early decline and positively correlated to the early decline slope (p<0.05) after adjustments for age, race/ethnicity, gender, diabetes status, socioeconomic status, beta blockers, steroids, hormone replacement therapy and smoking status. No heterogeneities of effects were observed by gender, age, and race/ethnicity. Higher BMI and WC are associated with neuroendocrine dysregulation, which is present in a large population sample, and only partially explained by other covariates. PMID:23404865

  19. Survivorship care and support following treatment for breast cancer: a multi-ethnic comparative qualitative study of women's experiences.

    Science.gov (United States)

    Tompkins, Charlotte; Scanlon, Karen; Scott, Emma; Ream, Emma; Harding, Seeromanie; Armes, Jo

    2016-08-18

    As the number of breast cancer survivors continues to rise, Western populations become more ethnically and socially diverse and healthcare resources become ever-more stretched, follow-up that focuses on monitoring for recurrence is no longer viable. New models of survivorship care need to ensure they support self-management and are culturally appropriate across diverse populations. This study explored experiences and expectations of a multi-ethnic sample of women with breast cancer regarding post-treatment care, in order to understand potential barriers to receiving care and inform new models of survivorship care. A phenomenological qualitative research design was employed. In-depth interviews were conducted with women from diverse socio-demographic backgrounds in England, who completed treatment for breast cancer in the 12 months prior to the study. Data were analysed using Framework Analysis. Sixty-six women participated and reported expectations and needs were unmet at follow-up. Whilst there were more commonalities in experiences, discernible differences, particularly by ethnicity and age, were identified relating to three key themes: emotional responses on transition to follow-up; challenges communicating with healthcare professionals at follow-up; and challenges finding and accessing information and support services to address unmet needs. There are cultural differences in the way healthcare professionals and women communicate, not necessarily differences in their post-treatment needs. We do not know if new models of care meet survivors' needs, or if they are appropriate for everyone. Further testing and potential cultural and linguistic adaptation of models of care is necessary to ensure their appropriateness and acceptability to survivors from different backgrounds. New ways of providing survivorship care mean survivors will need to be better prepared for the post-treatment period and the role they will have to play in managing their symptoms and care.

  20. Self-reported domain-specific and accelerometer-based physical activity and sedentary behaviour in relation to psychological distress among an urban Asian population.

    Science.gov (United States)

    Chu, A H Y; van Dam, R M; Biddle, S J H; Tan, C S; Koh, D; Müller-Riemenschneider, F

    2018-04-05

    The interpretation of previous studies on the association of physical activity and sedentary behaviour with psychological health is limited by the use of mostly self-reported physical activity and sedentary behaviour, and a focus on Western populations. We aimed to explore the association of self-reported and devise-based measures of physical activity and sedentary behaviour domains on psychological distress in an urban multi-ethnic Asian population. From a population-based cross-sectional study of adults aged 18-79 years, data were used from an overall sample (n = 2653) with complete self-reported total physical activity/sedentary behaviour and domain-specific physical activity data, and a subsample (n = 703) with self-reported domain-specific sedentary behaviour and accelerometry data. Physical activity and sedentary behaviour data were collected using the Global Physical Activity Questionnaire (GPAQ), a domain-specific sedentary behaviour questionnaire and accelerometers. The Kessler Screening Scale (K6) and General Health Questionnaire (GHQ-12) were used to assess psychological distress. Logistic regression models were used to calculate odds ratios (ORs) and 95% confidence intervals, adjusted for socio-demographic and lifestyle characteristics. The sample comprised 45.0% men (median age = 45.0 years). The prevalence of psychological distress based on the K6 and GHQ-12 was 8.4% and 21.7%, respectively. In the adjusted model, higher levels of self-reported moderate-to-vigorous physical activity (MVPA) were associated with significantly higher odds for K6 (OR = 1.47 [1.03-2.10]; p-trend = 0.03) but not GHQ-12 (OR = 0.97 [0.77-1.23]; p-trend = 0.79), when comparing the highest with the lowest tertile. Accelerometry-assessed MVPA was not significantly associated with K6 (p-trend = 0.50) nor GHQ-12 (p-trend = 0.74). The highest tertile of leisure-time physical activity, but not work- or transport-domain activity, was associated

  1. An alternative method for quantifying coronary artery calcification: the multi-ethnic study of atherosclerosis (MESA).

    Science.gov (United States)

    Liang, C Jason; Budoff, Matthew J; Kaufman, Joel D; Kronmal, Richard A; Brown, Elizabeth R

    2012-07-02

    Extent of atherosclerosis measured by amount of coronary artery calcium (CAC) in computed tomography (CT) has been traditionally assessed using thresholded scoring methods, such as the Agatston score (AS). These thresholded scores have value in clinical prediction, but important information might exist below the threshold, which would have important advantages for understanding genetic, environmental, and other risk factors in atherosclerosis. We developed a semi-automated threshold-free scoring method, the spatially weighted calcium score (SWCS) for CAC in the Multi-Ethnic Study of Atherosclerosis (MESA). Chest CT scans were obtained from 6814 participants in the Multi-Ethnic Study of Atherosclerosis (MESA). The SWCS and the AS were calculated for each of the scans. Cox proportional hazards models and linear regression models were used to evaluate the associations of the scores with CHD events and CHD risk factors. CHD risk factors were summarized using a linear predictor. Among all participants and participants with AS > 0, the SWCS and AS both showed similar strongly significant associations with CHD events (hazard ratios, 1.23 and 1.19 per doubling of SWCS and AS; 95% CI, 1.16 to 1.30 and 1.14 to 1.26) and CHD risk factors (slopes, 0.178 and 0.164; 95% CI, 0.162 to 0.195 and 0.149 to 0.179). Even among participants with AS = 0, an increase in the SWCS was still significantly associated with established CHD risk factors (slope, 0.181; 95% CI, 0.138 to 0.224). The SWCS appeared to be predictive of CHD events even in participants with AS = 0, though those events were rare as expected. The SWCS provides a valid, continuous measure of CAC suitable for quantifying the extent of atherosclerosis without a threshold, which will be useful for examining novel genetic and environmental risk factors for atherosclerosis.

  2. An alternative method for quantifying coronary artery calcification: the multi-ethnic study of atherosclerosis (MESA

    Directory of Open Access Journals (Sweden)

    Liang C

    2012-07-01

    Full Text Available Abstract Background Extent of atherosclerosis measured by amount of coronary artery calcium (CAC in computed tomography (CT has been traditionally assessed using thresholded scoring methods, such as the Agatston score (AS. These thresholded scores have value in clinical prediction, but important information might exist below the threshold, which would have important advantages for understanding genetic, environmental, and other risk factors in atherosclerosis. We developed a semi-automated threshold-free scoring method, the spatially weighted calcium score (SWCS for CAC in the Multi-Ethnic Study of Atherosclerosis (MESA. Methods Chest CT scans were obtained from 6814 participants in the Multi-Ethnic Study of Atherosclerosis (MESA. The SWCS and the AS were calculated for each of the scans. Cox proportional hazards models and linear regression models were used to evaluate the associations of the scores with CHD events and CHD risk factors. CHD risk factors were summarized using a linear predictor. Results Among all participants and participants with AS > 0, the SWCS and AS both showed similar strongly significant associations with CHD events (hazard ratios, 1.23 and 1.19 per doubling of SWCS and AS; 95% CI, 1.16 to 1.30 and 1.14 to 1.26 and CHD risk factors (slopes, 0.178 and 0.164; 95% CI, 0.162 to 0.195 and 0.149 to 0.179. Even among participants with AS = 0, an increase in the SWCS was still significantly associated with established CHD risk factors (slope, 0.181; 95% CI, 0.138 to 0.224. The SWCS appeared to be predictive of CHD events even in participants with AS = 0, though those events were rare as expected. Conclusions The SWCS provides a valid, continuous measure of CAC suitable for quantifying the extent of atherosclerosis without a threshold, which will be useful for examining novel genetic and environmental risk factors for atherosclerosis.

  3. Positive Predictive Value of BI-RADS Categorization in an Asian Population

    Directory of Open Access Journals (Sweden)

    Yah-Yuen Tan

    2004-07-01

    Full Text Available The Breast Imaging Reporting And Data System (BI-RADS categorization of mammograms is useful in estimating the risk of malignancy, thereby guiding management decisions. However, in Asian women, in whom breast density is increased, the sensitivity of mammography is correspondingly lower. We sought to determine the positive predictive value of BI-RADS categorization for malignancy in our Asian population and, hence, its value in helping us to choose between the various modalities for breast biopsy. We retrospectively reviewed all patients with occult breast lesions detected on mammography or ultrasound who underwent needle-localization open breast biopsy (NLOB in our institution over a 6-year period. There were 470 biopsies in 427 patients; 16% of lesions were malignant. The positive predictive value of BI-RADS 4 and 5 lesions for cancer was 0.27 and 0.84, respectively. While most BI-RADS 5 mass lesions were invasive cancers, the majority of calcifications in this category were in situ carcinomas. We conclude that BI-RADS remains useful in aiding decision-making for biopsy in our Asian population. Based on positive predictive values, we recommend percutaneous breast biopsy for initial evaluation of lesions categorized as BI-RADS 4 or less. For BI-RADS 5 lesions with microcalcifications, open surgical biopsy as a diagnostic and therapeutic procedure may be more appropriate. In the case of a BI-RADS 5 lesion associated with a mass, initial percutaneous biopsy may be useful for diagnosis, followed by a planned single-stage surgical procedure as necessary.

  4. Hemoglobin Constant Spring among Southeast Asian Populations: Haplotypic Heterogeneities and Phylogenetic Analysis.

    Directory of Open Access Journals (Sweden)

    Wittaya Jomoui

    Full Text Available Hemoglobin Constant Spring (Hb CS is an abnormal Hb caused by a mutation at the termination codon of α2-globin gene found commonly among Southeast Asian and Chinese people. Association of Hb CS with α°-thalassemia leads to a thalassemia intermedia syndrome commonly encountered in the region. We report chromosome background and addressed genetic origins of Hb CS observed in a large cohort of Hb CS among Southeast Asian populations.A study was done on 102 Vietnamese (aged 15-49 year-old and 40 Laotian (aged 18-39 year-old subjects with Hb CS and results compared with 120 Hb CS genes in Thailand. Hematological parameters were recorded and Hb analysis was performed using capillary electrophoresis. Hb CS mutation and thalassemia genotypes were defined by DNA analysis. Six DNA polymorphisms within α-globin gene cluster including 5'Xba I, Bgl I, Inter-zeta HVR, AccI, RsaI and αPstI 3', were determined using PCR-RFLP assay.Nine different genotypes of Hb CS were observed. In contrast to the Thai Hb CS alleles which are mostly linked to haplotype (+-S + + -, most of the Vietnamese and the Laotian Hb CS genes were associated with haplotype (+-M + + -, both of which are different from that of the European Hb CS.Hb CS is commonly found in combination with other thalassemias among Southeast Asian populations. Accurate genotyping of the cases requires both hematologic and DNA analyses. At least two independent origins are associated with the Hb CS gene which could indirectly explain the high prevalence of this Hb variant in the region.

  5. Replication of 13 obesity loci among Singaporean Chinese, Malay and Asian-Indian populations.

    Science.gov (United States)

    Dorajoo, R; Blakemore, A I F; Sim, X; Ong, R T-H; Ng, D P K; Seielstad, M; Wong, T-Y; Saw, S-M; Froguel, P; Liu, J; Tai, E-S

    2012-01-01

    Recent genome-wide association studies (GWAS) have identified 38 obesity-associated loci among European populations. However, their contribution to obesity in other ethnicities is largely unknown. We utilised five GWAS (N=10 482) from Chinese (three cohorts, including one with type 2 diabetes and another one of children), Malay and Indian ethnic groups from Singapore. Data sets were analysed individually and subsequently in combined meta-analysis for Z-score body-mass index (BMI) associations. Variants at the FTO locus showed the strongest associations with BMI Z-score after meta-analysis (P-values 1.16 × 10(-7)-7.95 × 10(-7)). We further detected associations with nine other index obesity variants close to the MC4R, GNPDA2, TMEM18, QPCTL/GIPR, BDNF, ETV5, MAP2K5/SKOR1, SEC16B and TNKS/MSRA loci (meta-analysis P-values ranging from 3.58 × 10(-4)-1.44 × 10(-2)). Three other single-nucleotide polymorphisms (SNPs) from CADM2, PTBP2 and FAIM2 were associated with BMI (P-value ≤ 0.0418) in at least one dataset. The neurotrophin/TRK pathway (P-value=0.029) was highlighted by pathway-based analysis of loci that had statistically significant associations among Singaporean populations. Our data confirm the role of FTO in obesity predisposition among Chinese, Malays and Indians, the three major Asian ethnic groups. We additionally detected associations for 12 obesity-associated SNPs among Singaporeans. Thus, it is likely that Europeans and Asians share some of the genetic predisposition to obesity. Furthermore, the neurotrophin/TRK signalling may have a central role for common obesity among Asians.

  6. Periodontal disease in a remote Asian population: association between clinical and microbiological parameters.

    Science.gov (United States)

    Kvarnvik, Christine; Söljegård, Emelie; Charalampakis, Georgios; Suksu-Art, Narong; Dahlén, Gunnar

    2016-08-01

    The aim was to clinically and microbiologically describe the periodontal conditions in a remote adult Asian population with poor oral hygiene. The subjects were 30-60-year-old adults of Karen Hill tribes with no access to dental care. Eighty-six subjects were selected randomly. Clinical registrations included number of remaining teeth, plaque index (PlI), bleeding on probing (BoP), clinical attachment loss (CAL), and probing pocket depth (PPD). Subgingival plaque samples were collected and analyzed with the checkerboard method. Subjects of the study group had mean number of remaining teeth of 26.5 despite the abundant plaque and a high bleeding score. Severe periodontitis (CAL ≥ 7 mm) was recorded in 12.9% of the youngest age group (30-39 years) while it was significantly higher (52%) in the middle group (40-49 years) and (60%) in the eldest age group (50-60 years). Pathological pocketing (PPD ≥ 7 mm) was significantly lower in all age groups. Age, betel chewing, and a microbiological cluster including at least one of Prevotella tannerae, Filifactor alocis and Porphyromonas endodontalis significantly correlated with the severity of periodontal disease. Age, betel chewing, and a new bacterial complex other than the "red complex" correlated to periodontal breakdown in this remote adult Asian population. © 2015 Wiley Publishing Asia Pty Ltd.

  7. Walk Score® and Transit Score® and Walking in the Multi-Ethnic Study of Atherosclerosis

    Science.gov (United States)

    Hirsch, Jana A.; Moore, Kari A.; Evenson, Kelly R.; Rodriguez, Daniel A; Diez Roux, Ana V.

    2013-01-01

    Background Walk Score® and Transit Score® are open-source measures of the neighborhood built environment to support walking (“walkability”) and access to transportation. Purpose To investigate associations of Street Smart Walk Score and Transit Score with self-reported transport and leisure walking using data from a large multi-city and diverse population-based sample of adults. Methods Data from a sample of 4552 residents of Baltimore MD; Chicago IL; Forsyth County NC; Los Angeles CA; New York NY; and St. Paul MN from the Multi-Ethnic Study of Atherosclerosis (2010–2012) were linked to Walk Score and Transit Score (collected in 2012). Logistic and linear regression models estimated ORs of not walking and mean differences in minutes walked, respectively, associated with continuous and categoric Walk Score and Transit Score. All analyses were conducted in 2012. Results After adjustment for site, key sociodemographic, and health variables, a higher Walk Score was associated with lower odds of not walking for transport and more minutes/week of transport walking. Compared to those in a “walker’s paradise,” lower categories of Walk Score were associated with a linear increase in odds of not transport walking and a decline in minutes of leisure walking. An increase in Transit Score was associated with lower odds of not transport walking or leisure walking, and additional minutes/week of leisure walking. Conclusions Walk Score and Transit Score appear to be useful as measures of walkability in analyses of neighborhood effects. PMID:23867022

  8. Labor market integration, immigration experience, and psychological distress in a multi-ethnic sample of immigrants residing in Portugal.

    Science.gov (United States)

    Teixeira, Ana F; Dias, Sónia F

    2018-01-01

    This study aims at examining how factors relating to immigrants' experience in the host country affect psychological distress (PD). Specifically, we analyzed the association among socio-economic status (SES), integration in the labor market, specific immigration experience characteristics, and PD in a multi-ethnic sample of immigrant individuals residing in Lisbon, Portugal. Using a sample (n = 1375) consisting of all main immigrant groups residing in Portugal's metropolitan area of Lisbon, we estimated multivariable linear regression models of PD regressed on selected sets of socio-economic independent variables. A psychological distress scale was constructed based on five items (feeling physically tired, feeling psychologically tired, feeling happy, feeling full of energy, and feeling lonely). Variables associated with a decrease in PD are being a male (demographic), being satisfied with their income level (SES), living with the core family and having higher number of children (social isolation), planning to remain for longer periods of time in Portugal (migration project), and whether respondents considered themselves to be in good health condition (subjective health status). Study variables negatively associated with immigrants' PD were job insecurity (labor market), and the perception that health professionals were not willing to understand immigrants during a clinical interaction. The study findings emphasized the importance of labor market integration and access to good quality jobs for immigrants' psychological well-being, as well as the existence of family ties in the host country, intention to reside long term in the host country, and high subjective (physical) health. Our research suggests the need to foster cross-national studies of immigrant populations in order to understand the social mechanisms that transverse all migrant groups and contribute to lower psychological well-being.

  9. Knowledge, attitudes, practices and behaviors regarding deceased organ donation and transplantation in Malaysia's multi-ethnic society: a baseline study.

    Science.gov (United States)

    Wong, Li Ping

    2011-01-01

    Malaysia's organ and tissue donation rates are among the lowest in the world. The study aims to explore the knowledge, attitudes, practices and behaviors regarding deceased organ donation and transplantation in the diverse ethnic communities in the state of Selangor, Malaysia. A cross-sectional, population-based, computer-assisted telephone interview exploring multi-ethnic participants' knowledge, attitudes, practices and behavioral on deceased organ donation and transplantation was conducted from February to April 2009. Although only 5.5% of the total participants (N = 1174) reported that they have registered to be organ donor, a further 35.2% of those who have not register for organ donation indicated willingness to donate their own. Significant socio-demographic disparities with respect to knowledge and attitudes scores were observed. In particular, Malays (20.7%) indicated lower willingness to donate organs compared to the Chinese (36.6%) and Indians (51.4%) (p < 0.001). In multivariate logistic regression analysis, willingness to donate one's own organ was associated with knowledge score (odds ratio [OR] = 1.17, 95% confidence interval [CI] = 1.13-1.22), attitude score (OR = 1.17, 95% CI = 1.05-1.31), secondary school education (OR = 1.46, 95% CI = 1.05-2.02), and Malay ethnicity (OR = 0.18, 95% CI = 0.03-0.94). Findings assist organ donation and transplantation organizations to reach out the diverse socio-demographic and ethnic communities with cultural-specific information about organ donation. © 2010 John Wiley & Sons A/S.

  10. Occupational Exposures and Subclinical Interstitial Lung Disease. The MESA (Multi-Ethnic Study of Atherosclerosis) Air and Lung Studies.

    Science.gov (United States)

    Sack, Coralynn S; Doney, Brent C; Podolanczuk, Anna J; Hooper, Laura G; Seixas, Noah S; Hoffman, Eric A; Kawut, Steven M; Vedal, Sverre; Raghu, Ganesh; Barr, R Graham; Lederer, David J; Kaufman, Joel D

    2017-10-15

    The impact of a broad range of occupational exposures on subclinical interstitial lung disease (ILD) has not been studied. To determine whether occupational exposures to vapors, gas, dust, and fumes (VGDF) are associated with high-attenuation areas (HAA) and interstitial lung abnormalities (ILA), which are quantitative and qualitative computed tomography (CT)-based measurements of subclinical ILD, respectively. We performed analyses of participants enrolled in MESA (Multi-Ethnic Study of Atherosclerosis), a population-based cohort aged 45-84 years at recruitment. HAA was measured at baseline and on serial cardiac CT scans in 5,702 participants. ILA was ascertained in a subset of 2,312 participants who underwent full-lung CT scanning at 10-year follow-up. Occupational exposures were assessed by self-reported VGDF exposure and by job-exposure matrix (JEM). Linear mixed models and logistic regression were used to determine whether occupational exposures were associated with log-transformed HAA and ILA. Models were adjusted for age, sex, race/ethnicity, education, employment status, tobacco use, and scanner technology. Each JEM score increment in VGDF exposure was associated with 2.64% greater HAA (95% confidence interval [CI], 1.23-4.19%). Self-reported vapors/gas exposure was associated with an increased odds of ILA among those currently employed (1.76-fold; 95% CI, 1.09-2.84) and those less than 65 years old (1.97-fold; 95% CI, 1.16-3.35). There was no consistent evidence that occupational exposures were associated with progression of HAA over the follow-up period. JEM-assigned and self-reported exposures to VGDF were associated with measurements of subclinical ILD in community-dwelling adults.

  11. Serum Phosphate and Retinal Microvascular Changes: The Multi-Ethnic Study of Atherosclerosis and the Beaver Dam Eye Study.

    Science.gov (United States)

    Mehta, Rupal; Hodakowski, Alexander; Cai, Xuan; Lee, Kris E; Kestenbaum, Bryan R; de Boer, Ian H; Fawzi, Amani; Wong, Tien Yin; Ix, Joachim; Klein, Barbara; Klein, Ronald; Isakova, Tamara

    2017-12-01

    Higher levels of serum phosphate are strongly linked to increased risk of cardiovascular disease and therapies aimed to lower serum phosphate are employed in the management of patients with chronic kidney disease (CKD). Data are limited, however, on serum phosphate as a risk factor for microvascular disease in community-based populations. It is important to determine the impact of novel risk factors, such as phosphate, on the microvasculature. We conducted a prospective study of 3919 individuals in the Multi-Ethnic Study of Atherosclerosis (MESA) and 3544 individuals in the Beaver Dam Eye Study (BDES) to test the associations of serum phosphate with retinopathy and retinal vessel caliber, and change in retinopathy severity and change in retinal vessel caliber. Mean (standard deviation) serum phosphate was 3.66 (0.52) mg/dl in the MESA and 3.77 (0.55) mg/dl in the BDES. In multivariable adjusted models, phosphate was significantly associated with prevalent retinopathy in the MESA (Odds Ratio [OR] per 1 mg/dl increase in phosphate, 1.22; Confidence Interval [CI] 1.02-1.47) and the BDES (OR 1.06; CI 1.01-1.11). In stratified analyses, these relationships were even stronger and only seen in individuals with diabetes in both the MESA (OR 1.81; CI 1.30-2.53) and the BDES (OR 1.16; CI 1.05-1.29). Phosphate was not associated with incident or change in retinopathy severity, nor any retinal caliber outcome. Among community-living individuals with low prevalence of CKD, higher serum phosphate was associated with prevalent retinopathy in individuals with diabetes. Further longitudinal assessments in patients with diabetes necessitate further investigation.

  12. Neighborhood characteristics influence DNA methylation of genes involved in stress response and inflammation: The Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Smith, Jennifer A; Zhao, Wei; Wang, Xu; Ratliff, Scott M; Mukherjee, Bhramar; Kardia, Sharon L R; Liu, Yongmei; Roux, Ava V Diez; Needham, Belinda L

    2017-08-01

    Living in a disadvantaged neighborhood is associated with poor health outcomes even after accounting for individual-level socioeconomic factors. The chronic stress of unfavorable neighborhood conditions may lead to dysregulation of the stress reactivity and inflammatory pathways, potentially mediated through epigenetic mechanisms such as DNA methylation. We used multi-level models to examine the relationship between 2 neighborhood conditions and methylation levels of 18 genes related to stress reactivity and inflammation in purified monocytes from 1,226 participants of the Multi-Ethnic Study of Atherosclerosis (MESA), a population-based sample of US adults. Neighborhood socioeconomic disadvantage, a summary of 16 census-based metrics, was associated with DNA methylation [False discovery rate (FDR) q-value ≤ 0.1] in 2 out of 7 stress-related genes evaluated (CRF, SLC6A4) and 2 out of 11 inflammation-related genes (F8, TLR1). Neighborhood social environment, a summary measure of aesthetic quality, safety, and social cohesion, was associated with methylation in 4 of the 7 stress-related genes (AVP, BDNF, FKBP5, SLC6A4) and 7 of the 11 inflammation-related genes (CCL1, CD1D, F8, KLRG1, NLRP12, SLAMF7, TLR1). High socioeconomic disadvantage and worse social environment were primarily associated with increased methylation. In 5 genes with significant associations between neighborhood and methylation (FKBP5, CD1D, F8, KLRG1, NLRP12), methylation was associated with gene expression of at least one transcript. These results demonstrate that multiple dimensions of neighborhood context may influence methylation levels and subsequent gene expression of stress- and inflammation-related genes, even after accounting for individual socioeconomic factors. Further elucidating the molecular mechanisms underlying these relationships will be important for understanding the etiology of health disparities.

  13. Increase in density of genetically diverse invasive Asian shore crab (Hemigrapsus sanguineus) populations in the Gulf of Maine.

    Science.gov (United States)

    Lord, Joshua P; Williams, Larissa M

    2017-04-01

    Hemigrapsus sanguineus , the Asian shore crab, has rapidly replaced Carcinus maenas , the green crab, as the most abundant crab on rocky shores in the northwest Atlantic since its introduction to the United States (USA) in 1988. The northern edge of this progressing invasion is the Gulf of Maine, where Asian shore crabs are only abundant in the south. We compared H. sanguineus population densities to those from published 2005 surveys and quantified genetic variation using the cytochrome c oxidase subunit I gene. We found that the range of H. sanguineus had extended northward since 2005, that population density had increased substantially (at least 10-fold at all sites), and that Asian shore crabs had become the dominant intertidal crab species in New Hampshire and southern Maine. Despite the significant increase in population density of H. sanguineus , populations only increased by a factor of 14 in Maine compared to 70 in southern New England, possibly due to cooler temperatures in the Gulf of Maine. Genetically, populations were predominantly composed of a single haplotype of Japanese, Korean, or Taiwanese origin, although an additional seven haplotypes were found. Six of these haplotypes were of Asian origin, while two are newly described. Large increases in population sizes of genetically diverse individuals in Maine will likely have a large ecological impact, causing a reduction in populations of mussels, barnacles, snails, and other crabs, similar to what has occurred at southern sites with large populations of this invasive crab species.

  14. EvoSNP-DB: A database of genetic diversity in East Asian populations.

    Science.gov (United States)

    Kim, Young Uk; Kim, Young Jin; Lee, Jong-Young; Park, Kiejung

    2013-08-01

    Genome-wide association studies (GWAS) have become popular as an approach for the identification of large numbers of phenotype-associated variants. However, differences in genetic architecture and environmental factors mean that the effect of variants can vary across populations. Understanding population genetic diversity is valuable for the investigation of possible population specific and independent effects of variants. EvoSNP-DB aims to provide information regarding genetic diversity among East Asian populations, including Chinese, Japanese, and Korean. Non-redundant SNPs (1.6 million) were genotyped in 54 Korean trios (162 samples) and were compared with 4 million SNPs from HapMap phase II populations. EvoSNP-DB provides two user interfaces for data query and visualization, and integrates scores of genetic diversity (Fst and VarLD) at the level of SNPs, genes, and chromosome regions. EvoSNP-DB is a web-based application that allows users to navigate and visualize measurements of population genetic differences in an interactive manner, and is available online at [http://biomi.cdc.go.kr/EvoSNP/].

  15. Recalibration of the Global Registry of Acute Coronary Events risk score in a multiethnic Asian population.

    Science.gov (United States)

    Chan, Mark Y; Shah, Bimal R; Gao, Fei; Sim, Ling Ling; Chua, Terrance; Tan, Huay Cheem; Yeo, Tiong Cheng; Ong, Hean Yee; Foo, David; Goh, Ping Ping; Surrun, Soondal K; Pieper, Karen S; Granger, Christopher B; Koh, Tian Hai; Salim, Agus; Tai, E Shyong

    2011-08-01

    Acute myocardial infarction (AMI) is a leading cause of mortality in Asia. However, quantitative risk scores to predict mortality after AMI were developed without the participation of Asian countries. We evaluated the performance of the Global Registry of Acute Coronary Events (GRACE) in-hospital mortality risk score, directly and after recalibration, in a large Singaporean cohort representing 3 major Asian ethnicities. The GRACE cohort included 11,389 patients, predominantly of European descent, hospitalized for AMI or unstable angina from 2002 to 2003. The Singapore cohort included 10,100 Chinese, 3,005 Malay, and 2,046 Indian patients hospitalized for AMI from 2002 to 2005.Using the original GRACE score, predicted in-hospital mortality was 2.4% (Chinese), 2.0% (Malay), and 1.6% (Indian). However, observed in-hospital mortality was much greater at 9.8% (Chinese), 7.6% (Malay), and 6.4% (Indian). The c statistic for Chinese, Malays, and Indians was 0.86, 0.86, and 0.84, respectively, and the Hosmer-Lemeshow statistic was 250, 56, and 41, respectively. Recalibration of the GRACE score, using the mean-centered constants derived from the Singapore cohort, did not change the c statistic but substantially improved the Hosmer-Lemeshow statistic to 90, 24, and 18, respectively. The recalibrated GRACE score predicted in-hospital mortality as follows: 7.7% (Chinese), 6.0% (Malay), and 5.2% (Indian). In this large cohort of 3 major Asian ethnicities, the original GRACE score, derived from populations outside Asia, underestimated in-hospital mortality after AMI. Recalibration improved risk estimation substantially and may help adapt externally developed risk scores for local practice. Copyright © 2011 Mosby, Inc. All rights reserved.

  16. Vitamin D Status during Pregnancy in a Multi-Ethnic Population-Representative Swedish Cohort

    Directory of Open Access Journals (Sweden)

    Linnea Bärebring

    2016-10-01

    Full Text Available There is currently little information on changes in vitamin D status during pregnancy and its predictors. The aim was to study the determinants of change in vitamin D status during pregnancy and of vitamin D deficiency (<30 nmol/L in early pregnancy. Blood was drawn in the first (T1 and third trimester (T3. Serum 25-hydroxyvitamin D (25(OHD (N = 1985 was analysed by liquid chromatography tandem-mass spectrometry. Season-corrected 25(OHD was calculated by fitting cosine functions to the data. Mean (standard deviation 25(OHD was 64.5(24.5 nmol/L at T1 and 74.6(34.4 at T3. Mean age was 31.3(4.9 years, mean body mass index (BMI was 24.5(4.2 kg/m2 and 74% of the women were born in Sweden. Vitamin D deficiency was common among women born in Africa (51% and Asia (46% and prevalent in 10% of the whole cohort. Determinants of vitamin D deficiency at T1 were of non-North European origin, and had less sun exposure, lower vitamin D intake and lower age. Season-corrected 25(OHD increased by 11(23 nmol/L from T1 to T3. The determinants of season-corrected change in 25(OHD were origin, sun-seeking behaviour, clothing style, dietary vitamin D intake, vitamin D supplementation and recent travel <35° N. In conclusion, season-corrected 25(OHD concentration increased during pregnancy and depended partly on lifestyle factors. The overall prevalence of vitamin D deficiency was low but common among women born in Africa and Asia. Among them, the determinants of both vitamin D deficiency and change in season-corrected vitamin D status were fewer, indicating a smaller effect of sun exposure.

  17. BRCA1 and BRCA2 Germline Mutations in Asian and European Populations

    Directory of Open Access Journals (Sweden)

    Ute Hamann

    2017-02-01

    Full Text Available Women who carry a pathogenic mutation in the breast cancer susceptibility genes BRCA1 or BRCA2 (BRCA have markedly increased risks of developing breast and ovarian cancers during their lifetime. It has been estimated that their breast and ovarian cancer risks are in the range of 46-87% and 15-68%, respectively. Therefore it is of utmost clinical importance to identify BRCA mutation carriers in order to target unaffected women for prevention and/or close surveillance and to help affected women choose the best chemotherapy regimen. Genetic testing for BRCA germline mutations is expanding in clinical oncology centers worldwide. Given the high costs of complete BRCA gene screens, a lot of effort has been expended on deciding upon whom to test. Relevant issues involved in decision making include the prior probability of a woman having a BRCA mutation, which is a function of her age and her disease status, her ethnic group, and her family history of breast or ovarian cancer. The frequency and spectrum of mutations in these genes show considerable variation by ethnic groups and by geographic regions. Most studies have been conducted in European and North American populations, while studies in Asian, Hispanic, and African populations are fewer. In most populations, many BRCA mutations were identified, which were distributed all over the genes. However, in some populations, a relatively small number of specific BRCA mutations are recurrent and account for the majority of all mutations in that population. Many of the recurrent mutations are founder mutations, which were derived from a common ancestor. Founder mutations are present in Ashkenazi Jewish, European, and Islander (Faroe, Easter, and Pitcairn populations. Such mutations have also been identified in patients from several Asian, South American, and African countries. Population-specific genetic risk assessment and genetic mutation screening have been facilitated at low costs. Given that mutations

  18. Development and validation of a food frequency questionnaire for dietary intake assessment among multi-ethnic primary school-aged children.

    Science.gov (United States)

    Fatihah, Fadil; Ng, Boon Koon; Hazwanie, Husin; Norimah, A Karim; Shanita, Safii Nik; Ruzita, Abd Talib; Poh, Bee Koon

    2015-12-01

    This study aimed to develop and validate a food frequency questionnaire (FFQ) to assess habitual diets of multi-ethnic Malaysian children aged 7-12 years. A total of 236 primary school children participated in the development of the FFQ and 209 subjects participated in the validation study, with a subsample of 30 subjects participating in the reproducibility study. The FFQ, consisting of 94 food items from 12 food groups, was compared with a three-day dietary record (3DR) as the reference method. The reproducibility of the FFQ was assessed through repeat administration (FFQ2), seven days after the first administration (FFQ1). The results of the validation study demonstrated good acceptance of the FFQ. Mean intake of macronutrients in FFQ1 and 3DR correlated well, although the FFQ intake data tended to be higher. Cross-classification of nutrient intake between the two methods showed that < 7% of subjects were grossly misclassified. Moderate correlations noted between the two methods ranged from r = 0.310 (p < 0.001) for fat to r = 0.497 (p < 0.001) for energy. The reproducibility of the FFQ, as assessed by Cronbach's alpha, ranged from 0.61 (protein) to 0.70 (energy, carbohydrates and fat). Spearman's correlations between FFQ1 and FFQ2 ranged from rho = 0.333 (p = 0.072) for protein to rho = 0.479 (p < 0.01) for fat. These findings indicate that the FFQ is valid and reliable for measuring the average intake of energy and macronutrients in a population of multi-ethnic children aged 7-12 years in Malaysia.

  19. Anatomic Variation in Morphometry of Human Coracoid Process among Asian Population

    Directory of Open Access Journals (Sweden)

    Manal Fathi

    2017-01-01

    Full Text Available Ethnic origin plays an important role in bone morphometry. Studies examining the influence of coracoid process have focused primarily on adults and have not included people from diverse Asian ethnic backgrounds. Our goal was to explore ethnic differences in morphometry of coracoid among Asian population. We performed morphometric measurements of coracoid process on cadaveric shoulders and shoulder CT scans from 118 specimens. The cadaveric sample included Indian (46%, Chinese (27%, and Myanmarese (27% subjects, while the CT scans sample included Chinese (67% and Malay (33% subjects. The morphometric measurements were performed using digital caliper and software developed at Golden Horses Health Sanctuary (GHHS. In the Indian cadaveric shoulders, the coracoid process is better developed than the other groups with the exception of the tip width of coracoid process. There are significant differences in almost all measurements (P<0.05 between the ethnic groups. On the other hand, the morphometry of coracoid process from CT scans data is bigger in Chinese than Malay subjects when stratified by sex (P<0.05. Moreover, in all morphometric measurements, the females had smaller measurements than males (P<0.05. Understanding such differences is important in anatomy, forensic and biological identity, and orthopaedic and shoulder surgeries.

  20. Anatomic Variation in Morphometry of Human Coracoid Process among Asian Population.

    Science.gov (United States)

    Fathi, Manal; Cheah, Pike-See; Ahmad, Umar; Nasir, M Nizlan; San, Aye Aye; Abdul Rahim, Ezamin; Hussin, Paisal; Mahmud, Rozi; Othman, Fauziah

    2017-01-01

    Ethnic origin plays an important role in bone morphometry. Studies examining the influence of coracoid process have focused primarily on adults and have not included people from diverse Asian ethnic backgrounds. Our goal was to explore ethnic differences in morphometry of coracoid among Asian population. We performed morphometric measurements of coracoid process on cadaveric shoulders and shoulder CT scans from 118 specimens. The cadaveric sample included Indian (46%), Chinese (27%), and Myanmarese (27%) subjects, while the CT scans sample included Chinese (67%) and Malay (33%) subjects. The morphometric measurements were performed using digital caliper and software developed at Golden Horses Health Sanctuary (GHHS). In the Indian cadaveric shoulders, the coracoid process is better developed than the other groups with the exception of the tip width of coracoid process. There are significant differences in almost all measurements ( P Chinese than Malay subjects when stratified by sex ( P < 0.05). Moreover, in all morphometric measurements, the females had smaller measurements than males ( P < 0.05). Understanding such differences is important in anatomy, forensic and biological identity, and orthopaedic and shoulder surgeries.

  1. Population Structure of Pseudocercospora fijiensis in Costa Rica Reveals Shared Haplotype Diversity with Southeast Asian Populations.

    Science.gov (United States)

    Saville, Amanda; Charles, Melodi; Chavan, Suchitra; Muñoz, Miguel; Gómez-Alpizar, Luis; Ristaino, Jean Beagle

    2017-12-01

    Pseudocercospora fijiensis is the causal pathogen of black Sigatoka, a devastating disease of banana that can cause 20 to 80% yield loss in the absence of fungicides in banana crops. The genetic structure of populations of P. fijiensis in Costa Rica was examined and compared with Honduran and global populations to better understand migration patterns and inform management strategies. In total, 118 isolates of P. fijiensis collected from Costa Rica and Honduras from 2010 to 2014 were analyzed using multilocus genotyping of six loci and compared with a previously published global dataset of populations of P. fijiensis. The Costa Rican and Honduran populations shared haplotype diversity with haplotypes from Southeast Asia, Oceania, and the Americas but not Africa for all but one of the six loci studied. Gene flow and shared haplotype diversity was found in Honduran and Costa Rican populations of the pathogen. The data indicate that the haplotypic diversity observed in Costa Rican populations of P. fijiensis is derived from dispersal from initial outbreak sources in Honduras and admixtures between genetically differentiated sources from Southeast Asia, Oceania, and the Americas.

  2. Inter-Population Variability of Endosymbiont Densities in the Asian Citrus Psyllid (Diaphorina citri Kuwayama).

    Science.gov (United States)

    Chu, Chia-Ching; Gill, Torrence A; Hoffmann, Mark; Pelz-Stelinski, Kirsten S

    2016-05-01

    The Asian citrus psyllid (Diaphorina citri Kuwayama) is an insect pest capable of transmitting Candidatus Liberibacter asiaticus (CLas), the causal agent of citrus greening in North America. D. citri also harbors three endosymbionts, Wolbachia, Candidatus Carsonella ruddii, and Candidatus Profftella armatura, which may influence D. citri physiology and fitness. Although genomic researches on these bacteria have been conducted, much remains unclear regarding their ecology and inter-population variability in D. citri. The present work examined the densities of each endosymbiont in adult D. citri sampled from different populations using quantitative PCR. Under field conditions, the densities of all three endosymbionts positively correlated with each other, and they are associated with D. citri gender and locality. In addition, the infection density of CLas also varied across populations. Although an analysis pooling D. citri from different populations showed that CLas-infected individuals tended to have lower endosymbiont densities compared to uninfected individuals, the difference was not significant when the population was included as a factor in the analysis, suggesting that other population-specific factors may have stronger effects on endosymbiont densities. To determine whether there is a genetic basis to the density differences, endosymbiont densities between aged CLas-negative females of two D. citri populations reared under standardized laboratory conditions were compared. Results suggested that inter-population variability in Wolbachia infection density is associated with the genotypes of the endosymbiont or the host. Findings from this work could facilitate understanding of D. citri-bacterial associations that may benefit the development of approaches for managing citrus greening, such as prevention of CLas transmission.

  3. Thyroid disorders and breast cancer risk in Asian population: a nationwide population-based case-control study in Taiwan.

    Science.gov (United States)

    Weng, Chien-Hsiang; Chen, Yi-Huei; Lin, Ching-Heng; Luo, Xun; Lin, Tseng-Hsi

    2018-03-30

    To evaluate whether hyperthyroidism or hypothyroidism increases the risk of subsequent breast cancer in an Asian population. Nationwide population-based case-control study. All healthcare facilities in Taiwan. A total of 103 466 women (mean age 53.3 years) were enrolled. 51 733 adult women with newly diagnosed primary breast cancer without a previous cancer history between 2006 and 2011 were identified and included in our study. 51 733 women with no cancer diagnosis prior to the index date were age matched as controls. Diagnosis of hyperthyroidism or hypothyroidism prior to the diagnosis of breast cancer or the same index date was identified, age, histories of thyroid disease treatment, oestrogen use and radioactive iodine treatment were adjusted. To identify risk differences in developing breast cancer among patients with a medical history of hyperthyroidism or hypothyroidism. There was a significantly increased risk of breast cancer in women with hyperthyroidism under the age of 55 years (age hypothyroidism also showed an increased risk of breast cancer (OR 1.19, P=0.029) without statistical significance after stratification by age group (age 55 years). Treatment for thyroid disorders did not alter the association in subgroup analyses (P=0.857; 0.262, respectively). Asian women under 55 years of age with history of hyperthyroidism have a significantly increased risk of breast cancer regardless of treatment. Women with history of hypothyroidism may also have an increased risk. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Establishing multiple omics baselines for three Southeast Asian populations in the Singapore Integrative Omics Study.

    Science.gov (United States)

    Saw, Woei-Yuh; Tantoso, Erwin; Begum, Husna; Zhou, Lihan; Zou, Ruiyang; He, Cheng; Chan, Sze Ling; Tan, Linda Wei-Lin; Wong, Lai-Ping; Xu, Wenting; Moong, Don Kyin Nwe; Lim, Yenly; Li, Bowen; Pillai, Nisha Esakimuthu; Peterson, Trevor A; Bielawny, Tomasz; Meikle, Peter J; Mundra, Piyushkumar A; Lim, Wei-Yen; Luo, Ma; Chia, Kee-Seng; Ong, Rick Twee-Hee; Brunham, Liam R; Khor, Chiea-Chuen; Too, Heng Phon; Soong, Richie; Wenk, Markus R; Little, Peter; Teo, Yik-Ying

    2017-09-21

    The Singapore Integrative Omics Study provides valuable insights on establishing population reference measurement in 364 Chinese, Malay, and Indian individuals. These measurements include > 2.5 millions genetic variants, 21,649 transcripts expression, 282 lipid species quantification, and 284 clinical, lifestyle, and dietary variables. This concept paper introduces the depth of the data resource, and investigates the extent of ethnic variation at these omics and non-omics biomarkers. It is evident that there are specific biomarkers in each of these platforms to differentiate between the ethnicities, and intra-population analyses suggest that Chinese and Indians are the most biologically homogeneous and heterogeneous, respectively, of the three groups. Consistent patterns of correlations between lipid species also suggest the possibility of lipid tagging to simplify future lipidomics assays. The Singapore Integrative Omics Study is expected to allow the characterization of intra-omic and inter-omic correlations within and across all three ethnic groups through a systems biology approach.The Singapore Genome Variation projects characterized the genetics of Singapore's Chinese, Malay, and Indian populations. The Singapore Integrative Omics Study introduced here goes further in providing multi-omic measurements in individuals from these populations, including genetic, transcriptome, lipidome, and lifestyle data, and will facilitate the study of common diseases in Asian communities.

  5. Comparative efficacy of Rubini, Jeryl-Lynn and Urabe mumps vaccine in an Asian population.

    Science.gov (United States)

    Ong, Gary; Goh, Kee Tai; Ma, Stefan; Chew, Suok Kai

    2005-11-01

    The comparative efficacy of the three mumps vaccine strains (Jeryl-Lynn, Urabe and Rubini) was conducted in an Asian population from data arising from an epidemiological investigation of seven institutional outbreaks of mumps in Singapore. Demographic information (gender, age, ethnic group), clinical presentation and vaccination history (date and place of mumps vaccination, type of mumps vaccine received) of all children who attended the six childcare centres and one primary school where outbreaks of 20 or more cases of mumps occurred in 1999 were collected. The attack rate of the unvaccinated group and the attack rates of the vaccine groups (for each vaccine strain) were determined and the vaccine efficacy of the three vaccines calculated. The vaccine efficacy of the Jeryl-Lynn strain, Urabe strain and Rubini strain mumps vaccine were 80.7, 54.4 and -55.3%, respectively. Rubini strain mumps vaccine conferred no protection and has since been deregistered in Singapore.

  6. Shovel-shaped incisors and associated invagination in some Asian and African populations.

    Science.gov (United States)

    Kharat, D U; Saini, T S; Mokeem, S

    1990-08-01

    Shovelling of the incisors is considered to be a polygenic inheritable trait. Shovelling differs considerably between groups of racial populations but is relatively stable within each group. Presence or absence of shovelling helps in racial identification and in exploration of ancestry. Periapical radiographs of patients of several nationalities from Asian and African continents were obtained. Shovelling and invaginations associated with the shovel-shaped incisors was studied according to nationality. Results indicated that the incidence of shovelling in Syrians, Jordanians, Palestinians and Filipinos was 5-6 per cent. In Saudi Arabians, Pakistanis and Indians, the incidence of shovelling was 10-12 per cent. Among Yemenis, Sudanese and Egyptians, the incidence of shovelling was 20-25 percent. The occurrence of invaginations in shovel-shaped incisors was 11 per cent.

  7. Association of Age, Sex, Body Size and Ethnicity with Electrocardiographic Values in Community-based Older Asian Adults.

    Science.gov (United States)

    Tan, Eugene S J; Yap, Jonathan; Xu, Chang Fen; Feng, Liang; Nyunt, Shwe Zin; Santhanakrishnan, Rajalakshmi; Chan, Michelle M Y; Seow, Swee Chong; Ching, Chi Keong; Yeo, Khung Keong; Richards, A Mark; Ng, Tze Pin; Lim, Toon Wei; Lam, Carolyn S P

    2016-07-01

    Existing electrocardiographic (ECG) reference values were derived in middle-aged Caucasian adults. We aimed to assess the association of age, sex, body size and ethnicity on ECG parameters in a multi-ethnic Asian population. Resting 12-lead ECG and anthropometric measurements were performed in a community-based cohort of 3777 older Asians (age 64.7±9.1 years, 1467 men, 88.8% Chinese, 7.7% Malay, 3.5% Indian, body mass index [BMI] 24.0±3.9kg/m(2)). Men had longer PR interval, wider QRS, shorter QTc interval and taller SV3. In both sexes, older age was associated with longer PR interval, wider QRS, larger R aVL and more leftward QRS axis, while higher BMI was associated with longer PR interval, wider QRS, larger RaVL and more negative QRS axis. There were significant inter-ethnic differences in QRS duration among men, as well as in PR and QTc intervals among women (all adjusted p<0.05). Findings were similar in a healthy subset of 1158 adults (age 61.2±9.1 years, 365 men) without cardiovascular risk factors. These first community-based ECG data in multi-ethnic older Asians highlight the independent effects of age, sex, body size and ethnicity on ECG parameters. Copyright © 2016 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

  8. Utilizing a diabetic registry to manage diabetes in a low-income Asian American population.

    Science.gov (United States)

    Seto, Winnie; Turner, Barbara S; Champagne, Mary T; Liu, Lynn

    2012-08-01

    Racial and income disparities persist in diabetes management in America. One third of African and Hispanic Americans with diabetes receive the recommended diabetes services (hemoglobin A1c [A1c] testing, retinal and foot examinations) shown to reduce diabetes complications and mortality, compared to half of whites with diabetes. National data for Asian Americans are limited, but studies suggest that those with language and cultural barriers have difficulty accessing health services. A diabetic registry has been shown to improve process and clinical outcomes in a population with diabetes. This study examined whether a community center that serves primarily low-income Asian American immigrants in Santa Clara County, California, could improve diabetes care and outcomes by implementing a diabetic registry. The registry was built using the Access 2007 software program. A total of 580 patients with diabetes were identified by reviewing charts, the appointment database, and reimbursement records from Medicaid, Medicare, and private insurance companies. Utilizing the registry, medical assistants contacted patients for follow-up appointments, and medical providers checked and tracked the patients' A1c results. Among the 431 patients who returned for treatment, the mean A1c was reduced from 7.27% to 6.97% over 8 months (P<0.001). Although 10.8% of the patients changed from controlled to uncontrolled diabetes post intervention, 32.6% of patients with uncontrolled diabetes converted to controlled diabetes (P<0.001). The diabetes control rate improved from 47% to 59% at the end of the study. This study demonstrated that a diabetic registry is an effective tool to manage an underserved population with diabetes, thereby reducing disparities in diabetes management.

  9. Midlife crisis perceptions, experiences, help-seeking, and needs among multi-ethnic malaysian women.

    Science.gov (United States)

    Wong, Li Ping; Awang, Halimah; Jani, Rohana

    2012-01-01

    In the present study, researchers explored attitudes toward midlife crises, experience with midlife crises, help-seeking, and needs among multi-ethnic Malaysian women. A total of 14 focus group discussions were conducted with 89 Malaysian women of different ages and socioeconomic backgrounds. Women expressed concern over physical aging and decline in their physical functional health. Having a midlife crisis was frequently reported. Issues that were frequently reported to trigger a midlife crisis, such as empty nest syndrome, impact of aging on sexual and reproductive function, extended parenthood, caring for aging or ill parents, and career challenges were noted by the study participants (listed here in order of most to least frequently reporting of these themes across the group discussions). Overall, these issues were associated with attitudes about aging. A comparatively less open attitude toward sexual attitudes and help-seeking for sexual problems were found among the Malay and Indian women. This may imply that intervention to increase positive attitudes concerning both sexuality and help-seeking intentions should be culturally specific. The use of religious coping for comfort and consolation was frequently reported; therefore, those providing midlife crisis prevention and intervention programs should consider involving faith-based interventions in the Malaysian setting.

  10. Toxic stress and protective factors in multi-ethnic school age children: A research protocol.

    Science.gov (United States)

    Condon, Eileen M; Sadler, Lois S; Mayes, Linda C

    2018-04-01

    Exposure to stressful environments in early childhood can cause a toxic stress response and lead to poor health outcomes, including obesity, cardiac disease, diabetes, and mental illness. In animals and maltreated children, the presence of a nurturing caregiver can buffer against the physiological disruptions associated with a toxic stress response; however, the specific caregiver and parenting characteristics that best promote a protective relationship in humans remain largely unexplored, particularly in families living in high-risk environments. In this study, framed in an ecobiodevelopmental (EBD) model, a cross-sectional design is being used to study 54 multi-ethnic, urban maternal-child dyads with children at early school age (4-9 years). Mothers' past experiences, mental health, and caregiving patterns and children's hair cortisol, C-reactive protein, pro-inflammatory cytokines, blood pressure, BMI, behavior, and school performance are being analyzed to identify maternal characteristics that may protect against children's toxic stress response in families at high risk for exposure to stressors such as poverty, trauma, or exposure to violence. © 2018 Wiley Periodicals, Inc.

  11. The effects of presentation methods and semantic information on multi-ethnicity face recognition

    Directory of Open Access Journals (Sweden)

    Kaarel Rundu

    2012-01-01

    Full Text Available Studies have shown that own-race faces are more accurately recognised than other-race faces. The present study examined the effects of own- and other-race face recognition when different ethnicity targets are presented to the participants together. Also the effect of semantic information on the recognition of different race faces was examined. The participants (N = 234 were presented with photos of own-race and other-race faces. For some participants the faces were presented with stereotypical names and for some not. As hypothesized, own-race faces were better recognised in target-present lineup and more correctly rejected in target-absent lineup than other-race faces. Concerning presentation method, both own-race and other-race faces were more correctly identified in target-present simultaneous than in target-present sequential lineups. No effects of stereotypical names on face recognition were found. The findings suggest that identifying multi-ethnicity perpetrators is a problematic and difficult task.

  12. Circulating cellular adhesion molecules and risk of diabetes: the Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Pankow, J S; Decker, P A; Berardi, C; Hanson, N Q; Sale, M; Tang, W; Kanaya, A M; Larson, N B; Tsai, M Y; Wassel, C L; Bielinski, S J

    2016-07-01

    To test the hypothesis that soluble cellular adhesion molecules would be positively and independently associated with risk of diabetes. Soluble levels of six cellular adhesion molecules (ICAM-1, E-selectin, VCAM-1, E-cadherin, L-selectin and P-selectin) were measured in participants in the Multi-Ethnic Study of Atherosclerosis, a prospective cohort study. Participants were then followed for up to 10 years to ascertain incident diabetes. Sample sizes ranged from 826 to 2185. After adjusting for age, sex, race/ethnicity, BMI and fasting glucose or HbA1c , four cellular adhesion molecules (ICAM-1, E-selectin, VCAM-1 and E-cadherin) were positively associated with incident diabetes and there was a statistically significant trend across quartiles. Comparing the incidence of diabetes in the highest and lowest quartiles of each cellular adhesion molecule, the magnitude of association was largest for E-selectin (hazard ratio 2.49; 95% CI 1.26-4.93) and ICAM-1 (hazard ratio 1.76; 95% CI 1.22-2.55) in fully adjusted models. Tests of effect modification by racial/ethnic group and sex were not statistically significant for any of the cellular adhesion molecules (P > 0.05). The finding of significant associations between multiple cellular adhesion molecules and incident diabetes may lend further support to the hypothesis that microvascular endothelial dysfunction contributes to risk of diabetes. © 2016 Diabetes UK.

  13. Sex-specific genetic diversity is shaped by cultural factors in Inner Asian human populations.

    Science.gov (United States)

    Marchi, Nina; Hegay, Tatyana; Mennecier, Philippe; Georges, Myriam; Laurent, Romain; Whitten, Mark; Endicott, Philipp; Aldashev, Almaz; Dorzhu, Choduraa; Nasyrova, Firuza; Chichlo, Boris; Ségurel, Laure; Heyer, Evelyne

    2017-04-01

    Sex-specific genetic structures have been previously documented worldwide in humans, even though causal factors have not always clearly been identified. In this study, we investigated the impact of ethnicity, geography and social organization on the sex-specific genetic structure in Inner Asia. Furthermore, we explored the process of ethnogenesis in multiple ethnic groups. We sampled DNA in Central and Northern Asia from 39 populations of Indo-Iranian and Turkic-Mongolic native speakers. We focused on genetic data of the Y chromosome and mitochondrial DNA. First, we compared the frequencies of haplogroups to South European and East Asian populations. Then, we investigated the genetic differentiation for eight Y-STRs and the HVS1 region, and tested for the effect of geography and ethnicity on such patterns. Finally, we reconstructed the male demographic history, inferred split times and effective population sizes of different ethnic groups. Based on the haplogroup data, we observed that the Indo-Iranian- and Turkic-Mongolic-speaking populations have distinct genetic backgrounds. However, each population showed consistent mtDNA and Y chromosome haplogroups patterns. As expected in patrilocal populations, we found that the Y-STRs were more structured than the HVS1. While ethnicity strongly influenced the genetic diversity on the Y chromosome, geography better explained that of the mtDNA. Furthermore, when looking at various ethnic groups, we systematically found a genetic split time older than historical records, suggesting a cultural rather than biological process of ethnogenesis. This study highlights that, in Inner Asia, specific cultural behaviors, especially patrilineality and patrilocality, leave a detectable signature on the sex-specific genetic structure. © 2017 Wiley Periodicals, Inc.

  14. Population genomics reveals that an anthropophilic population of Aedes aegypti mosquitoes in West Africa recently gave rise to American and Asian populations of this major disease vector.

    Science.gov (United States)

    Crawford, Jacob E; Alves, Joel M; Palmer, William J; Day, Jonathan P; Sylla, Massamba; Ramasamy, Ranjan; Surendran, Sinnathamby N; Black, William C; Pain, Arnab; Jiggins, Francis M

    2017-02-28

    The mosquito Aedes aegypti is the main vector of dengue, Zika, chikungunya and yellow fever viruses. This major disease vector is thought to have arisen when the African subspecies Ae. aegypti formosus evolved from being zoophilic and living in forest habitats into a form that specialises on humans and resides near human population centres. The resulting domestic subspecies, Ae. aegypti aegypti, is found throughout the tropics and largely blood-feeds on humans. To understand this transition, we have sequenced the exomes of mosquitoes collected from five populations from around the world. We found that Ae. aegypti specimens from an urban population in Senegal in West Africa were more closely related to populations in Mexico and Sri Lanka than they were to a nearby forest population. We estimate that the populations in Senegal and Mexico split just a few hundred years ago, and we found no evidence of Ae. aegypti aegypti mosquitoes migrating back to Africa from elsewhere in the tropics. The out-of-Africa migration was accompanied by a dramatic reduction in effective population size, resulting in a loss of genetic diversity and rare genetic variants. We conclude that a domestic population of Ae. aegypti in Senegal and domestic populations on other continents are more closely related to each other than to other African populations. This suggests that an ancestral population of Ae. aegypti evolved to become a human specialist in Africa, giving rise to the subspecies Ae. aegypti aegypti. The descendants of this population are still found in West Africa today, and the rest of the world was colonised when mosquitoes from this population migrated out of Africa. This is the first report of an African population of Ae. aegypti aegypti mosquitoes that is closely related to Asian and American populations. As the two subspecies differ in their ability to vector disease, their existence side by side in West Africa may have important implications for disease transmission.

  15. Population genomics reveals that an anthropophilic population of Aedes aegypti mosquitoes in West Africa recently gave rise to American and Asian populations of this major disease vector

    KAUST Repository

    Crawford, Jacob E.

    2017-02-20

    BackgroundThe mosquito Aedes aegypti is the main vector of dengue, Zika, chikungunya and yellow fever viruses. This major disease vector is thought to have arisen when the African subspecies Ae. aegypti formosus evolved from being zoophilic and living in forest habitats into a form that specialises on humans and resides near human population centres. The resulting domestic subspecies, Ae. aegypti aegypti, is found throughout the tropics and largely blood-feeds on humans.ResultsTo understand this transition, we have sequenced the exomes of mosquitoes collected from five populations from around the world. We found that Ae. aegypti specimens from an urban population in Senegal in West Africa were more closely related to populations in Mexico and Sri Lanka than they were to a nearby forest population. We estimate that the populations in Senegal and Mexico split just a few hundred years ago, and we found no evidence of Ae. aegypti aegypti mosquitoes migrating back to Africa from elsewhere in the tropics. The out-of-Africa migration was accompanied by a dramatic reduction in effective population size, resulting in a loss of genetic diversity and rare genetic variants.ConclusionsWe conclude that a domestic population of Ae. aegypti in Senegal and domestic populations on other continents are more closely related to each other than to other African populations. This suggests that an ancestral population of Ae. aegypti evolved to become a human specialist in Africa, giving rise to the subspecies Ae. aegypti aegypti. The descendants of this population are still found in West Africa today, and the rest of the world was colonised when mosquitoes from this population migrated out of Africa. This is the first report of an African population of Ae. aegypti aegypti mosquitoes that is closely related to Asian and American populations. As the two subspecies differ in their ability to vector disease, their existence side by side in West Africa may have important implications for

  16. Kin and birth order effects on male child mortality: three East Asian populations, 1716-1945.

    Science.gov (United States)

    Dong, Hao; Manfredini, Matteo; Kurosu, Satomi; Yang, Wenshan; Lee, James Z

    2017-03-01

    Human child survival depends on adult investment, typically from parents. However, in spite of recent research advances on kin influence and birth order effects on human infant and child mortality, studies that directly examine the interaction of kin context and birth order on sibling differences in child mortality are still rare. Our study supplements this literature with new findings from large-scale individual-level panel data for three East Asian historical populations from northeast China (1789-1909), northeast Japan (1716-1870), and north Taiwan (1906-1945), where preference for sons and first-borns is common. We examine and compare male child mortality risks by presence/absence of co-resident parents, grandparents, and other kin, as well as their interaction effects with birth order. We apply discrete-time event-history analysis on over 172,000 observations of 69,125 boys aged 1-9 years old. We find that in all three populations, while the presence of parents is important for child survival, it is more beneficial to first/early-borns than to later-borns. Effects of other co-resident kin are however null or inconsistent between populations. Our findings underscore the importance of birth order in understanding how differential parental investment may produce child survival differentials between siblings.

  17. Improving the Psychosocial Work Environment at Multi-Ethnic Workplaces: A Multi-Component Intervention Strategy in the Cleaning Industry

    OpenAIRE

    Smith, Louise Hardman; Hviid, Kirsten; Frydendall, Karen Bo; Flyvholm, Mari-Ann

    2013-01-01

    Global labour migration has increased in recent years and immigrant workers are often recruited into low status and low paid jobs such as cleaning. Research in a Danish context shows that immigrants working in the cleaning industry often form social networks based on shared languages and backgrounds, and that conflict between different ethnic groups may occur. This paper evaluates the impact of a multi-component intervention on the psychosocial work environment at a multi-ethnic Danish workpl...

  18. Major Population Expansion of East Asians Began before Neolithic Time: Evidence of mtDNA Genomes

    Science.gov (United States)

    Qin, Zhen-Dong; Wang, Yi; Tan, Jing-Ze; Li, Hui; Jin, Li

    2011-01-01

    It is a major question in archaeology and anthropology whether human populations started to grow primarily after the advent of agriculture, i.e., the Neolithic time, especially in East Asia, which was one of the centers of ancient agricultural civilization. To answer this question requires an accurate estimation of the time of lineage expansion as well as that of population expansion in a population sample without ascertainment bias. In this study, we analyzed all available mtDNA genomes of East Asians ascertained by random sampling, a total of 367 complete mtDNA sequences generated by the 1000 Genome Project, including 249 Chinese (CHB, CHD, and CHS) and 118 Japanese (JPT). We found that major mtDNA lineages underwent expansions, all of which, except for two JPT-specific lineages, including D4, D4b2b, D4a, D4j, D5a2a, A, N9a, F1a1'4, F2, B4, B4a, G2a1 and M7b1'2'4, occurred before 10 kya, i.e., before the Neolithic time (symbolized by Dadiwan Culture at 7.9 kya) in East Asia. Consistent to this observation, the further analysis showed that the population expansion in East Asia started at 13 kya and lasted until 4 kya. The results suggest that the population growth in East Asia constituted a need for the introduction of agriculture and might be one of the driving forces that led to the further development of agriculture. PMID:21998705

  19. Association of a polymorphism of BTN2A1 with dyslipidemia in East Asian populations

    Science.gov (United States)

    FUJIMAKI, TETSUO; KATO, KIMIHIKO; OGURI, MITSUTOSHI; YOHIDA, TETSURO; HORIBE, HIDEKI; YOKOI, KIYOSHI; WATANABE, SACHIRO; SATOH, KEI; AOYAGI, YUKITOSHI; TANAKA, MASASHI; YOSHIDA, HIROTO; SHINKAI, SHOJI; NOZAWA, YOSHINORI; SHIN, DONG-JIK; LEE, JONG HO; JANG, YANGSOO; YAMADA, YOSHIJI

    2011-01-01

    We previously identified rs6929846 of the butyrophilin, subfamily 2, member A1 gene (BTN2A1) as a susceptibility locus for myocardial infarction in Japanese individuals by a genome-wide association study. The aim of the present study was to examine the relation of the rs6929846 polymorphism of BTN2A1 to dyslipidemia in Japanese and Korean populations, given that dyslipidemia is an important risk factor for myocardial infarction. A total of 10,953 individuals from three independent subject panels were examined. The relations of the rs6929846 polymorphism of BTN2A1 to serum concentrations of triglycerides, high-density lipoprotein (HDL)-cholesterol and low-density lipoprotein (LDL)-cholesterol were examined in each subject panel. The C→T polymorphism (rs6929846) of BTN2A1 was significantly associated with serum concentrations of triglycerides in Japanese subject panels A (P=0.0004) and B (P=0.0010), and in the Korean population (P=0.0095), with the minor T allele being related to an increased serum concentration of triglycerides. The rs6929846 was associated with serum concentrations of HDL-cholesterol in Japanese subject panels A (P=0.0047) and B (P=0.0015), with the T allele being related to a decreased serum concentration of HDL-cholesterol, but not in the Korean population. This polymorphism was associated with the serum concentration of LDL-cholesterol only in Japanese subject panel B (P=0.0059), with the T allele being related to an increased serum concentration of LDL-cholesterol. The results suggest that BTN2A1 may be a susceptibility gene for hypertriglyceridemia in East Asian populations and for low serum HDL-cholesterol in the Japanese population. PMID:22977569

  20. A systematic review of knowledge, attitudes and beliefs about malaria among the South Asian population

    Directory of Open Access Journals (Sweden)

    Krishna Regmi

    2016-05-01

    Full Text Available Background: Malaria is one of the deadliest mosquito-borne diseases in the world. More than 80% of the total populations are at risk of malaria in the 22 countries in Asia and the Pacific. South Asia alone is home to an estimated 1.4 billion people at risk of contracting malaria. Despite the remarkable progress in reducing the burden of malaria, evidence of the disease based on knowledge of the social and cultural contexts from a South Asian perspective is limited. Our objective was to understand the knowledge, attitudes and beliefs about malaria in South Asian communities. Methodology: We conducted a systematic literature review, searching six databases, between 1990 and 2015, focusing on knowledge, attitudes and beliefs about malaria in South Asia. Databases were searched using both ‘free terms’ and ‘index terms’ funnelled using Boolean operators and truncations. Inclusion and exclusion criteria were set, and included papers were scrutinised, employing a critical appraisal tool to find the best available evidences to support the study purpose. Results and discussion: Evidence from 32 articles (26 quantitative, four qualitative and two mixed methods. General knowledge and awareness of the disease, its transmission, and control and preventative measures were generally found to be lacking amongst both the general public and healthcare professionals. In addition, the study shows that poor socio-economic factors – including limited access to services due to poor/limited availability – and issues of affordability are considered as major risk factors. Conclusion: This review suggests the importance of increasing health awareness, mobilising the local or community healthcare professionals, for prevention as well as early detection and effective treatment of malaria among people who are at risk. Malaria is also a disease associated with poverty and socio-cultural factors; therefore, strong political will, wider partnerships between health

  1. Population genetics of the Asian tiger mosquito Aedes albopictus, an invasive vector of human diseases

    Science.gov (United States)

    Goubert, C; Minard, G; Vieira, C; Boulesteix, M

    2016-01-01

    The Asian tiger mosquito Aedes albopictus is currently one of the most threatening invasive species in the world. Native to Southeast Asia, the species has spread throughout the world in the past 30 years and is now present in every continent but Antarctica. Because it was the main vector of recent Dengue and Chikungunya outbreaks, and because of its competency for numerous other viruses and pathogens such as the Zika virus, A. albopictus stands out as a model species for invasive diseases vector studies. A synthesis of the current knowledge about the genetic diversity of A. albopictus is needed, knowing the interplays between the vector, the pathogens, the environment and their epidemiological consequences. Such resources are also valuable for assessing the role of genetic diversity in the invasive success. We review here the large but sometimes dispersed literature about the population genetics of A. albopictus. We first debate about the experimental design of these studies and present an up-to-date assessment of the available molecular markers. We then summarize the main genetic characteristics of natural populations and synthesize the available data regarding the worldwide structuring of the vector. Finally, we pinpoint the gaps that remain to be addressed and suggest possible research directions. PMID:27273325

  2. Prevalence, Correlates, and Impact of Uncorrected Presbyopia in a Multiethnic Asian Population.

    Science.gov (United States)

    Kidd Man, Ryan Eyn; Fenwick, Eva Katie; Sabanayagam, Charumathi; Li, Ling-Jun; Gupta, Preeti; Tham, Yih-Chung; Wong, Tien Yin; Cheng, Ching-Yu; Lamoureux, Ecosse Luc

    2016-08-01

    To examine the prevalence, correlates, and impact of uncorrected presbyopia on vision-specific functioning (VF) in a multiethnic Asian population. Population-based cross-sectional study. We included 7890 presbyopic subjects (3909 female; age range, 40-86 years) of Malay, Indian, and Chinese ethnicities from the Singapore Epidemiology of Eye Disease study. Presbyopia was classified as corrected and uncorrected based on self-reported near correction use. VF was assessed with the VF-11 questionnaire validated using Rasch analysis. Multivariable logistic and linear regression models were used to investigate the associations of sociodemographic and clinical parameters with uncorrected presbyopia, and its impact on VF, respectively. As myopia may mitigate the impact of noncorrection, we performed a subgroup analysis on myopic subjects only (n = 2742). In total, 2678 of 7890 subjects (33.9%) had uncorrected presbyopia. In multivariable models, younger age, male sex, Malay and Indian ethnicities, presenting distance visual impairment (any eye), and lower education and income levels were associated with higher odds of uncorrected presbyopia (all P Malay and Indian ethnicities are needed. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. The Effect of Parents' Ethnic Socialization Practices on Ethnic Identity, Self-Esteem and Psychological Adjustment of Multi Ethnic Children in Malaysia

    OpenAIRE

    Chua Bee Seok; Rosnah Ismail; Jasmine Adela Mutang; Shaziah Iqbal; Nur Farhana Ardillah Aftar; Alfred Chan Huan Zhi; Ferlis Bin Bahari; Lailawati Madlan; Hon Kai Yee

    2012-01-01

    The present study aims to explore the role of parents' ethnic socialization practices contributes to the ethnic identity development, self-esteem and psychological adjustment of multi ethnic children in Sabah, Malaysia. A total of 342 multi ethnic children (age range = 10 years old to 14 years old; mean age = 12.65 years, SD = 0.88) and their parents participated in the present study. The modified version of Multi group Ethnic Identity Measure (MEIM), The Familial Ethnic ...

  4. Sociodemographic Correlates of Cognition in the Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Fitzpatrick, Annette L; Rapp, Stephen R; Luchsinger, José; Hill-Briggs, Felicia; Alonso, Alvaro; Gottesman, Rebecca; Lee, Hochang; Carnethon, Mercedes; Liu, Kiang; Williams, Kayleen; Sharrett, A Richey; Frazier-Wood, Alexis; Lyketsos, Constantine; Seeman, Teresa

    2015-07-01

    To describe the methodology utilized to evaluate cognitive function in the Multi-Ethnic Study of Atherosclerosis (MESA) and to present preliminary results by age, sex, and race/ethnicity. Cross-sectional measurements of a prospective observational cohort. Residents of 6 U.S. communities free of cardiovascular disease at baseline (2000-02). 4,591 adults who completed the fifth MESA clinical examination in 2011-12; mean age 70.3 (SD: 9.5) years, 53.1% women, 40.7% non-Hispanic white, 26.4% non-Hispanic black, 21.4% Hispanic, and 11.5% Chinese. The cognitive battery consisted of the Cognitive Abilities Screening Instrument (version 2) to evaluate global cognition, the Digit Symbol Code for processing speed and Digit Spans Forward and Backward to assess memory. Demographic, socioeconomic, and cultural covariates were also collected for descriptive statistics and multivariate modeling. Associations between socioeconomic factors and cognition revealed that age, race/ethnicity, education, occupational status, household income, health insurance type, household size, place of birth, years and generation in U.S., and the presence of the ApoE4 allele were significantly associated with performance on the cognitive tests, although patterns varied by specific test, racial/ethnicity, and sociocultural factors. As many of the influencing cultural and socioeconomic factors measured here are complex, multifactorial, and may not be adequately quantified, caution has been recommended with regard to comparison and interpretation of racial/ethnic group performance differences from these cross-sectional models. These data provide a baseline for future exams and more comprehensive longitudinal analyses of the contributions of subclinical and clinical diseases to cognitive function and decline. Copyright © 2015 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

  5. Incidence and progression of aortic valve calcium in the Multi-ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Owens, David S; Katz, Ronit; Takasu, Junichiro; Kronmal, Richard; Budoff, Matthew J; O'Brien, Kevin D

    2010-03-01

    Aortic valve calcium (AVC) is common among older adults and shares epidemiologic and histopathologic similarities to atherosclerosis. However, prospective studies have failed to identify meaningful risk associations with incident ("new") AVC or its progression. In the present study, AVC was quantified from serial computed tomographic images from 5,880 participants (aged 45 to 84 years) in the Multi-Ethnic Study of Atherosclerosis, using the Agatston method. Multivariate backward selection modeling was used to identify the risk factors for incident AVC and AVC progression. During a mean follow-up of 2.4 +/- 0.9 years, 210 subjects (4.1%) developed incident AVC. The incidence rate (mean 1.7%/year) increased significantly with age (p AVC included age, male gender, body mass index, current smoking, and the use of lipid-lowering and antihypertensive medications. Among those with AVC at baseline, the median rate of AVC progression was 2 Agatston units/year (interquartile range -21 to 37). The baseline Agatston score was a strong, independent predictor of progression, especially among those with high calcium scores at baseline. In conclusion, in this ethnically diverse, preclinical cohort, the rate of incident AVC increased significantly with age. The incident AVC risk was associated with several traditional cardiovascular risk factors, specifically age, male gender, body mass index, current smoking, and the use of both antihypertensive and lipid-lowering medications. AVC progression risk was associated with male gender and the baseline Agatston score. Additional research is needed to determine whether age- and stage-specific mechanisms underlie the risk of AVC progression. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Sociodemographic Correlates of Cognition in the Multi-Ethnic Study of Atherosclerosis (MESA)

    Science.gov (United States)

    Fitzpatrick, Annette L.; Rapp, Stephen R.; Luchsinger, Jose; Hill-Briggs, Felicia; Alonso, Alvaro; Gottesman, Rebecca; Lee, Hochang; Carnethon, Mercedes; Liu, Kiang; Williams, Kayleen; Sharrett, A. Richey.; Frazier-Wood, Alexis; Lyketsos, Constantine; Seeman, Teresa

    2015-01-01

    Objectives To describe the methodology utilized to evaluate cognitive function in the Multi-Ethnic Study of Atherosclerosis (MESA) and to present preliminary results by age, gender and race/ethnicity. Design Cross-sectional measurements of a prospective observational cohort. Setting Residents of 6 US communities free of cardiovascular disease at baseline (2000-02). Participants 4,591 adults who completed the 5th MESA clinical examination in 2011-12, mean age 70.3 (SD 9.5) years, 53.1% women, and 40.7% Non-Hispanic White, 26.4% Non-Hispanic Black, 21.4% Hispanic, and 11.5% Chinese. Measurements The cognitive battery consisted of the Cognitive Abilities Screening Instrument (version 2) to evaluate global cognition, the Digit Symbol Code for processing speed and Digit Spans Forward and Backward to assess memory. Demographic, socioeconomic, and cultural covariates were also collected for descriptive statistics and multivariate modeling. Results Associations between socio-economic factors and cognition revealed that age, race/ethnicity, education, occupational status, household income, health insurance type, household size, place of birth, years and generation in U.S., and the presence of the APOE4 allele were significantly associated with performance on the cognitive tests although patterns varied by specific test, racial/ethnicity, and socio-cultural factors. Conclusions As many of the influencing cultural and socioeconomic factors measured here are complex, multifactorial, and may not be adequately quantified, caution has been recommended with regard to comparison and interpretation of racial/ethnic group performance differences from these cross-sectional models. These data provide a baseline for future exams and more comprehensive longitudinal analyses of the contributions of subclinical and clinical diseases to cognitive function and decline. PMID:25704999

  7. Age at menopause and incident heart failure: the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Ebong, Imo A; Watson, Karol E; Goff, David C; Bluemke, David A; Srikanthan, Preethi; Horwich, Tamara; Bertoni, Alain G

    2014-06-01

    This study aims to evaluate the associations of early menopause (menopause occurring before age 45 years) and age at menopause with incident heart failure (HF) in postmenopausal women. We also explored the associations of early menopause and age at menopause with left ventricular (LV) measures of structure and function in postmenopausal women. We included 2,947 postmenopausal women, aged 45 to 84 years without known cardiovascular disease (2000-2002), from the Multi-Ethnic Study of Atherosclerosis. Cox proportional hazards models were used to examine the associations of early menopause and age at menopause with incident HF. In 2,123 postmenopausal women in whom cardiac magnetic resonance imaging was obtained at baseline, we explored the associations of early menopause and age at menopause with LV measures using multivariable linear regression. Across a median follow-up of 8.5 years, we observed 71 HF events. There were no significant interactions with ethnicity for incident HF (Pinteraction > 0.05). In adjusted analysis, early menopause was associated with an increased risk of incident HF (hazard ratio, 1.66; 95% CI, 1.01-2.73), whereas every 1-year increase in age at menopause was associated with a decreased risk of incident HF (hazard ratio, 0.96; 95% CI, 0.94-0.99). We observed significant interactions between early menopause and ethnicity for LV mass-to-volume ratio (LVMVR; Pinteraction = 0.02). In Chinese-American women, early menopause was associated with a higher LVMVR (+0.11; P = 0.0002), whereas every 1-year increase in age at menopause was associated with a lower LVMVR (-0.004; P = 0.04) at baseline. Older age at menopause is independently associated with a decreased risk of incident HF. Concentric LV remodeling, indicated by a higher LVMVR, is present in Chinese-American women who experienced early menopause at baseline.

  8. The prevalence of depression in White-European and South-Asian people with impaired glucose regulation and screen-detected type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Aujla, Navneet; Abrams, Keith R.; Davies, Melanie J.

    2009-01-01

    ) and South-Asian (SA) population attending a community diabetes screening programme, and to explore the association of depression with screen-detected Type 2 diabetes mellitus (T2DM) and impaired glucose regulation (IGR). Methodology/Principal Findings: Participants were recruited from general practices.......9% in WE, 26.4% in SA, p = 0.86). Age-adjusted prevalences were higher for females than males. Odds ratios adjusted for age, gender, and ethnicity, showed no significant increase in prevalent depression for people with T2DM (OR = 0.95, 95%CI 0.62 to 1.45) or IGR (OR = 1.17, 95%CI 0.96 to1.42). Conclusions......: Prior to the knowledge of diagnosis, depression was not significantly more prevalent in people with screen detected T2DM or IGR. Differences in prevalent depression between WE and SA people were also not identified. In this multi-ethnic population, female gender was significantly associated...

  9. Is the Memorial Sloan Kettering Cancer Centre (MSKCC) sarcoma nomogram useful in an Asian population?

    Science.gov (United States)

    Ng, Deanna Wan Jie; Tan, Grace Hwei Ching; Chia, Claramae Shulyn; Lim, Cindy Xindi; Chee, Soo Khee; Quek, Richard Hong Hui; Farid, Mohamad; Teo, Melissa Ching Ching

    2017-10-01

    A nomogram for prediction of 12-year sarcoma-specific survival has been developed based on patients with soft tissue sarcomas treated in Memorial Sloan Kettering Cancer Centre (MSKCC). We aim to evaluate the predictive accuracy of the MSKCC sarcoma nomogram in a cohort of patients treated at an Asian institution. This has not been validated in an Asian population and thus its universal applicability remains unproven. Between 1990 and 2013, 840 adult patients underwent treatment for primary soft tissue sarcoma (STS) at the National Cancer Centre Singapore. Patients who presented with locally recurrent or metastatic disease were excluded from the analysis. The variables included in the MSKCC nomogram included age at diagnosis, tumor size, histologic grade, histologic subtype, depth and site. A total of 399 patients were left for analysis. The nomogram was validated by assessing its extent of discrimination and level of calibration. All patients had deep tumors. Disease occurred most commonly in the lower extremity (n = 149 [37.3%]), the most common histologic subtype was "Others" (angiosarcoma, ewing's sarcoma, endometrial stromal sarcoma, sarcoma NOS [not otherwise specified] and rhabdomyosarcoma). Sixty-four percent of all patients had high-grade tumors while 36% had low-grade tumors. The median patient age at diagnosis was 54 years (range: 17-88 years). The median follow up time for all patients and surviving patients were 29 (range: 1-174) and 33 (range: 1-157) months, respectively. The observed 5- and 10-year sarcoma-specific survival were 55% and 33%, respectively. The concordance index was 0.71. For level of calibration, the observed correspondence between predicted and actual outcomes suggest that the MSKCC nomogram generally predicts well for patients with higher survival probability, but consistently overpredicts survival for the other groups, in our cohort of patients. The MSKCC sarcoma nomogram was found to be accurate in terms of extent of discrimination

  10. E-selectin gene polymorphisms and essential hypertension in Asian population: an updated meta-analysis.

    Directory of Open Access Journals (Sweden)

    Gaojun Cai

    Full Text Available Epidemiological studies have shown that E-selectin gene polymorphisms (A561C and C1839T may be associated with essential hypertension (EH, but the results are conflicting in different ethnic populations. Thus, we performed this meta-analysis to investigate a more authentic association between E-selectin gene polymorphisms and the risk of EH.We searched the relevant studies for the present meta-analysis from the following electronic databases: PubMed, Embase, Cochrane Library, Google Scholar, Web of Science, Wanfang Data, and China National Knowledge Infrastructure (CNKI. Odds ratios (OR with 95% confidence interval (CI were used to evaluate the strength of the association between E-selectin gene polymorphisms and EH susceptibility. The pooled ORs were performed for dominant model, allelic model and recessive model. The publication bias was examined by Begg's funnel plots and Egger's test.A total of eleven studies met the inclusion criteria. All studies came from Asians. Ten studies (12 cohorts evaluated the A561C polymorphism and EH risk, including 2,813 cases and 2,817 controls. The pooled OR was 2.280 (95%CI: 1.893-2.748, P<0.001 in dominant model, 5.284 (95%CI: 2.679-10.420, P<0.001 in recessive model and 2.359 (95%CI: 1.981-2.808, P = 0.001 in allelic model. Four studies (six cohorts evaluated C1839T polymorphism and EH risk, including 1,700 cases and 1,681 controls. The pooled OR was 0.785 (95%CI: 0.627-0.983, P = 0.035 in dominant model, 1.250 (95%CI: 0.336-4.652, P = 0.739 in recessive model and 0.805 (95%CI: 0.649-0.999, P = 0.049 in allelic model.The current meta-analysis concludes that the C allele of E-selectin A561C gene polymorphism might increase the EH risk in Asian population, whereas the T allele of E-selectin C1839T gene polymorphism might decrease the EH risk.

  11. Risk of Peritoneal Dialysis-Related Peritonitis in a Multi-Racial Asian Population.

    Science.gov (United States)

    Ong, Loke Meng; Ch'ng, Chin Chin; Wee, Hong Chin; Supramaniam, Premaa; Zainal, Hadzlinda; Goh, Bak Leong; Bavanandan, Sunita; Mushahar, Lily; Hooi, Lai Seong; Ahmad, Ghazali

    ♦ BACKGROUND: Peritonitis is one of the most common complications of peritoneal dialysis (PD). Understanding the risk factors of peritonitis in a multi-racial Asian population may help to improve outcomes on PD. ♦ METHODS: We conducted a prospective observational study to identify risk factors for PD-related peritonitis over a 1-year period in 15 adult PD centers. All peritonitis episodes were independently adjudicated. ♦ RESULTS: A total of 1,603 participants with a mean age of 51.6 years comprising 52.7% females, 62.6% ethnic Malays, 27.0% Chinese, and 8.1% Indians were recruited. The overall peritonitis rate was 1 episode per 44.0 patient-months with 354 episodes recorded in 282 (17.6%) patients over 15,588 patient-months. Significant risk factors of peritonitis were severe obesity (incidence-rate ratio [IRR] 3.32, 95% confidence interval [CI]: 1.30, 8.45), hypoalbuminemia (IRR 1.61, 95% CI: 1.06, 2.46), Staphylococcus aureus nasal carriage (IRR 2.26, 95% CI: 1.46, 3.50), and use of Fresenius system (Fresenius Medical Care North America, Waltham, MA, USA) (IRR 2.49, 95% CI: 1.27, 4.89). The risk of peritonitis was lower in those on automated PD compared with standard PD (IRR 0.43, 95% CI: 0.25, 0.74), and in centers with a patient-staff ratio of 15 to 29.9 (IRR 0.67, 95% CI: 0.49, 0.90) and ≥ 30 (IRR 0.52, 95% CI: 0.34, 0.80). Prevalent patients and exit-site care with topical antibiotics were also protective against peritonitis. Peritonitis rates varied between racial groups. The IRRs of overall peritonitis and gram-positive peritonitis in Chinese versus other racial groups were 0.65 (95% CI: 0.46, 0.90) and 0.47 (95% CI: 0.24, 0.91), respectively. ♦ CONCLUSIONS: Multiple patient, center, and PD-system factors influence the risk of peritonitis. In the Asian population, there are racial differences in the risk of peritonitis. Copyright © 2017 International Society for Peritoneal Dialysis.

  12. Population effect model identifies gene expression predictors of survival outcomes in lung adenocarcinoma for both Caucasian and Asian patients.

    Directory of Open Access Journals (Sweden)

    Guoshuai Cai

    Full Text Available We analyzed and integrated transcriptome data from two large studies of lung adenocarcinomas on distinct populations. Our goal was to investigate the variable gene expression alterations between paired tumor-normal tissues and prospectively identify those alterations that can reliably predict lung disease related outcomes across populations.We developed a mixed model that combined the paired tumor-normal RNA-seq from two populations. Alterations in gene expression common to both populations were detected and validated in two independent DNA microarray datasets. A 10-gene prognosis signature was developed through a l1 penalized regression approach and its prognostic value was evaluated in a third independent microarray cohort.Deregulation of apoptosis pathways and increased expression of cell cycle pathways were identified in tumors of both Caucasian and Asian lung adenocarcinoma patients. We demonstrate that a 10-gene biomarker panel can predict prognosis of lung adenocarcinoma in both Caucasians and Asians. Compared to low risk groups, high risk groups showed significantly shorter overall survival time (Caucasian patients data: HR = 3.63, p-value = 0.007; Asian patients data: HR = 3.25, p-value = 0.001.This study uses a statistical framework to detect DEGs between paired tumor and normal tissues that considers variances among patients and ethnicities, which will aid in understanding the common genes and signalling pathways with the largest effect sizes in ethnically diverse cohorts. We propose multifunctional markers for distinguishing tumor from normal tissue and prognosis for both populations studied.

  13. Estimation of internal radiation dose to the adult Asian population from the dietary intakes of two long-lived radionuclides

    International Nuclear Information System (INIS)

    Iyengar, G.V.; Kawamura, H.; Dang, H.S.; Parr, R.M.; Wang, J.W.; Akhter, Perveen; Cho, S.Y.; Natera, E.; Miah, F.K.; Nguyen, M.S.

    2004-01-01

    Daily dietary intakes of two naturally occurring long-lived radionuclides, 232 Th and 238 U, were estimated for the adult population living in a number of Asian countries, using highly sensitive analytical methods such as instrumental and radiochemical neutron activation analysis (INAA and RNAA), and inductively coupled plasma mass spectrometry (ICP-MS). The Asian countries that participated in the study were Bangladesh (BGD), China (CPR), India (IND), Japan (JPN), Pakistan (PAK), Philippines (PHI), Republic of Korea (ROK) and Vietnam (VIE). Altogether, these countries represent more than 50% of the world population. The median daily intakes of 232 Th ranged between 0.6 and 14.4 mBq, the lowest being for Philippines and the highest for Bangladesh, and daily intakes of 238 U ranged between 6.7 and 62.5 mBq, lowest and the highest being for India and China, respectively. The Asian median intakes were obtained as 4.2 mBq for 232 Th and 12.7 mBq for 238 U. Although the Asian intakes were lower than intakes of 12.3 mBq (3.0 μg) 232 Th and 23.6 mBq (1.9 μg) 238 U proposed by the International Commission on Radiological Protection (ICRP) for the ICRP Reference Man, they were comparable to the global intake values of 4.6 mBq 232 Th and 15.6 mBq 238 U proposed by the United Nation Scientific Commission on Effects of Radiation (UNSCEAR). The annual committed effective doses to Asian population from the dietary intake of 232 Th and 238 U were calculated to be 0.34 and 0.20 μSv, respectively, which are three orders of magnitude lower than the global average annual radiation dose of 2400 μSv to man from the natural radiation sources as proposed by UNSCEAR

  14. Type 2 diabetes: identifying high risk Asian American subgroups in a clinical population.

    Science.gov (United States)

    Wang, Elsie J; Wong, Eric C; Dixit, Anjali A; Fortmann, Stephen P; Linde, Randolph B; Palaniappan, Latha P

    2011-08-01

    We compared the prevalence and treatment of type 2 diabetes across Asian American subgroups (Asian Indian, Chinese, Filipino, Japanese, Korean, Vietnamese) and Non-Hispanic Whites (NHWs) in a Northern California healthcare system. A three-year, cross-sectional sample of patient electronic health records was accessed to compare diabetes prevalence in 21,816 Asian and 73,728 NHWs aged 35+ years. Diabetes was classified through ICD-9 codes, abnormal laboratory values, or use of oral anti-diabetic medication. Multivariate adjusted prevalence rates for each Asian subgroup, and adjusted odds ratios (OR) relative to NHWs, were compared. Age-adjusted prevalence ranged from 5.8% to 18.2% (women) and 8.1 to 25.3% (men). Age-adjusted ORs of Asian subgroups ranged 1.11-3.94 (women) and 1.14-4.56 (men). The odds of diabetes were significantly higher in Asian Indians (women OR 3.44, men OR 3.54) and Filipinos (women OR 3.94, men OR 4.56), compared to NHWs. Results for Asian Indians and Filipinos were similar with age-and-BMI adjustment. Treatment rates across subgroups were 59.7-82.0% (women) and 62.9-79.4% (men). Heterogeneity exists in the prevalence of diabetes across Asian subgroups, independent of obesity prevalence. Asian Indian and Filipino subgroups had particularly high prevalence of diabetes when compared to NHWs. Future studies should explore these clinically important differences among Asian subgroups. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  15. Population Dynamics of Native Parasitoids Associated with the Asian Chestnut Gall Wasp (Dryocosmus kuriphilus in Italy

    Directory of Open Access Journals (Sweden)

    Tiziana Panzavolta

    2018-01-01

    Full Text Available Native parasitoids may play an important role in biological control. They may either support or hinder the effectiveness of introduced nonnative parasitoids released for pest control purposes. Results of a three-year survey (2011–2013 of the Asian chestnut gall wasp (ACGW Dryocosmus kuriphilus Yasumatsu (Hymenoptera: Cynipidae populations and on parasitism rates by native indigenous parasitoids (a complex of chalcidoid hymenopterans in Italian chestnut forests are given. Changes in D. kuriphilus gall size and phenology were observed through the three years of study. A total of 13 species of native parasitoids were recorded, accounting for fluctuating parasitism rates. This variability in parasitism rates over the three years was mainly due to the effect of Torymus flavipes (Walker (Hymenoptera: Torymidae, which in 2011 accounted for 75% of all parasitoid specimens yet decreased drastically in the following years. This strong fluctuation may be related to climatic conditions. Besides, our data verified that parasitoids do not choose host galls based on their size, though when they do parasitize smaller ones, they exploit them better. Consequently, ACGWs have higher chances of surviving parasitism if they are inside larger galls.

  16. Population-level impact of active tuberculosis case finding in an Asian megacity.

    Directory of Open Access Journals (Sweden)

    David W Dowdy

    Full Text Available BACKGROUND: The potential population-level impact of private-sector initiatives for tuberculosis (TB case finding in Southeast Asia remains uncertain. In 2011, the Indus Hospital TB Control Program in Karachi, Pakistan, undertook an aggressive case-finding campaign that doubled notification rates, providing an opportunity to investigate potential population-level effects. METHODS: We constructed an age-structured compartmental model of TB in the intervention area. We fit the model using field and literature data, assuming that TB incidence equaled the estimated nationwide incidence in Pakistan (primary analysis, or 1.5 times greater (high-incidence scenario. We modeled the intervention as an increase in the rate of formal-sector TB diagnosis and evaluated the potential impact of sustaining this rate for five years. RESULTS: In the primary analysis, the five-year intervention averted 24% (95% uncertainty range, UR: 18-30% of five-year cumulative TB cases and 52% (95% UR: 45-57% of cumulative TB deaths. Corresponding reductions in the high-incidence scenario were 12% (95% UR: 8-17% and 27% (95% UR: 21-34%, although the absolute number of lives saved was higher. At the end of five years, TB notification rates in the primary analysis were below their 2010 baseline, incidence had dropped by 45%, and annual mortality had fallen by 72%. About half of the cumulative impact on incidence and mortality could be achieved with a one-year intervention. CONCLUSIONS: Sustained, multifaceted, and innovative approaches to TB case-finding in Asian megacities can have substantial community-wide epidemiological impact.

  17. Mediterranean diet score and left ventricular structure and function: the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Levitan, Emily B; Ahmed, Ali; Arnett, Donna K; Polak, Joseph F; Hundley, W Gregory; Bluemke, David A; Heckbert, Susan R; Jacobs, David R; Nettleton, Jennifer A

    2016-09-01

    Data are limited on the relation between dietary patterns and left ventricular (LV) structure and function. We examined cross-sectional associations of a diet-score assessment of a Mediterranean dietary pattern with LV mass, volume, mass-to-volume ratio, stroke volume, and ejection fraction. We measured LV variables with the use of cardiac MRI in 4497 participants in the Multi-Ethnic Study of Atherosclerosis study who were aged 45-84 y and without clinical cardiovascular disease. We calculated a Mediterranean diet score from intakes of fruit, vegetables, nuts, legumes, whole grains, fish, red meat, the monounsaturated fat:saturated fat ratio, and alcohol that were self-reported with the use of a food-frequency questionnaire. We used linear regression with adjustment for body size, physical activity, and cardiovascular disease risk factors to model associations and assess the shape of these associations (linear or quadratic). The Mediterranean diet score had a slight U-shaped association with LV mass (adjusted means: 146, 145, 146, and 147 g across quartiles of diet score, respectively; P-quadratic trend = 0.04). The score was linearly associated with LV volume, stroke volume, and ejection fraction: for each +1-U difference in score, LV volume was 0.4 mL higher (95% CI: 0.0, 0.8 mL higher), the stroke volume was 0.5 mL higher (95% CI: 0.2, 0.8 mL higher), and the ejection fraction was 0.2 percentage points higher (95% CI: 0.1, 0.3 percentage points higher). The score was not associated with the mass-to-volume ratio. A higher Mediterranean diet score is cross-sectionally associated with a higher LV mass, which is balanced by a higher LV volume as well as a higher ejection fraction and stroke volume. Participants in this healthy, multiethnic sample whose dietary patterns most closely conformed to a Mediterranean-type pattern had a modestly better LV structure and function than did participants with less-Mediterranean-like dietary patterns. This trial was registered at

  18. Metabolic Syndrome, Strain, and Reduced Myocardial Function: Multi-Ethnic Study of Atherosclerosis

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, André Luiz Cerqueira de, E-mail: andrealmeida@cardiol.br [Johns Hopkins University, Baltimore, MD (United States); Universidade Estadual de Feira de Santana, Bahia (Brazil); Teixido-Tura, Gisela; Choi, Eui-Young; Opdahl, Anders; Fernandes, Verônica R. S. [Johns Hopkins University, Baltimore, MD (United States); Wu, Colin O. [National Heart, Lung and Blood Institute, Bethesda, MD (United States); Bluemke, David A. [National Institutes of Health Clinical Center, National Institute for Biomedical Imaging and Bioengineering, Bethesda, MD (United States); Lima, João A. C. [Johns Hopkins University, Baltimore, MD (United States)

    2014-04-15

    Subclinical cardiovascular disease is prevalent in patients with Metabolic Syndrome (MetSyn). Left ventricular (LV) circumferential strain (ε{sub CC}) and longitudinal strain (ε{sub LL}), assessed by Speckle Tracking Echocardiography (STE), are indices of systolic function: shortening is indicated by negative strain, and thus, the more negative the strain, the better the LV systolic function. They have been used to demonstrate subclinical ventricular dysfunction in several clinical disorders. We hypothesized that MetSyn is associated with impaired myocardial function, as assessed by STE. We analyzed Multi-Ethnic Study of Atherosclerosis (MESA) participants who underwent STE and were evaluated for all MetSyn components. Among the 133 participants included [women: 63%; age: 65 ± 9 years (mean ± SD)], the prevalence of MetSyn was 31% (41/133). Individuals with MetSyn had lower ε{sub CC} and lower ε{sub LL} than those without MetSyn (-16.3% ± 3.5% vs. -18.4% ± 3.7%, p < 0.01; and -12.1% ± 2.5% vs. -13.9% ± 2.3%, p < 0.01, respectively). The LV ejection fraction (LVEF) was similar in both groups (p = 0.09). In multivariate analysis, MetSyn was associated with less circumferential myocardial shortening as indicated by less negative ε{sub CC} (B = 2.1%, 95%CI:0.6 3.5, p < 0.01) even after adjusting for age, ethnicity, LV mass, and LVEF). Likewise, presence of MetSyn (B = 1.3%, 95%CI:0.3 2.2, p < 0.01) and LV mass (B = 0.02%, 95% CI: 0.01-0.03, p = 0.02) were significantly associated with less longitudinal myocardial shortening as indicated by less negative ε{sub LL} after adjustment for ethnicity, LVEF, and creatinine. Left ventricular ε{sub CC} and ε{sub LL}, markers of subclinical cardiovascular disease, are impaired in asymptomatic individuals with MetSyn and no history of myocardial infarction, heart failure, and/or LVEF < 50%.

  19. Metabolic Syndrome, Strain, and Reduced Myocardial Function: Multi-Ethnic Study of Atherosclerosis

    International Nuclear Information System (INIS)

    Almeida, André Luiz Cerqueira de; Teixido-Tura, Gisela; Choi, Eui-Young; Opdahl, Anders; Fernandes, Verônica R. S.; Wu, Colin O.; Bluemke, David A.; Lima, João A. C.

    2014-01-01

    Subclinical cardiovascular disease is prevalent in patients with Metabolic Syndrome (MetSyn). Left ventricular (LV) circumferential strain (ε CC ) and longitudinal strain (ε LL ), assessed by Speckle Tracking Echocardiography (STE), are indices of systolic function: shortening is indicated by negative strain, and thus, the more negative the strain, the better the LV systolic function. They have been used to demonstrate subclinical ventricular dysfunction in several clinical disorders. We hypothesized that MetSyn is associated with impaired myocardial function, as assessed by STE. We analyzed Multi-Ethnic Study of Atherosclerosis (MESA) participants who underwent STE and were evaluated for all MetSyn components. Among the 133 participants included [women: 63%; age: 65 ± 9 years (mean ± SD)], the prevalence of MetSyn was 31% (41/133). Individuals with MetSyn had lower ε CC and lower ε LL than those without MetSyn (-16.3% ± 3.5% vs. -18.4% ± 3.7%, p < 0.01; and -12.1% ± 2.5% vs. -13.9% ± 2.3%, p < 0.01, respectively). The LV ejection fraction (LVEF) was similar in both groups (p = 0.09). In multivariate analysis, MetSyn was associated with less circumferential myocardial shortening as indicated by less negative ε CC (B = 2.1%, 95%CI:0.6 3.5, p < 0.01) even after adjusting for age, ethnicity, LV mass, and LVEF). Likewise, presence of MetSyn (B = 1.3%, 95%CI:0.3 2.2, p < 0.01) and LV mass (B = 0.02%, 95% CI: 0.01-0.03, p = 0.02) were significantly associated with less longitudinal myocardial shortening as indicated by less negative ε LL after adjustment for ethnicity, LVEF, and creatinine. Left ventricular ε CC and ε LL , markers of subclinical cardiovascular disease, are impaired in asymptomatic individuals with MetSyn and no history of myocardial infarction, heart failure, and/or LVEF < 50%

  20. Ethnic Differences in Mental Illness Severity: A Population-Based Study of Chinese and South Asian Patients in Ontario, Canada.

    Science.gov (United States)

    Chiu, Maria; Lebenbaum, Michael; Newman, Alice M; Zaheer, Juveria; Kurdyak, Paul

    2016-09-01

    Little is known about the sociocultural determinants of mental illness at hospital presentation. Our objective was to examine ethnic differences in illness severity at hospital admission among Chinese, South Asian, and the general population living in Ontario, Canada. We conducted a large, population-based, cross-sectional study of psychiatric inpatients aged from 19 to 105 years who were discharged between 2006 and 2014. A total of 133,588 patients were classified as Chinese (n = 2,582), South Asian (n = 2,452), or the reference group (n = 128,554) using a validated surnames algorithm (specificity: 99.7%). Diagnoses were based on DSM-IV criteria. We examined the association between ethnicity and 4 measures of disease severity: involuntary admissions, aggressive behaviors, and the number and frequency of positive symptoms (ie, hallucinations, command hallucinations, delusions, and abnormal thought process) (Positive Symptoms Scale, Resident Assessment Instrument-Mental Health [RAI-MH]). After adjusting for sociodemographic characteristics, immigration status, and discharge diagnosis, Chinese patients had greater odds of involuntary admissions (odds ratio [OR] = 1.79; 95% CI, 1.64-1.95) and exhibiting severe aggressive behaviors (OR = 1.36; 95% CI, 1.23-1.51) and ≥ 3 positive symptoms (OR = 1.39; 95% CI, 1.24-1.56) compared to the general population. South Asian ethnicity was also an independent predictor of most illness severity measures. The association between Chinese ethnicity and illness severity was consistent across sex, diagnostic and immigrant categories, and first-episode hospitalization. Chinese and South Asian ethnicities are independent predictors of illness severity at hospital presentation. Understanding the role of patient, family, and health system factors in determining the threshold for hospitalization is an important future step in informing culturally specific care for these large and growing populations worldwide. © Copyright 2016 Physicians

  1. AFSC/ABL: Population structure of odd- and even-broodline Asian pink salmon

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Electrophoretic analysis of Asian even brood-year pink salmon stocks has shown regional heterogeneity (Noll et al. in review). Hypothetical mixed fisheries were...

  2. The effectiveness of structured exercise in the south Asian population with type 2 diabetes: a systematic review.

    Science.gov (United States)

    Albalawi, Hani; Coulter, Elaine; Ghouri, Nazim; Paul, Lorna

    2017-11-01

    The impact of exercise interventions on south Asians with type 2 diabetes (T2DM), who have a higher T2DM incidence rate compared to other ethnic groups, is inconclusive. This study aimed to systematically review the effect of exercise interventions in south Asians with T2DM. Five electronic databases were searched up to April 2017 for controlled trials investigating the impact of exercise interventions on south Asian adults with T2DM. The PEDro scale was used to assess the quality of the included studies. Eighteen trials examining the effect of aerobic, resistance, balance or combined exercise programs met the eligibility criteria. All types of exercise were associated with improvements in glycemic control, blood pressure, waist circumference, blood lipids, muscle strength, functional mobility, quality of life or neuropathy progression. The majority of included studies were of poor methodological quality. Few studies compared different types or dose of exercise. In conclusion, this review supports the benefits of exercise for south Asians with T2DM, although it was not possible to identify the most effective exercise prescription. Further studies of good methodological quality are required to determine the most effective dosage and type of exercise to manage T2DM in this population.

  3. Developing theoretically based and culturally appropriate interventions to promote hepatitis B testing in 4 Asian American populations, 2006-2011.

    Science.gov (United States)

    Maxwell, Annette E; Bastani, Roshan; Glenn, Beth A; Taylor, Victoria M; Nguyen, Tung T; Stewart, Susan L; Burke, Nancy J; Chen, Moon S

    2014-05-01

    Hepatitis B infection is 5 to 12 times more common among Asian Americans than in the general US population and is the leading cause of liver disease and liver cancer among Asians. The purpose of this article is to describe the step-by-step approach that we followed in community-based participatory research projects in 4 Asian American groups, conducted from 2006 through 2011 in California and Washington state to develop theoretically based and culturally appropriate interventions to promote hepatitis B testing. We provide examples to illustrate how intervention messages addressing identical theoretical constructs of the Health Behavior Framework were modified to be culturally appropriate for each community. Intervention approaches included mass media in the Vietnamese community, small-group educational sessions at churches in the Korean community, and home visits by lay health workers in the Hmong and Cambodian communities. Use of the Health Behavior Framework allowed a systematic approach to intervention development across populations, resulting in 4 different culturally appropriate interventions that addressed the same set of theoretical constructs. The development of theory-based health promotion interventions for different populations will advance our understanding of which constructs are critical to modify specific health behaviors.

  4. A diversity of cancer incidence and mortality in West Asian populations.

    Science.gov (United States)

    Roshandel, Gholamreza; Boreiri, Majid; Sadjadi, Alireza; Malekzadeh, Reza

    2014-01-01

    -quality data for some West Asian countries was the major limitation of this study. Therefore, as the first step of cancer control programs, it is recommended that well-structured population-based cancer registries be established in all of these countries. Copyright © 2014 Icahn School of Medicine at Mount Sinai. Published by Elsevier Inc. All rights reserved.

  5. Obesity and Asian Americans

    Science.gov (United States)

    ... and Data > Minority Population Profiles > Asian American > Obesity Obesity and Asian Americans Non-Hispanic whites are 60% ... youthonline . [Accessed 08/18/2017] HEALTH IMPACT OF OBESITY People who are overweight are more likely to ...

  6. A multi-ethnic comparison of perceptions of forest recreation service quality

    Science.gov (United States)

    Chieh-Lu Li; James D. Absher; Harry C. Zinn; Alan R. Graefe; Garry E. Chick

    2010-01-01

    This study examines perceptions of service quality on an ethnically diverse national forest adjacent to a large metropolitan area, specifically looking for differences among whites, Hispanics, and Asians. Published studies of recreation and ethnicity have focused primarily on activity participation rates and patterns. The literature contains few cross–cultural...

  7. Diagnosis of common hemoglobinopathies among South East Asian population using capillary isoelectric focusing system.

    Science.gov (United States)

    Srivorakun, H; Fucharoen, G; Sanchaisuriya, K; Fucharoen, S

    2017-02-01

    We have evaluated an automated capillary isoelectric focusing (cIEF)-based Hb analyzer in diagnosis of hemoglobinopathies commonly found among South East Asian population. Study was performed on a cohort of 665 adult Thai subjects and 13 fetal blood specimens obtained at routine thalassemia diagnostic laboratory. Hb analysis was performed using the cIEF system. Thalassemia genotypes were defined by DNA analysis. The system revealed satisfactorily within-run and between-run precision for quantitation of Hb A 2 and Hb E (CV: 0.02-0.09%). The reference ranges of Hb A 2 and Hb E were 2.6-4.0% and 25.7-33.1%, respectively. The system identified the cases of β-thalassemia and Hb E disorders correctly. Several thalassemia genotypes and Hb variants were identifiable. However, Hb Constant Spring was separated closely to Hb A 2 and Hbs Bart's and H were relatively difficult to be reported due to interfering peaks separating at the same regions. Prenatal diagnosis by fetal blood analysis was found to be accurate for Hb Bart's hydrops fetalis and Hb E-β 0 -thalassemia disease. The cIEF system could accurately diagnose β-thalassemia and Hb E carriers and demonstrate many Hb variants found in the region. The system cannot report Hb A 2 in the presence of Hb E whereas Hbs Lepore and F are comigrated. Diagnosis of α-thalassemia disease based on Hb H and Hb Bart's might be difficult. © 2016 John Wiley & Sons Ltd.

  8. Central Obesity and H. pylori Infection Influence Risk of Barrett's Esophagus in an Asian Population.

    Directory of Open Access Journals (Sweden)

    Chih-Cheng Chen

    Full Text Available The prevalence rates of Barrett's esophagus (BE in western countries are higher than Asian ones, but little is known about their difference among risk factors of BE. The aim of this study is to investigate the associations of various risk factors including central obesity, body mass index (BMI, metabolic syndrome and H. pylori infection, with BE.A total of 161 subjects with BE were enrolled and compared to age- and gender-matched controls randomly sampled (1:4 from check-up center in same hospital. Central obesity was defined by waist circumference (female>80cm; male>90cm, metabolic syndrome by the modified National Cholesterol Education Program Adult Treatment Panel III criteria in Taiwan. Independent risk factors for BE were identified by multiple logistic regression analyses.The mean age for BE was 53.8±13.7 years and 75.8% was male. H. pylori infection status was detected by the rapid urease test with the prevalence of 28.4% and 44.4% in the BE patients and controls, respectively. The univariate logistic regression analyses showed the risk was associated with higher waist circumference (odds ratio [OR], 2.53; 95% confidence interval [CI], 1.78-3.60, metabolic syndrome (OR, 2.02; 95% CI, 1.38-2.96 and negative H. pylori infection (OR, 0.50; 95% CI, 0.34-0.74. However, multivariate logistic regression analyses revealed that BE associated with higher waist circumference (adjusted OR, 2.79; 95% CI, 1.89-4.12 and negative H. pylori infection (adjusted OR, 0.46; 95% CI, 0.30-0.70.Central obesity is associated with a higher risk of BE whereas H. pylori infection with a lower risk in an ethnic Chinese population.

  9. Interaction of malaria with a common form of severe thalassemia in an Asian population

    Science.gov (United States)

    O'Donnell, A.; Premawardhena, A.; Arambepola, M.; Samaranayake, R.; Allen, S. J.; Peto, T. E. A.; Fisher, C. A.; Cook, J.; Corran, P. H.; Olivieri, Nancy F.; Weatherall, D. J.

    2009-01-01

    In many Asian populations, the commonest form of severe thalassemia results from the coinheritance of HbE and β thalassemia. The management of this disease is particularly difficult because of its extreme clinical diversity; although some genetic and adaptive factors have been identified as phenotypic modifiers, the reasons remain unclear. Because the role of the environment in the course of severe thalassemia has been neglected completely and because malaria due to both Plasmodium falciparum and Plasmodium vivax has been prevalent in Sri Lanka, we carried out a pilot study of patients with HbE β thalassemia that showed high frequencies of antibodies to both parasite species and that 28.6% of the children had DNA-based evidence of current infection with P. vivax. Malarial antibodies then were assessed in patients with HbE β thalassemia compared with those in age-matched controls. There was a significant increase in the frequency of antibodies in the thalassemic patients, particularly against P. vivax and in young children. There was also a higher frequency in those who had been splenectomized compared with those with intact spleens, although in the latter it was still higher than that in the controls. The thalassemic patients showed significant correlations between malaria antibody status and phenotype. Patients with HbE β thalassemia may be more prone to malaria, particularly P. vivax, which is reflected in their clinical severity. Because P. vivax malaria is widespread in Asia, further studies of its interaction with HbE β thalassemia and related diseases are required urgently as a part of ongoing thalassemia control programs. PMID:19841268

  10. Contribution of the in-vehicle microenvironment to individual ambient-source nitrogen dioxide exposure: the Multi-Ethnic Study of Atherosclerosis and Air Pollution.

    Science.gov (United States)

    Hazlehurst, Marnie F; Spalt, Elizabeth W; Nicholas, Tyler P; Curl, Cynthia L; Davey, Mark E; Burke, Gregory L; Watson, Karol E; Vedal, Sverre; Kaufman, Joel D

    2018-03-06

    Exposure estimates that do not account for time in-transit may underestimate exposure to traffic-related air pollution, but exact contributions have not been studied directly. We conducted a 2-week monitoring, including novel in-vehicle sampling, in a subset of the Multi-Ethnic Study of Atherosclerosis and Air Pollution cohort in two cities. Participants spent the majority of their time indoors and only 4.4% of their time (63 min/day) in-vehicle, on average. The mean ambient-source NO 2 concentration was 5.1 ppb indoors and 32.3 ppb in-vehicle during drives. On average, indoor exposure contributed 69% and in-vehicle exposure contributed 24% of participants' ambient-source NO 2 exposure. For participants in the highest quartile of time in-vehicle (≥1.3 h/day), indoor and in-vehicle contributions were 60 and 31%, respectively. Incorporating infiltrated indoor and measured in-vehicle NO 2 produced exposure estimates 5.6 ppb lower, on average, than using only outdoor concentrations. The indoor microenvironment accounted for the largest proportion of ambient-source exposure in this older population, despite higher concentrations of NO 2 outdoors and in vehicles than indoors. In-vehicle exposure was more influential among participants who drove the most and for participants residing in areas with lower outdoor air pollution. Failure to characterize exposures in these microenvironments may contribute to exposure misclassification in epidemiologic studies.

  11. Vitamin D status in patients with musculoskeletal pain, fatigue and headache: a cross-sectional descriptive study in a multi-ethnic general practice in Norway.

    Science.gov (United States)

    Knutsen, Kirsten Valebjørg; Brekke, Mette; Gjelstad, Svein; Lagerløv, Per

    2010-09-01

    To investigate vitamin D levels in patients with non-specific musculoskeletal pain, headache, and fatigue. A cross-sectional descriptive study. A health center in Oslo, Norway, with a multi-ethnic population. A total of 572 patients referred by a general practitioner (GP) for an examination of hypovitaminosis D who reported musculoskeletal pain, headache, or fatigue. The patients' native countries were: Norway (n = 249), Europe, America, and South-East Asia (n = 83), and the Middle East, Africa, and South Asia (n = 240). Both genders and all ages were included. Vitamin D levels (25-hydroxyvitamin D) in nmol/L. Hypovitaminosis D (25-hydroxyvitamin D prevalence of hypovitaminosis D in patients with non-specific musculoskeletal pain, headache, or fatigue for whom the GP had suspected a low vitamin D level. Hypovitaminosis D was not restricted to immigrant patients. These results indicate that GPs should maintain awareness of hypovitaminosis D and refer patients who report headaches, fatigue, and musculoskeletal pain with minimal sun exposure and a low dietary vitamin D intake for assessment.

  12. Factors influencing time-location patterns and their impact on estimates of exposure: the Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air).

    Science.gov (United States)

    Spalt, Elizabeth W; Curl, Cynthia L; Allen, Ryan W; Cohen, Martin; Williams, Kayleen; Hirsch, Jana A; Adar, Sara D; Kaufman, Joel D

    2016-06-01

    We assessed time-location patterns and the role of individual- and residential-level characteristics on these patterns within the Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air) cohort and also investigated the impact of individual-level time-location patterns on individual-level estimates of exposure to outdoor air pollution. Reported time-location patterns varied significantly by demographic factors such as age, gender, race/ethnicity, income, education, and employment status. On average, Chinese participants reported spending significantly more time indoors and less time outdoors and in transit than White, Black, or Hispanic participants. Using a tiered linear regression approach, we predicted time indoors at home and total time indoors. Our model, developed using forward-selection procedures, explained 43% of the variability in time spent indoors at home, and incorporated demographic, health, lifestyle, and built environment factors. Time-weighted air pollution predictions calculated using recommended time indoors from USEPA overestimated exposures as compared with predictions made with MESA Air participant-specific information. These data fill an important gap in the literature by describing the impact of individual and residential characteristics on time-location patterns and by demonstrating the impact of population-specific data on exposure estimates.

  13. The recent multi-ethnic global lung initiative 2012 (GLI2012) reference values don't reflect contemporary adult's North African spirometry.

    Science.gov (United States)

    Ben Saad, Helmi; El Attar, Mohamed Nour; Hadj Mabrouk, Khaoula; Ben Abdelaziz, Ahmed; Abdelghani, Ahmed; Bousarssar, Mohamed; Limam, Khélifa; Maatoug, Chiraz; Bouslah, Hmida; Charrada, Ameur; Rouatbi, Sonia

    2013-12-01

    The applicability of the recent multi-ethnic reference equations derived by the ERS Global Lung Initiative (ERS/GLI) in interpreting spirometry data in North African adult subjects has not been studied. To ascertain how well the recent ERS/GLI reference equations fit contemporary adult Tunisian spirometric data. Spirometric data were recorded from 1192 consecutive spirometry procedures in adults aged 18-60 years. Reference values and lower limits of normality (LLN) were calculated using the local and the ERS/GLI reference equations. Applied definitions: large airway obstructive ventilatory defect (LAOVD): FEV1/FVC contemporary Tunisian spirometry. Using Tunisian reference equations, 71.31%, 6.71% and 19.04% of spirometry records were interpreted as normal, and as having, LAOVD and TRVD, respectively. Using the ERS/GLI reference equations, these figures were respectively, 85.82%, 4.19% and 8.39%. The mean ± SD Z-scores for the contemporary healthy North African subject's data were -0.55 ± 0.87 for FEV1, -0.62 ± 0.86 for FVC and 0.10 ± 0.73 for FEV1/FVC. The present study don't recommend the use of the recent ERS/GLI reference equations to interpret spirometry in North African adult population. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Characteristics and Risk Factors for Type 2 Endoleak in an East Asian Population From a Japanese Multicenter Database.

    Science.gov (United States)

    Fujimura, Naoki; Obara, Hideaki; Matsubara, Kentaro; Watada, Susumu; Shibutani, Shintaro; Akiyoshi, Takurin; Harada, Hirohisa; Kitagawa, Yuko

    2016-01-01

    Clinically distinct differences exist between East Asian and Caucasian subjects, but data for type 2 endoleak (T2EL) are limited in the East Asian population. The aim of this study was to analyze the characteristics of East Asian T2EL using a Japanese multicenter database. Retrospective analysis of 832 endovascular aneurysm repairs performed from 2008 to 2014 were conducted. T2EL was observed in 234 cases (28.1%), and in 32 cases (3.8%) it led to sac expansion >5 mm caused by isolated T2EL (median follow-up, 35.6 months). On univariate and multivariate analysis, non-smoker status (odds ratio [OR], 2.216; P<0.001), Excluder stent graft (OR, 2.027; P<0.001), and T2EL at final angiogram (OR, 2.080; P<0.001) were risk factors for T2EL. On multivariate analysis for isolated T2EL with sac expansion, only non-smoker status remained (OR, 2.671; P<0.001). Other than T1EL, isolated T2EL was the most significant risk factor for sac expansion (OR, 18.486; P<0.001). Furthermore, out of 11 transarterial embolization procedures initiated, 4 led to rupture during follow-up. East Asian T2EL had a strong relationship with non-smoker status. Also, T2EL was a significant risk factor for sac expansion, which sometimes led to rupture even after intervention. Along with the high prevalence of T2EL observed, East Asian T2EL may not always be benign.

  15. Assessment of condylar morphology and position using MSCT in an Asian population.

    Science.gov (United States)

    Liu, Qi; Wei, Xiaoer; Guan, Juanjuan; Wang, Ran; Zou, Derong; Yu, Lvfeng

    2018-02-01

    The purpose of the present study was to investigate the volume, surface, morphometric index (MI), and position of the condyle in a normal population by applying Mimics 17.0 software. Then, the difference between left and right sides, sex, and age can be explored, which will contribute to establish the reference value of condylar morphology and position in normal individuals, and help us to study characteristics of condylar morphology and position in abnormal individuals. Three-hundred subjects were enrolled in our study from the radiology department of Shanghai Jiao Tong University Affiliated Sixth People's Hospital. They were divided into three groups according to the age: group 1 (18-24 years old), group 2 (25-34 years old), and group 3 (35-44 years old). Each group included 100 subjects (with 50 males and 50 females). They were examined using multislice computed tomography (MSCT) after that. All images of condyle were reconstructed by Mimics 17.0 software, so as to measure the volume, surface, and MI of condyle, and to analyze the position of condyle in the articular fossa by means of joint spaces. The differences of condylar volume, surface, and MI between left and right sides were not obvious (P > 0.05). The condylar volume and surface were greater in males than females (P  0.05). No statistical differences were found in volume and surface among three age groups. However, the MI of group 1 was statistically lower than that of group 3 (P position (P > 0.05). Nevertheless, there were significant differences of condylar position regarding the gender and age (P position between left and right sides, but factors of gender and age were proven to have a certain influence on the morphology and position of the condyle. This information can be clinically useful in establishing the diagnostic criteria for condylar morphology and position in the normal Asian population. Examination of condylar morphology and position is important for evaluating the

  16. Improving the Psychosocial Work Environment at Multi-Ethnic Workplaces: A Multi-Component Intervention Strategy in the Cleaning Industry

    Directory of Open Access Journals (Sweden)

    Mari-Ann Flyvholm

    2013-10-01

    Full Text Available Global labour migration has increased in recent years and immigrant workers are often recruited into low status and low paid jobs such as cleaning. Research in a Danish context shows that immigrants working in the cleaning industry often form social networks based on shared languages and backgrounds, and that conflict between different ethnic groups may occur. This paper evaluates the impact of a multi-component intervention on the psychosocial work environment at a multi-ethnic Danish workplace in the cleaning sector. The intervention included Danish lessons, vocational training courses, and activities to improve collaboration across different groups of cleaners. Interviews about the outcome of the intervention were conducted with the cleaners and their supervisor. The Copenhagen Psychosocial Questionnaire was used as a supplement to the interviews. The results suggest that the psychosocial work environment had improved after the intervention. According to the interviews with the cleaners, the intervention had led to improved communication, trust, and collaboration. These findings are supported by the questionnaire where social support from supervisor and colleagues, social community, trust, and teamwork seem to have improved together with meaning of work, rewards, and emotional demands. The design of the intervention may provide inspiration for future psychosocial work environment interventions at multi-ethnic work places.

  17. Improving the psychosocial work environment at multi-ethnic workplaces: a multi-component intervention strategy in the cleaning industry.

    Science.gov (United States)

    Smith, Louise Hardman; Hviid, Kirsten; Frydendall, Karen Bo; Flyvholm, Mari-Ann

    2013-10-14

    Global labour migration has increased in recent years and immigrant workers are often recruited into low status and low paid jobs such as cleaning. Research in a Danish context shows that immigrants working in the cleaning industry often form social networks based on shared languages and backgrounds, and that conflict between different ethnic groups may occur. This paper evaluates the impact of a multi-component intervention on the psychosocial work environment at a multi-ethnic Danish workplace in the cleaning sector. The intervention included Danish lessons, vocational training courses, and activities to improve collaboration across different groups of cleaners. Interviews about the outcome of the intervention were conducted with the cleaners and their supervisor. The Copenhagen Psychosocial Questionnaire was used as a supplement to the interviews. The results suggest that the psychosocial work environment had improved after the intervention. According to the interviews with the cleaners, the intervention had led to improved communication, trust, and collaboration. These findings are supported by the questionnaire where social support from supervisor and colleagues, social community, trust, and teamwork seem to have improved together with meaning of work, rewards, and emotional demands. The design of the intervention may provide inspiration for future psychosocial work environment interventions at multi-ethnic work places.

  18. Towards a More Democratic Regime and Society? The Politics of Faith and Ethnicity in a Transitional Multi-Ethnic Malaysia

    Directory of Open Access Journals (Sweden)

    Kikue Hamayotsu

    2013-01-01

    Full Text Available The rising antagonistic attitudes and tension between the Malay majority and ethnic and religious minorities in Malaysia since 2007 is intriguing because it has occurred when society experienced an unprecedentedly large-scale and assertive multi-ethnic pro-democracy movement. This article argues that precisely these assertive and confident civil and political societies – and their emphasis on equal rights and equitable development for all Malaysians – have put the traditional Malay and religious elites on the defensive. The pro-democracy movement and the prospects of regime change have threatened not only the party-dominant regime but also – and more importantly – the constitutional and institutional foundations of ethnic exclusivism and privileges. Moreover, two Malay-based parties, the United Malays National Organization (UMNO and the Malaysian Islamic Party (PAS, are viewed as giving too many political concessions to the non-Malay communities to gain an electoral advantage, making the traditional Malay and religious elites even more defensive of their position and power. As a result, religious issues are excessively politicised, further deteriorating the already complicated inter-ethnic relations of the country. The prospects for achieving a democratic regime and society appear grim, although hopes have run high since the electoral rise of the multi-ethnic opposition.

  19. Determinants of eating at local and western fast-food venues in an urban Asian population: a mixed methods approach.

    Science.gov (United States)

    Naidoo, Nasheen; van Dam, Rob M; Ng, Sheryl; Tan, Chuen Seng; Chen, Shiqi; Lim, Jia Yi; Chan, Mei Fen; Chew, Ling; Rebello, Salome A

    2017-05-25

    Like several Southeast Asian countries, Singapore has a complex eating-out environment and a rising eating-out prevalence. However the determinants and drivers of eating-out in urban Asian environments are poorly understood. We examined the socio-demographic characteristics of persons who frequently ate away from home in local eateries called hawker centres and Western fast-food restaurants, using data from 1647 Singaporean adults participating in the National Nutrition Survey (NNS) 2010. We also assessed the underlying drivers of eating out and evaluated if these were different for eating at local eateries compared to Western fast-food restaurants using 18 focus group discussions of women (130 women). Participants reported a high eating-out frequency with 77.3% usually eating either breakfast, lunch or dinner at eateries. Main venues for eating-out included hawker centres (61.1% usually ate at least 1 of 3 daily meals at this venue) and school/workplace canteens (20.4%). A minority of participants (1.9%) reported usually eating at Western fast-food restaurants. Younger participants and those of Chinese and Malay ethnicity compared to Indians were more likely to eat at Western fast-food restaurants. Chinese and employed persons were more likely to eat at hawker centres. The ready availability of a large variety of affordable and appealing foods appeared to be a primary driver of eating out, particularly at hawker centres. Our findings highlight the growing importance of eating-out in an urban Asian population where local eating venues play a more dominant role compared with Western fast-food chains. Interventions focusing on improving the food quality at venues for eating out are important to improve the diet of urban Asian populations.

  20. Tackling health literacy: adaptation of public hypertension educational materials for an Indo-Asian population in Canada.

    Science.gov (United States)

    Jones, Charlotte A; Mawani, Shefina; King, Kathryn M; Allu, Selina Omar; Smith, Megan; Mohan, Sailesh; Campbell, Norman R C

    2011-01-11

    Indo-Asians in Canada are at increased risk for cardiovascular diseases. There is a need for cultural and language specific educational materials relating to this risk. During this project we developed and field tested the acceptability of a hypertension public education pamphlet tailored to fit the needs of an at risk local Indo-Asian population, in Calgary, Alberta, Canada. A community health board representing Calgary's Indo-Asian communities identified the culturally specific educational needs and language preferences of the local population. An adaptation of an existing English language Canadian Public Hypertension Recommendations pamphlet was created considering the literacy and translation challenges. The adapted pamphlet was translated into four Indo-Asian languages. The adapted pamphlets were disseminated as part of the initial educational component of a community-based culturally and language-sensitive cardiovascular risk factor screening and management program. Field testing of the materials was undertaken when participants returned for program follow-up seven to 12 months later. Fifty-nine English-speaking participants evaluated and confirmed the concept validity of the English adapted version. 28 non-English speaking participants evaluated the Gujarati (N = 13) and Punjabi (N = 15) translated versions of the adapted pamphlets. All participants found the pamphlets acceptable and felt they had improved their understanding of hypertension. Involving the target community to identify health issues as well as help to create culturally, language and literacy sensitive health education materials ensures resources are highly acceptable to that community. Minor changes to the materials will be needed prior to formal testing of hypertension knowledge and health decision-making on a larger scale within this at risk community.

  1. Dietary acculturation among the South-Asian Surinamese population in the Netherlands: the HELIUS study.

    Science.gov (United States)

    Raza, Qaisar; Nicolaou, Mary; Snijder, Marieke B; Stronks, Karien; Seidell, Jacob C

    2017-08-01

    To test Koctürk's model of dietary change among South-Asian Surinamese in the Netherlands. The model categorizes foods into staple, complementary and accessory foods and postulates that dietary change after migration begins with accessory foods while foods associated with ethnic identity (staple foods) change at a slower rate. Cross-sectional data from the HELIUS study. Dietary intake was assessed with an FFQ. Acculturation was based on social contacts and sense of belonging and was translated into four strategies of acculturation: assimilation, integration, separation and marginalization. Other indicators of acculturation included residence duration, age at migration and migration generation status. Amsterdam, the Netherlands. Participants of Dutch (n 1456) and South-Asian Surinamese origin (n 968). Across all acculturation strategies, South-Asian Surinamese participants reported significantly higher intakes of rice (staple food) and chicken (complementary food) and significantly lower intakes of red meat and vegetables (complementary foods) and cookies and sweets (accessory food) than Dutch participants. Men, second-generation and assimilated South-Asian Surinamese were inclined towards Dutch foods such as potato, pasta and red meat. Accessory foods like fruits showed variation across acculturation strategies. Consistent with the Koctürk model, the intake of staple foods was stable among South-Asian Surinamese irrespective of acculturation strategy while the intake of accessory foods like fruit varied. Contrary to expectations, South-Asian Surinamese showed consistently high intakes of complementary foods like chicken and fish irrespective of acculturation strategy. Public health practitioners should take into consideration the complex and dynamic nature of dietary acculturation.

  2. Cancer-specific mortality of Asian Americans diagnosed with cancer: a nationwide population-based assessment.

    Science.gov (United States)

    Trinh, Quoc-Dien; Nguyen, Paul L; Leow, Jeffrey J; Dalela, Deepansh; Chao, Grace F; Mahal, Brandon A; Nayak, Manan; Schmid, Marianne; Choueiri, Toni K; Aizer, Ayal A

    2015-06-01

    Racial disparities in cancer survival outcomes have been primarily attributed to underlying biologic mechanisms and the quality of cancer care received. Because prior literature shows little difference exists in the socioeconomic status of non-Hispanic whites and Asian Americans, any difference in cancer survival is less likely to be attributable to inequalities of care. We sought to examine differences in cancer-specific survival between whites and Asian Americans. The Surveillance, Epidemiology, and End Results Program was used to identify patients with lung (n = 130 852 [16.9%]), breast (n = 313 977 [40.4%]), prostate (n = 166 529 [21.4%]), or colorectal (n = 165 140 [21.3%]) cancer (the three leading causes of cancer-related mortality within each sex) diagnosed between 1991 and 2007. Fine and Gray's competing risks regression compared the cancer-specific mortality (CSM) of eight Asian American groups (Chinese, Filipino, Hawaiian/Pacific Islander, Japanese, Korean, other Asian, South Asian [Indian/Pakistani], and Vietnamese) to non-Hispanic white patients. All P values were two-sided. In competing risks regression, the receipt of definitive treatment was an independent predictor of CSM (hazard ratio [HR] = 0.37, 95% confidence interval [CI] = 0.35 to 0.40; HR = 0.55, 95% CI = 0.53 to 0.58; HR = 0.61, 95% CI = 0.60 to 0.62; and HR = 0.27, 95% CI = 0.25 to 0.29) for prostate, breast, lung, and colorectal cancers respectively, all P < .001). In adjusted analyses, most Asian subgroups (except Hawaiians and Koreans) had lower CSM relative to white patients, with hazard ratios ranging from 0.54 (95% CI = 0.38 to 0.78) to 0.88 (95% CI = 0.84 to 0.93) for Japanese patients with prostate and Chinese patients with lung cancer, respectively. Despite adjustment for potential confounders, including the receipt of definitive treatment and tumor characteristics, most Asian subgroups had better CSM than non-Hispanic white patients. These findings suggest that underlying genetic

  3. Estimation of internal radiation dose to the adult Asian population from the dietary intakes of two long-lived radionuclides

    Energy Technology Data Exchange (ETDEWEB)

    Iyengar, G.V. E-mail: v.iyengar@iaea.org; Kawamura, H.; Dang, H.S.; Parr, R.M.; Wang, J.W.; Akhter, Perveen; Cho, S.Y.; Natera, E.; Miah, F.K.; Nguyen, M.S

    2004-07-01

    Daily dietary intakes of two naturally occurring long-lived radionuclides, {sup 232}Th and {sup 238}U, were estimated for the adult population living in a number of Asian countries, using highly sensitive analytical methods such as instrumental and radiochemical neutron activation analysis (INAA and RNAA), and inductively coupled plasma mass spectrometry (ICP-MS). The Asian countries that participated in the study were Bangladesh (BGD), China (CPR), India (IND), Japan (JPN), Pakistan (PAK), Philippines (PHI), Republic of Korea (ROK) and Vietnam (VIE). Altogether, these countries represent more than 50% of the world population. The median daily intakes of {sup 232}Th ranged between 0.6 and 14.4 mBq, the lowest being for Philippines and the highest for Bangladesh, and daily intakes of {sup 238}U ranged between 6.7 and 62.5 mBq, lowest and the highest being for India and China, respectively. The Asian median intakes were obtained as 4.2 mBq for {sup 232}Th and 12.7 mBq for {sup 238}U. Although the Asian intakes were lower than intakes of 12.3 mBq (3.0 {mu}g) {sup 232}Th and 23.6 mBq (1.9 {mu}g) {sup 238}U proposed by the International Commission on Radiological Protection (ICRP) for the ICRP Reference Man, they were comparable to the global intake values of 4.6 mBq {sup 232}Th and 15.6 mBq {sup 238}U proposed by the United Nation Scientific Commission on Effects of Radiation (UNSCEAR). The annual committed effective doses to Asian population from the dietary intake of {sup 232}Th and {sup 238}U were calculated to be 0.34 and 0.20 {mu}Sv, respectively, which are three orders of magnitude lower than the global average annual radiation dose of 2400 {mu}Sv to man from the natural radiation sources as proposed by UNSCEAR.

  4. Estimating the population density of the Asian tapir (Tapirus indicus) in a selectively logged forest in Peninsular Malaysia.

    Science.gov (United States)

    Rayan, D Mark; Mohamad, Shariff Wan; Dorward, Leejiah; Aziz, Sheema Abdul; Clements, Gopalasamy Reuben; Christopher, Wong Chai Thiam; Traeholt, Carl; Magintan, David

    2012-12-01

    The endangered Asian tapir (Tapirus indicus) is threatened by large-scale habitat loss, forest fragmentation and increased hunting pressure. Conservation planning for this species, however, is hampered by a severe paucity of information on its ecology and population status. We present the first Asian tapir population density estimate from a camera trapping study targeting tigers in a selectively logged forest within Peninsular Malaysia using a spatially explicit capture-recapture maximum likelihood based framework. With a trap effort of 2496 nights, 17 individuals were identified corresponding to a density (standard error) estimate of 9.49 (2.55) adult tapirs/100 km(2) . Although our results include several caveats, we believe that our density estimate still serves as an important baseline to facilitate the monitoring of tapir population trends in Peninsular Malaysia. Our study also highlights the potential of extracting vital ecological and population information for other cryptic individually identifiable animals from tiger-centric studies, especially with the use of a spatially explicit capture-recapture maximum likelihood based framework. © 2012 Wiley Publishing Asia Pty Ltd, ISZS and IOZ/CAS.

  5. Unidimensional versus Multidimensional Approaches to the Assessment of Acculturation for Asian American Populations.

    Science.gov (United States)

    Abe-Kim, Jennifer; Okazaki, Sumie; Goto, Sharon G.

    2001-01-01

    Examines approaches to assessing acculturation among Asian Americans college students in relation to the cultural indicators of individualism-collectivism, self-construal, impression management, and loss of face. An uneven nature of these relationships was found which is significant in light of the fact that acculturation differences are often…

  6. Medical care of hepatitis B among Asian American populations: perspectives from three provider groups.

    Science.gov (United States)

    Hwang, Jessica P; Roundtree, Aimee K; Engebretson, Joan C; Suarez-Almazor, Maria E

    2010-03-01

    Physicians can play a significant role in helping to decrease the hepatitis B virus (HBV) burden among Asian Americans. Few studies have described knowledge and practice patterns in the medical community among different provider types regarding HBV and liver cancer. Our study explores the HBV beliefs, attitudes and practice patterns of medical providers serving Asian American communities. We conducted three focus groups with primary care providers, liver specialists, and other providers predominantly serving Asian American community. We asked about practices and barriers to appropriate medical care and outreach. We moderated three focus groups with 23 participants, 18 of whom completed and returned demographic surveys. Twelve were of Asian ethnicity and 13 spoke English as a second language. Only eight screened at least half of their patients, most (72%) using the hepatitis B surface antigen test. We used grounded theory methods to analyze focus group transcripts. Participants frequently discussed cultural and financial barriers to hepatitis care. They admitted reluctance to screen for HBV because patients might be unwilling or unable to afford treatment. Cultural differences were discussed most by primary care providers; best methods of outreach were discussed most by liver specialists; and alternative medicine was discussed most by acupuncturists and other providers. More resources are needed to lower financial barriers complicating HBV care and encourage providing guideline-recommended screenings. Other providers can help promote HBV screening and increase community and cultural awareness.

  7. Gene-Based Genome-Wide Association Analysis in European and Asian Populations Identified Novel Genes for Rheumatoid Arthritis.

    Directory of Open Access Journals (Sweden)

    Hong Zhu

    Full Text Available Rheumatoid arthritis (RA is a complex autoimmune disease. Using a gene-based association research strategy, the present study aims to detect unknown susceptibility to RA and to address the ethnic differences in genetic susceptibility to RA between European and Asian populations.Gene-based association analyses were performed with KGG 2.5 by using publicly available large RA datasets (14,361 RA cases and 43,923 controls of European subjects, 4,873 RA cases and 17,642 controls of Asian Subjects. For the newly identified RA-associated genes, gene set enrichment analyses and protein-protein interactions analyses were carried out with DAVID and STRING version 10.0, respectively. Differential expression verification was conducted using 4 GEO datasets. The expression levels of three selected 'highly verified' genes were measured by ELISA among our in-house RA cases and controls.A total of 221 RA-associated genes were newly identified by gene-based association study, including 71'overlapped', 76 'European-specific' and 74 'Asian-specific' genes. Among them, 105 genes had significant differential expressions between RA patients and health controls at least in one dataset, especially for 20 genes including 11 'overlapped' (ABCF1, FLOT1, HLA-F, IER3, TUBB, ZKSCAN4, BTN3A3, HSP90AB1, CUTA, BRD2, HLA-DMA, 5 'European-specific' (PHTF1, RPS18, BAK1, TNFRSF14, SUOX and 4 'Asian-specific' (RNASET2, HFE, BTN2A2, MAPK13 genes whose differential expressions were significant at least in three datasets. The protein expressions of two selected genes FLOT1 (P value = 1.70E-02 and HLA-DMA (P value = 4.70E-02 in plasma were significantly different in our in-house samples.Our study identified 221 novel RA-associated genes and especially highlighted the importance of 20 candidate genes on RA. The results addressed ethnic genetic background differences for RA susceptibility between European and Asian populations and detected a long list of overlapped or ethnic specific RA

  8. Tobacco Use, Insulin Resistance, and Risk of Type 2 Diabetes: Results from the Multi-Ethnic Study of Atherosclerosis.

    Directory of Open Access Journals (Sweden)

    Rachel J Keith

    Full Text Available Tobacco use is associated with insulin resistance and incident diabetes. Given the racial/ethnic differences in smoking patterns and incident type 2 diabetes our objective was to evaluate the association between tobacco use and insulin resistance (IR as well as incident type 2 diabetes mellitus in a contemporary multiethnic cohort.We studied 5,931 Multi- Ethnic Study of Atherosclerosis (MESA participants who at baseline were free of type 2 diabetes (fasting glucose ≥7.0 mmol/l (126 mg/dl and/or use of insulin or oral hypoglycemic medications categorized by self-reported tobacco status and reclassified by urinary cotinine (available in 58% of participants as never, current or former tobacco users. The association between tobacco use, IR (fasting plasma glucose, insulin, and the homeostatic model assessment of insulin resistance (HOMA-IR and incident diabetes over 10 years was evaluated using multivariable linear regression and Cox proportional hazards models, respectively. Mean age of the participants was 62 (±10 years, 46% were male, 41% Caucasian, 12% Chinese, 26% African American and 21% Hispanic/Latino. IR biomarkers did not significantly differ between current, former, and never cigarette users (P >0.10 but showed limited unadjusted differences for users of cigar, pipe and smokeless tobacco (All P <0.05. Fully adjusted models showed no association between dose or intensity of tobacco exposure and any index of IR. When stratified into participants that quit smoking vs. those who continued smoking during the 10-year study there was no difference in serum glucose levels or frequency of diabetes. In fully adjusted models, there was no significant difference in diabetes risk between former or current cigarette smokers compared to never smokers [HR (95% CI 1.02 (0.77,1.37 and 0.81 (0.52,1.26 respectively].In a contemporary multi-ethnic cohort, there was no independent association between tobacco use and IR or incident type 2 diabetes. The role

  9. Smile characterization by U.S. white, U.S. Asian Indian, and Indian populations.

    Science.gov (United States)

    Sharma, Neeru; Rosenstiel, Stephen F; Fields, Henry W; Beck, F Mike

    2012-05-01

    With growing demand for high esthetic standards, dentists must understand patient perception and incorporate their preferences into treatment. However, little is known about how cultural and ethnic differences influence esthetic perception. The purpose of this study was to determine whether differences in ethnic background, including the possibility of assimilation, affected a layperson's perception of esthetic and smile characteristics. A survey was developed containing images that were digitally manipulated into a series of barely perceptible steps, changing 1 smile parameter to form a strip of images that displayed that parameter over a wide range. Data were collected with a customized program which randomly displayed a single image and allowed the subject to use the mouse to adjust an on-screen slider according to displayed instructions, that is, "Please move the slider to select the image you find to be most ideal"; or "Please move the slider to select the first image that you find unattractive." A convenience sample (n=288) comprised of U.S. whites, U.S. Asian Indians, and Indians living in India was surveyed. This sample provided a power of .86 to detect a difference of ±1.5 mm. Subjects evaluated images showing the smile arc, buccal corridor, gingival display, vertical overlap, lateral incisal step, maxillary midline to midface, and maxillary to mandibular midline. Rater reliability was assessed with the Fleiss-Cohen weighted Kappa (Kw) statistic and corresponding 95% confidence interval after each question was repeated in a random sequence. Choice differences due to ethnicity were assessed with a multiple randomization test and the adjusted P value with the step-down Bonferrroni method of Holm (α=.05). The Kw for the 17 variables in all 3 groups ranged from 0.11 for ideal vertical overlap to 0.64 for ideal buccal corridor space. Overall reliability was fair to moderate. Differences attributed to ethnicity were demonstrated between the Asian Indians and U

  10. Phylogeographic and population insights of the Asian common toad (Bufo gargarizans in Korea and China: population isolation and expansions as response to the ice ages

    Directory of Open Access Journals (Sweden)

    Amaël Borzée

    2017-11-01

    Full Text Available The effects of ice ages on speciation have been well documented for many European and North American taxa. In contrast, very few studies have addressed the consequences of such environmental and topographical changes in North East Asian species. More precisely, the Korean Peninsula offers a unique model to assess patterns and processes of speciation as it hosts the northern- and eastern-most distribution limit of some widespread Asian taxa. Despite this, studies addressing phylogeographic patterns and population genetics in the peninsula and surrounding countries are few and studies for most families are lacking. Here we inferred the phylogenetic relationships of the common toad (Bufo gargarizans from South Korea and their North East Asian counterpart populations, based on mitochondrial data. Korean B. gargarizans GenBank BLASTs matched few individuals from nearby China, but the presence of a Korean clade suggests isolation on the Korean Peninsula, previous to the last glacial maximum, linked to sea level resurgence. Molecular clock calibrations within this group were used to date the divergence between clades and their relationship to paleo-climatic events in the area. Lack of genetic structure among South Korean populations and strong homogeneity between the Korean and some Chinese localities suggest weak isolation and recent expansion. Geographical projection of continuous coalescent maximum-clade-credibility trees shows an original Chinese expansion towards the Korean Peninsula through the Yellow Sea circa two million years ago with colonisation events dating circa 800 thousand years ago (K. y. a.. Following this colonisation, the data point to outgoing Korean Peninsula dispersal events throughout different periods, towards the North through land, and West through land bridge formations over the Yellow Sea during sea level falls. In accordance, demographic analyses revealed a population expansion in the Koran Peninsula circa 300 K. y. a

  11. Trends in Stroke Incidence and 28-Day Case Fatality in a Nationwide Stroke Registry of a Multiethnic Asian Population.

    Science.gov (United States)

    Tan, Chuen Seng; Müller-Riemenschneider, Falk; Ng, Sheryl Hui Xian; Tan, Pei Zheng; Chan, Bernard P L; Tang, Kok-Foo; Ahmad, Aftab; Kong, Keng He; Chang, Hui Meng; Chow, Khuan Yew; Koh, Gerald Choon-Huat; Venketasubramanian, Narayanaswamy

    2015-10-01

    This study investigated trends in stroke incidence and case fatality overall and according to sex, age, ethnicity, and stroke subtype in a multiethnic Asian population. The Singapore Stroke Registry identifies all stroke cases in all public hospitals using medical claims, hospital discharge summaries, and death registry data. Age-standardized incidence rates and 28-day case-fatality rates were calculated for individuals aged ≥15 years between 2006 and 2012. To estimate the annual percentage change of the rates, a linear regression model was fitted to the log rates, and a Wald test was performed to test for trend. P values Chinese (-2.64; 95% CI, -3.15 to -2.13), Indians (-3.78; 95% CI, -5.93 to -1.58), and others (-12.73; 95% CI, -18.93 to -6.06) compared with Malays (2.58; 95% CI, 1.17 to 4.02); and in ischemic stroke subtype (ischemic: -2.43; 95% CI, -3.13 to -1.73; hemorrhagic: -1.02; 95% CI, -2.04 to 0.01). Subgroup-specific findings for case fatality were similar. This is the first countrywide hospital-based registry study in a multiethnic Asian population, and it revealed marked overall reductions in stroke incidence and case fatality. However, it also identified important population groups with less favorable trends, especially younger adults and those of Malay ethnicity. © 2015 American Heart Association, Inc.

  12. Welfare States, Labor Markets, Political Dynamics, and Population Health: A Time-Series Cross-Sectional Analysis Among East and Southeast Asian Nations.

    Science.gov (United States)

    Ng, Edwin; Muntaner, Carles; Chung, Haejoo

    2016-04-01

    Recent scholarship offers different theories on how macrosocial determinants affect the population health of East and Southeast Asian nations. Dominant theories emphasize the effects of welfare regimes, welfare generosity, and labor market institutions. In this article, we conduct exploratory time-series cross-sectional analyses to generate new evidence on these theories while advancing a political explanation. Using unbalanced data of 7 East Asian countries and 11 Southeast Asian nations from 1960 to 2012, primary findings are 3-fold. First, welfare generosity measured as education and health spending has a positive impact on life expectancy, net of GDP. Second, life expectancy varies significantly by labor markets; however, these differences are explained by differences in welfare generosity. Third, as East and Southeast Asian countries become more democratic, welfare generosity increases, and population health improves. This study provides new evidence on the value of considering politics, welfare states, and labor markets within the same conceptual framework. © 2016 APJPH.

  13. Ten-year trends in coronary calcification in individuals without clinical cardiovascular disease in the multi-ethnic study of atherosclerosis.

    Directory of Open Access Journals (Sweden)

    Diane E Bild

    Full Text Available Coronary heart disease (CHD incidence has declined significantly in the US, as have levels of major coronary risk factors, including LDL-cholesterol, hypertension and smoking, but whether trends in subclinical atherosclerosis mirror these trends is not known.To describe recent secular trends in subclinical atherosclerosis as measured by serial evaluations of coronary artery calcification (CAC prevalence in a population over 10 years, we measured CAC using computed tomography (CT and CHD risk factors in five serial cross-sectional samples of men and women from four race/ethnic groups, aged 55-84 and without clinical cardiovascular disease, who were members of Multi-Ethnic Study of Atherosclerosis (MESA cohort from 2000 to 2012. Sample sizes ranged from 1062 to 4837. After adjusting for age, gender, and CT scanner, the prevalence of CAC increased across exams among African Americans, whose prevalence of CAC was 52.4% in 2000-02, 50.4% in 2003-04, 60.0% is 2005-06, 57.4% in 2007-08, and 61.3% in 2010-12 (p for trend <0.001. The trend was strongest among African Americans aged 55-64 [prevalence ratio for 2010-12 vs. 2000-02, 1.59 (95% confidence interval 1.06, 2.39; p = 0.005 for trend across exams]. There were no consistent trends in any other ethnic group. Risk factors generally improved in the cohort, and adjustment for risk factors did not change trends in CAC prevalence.There was a significant secular trend towards increased prevalence of CAC over 10 years among African Americans and no change in three other ethnic groups. Trends did not reflect concurrent general improvement in risk factors. The trend towards a higher prevalence of CAC in African Americans suggests that CHD risk in this population is not improving relative to other groups.

  14. Advances in Understanding Air Pollution and Cardiovascular Diseases: The Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air)

    Science.gov (United States)

    Kaufman, Joel D.; Spalt, Elizabeth W.; Curl, Cynthia L.; Hajat, Anjum; Jones, Miranda R.; Kim, Sun-Young; Vedal, Sverre; Szpiro, Adam A.; Gassett, Amanda; Sheppard, Lianne; Daviglus, Martha L.; Adar, Sara D.

    2016-01-01

    The Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air) leveraged the platform of the MESA cohort into a prospective longitudinal study of relationships between air pollution and cardiovascular health. MESA Air researchers developed fine-scale, state-of-the-art air pollution exposure models for the MESA Air communities, creating individual exposure estimates for each participant. These models combine cohort-specific exposure monitoring, existing monitoring systems, and an extensive database of geographic and meteorological information. Together with extensive phenotyping in MESA—and adding participants and health measurements to the cohort—MESA Air investigated environmental exposures on a wide range of outcomes. Advances by the MESA Air team included not only a new approach to exposure modeling but also biostatistical advances in addressing exposure measurement error and temporal confounding. The MESA Air study advanced our understanding of the impact of air pollutants on cardiovascular disease and provided a research platform for advances in environmental epidemiology. PMID:27741981

  15. Relationship of Aortic Wall Distensibility to Mitral and Aortic Valve Calcification: The Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Cohoon, Kevin P; Criqui, Michael H; Budoff, Matthew J; Lima, Joao A; Blaha, Michael J; Decker, Paul A; Durazo, Ramon; Liu, Kiang; Kramer, Holly

    2018-05-01

    Data are limited on whether valvular calcification is associated with aortic wall stiffness. We tested whether aortic valve calcification (AVC) and/or mitral valve calcification (MVC) is inversely associated with aortic distensibility (AD). Cross-sectional study conducted in a subset of the Multi-Ethnic Study of Atherosclerosis (MESA) included 3676 MESA participants aged 44 to 84 years with AD measured with magnetic resonance imaging and with AVC and MVC measured with noncontrast cardiac computed tomography scans. Both AVC and MVC were divided into 3 categories: zero, AVC and MVC, while 6% (n = 211) and 4% (n = 156) had low, and 6% (n = 209) and 4% (n = 155) had high values of AVC and MVC, respectively. The AVC was independently associated with AD after adjusting for age, gender, and ethnicity ( P = .035). No association was noted between AVC groups and AD after adjustment for all covariates or MVC groups and AD in any model.

  16. A descriptive quantitative study on multi-ethnic patient satisfaction with nursing care measured by the Revised Humane Caring Scale.

    Science.gov (United States)

    Goh, Mien Li; Ang, Emily N K; Chan, Yiong-Huak; He, Hong-Gu; Vehviläinen-Julkunen, Katri

    2016-08-01

    To determine patients' satisfaction with nursing care during hospitalization. Limited studies reporting patients' satisfaction with quality of nursing care in Singapore. A descriptive study was conducted in a tertiary hospital in Singapore. Data were collected from 270 adult patients using the Revised Humane Caring Scale. Patients were moderately satisfied with the nursing care. There were significant differences of patients' level of satisfaction between/among socio-demographic subgroups including ethnicity, gender, reasons for admission and disciplines. Chinese patients were least satisfied with nursing care. The patients were most satisfied with 'Respecting patient's feeling' (mean=82.29, SD=14.50) and least satisfied with 'Communication and participation' (mean=62.00, SD=16.46). Our results reinforced the need to pay more attention to patient information provision and effective communication, which could improve patient satisfaction. The multi-ethnic patients valued respect as an influential attribute in quality nursing care. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Mental Health and Asian Americans

    Science.gov (United States)

    ... Data > Minority Population Profiles > Asian American > Mental Health Mental Health and Asian Americans Suicide was the 9th leading ... Americans is half that of the White population. MENTAL HEALTH STATUS Serious psychological distress among adults 18 years ...

  18. Construct-driven development of a video-based situational judgment test for integrity : A study in a multi-ethnic police setting

    NARCIS (Netherlands)

    L.A.L. de Meijer (Lonneke); M.Ph. Born (Marise); J. van Zielst (Jaap); H.T. van der Molen (Henk)

    2010-01-01

    textabstractIn a field study conducted in a multi-ethnic selection setting at the Dutch police, we examined the construct validity of a video-based situational judgment test (SJT) aimed to measure the construct of integrity. Integrity is of central importance to productive work performance of police

  19. Association between circulating vitamin K1 and coronary calcium progression in community-dwelling adults: the Multi-Ethnic Study of Atherosclerosis

    Science.gov (United States)

    While animal studies found vitamin K treatment reduced vascular calcification, human data are limited. Using a case-cohort design, we determined the association between vitamin K status and coronary artery calcium (CAC) progression in the Multi-ethnic Study of Atherosclerosis. Serum phylloquinone (v...

  20. Eating disorders in Asian populations: a critique of current approaches to the study of culture, ethnicity, and eating disorders.

    Science.gov (United States)

    Cummins, Lillian Huang; Simmons, Angela M; Zane, Nolan W S

    2005-10-01

    There is increasing evidence that eating disorders are present among ethnically diverse populations, and researchers have suggested that investigations in this area may inform the field's understanding of how sociocultural factors are related to the development of eating disorders. Although it is generally accepted that sociocultural factors are key in eating disorder etiology, knowledge on how best to study these influences in diverse groups is still limited. In this article, the authors review how the research literature has explored relationships among culture, ethnicity, and eating disorders in Asian populations and critically examine strategies that have been used to investigate these issues across 1 ethnic/racial group. The methodological challenges encountered in these approaches are identified and considered in the provision of recommendations for future endeavors to improve the field's understanding of how culture is related to eating disorders.

  1. Diffuse Large B-Cell Lymphoma in the Elderly: Real World Outcomes of Immunochemotherapy in Asian Population.

    Science.gov (United States)

    Byun, Ja Min; Lee, Jeong-Ok; Kang, Beodeul; Kim, Ji-Won; Kim, Se Hyun; Kim, Jin Won; Kim, Yu Jung; Lee, Keun-Wook; Bang, Soo-Mee; Lee, Jong Seok

    2016-09-01

    We evaluated the real-life treatment outcomes of elderly patients with diffuse large B-cell lymphoma from a homogenous Asian population and defined the cutoff age for "elderly." The medical records of 192 DLBCL patients aged > 60 years who had received first-line immunochemotherapy were retrospectively evaluated. The treatment schedule, adverse events, and survival outcomes were analyzed overall and stratified by 4 age groups (> 60-64, 65-69, 70-74, and ≥ 75 years). Patient age of ≥ 75 years was associated with a significantly lower complete remission rate (86.5% vs. 81.4% vs. 82.0% vs. 51%; P population, 75 years seems to be a judicious cutoff for predicting treatment outcomes. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Prevalence of serum celiac antibodies in a multiracial Asian population--a first study in the young Asian adult population of Malaysia.

    Science.gov (United States)

    Yap, Theresa Wan-Chen; Chan, Weng-Kai; Leow, Alex Hwong-Ruey; Azmi, Ahmad Najib; Loke, Mun-Fai; Vadivelu, Jamuna; Goh, Khean-Lee

    2015-01-01

    Celiac disease (CD) is an immune-mediated disorder induced by the ingestion of gluten in genetically susceptible persons. The prevalence of CD in Malaysia is unknown. We aim to determine the seroprevalence of CD antibodies and also investigate the correlation between H. pylori infection and CD in the young and healthy multiracial Malaysian population. Healthy young adult volunteers between the ages of 18-30 years were consecutively recruited from June 2012 to May 2014 at the University of Malaya Medical Centre (UMMC), Kuala Lumpur. Serum samples from all the participants were tested for anti-gliadin antibody immunoglobulin A/immunoglobulin G (IgA/IgG) and anti-tissue transglutaminase antibody (tTG) IgA/IgG. Samples positive for both anti-gliadin and anti-tTG were further validated for anti-human endomysial IgA antibodies (EmA). Serological diagnosis of CD was made when anti-gliadin, anti-tTG and anti-EmA were positive. 562 qualified participants with mean age 24 ± 2.4 years old were recruited into our study. CD was found in 7 participants where most of them were asymptomatic and unaware of their CD status. The median of anti-gliadin and anti-tTG IgA/IgG value was 38.2 U/ml (interquartile range, 28.3-60.4 U/ml) and 49.2 U/ml (interquartile range, 41.1-65.9 U/ml), respectively. Seroprevalence of CD antibodies was 1.9% (6 out of 324) in female while only 0.4% (1 out of 238) in male. Seroprevalence among Malay was 0.8% (2 of 236), Chinese was 1.7% (3 of 177) and Indian was 1.3% (2 of 149). Overall, seroprevalence of CD antibodies in healthy asymptomatic adults in the Malaysian population was 1.25% (95% CI, 0.78%-1.72%). No significant relationship was discovered between CD and H. pylori infection. The seroprevalence of CD antibodies in healthy young adults in the Malaysian population was 1.25% (1 in 100). CD is underdiagnosed and it could be a much greater problem in Malaysia than previously thought.

  3. Prevalence of Serum Celiac Antibodies in a Multiracial Asian Population-A First Study in the Young Asian Adult Population of Malaysia

    Science.gov (United States)

    Yap, Theresa Wan-Chen; Chan, Weng-Kai; Leow, Alex Hwong-Ruey; Azmi, Ahmad Najib; Loke, Mun-Fai; Vadivelu, Jamuna; Goh, Khean-Lee

    2015-01-01

    Background Celiac disease (CD) is an immune-mediated disorder induced by the ingestion of gluten in genetically susceptible persons. The prevalence of CD in Malaysia is unknown. We aim to determine the seroprevalence of CD antibodies and also investigate the correlation between H. pylori infection and CD in the young and healthy multiracial Malaysian population. Methods Healthy young adult volunteers between the ages of 18–30 years were consecutively recruited from June 2012 to May 2014 at the University of Malaya Medical Centre (UMMC), Kuala Lumpur. Serum samples from all the participants were tested for anti-gliadin antibody immunoglobulin A/immunoglobulin G (IgA/IgG) and anti-tissue transglutaminase antibody (tTG) IgA/IgG. Samples positive for both anti-gliadin and anti-tTG were further validated for anti-human endomysial IgA antibodies (EmA). Serological diagnosis of CD was made when anti-gliadin, anti-tTG and anti-EmA were positive. Results 562 qualified participants with mean age 24 ± 2.4 years old were recruited into our study. CD was found in 7 participants where most of them were asymptomatic and unaware of their CD status. The median of anti-gliadin and anti-tTG IgA/IgG value was 38.2 U/ml (interquartile range, 28.3–60.4 U/ml) and 49.2 U/ml (interquartile range, 41.1–65.9 U/ml), respectively. Seroprevalence of CD antibodies was 1.9% (6 out of 324) in female while only 0.4% (1 out of 238) in male. Seroprevalence among Malay was 0.8% (2 of 236), Chinese was 1.7% (3 of 177) and Indian was 1.3% (2 of 149). Overall, seroprevalence of CD antibodies in healthy asymptomatic adults in the Malaysian population was 1.25% (95% CI, 0.78%-1.72%). No significant relationship was discovered between CD and H. pylori infection. Conclusions The seroprevalence of CD antibodies in healthy young adults in the Malaysian population was 1.25% (1 in 100). CD is underdiagnosed and it could be a much greater problem in Malaysia than previously thought. PMID:25799401

  4. Associations of Neighborhood Crime and Safety and With Changes in Body Mass Index and Waist Circumference: The Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Powell-Wiley, Tiffany M; Moore, Kari; Allen, Norrina; Block, Richard; Evenson, Kelly R; Mujahid, Mahasin; Diez Roux, Ana V

    2017-08-01

    Using data from the Multi-Ethnic Study of Atherosclerosis (MESA), we evaluated associations of neighborhood crime and safety with changes in adiposity (body mass index (BMI) and waist circumference). MESA is a longitudinal study of cardiovascular disease among adults aged 45-84 years at baseline in 2000-2002, from 6 US sites, with follow-up for MESA participants until 2012. Data for this study were limited to Chicago, Illinois, participants in the MESA Neighborhood Ancillary Study, for whom police-recorded crime data were available, and who had complete baseline data (n = 673). We estimated associations of individual-level safety, aggregated neighborhood-level safety, and police-recorded crime with baseline levels and trajectories of BMI and waist circumference over time using linear mixed modeling with random effects. We also estimated how changes in these factors related to changes in BMI and waist circumference using econometric fixed-effects models. At baseline, greater individual-level safety was associated with more adiposity. Increasing individual- and neighborhood-level safety over time were associated with decreasing BMI over the 10-year period, with a more pronounced effect observed in women for individual-level safety and men for neighborhood-level safety. Police-recorded crime was not associated with adiposity. Neighborhood-level safety likely influences adiposity change and subsequent cardiovascular risk in multiethnic populations. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  5. Associations of Circulating Lymphocyte Subpopulations with Type 2 Diabetes: Cross-Sectional Results from the Multi-Ethnic Study of Atherosclerosis (MESA.

    Directory of Open Access Journals (Sweden)

    Nels C Olson

    Full Text Available Distinct lymphocyte subpopulations have been implicated in the regulation of glucose homeostasis and obesity-associated inflammation in mouse models of insulin resistance. Information on the relationships of lymphocyte subpopulations with type 2 diabetes remain limited in human population-based cohort studies.Circulating levels of innate (γδ T, natural killer (NK and adaptive immune (CD4+ naive, CD4+ memory, Th1, and Th2 lymphocyte subpopulations were measured by flow cytometry in the peripheral blood of 929 free-living participants of the Multi-Ethnic Study of Atherosclerosis (MESA. Cross-sectional relationships of lymphocyte subpopulations with type 2 diabetes (n = 154 and fasting glucose and insulin concentrations were evaluated by generalized linear models.Each standard deviation (SD higher CD4+ memory cells was associated with a 21% higher odds of type 2 diabetes (95% CI: 1-47% and each SD higher naive cells was associated with a 22% lower odds (95% CI: 4-36% (adjusted for age, gender, race/ethnicity, and BMI. Among participants not using diabetes medication, higher memory and lower naive CD4+ cells were associated with higher fasting glucose concentrations (p<0.05, adjusted for age, sex, and race/ethnicity. There were no associations of γδ T, NK, Th1, or Th2 cells with type 2 diabetes, glucose, or insulin.A higher degree of chronic adaptive immune activation, reflected by higher memory and lower naive CD4+ cells, was positively associated with type 2 diabetes. These results are consistent with a role of chronic immune activation and exhaustion augmenting chronic inflammatory diseases, and support the importance of prospective studies evaluating adaptive immune activation and type 2 diabetes.

  6. Relation of Serum Vitamin D to Risk of Mitral Annular and Aortic Valve Calcium (from the Multi-Ethnic Study of Atherosclerosis).

    Science.gov (United States)

    Tibuakuu, Martin; Zhao, Di; de Boer, Ian H; Guallar, Eliseo; Bortnick, Anna E; Lutsey, Pamela L; Budoff, Matthew J; Kizer, Jorge R; Kestenbaum, Bryan R; Michos, Erin D

    2017-08-01

    Serum 25-hydroxyvitamin D [25(OH)D] concentration has been identified as a possible modifiable risk factor for cardiovascular disease (CVD). We hypothesized that serum 25(OH)D concentration would be associated with calcifications of the left-sided heart valves, which are markers of CVD risk. Aortic valve calcium (AVC) and mitral annular calcium (MAC) were quantified from cardiac computed tomography scans performed on 5,530 Multi-Ethnic Study of Atherosclerosis participants at the baseline examination (2000 to 2002) and at a follow-up visit at either Examination 2 (2002 to 2004) or Examination 3 (2004 to 2005). 25(OH)D was measured from serum samples collected at the baseline examination. Using relative risk regression, we evaluated the multivariable-adjusted risk of prevalent and incident AVC and MAC in this ethnically diverse population free of clinical CVD at baseline. The mean age of participants was 62 ± 10 years; 53% were women, 40% white, 26% black, 21% Hispanic, and 12% Chinese. Prevalent AVC and MAC were observed in 12% and 9% of study sample, respectively. There were no significant associations between 25(OH)D and prevalent AVC or MAC. Over a mean follow-up of 2.5 years, 4% developed incident AVC and 5% developed incident MAC. After adjusting for demographic variables, each 10 ng/ml higher serum 25(OH)D was associated with a 15% (relative risk 0.85, 95% confidence interval 0.74 to 0.98) lower risk of incident MAC but not AVC. However, this association was no longer significant after adjusting for lifestyle and CVD risk factors. Results suggest a possible link between serum 25(OH)D and the risk for incident MAC, but future studies with longer follow-up are needed to further test this association. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Socioeconomic Status and Poor Health Outcome at 10 Years of Follow-Up in the Multi-Ethnic Study of Atherosclerosis.

    Directory of Open Access Journals (Sweden)

    Steven Shea

    Full Text Available Predictors of healthy aging have not been well-studied using longitudinal data with demographic, clinical, subclinical, and genetic information. The objective was to identify predictors of poor health outcome at 10 years of follow-up in the Multi-Ethnic Study of Atherosclerosis (MESA.Prospective cohort study.Population-based sample from 6 U.S. communities.4,355 participants In the MESA Study.Poor health outcome at 10 years of follow-up was defined as having died or having clinical cardiovascular disease, depression, cognitive impairment, chronic obstructive pulmonary disease, or cancer other than non-melanoma skin cancer. Absolute risk regression was used to estimate risk differences in the outcome adjusting for demographic variables, clinical and behavioral risk factors, subclinical cardiovascular disease, and ApoE genotype. Models were weighted to account for selective attrition.Mean age at 10 years of follow-up was 69.5 years; 1,480 participants had a poor health outcome, 2,157 participants were in good health, and 718 were unknown. Older age, smoking, not taking a statin, hypertension, diabetes, and higher coronary calcium score were associated with higher probability of poor health outcome. After multivariable adjustment, participants in the lowest income and educational categories had 7 to 14% greater absolute risk of poor health outcome at 10 years of follow-up compared to those in the next highest categories of income or education (P = 0.002 for both. Those in the lowest categories of both income and education had 21% greater absolute risk of poor health outcome compared to those in the highest categories of both income and education.Low income and educational level predict poor health outcome at 10 years of follow-up in an aging cohort, independent of clinical and behavioral risk factors and subclinical cardiovascular disease.

  8. Impacts of urbanisation on the lifestyle and on the prevalence of diabetes in native Asian Indian population.

    Science.gov (United States)

    Ramachandran, A; Snehalatha, C; Latha, E; Manoharan, M; Vijay, V

    1999-06-01

    Recent studies from the Asian subcontinent show an increasing prevalence of diabetes. This increase has been attributed to factors related to lifestyle changes related to modernisation. A periurban rural population resembling the rural in their occupation, but with access to certain urban facilities was chosen for this study. The aim of the study was to assess the impact of modernisation on the rising prevalence of diabetes in the native Indians. A total of 1637 adults aged 20 years and above (749 men and 888 women) were tested for diabetes and impaired glucose tolerance (IGT) by 2 h post-glucose challenge. Demographic, anthropometric, dietary and occupational details, were recorded. Dietary habits were similar in all categories of socio-economic strata. In the present study group, the age standardised prevalence of Type 2 diabetes was 5.9%, which was intermediate to that in the urban (11.6%) and rural (2.4%) populations. The prevalence data of the latter two population were available from previous surveys. Prevalence of impaired glucose tolerance (IGT) was high (6.9%) and similar in all three population samples. In the periurban population, a large percentage of subjects were doing only routine household work and had a sedentary life-style. After correcting for the age and BMI, sedentary work and occupation had a significant association with diabetes, suggesting that sedentary lifestyle may be an important determinant for the higher prevalence of diabetes in an urbanising population.

  9. The distribution of urban population and income: explorations using six Asian cases.

    Science.gov (United States)

    Chakravorty, S

    1993-02-01

    "Urban concentration (or primacy) and inequality (in size distribution of income) are expected to follow bell shaped curves through the development process. Spatial convergence (through investments in transportation etc.) is expected to precede income convergence. Using longitudinal data from six Asian countries (Japan, Taiwan, Malaysia, the Philippines, Sri Lanka and India) this paper shows that (i) the bell shapes for urban concentration and income inequality generally hold, and (ii) the temporal relationship between the curve peaks is determined by geographical factors (for urban concentration); income inequality is seen to be more policy amenable." excerpt

  10. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  11. Taiwan experience suggests that RhD typing for blood transfusion is unnecessary in southeast Asian populations.

    Science.gov (United States)

    Lin, Marie

    2006-01-01

    The high frequency of RhD (D) antigen among Taiwanese persons (99.67%) often imposes unnecessary risks of under-transfusion on D- patients awaiting D- blood. Also because of the rare occurrence of anti-D among Taiwanese persons, routine pretransfusion D typing has been discontinued in the Mackay Memorial Hospital since 1988. This report is the retrospective evaluation of the outcome of abolishing RhD typing for Taiwanese. More than 10 years of alloantibody data at Mackay Memorial Hospital Blood Bank were reviewed. The cases with anti-D were further used to analyze the potency of D antigen and to observe whether there were differences in the incidence of anti-D before and after discontinuation of routine D typing among Taiwanese individuals. The incidence of anti-D before and after discontinuation of routine pretransfusion D typing has remained unchanged. The immunogenicity of D and "Mi(a)" in Taiwanese persons is found to be similar. In terms of opportunity for immunization, however, the "Mi(a)" antigen (phenotype frequency 7.3% in Taiwanese persons) has become the most important blood group antigen in Taiwan. The results strongly support the exclusion of D typing from routine compatibility testing for individuals of Taiwanese origin. Because the low incidence of D- and relatively high incidence of "Mi(a)"+ phenotypes are common findings throughout southeast Asia, and because a population genetic study revealed that the Taiwanese people are genetically related to southern Asian populations, it is suggested that RhD typing for blood transfusion is unnecessary among southeast Asian populations.

  12. Genome-wide association study of pigmentary traits (skin and iris color in individuals of East Asian ancestry

    Directory of Open Access Journals (Sweden)

    Lida Rawofi

    2017-11-01

    Full Text Available Background Currently, there is limited knowledge about the genetics underlying pigmentary traits in East Asian populations. Here, we report the results of the first genome-wide association study of pigmentary traits (skin and iris color in individuals of East Asian ancestry. Methods We obtained quantitative skin pigmentation measures (M-index in the inner upper arm of the participants using a portable reflectometer (N = 305. Quantitative measures of iris color (expressed as L*, a* and b* CIELab coordinates were extracted from high-resolution iris pictures (N = 342. We also measured the color differences between the pupillary and ciliary regions of the iris (e.g., iris heterochromia. DNA samples were genotyped with Illumina’s Infinium Multi-Ethnic Global Array (MEGA and imputed using the 1000 Genomes Phase 3 samples as reference haplotypes. Results For skin pigmentation, we did not observe any genome-wide significant signal. We followed-up in three independent Chinese samples the lead SNPs of five regions showing multiple common markers (minor allele frequency ≥ 5% with good imputation scores and suggestive evidence of association (p-values < 10−5. One of these markers, rs2373391, which is located in an intron of the ZNF804B gene on chromosome 7, was replicated in one of the Chinese samples (p = 0.003. For iris color, we observed genome-wide signals in the OCA2 region on chromosome 15. This signal is driven by the non-synonymous rs1800414 variant, which explains 11.9%, 10.4% and 6% of the variation observed in the b*, a* and L* coordinates in our sample, respectively. However, the OCA2 region was not associated with iris heterochromia. Discussion Additional genome-wide association studies in East Asian samples will be necessary to further disentangle the genetic architecture of pigmentary traits in East Asian populations.

  13. Vitamin D status and vascular dementia due to cerebral small vessel disease in the elderly Asian Indian population.

    Science.gov (United States)

    Prabhakar, Puttachandra; Chandra, Sadanandavalli Retnaswami; Supriya, Manjunath; Issac, Thomas Gregor; Prasad, Chandrajit; Christopher, Rita

    2015-12-15

    Vitamin D plays vital roles in human health and recent studies have shown its beneficial effect on brain functioning. The present study was designed to evaluate the association of vitamin D with vascular dementia (VaD) due to cerebral small vessel disease (SVD) in Asian Indian population. 140 VaD patients aged ≥ 60 years with neuroimaging evidence of SVD, and 132 age and gender-matched controls, were investigated. Vitamin D status was estimated by measuring serum 25-hydroxy vitamin D. Logistic regression model revealed that deficient levels of vitamin D (vitamin D deficiency and insufficiency (12-20 ng/ml), the odds were increased to 31.6-fold and 14.4-fold, respectively. However, in hypertensives with vitamin D sufficiency (>20 ng/ml), the odds of VaD were increased by 3.8-fold only. Pearson correlation showed that serum vitamin D was inversely associated with systolic and diastolic blood pressure (r=-0.401 and -0.411, pvitamin D-deficient subjects. Since the combined presence of hypertension and vitamin D deficiency increases the probability of developing VaD, screening for vitamin D status in addition to regular monitoring of blood pressure, could reduce the risk of VaD associated with cerebral SVD in the elderly Asian Indian subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Low-dose CT screening in an Asian population with diverse risk for lung cancer: A retrospective cohort study

    International Nuclear Information System (INIS)

    Yi, Chin A.; Lee, Kyung Soo; Shin, Myung-Hee; Cho, Yun Yung; Choi, Yoon-Ho; Kwon, O. Jung; Shin, Kyung Eun

    2015-01-01

    To evaluate the performance of low-dose CT (LDCT) screening for lung cancer (LCA) detection in an Asian population with diverse risks for LCA. LCA screening was performed in 12,427 symptomless Asian subjects using either LDCT (5,771) or chest radiography (CXR) (6,656) in a non-trial setting. Subjects were divided into high-risk and non-high-risk groups. Data were collected on the number of patients with screening-detected LCAs and their survival in order to compare outcomes between LDCT and CXR screening with the stratification of risks considering age, sex and smoking status. In the non-high-risk group, a significant difference was observed for the detection of lung cancer (adjusted OR, 5.07; 95 % CI, 2.72-9.45) and survival (adjusted HR of LCA survival between LDCT vs. CXR group, 0.08; 95 % CI, 0.01-0.62). No difference in detection or survival of LCA was noticed in the high-risk group. LCAs in the non-high-risk group were predominantly adenocarcinomas (96 %), and more likely to be part-solid or non-solid compared with those in the high-risk group (p = 0.023). In the non-high-risk group, LDCT helps detect more LCAs and offers better survival than CXR screening, due to better detection of part solid or non-solid lung adenocarcinomas. (orig.)

  15. Low-dose CT screening in an Asian population with diverse risk for lung cancer: A retrospective cohort study

    Energy Technology Data Exchange (ETDEWEB)

    Yi, Chin A. [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Seoul (Korea, Republic of); Lee, Kyung Soo [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Seoul (Korea, Republic of); Sungkyunkwan University School of Medicine, Department of Radiology, Samsung Medical Center, Seoul (Korea, Republic of); Shin, Myung-Hee; Cho, Yun Yung [Sungkyunkwan University School of Medicine, Department of Social and Preventive Medicine, Seoul (Korea, Republic of); Choi, Yoon-Ho [Sungkyunkwan University School of Medicine, Center for Health Promotion, Seoul (Korea, Republic of); Kwon, O. Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea, Republic of); Shin, Kyung Eun [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Seoul (Korea, Republic of); Kyung Hee University Hospital, Department of Diagnostic Radiology, Seoul (Korea, Republic of)

    2015-08-15

    To evaluate the performance of low-dose CT (LDCT) screening for lung cancer (LCA) detection in an Asian population with diverse risks for LCA. LCA screening was performed in 12,427 symptomless Asian subjects using either LDCT (5,771) or chest radiography (CXR) (6,656) in a non-trial setting. Subjects were divided into high-risk and non-high-risk groups. Data were collected on the number of patients with screening-detected LCAs and their survival in order to compare outcomes between LDCT and CXR screening with the stratification of risks considering age, sex and smoking status. In the non-high-risk group, a significant difference was observed for the detection of lung cancer (adjusted OR, 5.07; 95 % CI, 2.72-9.45) and survival (adjusted HR of LCA survival between LDCT vs. CXR group, 0.08; 95 % CI, 0.01-0.62). No difference in detection or survival of LCA was noticed in the high-risk group. LCAs in the non-high-risk group were predominantly adenocarcinomas (96 %), and more likely to be part-solid or non-solid compared with those in the high-risk group (p = 0.023). In the non-high-risk group, LDCT helps detect more LCAs and offers better survival than CXR screening, due to better detection of part solid or non-solid lung adenocarcinomas. (orig.)

  16. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  17. French invasive Asian tiger mosquito populations harbor reduced bacterial microbiota and genetic diversity compared to Vietnamese autochthonous relatives

    Directory of Open Access Journals (Sweden)

    Guillaume eMinard

    2015-09-01

    Full Text Available The Asian tiger mosquito Aedes albopictus is one of the most significant pathogen vectors of the 21st century. Originating from Asia, it has invaded a wide range of eco-climatic regions worldwide. The insect-associated microbiota is now recognized to play a significant role in host biology. While genetic diversity bottlenecks are known to result from biological invasions, the resulting shifts in host-associated microbiota diversity has not been thoroughly investigated. To address this subject, we compared four autochthonous Ae. albopictus populations in Vietnam, the native area of Ae. albopictus, and three populations recently introduced to Metropolitan France, with the aim of documenting whether these populations display differences in host genotype and bacterial microbiota. Population-level genetic diversity (microsatellite markers and COI haplotype and bacterial diversity (16S rDNA metabarcoding were compared between field-caught mosquitoes. Bacterial microbiota from the whole insect bodies were largely dominated by Wolbachia pipientis. Targeted analysis of the gut microbiota revealed a greater bacterial diversity in which a fraction was common between French and Vietnamese populations. The genus Dysgonomonas was the most prevalent and abundant across all studied populations. Overall genetic diversities of both hosts and bacterial microbiota were significantly reduced in recently established populations of France compared to the autochthonous populations of Vietnam. These results open up many important avenues of investigation in order to link the process of geographical invasion to shifts in commensal and symbiotic microbiome communities, as such shifts may have dramatic impacts on the biology and/or vector competence of invading hematophagous insects.

  18. Ethnopsychopharmacology considerations for Asians and Asian Americans.

    Science.gov (United States)

    Wong, Felicia K; Pi, Edmond H

    2012-03-01

    Asians comprise more than 60% of the world's population and are the fastest growing minority group in the United States. Today's psychiatrist must learn to recognize and appreciate the unique factors that influence mental health outcomes in this group. Asian Americans are affected by psychiatric disorders at similar rates as non-Asians, but are significantly underrepresented in psychiatric clinics. When Asians and Asian Americans do present for psychiatric treatment, they often do so with higher severity of illness, and variable levels of compliance. Studies over the past three decades have suggested that pharmacokinetic and pharmacodynamic profiles of various psychotropic medications may be different in Asians, leading to differences in dosage requirements and side-effect profiles. These variations appear to be largely determined by genetic predisposition, but are also influenced by other factors such as environment, social support, cultural perceptions, and physicians' prescribing habits. In this paper, we provide an overview of biological and socio-cultural issues as they relate to psychopharmacology in Asians and Asian Americans, with the hope that a better understanding of these issues will lead to improved mental health care delivery to this population both in the United States, as well as in Asian countries. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Immigrant Asian Indians in the U.S.: A Population at Risk for Diabetes and Cardiovascular Disease

    Science.gov (United States)

    Misra, Ranjita

    2009-01-01

    Asian Indians are the third largest and fastest growing Asian subgroup in the U.S. and considered the model minority due to their high education and income level. Unlike other Asian immigrants, they are a more heterogeneous group with a genetic predisposition for diabetes and cardiovascular disease. Current national surveys are incapable of…

  20. Chaunocephalosis in a wild population of Asian open-billed storks in Thailand.

    Science.gov (United States)

    Poonswad, P; Chatikavanij, P; Thamavit, W

    1992-07-01

    The most common trematode collected from Asian open-billed storks (Anastomus oscitans) was Chaunocephalus ferox (80% prevalence). The trematode was paired in granulomas in the intestinal wall. Based on histological examination of these capsules, there was degeneration and necrosis of muscle cells in the tunica muscularis. Granulation tissue with hetrophil and lymphocyte infiltration appeared in the granulomas. Intestinal villi were shorter and wider in infected areas than in non-infected areas. Some intestinal glands were dilated. Storks with high intensity of C. ferox appeared ill. The death of storks infected with C. ferox may result from malnutrition due to the loss of absorptive function of the intestine and from the effect of granuloma formation which might interfere with the intestinal peristalsis.

  1. A facial expression image database and norm for Asian population: a preliminary report

    Science.gov (United States)

    Chen, Chien-Chung; Cho, Shu-ling; Horszowska, Katarzyna; Chen, Mei-Yen; Wu, Chia-Ching; Chen, Hsueh-Chih; Yeh, Yi-Yu; Cheng, Chao-Min

    2009-01-01

    We collected 6604 images of 30 models in eight types of facial expression: happiness, anger, sadness, disgust, fear, surprise, contempt and neutral. Among them, 406 most representative images from 12 models were rated by more than 200 human raters for perceived emotion category and intensity. Such large number of emotion categories, models and raters is sufficient for most serious expression recognition research both in psychology and in computer science. All the models and raters are of Asian background. Hence, this database can also be used when the culture background is a concern. In addition, 43 landmarks each of the 291 rated frontal view images were identified and recorded. This information should facilitate feature based research of facial expression. Overall, the diversity in images and richness in information should make our database and norm useful for a wide range of research.

  2. The profile of adult onset Henoch-Schönlein purpura in an Asian population.

    Science.gov (United States)

    Yong, Adeline Mei-Yen; Lee, Shan-Xian; Tay, Yong-Kwang

    2015-11-01

    Henoch-Schönlein purpura (HSP) is less common in adults and has been linked with a more severe clinical syndrome as well as a higher frequency of renal disease and internal malignancy. Renal involvement in adult HSP has been significantly associated with antecedent infections, pyrexia at time of first presentation, and purpura above the waist. We aim to evaluate the frequency of cutaneous and extra-cutaneous features and identify the predictive factors for renal involvement in Asian adults with HSP. We performed a retrospective study of 48 adult Asian patients diagnosed with HSP based on the European League Against Rheumatism (EULAR) criteria at a tertiary hospital in Singapore between January 2000 and December 2011. The most common cutaneous manifestations were palpable purpura (73%), papules (31%), and petechiae (27%). Forty-percent had cutaneous lesions extending above the waist. Fifteen patients (31%) had gastrointestinal symptoms, 21 (44%) had joint involvement, and 27 (56%) had renal disease. Seventy-percent of patients with pyrexia at presentation experienced renal disease, whereas only 30% without pyrexia had renal involvement (P = 0.018). Sixty-six percent of patients with purpura had renal involvement as compared to 31% in those without purpura (P = 0.049). The frequency of renal involvement in patients with purpura above the waist (52%) was similar to those with purpura below the waist (55%). Our study confirms that HSP in adults tends to be more severe with a high incidence of extracutaneous manifestations, especially renal disease. Pyrexia at presentation and the presence of purpura were significant predictive factors for renal involvement. © 2015 The International Society of Dermatology.

  3. Diabetic dyslipidaemia in Asian populations in the Western Pacific Region: what we know and don't know.

    Science.gov (United States)

    Chan, Juliana C N; Chan, Siew Pheng; Deerochanawong, Chaicharn; Go, Ruby T; Lee, Kok-Onn; Ma, Ronald Ching-Wan; Pan, Chang-Yu; Sheu, Wayne H-H; Barter, Philip

    2011-10-01

    Approximately 77 million persons with diabetes reside in the Western Pacific Region. This number is estimated to rise to 113 million in 2030 with increasing burden of cardio-renal disease, affecting an increasingly young population. Randomized clinical trials have confirmed the benefits of using statins to reduce low-density lipoprotein cholesterol in preventing cardiovascular disease (CVD) in Caucasians, although similar data are lacking in Asia. Experts from the Western Pacific Region met and reviewed evidence regarding risk association of diabetic dyslipidaemia with cardio-renal disease, effects of lipid lowering, recommended guidelines and clinical practices in Asian populations. There is strong evidence supporting the role of diabetic dyslipidaemia in cardio-renal disease and the benefits of lipid lowering in these populations. The high rate of diabetic kidney disease, its close links with CVD, and the benefits of lipid lowering on renal function are particularly relevant to this population. While most national guidelines use criteria similar to the West in management of diabetic dyslipidaemia, there are consistently low rates of use of lipid-lowering drugs and attaining treatment goals in the region. The group recommends conducting randomized studies, strengthening of the health care system to promote early detection, and intervention of diabetic dyslipidaemia to prevent end organ damage. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  4. Geographic distribution of habitat, development, and population growth rates of the Asian citrus psyllid, Diaphorina citri, in Mexico.

    Science.gov (United States)

    López-Collado, José; Isabel López-Arroyo, J; Robles-García, Pedro L; Márquez-Santos, Magdalena

    2013-01-01

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), is an introduced pest in Mexico and a vector of huanglongbing, a lethal citrus disease. Estimations of the habitat distribution and population growth rates of D. citri are required to establish regional and areawide management strategies and can be used as a pest risk analysis tools. In this study, the habitat distribution of D. citri in Mexico was computed with MaxEnt, an inductive, machine-learning program that uses bioclimatic layers and point location data. Geographic distributions of development and population growth rates were determined by fitting a temperature-dependent, nonlinear model and projecting the rates over the target area, using the annual mean temperature as the predictor variable. The results showed that the most suitable regions for habitat of D. citri comprise the Gulf of Mexico states, Yucatán Peninsula, and areas scattered throughout the Pacific coastal states. Less suitable areas occurred in northern and central states. The most important predictor variables were related to temperature. Development and growth rates had a distribution wider than habitat, reaching some of the northern states of México. Habitat, development, and population growth rates were correlated to each other and with the citrus producing area. These relationships indicated that citrus producing states are within the most suitable regions for the occurrence, development, and population growth of D. citri, therefore increasing the risk of huanglongbing dispersion.

  5. Heart Disease and Asians and Pacific Islanders

    Science.gov (United States)

    ... Data > Minority Population Profiles > Asian American > Heart Disease Heart Disease and Asians and Pacific Islanders Overall, Asian American ... are less likely than white adults to have heart disease and they are less likely to die from ...

  6. Immunizations and Asians and Pacific Islanders

    Science.gov (United States)

    ... and Data > Minority Population Profiles > Asian American > Immunizations Immunizations and Asians and Pacific Islanders Asian/Pacific Islander ... 35 months reached the Healthy People goal for immunizations for hepatitis B, MMR (measles-mumps-rubella), polio ...

  7. Towards a population information network for the Association of South-east Asian Nations (ASEAN POPIN).

    Science.gov (United States)

    Feliciano, G D

    1982-04-01

    ASEAN POPIN was inspired by the work of various international organizations in developing or strengthening capabilities of countries to share population information, and nurtured by the recognition by ASEAN heads of population programs that population information is essential to policy making and program development. Population information has been made a focal point of ASEAN country population programs in various ways, and there has been some attempt to coordinate a sharing of information. Some form of informal network exists in each country among producers, channellers and users of population information. With a view toward strengthening these within and later among the countries, an ASEAN POPIN project was agreed upon in 1979 and a draft proposal developed. The proposal was approved after a series of meetings with ASEAN population program heads. Objectives and expectations of the program, plan of work, strategy of implementation, and past and current activities of the project are briefly summarized and areas of concern and needs discussed.

  8. Perceptions of community participation and health gain in a community project for the South Asian population: a qualitative study.

    Science.gov (United States)

    Bandesha, G; Litva, A

    2005-09-01

    The new public health rejects old individualist attempts at improving health and embraces community-based approaches in reducing health inequalities. Primary Care Trusts in England face the challenge of converting community participation in health into reality. This study explores differences in perception of participation between lay and professional stakeholders of a community health project for a South Asian population in Greater Manchester. In-depth interviews and focus groups were used to explore the views of professional and lay stakeholders. All data were audio-taped, transcribed and analysed for emerging themes using a qualitative framework. Professionals talked of working in partnership with the community but lay stakeholders did not feel that they had control over the project. There were problems in engaging the community and local health professionals in the project. Lack of cultural awareness hampered participation in the project. There was agreement that the project improved the self-confidence of participants and created a more informed population. However, there was little support for claims of improvements in social cohesion and changes in lifestyle directly as a result of the project. Converting the rhetoric of community participation in health into reality is a greater challenge than was envisaged by policy makers. Marginalized communities may not be willing participants and issues of language and cultural sensitivity are important. Project outcomes need to be agreed to ensure projects are evaluated appropriately. Projects with South Asian communities should not be seen to be dealing with all 'ethnic health' issues without addressing changes in statutory organizations and other wider social determinants of health.

  9. The association between two common polymorphisms in MicroRNAs and hepatocellular carcinoma risk in Asian population.

    Directory of Open Access Journals (Sweden)

    Miao Hu

    Full Text Available BACKGROUND: Emerging evidence has shown that microRNAs (miRNAs participate in human carcinogenesis as tumor suppressors or oncogenes. Single nucleotide polymorphism (SNP located in the miRNAs may influence the function of mature miRNAs and then affect the processing of carcinogenesis. It has been suggested that two common SNPs rs2910164 in miR-146a and rs3746444 in miR-499 are associated with susceptibility to hepatocellular carcinoma (HCC. However, published results are inconsistent and inconclusive. To acquire a more precise effect of the association between these polymorphisms and HCC risk, we performed this meta-analysis. METHODOLOGY/PRINCIPAL FINDINGS: We have conducted a search of case-control studies on the associations of SNPs rs2910164 and/or rs3746444 with susceptibility to HCC in PubMed, ScienceDirect, Cochrane Central Register of Controlled Trials, and Chinese National Knowledge Infrastructure databases for the period up to Sep 10th, 2012. A total of 6 studies were identified with 2071 cases and 2350 controls for miR-146a rs2910164 polymorphism, 667 cases and 1006 controls for miR-499 rs3746444 polymorphism. It was found that neither allele frequency nor genotype distribution of the two polymorphisms was associated with risk of HCC in all genetic models. Similarly, subgroup analysis in Asian population showed no associations between the two SNPs and the susceptibility to HCC. CONCLUSIONS/SIGNIFICANCE: This meta-analysis suggests that miR-146a rs2910164 and miR-499 rs3746444 polymorphisms may not be associated with the risk of HCC, especially for Asian population. However, well-designed studies with larger sample size and more detailed data are needed to confirm these conclusions.

  10. Predictive Factors for BRCA1 and BRCA2 Genetic Testing in an Asian Clinic-Based Population.

    Directory of Open Access Journals (Sweden)

    Edward S Y Wong

    Full Text Available The National Comprehensive Cancer Network (NCCN has proposed guidelines for the genetic testing of the BRCA1 and BRCA2 genes, based on studies in western populations. This current study assessed potential predictive factors for BRCA mutation probability, in an Asian population.A total of 359 breast cancer patients, who presented with either a family history (FH of breast and/or ovarian cancer or early onset breast cancer, were accrued at the National Cancer Center Singapore (NCCS. The relationships between clinico-pathological features and mutational status were calculated using the Chi-squared test and binary logistic regression analysis.Of 359 patients, 45 (12.5% had deleterious or damaging missense mutations in BRCA1 and/or BRCA2. BRCA1 mutations were more likely to be found in ER-negative than ER-positive breast cancer patients (P=0.01. Moreover, ER-negative patients with BRCA mutations were diagnosed at an earlier age (40 vs. 48 years, P=0.008. Similarly, triple-negative breast cancer (TNBC patients were more likely to have BRCA1 mutations (P=0.001 and that these patients were diagnosed at a relatively younger age than non-TNBC patients (38 vs. 46 years, P=0.028. Our analysis has confirmed that ER-negative status, TNBC status and a FH of hereditary breast and ovarian cancer (HBOC are strong factors predicting the likelihood of having BRCA mutations.Our study provides evidence that TNBC or ER-negative patients may benefit from BRCA genetic testing, particularly younger patients (<40 years or those with a strong FH of HBOC, in Asian patients.

  11. Diverse Array of New Viral Sequences Identified in Worldwide Populations of the Asian Citrus Psyllid (Diaphorina citri) Using Viral Metagenomics.

    Science.gov (United States)

    Nouri, Shahideh; Salem, Nidá; Nigg, Jared C; Falk, Bryce W

    2015-12-16

    The Asian citrus psyllid, Diaphorina citri, is the natural vector of the causal agent of Huanglongbing (HLB), or citrus greening disease. Together; HLB and D. citri represent a major threat to world citrus production. As there is no cure for HLB, insect vector management is considered one strategy to help control the disease, and D. citri viruses might be useful. In this study, we used a metagenomic approach to analyze viral sequences associated with the global population of D. citri. By sequencing small RNAs and the transcriptome coupled with bioinformatics analysis, we showed that the virus-like sequences of D. citri are diverse. We identified novel viral sequences belonging to the picornavirus superfamily, the Reoviridae, Parvoviridae, and Bunyaviridae families, and an unclassified positive-sense single-stranded RNA virus. Moreover, a Wolbachia prophage-related sequence was identified. This is the first comprehensive survey to assess the viral community from worldwide populations of an agricultural insect pest. Our results provide valuable information on new putative viruses, some of which may have the potential to be used as biocontrol agents. Insects have the most species of all animals, and are hosts to, and vectors of, a great variety of known and unknown viruses. Some of these most likely have the potential to be important fundamental and/or practical resources. In this study, we used high-throughput next-generation sequencing (NGS) technology and bioinformatics analysis to identify putative viruses associated with Diaphorina citri, the Asian citrus psyllid. D. citri is the vector of the bacterium causing Huanglongbing (HLB), currently the most serious threat to citrus worldwide. Here, we report several novel viral sequences associated with D. citri. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Epidemiology of postoperative endophthalmitis in an Asian population: 11-year incidence and effect of intracameral antibiotic agents.

    Science.gov (United States)

    Tan, Colin S H; Wong, Hon Kiat; Yang, Francine P

    2012-03-01

    To describe the incidence of postoperative endophthalmitis after cataract surgery in a multiethnic Asian population over an 11-year period, compare the endophthalmitis rates before and after the use of intracameral antibiotic agents, and identify potential risk factors for endophthalmitis. Department of Ophthalmology, Tan Tock Seng Hospital, Singapore. Cohort study. The incidence and risk factors for postoperative endophthalmitis in patients who had cataract surgery over 11 years were reviewed. Subconjunctival antibiotic agents only were administered over 7 years; in the subsequent 4 years, intracameral cefazolin (1.0 mg/0.1 mL) was used. The overall incidence of postoperative endophthalmitis in 50,177 was 0.042%. Over the 7 years without intracameral antibiotics, the endophthalmitis rate was 0.064% (19/29,539). With the use of intracameral cefazolin, the incidence decreased to 0.01% (2/20,638) (multivariate odds ratio [OR], 13.6; 95% confidence interval [CI], 3.15-58.58; P<.001). The independent risk factors for endophthalmitis were age (OR, 1.05; 95% CI, 1.01-1.09; P=.025) and male sex (0.06% versus 0.02%; OR, 2.96; 95% CI; 1.15-7.65; P=.025). There was a significant reduction in the rate of postoperative endophthalmitis in a multiethnic Asian population with the use of intracameral cefazolin. Men and older patients were at a higher risk for endophthalmitis. No author has a financial or proprietary interest in any material or method mentioned. Copyright © 2012 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  13. Leading Multi-Ethnic Schools: Adjustments in Concepts and Practices for Engaging with Diversity

    Science.gov (United States)

    Shah, Saeeda

    2008-01-01

    The student population across world is increasingly reflective of diverse cultures, religions and ethnicities. This rich diversity may become a challenge for educational leaders, teachers, and policy-makers in the absence of an understanding of diverse sources of knowledge people draw on for directing their beliefs and daily practices. This paper…

  14. National Identity and Language in Multi-Ethnic Latin America. Occasional Papers, 24.

    Science.gov (United States)

    Mar-Molinero, Clare

    A discussion of the relationship between national identity and language in Spanish-speaking Latin America focuses on issues concerning indigenous languages, education, and literacy. The sociolinguistic history and configuration Spanish-speaking Latin America are outlined briefly, noting the influences of indigenous populations, non-Spanish…

  15. Starting Off on the Wrong Foot : Elite Influences in Multi-Ethnic Democratization Settings

    NARCIS (Netherlands)

    Krebs, Lutz F.

    2016-01-01

    Elite manipulation theories, particularly the idea of diversionary war, have played a substantial role in the analysis of ethnic civil wars. Some, as Gagnon (2004), argue that political elites have shaped the perceptions of their population to create the illusion of a threatening outside world.

  16. Performance of the U.S. Office of Management and Budget's Revised Race and Ethnicity Categories in Asian Populations*

    Science.gov (United States)

    Holup, Joan L; Press, Nancy; Vollmer, William M; Harris, Emily L; Vogt, Thomas M; Chen, Chuhe

    2007-09-01

    OBJECTIVES: The U.S. Office of Management and Budget (OMB) guidelines for collecting and reporting race and ethnicity information recently divided the "Asian or Pacific Islander" category into "Asian" and "Native Hawaiian or Other Pacific Islander". The OMB's decision to disaggregate the "Asian or Pacific Islander" category was the first step toward providing these communities with information to better serve their needs. However, whether individuals who formerly made up the combined group categorize themselves as the new guidelines intend is a question analyzed in this report. METHODS: A subset of adults participating in the Hemochromatosis and Iron Overload Screening Study completed both the OMB-minimum and the expanded race and ethnicity measure used in the National Health Interview Survey. We compared responses on the expanded measure contained within the OMB "Asian" definition (Filipino, Korean, Vietnamese, Japanese, Asian Indian, Chinese, and/or Other Asian) to "Asian" responses on the OMB-minimum measure. RESULTS: Mixed heritage Asians less often marked "Asian". Among mixed heritage Japanese, Chinese, and Filipinos, 27%, 49%, and 52% did not mark "Asian" on the OMB measure, respectively. Eleven percent of single-heritage Filipinos did not mark "Asian." CONCLUSIONS: Many individuals formerly making up the combined "Asian or Pacific Islander" group do not categorize themselves as the revised OMB guidelines intend. This is particularly evident among Filipinos and among Asians of mixed heritage. This research illuminates the reliability and utility of the broad "Asian" category and points to possible consequences of collapsing groups into a single category, i.e., missed information and/or erroneous generalization.

  17. Characterizing the genetic risk for Type 2 diabetes in a Malaysian multi-ethnic cohort.

    Science.gov (United States)

    Abdullah, N; Abdul Murad, N A; Attia, J; Oldmeadow, C; Mohd Haniff, E A; Syafruddin, S E; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G

    2015-10-01

    To characterize the association with Type 2 diabetes of known Type 2 diabetes risk variants in people in Malaysia of Malay, Chinese and Indian ancestry who participated in the Malaysian Cohort project. We genotyped 1604 people of Malay ancestry (722 cases, 882 controls), 1654 of Chinese ancestry (819 cases, 835 controls) and 1728 of Indian ancestry (851 cases, 877 controls). First, 62 candidate single-nucleotide polymorphisms previously associated with Type 2 diabetes were assessed for association via logistic regression within ancestral groups and then across ancestral groups using a meta-analysis. Second, estimated odds ratios were assessed for excess directional concordance with previously studied populations. Third, a genetic risk score aggregating allele dosage across the candidate single-nucleotide polymorphisms was tested for association within and across ancestral groups. After Bonferroni correction, seven individual single-nucleotide polymorphisms were associated with Type 2 diabetes in the combined Malaysian sample. We observed a highly significant excess in concordance of effect directions between Malaysian and previously studied populations. The genetic risk score was strongly associated with Type 2 diabetes in all Malaysian groups, explaining from 1.0 to 1.7% of total Type 2 diabetes risk variance. This study suggests there is substantial overlap of the genetic risk alleles underlying Type 2 diabetes in Malaysian and other populations. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.

  18. Walkability and cardiometabolic risk factors: Cross-sectional and longitudinal associations from the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Braun, Lindsay M; Rodríguez, Daniel A; Evenson, Kelly R; Hirsch, Jana A; Moore, Kari A; Diez Roux, Ana V

    2016-05-01

    We used data from 3227 older adults in the Multi-Ethnic Study of Atherosclerosis (2004-2012) to explore cross-sectional and longitudinal associations between walkability and cardiometabolic risk factors. In cross-sectional analyses, linear regression was used to estimate associations of Street Smart Walk Score® with glucose, triglycerides, HDL and LDL cholesterol, systolic and diastolic blood pressure, and waist circumference, while logistic regression was used to estimate associations with odds of metabolic syndrome. Econometric fixed effects models were used to estimate longitudinal associations of changes in walkability with changes in each risk factor among participants who moved residential locations between 2004 and 2012 (n=583). Most cross-sectional and longitudinal associations were small and statistically non-significant. We found limited evidence that higher walkability was cross-sectionally associated with lower blood pressure but that increases in walkability were associated with increases in triglycerides and blood pressure over time. Further research over longer time periods is needed to understand the potential for built environment interventions to improve cardiometabolic health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. The influence of active coping and perceived stress on health disparities in a multi-ethnic low income sample

    Directory of Open Access Journals (Sweden)

    Tomar Scott L

    2008-01-01

    Full Text Available Abstract Background Extensive research has shown that ethnic health disparities are prevalent and many psychological and social factors influence health disparities. Understanding what factors influence health disparities and how to eliminate health disparities has become a major research objective. The purpose of this study was to examine the impact of coping style, stress, socioeconomic status (SES, and discrimination on health disparities in a large urban multi-ethnic sample. Methods Data from 894 participants were collected via telephone interviews. Independent variables included: coping style, SES, sex, perceived stress, and perceived discrimination. Dependent variables included self-rated general and oral health status. Data analysis included multiple linear regression modeling. Results Coping style was related to oral health for Blacks (B = .23, p Conclusion Our results indicate that perceived stress is a critical component in understanding health outcomes for all ethnoracial groups. While SES related significantly to general health for Whites and Hispanics, this relationship was mediated by perceived stress. Active coping was associated only with oral health.

  20. Serum phosphate is associated with aortic valve calcification in the Multi-ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Linefsky, Jason P; O'Brien, Kevin D; Sachs, Michael; Katz, Ronit; Eng, John; Michos, Erin D; Budoff, Matthew J; de Boer, Ian; Kestenbaum, Bryan

    2014-04-01

    This study sought to investigate associations of phosphate metabolism biomarkers with aortic valve calcification (AVC). Calcific aortic valve disease (CAVD) is a common progressive condition that involves inflammatory and calcification mediators. Currently there are no effective medical treatments, but mineral metabolism pathways may be important in the development and progression of disease. We examined associations of phosphate metabolism biomarkers, including serum phosphate, urine phosphate, parathyroid hormone (PTH) and serum fibroblast growth factor (FGF)-23, with CT-assessed AVC at study baseline and in short-term follow-up in 6814 participants of the Multi-Ethnic Study of Atherosclerosis (MESA). At baseline, AVC prevalence was 13.2%. Higher serum phosphate levels were associated with significantly greater AVC prevalence (relative risk 1.3 per 1 mg/dL increment, 95% confidence incidence: 1.1 to 1.5, pAVC. Average follow-up CT evaluation was 2.4 years (range 0.9-4.9 years) with an AVC incidence of 4.1%. Overall, phosphate metabolism biomarkers were not associated with incident AVC except in the top FGF-23 quartile. Serum phosphate levels are significantly associated with AVC prevalence. Further study of phosphate metabolism as a modifiable risk factor for AVC is warranted. Published by Elsevier Ireland Ltd.

  1. Relationship of aortic valve calcification with coronary artery calcium severity: the Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Nasir, Khurram; Katz, Ronit; Al-Mallah, Mouaz; Takasu, Junichiro; Shavelle, David M; Carr, Jeffery J; Kronmal, Richard; Blumenthal, Roger S; O'Brien, Kevin; Budoff, Matthew J

    2010-01-01

    Aortic valve calcification (AVC) and atherosclerosis share causative and pathologic features. We evaluated the relationship between AVC and coronary artery calcium (CAC) severity in the Multi-Ethnic Study of Atherosclerosis (MESA). Men and women aged 45-84 years (n=6809; mean age, 62 years) were studied. The presence and burden of AVC and CAC were determined by noncontrast cardiac computed tomography. Relative risk regression was used to model the probability of AVC as a function of CAC > 0 as well as CAC categories (0, 1-99, 100-399, and > or = 400) with the reference group being CAC=0. The prevalence of AVC and CAC was 13% and 50%, respectively. Among those without CAC, the prevalence of AVC was 5% and increased across levels of CAC severity such that 14%, 25%, and 38% had AVC with increasing CAC scores of 1-99, 100-399, and > or = 400, respectively (P for trendAVC among those with mild CAC (1-99) was 1.83 (95% CI, 1.45-2.31) and increased to 3.36 (95% CI, 2.56-4.42) for CAC > or = 400. Similar statistically significant increased risk of AVC was found when CAC was assessed as a continuous variable. Our study shows that AVC is independently associated with increasing severity of CAC. 2010 Society of Cardiovascular Computed Tomography. Published by Elsevier Inc. All rights reserved.

  2. Cross Ethnic Friendship among Multi-ethnic Students and Teacher’s Role in Supporting Cultural Diversity in School

    Directory of Open Access Journals (Sweden)

    Ahmad Yasmin

    2018-01-01

    Full Text Available This article presents an in-depth discussion about cross ethnic friendship among students and teacher's role in supporting the cultural diversity that exists in school. The school which consist of students from various ethnic groups provide space and opportunities for students to interact socially with peers either from the same or other ethnic groups. On the other hand, the school that consists of only one ethnic group limits the opportunity for students to interact with friends from different ethnic groups. Students who have attended the schools that are not diverse in terms of ethnicity were reported having more friends from the same ethnic group. A positive relationship between individuals from different ethnic groups led to the reduction in prejudice, enhance the sense of common identity and closeness among individuals. Teachers as agents of unity should play an important role in assisting students to acquire the necessary social skills that enables them to interact effectively with students from different ethnic, cultural and languages which consequently create a harmony cross ethnic friendships among multi-ethnic students in school.

  3. The regeneration of a multi-ethnic mixed-use area: The case of Robin Hood Chase

    Directory of Open Access Journals (Sweden)

    Ian Bentley

    1997-01-01

    Full Text Available Urban designers show increasing interest in promoting community participation in urban regeneration and especially housing regeneration. However, effective participation has proved difficult in multi-ethnic mixed-use areas, with their wide range of different (and often conflicting interest groups. This paper, presented in case-study form, analyses a project in one such area: the Robin Hood Chase local centre in St. Ann’s area of Nottingham. It pays particular attention to the identification of different interest groups and their associated institutions, the use of local media and social events to involve these groups in the urban design process, the use of rearrangeable models in a process of “enquiry by design”, and the production of a widely acceptable urban design strategy for the area. Analysis of feedback from participants indicates a high level of satisfaction both with the final physical design proposal and with the process itself; and also identifies directions for further development in the approach and techniques employed.

  4. Psychosocial Predictors of Metabolic Syndrome among Latino Groups in the Multi-Ethnic Study of Atherosclerosis (MESA.

    Directory of Open Access Journals (Sweden)

    Manuel S Ortiz

    Full Text Available We sought to determine the contribution of psychological variables to risk for metabolic syndrome (MetS among Latinos enrolled in the Multi-Ethnic Study of Atherosclerosis (MESA, and to investigate whether social support moderates these associations, and whether inflammatory markers mediate the association between psychological variables and MetS.Cross-sectional analyses at study baseline were conducted with a national Latino cohort (n = 1,388 that included Mexican Americans, Dominican Americans, Puerto Rican Americans and Central/South Americans. Hierarchical logistic regression analyses were conducted to test the effects of psychosocial variables (chronic stress, depressive symptoms, and social support on MetS. In addition, separate subgroup-specific models, controlling for nationality, age, gender, socioeconomic position, language spoken at home, exercise, smoking and drinking status, and testing for the effects of chronic stress, depressive symptoms and inflammation (IL-6, CRP, fibrinogen in predicting risk for MetS were conducted.In the overall sample, high chronic stress independently predicted risk for MetS, however this association was found to be significant only in Mexican Americans and Puerto Rican Americans. Social support did not moderate the associations between chronic stress and MetS for any group. Chronic stress was not associated with inflammatory markers in either the overall sample or in each group.Our results suggest a differential contribution of chronic stress to the prevalence of MetS by national groups.

  5. Psychological distress during pregnancy in a multi-ethnic community: findings from the born in Bradford cohort study.

    Directory of Open Access Journals (Sweden)

    Stephanie L Prady

    Full Text Available Antenatal anxiety and depression are predictive of future mental distress, which has negative effects on children. Ethnic minority women are more likely to have a lower socio-economic status (SES but it is unclear whether SES is an independent risk factor for mental health in pregnancy. We described the association between maternal mental distress and socio-demographic factors in a multi-ethnic cohort located in an economically deprived city in the UK.We defined eight distinct ethno-language groups (total N = 8,454 and classified a threshold of distress as the 75th centile of within-group GHQ-28 scores, which we used as the outcome for univariate and multivariate logistic regression for each ethnic group and for the sample overall.Financial concerns were strongly and independently associated with worse mental health for six out of the eight ethnic groups, and for the cohort overall. In some groups, factors such as working status, education and family structure were associated with worse mental health, but for others these factors were of little importance.The diversity between and within ethnic groups in this sample underlines the need to take into consideration individual social, migration and economic circumstances and their potential effect on mental health in ethnically diverse areas.

  6. Liminal cosmopolitanisms: Identity strategies and categorization of culture and class in multi-ethnic squats in Rome

    Directory of Open Access Journals (Sweden)

    Piero Vereni

    2016-08-01

    Full Text Available In the last twenty years, the squatting movement in Rome has witnessed a steady increase of foreign participants as regular members but a scarce presence among the leadership. Moreover, the incidence of immigrants among squatters is typically not marked in the public self-representation of the movement yet overemphasized and disputed by mainstream media. The essay attempts an interpretation of this peculiar distribution of foreign immigrants among squatters. On the one side, their being foreigners within Italian welfare puts them at risk of higher exclusion; on the other, political leaders in the squats may see the foreigners (as bearers of a shared class condition as a suitable pool for the wider political aim of squatting, namely the implementation of an alternative urban lifestyle. Furthermore, foreigners may take part into squats just as a self-attained form of social emancipation, since the act of squatting may equal an otherwise inaccessible house possession. Within these apparently contradictory aims, multi-ethnic squats turn into cosmopolitan spaces of identities that accept transcending their specificities to pour into a common kiln of class identity, between revolutionary proletariat and pity bourgeoisie seeking full social integration.

  7. Age-related left ventricular remodeling and associated risk for cardiovascular outcomes: the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Cheng, Susan; Fernandes, Verônica R S; Bluemke, David A; McClelland, Robyn L; Kronmal, Richard A; Lima, João A C

    2009-05-01

    Age-related alterations of left ventricular (LV) structure and function that may predispose to cardiovascular events are not well understood. We used cardiac MRI to examine age-related differences in LV structure and function in 5004 participants without overt cardiovascular disease when enrolled in the Multi-Ethnic Study of Atherosclerosis; 1099 participants received additional strain analyses by MRI tagging. We also assessed the relation of age-associated remodeling with cardiovascular outcomes using Cox proportional hazard models adjusting for cardiovascular risk factors. Although LV mass decreased with age (-0.3 g per year), the mass-to-volume ratio markedly increased (+5 mg/mL per year, Pfall in stroke volume (-0.4 mL per year, P or =65 years; hazard ratio, 1.68 [CI 0.77 to 3.68]) individuals with the highest compared to lowest mass-to-volume ratio quintile (P(interaction)=0.013). Age is associated with a phenotype of LV remodeling marked by increased mass-to-volume ratio and accompanied by systolic as well as diastolic myocardial dysfunction that is not reflected by preserved ejection fraction. This pattern of ventricular remodeling confers significant cardiovascular risk, particularly when present earlier in life.

  8. Changes in walking associated with perceived neighborhood safety and police-recorded crime: The multi-ethnic study of atherosclerosis.

    Science.gov (United States)

    Kerr, Zachary; Evenson, Kelly R; Moore, Kari; Block, Richard; Diez Roux, Ana V

    2015-04-01

    To explore the association of changes in perceived safety and police-recorded crime with changes in transport and leisure walking using longitudinal data from Chicago residents participating in the Multi-Ethnic Study of Atherosclerosis (2000-2012). Main exposures included perceived safety (self-reported as feeling safe walking in the neighborhood and reporting violence to be a problem in the neighborhood), and one-year counts of police-recorded crime occurring within a one-mile buffer of participants' residences. Main outcomes included transport and leisure walking (self-reported and calculated as total minutes/week across four study visits). Fixed effects models assessed the association of change in perceived safety and police-recorded crime with changes in transport and leisure walking over a 10-year period for 796 adults. No associations were found between changes in perceived safety and either changes in transport or leisure walking. Residing in areas with increases in murder was associated with decreases in transport walking. However, no other associations were found with police-recorded crime. There continues to be a need to explore the benefits of cultivating safe neighborhoods that enhance resident health and well-being. Research should continue examining how community initiatives may build safe environments and community identity that promote walking. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Critical shoulder angle in an East Asian population: correlation to the incidence of rotator cuff tear and glenohumeral osteoarthritis.

    Science.gov (United States)

    Shinagawa, Kiyotsugu; Hatta, Taku; Yamamoto, Nobuyuki; Kawakami, Jun; Shiota, Yuki; Mineta, Mitsuyoshi; Itoi, Eiji

    2018-05-03

    Focus has recently been on the critical shoulder angle (CSA) as a factor related to rotator cuff tear and osteoarthritis (OA) in the European population. However, whether this relationship is observed in the Asian population is unclear. The correlation between the CSAs measured on anteroposterior radiographs and the presence or absence of rotator cuff tears or OA changes was assessed in 295 patients. Rotator cuff tears were diagnosed with magnetic resonance imaging or ultrasonography. OA findings were classified using the Samilson-Prieto classification. The CSAs among the patients with rotator cuff tears, OA changes, and those without pathologies were compared. Multivariable analyses were used to clarify the potential risks for these pathologies. The mean CSA with rotator cuff tear (33.9° ± 4.1°) was significantly greater than that without a rotator cuff tear (32.3° ± 4.5°; P = .002). Multivariable analysis also showed that a greater CSA had a significantly increased risk of rotator cuff tears, with the odds ratio of 1.08 per degree. OA findings showed no significant correlation to the CSAs. Our study demonstrates that the CSA is greater in those with a rotator cuff tear than in those without a tear or OA changes, which may be an independent risk factor for the incidence of rotator cuff tears in the Japanese population. Copyright © 2018 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  10. The role of polymorphisms associated with early tooth eruption in dental and occlusal traits in East Asian populations

    Science.gov (United States)

    Kawaguchi, Akira; Kim, Yong-Il; Haga, Shugo; Katayama, Koshu; Ishida, Hajime; Park, Soo-Byung; Maki, Koutaro; Kimura, Ryosuke

    2014-01-01

    Objective A recent study suggested that rs6504340, a polymorphism within the homeobox B (HOXB) gene cluster, is associated with the susceptibility for malocclusions in Europeans. The resulting malocclusions require orthodontic treatment. The aim of this study was to investigate the association of rs6504340 and other dentition-implicated polymorphisms with dental and occlusal traits in Korean and Japanese populations. Methods The study participants included 223 unrelated Koreans from the Busan area and 256 unrelated Japanese individuals from the Tokyo metropolitan area. DNA samples were extracted from saliva specimens. Genotyping for rs6504340 and four single nucleotide polymorphisms (SNPs) that have been shown to be associated with the timing of first tooth eruption and the number of teeth at 1 year of age (rs10506525, rs1956529, rs9674544, and rs8079702) was performed using TaqMan assays. The Index of Orthodontic Treatment Need (IOTN), overjet, overbite, arch length discrepancy, crown sizes, and length and width of the dental arches were measured. Spearman's correlation coefficients were calculated to evaluate relationships between rs6504340 and these dental/occlusal traits. Results We evaluated the aesthetic components and dental health components of the IOTN in the Korean and Japanese populations and found that neither rs6504340 nor the other four SNPs showed any association with dental and occlusal traits in these East Asian populations. Conclusions These negative results suggest that further research is needed to identify the genetic determinants of malocclusions in order to reach a consensus. PMID:24696826

  11. Evaluation of the InnoTyper® 21 genotyping kit in multi-ethnic populations

    DEFF Research Database (Denmark)

    Ristow, Peter Gustav; Barnes, Nicole; Murphy, Gina Pineda

    2017-01-01

    We report the findings of the evaluation of the InnoTyper® 21 genotyping kit for the use of human identification (HID) and paternity testing in South Africa. This novel forensic kit evaluates 20 retrotransposable elements (AC4027, MLS26, ALU79712, NBC216, NBC106, RG148, NBC13, AC2265, MLS09, AC11...

  12. Brain Amyloid Deposition and Longitudinal Cognitive Decline in Nondemented Older Subjects: Results from a Multi-Ethnic Population.

    Directory of Open Access Journals (Sweden)

    Yian Gu

    Full Text Available We aimed to whether the abnormally high amyloid-β (Aβ level in the brain among apparently healthy elders is related with subtle cognitive deficits and/or accelerated cognitive decline.A total of 116 dementia-free participants (mean age 84.5 years of the Washington Heights Inwood Columbia Aging Project completed 18F-Florbetaben PET imaging. Positive or negative cerebral Aβ deposition was assessed visually. Quantitative cerebral Aβ burden was calculated as the standardized uptake value ratio in pre-established regions of interest using cerebellar cortex as the reference region. Cognition was determined using a neuropsychological battery and selected tests scores were combined into four composite scores (memory, language, executive/speed, and visuospatial using exploratory factor analysis. We examined the relationship between cerebral Aβ level and longitudinal cognition change up to 20 years before the PET scan using latent growth curve models, controlling for age, education, ethnicity, and Apolipoprotein E (APOE genotype.Positive reading of Aβ was found in 41 of 116 (35% individuals. Cognitive scores at scan time was not related with Aβ. All cognitive scores declined over time. Aβ positive reading (B = -0.034, p = 0.02 and higher Aβ burden in temporal region (B = -0.080, p = 0.02 were associated with faster decline in executive/speed. Stratified analyses showed that higher Aβ deposition was associated with faster longitudinal declines in mean cognition, language, and executive/speed in African-Americans or in APOE ε4 carriers, and with faster memory decline in APOE ε4 carriers. The associations remained significant after excluding mild cognitive impairment participants.High Aβ deposition in healthy elders was associated with decline in executive/speed in the decade before neuroimaging, and the association was observed primarily in African-Americans and APOE ε4 carriers. Our results suggest that measuring cerebral Aβ may give us important insights into the cognitive profile in the years prior to the scan in cognitively normal elders.

  13. A qualitative study on healthcare professionals’ perceived barriers to insulin initiation in a multi-ethnic population

    Directory of Open Access Journals (Sweden)

    Lee Yew

    2012-07-01

    Full Text Available Abstract Background Nationwide surveys have shown that the prevalence of diabetes rates in Malaysia have almost doubled in the past ten years; yet diabetes control remains poor and insulin therapy is underutilized. This study aimed to explore healthcare professionals’ views on barriers to starting insulin therapy in people with type 2 diabetes. Methods Healthcare professionals consisting of general practitioners (n = 11, family medicine specialists (n = 10, medical officers (n = 8, government policy makers (n = 4, diabetes educators (n = 3 and endocrinologists (n = 2 were interviewed. A semi-structured topic guide was used to guide the interviews by trained facilitators. The interviews were transcribed verbatim and analysed using a thematic analysis approach. Results Insulin initiation was found to be affected by patient, healthcare professional and system factors. Patients’ barriers include culture-specific barriers such as the religious purity of insulin, preferred use of complementary medication and perceived lethality of insulin therapy. Healthcare professionals’ barriers include negative attitudes towards insulin therapy and the ‘legacy effect’ of old insulin guidelines; whilst system barriers highlight the lack of resources, language and communication challenges. Conclusions Tackling the issue of insulin initiation should not only happen during clinical consultations. It requires health education to emphasise the progressive nature of diabetes and the eventuality of insulin therapy at early stage of the illness. Healthcare professionals should be trained how to initiate insulin and communicate effectively with patients from various cultural and religious backgrounds.

  14. Angiotensin-Converting Inhibitors and Angiotensin II Receptor Blockers and Longitudinal Change in Percent Emphysema on Computed Tomography. The Multi-Ethnic Study of Atherosclerosis Lung Study

    Science.gov (United States)

    Parikh, Megha A.; Aaron, Carrie P.; Hoffman, Eric A.; Schwartz, Joseph E.; Madrigano, Jaime; Austin, John H. M.; Lovasi, Gina; Watson, Karol; Stukovsky, Karen Hinckley

    2017-01-01

    Rationale: Although emphysema on computed tomography (CT) is associated with increased morbidity and mortality in patients with and without spirometrically defined chronic obstructive pulmonary disease, no available medications target emphysema outside of alpha-1 antitrypsin deficiency. Transforming growth factor-β and endothelial dysfunction are implicated in emphysema pathogenesis, and angiotensin II receptor blockers (ARBs) inhibit transforming growth factor-β, improve endothelial function, and restore airspace architecture in murine models. Evidence in humans is, however, lacking. Objectives: To determine whether angiotensin-converting enzyme (ACE) inhibitor and ARB dose is associated with slowed progression of percent emphysema by CT. Methods: The Multi-Ethnic Study of Atherosclerosis researchers recruited participants ages 45–84 years from the general population from 2000 to 2002. Medication use was assessed by medication inventory. Percent emphysema was defined as the percentage of lung regions less than −950 Hounsfield units on CTs. Mixed-effects regression models were used to adjust for confounders. Results: Among 4,472 participants, 12% used an ACE inhibitor and 6% used an ARB at baseline. The median percent emphysema was 3.0% at baseline, and the rate of progression was 0.64 percentage points over a median of 9.3 years. Higher doses of ACE or ARB were independently associated with a slower change in percent emphysema (P = 0.03). Over 10 years, in contrast to a predicted mean increase in percent emphysema of 0.66 percentage points in those who did not take ARBs or ACE inhibitors, the predicted mean increase in participants who used maximum doses of ARBs or ACE inhibitors was 0.06 percentage points (P = 0.01). The findings were of greatest magnitude among former smokers (P emphysema. There was no evidence that ACE inhibitor or ARB dose was associated with decline in lung function. Conclusions: In a large population-based study, ACE

  15. Blood pressure and antihypertensive medication profile in a multiethnic Asian population of stable chronic kidney disease patients.

    Science.gov (United States)

    Teo, Boon Wee; Chua, Horng Ruey; Wong, Weng Kin; Haroon, Sabrina; Subramanian, Srinivas; Loh, Ping Tyug; Sethi, Sunil; Lau, Titus

    2016-05-01

    Clinical practice guidelines recommend different blood pressure (BP) goals for chronic kidney disease (CKD) patients. Usage of antihypertensive medication and attainment of BP targets in Asian CKD patients remain unclear. This study describes the profile of antihypertensive agents used and BP components in a multiethnic Asian population with stable CKD. Stable CKD outpatients with variability of serum creatinine levels 3 months apart, were recruited. Mean systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured using automated manometers, according to practice guidelines. Serum creatinine was assayed and the estimated glomerular filtration rate (GFR) calculated using the CKD Epidemiology Collaboration equation. BP and antihypertensive medication profile was examined using univariate analyses. 613 patients (55.1% male; 74.7% Chinese, 6.4% Indian, 11.4% Malay; 35.7% diabetes mellitus) with a mean age of 57.8 ± 14.5 years were recruited. Mean SBP was 139 ± 20 mmHg, DBP was 74 ± 11 mmHg, serum creatinine was 166 ± 115 µmol/L and GFR was 53 ± 32 mL/min/1.73 m(2). At a lower GFR, SBP increased (p < 0.001), whereas DBP decreased (p = 0.0052). Mean SBP increased in tandem with the number of antihypertensive agents used (p < 0.001), while mean DBP decreased when ≥ 3 antihypertensive agents were used (p = 0.0020). Different targets are recommended for each BP component in CKD patients. A majority of patients cannot attain SBP targets and/or exceed DBP targets. Research into monitoring and treatment methods is required to better define BP targets in CKD patients. Copyright: © Singapore Medical Association.

  16. Rapid population growth and fragile environments: the sub-Saharan African and south Asian experience.

    Science.gov (United States)

    Caldwell, J C; Caldwell, P

    1994-02-18

    Case studies of the world's two poorest regions, sub-Saharan Africa and South Asia, were used to illustrate the compromised standard of living of the poor and environmental damage due to continued rapid population growth. The conclusion was that the livelihoods of the poor should not be endangered for preserving the living standards of richer people. Nations must not ignore the challenges of reducing population growth as fast as can be achieved. The transitional period over the next 50 years is the main concern, because population growth rates will be slowing. Rural population growth is expected to decline from 60% of total population growth in South Asia to 7% between 2000 and 2025; similarly the decline in sub-Saharan Africa would be from 50% to 15%. Over the past 30 years, food production in South Asia has kept pace with population growth. Sub-Saharan Africa has adopted food importation to meet demand. African problems are a low resource base, faster population growth, and the fact that governments and individuals are too poor to maintain soil fertility. Long-term studies of how much soil depletion will occur are not available for these regions, and local area studies are not as pessimistic. Transition policies are needed to put "people first in terms of engineered or directed population and ecological change." The six main issues are the following: 1) the Brundtland Commission appropriately identified poverty as the main cause and effect of environmental degradation because of the threat to survival; 2) the verdict is still out about whether food production will keep pace with population growth through economic growth and investment in agriculture; 3) empirical research is needed to examine local social and regulatory institutions and the possibility of reinforcing these mechanisms rather than instituting central controls; 4) central coercion or modernizing economic policies can destroy local level controls; 5) famine is a complex ecological phenomenon and the

  17. CMPK1 and RBP3 are associated with corneal curvature in Asian populations.

    Science.gov (United States)

    Chen, Peng; Miyake, Masahiro; Fan, Qiao; Liao, Jiemin; Yamashiro, Kenji; Ikram, Mohammad K; Chew, Merywn; Vithana, Eranga N; Khor, Chiea-Chuen; Aung, Tin; Tai, E-Shyong; Wong, Tien-Yin; Teo, Yik-Ying; Yoshimura, Nagahisa; Saw, Seang-Mei; Cheng, Ching-Yu

    2014-11-15

    Corneal curvature (CC) measures the steepness of the cornea and is an important parameter for clinically diseases such as astigmatism and myopia. Despite the high heritability of CC, only two associated genes have been discovered to date. We performed a three-stage genome-wide association study meta-analysis in 12 660 Asian individuals. Our Stage 1 was done in multiethnic cohorts comprising 7440 individuals, followed by a Stage 2 replication in 2473 Chinese and Stage 3 in 2747 Japanese. The SNP array genotype data were imputed up to the 1000 Genomes Project Phase 1 cosmopolitan panel. The SNP association with the radii of CC was investigated in the linear regression model with the adjustment of age, gender and principal components. In addition to the known genes, MTOR (also known as FRAP1) and PDGFRA, we discovered two novel genes associated with CC: CMPK1 (rs17103186, P = 3.3 × 10(-12)) and RBP3 (rs11204213 [Val884Met], P = 1.1 × 10(-13)). The missense RBP3 SNP, rs11204213, was also associated with axial length (AL) (P = 4.2 × 10(-6)) and had larger effects on both CC and AL compared with other SNPs. The index SNPs at the four indicated loci explained 1.9% of CC variance across the Stages 1 and 2 cohorts, while 33.8% of CC variance was explained by the genome-wide imputation data. We identified two novel genes influencing CC, which are related to either corneal shape or eye size. This study provides additional insights into genetic architecture of corneal shape. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Bone mineral density and factors influencing it in Asian Indian population with type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Sadishkumar Kamalanathan

    2014-01-01

    Full Text Available Objective: To assess bone mineral density (BMD in type 2 diabetes mellitus (T2DM patients and its relation, if any, to clinical, hormonal and metabolic factors. Materials and Methods: A prospective evaluation of 194 T2DM patients (97 men and 97 women was carried out. BMD was done with dual energy X-ray absorptiometry (DXA at the lumbar spine and total hip. Physical activity, nutritional intake and sunlight exposure were calculated. Biochemical and hormonal tests included serum 25 hydroxy vitamin D [25(OH D], parathyroid hormone, estrogen, testosterone and urinary calcium-creatinine ratio. Glycosylated hemoglobin and complete lipid profiles were done in patients with diabetes. Five hundred and seventy one non-diabetic controls (262 males and 309 females were evaluated for BMD alone. Results: BMD was normal (Z score > -2 in 156 (80.5% and low (Z score ≤ -2 in 38 (19.5% patients in the diabetes study group. BMD in the diabetes group was significantly higher than the control group in both sexes at the hip and spine. The difference was no longer significant on analysis of a BMI matched control subgroup. Weight and BMI showed significant correlation to BMD. Duration of T2DM, degree of glycemic control, use of drugs like statins and thiazolidinediones, 25(OH D levels, calcium intake, sunlight exposure and physical activity did not significantly affect BMD in this cohort of individuals with diabetes. Conclusions: Bone mineral density of Asian Indian T2DM subjects was similar to that of healthy volunteers in this study.

  19. Obesity, hypertension, and migration: a meta-analysis of populations of the South Asian diaspora.

    Science.gov (United States)

    Madrigal, Lorena; Brady, Jeffrey; Raxter, Michelle; Ruiz, Ernesto; Otarola, Flory; Blell, Mwenza

    2011-02-01

    The effects of migration on human health have been a topic of interest for demographers and human biologists. Even if migrants to a new region achieve a higher standard of living in their new place of residence, their improved living conditions may not be associated with better health. Part of the difficulty of understanding the health consequences of migration is the complications in trying to control for variables that may affect health, such as gender, age, and urban or rural environment of migrants and nonmigrants. In this paper we report results of a meta-analysis of the body mass index (BMI) and blood pressure (BP) of people of South Asian descent, by comparing nonmigrants who inhabit the subcontinent, with migrants who moved to various places around the globe. Our results indicate that BMI almost always increases to a significant level upon migration and that an increase in BMI is most pronounced in female migrants. Our results also show that BP does not always increase in migrant communities and that it is actually lower in some migrant samples than it is in comparable nonmigrant groups. Therefore, our results show that BP and the BMI do not behave in the same manner following a migration event. We propose that the BMI changes experienced by migrants are likely to reflect different activity levels and diet in the new homeland. However, the BP changes experienced by migrants are likely to reflect stress broadly defined. Such stress may be increased or decreased, depending on the specific migration experience. We propose that the BMI and BP measure two different dimensions of the migration experience.

  20. Major single nucleotide polymorphisms in polypoidal choroidal vasculopathy: a comparative analysis between Thai and other Asian populations

    Directory of Open Access Journals (Sweden)

    Chantaren P

    2012-03-01

    Full Text Available Patchima Chantaren1, Paisan Ruamviboonsuk1, Mathurose Ponglikitmongkol2, Montip Tiensuwan3, Somying Promso41Department of Ophthalmology, Rajavithi Hospital, Bangkok, 2Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok, 3Department of Mathematics, Faculty of Science, Mahidol University, Bangkok, 4Virology and Molecular Microbiology Unit, Department of Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, ThailandPurpose: To investigate the association in a Thai population between the major age-related macular degeneration (AMD susceptibility loci, Y402H and I62V in the complement factor H (CFH and A69S in the age-related maculopathy susceptibility 2 (ARMS2 genes, and polypoidal choroidal vasculopathy (PCV.Methods: A case-control study included 97 PCV cases and 102 age- and gender-matched controls without any retinopathy. The genotypic profiles of the three polymorphisms were obtained using a real-time polymerase chain reaction assay. The allelic and genotypic association between the polymorphisms and PCV were compared with those from the compiled data of other Asian populations reported previously.Results: Strong associations between the Y402H, I62V, and A69S polymorphisms and PCV were observed in the present study (P = 0.002, 0.003, and 0.0008 respectively and in the compiled data (P < 0.0001 for all three polymorphisms. The risk allele frequencies of the polymorphisms in PCVs and in controls from the present study (15.0% and 5.4% for Y402H, 71.7% and 57.4% for I62V, and 54.1% and 37.3% for A69S respectively were also comparable with the frequencies from the compiled data (10.3% and 6.4% for Y402H, 75.2% and 58.3% for I62V, and 56.8% and 36.8% for A69S respectively. The genotype distribution for each polymorphism was also comparable in both datasets.Conclusion: The findings of this study support a significant genetic association between the major AMD susceptibility genes and PCV across Asian

  1. Evaluation of the URIT-2900 automated hematology analyzer for screening of thalassemia and hemoglobinopathies in Southeast Asian populations.

    Science.gov (United States)

    Karnpean, Rossarin; Pansuwan, Anupong; Fucharoen, Goonnapa; Fucharoen, Supan

    2011-07-01

    The effectiveness of the URIT-2900 Hematology Analyzer for screening of hemoglobinopathies commonly found in Southeast Asian populations was examined. Appropriate cut-off values of MCV and MCH for screening of α(0) and β thalassemias were derived from the receiver operator characteristic curve conducted initially on 279 subjects with various thalassemia genotypes. Validation was performed additionally in a cohort of another unrelated 313 subjects. The best cut off values of MCV and MCH were found to be 78fL and 27pg, respectively. Using these cut off values in combination with the dichlorophenolindophenol test in screening of α(0) thalassemia, β thalassemia and Hb E in a cohort study revealed 100% sensitivity, 79.6% specificity, 80.0% positive predictive value and 100% negative predictive value. The combined blood cell counting using the URIT-2900 Automated Hematology Analyzer and dichlorophenolindophenol test is suitable for population screening of thalassemia and hemoglobinopathies in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  2. Strong positive association of traditional Asian-style diets with blood cadmium and lead levels in the Korean adult population.

    Science.gov (United States)

    Park, Sunmin; Lee, Byung-Kook

    2013-12-01

    Blood lead and cadmium levels are more than twofold to fivefold higher in the Korean population compared to that of the USA. This may be related to the foods consumed. We examined which food categories are related to blood lead and cadmium levels in the Korean adult population using the 2008-2010 Korean National Health and Nutrition Examination Survey (n = 5504). High and moderate consumption of bread and crackers, potatoes, meat and meat products, milk and dairy products, and pizza and hamburger resulted in significantly lower odds ratios for blood lead levels than their low consumption. However, consumption of salted fish, white fish, green vegetables, white and yellow vegetables, coffee, and alcohol resulted in significantly higher odds ratios of blood lead and cadmium. In conclusion, the typical Asian diet based on rice, fish, vegetables, regular coffee, and alcoholic drinks may be associated with higher blood cadmium and lead levels. This study suggests that lead and cadmium contents should be monitored and controlled in agricultural products to reduce health risks from heavy metals.

  3. First record of the Asian bush mosquito, Aedes japonicus japonicus, in Italy: invasion from an established Austrian population.

    Science.gov (United States)

    Seidel, Bernhard; Montarsi, Fabrizio; Huemer, Hartwig P; Indra, Alexander; Capelli, Gioia; Allerberger, Franz; Nowotny, Norbert

    2016-05-16

    In 2011 we identified the Asian bush mosquito, Aedes japonicus japonicus (Theobald, 1901) (Diptera: Culicidae) for the first time in northern Slovenia and in the bordering Austrian federal state of Styria. Between May and July 2012 the distribution area of Ae. j. japonicus was already found to be extended westwards into Carinthia and eastwards towards Burgenland and bordering Hungary. In August 2012 the species was first detected in a western province of Hungary. In subsequent years, follow-up field studies demonstrated an active spread westwards throughout Carinthia, reaching the border to northern Italy. In July 2015 several aquatic-stage specimens of the species were discovered at three different sites in the Friuli Venezia Giulia region, north-eastern Italy. In September 2015, co-occurrence of Ae. j. japonicus and Aedes albopictus (Skuse, 1895) was observed in the same sample in that region. Ae. j. japonicus actively extended its geographic range from an established population in Carinthia (Austria) southwards to northern Italy by crossing Alpine ranges. Since Ae. albopictus and Aedes koreicus (Edwards, 1917) are already well established in northern Italy, it will be pivotal to monitor the consequences of a third invasive mosquito species trying to populate the same geographic region.

  4. Population Dynamics Among six Major Groups of the Oryza rufipogon Species Complex, Wild Relative of Cultivated Asian Rice.

    Science.gov (United States)

    Kim, HyunJung; Jung, Janelle; Singh, Namrata; Greenberg, Anthony; Doyle, Jeff J; Tyagi, Wricha; Chung, Jong-Wook; Kimball, Jennifer; Hamilton, Ruaraidh Sackville; McCouch, Susan R

    2016-12-01

    Understanding population structure of the wild progenitor of Asian cultivated rice (O. sativa), the Oryza rufipogon species complex (ORSC), is of interest to plant breeders and contributes to our understanding of rice domestication. A collection of 286 diverse ORSC accessions was evaluated for nuclear variation using genotyping-by-sequencing (113,739 SNPs) and for chloroplast variation using Sanger sequencing (25 polymorphic sites). Six wild subpopulations were identified, with 25 % of accessions classified as admixed. Three of the wild groups were genetically and geographically closely related to the O. sativa subpopulations, indica, aus and japonica, and carried O. sativa introgressions; the other three wild groups were genetically divergent, had unique chloroplast haplotypes, and were located at the geographical extremes of the species range. The genetic subpopulations were significantly correlated (r 2  = 0.562) with traditional species designations, O. rufipogon (perennial) and O. nivara (annual), differentiated based on morphology and life history. A wild diversity panel of 95 purified (inbred) accessions was developed for future genetic studies. Our results suggest that the cultivated aus subpopulation is most closely related to an annual wild relative, japonica to a perennial wild relative, and indica to an admixed population of diverse annual and perennial wild ancestors. Gene flow between ORSC and O. sativa is common in regions where rice is cultivated, threatening the identity and diversity of wild ORSC populations. The three geographically isolated ORSC populations harbor variation rarely seen in cultivated rice and provide a unique window into the genetic composition of ancient rice subpopulations.

  5. Are C-reactive protein associated genetic variants associated with serum levels and retinal markers of microvascular pathology in Asian populations from Singapore?

    Directory of Open Access Journals (Sweden)

    Rajkumar Dorajoo

    Full Text Available C-reactive protein (CRP levels are associated with cardiovascular disease and systemic inflammation. We assessed whether CRP-associated loci were associated with serum CRP and retinal markers of microvascular disease, in Asian populations.Genome-wide association analysis (GWAS for serum CRP was performed in East-Asian Chinese (N = 2,434 and Malays (N = 2,542 and South-Asian Indians (N = 2,538 from Singapore. Leveraging on GWAS data, we assessed, in silico, association levels among the Singaporean datasets for 22 recently identified CRP-associated loci. At loci where directional inconsistencies were observed, quantification of inter-ethnic linkage disequilibrium (LD difference was determined. Next, we assessed association for a variant at CRP and retinal vessel traits [central retinal artery equivalent (CRAE and central retinal vein equivalent (CRVE] in a total of 24,132 subjects of East-Asian, South-Asian and European ancestry.Serum CRP was associated with SNPs in/near APOE, CRP, HNF1A and LEPR (p-values ≤4.7×10(-8 after meta-analysis of Singaporean populations. Using a candidate-SNP approach, we further replicated SNPs at 4 additional loci that had been recently identified to be associated with serum CRP (IL6R, GCKR, IL6 and IL1F10 (p-values ≤0.009, in the Singaporean datasets. SNPs from these 8 loci explained 4.05% of variance in serum CRP. Two SNPs (rs2847281 and rs6901250 were detected to be significant (p-value ≤0.036 but with opposite effect directions in the Singaporean populations as compared to original European studies. At these loci we did not detect significant inter-population LD differences. We further did not observe a significant association between CRP variant and CRVE or CRAE levels after meta-analysis of all Singaporean and European datasets (p-value >0.058.Common variants associated with serum CRP, first detected in primarily European studies, are also associated with CRP levels in East-Asian and South-Asian

  6. ADH1B Arg47His polymorphism is associated with esophageal cancer risk in high-incidence Asian population: evidence from a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Guohong Zhang

    Full Text Available BACKGROUND AND OBJECTIVES: Incidence of Esophageal squamous cell carcinoma (ESCC is prevalent in Asian populations, especially in the ones from the "Asian esophageal cancer belt" along the Silk Road and the ones from East Asia (including Japan. Silk Road and Eastern Asia population genetics are relevant to the ancient population migration from central China. The Arg47His (rs1229984 polymorphism of ADH1B is the highest in East Asians, and ancient migrations along the Silk Road were thought to be contributive to a frequent ADH1B*47His allele in Central Asians. This polymorphism was identified as responsible for susceptibility in the first large-scale genome-wide association study of ESCC and that's explained by its modulation of alcohol oxidization capability. To investigate the association of ADH1B Arg47His with ESCC in Asian populations under a common ancestry scenario of the susceptibility loci, we combined all available studies into a meta-analysis. METHODS: A dataset composed of 4,220 cases and 8,946 controls from twelve studies of Asian populations was analyzed for ADH1B Arg47His association with ESCC and its interactions with alcohol drinking and ALDH2 Glu504Lys. Heterogeneity among studies and their publication bias were also tested. RESULTS: The ADH1B*47Arg allele was found to be associated to increased risk of ESCC, with the odds ratios (OR being 1.62 (95% CI: 1.49-1.76 and 3.86 (2.96-5.03 for the His/Arg and the Arg/Arg genotypes, respectively. When compared with the His/His genotype of non-drinkers, the Arg/Arg genotype can interact with alcohol drinking and greatly increase the risk of ESCC (OR = 20.69, 95%CI: 5.09-84.13. Statistical tests also showed gene-gene interaction of ADH1B Arg+ with ALDH2 Lys+ can bring more risk to ESCC (OR  = 13.46, 95% CI: 2.32-78.07. CONCLUSION: Revealed by this meta-analysis, ADH1B*47Arg as a common ancestral allele can significantly increase the risk of ESCC in Asians, especially when coupled

  7. ADH1B Arg47His polymorphism is associated with esophageal cancer risk in high-incidence Asian population: evidence from a meta-analysis.

    Science.gov (United States)

    Zhang, Guohong; Mai, Ruiqin; Huang, Bo

    2010-10-27

    Incidence of Esophageal squamous cell carcinoma (ESCC) is prevalent in Asian populations, especially in the ones from the "Asian esophageal cancer belt" along the Silk Road and the ones from East Asia (including Japan). Silk Road and Eastern Asia population genetics are relevant to the ancient population migration from central China. The Arg47His (rs1229984) polymorphism of ADH1B is the highest in East Asians, and ancient migrations along the Silk Road were thought to be contributive to a frequent ADH1B*47His allele in Central Asians. This polymorphism was identified as responsible for susceptibility in the first large-scale genome-wide association study of ESCC and that's explained by its modulation of alcohol oxidization capability. To investigate the association of ADH1B Arg47His with ESCC in Asian populations under a common ancestry scenario of the susceptibility loci, we combined all available studies into a meta-analysis. A dataset composed of 4,220 cases and 8,946 controls from twelve studies of Asian populations was analyzed for ADH1B Arg47His association with ESCC and its interactions with alcohol drinking and ALDH2 Glu504Lys. Heterogeneity among studies and their publication bias were also tested. The ADH1B*47Arg allele was found to be associated to increased risk of ESCC, with the odds ratios (OR) being 1.62 (95% CI: 1.49-1.76) and 3.86 (2.96-5.03) for the His/Arg and the Arg/Arg genotypes, respectively. When compared with the His/His genotype of non-drinkers, the Arg/Arg genotype can interact with alcohol drinking and greatly increase the risk of ESCC (OR = 20.69, 95%CI: 5.09-84.13). Statistical tests also showed gene-gene interaction of ADH1B Arg+ with ALDH2 Lys+ can bring more risk to ESCC (OR  = 13.46, 95% CI: 2.32-78.07). Revealed by this meta-analysis, ADH1B*47Arg as a common ancestral allele can significantly increase the risk of ESCC in Asians, especially when coupled with alcohol drinking or the ALDH2*504Lys allele.

  8. Are C-Reactive Protein Associated Genetic Variants Associated with Serum Levels and Retinal Markers of Microvascular Pathology in Asian Populations from Singapore?

    Science.gov (United States)

    Ikram, Mohammad Kamran; Liu, Jianjun; Froguel, Philippe; Lee, Jeannette; Sim, Xueling; Ong, Rick Twee-Hee; Tay, Wan Ting; Peng, Chen; Young, Terri L.; Blakemore, Alexandra I. F.; Cheng, Ching Yu; Aung, Tin; Mitchell, Paul; Wang, Jie Jin; Klaver, Caroline C.; Boerwinkle, Eric; Klein, Ronald; Siscovick, David S.; Jensen, Richard A.; Gudnason, Vilmundur; Smith, Albert Vernon; Teo, Yik Ying; Wong, Tien Yin; Tai, E-Shyong; Heng, Chew-Kiat; Friedlander, Yechiel

    2013-01-01

    Introduction C-reactive protein (CRP) levels are associated with cardiovascular disease and systemic inflammation. We assessed whether CRP-associated loci were associated with serum CRP and retinal markers of microvascular disease, in Asian populations. Methods Genome-wide association analysis (GWAS) for serum CRP was performed in East-Asian Chinese (N = 2,434) and Malays (N = 2,542) and South-Asian Indians (N = 2,538) from Singapore. Leveraging on GWAS data, we assessed, in silico, association levels among the Singaporean datasets for 22 recently identified CRP-associated loci. At loci where directional inconsistencies were observed, quantification of inter-ethnic linkage disequilibrium (LD) difference was determined. Next, we assessed association for a variant at CRP and retinal vessel traits [central retinal artery equivalent (CRAE) and central retinal vein equivalent (CRVE)] in a total of 24,132 subjects of East-Asian, South-Asian and European ancestry. Results Serum CRP was associated with SNPs in/near APOE, CRP, HNF1A and LEPR (p-values ≤4.7×10−8) after meta-analysis of Singaporean populations. Using a candidate-SNP approach, we further replicated SNPs at 4 additional loci that had been recently identified to be associated with serum CRP (IL6R, GCKR, IL6 and IL1F10) (p-values ≤0.009), in the Singaporean datasets. SNPs from these 8 loci explained 4.05% of variance in serum CRP. Two SNPs (rs2847281 and rs6901250) were detected to be significant (p-value ≤0.036) but with opposite effect directions in the Singaporean populations as compared to original European studies. At these loci we did not detect significant inter-population LD differences. We further did not observe a significant association between CRP variant and CRVE or CRAE levels after meta-analysis of all Singaporean and European datasets (p-value >0.058). Conclusions Common variants associated with serum CRP, first detected in primarily European studies, are also associated with

  9. Objectively recorded physical activity in pregnancy and postpartum in a multi-ethnic cohort: association with access to recreational areas in the neighbourhood.

    Science.gov (United States)

    Richardsen, Kåre Rønn; Mdala, Ibrahimu; Berntsen, Sveinung; Ommundsen, Yngvar; Martinsen, Egil Wilhelm; Sletner, Line; Jenum, Anne Karen

    2016-07-07

    Physical activity may reduce the risk of adverse pregnancy outcomes; however, compared to non-pregnant women, a lower proportion of pregnant women meet the physical activity guidelines. Our objectives were to explore overall changes and ethnic differences in objectively recorded moderate-to-vigorous intensity physical activity (MVPA) during pregnancy and postpartum and to investigate the associations with objective and perceived access to recreational areas. We analysed 1,467 person-observations from 709 women in a multi-ethnic population-based cohort, with MVPA data recorded with the SenseWear™ Pro(3) Armband in early pregnancy (mean gestational week (GW) 15), mid-pregnancy (mean GW 28) and postpartum (mean postpartum week 14). MVPA was limited to bouts ≥10 min. Women were nested within 56 neighbourhoods defined by postal code area. We derived neighbourhood-level objective access to recreational areas (good vs limited) by geographic information systems. We collected information about perceived access (high vs low perception) to recreational areas in early pregnancy. We treated ethnicity, objective and perceived access as explanatory variables in separate models based on linear mixed effects regression analyses. Overall, MVPA dropped between early and mid-pregnancy, followed by an increase postpartum. Western women performed more MVPA than women in other ethnic groups across time points, but the differences increased postpartum. Women residing in neighbourhoods with good objective access to recreational areas accumulated on average nine additional MVPA minutes/day (p perceived and objective access to recreational areas remained significantly associated with MVPA. The association between MVPA and access to recreational areas did not differ by time point, ethnic group or socio-economic position. In all ethnic groups, we observed a decline in MVPA between early and mid-pregnancy. However, at both time points during pregnancy, and especially three months

  10. Decreased naive and increased memory CD4(+ T cells are associated with subclinical atherosclerosis: the multi-ethnic study of atherosclerosis.

    Directory of Open Access Journals (Sweden)

    Nels C Olson

    Full Text Available Adaptive immunity has been implicated in atherosclerosis in animal models and small clinical studies. Whether chronic immune activation is associated with atherosclerosis in otherwise healthy individuals remains underexplored. We hypothesized that activation of adaptive immune responses, as reflected by higher proportions of circulating CD4(+ memory cells and lower proportions of naive cells, would be associated with subclinical atherosclerosis.We examined cross-sectional relationships of circulating CD4(+ naive and memory T cells with biomarkers of inflammation, serologies, and subclinical atherosclerosis in 912 participants of the Multi-Ethnic Study of Atherosclerosis (MESA. Circulating CD4(+ naive cells were higher in women than men and decreased with age (all p-values <0.0001. European-Americans had higher levels of naive cells and lower levels of memory cells compared with African-Americans and Hispanic-Americans (all p-values ≤0.0005. Lower naive/higher memory cells were associated with interleukin-6 levels. In multivariate models, cytomegalovirus (CMV and H. Pylori titers were strongly associated with higher memory and lower naive cells (all p-values <0.05. Higher memory cells were associated with coronary artery calcification (CAC level in the overall population [β-Coefficient (95% confidence interval (CI  = 0.20 (0.03, 0.37]. Memory and naive (inversely cells were associated with common carotid artery intimal media thickness (CC IMT in European-Americans [memory: β =  0.02 (0.006, 0.04; naive: β = -0.02 (-0.004, -0.03].These results demonstrate that the degree of chronic adaptive immune activation is associated with both CAC and CC IMT in otherwise healthy individuals, consistent with the known role of CD4(+ T cells, and with innate immunity (inflammation, in atherosclerosis. These data are also consistent with the hypothesis that immunosenescence accelerates chronic diseases by putting a greater burden on the innate

  11. Sex and race/ethnic disparities in the cross-sectional association between depressive symptoms and muscle mass: the Multi-ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Remigio-Baker, Rosemay A; Allison, Matthew A; Schreiner, Pamela J; Carnethon, Mercedes R; Nettleton, Jennifer A; Mujahid, Mahasin S; Szklo, Moyses; Crum, Rosa M; Leuotsakos, Jeannie-Marie; Franco, Manuel; Jensky, Nicole; Golden, Sherita Hill

    2015-09-18

    The cross-sectional area of total muscle mass has been reported to decrease by about 40% for those 20-60 years of age. Depressive symptoms may discourage motivation to engage in physical activity such as strength training shown to negate muscle loss. Inflammation related to depressive symptoms may also contribute to muscle atrophy. Physiological differences by sex and race/ethnicity may also modify the association between depression and muscle mass. Evidence on the relationship between depression (or depressive symptoms) and adiposity has been mounting; however, little is known about the depressive symptoms-muscle mass association. We sought to determine the association between elevated depressive symptoms (EDS) and lean muscle mass and whether this varies by sex and race/ethnicity. Evaluating 1605 adults (45-84 years of age) from the Multi-ethnic Study of Atherosclerosis Abdominal Body Composition, Inflammation and Cardiovascular Disease Study, we examined the cross-sectional association between EDS (Center for Epidemiologic Studies for Depression Scale score≥16 and/or antidepressant use) and computed tomography-measured abdominal lean muscle mass using linear regression. Muscles were evaluated as a whole and by functionality (locomotion vs. stabilization/posture). Covariates included height, body mass index, sociodemographics, comorbidities, inflammatory markers and health behaviors (pack-years of smoking, alcohol locomotion compared to men, total intentional exercise, daily caloric intake). Sex and race/ethnicity were assessed as potential modifiers. Statistical significance was at a pdepressive symptoms had 5.9 cm2 lower lean muscle mass for locomotion compared to men without EDS, fully-adjusted (CI=-10.5, -1.4, p=0.011). This was statistically significantly different from the null finding among women (interaction p=0.05). Chinese participants with EDS had 10.2 cm2 lower abdominal lean muscle mass for locomotion compared to those without EDS (fully

  12. Worlds apart 2: Thailand and the Philippines. Heroes and villains in an Asian population drama.

    Science.gov (United States)

    Ness, G D

    1994-01-01

    A comparison of population growth was made for the Philippines and Thailand. Although both countries had 20 million population in 1950 and developed family planning (FP) in similar stages, Thailand had a contraceptive use rate of about 65% and total fertility of 2.1 and a population of 57 million, while the Philippines had 7.4 million more people and slower economic development. Environmental effects of this situation in the Philippines included the movement of people to marginal mountainous land and soil erosion and degradation. A major medical problem has been complications from illegal abortion. While Thailand is expected to reach replacement level by 1995, the Philippines will not reach replacement level until at least 2015, by which time the population will be 20 million more than in Thailand. Thailand is experiencing declines in school age population, and the Philippines is experiencing growth in its school enrollment and labor force. Although the Philippines has received more foreign FP assistance than Thailand, the demographic impact has been greater in Thailand. The Philippines made mistakes in centralizing its FP efforts in Manila and spending too much on communication programs and less on service delivery in rural areas. After 1978, the emphasis shifted and funds were diminished for all social services by the Marcos regime. Mrs. Aguino could not right the wrongs of the previous administration because of her strong commitment to Roman Catholicism. The new Fidel Ramos administration and Health Secretary Flavier are now dedicated to promotion of primary health care and FP. Unfortunately, past political and religious leaders abnegated their responsibility in promoting responsible parenthood and providing appropriate social services. Instead these parties achieved personal wealth at the expense of the masses and protected a "dubious morality."

  13. Trait anger but not anxiety predicts incident type 2 diabetes: The Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Abraham, Sherley; Shah, Nina G; Diez Roux, Ana; Hill-Briggs, Felicia; Seeman, Teresa; Szklo, Moyses; Schreiner, Pamela J; Golden, Sherita Hill

    2015-10-01

    Prior studies have shown a bidirectional association between depression and type 2 diabetes mellitus (T2DM); however, the prospective associations of anger and anxiety with T2DM have not been established. We hypothesized that trait anger and anxiety would predict incident T2DM, independently of depressive symptoms. In the Multi-ethnic Study of Atherosclerosis (MESA), we prospectively examined the association of trait anger and trait anxiety (assessed via the Spielberger Trait Anger and Anxiety Scales, respectively) with incident T2DM over 11.4 years in 5598 White, Black, Hispanic, and Chinese participants (53.2% women, mean age 61.6 years) at baseline without prevalent T2DM or cardiovascular disease. We used Cox proportional hazards models to calculate the hazard ratios (HR) of incident T2DM by previously defined anger category (low, moderate, high), and anxiety quartile, as there were no previously defined categories. High total trait anger was associated with incident T2DM (HR 1.50; 95% CI 1.08-2.07) relative to low total trait anger. The association was attenuated following adjustment for waist circumference (HR 1.32; 95% CI 0.94-1.86). Higher anger reaction was also associated with incident T2DM (HR=1.07; 95% CI 1.03-1.11) that remained significant after adjusting for potential confounders/explanatory factors. In contrast, trait anxiety did not predict incident T2DM. High total trait anger and anger reaction are potential modifiable risk factors for T2DM. Further research is needed to explore the mechanisms of the anger-diabetes relationship and to develop preventive interventions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Associations of organic produce consumption with socioeconomic status and the local food environment: Multi-Ethnic Study of Atherosclerosis (MESA).

    Science.gov (United States)

    Curl, Cynthia L; Beresford, Shirley A A; Hajat, Anjum; Kaufman, Joel D; Moore, Kari; Nettleton, Jennifer A; Diez-Roux, Ana V

    2013-01-01

    Neighborhood characteristics, such as healthy food availability, have been associated with consumption of healthy food. Little is known about the influence of the local food environment on other dietary choices, such as the decision to consume organic food. We analyzed the associations between organic produce consumption and demographic, socioeconomic and neighborhood characteristics in 4,064 participants aged 53-94 in the Multi-Ethnic Study of Atherosclerosis using log-binomial regression models. Participants were classified as consuming organic produce if they reported eating organic fruits and vegetables either "sometimes" or "often or always". Women were 21% more likely to consume organic produce than men (confidence interval [CI]: 1.12-1.30), and the likelihood of organic produce consumption was 13% less with each additional 10 years of age (CI: 0.84-0.91). Participants with higher education were significantly more likely to consume organic produce (prevalence ratios [PR] were 1.05 with a high school education, 1.39 with a bachelor's degree and 1.68 with a graduate degree, with less than high school as the reference group [1.00]). Per capita household income was marginally associated with produce consumption (p = 0.06), with the highest income category more likely to consume organic produce. After adjustment for these individual factors, organic produce consumption was significantly associated with self-reported assessment of neighborhood produce availability (PR: 1.07, CI: 1.02-1.11), with an aggregated measure of community perception of the local food environment (PR: 1.08, CI: 1.00-1.17), and, to a lesser degree, with supermarket density (PR: 1.02: CI: 0.99-1.05). This research suggests that both individual-level characteristics and qualities of the local food environment are associated with having a diet that includes organic food.

  15. Differences in Natriuretic Peptide Levels by Race/Ethnicity (From the Multi-Ethnic Study of Atherosclerosis).

    Science.gov (United States)

    Gupta, Deepak K; Daniels, Lori B; Cheng, Susan; deFilippi, Christopher R; Criqui, Michael H; Maisel, Alan S; Lima, Joao A; Bahrami, Hossein; Greenland, Philip; Cushman, Mary; Tracy, Russell; Siscovick, David; Bertoni, Alain G; Cannone, Valentina; Burnett, John C; Carr, John Jeffrey; Wang, Thomas J

    2017-09-15

    Natriuretic peptides (NP) are cardiac-derived hormones with favorable cardiometabolic actions. Low NP levels are associated with increased risks of hypertension and diabetes mellitus, conditions with variable prevalence by race and ethnicity. Heritable factors underlie a significant proportion of the interindividual variation in NP concentrations, but the specific influences of race and ancestry are unknown. In 5597 individuals (40% white, 24% black, 23% Hispanic, and 13% Chinese) without prevalent cardiovascular disease at baseline in the Multi-Ethnic Study of Atherosclerosis, multivariable linear regression and restricted cubic splines were used to estimate differences in serum N-terminal pro B-type natriuretic peptide (NT-proBNP) levels according to, ethnicity, and ancestry. Ancestry was determined using genetic ancestry informative markers. NT-proBNP concentrations differed significantly by race and ethnicity (black, median 43 pg/ml [interquartile range 17 to 94], Chinese 43 [17 to 90], Hispanic 53 [23 to 107], white 68 [34 to 136]; p = 0.0001). In multivariable models, NT-proBNP was 44% lower (95% confidence interval -48 to -40) in black and 46% lower (-50 to -41) in Chinese, compared with white individuals. Hispanic individuals had intermediate concentrations. Self-identified blacks and Hispanics were the most genetically admixed. Among self-identified black individuals, a 20% increase in genetic European ancestry was associated with 12% higher (1% to 23%) NT-proBNP. Among Hispanic individuals, genetic European and African ancestry were positively and negatively associated with NT-proBNP levels, respectively. In conclusion, NT-proBNP levels differ according to race and ethnicity, with the lowest concentrations in black and Chinese individuals. Racial and ethnic differences in NT-proBNP may have a genetic basis, with European and African ancestry associated with higher and lower NT-proBNP concentrations, respectively. Copyright © 2017 Elsevier Inc. All

  16. Visibility and Social Recognition as Psychosocial Work Environment Factors among Cleaners in a Multi-Ethnic Workplace Intervention

    Directory of Open Access Journals (Sweden)

    Kirsten Hviid

    2012-12-01

    Full Text Available This article focuses on the psychosocial work environment of immigrant cleaners at a Danish workplace. Today, many cleaners working in Danish cleaning jobs are women from the established immigrant communities, but also labour migrants from the newer EU member states have found their way to the cleaning industry. Studies have drawn attention to immigrants’ low position in the cleaning industry and their increased risk of work injuries. This article is based on a case study of an intervention called “Make a Difference” designed to improve the work environment among cleaners at a multi-ethnic workplace. We used semi-structured interviews, photo logs, observation and participation to investigate how the cleaners experienced their work environment. The cleaners reported an overload of heavy work, related to the concept of a classroom’s “readiness for cleaning”, and they expressed strained social relations and communication in addition to a lack of social recognition and invisibility at the workplace, a school. We analysed these psychosocial work environmental problems by investigating the different forms of social relationships and communication within the group of cleaners, and between the cleaners and the teachers and pupils at the school. Moreover, we discussed why the intervention, based on training of language and cleaning skills and social interaction, only partially improved the cleaners’ psychosocial work environment problems. In this article, we argue that social divisions based on ethnicity between the new and the established group of cleaners, combined with their marginal position and poor work organisation at the school, reinforced the cleaners’ experiences of psychosocial work environment problems. This article suggests that increased effort towards social inclusion at work and improved work organisation, especially for the new labour migrants from newer EU-countries, should be considered.

  17. Visual Impairment in White, Chinese, Black, and Hispanic Participants from the Multi-Ethnic Study of Atherosclerosis Cohort.

    Science.gov (United States)

    Fisher, Diana E; Shrager, Sandi; Shea, Steven J; Burke, Gregory L; Klein, Ronald; Wong, Tien Y; Klein, Barbara E; Cotch, Mary Frances

    2015-01-01

    To describe the prevalence of visual impairment and examine its association with demographic, socioeconomic, and health characteristics in the Multi-Ethnic Study of Atherosclerosis (MESA) cohort. Visual acuity data were obtained from 6134 participants, aged 46-87 years at time of examination between 2002 and 2004 (mean age 64 years, 47.6% male), from six communities in the United States. Visual impairment was defined as presenting visual acuity 20/50 or worse in the better-seeing eye. Risk factors were included in multivariable logistic regression models to determine their impact on visual impairment for men and women in each racial/ethnic group. Among all participants, 6.6% (n = 421) had visual impairment, including 5.6% of men (n = 178) and 7.5% of women (n = 243). Prevalence of impairment ranged from 4.2% (n = 52) and 6.0% (n = 77) in white men and women, respectively, to 7.6% (n = 37) and 11.6% (n = 44) in Chinese men and women, respectively. Older age was significantly associated with visual impairment in both men and women, particularly in those with lower socioeconomic status, but the effects of increasing age were more pronounced in men. Two-thirds of participants already wore distance correction, and not unexpectedly, a lower prevalence of visual impairment was seen in this group; however, 2.4% of men and 3.5% of women with current distance correction had correctable visual impairment, most notably among seniors. Even in the U.S. where prevalence of refractive correction is high, both visual impairment and uncorrected refractive error represent current public health challenges.

  18. Left ventricular mass and hypertrophy by echocardiography and cardiac magnetic resonance: the multi-ethnic study of atherosclerosis.

    Science.gov (United States)

    Armstrong, Anderson C; Gjesdal, Ola; Almeida, André; Nacif, Marcelo; Wu, Colin; Bluemke, David A; Brumback, Lyndia; Lima, João A C

    2014-01-01

    Left ventricular mass (LVM) and hypertrophy (LVH) are important parameters, but their use is surrounded by controversies. We compare LVM by echocardiography and cardiac magnetic resonance (CMR), investigating reproducibility aspects and the effect of echocardiography image quality. We also compare indexing methods within and between imaging modalities for classification of LVH and cardiovascular risk. Multi-Ethnic Study of Atherosclerosis enrolled 880 participants in Baltimore city, 146 had echocardiograms and CMR on the same day. LVM was then assessed using standard techniques. Echocardiography image quality was rated (good/limited) according to the parasternal view. LVH was defined after indexing LVM to body surface area, height(1.7) , height(2.7) , or by the predicted LVM from a reference group. Participants were classified for cardiovascular risk according to Framingham score. Pearson's correlation, Bland-Altman plots, percent agreement, and kappa coefficient assessed agreement within and between modalities. Left ventricular mass by echocardiography (140 ± 40 g) and by CMR were correlated (r = 0.8, P echocardiography image quality. The reproducibility profile had strong correlations and agreement for both modalities. Image quality groups had similar characteristics; those with good images compared to CMR slightly superiorly. The prevalence of LVH tended to be higher with higher cardiovascular risk. The agreement for LVH between imaging modalities ranged from 77% to 98% and the kappa coefficient from 0.10 to 0.76. Echocardiography has a reliable performance for LVM assessment and classification of LVH, with limited influence of image quality. Echocardiography and CMR differ in the assessment of LVH, and additional differences rise from the indexing methods. © 2013. This article is a U.S. Government work and is in the public domain in the USA.

  19. Visibility and social recognition as psychosocial work environment factors among cleaners in a multi-ethnic workplace intervention.

    Science.gov (United States)

    Hviid, Kirsten; Smith, Louise Hardman; Frydendall, Karen Bo; Flyvholm, Mari-Ann

    2012-12-24

    This article focuses on the psychosocial work environment of immigrant cleaners at a Danish workplace. Today, many cleaners working in Danish cleaning jobs are women from the established immigrant communities, but also labour migrants from the newer EU member states have found their way to the cleaning industry. Studies have drawn attention to immigrants' low position in the cleaning industry and their increased risk of work injuries. This article is based on a case study of an intervention called "Make a Difference" designed to improve the work environment among cleaners at a multi-ethnic workplace. We used semi-structured interviews, photo logs, observation and participation to investigate how the cleaners experienced their work environment. The cleaners reported an overload of heavy work, related to the concept of a classroom's "readiness for cleaning", and they expressed strained social relations and communication in addition to a lack of social recognition and invisibility at the workplace, a school. We analysed these psychosocial work environmental problems by investigating the different forms of social relationships and communication within the group of cleaners, and between the cleaners and the teachers and pupils at the school. Moreover, we discussed why the intervention, based on training of language and cleaning skills and social interaction, only partially improved the cleaners' psychosocial work environment problems. In this article, we argue that social divisions based on ethnicity between the new and the established group of cleaners, combined with their marginal position and poor work organisation at the school, reinforced the cleaners' experiences of psychosocial work environment problems. This article suggests that increased effort towards social inclusion at work and improved work organisation, especially for the new labour migrants from newer EU-countries, should be considered.

  20. Association of menopause age and N-terminal pro brain natriuretic peptide: the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Ebong, Imo A; Watson, Karol E; Goff, David C; Bluemke, David A; Srikanthan, Preethi; Horwich, Tamara; Bertoni, Alain G

    2015-05-01

    Menopause age can affect the risk of developing cardiovascular disease (CVD). The purpose of this study was to investigate the associations of early menopause (menopause occurring before age 45 y) and menopause age with N-terminal pro brain natriuretic peptide (NT-proBNP), a potential risk marker of CVD and heart failure. Our cross-sectional study included 2,275 postmenopausal women, aged 45 to 85 years and without clinical CVD (2000-2002), from the Multi-Ethnic Study of Atherosclerosis. Participants were classified as having or not having early menopause. NT-proBNP was log-transformed. Multivariable linear regression was used for analysis. Five hundred sixty-one women had early menopause. The median (25th-75th percentiles) NT-proBNP value was 79.0 (41.1-151.6) pg/mL for all participants, 83.4 (41.4-164.9) pg/mL for women with early menopause, and 78.0 (40.8-148.3) pg/mL for women without early menopause. The mean (SD) age was 65 (10.1) and 65 (8.9) years for women with and without early menopause, respectively. No significant interactions between menopause age and ethnicity were observed. In multivariable analysis, early menopause was associated with a 10.7% increase in NT-proBNP levels, whereas each 1-year increase in menopause age was associated with a 0.7% decrease in NT-proBNP levels. Early menopause is associated with greater NT-proBNP levels, whereas each 1-year increase in menopause age is associated with lower NT-proBNP levels, in postmenopausal women.

  1. Visual Impairment in White, Chinese, Black and Hispanic Participants from the Multi-Ethnic Study of Atherosclerosis Cohort

    Science.gov (United States)

    Fisher, Diana E.; Shrager, Sandi; Shea, Steven J.; Burke, Gregory L.; Klein, Ronald; Wong, Tien Y.; Klein, Barbara E; Cotch, Mary Frances

    2016-01-01

    Purpose To describe the prevalence of visual impairment and examine its association with demographic, socioeconomic, and health characteristics in the Multi-Ethnic Study of Atherosclerosis (MESA) cohort. Methods Visual acuity data was obtained from 6134 participants, aged 46 to 87 years old at time of examination between 2002 and 2004 (mean age 64 years, 47.6% male), from six communities in the United States (U.S.). Visual impairment was defined as a presenting visual acuity of 20/50 or worse in the better-seeing eye. Risk factors were included in multivariable logistic regression models to determine their impact on visual impairment for men and women in each racial/ethnic group. Results Among all participants, 6.6% (N=421) had visual impairment, including 5.6% (N=178) of men and 7.5% (N=243) of women. Prevalence of impairment ranged from 4.2% (N=52) and 6.0% (N=77) in White men and women, respectively, to 7.6% (N=37) and 11.6% (N=44) in Chinese men and women, respectively. Older age was significantly associated with visual impairment in both men and women, particularly in those with lower socioeconomic status, but the effects of increasing age were more pronounced in men. Two-thirds of participants already wore distance correction and not unexpectedly, lower prevalence of visual impairment was seen in this group; however, 2.4% of men and 3.5% of women with current distance correction had correctable visual impairment, most notably among seniors. Conclusion Even in the United States where prevalence of refractive correction is high, both visual impairment and uncorrected refractive error represent current public health challenges. PMID:26395659

  2. Age at menopause and determinants of hysterectomy and menopause in a multi-ethnic community: the Hilo Women's Health Study.

    Science.gov (United States)

    Sievert, Lynnette Leidy; Murphy, Lorna; Morrison, Lynn A; Reza, Angela M; Brown, Daniel E

    2013-12-01

    A lifespan approach was used to evaluate age at menopause, and determinants of surgical and natural menopause, in the multi-ethnic community of Hilo, Hawaii. Participants aged 40-60 years (n=898) were drawn from a larger, randomly generated sample recruited by postal questionnaires. Median age at natural menopause was computed by probit analysis. Logistic regression analysis was applied to examine determinants of hysterectomy, and Cox regression analysis was used to examine risk factors for an earlier age at menopause. History of hysterectomy, age at menopause. Frequency of hysterectomy was 19.2% at a mean age of 40.5 years. The likelihood of hysterectomy increased with older ages, lower education, mixed ancestry, having been overweight at age 30, and married 20 years prior to survey. Median age at natural menopause was 53.0 years. Smoking and not being married 10 years before survey were associated with an earlier age at menopause. Median age at menopause was later than the national average. Ethnicity and education were determinants of hysterectomy, but not associated with age at natural menopause. Events later in the lifespan (e.g., smoking and not being married 10 years prior to the survey) were more important than earlier events (e.g., childhood residence) in relation to age at menopause. The timing of weight gain and marital status appear to be important in relation to surgical menopause, and the timing of marital status appears to be important in relation to the timing of natural menopause. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Evaluation of common type 2 diabetes risk variants in a South Asian population of Sri Lankan descent.

    Directory of Open Access Journals (Sweden)

    Neelam Hassanali

    Full Text Available Most studies seeking common variant associations with type 2 diabetes (T2D have focused on individuals of European ancestry. These discoveries need to be evaluated in other major ancestral groups, to understand ethnic differences in predisposition, and establish whether these contribute to variation in T2D prevalence and presentation. This study aims to establish whether common variants conferring T2D-risk in Europeans contribute to T2D-susceptibility in the South Asian population of Sri Lanka.Lead single nucleotide polymorphism (SNPs at 37 T2D-risk loci attaining genome-wide significance in Europeans were genotyped in 878 T2D cases and 1523 normoglycaemic controls from Sri Lanka. Association testing was performed by logistic regression adjusting for age and sex and by the Cochran-Mantel-Haenszel test after stratifying according to self-identified ethnolinguistic subgroup. A weighted genetic risk score was generated to examine the combined effect of these SNPs on T2D-risk in the Sri Lankan population.Of the 36 SNPs passing quality control, sixteen showed nominal (p<0.05 association in Sri Lankan samples, fifteen of those directionally-consistent with the original signal. Overall, these association findings were robust to analyses that accounted for membership of ethnolinguistic subgroups. Overall, the odds ratios for 31 of the 36 SNPs were directionally-consistent with those observed in Europeans (p = 3.2×10(-6. Allelic odds ratios and risk allele frequencies in Sri Lankan subjects were not systematically different to those reported in Europeans. Genetic risk score and risk of T2D were strongly related in Sri Lankans (per allele OR 1.10 [95%CI 1.08-1.13], p = 1.2×10(-17.Our data indicate that most T2D-risk variants identified in Europeans have similar effects in South Asians from Sri Lanka, and that systematic difference in common variant associations are unlikely to explain inter-ethnic differences in prevalence or presentation of T2D.

  4. The New Asian Immigrants.

    Science.gov (United States)

    Wong, Morrison G.; Hirschman, Charles

    In the early 1960s, Asian immigration to the United States was severely limited. The passage of the Immigration Act of 1965 expanded Asian immigration and ended a policy of racial discrimination and exclusion. Currently, over one third of the total immigrant population to the United States is from Asia, particularly China, Japan, Korea, the…

  5. Genetic variation and potential coinfection of Wolbachia among widespread Asian citrus psyllid (Diaphorina citri Kuwayama) populations.

    Science.gov (United States)

    Chu, Chia-Ching; Hoffmann, Mark; Braswell, W Evan; Pelz-Stelinski, Kirsten S

    2017-12-29

    Wolbachia can profoundly influence the survival, reproduction, and defenses of insect hosts. These interactions could potentially be harnessed for managing pests or insect-transmitted diseases. Diaphorina citri Kuwayama is a phloem-feeding pest capable of transmitting the putative causal agent of citrus greening, Candidatus Liberibacter asiaticus (CLas). Like many insects, D. citri is also infected with Wolbachia (wDi). Recent studies indicate that the relative abundance of wDi could be associated with the abundance of CLas, and that wDi may contribute to regulating expression of phage lytic cycle genes in CLas, suggesting the need for better understanding of wDi biology in general. This study investigated the genetic diversity of wDi among D. citri in populations spanning eleven countries and two U.S. territories. Six Wolbachia genes, wsp, coxA, fbpA, ftsZ, gatB, and hcpA, were sequenced and compared across samples. Two prevalent wDi strains were identified across the samples, and screening of clone libraries revealed possible coinfection of wDi strains in specific populations. D. citri mitochondrial cytochrome oxidase subunit I gene (mtCOI) were more divergent between D. citri populations that were infected with different wDi strains or had different infection statuses (single infection vs. coinfection). While we could not eliminate the possibility that maternal transmission may contribute to such patterns, it is also possible that wDi may induce cytoplasmic incompatibility in their host. These findings should contribute to the understanding of wDi population ecology, which may facilitate manipulation of this endosymbiont for management of citrus greening disease worldwide. © 2017 The Authors. Insect Science published by John Wiley & Sons Australia, Ltd on behalf of Institute of Zoology, Chinese Academy of Sciences.

  6. Multiplexed SNP Typing of Ancient DNA Clarifies the Origin of Andaman mtDNA Haplogroups amongst South Asian Tribal Populations

    Science.gov (United States)

    Endicott, Phillip; Metspalu, Mait; Stringer, Chris; Macaulay, Vincent; Cooper, Alan; Sanchez, Juan J.

    2006-01-01

    The issue of errors in genetic data sets is of growing concern, particularly in population genetics where whole genome mtDNA sequence data is coming under increased scrutiny. Multiplexed PCR reactions, combined with SNP typing, are currently under-exploited in this context, but have the potential to genotype whole populations rapidly and accurately, significantly reducing the amount of errors appearing in published data sets. To show the sensitivity of this technique for screening mtDNA genomic sequence data, 20 historic samples of the enigmatic Andaman Islanders and 12 modern samples from three Indian tribal populations (Chenchu, Lambadi and Lodha) were genotyped for 20 coding region sites after provisional haplogroup assignment with control region sequences. The genotype data from the historic samples significantly revise the topologies for the Andaman M31 and M32 mtDNA lineages by rectifying conflicts in published data sets. The new Indian data extend the distribution of the M31a lineage to South Asia, challenging previous interpretations of mtDNA phylogeography. This genetic connection between the ancestors of the Andamanese and South Asian tribal groups ∼30 kya has important implications for the debate concerning migration routes and settlement patterns of humans leaving Africa during the late Pleistocene, and indicates the need for more detailed genotyping strategies. The methodology serves as a low-cost, high-throughput model for the production and authentication of data from modern or ancient DNA, and demonstrates the value of museum collections as important records of human genetic diversity. PMID:17218991

  7. Conceptual parameters of acculturation within the Asian and Pacific Islander American populations: applications for nursing practice and research.

    Science.gov (United States)

    Baker, Dian

    2011-01-01

    Asian and Pacific Islander Americans (A&PIAs) are experiencing health inequities. For example, A&PIA is the only racial/ethnic group in America to experience cancer as their leading cause of death. Several studies within the A&PIA population have pointed to acculturation as a significant variable to explain their health and health-seeking behaviors. Acculturation is a key construct in understanding the health of the A&PIA population. The purpose of this concept analysis is to provide a current conceptual understanding of the relationship between acculturation and health, especially within the A&PIA populations, which will serve as a pragmatic guideline for nursing practice and research. Understanding the contemporary issues surrounding the conceptual application of acculturation will aid in the development of appropriate programs to reduce health inequities. Acculturation was explored using the Morse method of concept analysis. An iterative historical and contemporary literature review across the disciplines of anthropology, sociology, psychology, medicine, and nursing was completed. Analytical questions asked of the resultant data provided the theoretical definition, antecedents, key attributes, outcomes, and implications. The concept analysis resulted in a new theoretical definition that includes multidimensional concepts of acculturation. Dilemmas in the measurement of key attributes of acculturation include unidirectional and bidirectional analysis, psychometric issues, and the appropriateness of proxy measurements. Outcomes of acculturation on health can be positive or negative and depend on an individual's or group's ability to navigate freely with necessary supports. Results of the conceptual analysis resulted in recommendations for nursing practice and future acculturation research. While debate continues about the appropriate use and definition of acculturation, researchers agree that it is an important construct in understanding the health of migrating

  8. Roflumilast for the treatment of COPD in an Asian population: a randomized, double-blind, parallel-group study.

    Science.gov (United States)

    Zheng, Jinping; Yang, Jinghua; Zhou, Xiangdong; Zhao, Li; Hui, Fuxin; Wang, Haoyan; Bai, Chunxue; Chen, Ping; Li, Huiping; Kang, Jian; Brose, Manja; Richard, Frank; Goehring, Udo-Michael; Zhong, Nanshan

    2014-01-01

    Roflumilast is the only oral phosphodiesterase 4 inhibitor indicated for use in the treatment of COPD. Previous studies of roflumilast have predominantly involved European and North American populations. A large study was necessary to determine the efficacy and safety of roflumilast in a predominantly ethnic Chinese population. In a placebo-controlled, double-blind, parallel-group, multicenter, phase 3 study, patients of Chinese, Malay, and Indian ethnicity (N = 626) with severe to very severe COPD were randomized 1:1 to receive either roflumilast 500 μg once daily or placebo for 24 weeks. The primary end point was change in prebronchodilator FEV1 from baseline to study end. Three hundred thirteen patients were assigned to each treatment. Roflumilast provided a sustained increase over placebo in mean prebronchodilator FEV1 (0.071 L; 95% CI, 0.046, 0.095 L; P < .0001). Similar improvements were observed in the secondary end points of postbronchodilator FEV1 (0.068 L; 95% CI 0.044, 0.092 L; P < .0001) and prebronchodilator and postbronchodilator FVC (0.109 L; 95% CI, 0.061, 0.157 L; P < .0001 and 0.101 L; 95% CI, 0.055, 0.146 L; P < .0001, respectively). The adverse event profile was consistent with previous roflumilast studies. The most frequently reported treatment-related adverse event was diarrhea (6.0% and 1.0% of patients in the roflumilast and placebo groups, respectively). Roflumilast plays an important role in lung function improvement and is well tolerated in an Asian population. It provides an optimal treatment choice for patients with severe to very severe COPD.

  9. The STOP-BANG questionnaire as a screening tool for obstructive sleep apneainduced hypertension in Asian population

    Directory of Open Access Journals (Sweden)

    Tanut Pavarangkul

    2016-04-01

    Full Text Available Obstructive sleep apnea (OSA is a common public health issue. If left untreated, OSA may cause a large health economic burden from cardiovascular complications particularly stroke. The diagnosis of OSA can be made by polysomnography, but its availability is limited in the developing countries in Asia. STOP-BANG questionnaire is a good screening tool but may need some adjustment for Asian population. STOP-BANG stands for: Snoring history, Tired during the day, Observed stop breathing while sleep, High blood pressure, body mass index (BMI more than 35 kg/m2, Age more than 50 years, Neck circumference more than 40 cm and male Gender. We compared clinical features in STOP-BANG questionnaire between 42 OSA induced hypertension patients and 82 healthy control subjects in the Faculty of Medicine, Khon Kaen University, Thailand. The best cutoff point for the BMI and the neck circumference were 24.5 kg/m2 and 36 cm, respectively. The sensitivity and specificity of the BMI cutoff point were 97.2% and 91.40, while those of the neck circumference were 94.7% and 82.9%. In conclusion, the appropriate cutoff points of BMI and neck circumference for Thai STOP-BANG questionnaire were 25 kg/m2 and 36 cm.

  10. Gnathostoma spinigerum in live Asian swamp eels (Monopterus spp.) from food markets and wild populations, United States

    Science.gov (United States)

    Cole, Rebecca A.; Choudhury, Anindo; Nico, Leo G.; Griffin, Kathryn M.

    2014-01-01

    In Southeast Asia, swamp eels (Synbranchidae: Monopterus spp.) are a common source of human gnathostomiasis, a foodborne zoonosis caused by advanced third-stage larvae (AL3) of Gnathostoma spp. nematodes. Live Asian swamp eels are imported to US ethnic food markets, and wild populations exist in several states. To determine whether these eels are infected, we examined 47 eels from markets and 67 wild-caught specimens. Nematodes were identified by morphologic features and ribosomal intergenic transcribed spacer–2 gene sequencing. Thirteen (27.7%) M. cuchia eels from markets were infected with 36 live G. spinigerum AL3: 21 (58.3%) in liver; 7 (19.4%) in muscle; 5 (13.8%) in gastrointestinal tract, and 3 (8.3%) in kidneys. Three (4.5%) wild-caught M. albus eels were infected with 5 G. turgidum AL3 in muscle, and 1 G. lamothei AL3 was found in a kidney (both North American spp.). Imported live eels are a potential source of human gnathostomiasis in the United States.

  11. Early Ahmed glaucoma valve implantation after penetrating keratoplasty leads to better outcomes in an Asian population with preexisting glaucoma.

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Tai

    Full Text Available BACKGROUND: To evaluate the efficacy of Ahmed Glaucoma Valve (AGV surgery and the optimal interval between penetrating keratoplasty (PKP and AGV implantation in a population of Asian patients with preexisting glaucoma who underwent PKP. METHODOLOGY/PRINCIPAL FINDINGS: In total, 45 eyes of 45 patients were included in this retrospective chart review. The final intraocular pressures (IOPs, graft survival rate, and changes in visual acuity were assessed to evaluate the outcomes of AGV implantations in eyes in which AGV implantation occurred within 1 month of post-PKP IOP elevation (Group 1 and in eyes in which AGV implantation took place more than 1 month after the post-PKP IOP evaluation (Group 2. Factors that were associated with graft failure were analyzed, and the overall patterns of complications were reviewed. By their final follow-up visits, 58% of the patients had been successfully treated for glaucoma. After the operation, there were no statistically significant differences between the groups with respect to graft survival (p = 0.98, but significant differences for IOP control (p = 0.049 and the maintenance of visual acuity (VA (p21 mm Hg. The most common surgical complication, aside from graft failure, was hyphema. CONCLUSIONS/SIGNIFICANCE: Early AGV implantation results in a higher probability of AGV survival and a better VA outcome without increasing the risk of corneal graft failure as a result of post-PKP glaucoma drainage tube implantation.

  12. Early Ahmed Glaucoma Valve Implantation after Penetrating Keratoplasty Leads to Better Outcomes in an Asian Population with Preexisting Glaucoma

    Science.gov (United States)

    Tai, Ming-Cheng; Chen, Yi-Hao; Cheng, Jen-Hao; Liang, Chang-Min; Chen, Jiann-Torng; Chen, Ching-Long; Lu, Da-Wen

    2012-01-01

    Background To evaluate the efficacy of Ahmed Glaucoma Valve (AGV) surgery and the optimal interval between penetrating keratoplasty (PKP) and AGV implantation in a population of Asian patients with preexisting glaucoma who underwent PKP. Methodology/Principal Findings In total, 45 eyes of 45 patients were included in this retrospective chart review. The final intraocular pressures (IOPs), graft survival rate, and changes in visual acuity were assessed to evaluate the outcomes of AGV implantations in eyes in which AGV implantation occurred within 1 month of post-PKP IOP elevation (Group 1) and in eyes in which AGV implantation took place more than 1 month after the post-PKP IOP evaluation (Group 2). Factors that were associated with graft failure were analyzed, and the overall patterns of complications were reviewed. By their final follow-up visits, 58% of the patients had been successfully treated for glaucoma. After the operation, there were no statistically significant differences between the groups with respect to graft survival (p = 0.98), but significant differences for IOP control (p = 0.049) and the maintenance of visual acuity (VA) (pglaucoma, a history of previous PKP, and a preoperative IOP that was >21 mm Hg. The most common surgical complication, aside from graft failure, was hyphema. Conclusions/Significance Early AGV implantation results in a higher probability of AGV survival and a better VA outcome without increasing the risk of corneal graft failure as a result of post-PKP glaucoma drainage tube implantation. PMID:22629464

  13. Fetal growth trajectories in pregnancies of European and South Asian mothers with and without gestational diabetes, a population-based cohort study.

    Science.gov (United States)

    Sletner, Line; Jenum, Anne Karen; Yajnik, Chittaranjan S; Mørkrid, Kjersti; Nakstad, Britt; Rognerud-Jensen, Odd Harald; Birkeland, Kåre I; Vangen, Siri

    2017-01-01

    Our aim was to examine the impact of gestational diabetes (GDM), from before the GDM-diagnosis is made, on fetal growth trajectories, and to compare it in Europeans and South Asians; two ethnic groups with dissimilar fetal growth patterns. We studied European (n = 349) and South Asian (n = 184) pregnant women, from the population-based STORK-Groruddalen cohort in Oslo, Norway. Mothers were enrolled in early pregnancy, screened for GDM in gestational week 28 ±2, and classified as "non-GDM", "mild GDM" or "moderate/severe GDM". We measured fetal head circumference, abdominal circumference and femur length by ultrasound, and estimated fetal weight in gestational week 24, 32 and 37, and performed corresponding measurements at birth. In non-GDM pregnancies, South Asian fetuses (n = 156) had a slower growth from gestational week 24, compared with Europeans (n = 310). More than two thirds of the European mothers later diagnosed with GDM were overweight or obese in early pregnancy, while this was not observed in South Asians. Fetuses of GDM mothers tended to be smaller than fetuses of non-GDM mothers in week 24, but thereafter grew faster until birth. This pattern was especially pronounced in fetuses of South Asian mothers with moderate/severe GDM. In week 24 these fetuses had a -0.95 SD (95% CI: -1.53, -0.36) lower estimated fetal weight than their non-GDM counterparts. In contrast, at birth they were 0.45 SD (0.09, 0.81) larger. Offspring of GDM mothers were smaller in mid pregnancy, but subsequently grew faster until birth, compared with offspring of non-GDM mothers. This pattern was most prominent in South Asian mothers with moderate to severe GDM. However, the most remarkable characteristic of these fetuses was not a large size at birth, but the small size in mid pregnancy, before the GDM diagnosis was set.

  14. Thin-plate spline analysis of the cranial base in African, Asian and European populations and its relationship with different malocclusions.

    Science.gov (United States)

    Rosas, Antonio; Bastir, Markus; Alarcón, Jose Antonio; Kuroe, Kazuto

    2008-09-01

    To test the hypothesis that midline basicranial orientation and posterior cranial base length are discriminating factors between adults of different populations and its potential maxillo/mandibular disharmonies. Twenty-nine 2D landmarks of the midline cranial base, the face and the mandible of dry skull X-rays from three major populations (45 Asians, 34 Africans, 64 Europeans) were digitized and analysed by geometric morphometrics. We used, first, MANOVA to test for mean shape differences between populations; then, principal components analysis (PCA) to assess the overall variation in the sample and finally, canonical variate analysis (CVA) with jack-knife validations (N=1000) to analyse the anatomical features that best distinguished among populations. Significant mean shapes differences were shown between populations (P<0.001). CVA revealed two significant axes of discrimination (P<0.001). Jack-knife validation correctly identified 92% of 15,000 unknowns. In Africans the whole cranial base is rotated into a forward-downward position, while in Asians it is rotated in the opposite way. The Europeans occupied an intermediate position. African and Asian samples showed a maxillo/mandibular prognathism. African prognathism was produced by an anterior positioned maxilla, Asian prognathism by retruded anterior cranial base and increase of the posterior cranial base length. Europeans showed a trend towards retracted mandibles with relatively shorter posterior cranial bases. The results supported the hypothesis that basicranial orientation and posterior cranial base length are valid factors to distinguish between geographic groups. The whole craniofacial configuration underlying a particular maxillo-facial disharmony must be considered in diagnosis, growth predictions and resulting treatment planning.

  15. Population-based intervention for cardiovascular diseases related knowledge and behaviours in Asian Indian women.

    Science.gov (United States)

    Pandey, Ravindra Mohan; Agrawal, Aachu; Misra, Anoop; Vikram, Naval Kishore; Misra, Puneet; Dey, Sanjit; Rao, Shobha; Vasantha Devi, K P; Usha Menon, V; Revathi, R; Sharma, Vinita; Gupta, Rajeev

    2013-01-01

    There is poor knowledge and behaviors regarding chronic diseases related nutritional and lifestyle factors among women in low income countries. To evaluate efficacy of a multilevel population-based intervention in improving knowledge and practices for related factors we performed a study in India. Population based study among women 35-70 years was performed in four urban and five rural locations. Stratified sampling was performed and we enrolled 4624 (rural 2616, urban 2008) of eligible 8000 women (58%). Demographic details, medical history, diet, physical activity and anthropometry were recorded and blood hemoglobin, glucose and total cholesterol determined. Knowledge and behaviors regarding diet in chronic diseases were inquired in a randomly selected 100 women at each site (n = 900). A systematic multilevel population based intervention (using posters, handouts, street plays, public lectures, group lectures and focused group discussions) was administered over 6 months at each site. The questionnaire was re-administered at the end in random 100 women (n = 900) and differences determined. Descriptive statistics are reported. Comparison of parameters before and after intervention was assessed using Mann Whitney test. Prevalence (%) of chronic disease related lifestyles and risk factors in rural/urban women, respectively, was illiteracy in 63.6/29.4, smoking/tobacco use 39.3/18.9, high fat intake 93.6/93.4, high salt intake 18.2/12.6, low physical activity 59.5/70.2, overweight/obesity 22.5/45.6, truncal obesity 13.0/44.3, hypertension 31.6/48.2, hypercholesterolemia 13.5/27.7, and diabetes in 4.3/15.1 percent. Composite chronic diseases knowledge at baseline vs after intervention increased significantly in overall (32.0 vs 62.0), rural (29.0 vs 63.5) and urban (39.5 vs 60.5) groups (p women in rural and urban locations in India increased chronic disease knowledge but failed to influence practices. Copyright © 2013. Published by Elsevier B.V.

  16. Rheumatoid arthritis disease activity and vitamin D deficiency in an Asian resident population.

    Science.gov (United States)

    Quraishi, Mohammed K; Badsha, Humeira

    2016-04-01

    We aimed to assess the prevalence of vitamin D deficiency and its association with rheumatoid arthritis (RA) disease activity in a UAE population. Forty-five consecutive subjects were prospectively recruited during the early summer with their clinical examination and Health Assessment Questionnaire (HAQ) being recorded at a clinic appointment, along with their blood sample being taken for the 25-hydroxyvitamin D (25(OH)D) total test. Thirty-five (76%) patients claimed to be exposed to sunlight for Disease Activity Score (DAS28) or HAQ scores. A direct relationship was observed between HAQ scores and DAS28 scores (P culture. No association was observed between vitamin D and disease activity. However, the high prevalence of vitamin D deficiency may negatively impact on bone health of these patients in the future. © 2013 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

  17. Management of Complex Knee Deformities in Asian Population: Our Experience of 11 Cases

    Directory of Open Access Journals (Sweden)

    Syed Shahid Noor

    2015-01-01

    Total Knee Arthroplasty (TKA is a life changing procedure for such patients. Great improvements in quality of life and outcome measure scores have been observed in patients undergone TKA. Our patients are challenging further as compared to western population because they present late for consultation when the disease and deformity is advanced. Their expectations are high, as they wish to resume their ground base activities such as kneeling for prayers. Furthermore with financial constraints present with most of the patients, one has to be careful in choosing the type of implant and keep in consideration other alternative available options. This case series encompasses our experience of TKA on patients with variety of challenging deformities, their short term outcome and a review of the literature.

  18. Temporal trends in cardiovascular disease risk factors among white, South Asian, Chinese and black groups in Ontario, Canada, 2001 to 2012: a population-based study.

    Science.gov (United States)

    Chiu, Maria; Maclagan, Laura C; Tu, Jack V; Shah, Baiju R

    2015-08-10

    To determine ethnic-specific temporal trends in cardiovascular risk factors in Ontario between 2001 and 2012. A population-based repeated cross-sectional study. Ontario, Canada. 219,276 participants of the Canadian Community Health Survey (205,326 white, 5620 South Asian, 4368 Chinese and 3962 black) during the period 2001 to 2012. Age-standardised ethnic-sex-specific prevalence of cardiovascular risk factors for three time periods: 2001-2004, 2005-2008 and 2009-2012 among Canada's four major ethnic groups: white, South Asian, Chinese and black. During the study period, the prevalence of diabetes increased 2.3-fold (p = 0.0001) among South Asian males and 1.9-fold (p = 0.02) among black females. The prevalence of obesity (body mass index ≥ 30 kg/m(2)) increased over time across all ethnic groups, with the largest relative increases observed among males of Chinese (2.1-fold increase, p = 0.04) and black (1.7-fold increase, p = 0.06) descent. The prevalence of hypertension increased the most among black females. Smoking prevalence decreased by more than 20% among South Asian, Chinese and white females. Overall, South Asian males and black males and females showed the greatest declines in cardiovascular health over the study period. We observed important ethnic differences in the temporal trends in cardiovascular risk factor profiles in Ontario. Awareness of the direction and magnitude of these risk factor trends may be useful in informing targeted strategies for preventing cardiovascular diseases in multiethnic populations. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  19. Optimizing Glycemic Control Through Titration of Insulin Glargine 100 U/mL: A Review of Current and Future Approaches with a Focus on Asian Populations.

    Science.gov (United States)

    Deerochanawong, Chaicharn; Bajpai, Shailendra; Dwipayana, I Made Pande; Hussein, Zanariah; Mabunay, Maria Aileen; Rosales, Reynaldo; Tsai, Shih-Tzer; Tsang, Man Wo

    2017-12-01

    Various data have demonstrated inadequate glycemic control amongst Asians with type 2 diabetes mellitus (T2DM), possibly on account of suboptimal titration of basal insulin-an issue which needs to be further examined. Here we review the available global and Asia-specific data on titration of basal insulin, with a focus on the use of insulin glargine 100 U/mL (Gla-100). We also discuss clinical evidence on the efficacy and safety of titrating Gla-100, different approaches to titration, including some of the latest technological advancements, and guidance on the titration of basal insulin from international and local Asian guidelines. The authors also provide their recommendations for the initiation and titration of basal insulin for Asian populations. Discussion of the data included in this review and in relation to the authors' clinical experience with treating T2DM in Asian patients is also included. Briefly, clinical studies demonstrate the achievement of adequate glycemic control in adults with T2DM through titration of Gla-100. However, studies investigating approaches to titration, specifically in Asian populations, are lacking and need to be conducted. Given that the management of insulin therapy is a multidisciplinary team effort involving endocrinologists, primary care physicians, nurse educators, and patients, greater resources and education targeted at these groups are needed regarding the optimal titration of basal insulin. Technological advancements in the form of mobile or web-based applications for automated dose adjustment can aid different stakeholders in optimizing the dose of basal insulin, enabling a larger number of patients in Asia to reach their target glycemic goals with improved outcomes.

  20. Association of "Elevated Blood Pressure" and "Stage 1 Hypertension" With Cardiovascular Mortality Among an Asian Population.

    Science.gov (United States)

    Talaei, Mohammad; Hosseini, Naeimeh; Koh, Angela S; Yuan, Jian-Min; Koh, Woon-Puay

    2018-04-10

    The new American College of Cardiology/American Heart Association high blood pressure (BP) guidelines in the United States have lowered definition of hypertension by defining normal as systolic/diastolic BP hypertension as systolic between 130 and 139 mm Hg or diastolic between 80 and 89 mm Hg. We investigated the association between the new hypertension definition and cardiovascular disease mortality among Chinese in Singapore. We used data from 30 636 participants of a population-based cohort, the SCHS (Singapore Chinese Health Study), who had BPs measured using a standard protocol at ages 46 to 85 years between 1994 and 2005. Information on lifestyle factors was collected at recruitment (1993-1998) and follow-up 1 interviews (1999 and 2004). Mortality was identified via nationwide registry linkage up to December 31, 2016. Neither elevated BP (hazard ratio, 0.89; 95% confidence interval, 0.74-1.07) nor stage 1 hypertension (hazard ratio, 0.94; 95% confidence interval, 0.81-1.11) was associated with increased risk of cardiovascular mortality compared with normal BP in the whole cohort. Stage 1 hypertension was associated with increased cardiovascular risk only in those hypertension may not be associated with increased cardiovascular mortality across all ages among Chinese in Singapore, but that the at-risk subpopulation is limited to those <65 years of age and without a prior cardiovascular disease. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  1. Population genomics reveals that an anthropophilic population of Aedes aegypti mosquitoes in West Africa recently gave rise to American and Asian populations of this major disease vector

    KAUST Repository

    Crawford, Jacob E.; Alves, Joel M.; Palmer, William J.; Day, Jonathan P.; Sylla, Massamba; Ramasamy, Ranjan; Surendran, Sinnathamby N.; Black, William C., IV; Pain, Arnab; Jiggins, Francis M.

    2017-01-01

    this transition, we have sequenced the exomes of mosquitoes collected from five populations from around the world. We found that Ae. aegypti specimens from an urban population in Senegal in West Africa were more closely related to populations in Mexico and Sri

  2. Mediterranean diet score and left ventricular structure and function: the Multi-Ethnic Study of Atherosclerosis12

    Science.gov (United States)

    Levitan, Emily B; Ahmed, Ali; Arnett, Donna K; Polak, Joseph F; Hundley, W Gregory; Bluemke, David A; Heckbert, Susan R; Jacobs, David R; Nettleton, Jennifer A

    2016-01-01

    Background: Data are limited on the relation between dietary patterns and left ventricular (LV) structure and function. Objective: We examined cross-sectional associations of a diet-score assessment of a Mediterranean dietary pattern with LV mass, volume, mass-to-volume ratio, stroke volume, and ejection fraction. Design: We measured LV variables with the use of cardiac MRI in 4497 participants in the Multi-Ethnic Study of Atherosclerosis study who were aged 45–84 y and without clinical cardiovascular disease. We calculated a Mediterranean diet score from intakes of fruit, vegetables, nuts, legumes, whole grains, fish, red meat, the monounsaturated fat:saturated fat ratio, and alcohol that were self-reported with the use of a food-frequency questionnaire. We used linear regression with adjustment for body size, physical activity, and cardiovascular disease risk factors to model associations and assess the shape of these associations (linear or quadratic). Results: The Mediterranean diet score had a slight U-shaped association with LV mass (adjusted means: 146, 145, 146, and 147 g across quartiles of diet score, respectively; P-quadratic trend = 0.04). The score was linearly associated with LV volume, stroke volume, and ejection fraction: for each +1-U difference in score, LV volume was 0.4 mL higher (95% CI: 0.0, 0.8 mL higher), the stroke volume was 0.5 mL higher (95% CI: 0.2, 0.8 mL higher), and the ejection fraction was 0.2 percentage points higher (95% CI: 0.1, 0.3 percentage points higher). The score was not associated with the mass-to-volume ratio. Conclusions: A higher Mediterranean diet score is cross-sectionally associated with a higher LV mass, which is balanced by a higher LV volume as well as a higher ejection fraction and stroke volume. Participants in this healthy, multiethnic sample whose dietary patterns most closely conformed to a Mediterranean-type pattern had a modestly better LV structure and function than did participants with less

  3. Acculturation and Plasma Fatty Acid Concentrations in Hispanic and Chinese-American Adults: The Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Diep, Cassandra S; Lemaitre, Rozenn N; Chen, Tzu-An; Baranowski, Tom; Lutsey, Pamela L; Manichaikul, Ani W; Rich, Stephen S; St-Jules, David E; Steffen, Brian T; Tsai, Michael Y; Siscovick, David S; Frazier-Wood, Alexis C

    2016-01-01

    Acculturation to the U.S. is associated with increased risk of cardiovascular disease, but the etiologic pathways are not fully understood. Plasma fatty acid levels exhibit ethnic differences and are emerging as biomarkers and predictors of cardiovascular disease risk. Thus, plasma fatty acids may represent one pathway underlying the association between acculturation and cardiovascular disease. We investigated the cross-sectional relationship between acculturation and plasma phospholipid fatty acids in a diverse sample of Hispanic- and Chinese-American adults. Participants included 377 Mexican, 320 non-Mexican Hispanic, and 712 Chinese adults from the Multi-Ethnic Study of Atherosclerosis, who had full plasma phospholipid assays and acculturation information. Acculturation was determined from three proxy measures: nativity, language spoken at home, and years in the U.S., with possible scores ranging from 0 (least acculturated) to 5 (most acculturated) points. α-Linolenic acid, linoleic acid, eicosapentaenoic acid, docosahexaenoic acid, and arachidonic acid were measured in fasting plasma. Linear regression models were conducted in race/ethnicity-stratified analyses, with acculturation as the predictor and plasma phospholipid fatty acids as the outcome variables. We ran secondary analyses to examine associations between acculturation and dietary fatty acids for comparison. Covariates included age, gender, education, and income. Contrary to our hypothesis, no statistically significant associations were detected between acculturation and plasma phospholipid fatty acids for Chinese, non-Mexican Hispanic, or Mexican participants. However, acculturation was related to dietary total n-6 fatty acids and dietary n-3/n-6 ratios in expected directions for Mexican, non-Mexican Hispanic, and combined Hispanic participants. In Chinese individuals, acculturation was unexpectedly associated with lower arachidonic acid intake. Absence of associations between acculturation and

  4. Legal Pluralism: Interactions Between Official and Unofficial Laws: The Case Study of a Multi-ethnic Community Farm

    Directory of Open Access Journals (Sweden)

    Gabriela Ribeiro Farinha

    2015-12-01

    Full Text Available A multi-ethnic community farm, located in California, was created in 2011 to be commonly exploited by refugees and emigrants from different countries.This paper aims to describe, as an observable fact, how distinct non-state normativities behave and relate in their dynamic process of interaction, surpassing the usual state/local law bases of analysis.The farm was approved by the state authorities and the NGO has created its regulations. Concomitantly, the distinct communities of farmers have defied and transformed the farm’s regulations by incorporating their competing legal land tenure regimes and legal postulates in the same structure of the unofficial law of the farm, through a common frame of meaning and the enactment of the “autonomy rule”. This has allowed the growers to follow their normativities inside the farm. However, its creation process and daily practice also exposes the relevance of the official law in its constitution, shape and function. En 2011 se creó en California una granja multiétnica comunal, para que fuera explotada en comunidad por refugiados y emigrantes de diferentes países. Este artículo pretende describir, como hecho observable, cómo se comportan y se relacionan normativas no estatales en un proceso dinámico de interacción, superando las bases de análisis estado/local habituales del derecho. Las autoridades estatales aprobaron la granja, y la ONG creó su propia normativa. Al mismo tiempo, las diferentes comunidades de agricultores han desafiado y transformado el reglamento de la granja, incorporando sus regímenes legales de tenencia de tierras vigentes, y los postulados legales en la misma estructura del derecho no oficial, a través de un marco común de significado y la promulgación de la “norma de autonomía”. Esto ha permitido a los productores seguir sus normativas dentro de la finca. Sin embargo, su proceso de creación y práctica diaria también pone de manifiesto la importancia del

  5. Explanations for inter-ethnic differences regarding immigrants' preferences for living in ‘ethnic enclaves’ or in multi-ethnic neighbourhoods

    DEFF Research Database (Denmark)

    Andersen, Hans Skifter

    In European countries there are large differences between the settlements patterns of different ethnic immigrant groups. One explanation is that different groups to a different extent have been successful immigrants. Differences regarding their social and cultural integration and their economic...... network they can rely on, so-called ethnic enclaves, or for preferences for living in so-called multi-ethnic neighbourhoods, where there are few Danes but many other ethnic groups. The results of the study thus supports that the American ‘spatial assimilation theory’ has some importance also in Europe...

  6. Comparison of Muscle Recovery Following Bi-cruciate Substituting versus Posterior Stabilized Total Knee Arthroplasty in the Asian Population.

    Science.gov (United States)

    Takubo, Akihito; Ryu, Keinosuke; Iriuchishima, Takanori; Tokuhashi, Yasuaki

    2017-09-01

    The purpose of this study was to compare muscle recovery in the lower extremities following the newly developed bi-cruciate substituting (BCS) to posterior stabilized (PS) total knee arthroplasty (TKA) in the Asian population. Forty-one knees in 41 patients undergoing BCS-TKA (41 female, average age: 71 ± 8.8) and 34 knees in 34 patients undergoing PS-TKA (33 female, average age: 73 ± 7.2) were included in this study. The maximum isometric power of the quadriceps and hamstring muscles was measured preoperatively, and at 1, 3, 6, and 12 months after surgery using a handheld dynamometer. Postoperative muscle recovery was calculated regarding preoperative muscle power as 100%. Pre- and postoperative range of knee motion, femorotibial angle, and clinical scores (Knee Society score and function score) were also compared. No significant difference in sex, age, preoperative quadriceps, or preoperative hamstring power was observed between the BCS and PS-TKA groups. When regarding the preoperative muscle power as 100%, quadriceps power at 1, 3, 6, and 12 months following BCS-TKA was 61.2 ± 22%, 86.3 ± 28.3%, 97 ± 27.4%, and 112.4 ± 30.8%, respectively. Quadriceps power at 1, 3, 6, and 12 months following PS-TKA was 72.4 ± 20.8%, 84 ± 16.9%, 95 ± 20.7%, and 110.8 ± 27%, respectively. Hamstring power at 1, 3, 6, and 12 months following BCS-TKA was 96.3 ± 30%, 111.4 ± 35%, 120 ± 37%, and 125 ± 31%, respectively. Hamstring power at 1, 3, 6, and 12 months following PS-TKA was 95 ± 25%, 112.4 ± 27%, 117 ± 38.5%, and 120.4 ± 18.5%, respectively. No significant difference in muscle power recovery was observed at 3 ( p  = 0.995), 6 ( p  = 0.944), and 12 ( p  = 0.917) months after surgery between the two groups. No significant difference of the clinical score was observed between the groups (Knee Society score: p  = 0.479, function score: p  = 0.342). No significant

  7. Asian patients with dyslipidemia in an urban population: Effect of ethnicity on their LDL-cholesterol treatment goals.

    Science.gov (United States)

    Tan, Ngiap Chuan; Koh, Kim Hwee; Goh, Chin Chin; Koh, Yi Ling Eileen; Goh, Soo Chye Paul

    2016-01-01

    Dyslipidemia is the primary risk factor for arthrosclerosis. It is the most common chronic disease among the multiethnic Asian population in Singapore. Local national health survey has shown ethnic variability in achieving control of dyslipidemia. This study aimed to determine the proportion of patients in primary care, who achieved their low-density lipoprotein (LDL)-cholesterol treatment goals, stratified by the local major ethnic groups. It also evaluated the factors that affected their dyslipidemia control, including diet, exercise and medication usage. Research assistants administered questionnaires on adult patients with physician-diagnosed dyslipidemia to determine their views on diet, exercise, and medications in this cross-sectional study in 2 local primary care clinics. Their lipid profiles were retrieved from their laboratory reports in their electronic health records. Chi-square and Fisher exact tests were used for the categorical demographics and questionnaire variables, (P < .05: statistically significant). Logistic regression was performed using these significant variables to determine the adjusted odds of the ethnic groups. A total of 1093 eligible patients completed the questionnaires. The proportion of Chinese, Malay, and Indian patients who achieved LDL-cholesterol goals was 78.3%, 67.9%, and 68.5%, respectively. Among those who self-reported taking their favorite cholesterol-rich food occasionally when their cholesterol became controlled, 35.8% Indians failed to achieve treatment goals, compared to 20.1% Chinese and 30.9% Malay patients. Regular medication adherence was associated with 81.8% Chinese, 69.0% Malay, and 69.7% Indian reaching treatment goals. More Chinese met LDL-cholesterol treatment goals compared to Malays and Indians. Lipid-lowering medications enabled but smoking hindered their achievement of these treatment goals. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  8. Physical Activity and Sedentary Behavior Patterns Before and During Pregnancy in a Multi-ethnic Sample of Asian Women in Singapore.

    Science.gov (United States)

    Padmapriya, N; Shen, Liang; Soh, Shu-E; Shen, Zhe; Kwek, Kenneth; Godfrey, Keith M; Gluckman, Peter D; Chong, Yap-Seng; Saw, Seang-Mei; Müller-Riemenschneider, Falk

    2015-11-01

    To describe physical activity (PA) and sedentary behavior (SB) patterns before and during pregnancy among Chinese, Malay and Indian women. In addition, to investigate determinants of change in PA and SB during pregnancy. The Growing Up in Singapore Towards healthy Outcomes cohort recruited first trimester pregnant women. PA and SB (sitting time and television time) before and during pregnancy were assessed as a part of an interview questionnaire at weeks 26-28 gestational clinic visit. Total energy expenditure (TEE) on PA and time in SB were calculated. Determinants of change in PA and SB were investigated using multiple logistic regression analysis. PA and SB questions were answered by 94 % (n = 1171) of total recruited subjects. A significant reduction in TEE was observed from before to during pregnancy [median 1746.0-1039.5 metabolic equivalent task (MET) min/week, p women insufficiently active (Women with higher household income, lower level of perceived health, nausea/vomiting during pregnancy and higher level of pre-pregnancy PA were more likely to reduce PA. Women with children were less likely to reduce PA. Women reporting nausea/vomiting and lower level of pre-pregnancy sitting time were more likely to increase sitting time. Participants substantially reduced PA and increased SB by 26-28 weeks of pregnancy. Further research is needed to better understand determinants of change in PA and SB and develop effective health promotion strategies.

  9. Association of Maternal Vitamin D Status with Glucose Tolerance and Caesarean Section in a Multi-Ethnic Asian Cohort: The Growing Up in Singapore Towards Healthy Outcomes Study.

    Science.gov (United States)

    Loy, See Ling; Lek, Ngee; Yap, Fabian; Soh, Shu E; Padmapriya, Natarajan; Tan, Kok Hian; Biswas, Arijit; Yeo, George Seow Heong; Kwek, Kenneth; Gluckman, Peter D; Godfrey, Keith M; Saw, Seang Mei; Müller-Riemenschneider, Falk; Chong, Yap-Seng; Chong, Mary Foong-Fong; Chan, Jerry Kok Yen

    2015-01-01

    Epidemiological studies relating maternal 25-hydroxyvitamin D (25OHD) with gestational diabetes mellitus (GDM) and mode of delivery have shown controversial results. We examined if maternal 25OHD status was associated with plasma glucose concentrations, risks of GDM and caesarean section in the Growing Up in Singapore Towards healthy Outcomes (GUSTO) study. Plasma 25OHD concentrations, fasting glucose (FG) and 2-hour postprandial glucose (2HPPG) concentrations were measured in 940 women from a Singapore mother-offspring cohort study at 26-28 weeks' gestation. 25OHD inadequacy and adequacy were defined based on concentrations of 25OHD ≤75nmol/l and >75nmol/l respectively. Mode of delivery was obtained from hospital records. Multiple linear regression was performed to examine the association between 25OHD status and glucose concentrations, while multiple logistic regression was performed to examine the association of 25OHD status with risks of GDM and caesarean section. In total, 388 (41.3%) women had 25OHD inadequacy. Of these, 131 (33.8%), 155 (39.9%) and 102 (26.3%) were Chinese, Malay and Indian respectively. After adjustment for confounders, maternal 25OHD inadequacy was associated with higher FG concentrations (β = 0.08mmol/l, 95% Confidence Interval (CI) = 0.01, 0.14), but not 2HPPG concentrations and risk of GDM. A trend between 25OHD inadequacy and higher likelihood of emergency caesarean section (Odds Ratio (OR) = 1.39, 95% CI = 0.95, 2.05) was observed. On stratification by ethnicity, the association with higher FG concentrations was significant in Malay women (β = 0.19mmol/l, 95% CI = 0.04, 0.33), while risk of emergency caesarean section was greater in Chinese (OR = 1.90, 95% CI = 1.06, 3.43) and Indian women (OR = 2.41, 95% CI = 1.01, 5.73). 25OHD inadequacy is prevalent in pregnant Singaporean women, particularly among the Malay and Indian women. This is associated with higher FG concentrations in Malay women, and increased risk of emergency caesarean section in Chinese and Indian women.

  10. Association of Maternal Vitamin D Status with Glucose Tolerance and Caesarean Section in a Multi-Ethnic Asian Cohort: The Growing Up in Singapore Towards Healthy Outcomes Study.

    Directory of Open Access Journals (Sweden)

    See Ling Loy

    Full Text Available Epidemiological studies relating maternal 25-hydroxyvitamin D (25OHD with gestational diabetes mellitus (GDM and mode of delivery have shown controversial results. We examined if maternal 25OHD status was associated with plasma glucose concentrations, risks of GDM and caesarean section in the Growing Up in Singapore Towards healthy Outcomes (GUSTO study.Plasma 25OHD concentrations, fasting glucose (FG and 2-hour postprandial glucose (2HPPG concentrations were measured in 940 women from a Singapore mother-offspring cohort study at 26-28 weeks' gestation. 25OHD inadequacy and adequacy were defined based on concentrations of 25OHD ≤75nmol/l and >75nmol/l respectively. Mode of delivery was obtained from hospital records. Multiple linear regression was performed to examine the association between 25OHD status and glucose concentrations, while multiple logistic regression was performed to examine the association of 25OHD status with risks of GDM and caesarean section.In total, 388 (41.3% women had 25OHD inadequacy. Of these, 131 (33.8%, 155 (39.9% and 102 (26.3% were Chinese, Malay and Indian respectively. After adjustment for confounders, maternal 25OHD inadequacy was associated with higher FG concentrations (β = 0.08mmol/l, 95% Confidence Interval (CI = 0.01, 0.14, but not 2HPPG concentrations and risk of GDM. A trend between 25OHD inadequacy and higher likelihood of emergency caesarean section (Odds Ratio (OR = 1.39, 95% CI = 0.95, 2.05 was observed. On stratification by ethnicity, the association with higher FG concentrations was significant in Malay women (β = 0.19mmol/l, 95% CI = 0.04, 0.33, while risk of emergency caesarean section was greater in Chinese (OR = 1.90, 95% CI = 1.06, 3.43 and Indian women (OR = 2.41, 95% CI = 1.01, 5.73.25OHD inadequacy is prevalent in pregnant Singaporean women, particularly among the Malay and Indian women. This is associated with higher FG concentrations in Malay women, and increased risk of emergency caesarean section in Chinese and Indian women.

  11. Breast cancer in a multi-ethnic Asian setting : Results from the Singapore-Malaysia hospital-based breast cancer registry

    NARCIS (Netherlands)

    Pathy, Nirmala Bhoo; Yip, Cheng Har; Taib, Nur Aishah; Hartman, Mikael; Saxena, Nakul; Lau, Philip; Bulgiba, Awang M.; Lee, Soo Chin; Lim, Siew Eng; Wong, John E. L.; Verkooijen, Helena M.

    Two hospital-based breast cancer databases (University Malaya Medical Center, Malaysia [n = 1513] and National University Hospital, Singapore [n = 2545]) were merged into a regional registry of breast cancer patients diagnosed between 1990 and 2007. A review of the data found 51% of patients

  12. Gender Differences in the Use of Drug Resistance Strategies: An Analysis of Rural Asian/Pacific Islander Youth

    OpenAIRE

    Okamoto, Scott K.; Pel, Suzanne; Helm, Susana; Valdez, Jessica

    2013-01-01

    This study examines gender differences in the use of drug resistance strategies for rural Asian/Pacific Islander youth. Multi-ethnic Asian/Pacific Islander youth (N = 213) from 6 middle/intermediate schools on the Island of Hawai’i participated in the study, and gender differences in their real-world use of specific strategies (e.g., refuse, explain, avoid, leave) were examined. Despite similar levels of exposure to situations where drugs and/or alcohol were offered, girls indicated significa...

  13. Suboptimal vitamin D status in a population-based study of Asian children: prevalence and relation to allergic diseases and atopy.

    Directory of Open Access Journals (Sweden)

    Tsung-Chieh Yao

    Full Text Available BACKGROUND: New evidence shows high prevalence of vitamin D deficiency in many countries and some studies suggest a possible link between vitamin D status and allergic diseases. The objectives of this study were to determine the prevalence of suboptimal vitamin D status in a population sample of Asian children and to investigate the relationship of vitamin D status with allergic diseases and atopy. METHODS: Children aged 5-18 years (N = 1315 in the Prediction of Allergies in Taiwanese CHildren (PATCH study were evaluated using questionnaires, anthropometric measurements, and serum levels of 25-hydroxyvitamin D [25(OHD] and total and specific immunoglobulin E (IgE. RESULTS: The mean concentration of serum 25(OHD was 20.4 ng/mL (SD: 7.1 ng/mL. Vitamin D deficiency (defined as serum 25(OHD0.05. CONCLUSIONS: Low serum 25(OHD levels are remarkably common in this population sample of Asian children, suggesting that millions of children living in Taiwan may have suboptimal levels of vitamin D, which should be a matter of public health concern. Our results provides epidemiological evidence against the association of vitamin D status with various allergic diseases and atopy in Asian children.

  14. Population burden of betel quid abuse and its relation to oral premalignant disorders in South, Southeast, and East Asia: an Asian Betel-quid Consortium Study.

    Science.gov (United States)

    Lee, Chien-Hung; Ko, Albert Min-Shan; Warnakulasuriya, Saman; Ling, Tian-You; Sunarjo; Rajapakse, Palandage Sunethra; Zain, Rosnah Binti; Ibrahim, Salah Osman; Zhang, Shan-Shan; Wu, Han-Jiang; Liu, Lin; Kuntoro; Utomo, Budi; Warusavithana, Supun Amila; Razak, Ishak Abdul; Abdullah, Norlida; Shrestha, Prashanta; Shieh, Tien-Yu; Yen, Cheng-Fang; Ko, Ying-Chin

    2012-03-01

    We investigated the population burden of betel quid abuse and its related impact on oral premalignant disorders (OPDs) in South, Southeast, and East Asia. The Asian Betel-Quid Consortium conducted a multistage sampling of 8922 representative participants from Taiwan, Mainland China, Malaysia, Indonesia, Nepal, and Sri Lanka. Participants received an interviewer-administered survey and were examined for oral mucosal disorders. The prevalence of betel quid abuse was 0.8% to 46.3% across 6 Asian populations. The abuse frequency was over 40.5% for current chewers, with the highest proportion in Nepalese and Southeast Asian chewers (76.9%-99.6%). Tobacco-added betel quid conferred higher abuse rates (74.4%-99.6%) among Malaysian, Indonesian, and Sri Lankan men than did tobacco-free betel quid (21.8%-89.1%). Gender, lower education level, younger age at chewing initiation, and clustering of familial betel quid use significantly contributed to higher abuse rates. Indonesian betel quid abusers showed the highest prevalence of OPDs and had a greater risk of OPDs than did nonabusers. Betel quid abuse is high in regions of Asia where it is customarily practiced, and such abuse correlates highly with OPDs. By recognizing abuse-associated factors, health policies and preventive frameworks can be effectively constructed to combat these oral preneoplasms.

  15. Disparities in Breast Cancer Survival Among Asian Women by Ethnicity and Immigrant Status: A Population-Based Study

    Science.gov (United States)

    Clarke, Christina A.; Shema, Sarah J.; Chang, Ellen T.; Keegan, Theresa H. M.; Glaser, Sally L.

    2010-01-01

    Objectives. We investigated heterogeneity in ethnic composition and immigrant status among US Asians as an explanation for disparities in breast cancer survival. Methods. We enhanced data from the California Cancer Registry and the Surveillance, Epidemiology, and End Results program through linkage and imputation to examine the effect of immigrant status, neighborhood socioeconomic status, and ethnic enclave on mortality among Chinese, Japanese, Filipino, Korean, South Asian, and Vietnamese women diagnosed with breast cancer from 1988 to 2005 and followed through 2007. Results. US-born women had similar mortality rates in all Asian ethnic groups except the Vietnamese, who had lower mortality risk (hazard ratio [HR] = 0.3; 95% confidence interval [CI] = 0.1, 0.9). Except for Japanese women, all foreign-born women had higher mortality than did US-born Japanese, the reference group. HRs ranged from 1.4 (95% CI = 1.2, 1.7) among Koreans to 1.8 (95% CI = 1.5, 2.2) among South Asians and Vietnamese. Little of this variation was explained by differences in disease characteristics. Conclusions. Survival after breast cancer is poorer among foreign- than US-born Asians. Research on underlying factors is needed, along with increased awareness and targeted cancer control. PMID:20299648

  16. Is cardiovascular risk reduction therapy effective in South Asian, Chinese and other patients with diabetes? A population-based cohort study from Canada.

    Science.gov (United States)

    Ke, Calvin H; Morgan, Steve; Smolina, Kate; Gasevic, Danijela; Qian, Hong; Khan, Nadia A

    2017-08-31

    Guidelines recommend ACE inhibitors (ACEi), angiotensin receptor blockers (ARBs), calcium channel blockers (CCBs) and diuretics in all patients with diabetes mellitus. However, the effectiveness of these agents in South Asian and Chinese populations is unknown. We sought to determine whether ACEi, ARB, CCB and diuretics are associated with reduced mortality in South Asian, Chinese and other patients with diabetes. Population-based cohort study using administrative health databases. Province of British Columbia, Canada (2006-2013). Patients aged ≥35 years with incident diabetes. Primary outcome was all-cause mortality for each medication class compared with untreated patients within each ethnicity. Treatment effect was assessed using inverse probability of treatment weighted Cox proportional hazards models. Medication adherence effect on mortality was also evaluated. 208 870 patients (13 755 South Asian, 22 871 Chinese, 172 244 other Canadian) were included. ACEi reduced mortality in other patients (HR=0.88, 0.84-0.91), but power was insufficient to evaluate for benefit in Chinese and South Asian patients. ARB and diuretics reduced mortality in Chinese (ARB HR=0.64, 0.50-0.82; diuretics HR=0.77, 0.62-0.96) and other patients (ARB HR=0.69, 0.64-0.74; diuretics HR=0.66, 0.63-0.69) compared with untreated patients. No mortality benefit was observed among South Asians for any drug class or for CCB among all ethnicities. Higher medication adherence was associated with lower mortality for other patients only (HR=0.79, 0.72-0.86). Effectiveness of cardiovascular risk reduction therapy on mortality varies considerably by ethnicity. Further study is needed to evaluate the mortality benefit of antihypertensive agents in South Asians. Inclusion of these ethnic groups in future clinical trials is essential to examine for differential responses. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No

  17. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  18. Cirurgia cardíaca em uma sociedade multiétnica: a experiência do Caribbean Heart Care Cardiac surgery in a multi-ethnic low volume service: the Caribbean Heart Care Experience

    Directory of Open Access Journals (Sweden)

    Jose Burgos-Irazabal

    2005-09-01

    Full Text Available OBJETIVO: A população do Caribe constitui uma sociedade multiétnica, incluindo caucasianos, afro-caribenhos, indianos, asiáticos, hispânicos, europeus e nativos, com uma grande variabilidade de padrões socioeconômicos. A incidência e os tipos de doenças cardíacas também variam significativamente entre essas etnias. Relatamos aqui a experiência (em pacientes adultos e pediátricos em um serviço de cirurgia cardíaca de baixo volume em Trinidad e Tobago, no Caribe. MÉTODO: O programa de cirurgia cardíaca de adultos começou em novembro de 1993, são reportados os dados de 878 pacientes (629 homens, idade entre 18 e 88 anos, com média de 67 anos. Destes, 39,4% eram diabéticos e 46,5% hipertensos. Os procedimentos incluíram cirurgia de revascularização miocárdica (CRM, reparo e substituição de valvas e cirurgias da aorta. O programa de cirurgia cardíaca pediátrica (idades entre duas semanas e 21 anos começou em setembro de 1998, tendo sido realizado um total de 279 operações. RESULTADOS: Adultos - a mortalidade total foi de 3,8%. A maioria dos procedimentos foi CRM (82,3% com mortalidade total de 2,8% (0% em 2004. A técnica sem circulação extracorpórea foi empregada em 43% dos procedimentos de CRM (71,2% em 2004. A cirurgia de valva aórtica foi feita em 49 pacientes, e a substituição/reparo da valva mitral em 96 doentes. Pediátricos - a maioria dos procedimentos foi correção de comunicação interventricular (111, comunicação interatrial (57, tetralogia de Fallot (23, e 88 outros (com mortalidade de 1,5%. CONCLUSÃO: Cirurgia cardíaca em um serviço multiétnico de baixo volume pode ser realizada com excelentes resultados, comparáveis com padrões internacionais de qualidade.INTRODUCTION: The Caribbean is a multi-ethnic society, including Caucasian, Afro-Caribbean, East Indians, Asians, Hispanics, European and natives, which has a broad range of living standards. The incidence and types of heart diseases

  19. A retrospective critic Re-Debate on Stakeholders’ resistance checklist in software project management within multi-cultural, multi-ethnical and cosmopolitan society context: The Malaysian experience

    Directory of Open Access Journals (Sweden)

    Hamed Taherdoost

    2016-12-01

    Full Text Available Risks stemming from software projects were extensively studied. However, software project risk management has rarely researched organizational risks within multi-cultural and multi-ethnical atmospheres. The fact of the matter is that problems occur when the stakeholders’ cultural and ethnical aspects are not addressed, especially in multi-cultural, multi-ethnical, and cosmopolitan society such as Malaysia. To avoid analyzing something that has already been studied in detail, this study conducted based on in-depth literature review considering key word search in subject-specific databases. Journal articles published in reputed journals were reviewed. By employing Rumelt’s resistance to change checklist and culture gap tool source, this paper develops an organizational risk framework considering cross-cultural and cross-ethnical critical factors in order to show how can risks be better comprehended and managed. The significance of bio-cultural dimensions was scrutinized as vital criteria which should be considered in international project sphere, so that, not only the odds of project success would be increased but also the risks can be mitigated significantly. A review of the risk management process, Rumelt’s Checklist, cultural issues in international project environment allows a better understanding of the importance of cultural dimensions in project spheres.

  20. Mid-term study of transcatheter aortic valve implantation in an Asian population with severe aortic stenosis: two-year Valve Academic Research Consortium-2 outcomes.

    Science.gov (United States)

    Chew, Nicholas; Hon, Jimmy Kim Fatt; Yip, Wei Luen James; Chan, Siew Pang; Poh, Kian-Keong; Kong, William Kok-Fai; Teoh, Kristine Leok Kheng; Yeo, Tiong Cheng; Tan, Huay Cheem; Tay, Edgar Lik Wui

    2017-09-01

    Transcatheter aortic valve implantation (TAVI) is an effective treatment for high-risk or inoperative patients with severe aortic stenosis. Given the unique characteristics of Asian populations, questions regarding mid-term outcomes in Asians undergoing TAVI have yet to be addressed. We evaluated the two-year clinical outcomes of TAVI in an Asian population using Valve Academic Research Consortium-2 definitions. This prospective study recruited 59 patients from a major academic medical centre in Singapore. The main outcomes were two-year survival rates, peri-procedural complications, symptom improvement, valvular function and assessment of learning curve. Mean age was 76.8 years (61.0% male), mean body surface area 1.6 m 2 and mean logistic EuroSCORE 18.7%. Survival was 93.2%, 86.0% and 79.1% at 30 days, one year and two years, respectively. At 30 days post TAVI, the rate of stroke was 1.7%, life-threatening bleeding 5.1%, acute kidney injury 25.0%, major vascular complication 5.1%, and new permanent pacemaker implantation 6.8%. 29.3% of TAVI patients were rehospitalised (47.1% cardiovascular-related) within one year. These composite outcomes were measured: device success (93.2%); early safety (79.7%); clinical efficacy (66.1%); and time-related valve safety (84.7%). Univariate analysis found these predictors of two-year all-cause mortality: logistic EuroSCORE (hazard ratio [HR] 1.07; p < 0.001); baseline estimated glomerular filtration rate (HR 0.97; p = 0.048); and acute kidney injury (HR 5.33; p = 0.022). Multivariate analysis identified non-transfemoral TAVI as a predictor of cardiovascular-related two-year mortality (HR 14.64; p = 0.008). Despite the unique clinical differences in Asian populations, this registry demonstrated favourable mid-term clinical and safety outcomes in Asians undergoing TAVI. Copyright: © Singapore Medical Association

  1. The effect of tranexamic acid in unilateral and bilateral total knee arthroplasty in the South Asian population: A retrospective cohort study.

    Science.gov (United States)

    Mufarrih, Syed Hamza; Malik, Azeem Tariq; Qureshi, Nada Qaisar; Lakdawala, Riaz Hussain; Rabbani, Muhammad Umar; Ali, Arif; Noordin, Shahryar

    2018-04-01

    Together with evidence of higher bleeding tendencies, the vulnerability of the South-Asian population to anemia secondary to a higher prevalence of hemoglobinopathies and micronutrient deficiencies merits further exploration of the effects of tranexamic acid on this population. Additionally, limited access to self-care facilities and certain sociocultural beliefs and practices may not be conducive to a speedy recovery from surgical complications. The aim of this study is to investigate the effects of intraoperative administration of tranexamic acid during total knee arthroplasty when considering the South-Asian population. Medical record files of 355 patients who underwent total knee arthroplasty (2007-2015) were reviewed to collect data regarding patient characteristics, surgical variables and post-operative complications. Unilateral and Bilateral total knee arthroplasty were studied separately. Analysis was done using t-test, Mann-Whitney U test, chi-square and Fisher's exact square where appropriate. The threshold for significance was p tranexamic acid caused a significant reduction in estimated blood loss (p-value=0.011), total operative time, calculated blood loss, and hemoglobin change (p-valuetranexamic acid only caused a significant reduction in calculated blood loss (p-value tranexamic acid vs. those who did not, there was a significant increase in length of hospital stay (ptranexamic acid effectively reduces intraoperative blood loss, it does not have an effect on the need for post-operative blood transfusions. The increased length of stay and special care unit admissions associated with tranexamic acid use should be explored further to reveal the complete safety profile of tranexamic acid administration in the South-Asian population during total knee arthroplasty. Copyright © 2018 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

  2. The South Asian genome.

    Directory of Open Access Journals (Sweden)

    John C Chambers

    Full Text Available The genetic sequence variation of people from the Indian subcontinent who comprise one-quarter of the world's population, is not well described. We carried out whole genome sequencing of 168 South Asians, along with whole-exome sequencing of 147 South Asians to provide deeper characterisation of coding regions. We identify 12,962,155 autosomal sequence variants, including 2,946,861 new SNPs and 312,738 novel indels. This catalogue of SNPs and indels amongst South Asians provides the first comprehensive map of genetic variation in this major human population, and reveals evidence for selective pressures on genes involved in skin biology, metabolism, infection and immunity. Our results will accelerate the search for the genetic variants underlying susceptibility to disorders such as type-2 diabetes and cardiovascular disease which are highly prevalent amongst South Asians.

  3. Diagnostic value of circulating microRNAs for gastric cancer in Asian populations: a meta-analysis.

    Science.gov (United States)

    Liu, Lihua; Wang, Shan; Cao, Xiutang; Liu, Jianchao

    2014-12-01

    Gastric cancer (GC) accounts for one of the highest mortality worldwide and particularly in East Asia. Many studies have reported on the potential value of microRNAs (miRNAs) detection for diagnosing GC, but their results have proven inconclusive. The present meta-analysis was conducted to assess the diagnostic value of circulating miRNAs for GC diagnosis. A literature search was carried out in databases (PubMed, Embase, Web of Science, The Cochrane Library, and CNKI) and other sources using combinations of keywords relating to GC, miRNAs, and diagnosis. The values of sensitivity, specificity, positive likelihood ratios (PLR), negative likelihood ratios (NLR), and diagnostic odds ratio (DOR) reported in individual studies were pooled using random-effects models. Potential sources of heterogeneity were assessed with subgroup and meta-regression analyses. The summary receiver operating characteristic (SROC) curve and the area under the curve (AUC) were used to assess the diagnosis accuracy of miRNAs. This meta-analysis included 1,279 patients with GC and 954 healthy controls from 20 publications. The pooled sensitivity, specificity, PLR, NLR, DOR, and AUC were 0.78 (95 % CI: 0.73-0.81), 0.80 (95 % CI: 0.76-0.84), 4.0 (95 % CI: 3.1-6.0), 0.28 (95 % CI: 0.23-0.34), 14 (95 % CI: 10-21), and 0.86 (95 % CI: 0.83-0.89), respectively. Subgroup analyses showed that early stages (I and II) GC were more easily detected than later stages and that multiple miRNAs assays were more accurate than single miRNA assays. Our meta-analysis suggests that miRNAs have a high diagnostic value for GC, especially in its early stages (I and II). In addition, multiple miRNAs assays have a better diagnosis value than single miRNA assays. In conclusion, circulating miRNAs might be used as noninvasive biomarkers for the confirmation of GC detection in Asian populations.

  4. High rates of pneumonia in children under two years of age in a South East Asian refugee population.

    Directory of Open Access Journals (Sweden)

    Claudia Turner

    Full Text Available There are an estimated 150 million episodes of childhood pneumonia per year, with 11-20 million hospital admissions and 1.575 million deaths. Refugee children are particularly vulnerable, with poorly defined pneumonia epidemiology.We followed a birth cohort of 955 refugee infants, born over a one-year period, until two years of age. Clinical and radiographic pneumonia were diagnosed according to WHO criteria. Detailed characteristics were collected to determine risk factors for clinical, radiological and multiple episodes of pneumonia. Investigations were taken during a pneumonia episode to help determine or to infer an aetiological diagnosis.The incidence of clinical pneumonia was 0.73 (95% CI 0.70-0.75 episodes per child year (/CY and of radiological primary endpoint pneumonia (PEP was 0.22/CY (95% CI 0.20-0.24. The incidence of pneumonia without severe signs was 0.50/CY (95% CI 0.48-0.53, severe pneumonia 0.15/CY (95% CI 0.13-0.17 and very severe pneumonia 0.06/CY (0.05-0.07. Virus was detected, from a nasopharyngeal aspirate, in 61.3% of episodes. A reduced volume of living space per person (IRR 0.99, 95% CI 0.99-1.0, p = 0.003 and young maternal age (IRR 1.59, 95% CI 1.12-2.27, p = 0.01 were risk factors for developing pneumonia. The risk of a child having >1 episode of pneumonia was increased by having a shorter distance to the next house (IRR 0.86, 95% CI 0.74-1.00, p = 0.04. Infants were at risk of having an episode of PEP if there was a shorter distance from stove to bed (IRR 0.89, 95% CI 0.80-0.99, p = 0.03. Raised CRP and neutrophil values were associated with PEP.There was a high incidence of pneumonia in young children in this SE Asian refugee population. Viral infections were important, however CXR and non-specific marker findings suggested that bacteria may be involved in up to a third of cases.

  5. Immunogenicity and safety of human papillomavirus (HPV) vaccination in Asian populations from six countries : a meta-analysis

    NARCIS (Netherlands)

    Setiawan, Didik; Luttjeboer, Jos; Pouwels, Koen B.; Wilschut, Jan C.; Postma, Maarten J.

    Cervical cancer is a serious public-health problem in Asian countries. Since human papillomavirus (HPV) infection is the main risk factor for cervical cancer, HPV vaccination is considered a promising strategy to prevent cervical cancer. However, comprehensive immunogenicity and safety information

  6. Studying the Genetics of Complex Disease With Ancestry-Specific Human Phenotype Networks: The Case of Type 2 Diabetes in East Asian Populations.

    Science.gov (United States)

    Qiu, Jingya; Moore, Jason H; Darabos, Christian

    2016-05-01

    Genome-wide association studies (GWAS) have led to the discovery of over 200 single nucleotide polymorphisms (SNPs) associated with type 2 diabetes mellitus (T2DM). Additionally, East Asians develop T2DM at a higher rate, younger age, and lower body mass index than their European ancestry counterparts. The reason behind this occurrence remains elusive. With comprehensive searches through the National Human Genome Research Institute (NHGRI) GWAS catalog literature, we compiled a database of 2,800 ancestry-specific SNPs associated with T2DM and 70 other related traits. Manual data extraction was necessary because the GWAS catalog reports statistics such as odds ratio and P-value, but does not consistently include ancestry information. Currently, many statistics are derived by combining initial and replication samples from study populations of mixed ancestry. Analysis of all-inclusive data can be misleading, as not all SNPs are transferable across diverse populations. We used ancestry data to construct ancestry-specific human phenotype networks (HPN) centered on T2DM. Quantitative and visual analysis of network models reveal the genetic disparities between ancestry groups. Of the 27 phenotypes in the East Asian HPN, six phenotypes were unique to the network, revealing the underlying ancestry-specific nature of some SNPs associated with T2DM. We studied the relationship between T2DM and five phenotypes unique to the East Asian HPN to generate new interaction hypotheses in a clinical context. The genetic differences found in our ancestry-specific HPNs suggest different pathways are involved in the pathogenesis of T2DM among different populations. Our study underlines the importance of ancestry in the development of T2DM and its implications in pharmocogenetics and personalized medicine. © 2016 The Authors. *Genetic Epidemiology Published by Wiley Periodicals, Inc.

  7. Predictors of low diabetes risk perception in a multi-ethnic cohort of women with gestational diabetes mellitus.

    Science.gov (United States)

    Mukerji, G; Kainth, S; Pendrith, C; Lowe, J; Feig, D S; Banerjee, A T; Wu, W; Lipscombe, L L

    2016-10-01

    To determine what proportion of women with gestational diabetes underestimate their diabetes risk and identify factors associated with low diabetes risk perception. Participants included pregnant adult women with gestational diabetes between 2009 and 2012 across seven diabetes clinics in Ontario, Canada. Data were collected through chart review and a survey that included a diabetes risk perception question. Of the 614 of 902 women (68% response rate) with gestational diabetes, 89% correctly responded that gestational diabetes increases the risk for developing diabetes. However, 47.1% of women perceived themselves to be at low risk for developing diabetes within 10 years. On multivariable analysis, BMI gestational diabetes history, absent diabetes family history and absent insulin use were appropriately associated with low diabetes risk perception. However, compared with Caucasian ethnicity, high-risk ethnicity (Aboriginal, Latin American, West Indian, South Asian, Middle Eastern, Filipino, Black, Pacific Islander) [odds ratio (OR) 2.07; 95% CI 1.30-3.31] and East and South East Asian ethnicity (OR 2.01; 1.10-3.67) were associated with low diabetes risk perception. After further adjustment for immigration, only high-risk ethnicity remained a predictor of low diabetes risk perception (OR 1.86; 1.09-3.19), whereas East and South East Asian ethnicity did not (OR 1.67; 0.86-3.22). Although the majority of women recognized gestational diabetes as a risk factor for diabetes, almost half underestimated their personal high diabetes risk despite prenatal care. Furthermore, women from high-risk ethnic groups were more likely to underestimate their risk, even after adjusting for immigration. Interventions tailored to these groups are necessary to enhance perceived diabetes risk. © 2015 Diabetes UK.

  8. Significant genotype difference in the CYP2E1 PstI polymorphism of indigenous groups in Sabah, Malaysia with Asian and non-Asian populations.

    Science.gov (United States)

    Goh, Lucky Poh Wah; Chong, Eric Tzyy Jiann; Chua, Kek Heng; Chuah, Jitt Aun; Lee, Ping-Chin

    2014-01-01

    CYP2E1 PstI polymorphism G-1259C (rs3813867) genotype distributions vary significantly among different populations and are associated with both diseases, like cancer, and adverse drug effects. To date, there have been limited genotype distributions and allele frequencies of this polymorphism reported in the three major indigenous ethnic groups (KadazanDusun, Bajau, and Rungus) in Sabah, also known as North Borneo. The aim of this study was to investigate the genotype distributions and allele frequencies of the CYP2E1 PstI polymorphism G-1259C in these three major indigenous peoples in Sabah. A total of 640 healthy individuals from the three dominant indigenous groups were recruited for this study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at G-1259C polymorphic site of CYP2E1 gene was performed using the Pst I restriction enzyme. Fragments were analyzed using agarose gel electrophoresis and confirmed by direct sequencing. Overall, the allele frequencies were 90.3% for c1 allele and 9.7% for c2 allele. The genotype frequencies for c1/c1, c1/c2 and c2/c2 were observed as 80.9%, 18.8%, and 0.3%, respectively. A highly statistical significant difference (ppopulations. However, among these three indigenous groups, there was no statistical significant difference (p>0.001) in their genotype distributions. The three major indigenous ethnic groups in Sabah show unique genotype distributions when compared with other populations. This finding indicates the importance of establishing the genotype distributions of CYP2E1 PstI polymorphism in the indigenous populations.

  9. Explaining disparities in colorectal cancer screening among five Asian ethnic groups: A population-based study in California

    Directory of Open Access Journals (Sweden)

    Antonio Cynthia M

    2010-05-01

    Full Text Available Abstract Background Data from the California Health Interview Survey (CHIS indicate that levels and temporal trends in colorectal cancer (CRC screening prevalence vary among Asian American groups; however, the reasons for these differences have not been fully investigated. Methods Using CHIS 2001, 2003 and 2005 data, we conducted hierarchical regression analyses progressively controlling for demographic characteristics, English proficiency and access to care in an attempt to identify factors explaining differences in screening prevalence and trends among Chinese, Filipino, Vietnamese, Korean and Japanese Americans (N = 4,188. Results After controlling for differences in gender and age, all Asian subgroups had significantly lower odds of having ever received screening in 2001 than the reference group of Japanese Americans. In addition, Korean Americans were the only subgroup that had a statistically significant decline in screening prevalence from 2001 to 2005 compared to the trend among Japanese Americans. After controlling for differences in education, marital status, employment status and federal poverty level, Korean Americans were the only group that had significantly lower screening prevalence than Japanese Americans in 2001, and their trend to 2005 remained significantly depressed. After controlling for differences in English proficiency and access to care, screening prevalences in 2001 were no longer significantly different among the Asian subgroups, but the trend among Korean Americans from 2001 to 2005 remained significantly depressed. Korean and Vietnamese Americans were less likely than other groups to report a recent doctor recommendation for screening and more likely to cite a lack of health problems as a reason for not obtaining screening. Conclusions Differences in CRC screening trends among Asian ethnic groups are not entirely explained by differences in demographic characteristics, English proficiency and access to care. A

  10. Development and validation of a food frequency questionnaire for dietary intake assessment among multi-ethnic primary school-aged children

    Science.gov (United States)

    Fatihah, Fadil; Ng, Boon Koon; Hazwanie, Husin; Norimah, A Karim; Shanita, Safii Nik; Ruzita, Abd Talib; Poh, Bee Koon

    2015-01-01

    INTRODUCTION This study aimed to develop and validate a food frequency questionnaire (FFQ) to assess habitual diets of multi-ethnic Malaysian children aged 7–12 years. METHODS A total of 236 primary school children participated in the development of the FFQ and 209 subjects participated in the validation study, with a subsample of 30 subjects participating in the reproducibility study. The FFQ, consisting of 94 food items from 12 food groups, was compared with a three-day dietary record (3DR) as the reference method. The reproducibility of the FFQ was assessed through repeat administration (FFQ2), seven days after the first administration (FFQ1). RESULTS The results of the validation study demonstrated good acceptance of the FFQ. Mean intake of macronutrients in FFQ1 and 3DR correlated well, although the FFQ intake data tended to be higher. Cross-classification of nutrient intake between the two methods showed that Malaysia. PMID:26702165

  11. Association between the -455T>C promoter polymorphism of the APOC3 gene and the metabolic syndrome in a multi-ethnic sample

    DEFF Research Database (Denmark)

    Pollex, Rebecca L; Ban, Matthew R; Young, T Kue

    2007-01-01

    it also a potential genetic determinant for MetS. The objective of this study is to examine the APOC3 -455T>C and the INSIG2 rs7566605 polymorphisms as potential genetic determinants for MetS in a multi-ethnic sample. METHODS: Subjects were genotyped for both the APOC3 -455T>C and INSIG2 rs7566605...... definition). Carriers of > or =1 copy of APOC3 -455C were more likely to have MetS (NCEP ATP III definition) than noncarriers (carrier odds ratio 1.73, 95% CI 1.40 to 2.14, adjusting for age and study group). The basis of the association was related not only to a higher proportion of -455C carriers meeting...

  12. Association of Geography and Ambient Air Pollution with Urine Metal Concentrations in Six US Cities: The Multi-Ethnic Study of Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Yuanjie Pang

    2016-03-01

    Full Text Available We investigated the associations of urinary concentrations of antimony, cadmium, tungsten and uranium with geographic locations and with ambient air pollution in 304 adults in the Multi-Ethnic Study of Atherosclerosis from six US cities. After adjustment for sociodemographics, body mass index, and smoking status, urinary cadmium was the highest in Winston-Salem among all study sites (the geometric mean [GM] in Winston-Salem was 0.84 µg/L [95% confidence interval (CI 0.57–1.22]. The adjusted GMs of urinary tungsten and uranium were highest in Los Angeles (0.11 µg/L [95% CI 0.08–0.16] and 0.019 µg/L [95% CI 0.016–0.023], respectively. The adjusted GM ratio comparing fine particulate matter (PM2.5 tertiles 2 and 3 with the lowest tertile were 1.64 (95% CI 1.05–2.56 and 3.55 (95% CI 2.24–5.63 for tungsten, and 1.18 (95% CI 0.94–1.48 and 1.70 (95% CI 1.34–2.14 for uranium. The results for tungsten remained similar after adjustment for study site. Urinary cadmium, tungsten and uranium concentrations differed by geographic locations in MESA (Multi-Ethnic Study of Atherosclerosis communities. PM2.5 levels could contribute to geographic differences in tungsten exposure. These findings highlight the need to implement preventive strategies to decrease toxic metal exposure and to evaluate the health effects of chronic exposure to those metals.

  13. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    Science.gov (United States)

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  14. Lupus, still a mystery: A comparison of clinical features of Pakistani population living in suburbs of Karachi with other Asian countries

    International Nuclear Information System (INIS)

    Ishaq, M.; Nazir, L.; Riaz, A.; Kidwai, S.S.; Haroon, W.; Siddiq, S.

    2013-01-01

    Objective: To determine the presenting features of patients with systemic lupus erythematosus at a private hospital in Karachi, and to compare the features with those of other Asian populations. Methods: The retrospective study comprised records of all lupus cases meeting the revised American Rheumatism Association criteria at the time of presentation at Jinnah Medical College Hospital, Karachi, from May 2008 to June 2011. Demographic and clinical data was analysed using SPSS 11.5. Results: Of the 105 cases in the study, there were 6 (5.7%) males and 99 (94.3%) females, with a male-to-female ratio of 1:16 and a mean age of 31.6+-10.5 years. Clinical manifestations included: constitutional symptoms in (n=69; 65.7%), arthropathy (n=81; 77%), cutaneous involvement (n=39; 37%), lupus nephritis (n=24; 22.8%), pleurisy (n=9; 8.6%), Raynaud's phenomenon (n=24; 22.8%), and vasculitis (n=18; 17%). One (0.95%) patient presented with mononeuritis multiplex, and 1 (0.95%) with acute pancreatitis. Conclusion: The diversity in clinical presentation appeared to be a reflection of the great variability that exists among Asian countries with regards to their genetic, environmental and socio-demographic backgrounds. The differences also existed in our own population, suggesting some unknown etiology. (author)

  15. Ancestry, Socioeconomic Status, and Age-Related Cataract in Asians: The Singapore Epidemiology of Eye Diseases Study.

    Science.gov (United States)

    Chua, Jacqueline; Koh, Jia Yu; Tan, Ava Grace; Zhao, Wanting; Lamoureux, Ecosse; Mitchell, Paul; Wang, Jie Jin; Wong, Tien Yin; Cheng, Ching-Yu

    2015-11-01

    To determine the prevalence of age-related cataract and its ancestral and socioeconomic risk factors in a multi-ethnic Asian population. Population-based, cross-sectional study. A total of 10 033 adults (3353 Chinese, 3280 Malays, and 3400 Indians) aged >40 years in the Singapore Epidemiology of Eye Diseases Study. Study participants were invited for a structured interview and received a standardized comprehensive eye examination. Digital lens photographs were taken from eyes of each participant and graded for nuclear, cortical, and posterior subcapsular (PSC) cataract, following the Wisconsin Cataract Grading System. Prevalence data were compared with the Blue Mountains Eye Study (BMES) in Australia. Information on medical and lifestyle factors was collected using questionnaires and blood samples. To increase the precision of racial definition, genetic ancestry was derived from genome-wide single nucleotide polymorphism markers using principal component analysis. Regression models were used to investigate the association of cataract with socioeconomic factors (education and income) and genetic ancestry. Age-related cataract. A total of 8750 participants (94.0%) had gradable lens photographs. The age-standardized prevalence of cataract surgery in Chinese (16.0%), Malays (10.6%), and Indians (20.2%) was higher than in white subjects (4.1%). We found the age-standardized cataract prevalence in Chinese (30.4%), Malays (37.8%), and Indians (33.1%) was higher than in whites (18.5%). Cataract was 1.5 to 2 times more common in Asians and began 10 years earlier than in white subjects. Malays had significantly higher age-standardized prevalence of nuclear, cortical, and PSC cataract than Chinese (PChinese and Indians but not Malays. The presence of visual impairment associated with cataract was higher in people aged ≥60 years and Malays. We showed that people of different Asian ethnicities had a higher prevalence and earlier age of onset of cataract than Europeans. People

  16. Differential distribution and association of FTO rs9939609 gene polymorphism with obesity: A cross-sectional study among two tribal populations of India with East-Asian ancestry.

    Science.gov (United States)

    Ningombam, Somorjit Singh; Chhungi, Varhlun; Newmei, Masan Kambo; Rajkumari, Sunanda; Devi, Naorem Kiranmala; Mondal, Prakash Ranjan; Saraswathy, Kallur Nava

    2018-03-20

    The fat mass and obesity associated (FTO) rs9939609 gene polymorphism is most widely studied in terms of obesity in various populations. Recently, the prevalence of obesity has been reported to be very high among the North-Eastern State of India. The major aim of the present study is to understand the extent of FTO rs9939609 gene polymorphism and its association with obesity among the two North-East Indian tribal populations with similar East Asian ancestry. Somatometric data and fasting blood sample were collected from 521 tribal individuals (258 Liangmai and 263 Mizo) of Manipur after obtaining written informed consent. Genotyping of FTO rs9939609 single nucleotide polymorphism (SNP) was done using restriction fragment length polymorphism method for PCR-amplified fragments. Both the presently studied populations were not following Hardy-Weinberg law. The prevalence of obesity and minor allele frequency of FTO rs9939609 polymorphism was found to be significantly higher among the Mizo tribe compared to that of Liangmai. The selected polymorphism was found to be significantly associated with obesity (BMI) only among the Liangmai tribe (Odds ratio-3.0; 95% CI-1.4, 6.4; p-0.003), after adjusting for age and occupation. Age-cohort wise distribution and absolute fitness analysis indicated the lower fitness of minor allele in the higher age group among the Liangmai tribe. To the best of the author's knowledge this is the first study, associating FTO rs9939609 gene polymorphism and obesity in the North-eastern Indian tribal populations with East-Asian ancestry. This study revealed the FTO rs9939609 polymorphism is observed to be associated with obesity only among the Liangmai tribe not among the Mizo tribe. The differential distribution and association observed in the two selected tribes, inhabited in a similar geographical region, could be attributed to differences in their migratory histories in terms of both route and time of settlement. Copyright © 2018 Elsevier B

  17. The linear relationship between the Vulnerable Elders Survey-13 score and mortality in an Asian population of community-dwelling older persons.

    Science.gov (United States)

    Wang, Jye; Lin, Wender; Chang, Ling-Hui

    2018-01-01

    The Vulnerable Elders Survey-13 (VES-13) has been used as a screening tool to identify vulnerable community-dwelling older persons for more in-depth assessment and targeted interventions. Although many studies supported its use in different populations, few have addressed Asian populations. The optimal scaling system for the VES-13 in predicting health outcomes also has not been adequately tested. This study (1) assesses the applicability of the VES-13 to predict the mortality of community-dwelling older persons in Taiwan, (2) identifies the best scaling system for the VES-13 in predicting mortality using generalized additive models (GAMs), and (3) determines whether including covariates, such as socio-demographic factors and common geriatric syndromes, improves model fitting. This retrospective longitudinal cohort study analyzed the data of 2184 community-dwelling persons 65 years old or older from the 2003 wave of the national-wide Taiwan Longitudinal Study on Aging. Cox proportional hazards models and Generalized Additive Models (GAMs) were used. The VES-13 significantly predicted the mortality of Taiwan's community-dwelling elders. A one-point increase in the VES-13 score raised the risk of death by 26% (hazard ratio, 1.26; 95% confidence interval, 1.21-1.32). The hazard ratio of death increased linearly with each additional VES-13 score point, suggesting that using a continuous scale is appropriate. Inclusion of socio-demographic factors and geriatric syndromes improved the model-fitting. The VES-13 is appropriate for an Asian population. VES-13 scores linearly predict the mortality of this population. Adjusting the weighting of the physical activity items may improve the performance of the VES-13. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Coffee consumption is not associated with prevalent subclinical cardiovascular disease (CVD) or the risk of CVD events, in nonalcoholic fatty liver disease: results from the multi-ethnic study of atherosclerosis.

    Science.gov (United States)

    Simon, Tracey G; Trejo, Maria Esther Perez; Zeb, Irfan; Frazier-Wood, Alexis C; McClelland, Robyn L; Chung, Raymond T; Budoff, Matthew J

    2017-10-01

    Atherosclerosis and its clinical sequelae represent the leading cause of mortality among patients with nonalcoholic fatty liver disease (NAFLD). While epidemiologic data support the hepatoprotective benefits of coffee in NAFLD, whether coffee improves NAFLD-associated CVD risk is unknown. We examined 3710 ethnically-diverse participants from the Multi-Ethnic Study of Atherosclerosis (MESA) cohort, without history of known liver disease, and with available coffee data from a validated 120-item food frequency questionnaire. All participants underwent baseline non-contrast cardiac CT from which NAFLD was defined by liver:spleen ratio (L:S0. Major CVD events were defined by the first occurrence of myocardial infarction, cardiac arrest, angina, stroke, or CVD death. We used log-binomial regression to calculate the adjusted prevalence ratio (PR) for CAC>0 by coffee intake and NAFLD status, and events were compared between groups using frequency of events within adjusted Cox proportional hazard regression models. Seventeen percent (N=637) of participants met criteria for NAFLD. NAFLD participants were more likely to have elevated BMI (mean 31.1±5.5kg/m 2 vs. 28.0±5.2kg/m 2 , pcoffee consumption (p=0.97). Among NAFLD participants, coffee consumption was not associated with prevalent, baseline CAC>0 (PR=1.02 [0.98-1.07]). Over 12.8years of follow-up, 93 NAFLD and 415 non-NAFLD participants experienced a CV event. However, coffee intake was not associated with incident CVD events, in either NAFLD (HR=1.05 [0.91-1.21]) or non-NAFLD participants (HR=1.03 [0.97-1.11]). In a large, population-based cohort, coffee consumption was not associated with the prevalence of subclinical CVD, nor did coffee impact the future risk of major CVD events, regardless of underlying NAFLD status. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Association of DSM-5 Betel-Quid Use Disorder With Oral Potentially Malignant Disorder in 6 Betel-Quid Endemic Asian Populations.

    Science.gov (United States)

    Lee, Chien-Hung; Ko, Albert Min-Shan; Yang, Frances M; Hung, Chung-Chieh; Warnakulasuriya, Saman; Ibrahim, Salah Osman; Zain, Rosnah Binti; Ko, Ying-Chin

    2018-03-01

    Betel-quid (BQ) is the fourth most popular psychoactive agent worldwide. An emerging trend across Asia is the addictive consumption of BQ, which is associated with oral cancer and other health consequences. To investigate the validity and pattern of DSM-5-defined BQ use disorder (BUD) and its association with oral potentially malignant disorder (OPMD) among Asian populations. In-person interviews were conducted from January 1, 2009, to February 28, 2010, among a random sample of 8922 noninstitutionalized adults from the Asian Betel-quid Consortium study, an Asian representative survey of 6 BQ-endemic populations. Statistical analysis was performed from January 1, 2015, to December 31, 2016. Participants were evaluated for BUD using DSM-5 criteria for substance use disorder and for OPMD using a clinical oral examination. Current users of BQ with 0 to 1 symptoms were classified as having no BUD, those with 2 to 3 symptoms as having mild BUD, those with 4 to 5 symptoms as having moderate BUD, and those with 6 or more symptoms as having severe BUD. Among the 8922 participants (4564 women and 4358 men; mean [SD] age, 44.2 [0.2] years), DSM-5 symptoms showed sufficient unidimensionality to act as a valid measure for BUD. The 12-month prevalence of DSM-5-defined BUD in the 6 study populations was 18.0% (mild BUD, 3.2%; moderate BUD, 4.3%; and severe BUD, 10.5%). The 12-month proportion of DSM-5-defined BUD among current users of BQ was 86.0% (mild BUD, 15.5%; moderate BUD, 20.6%; and severe BUD, 50.0%). Sex, age, low educational level, smoking, and drinking were significantly associated with BUD. Among individuals who used BQ, family use, high frequency of use, and amount of BQ used were significantly linked to moderate to severe BUD. Compared with individuals who did not use BQ, those who used BQ and had no BUD showed a 22.0-fold (95% CI, 4.3-112.4) risk of OPMD (P < .001), whereas those with mild BUD showed a 9.6-fold (95% CI, 1.8-56.8) risk (P = .01), those

  20. USMLE performances in a predominantly Asian and Pacific Islander population of medical students in a problem-based learning curriculum.

    Science.gov (United States)

    Kasuya, Richard T; Naguwa, Gwen S; Guerrero, Anthony P S; Hishinuma, Earl S; Lindberg, Marlene A; Judd, Nanette K

    2003-05-01

    To compare the USMLE performances of students of various ethnicities, predominantly Pacific Islander and Asian, at one medical school and to examine the predictive validity of MCAT scores for USMLE performance. A total of 258 students in the graduating classes of 1996-2000 at the University of Hawai'i School of Medicine were classified by ethnicity. Demographic and performance characteristics of the groups were examined, and MCAT scores with and without undergraduate science GPA were used to predict USMLE performance. Under- and over-prediction rates were computed for each ethnic group. Ethnic groups did not differ significantly by gender or undergraduate GPA. Chinese, Caucasian, and Other Asian students tended to have higher MCAT scores than Hawaiian/other Pacific Islander, and Filipino students. Ethnic groups did not differ significantly in prediction of USMLE Step 1 performance. For Step 2, MCAT scores significantly over-predicted performance of Filipino students and tended to under-predict performance of Caucasian students. Although MCAT scores and science GPA were good predictors of USMLE performance, ethnic differences were found in the degrees of their predictive validity. These findings both replicate and extend results of earlier studies, and again point to the importance of exploring additional predictor variables. The authors encourage future research on the effects of the following factors on success in medical school: reading and test-taking skills, socio-cultural and environmental influences on learning, communication styles, primary language use, family support, and family responsibilities.

  1. Current Update in Asian Rhinoplasty

    Directory of Open Access Journals (Sweden)

    Clyde H. Ishii, MD, FACS

    2014-04-01

    Full Text Available Summary: There has been a tremendous growth of cosmetic surgery among Asians worldwide. Rhinoplasty is second only to blepharoplasty in terms of popularity among Asians regarding cosmetic surgical procedures. Most Asians seek to improve their appearance while maintaining the essential features of their ethnicity. There are considerable ethnic nasal and facial variations in this population alone. Successful rhinoplasty in Asians must take into account underlying anatomic differences between Asians and whites. Due to ethnic variations, cultural differences, and occasional language barriers, careful preoperative counseling is necessary to align the patient’s expectations with the limitations of the procedure. This article will review the many facets of Asian rhinoplasty as it is practiced today.

  2. Barriers to early initiation of antenatal care in a multi-ethnic sample in South Auckland, New Zealand.

    Science.gov (United States)

    Corbett, Sarah; Chelimo, Carol; Okesene-Gafa, Kara

    2014-10-17

    To identify barriers to early initiation of antenatal care amongst pregnant women in South Auckland, New Zealand. Women in late pregnancy (>37 weeks gestation) or who had recently delivered (18 weeks (late bookers). The ethnic composition of the sample was: 43% Pacific Peoples, 20% Maori, 14% Asian, and 21% European or other ethnicities. The multivariate analysis indicated that women were significantly more likely to book late for antenatal care if they had limited resources (OR=1.86; 95% CI=1.17-2.93), no tertiary education (OR=1.96; 95% CI=1.23-3.15), or were not living with a husband/partner (OR=2.34; 95% CI=1.48-3.71). In addition, the odds of late booking for antenatal care was almost six times higher among Maori (OR=5.70; 95% CI=2.57-12.64) and Pacific (OR=5.90; 95% CI=2.83-12.29) women compared to those of European and other ethnicities. Late booking for antenatal care in the Counties Manukau District Health Board area (South Auckland) is associated with sociodemographic factors, social deprivation, and inadequate social support.

  3. Clustering of cardiac risk factors associated with the metabolic syndrome and associations with psychosocial distress in a young Asian Indian population.

    Science.gov (United States)

    Suchday, Sonia; Bellehsen, Mayer; Friedberg, Jennifer P; Almeida, Maureen; Kaplan, Erica

    2014-08-01

    The metabolic syndrome is a precursor for coronary heart disease. However, its pathophysiology is not clear, its phenotypic expression may vary by region; also, the phenotypic manifestation may be exacerbated by psychosocial distress and family history. The purpose of the current study was to assess the factor structure of the metabolic syndrome in young urban Asian Indians. Asian Indian youth (N = 112) were evaluated for body mass index (BMI), waist-hip ratio, blood pressure (systolic: SBP; diastolic: DBP), blood sugar, triglycerides, cholesterol, insulin, psychosocial distress and family health history. Factor analyses were computed on components of the metabolic syndrome. Three factors were identified for the entire sample: hemodynamic-obesity (SBP, DBP, waist-hip ratio), Lipid (cholesterol, triglyceride), and insulin-obesity (blood sugar, BMI, insulin). Similar to previous research with this population, three distinct factors with no overlap were identified. Factors did not correlate with psychosocial distress or family history. Lack of correlation with family history and psychosocial distress may be a function of the young age and demographics of the sample.

  4. Single-photon emission computed tomography myocardial perfusion imaging-assessed stress perfusion defect severity is associated with mortality independent of ethnicity in an Asian population.

    Science.gov (United States)

    Chin, Chee Tang; Gao, Fei; Keng, Felix Y J; Shah, Bimal R; Koh, Angela S; Tan, Ru San; Chua, Terrance S J

    2014-12-01

    Ischemic heart disease is growing by epidemic proportions in Asia. Among patients in Western populations with similar myocardial perfusion imaging (MPI) ischemia severity, ethnicity is independently associated with mortality. We aimed to determine the differential prognostic value of MPI abnormality severity among three major Asian ethnic groups. From 16,921 consecutive patients, we used summed stress score to define increasing abnormal scan severity groups (minimal, mild, moderate, and severe) among Chinese, Indian, and Malay patients. We determined mortality from the national death registry. Using multivariable Cox regression models, we examined the association between ethnicity and mortality. Chinese patients were older than Indians or Malays. Annual all-cause death rates increased with increasing abnormal scan severity in all three ethnicities. After adjustment, ethnicity was not associated with mortality. With Chinese as the reference group, adjusted hazard ratio and 95% CI for Malays and Indians were 1.29 (0.95-1.77) and 1.06 (0.74-1.50) in the minimally abnormal scan group, and 1.20 (0.75-1.91) and 0.82 (0.47-1.45) in the severely abnormal scan group, respectively. Mortality risk is related to the severity of scan abnormality and is independent of ethnicity in Asians. Our findings emphasize the continued utility of MPI in guiding risk stratification in Asia.

  5. Time trends in upper gastrointestinal diseases and Helicobacter pylori infection in a multiracial Asian population--a 20-year experience over three time periods.

    Science.gov (United States)

    Leow, A H-R; Lim, Y-Y; Liew, W-C; Goh, K-L

    2016-04-01

    Marked epidemiological changes in upper gastrointestinal diseases and Helicobacter pylori infection have taken place in the Asian Pacific region. In particular, differences with respect to race in the multiracial Asian population in Malaysia have been important and interesting. A time trend study of upper gastrointestinal disease and H. pylori infection in three time periods: 1989-1990, 1999-2000 and 2009-2010 spanning a period of 20 years was carried out. Consecutive first time gastroscopies carried out on patients attending the University of Malaya Medical Center were studied. Diagnoses and H. pylori infection status were carefully recorded. A steady decline in prevalence of duodenal ulcer (DU) and gastric ulcer (GU) from 21.1% to 9.5% to 5.0% and from 11.9% to 9.4% to 9.9% while an increase in erosive oesophagitis (EO) from 2.0% to 8.4% to 9.5% (chi-square for trend; P Chinese and Indians but the difference over time was most marked in Malays. There was a steady decline in the proportion of patients with gastric and oesophageal cancers. Peptic ulcers have declined significantly over a 20-year period together with a decline in H. pylori infection. In contrast, a steady increase in erosive oesophagitis was observed. Gastric and oesophageal squamous cell cancers have declined to low levels. © 2016 John Wiley & Sons Ltd.

  6. Replication study for the association of 9 East Asian GWAS-derived loci with susceptibility to type 2 diabetes in a Japanese population.

    Directory of Open Access Journals (Sweden)

    Kensuke Sakai

    Full Text Available AIMS: East Asian genome-wide association studies (GWAS for type 2 diabetes identified 8 loci with genome-wide significance, and 2 loci with a borderline association. However, the associations of these loci except MAEA locus with type 2 diabetes have not been evaluated in independent East Asian cohorts. We performed a replication study to investigate the association of these susceptibility loci with type 2 diabetes in an independent Japanese population. METHODS: We genotyped 7,379 Japanese participants (5,315 type 2 diabetes and 2,064 controls for each of the 9 single nucleotide polymorphisms (SNPs, rs7041847 in GLIS3, rs6017317 in FITM2-R3HDML-HNF4A, rs6467136 near GCCI-PAX4, rs831571 near PSMD6, rs9470794 in ZFAND3, rs3786897 in PEPD, rs1535500 in KCNK16, rs16955379 in CMIP, and rs17797882 near WWOX. Because the sample size in this study was not sufficient to replicate single SNP associations, we constructed a genetic risk score (GRS by summing a number of risk alleles of the 9 SNPs, and examined the association of the GRS with type 2 diabetes using logistic regression analysis. RESULTS: With the exception of rs1535500 in KCNK16, all SNPs had the same direction of effect (odds ratio [OR]>1.0 as in the original reports. The GRS constructed from the 9 SNPs was significantly associated with type 2 diabetes in the Japanese population (p = 4.0 × 10(-4, OR = 1.05, 95% confidence interval: 1.02-1.09. In quantitative trait analyses, rs16955379 in CMIP was nominally associated with a decreased homeostasis model assessment of β-cell function and with increased fasting plasma glucose, but neither the individual SNPs nor the GRS showed a significant association with the glycemic traits. CONCLUSIONS: These results indicate that 9 loci that were identified in the East Asian GWAS meta-analysis have a significant effect on the susceptibility to type 2 diabetes in the Japanese population.

  7. Asian Americans and Education

    Science.gov (United States)

    Chang, Benjamin

    2017-01-01

    The communities that constitute the racialized category of Asian Americans consist of approximately 20 million people in the United States, or about 5% of the total population. About 20% or 4 million are of primary or secondary school age, and over 1.1 million are in higher education. Both in popular and academic discourse, "Asian…

  8. Improving tuberculosis case detection in underdeveloped multi-ethnic regions with high disease burden: a case study of integrated control program in China.

    Science.gov (United States)

    Li, Jun; Liu, Xiao-Qiu; Jiang, Shi-Wen; Li, Xue; Yu, Fei; Wang, Yan; Peng, Yong; Gu, Xiao-Ming; Sun, Yan-Ni; Zhang, Hui; Wang, Li-Xia

    2017-11-29

    In the underdeveloped multi-ethnic regions of China, high tuberculosis (TB) burden and regional inequity in access to healthcare service increase the challenge of achieving the End TB goals. Among all the provinces, the highest TB burden is reported in Xinjiang, where ethnic minorities and older people have suffered most. However, current case-finding strategy is inadequate given the complex social determinants and suboptimal case detection rates. Thus, we developed an integrated TB control program to improve case detection and conducted a pilot in Xinjiang from 2014 to 2015. In this case study, we summarized the activities and key findings. We also shared the experiences and challenges of implementing interventions and provided recommendations to inform the TB control program in the future. The pilot interventions were implemented in one selected town in Yining based on local TB control programs. By applying tailor-made educational materials, outreach TB educational activities were conducted in diverse ways. In 22 Masjids, the trained imams promoted TB education to the Muslims, covering 20,440 person-times in 88 delivered preaching sessions. In seven schools, 1944 students were educated by the teachers and contributed to educating 6929 family members. In the village communities, 13,073 residents participated in household education and screening. Among them, 12,292 people aged under 65 years were investigated for suspicious pulmonary TB symptoms, where six TB patients were diagnosed out of 89 TB suspects; 781 older people were mobilized for screening directly by chest X-ray, where 10 patients were diagnosed out of 692 participants. Supportive healthcare system, multi-sectoral cooperation and multi-channel financing mechanism were the successful experiences of implementation. The interventions were proved to be more effective than the previous performance: the number of TB suspects consulting doctors and patients detected increased by 50% and 26%, respectively

  9. A Unified Spatiotemporal Modeling Approach for Predicting Concentrations of Multiple Air Pollutants in the Multi-Ethnic Study of Atherosclerosis and Air Pollution

    Science.gov (United States)

    Olives, Casey; Kim, Sun-Young; Sheppard, Lianne; Sampson, Paul D.; Szpiro, Adam A.; Oron, Assaf P.; Lindström, Johan; Vedal, Sverre; Kaufman, Joel D.

    2014-01-01

    Background: Cohort studies of the relationship between air pollution exposure and chronic health effects require predictions of exposure over long periods of time. Objectives: We developed a unified modeling approach for predicting fine particulate matter, nitrogen dioxide, oxides of nitrogen, and black carbon (as measured by light absorption coefficient) in six U.S. metropolitan regions from 1999 through early 2012 as part of the Multi-Ethnic Study of Atherosclerosis and Air Pollution (MESA Air). Methods: We obtained monitoring data from regulatory networks and supplemented those data with study-specific measurements collected from MESA Air community locations and participants’ homes. In each region, we applied a spatiotemporal model that included a long-term spatial mean, time trends with spatially varying coefficients, and a spatiotemporal residual. The mean structure was derived from a large set of geographic covariates that was reduced using partial least-squares regression. We estimated time trends from observed time series and used spatial smoothing methods to borrow strength between observations. Results: Prediction accuracy was high for most models, with cross-validation R2 (R2CV) > 0.80 at regulatory and fixed sites for most regions and pollutants. At home sites, overall R2CV ranged from 0.45 to 0.92, and temporally adjusted R2CV ranged from 0.23 to 0.92. Conclusions: This novel spatiotemporal modeling approach provides accurate fine-scale predictions in multiple regions for four pollutants. We have generated participant-specific predictions for MESA Air to investigate health effects of long-term air pollution exposures. These successes highlight modeling advances that can be adopted more widely in modern cohort studies. Citation: Keller JP, Olives C, Kim SY, Sheppard L, Sampson PD, Szpiro AA, Oron AP, Lindström J, Vedal S, Kaufman JD. 2015. A unified spatiotemporal modeling approach for predicting concentrations of multiple air pollutants in the Multi-Ethnic

  10. Determinants of the over-anticoagulation response during warfarin initiation therapy in Asian patients based on population pharmacokinetic-pharmacodynamic analyses.

    Science.gov (United States)

    Ohara, Minami; Takahashi, Harumi; Lee, Ming Ta Michael; Wen, Ming-Shien; Lee, Tsong-Hai; Chuang, Hui-Ping; Luo, Chen-Hui; Arima, Aki; Onozuka, Akiko; Nagai, Rui; Shiomi, Mari; Mihara, Kiyoshi; Morita, Takashi; Chen, Yuan-Tsong

    2014-01-01

    To clarify pharmacokinetic-pharmacodynamic (PK-PD) factors associated with the over-anticoagulation response in Asians during warfarin induction therapy, population PK-PD analyses were conducted in an attempt to predict the time-courses of the plasma S-warfarin concentration, Cp(S), and coagulation and anti-coagulation (INR) responses. In 99 Chinese patients we analyzed the relationships between dose and Cp(S) to estimate the clearance of S-warfarin, CL(S), and that between Cp(S) and the normal prothrombin concentration (NPT) as a coagulation marker for estimation of IC50. We also analyzed the non-linear relationship between NPT inhibition and the increase in INR to derive the non-linear index λ. Population analyses accurately predicted the time-courses of Cp(S), NPT and INR. Multivariate analysis showed that CYP2C9*3 mutation and body surface area were predictors of CL(S), that VKORC1 and CYP4F2 polymorphisms were predictors of IC50, and that baseline NPT was a predictor of λ. CL(S) and λ were significantly lower in patients with INR≥4 than in those with INR<4 (190 mL/h vs 265 mL/h, P<0.01 and 3.2 vs 3.7, P<0.01, respectively). Finally, logistic regression analysis revealed that CL(S), ALT and hypertension contributed significantly to INR≥4. All these results indicate that factors associated with the reduced metabolic activity of warfarin represented by CL(S), might be critical determinants of the over-anticoagulation response during warfarin initiation in Asians. ClinicalTrials.gov NCT02065388.

  11. Determinants of the over-anticoagulation response during warfarin initiation therapy in Asian patients based on population pharmacokinetic-pharmacodynamic analyses.

    Directory of Open Access Journals (Sweden)

    Minami Ohara

    Full Text Available To clarify pharmacokinetic-pharmacodynamic (PK-PD factors associated with the over-anticoagulation response in Asians during warfarin induction therapy, population PK-PD analyses were conducted in an attempt to predict the time-courses of the plasma S-warfarin concentration, Cp(S, and coagulation and anti-coagulation (INR responses. In 99 Chinese patients we analyzed the relationships between dose and Cp(S to estimate the clearance of S-warfarin, CL(S, and that between Cp(S and the normal prothrombin concentration (NPT as a coagulation marker for estimation of IC50. We also analyzed the non-linear relationship between NPT inhibition and the increase in INR to derive the non-linear index λ. Population analyses accurately predicted the time-courses of Cp(S, NPT and INR. Multivariate analysis showed that CYP2C9*3 mutation and body surface area were predictors of CL(S, that VKORC1 and CYP4F2 polymorphisms were predictors of IC50, and that baseline NPT was a predictor of λ. CL(S and λ were significantly lower in patients with INR≥4 than in those with INR<4 (190 mL/h vs 265 mL/h, P<0.01 and 3.2 vs 3.7, P<0.01, respectively. Finally, logistic regression analysis revealed that CL(S, ALT and hypertension contributed significantly to INR≥4. All these results indicate that factors associated with the reduced metabolic activity of warfarin represented by CL(S, might be critical determinants of the over-anticoagulation response during warfarin initiation in Asians.ClinicalTrials.gov NCT02065388.

  12. Asian Ginseng

    Science.gov (United States)

    ... care provider before using Asian ginseng. Keep in Mind Tell all your health care providers about any ... Privacy and Policies Accessibility en Español FOIA Site Map Contact Us U.S. Department of Health & Human Services , ...

  13. Prevalence and Associations of Retinal Emboli With Ethnicity, Stroke, and Renal Disease in a Multiethnic Asian Population: The Singapore Epidemiology of Eye Disease Study.

    Science.gov (United States)

    Cheung, Ning; Teo, Kelvin; Zhao, Wanting; Wang, Jie Jin; Neelam, Kumari; Tan, Nicholas Y Q; Mitchell, Paul; Cheng, Ching-Yu; Wong, Tien Yin

    2017-10-01

    To our knowledge, population-based data on retinal emboli are limited in Asia. Besides its associations with traditional cardiovascular risk factors and stroke, associations between retinal emboli and renal disease and function remain unclear. To examine the prevalence of and risk factors for retinal emboli in a large, contemporary, multiethnic Asian population. This population-based cross-sectional study was conducted from 2004 to 2011 and included a total of 10 033 Chinese, Malay, and Indian persons aged 40 to 80 years residing in the general communities of Singapore. Analyses were performed from November 2016 to February 2017. Retinal emboli were ascertained from retinal photographs obtained from both eyes of all participants according to a standardized protocol. Age-standardized prevalence of retinal emboli was calculated using the 2010 Singapore adult population. Risk factors were assessed from comprehensive systemic and ophthalmic examinations, interviews, and laboratory investigations. Retinal emboli. Of the 10 033 participants, 9978 (99.5%) had gradable retinal photographs. Of these, 5057 (50.7%) were female, and 3375 (33.8%) were Indian. We identified 88 individuals (0.9%) with retinal emboli; the overall person-specific, age-standardized prevalence of retinal emboli was 0.75% (95% CI, 0.60-0.95), with the highest prevalence seen in the Indian cohort (0.98%), followed by the Chinese (0.73%) and Malay (0.44%) cohorts (P = .03). In multivariable-adjusted analysis, factors associated with prevalent retinal emboli included older age (per 5-year increase; odds ratio [OR], 1.22; 95% CI, 1.05-1.41), Indian ethnicity (compared with Malay ethnicity; OR, 3.58; 95% CI, 1.95-6.60), hypertension (OR, 1.95; 95% CI, 1.03-3.70), chronic kidney disease (OR, 2.05; 95% CI, 1.15-3.64), creatinine level (per SD increase; OR, 1.13; 95% CI, 1.05-1.21), glomerular filtration rate (per SD increase; OR, 0.67; 95% CI, 0.51-0.86), and history of stroke (OR, 3.45; 95% CI, 1

  14. Biomarkers of Dairy Fatty Acids and Risk of Cardiovascular Disease in the Multi-Ethnic Study of Atherosclerosis

    NARCIS (Netherlands)

    Oliveira Otto, de M.C.; Nettleton, J.A.; Lemaitre, R.N.; Steffen, L.M.; Kromhout, D.; Rich, R.L.; Tsai, M.Y.; Jacobs, D.R.; Mozaffarian, D.

    2013-01-01

    Background Evidence regarding the role of dairy fat intake in cardiovascular disease (CVD) has been mixed and inconclusive. Most earlier studies have used self-reported measures of dietary intake and focused on relatively racially homogeneous populations. Circulating biomarkers of dairy fat in a

  15. Asian population frequencies and haplotype distribution of killer cell immunoglobulin-like receptor (KIR) genes among Chinese, Malay, and Indian in Singapore.

    Science.gov (United States)

    Lee, Yi Chuan; Chan, Soh Ha; Ren, Ee Chee

    2008-11-01

    Killer cell immunoglobulin-like receptors (KIR) gene frequencies have been shown to be distinctly different between populations and contribute to functional variation in the immune response. We have investigated KIR gene frequencies in 370 individuals representing three Asian populations in Singapore and report here the distribution of 14 KIR genes (2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1) with two pseudogenes (2DP1, 3DP1) among Singapore Chinese (n = 210); Singapore Malay (n = 80), and Singapore Indian (n = 80). Four framework genes (KIR3DL3, 3DP1, 2DL4, 3DL2) and a nonframework pseudogene 2DP1 were detected in all samples while KIR2DS2, 2DL2, 2DL5, and 2DS5 had the greatest significant variation across the three populations. Fifteen significant linkage patterns, consistent with associations between genes of A and B haplotypes, were observed. Eighty-four distinct KIR profiles were determined in our populations, 38 of which had not been described in other populations. KIR haplotype studies were performed using nine Singapore Chinese families comprising 34 individuals. All genotypes could be resolved into corresponding pairs of existing haplotypes with eight distinct KIR genotypes and eight different haplotypes. The haplotype A2 with frequency of 63.9% was dominant in Singapore Chinese, comparable to that reported in Korean and Chinese Han. The A haplotypes predominate in Singapore Chinese, with ratio of A to B haplotypes of approximately 3:1. Comparison with KIR frequencies in other populations showed that Singapore Chinese shared similar distributions with Chinese Han, Japanese, and Korean; Singapore Indian was found to be comparable with North Indian Hindus while Singapore Malay resembled the Thai.

  16. mtDNA variation predicts population size in humans and reveals a major Southern Asian chapter in human prehistory.

    Science.gov (United States)

    Atkinson, Quentin D; Gray, Russell D; Drummond, Alexei J

    2008-02-01

    The relative timing and size of regional human population growth following our expansion from Africa remain unknown. Human mitochondrial DNA (mtDNA) diversity carries a legacy of our population history. Given a set of sequences, we can use coalescent theory to estimate past population size through time and draw inferences about human population history. However, recent work has challenged the validity of using mtDNA diversity to infer species population sizes. Here we use Bayesian coalescent inference methods, together with a global data set of 357 human mtDNA coding-region sequences, to infer human population sizes through time across 8 major geographic regions. Our estimates of relative population sizes show remarkable concordance with the contemporary regional distribution of humans across Africa, Eurasia, and the Americas, indicating that mtDNA diversity is a good predictor of population size in humans. Plots of population size through time show slow growth in sub-Saharan Africa beginning 143-193 kya, followed by a rapid expansion into Eurasia after the emergence of the first non-African mtDNA lineages 50-70 kya. Outside Africa, the earliest and fastest growth is inferred in Southern Asia approximately 52 kya, followed by a succession of growth phases in Northern and Central Asia (approximately 49 kya), Australia (approximately 48 kya), Europe (approximately 42 kya), the Middle East and North Africa (approximately 40 kya), New Guinea (approximately 39 kya), the Americas (approximately 18 kya), and a second expansion in Europe (approximately 10-15 kya). Comparisons of relative regional population sizes through time suggest that between approximately 45 and 20 kya most of humanity lived in Southern Asia. These findings not only support the use of mtDNA data for estimating human population size but also provide a unique picture of human prehistory and demonstrate the importance of Southern Asia to our recent evolutionary past.

  17. Does tranexamic acid increase the risk of thromboembolism after bilateral simultaneous total knee arthroplasties in Asian Population?

    Science.gov (United States)

    Kim, Young-Hoo; Park, Jang-Won; Kim, Jun-Shik; Seo, Dong-Hyuk

    2018-01-01

    To ascertain whether tranexamic acid reduces the blood loss and transfusion rate and volumes; increase the prevalence of deep vein thrombosis (DVT); and investigate factors associated with DVT in patients undergoing primary bilateral total knee arthroplasties (TKAs) without use of chemical thromboprophylaxis. There were 874 patients (1748 knees) in the control group who did not receive tranexamic acid and 871 patients (1742 knees) in the study group who received tranexamic acid. Mechanical compression device was applied without any chemical thromboprophylaxis. Transfusion rates and volumes were recorded. DVT was diagnosed using both sonogram and venogram at 7 or 8 day post-operatively. Intra- and post-operative blood loss and transfusion volumes were significantly lower in the tranexamic acid group. The prevalence of DVT was 14% (245 of 1748 knees) in the control group and 18% (314 of 1742 knees) in the tranexamic acid group. Pre- and post-operative perfusion lung scans revealed no evidence of PE in any patients in either group. Coagulation or thrombophilic data or molecular genetic testing was not significantly different between the two groups. The use of tranexamic acid reduces the volume of blood transfusion and does not increase the prevalence of DVT or PE in the patients who did not receive routine chemical thromboprophylaxis after primary bilateral simultaneous sequential TKAs in Asian patients.

  18. Parental feeding practices and socioeconomic status are associated with child adiposity in a multi-ethnic sample of children.

    Science.gov (United States)

    Cardel, Michelle; Willig, Amanda L; Dulin-Keita, Akilah; Casazza, Krista; Beasley, T Mark; Fernández, José R

    2012-02-01

    Parental feeding practices have been associated with children's weight status, but results have been inconsistent across populations. Research is needed to elucidate the relationship between parental feeding practices and adiposity in diverse populations. The present study tested if: (1) parental feeding practices differed by race/ethnicity, (2) parental pressure to eat and parental restriction were associated with adiposity levels, and (3) to investigate the relationship between parental feeding practices and/or child adiposity with socioeconomic status (SES). Structural equations modeling was conducted to test the model in 267 children aged 7-12 years self-identified as African American (AA), European American (EA), or Hispanic American (HA) from economically diverse backgrounds. Dual energy X-ray absorptiometry and computed tomography scanning were used to determine body composition and abdominal fat distribution, respectively. Parental restriction was a significant predictor of child adiposity while parental pressure to eat had an inverse relationship with child adiposity. HA parents reported significantly higher levels of restriction and pressure to eat, whereas EA parents reported the lowest. SES was positively associated with child adiposity and inversely related to parental restriction and pressure to eat. Thus, parental feeding practices differ across racial/ethnic groups and SES and may contribute to population differences in child adiposity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Unequal Exposure or Unequal Vulnerability? Contributions of Neighborhood Conditions and Cardiovascular Risk Factors to Socioeconomic Inequality in Incident Cardiovascular Disease in the Multi-Ethnic Study of Atherosclerosis.

    Science.gov (United States)

    Hussein, Mustafa; Diez Roux, Ana V; Mujahid, Mahasin S; Hastert, Theresa A; Kershaw, Kiarri N; Bertoni, Alain G; Baylin, Ana

    2017-11-23

    Risk factors can drive socioeconomic inequalities in cardiovascular disease (CVD) through differential exposure and differential vulnerability. We show how econometric decomposition directly enables simultaneous, policy-oriented assessment of these two mechanisms. We specifically estimated contributions via these mechanisms of neighborhood environment and proximal risk factors to socioeconomic inequality in CVD incidence. We followed 5,608 participants in the Multi-Ethnic Study of Atherosclerosis (2000-2012) until the first CVD event (median follow-up 12.2 years). We used a summary measure of baseline socioeconomic position (SEP). Covariates included baseline demographics, neighborhood, psychosocial, behavioral, and biomedical risk factors. Using Poisson models, we decomposed the difference (inequality) in incidence rates between low- and high-SEP groups into contributions of 1) differences in covariate means (differential exposure), and 2) differences in CVD risk associated with covariates (differential vulnerability). Notwithstanding large uncertainty in neighborhood estimates, our analysis suggests that differential exposure to poorer neighborhood socioeconomic conditions, adverse social environment, diabetes, and hypertension accounts for most of inequality. Psychosocial and behavioral contributions were negligible. Further, neighborhood SEP, female gender, and White race were more strongly associated with CVD among low-SEP (vs. high-SEP) participants. These differentials in vulnerability also accounted for nontrivial portions of the inequality, and could have important implications for intervention. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. The influence of persistent pathogens on circulating levels of inflammatory markers: a cross-sectional analysis from the Multi-Ethnic Study of Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Szklo Moyses

    2010-11-01

    Full Text Available Abstract Background Systemic inflammation is linked to cardiovascular risk, but the influence of persistent pathogens, which are conventionally dichotomously categorized, on circulating levels of inflammatory markers is not clear. Antibody levels of pathogens have not been examined in relation to inflammation. Methods Using data from a subsample of the Multi-Ethnic Study of Atherosclerosis, we examined circulating levels of interleukin-6 (IL-6, C-reactive protein (CRP and fibrinogen in relation to five common persistent pathogens: cytomegalovirus, herpes simplex virus-1, Hepatitis A virus, Helicobacter pylori and Chlamydia pneumoniae. We tested the hypothesis that the number of seropositive pathogens (based on conventional cut-off points would not be as sensitive a marker of inflammation as immune response measured by antibody levels to pathogens. Results High antibody response to multiple pathogens showed graded and significant associations with IL-6 (p Conclusions High antibody response to pathogens was a more consistent marker of inflammatory outcomes compared to seropositivity alone and high antibody response to multiple pathogens was a stronger marker compared to any single pathogen.