Analytical Study of Active Prosthetic Legs

Science.gov (United States)

Ono, Kyosuke; Katsumata, Mie

Walking with prosthesis has not been well analyzed mathematically and it seems that the design of powered prosthesis has been done empirically so far. This paper presents a dynamic simulation of a normal human walking and walking with an active prosthesis. We also studied the two controlling methods of a powered thigh prosthesis based on multi-body simulation of human walking. First we measured the normal human walking gait, then, we showed that a 3-DOF human walking model can walk on level ground by applying tracking control to the measured walking gait within a certain range of tuned walking period. Next, we applied the tracking control and self-excited control to the powered thigh prosthesis and compared the robustness and efficiency of the two control methods by numerical simulation. As a result, we found that the self-excited control can significantly decrease the hip joint torque and specific cost to 1/3 compared with the tracking control. Moreover, the self-excited control is superior to the tracking control because tuning for the walking period is not needed for the active prosthetic leg.

Sensor fusion and computer vision for context-aware control of a multi degree-of-freedom prosthesis

Science.gov (United States)

Markovic, Marko; Dosen, Strahinja; Popovic, Dejan; Graimann, Bernhard; Farina, Dario

2015-12-01

Objective. Myoelectric activity volitionally generated by the user is often used for controlling hand prostheses in order to replicate the synergistic actions of muscles in healthy humans during grasping. Muscle synergies in healthy humans are based on the integration of visual perception, heuristics and proprioception. Here, we demonstrate how sensor fusion that combines artificial vision and proprioceptive information with the high-level processing characteristics of biological systems can be effectively used in transradial prosthesis control. Approach. We developed a novel context- and user-aware prosthesis (CASP) controller integrating computer vision and inertial sensing with myoelectric activity in order to achieve semi-autonomous and reactive control of a prosthetic hand. The presented method semi-automatically provides simultaneous and proportional control of multiple degrees-of-freedom (DOFs), thus decreasing overall physical effort while retaining full user control. The system was compared against the major commercial state-of-the art myoelectric control system in ten able-bodied and one amputee subject. All subjects used transradial prosthesis with an active wrist to grasp objects typically associated with activities of daily living. Main results. The CASP significantly outperformed the myoelectric interface when controlling all of the prosthesis DOF. However, when tested with less complex prosthetic system (smaller number of DOF), the CASP was slower but resulted with reaching motions that contained less compensatory movements. Another important finding is that the CASP system required minimal user adaptation and training. Significance. The CASP constitutes a substantial improvement for the control of multi-DOF prostheses. The application of the CASP will have a significant impact when translated to real-life scenarious, particularly with respect to improving the usability and acceptance of highly complex systems (e.g., full prosthetic arms) by amputees.

HyPro: A Multi-DoF Hybrid-Powered Transradial Robotic Prosthesis

Directory of Open Access Journals (Sweden)

C. L. Semasinghe

2018-01-01

Full Text Available This paper proposes a multi-DoF hybrid-powered transradial robotic prosthesis, named HyPro. The HyPro consists of two prosthetic units: hand and wrist that can achieve five grasping patterns such as power grasp, tip grasp, lateral grasp, hook grasp, and index point. It is an underactuated device with 15 degrees of freedom. A hybrid powering concept is proposed and implemented on hand unit of HyPro where the key focus is on restoration of grasp functions of biological hand. A novel underactuated mechanism is introduced to achieve the required hand preshaping for a given grasping pattern using electric power in the pregrasp stage and body power is used in grasp stage to execute the final grasping action with the selected fingers. Unlike existing hybrid prostheses where each of the joints is separately controlled by either electric or body power, the proposed prosthesis is capable of delivering grasping power in combination. The wrist unit of HyPro is designed and developed to achieve flexion-extension and supination-pronation using electric power. Experiments were carried out to evaluate the functionality and performance of the proposed hybrid-powered robotic prosthesis. The results verified the potential of HyPro to perform intended grasping patterns effectively and efficiently.

Multi-Mode Vibration Suppression in MIMO Systems by Extending the Zero Placement Input Shaping Technique: Applications to a 3-DOF Piezoelectric Tube Actuator

Directory of Open Access Journals (Sweden)

Yasser Al Hamidi

2016-04-01

Full Text Available Piezoelectric tube actuators are extensively used in scanning probe microscopes to provide dynamic scanning motions in open-loop operations. Furthermore, they are employed as micropositioners due to their high bandwidth, high resolution and ease of excitation. However, these piezoelectric micropositioners exhibit badly damped vibrations that occur when the input excites the dynamic response, which tends to degrade positioning accuracy and performance. This paper deals with vibrations’ feedforward control of a multi-degrees of freedom (DOF piezoelectric micropositioner in order to damp the vibrations in the direct axes and to reduce the cross-couplings. The novelty in this paper relative to the existing vibrations feedforward controls is the simplicity in design approach, the minimal number of shaper impulses for each input required to damp all modes of vibration at each output, and the account for the strong cross-couplings which only occur in multi-DOF cases. A generalization to a multiple degrees of freedom actuator is first proposed. Then simulation runs on a 3-DOF piezoelectric tube micropositioner have been effectuated to demonstrate the efficiency of the proposed method. Finally, experimental tests were carried out to validate and to confirm the predicted simulation.

Biologically inspired multi-layered synthetic skin for tactile feedback in prosthetic limbs.

Science.gov (United States)

Osborn, Luke; Nguyen, Harrison; Betthauser, Joseph; Kaliki, Rahul; Thakor, Nitish

2016-08-01

The human body offers a template for many state-of-the-art prosthetic devices and sensors. In this work, we present a novel, sensorized synthetic skin that mimics the natural multi-layered nature of mechanoreceptors found in healthy glabrous skin to provide tactile information. The multi-layered sensor is made up of flexible piezoresistive textiles that act as force sensitive resistors (FSRs) to convey tactile information, which are embedded within a silicone rubber to resemble the compliant nature of human skin. The top layer of the synthetic skin is capable of detecting small loads less than 5 N whereas the bottom sensing layer responds reliably to loads over 7 N. Finite element analysis (FEA) of a simplified human fingertip and the synthetic skin was performed. Results suggest similarities in behavior during loading. A natural tactile event is simulated by loading the synthetic skin on a prosthetic limb. Results show the sensors' ability to detect applied loads as well as the ability to simulate neural spiking activity based on the derivative and temporal differences of the sensor response. During the tactile loading, the top sensing layer responded 0.24 s faster than the bottom sensing layer. A synthetic biologically-inspired skin such as this will be useful for enhancing the functionality of prosthetic limbs through tactile feedback.

Control of a perturbed under-actuated mechanical system

KAUST Repository

Zayane, Chadia; Laleg-Kirati, Taous-Meriem; Chemori, Ahmed

2015-01-01

In this work, the trajectory tracking problem for an under-actuated mechanical system in presence of unknown input disturbances is addressed. The studied inertia wheel inverted pendulum falls in the class of non minimum phase systems. The proposed

Stabilization and trajectory tracking control for underactuated

Indian Academy of Sciences (India)

The control of quadrotor helicopter has been a great challenge for control engineers and researchers since quadrotor is an underactuated and a highly unstable nonlinear system. In this paper, the dynamic model of quadrotor has been derived and a so-called robust optimal backstepping control (ROBC) is designed to ...

Three-dimensional trajectory tracking for underactuated AUVs with bio-inspired velocity regulation

Directory of Open Access Journals (Sweden)

Jiajia Zhou

2018-05-01

Full Text Available This paper attempts to address the motion parameter skip problem associated with three-dimensional trajectory tracking of an underactuated Autonomous Underwater Vehicle (AUV using backstepping-based control, due to the unsmoothness of tracking trajectory. Through kinematics concepts, a three-dimensional dynamic velocity regulation controller is derived. This controller makes use of the surge and angular velocity errors with bio-inspired models and backstepping techniques. It overcomes the frequently occurring problem of parameter skip at inflection point existing in backstepping tracking control method and increases system robustness. Moreover, the proposed method can effectively avoid the singularity problem in backstepping control of virtual velocity error. The control system is proved to be uniformly ultimately bounded using Lyapunov stability theory. Simulation results illustrate the effectiveness and efficiency of the developed controller, which can realize accurate three-dimensional trajectory tracking for an underactuated AUV with constant external disturbances. Keywords: Dynamic velocity regulation, Bio-inspired model, Backstepping, Underactuated AUV, Three-dimensional trajectory tracking

A multi-DOF robotic exoskeleton interface for hand motion assistance.

Science.gov (United States)

Iqbal, Jamshed; Tsagarakis, Nikos G; Caldwell, Darwin G

2011-01-01

This paper outlines the design and development of a robotic exoskeleton based rehabilitation system. A portable direct-driven optimized hand exoskeleton system has been proposed. The optimization procedure primarily based on matching the exoskeleton and finger workspaces guided the system design. The selection of actuators for the proposed system has emerged as a result of experiments with users of different hand sizes. Using commercial sensors, various hand parameters, e.g. maximum and average force levels have been measured. The results of these experiments have been mapped directly to the mechanical design of the system. An under-actuated optimum mechanism has been analysed followed by the design and realization of the first prototype. The system provides both position and force feedback sensory information which can improve the outcomes of a professional rehabilitation exercise.

Wake topology of under-actuated rajiform batoid robots

Science.gov (United States)

Valdivia Y Alvarado, Pablo; Weymouth, Gabriel; Thekoodan, Dilip; Patrikalakis, Nicholas

2011-11-01

Under-actuated continuous soft robots are designed to have modes of vibration that match desired body motions using minimal actuation. The desired modes of vibration are enabled by flexible continuous bodies with heterogenous material distributions. Errors or intentional approximations in the manufactured material distributions alter the achieved body motions and influence the resulting locomotion performance. An under-actuated continuous soft robot designed to mimic rajiform batoids such as stingrays is used to investigate the influence that fin kinematics variations have on wake topology, and the trade-offs that simplifying the body material structure has on achievable swimming performance. Pectoral fin kinematics in rajiform batoids are defined by traveling waves along the fin cord with particular amplitude envelopes along both the fin cord and span. Digital particle image velocimetry (DPIV) analysis of a prototype's wake structure and immersed-boundary numerical simulations are used to clarify the role of traveling wave wavelength, fin flapping frequency, and amplitude envelope characteristics on the resulting wake topology and swimming performance.

Comparative study of 2-DOF micromirrors for precision light manipulation

Science.gov (United States)

Young, Johanna I.; Shkel, Andrei M.

2001-08-01

Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

OpenAIRE

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

Robust Control of Underactuated Systems: Higher Order Integral Sliding Mode Approach

Directory of Open Access Journals (Sweden)

Sami ud Din

2016-01-01

Full Text Available This paper presents a robust control design for the class of underactuated uncertain nonlinear systems. Either the nonlinear model of the underactuated systems is transformed into an input output form and then an integral manifold is devised for the control design purpose or an integral manifold is defined directly for the concerned class. Having defined the integral manifolds discontinuous control laws are designed which are capable of maintaining sliding mode from the very beginning. The closed loop stability of these systems is presented in an impressive way. The effectiveness and demand of the designed control laws are verified via the simulation and experimental results of ball and beam system.

Dynamics of underactuated multibody systems modeling, control and optimal design

CERN Document Server

Seifried, Robert

2014-01-01

Underactuated multibody systems are intriguing mechatronic systems, as they possess fewer control inputs than degrees of freedom. Some examples are modern light-weight flexible robots and articulated manipulators with passive joints. This book investigates such underactuated multibody systems from an integrated perspective. This includes all major steps from the modeling of rigid and flexible multibody systems, through nonlinear control theory, to optimal system design. The underlying theories and techniques from these different fields are presented using a self-contained and unified approach and notation system. Subsequently, the book focuses on applications to large multibody systems with multiple degrees of freedom, which require a combination of symbolical and numerical procedures. Finally, an integrated, optimization-based design procedure is proposed, whereby both structural and control design are considered concurrently. Each chapter is supplemented by illustrated examples.

The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

KAUST Repository

Kim, Hyungsae

2010-10-05

Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

KAUST Repository

Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong

2010-01-01

Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

Quasivelocities and Optimal Control for underactuated Mechanical Systems

International Nuclear Information System (INIS)

Colombo, L.; Martin de Diego, D.

2010-01-01

This paper is concerned with the application of the theory of quasivelocities for optimal control for underactuated mechanical systems. Using this theory, we convert the original problem in a variational second-order lagrangian system subjected to constraints. The equations of motion are geometrically derived using an adaptation of the classical Skinner and Rusk formalism.

Port-based Modeling and Control of Underactuated Aerial Vehicles

NARCIS (Netherlands)

Mersha, A.Y.; Carloni, Raffaella; Stramigioli, Stefano

2011-01-01

In this paper, we propose a generic model and a controller design for a class of underactuated aerial vehicles, namely for unmanned aerial vehicles whose primary support against gravity is thrust. The approach followed is based on energetic consideration and uses the formalisms of port-Hamiltonian

Hydrodynamics of an Under-actuated Plesiosaur-inspired robot

Science.gov (United States)

Weymouth, Gabriel; Devereux, Kate; Copsey, Nick; Muscutt, Luke; Downes, Jon; Ganapathisubramani, Bharath

2017-11-01

Underwater vehicles are increasingly important tools for use in science and engineering, but maneuverability and mission life seem to be mutually exclusive goals. Inspired by the unique swimming method of the plesiosaur, which used four flippers of essentially equal size and musculature, we analyzed designed and built an underwater vehicle with the potential for both gliding and active maneuvering modes. Using 2D simulations and strip theory approximation to account for the changing arc length along the flipper span, we studied the wake and forces on the foils and determined the optimum flipper geometry, spacing and kinematics. To reduce mechanical and control complexity and cost, we next studied the impact of under-actuated kinematics. Even after optimizing pivot location and range of motion, leaving the foils free to pitch was found to reduce efficiency by approximately 50%. Based on these specifications, the vehicle was built and tested over a range of free swimming and maneuvering cases using motion tracking equipment. The excellent maneuverability of the under-actuated vehicle validates the concept, and the new platform should enable further detailed experimental measurements in the future.

Investigation for Synchronization of a Rotor-Pendulum System considering the Multi-DOF Vibration

Directory of Open Access Journals (Sweden)

Yongjun Hou

2016-01-01

Full Text Available This work is a continuation for our published literature for vibration synchronization. A new mechanism, two rotors coupled with a pendulum rod in a multi-DOF vibration system, is proposed to implement coupling synchronization, and the dynamics equation of mechanism is derived by Lagrange equation. In addition, the coupling relationship between the vibrobody and the pendulum rod is ascertained with the Laplace transformation method, based on the dimensionless equation of the dynamics system. The Poincare method is employed to study the synchronization state between the two unbalanced rotors, which is converted into that of existence and the stability of solutions for synchronization-balance equations. The obtained results are supported by computer simulations. It is demonstrated that the values of the spring stiffness coefficient, the length of the pendulum, and the angular installation of the pendulum are important parameters with respect to the synchronous behavior in the rotor-pendulum system.

Current-Sensitive Path Planning for an Underactuated Free-Floating Ocean Sensorweb

Science.gov (United States)

Dahl, Kristen P.; Thompson, David R.; McLaren, David; Chao, Yi; Chien, Steve

2011-01-01

This work investigates multi-agent path planning in strong, dynamic currents using thousands of highly under-actuated vehicles. We address the specific task of path planning for a global network of ocean-observing floats. These submersibles are typified by the Argo global network consisting of over 3000 sensor platforms. They can control their buoyancy to float at depth for data collection or rise to the surface for satellite communications. Currently, floats drift at a constant depth regardless of the local currents. However, accurate current forecasts have become available which present the possibility of intentionally controlling floats' motion by dynamically commanding them to linger at different depths. This project explores the use of these current predictions to direct float networks to some desired final formation or position. It presents multiple algorithms for such path optimization and demonstrates their advantage over the standard approach of constant-depth drifting.

Kontrola kvalitete DOF 2

OpenAIRE

Kozić, Ružica; Meštrić, Lucija

2013-01-01

Projekt studentske radionice bio je kontrola DOF-a u mjerilu 1:2000 na području općine Đurđevac. Proveden je terenski dio kontrole točnosti DMR-a, DOF-a, izvedene signalizacije te načina signalizacije. Mjerenja su obavljena 19.travnja 2013. godine. Obavljena je ponovna izmjera GPS točaka homogenog polja Đurđevac RTK metodom u sustavu CROPOS s ciljem kontrole tih točaka, čije su koordinate već određene u sklopu izrade DOF2. Uz trajno stabilizirane točke homogenog polja, RTK metodom snimane su ...

A fully rotational joint underactuated finger mechanism and its kinematics analysis

Directory of Open Access Journals (Sweden)

Wu Licheng

2016-09-01

Full Text Available The characteristic features of underactuated finger are compact structure, large grasping force, and simple operation. It has a wide application prospect in the fields of industrial robot, humanoid robot, human artificial limb, and space robot. A new type of fully rotating joint linkage-based underactuated mechanism is proposed, and a new method based on the law of minimum resistance is presented to realize the equivalent mechanism at different contact conditions of the finger and the kinematical analysis based on the equivalent mechanism. The kinematic equations and the limit moving position of the mechanism are derived using the proposed method. Finally, the numerical simulation is carried out by MATLAB program. The correctness and effectiveness of the proposed method are verified. The simulation results show that the proposed mechanism has a large grasp space and can achieve good grasp trajectory.

Kinematics analysis and simulation of a new underactuated parallel robot

Directory of Open Access Journals (Sweden)

Wenxu YAN

2017-04-01

Full Text Available The number of degrees of freedom is equal to the number of the traditional robot driving motors, which causes defects such as low efficiency. To overcome that problem, based on the traditional parallel robot, a new underactuated parallel robot is presented. The structure characteristics and working principles of the underactuated parallel robot are analyzed. The forward and inverse solutions are derived by way of space analytic geometry and vector algebra. The kinematics model is established, and MATLAB is implied to verify the accuracy of forward and inverse solutions and identify the optimal work space. The simulation results show that the robot can realize the function of robot switch with three or four degrees of freedom when the number of driving motors is three, improving the efficiency of robot grasping, with the characteristics of large working space, high speed operation, high positioning accuracy, low manufacturing cost and so on, and it will have a wide range of industrial applications.

Online payload estimation for the control of underactuated mechanical systems

International Nuclear Information System (INIS)

Lu, Yu Sheng; Chiu, Hua Hsu

2014-01-01

This paper presents a payload estimation scheme for underactuated robotic manipulators with passive joints that are not driven by actuators. In the proposed scheme, only the payload, which can be quite uncertain when a robot performs various tasks, is estimated, because the manipulator's electrical and other mechanical parameters are generally known in advance. In comparison to other adaptive schemes for underactuated robotic manipulators, the proposed scheme produces satisfactory transient performance and also reduces the computational burden in real-time implementation. The proposed estimation law is also based on the theory of Variable Structure Systems. In contrast to existing adaptation laws that have an integral form, the proposed law estimates uncertain payload using lowpass filtering of a switching signal that is always bounded, which avoids the parameter-drifting problem that is often encountered when using the previous integral laws. Real-time experiments are conducted using an inverted pendulum and the experimental results demonstrate the feasibility and effectiveness of the proposed scheme.

An under-actuated origami gripper with adjustable stiffness joints for multiple grasp modes

Science.gov (United States)

Firouzeh, Amir; Paik, Jamie

2017-05-01

Under-actuated robots offer multiple degrees of freedom without much added complexity to the actuation and control. Utilizing adjustable stiffness joints in these robots allows us to control their stable configurations and their mode of interaction with the environment. In this paper, we present the design of tendon-driven robotic origami (robogami) joints with adjustable stiffness. The proposed designs allow us to place joints along any direction in the plane of the robot and in the normal direction to the plane. The layer-by-layer manufacturing of robogamis facilitates the design and manufacturing of robots with different arrangement of joints for different applications. We use thermally activated shape memory polymer to control the joint stiffness. The manufacturing of the polymer layer is compatible with the layer-by-layer manufacturing process of the robogamis which results in scalable and customizable robots. To demonstrate, we prototyped an under-actuated gripper with three fingers and only one input actuation. The grasp mode of the gripper is set by adjusting the configuration of the locked joints and modulating the stiffness of the active joints. We present a model to estimate the configuration and the contact forces of the gripper at different settings that will assist us in design and control of future generation of under-actuated robogamis.

Bilateral teleoperation of underactuated unmanned aerial vehicles: The virtual slave concept

NARCIS (Netherlands)

Mersha, A.Y.; Stramigioli, Stefano; Carloni, Raffaella

In this paper, we present haptic teleoperation of underactuated unmanned aerial vehicles by providing a multidimensional generalization of the virtual slave concept. The proposed control architecture is composed of high-level and low-level controllers. The high-level controller commands the vehicle

Stabilization of an Underactuated Surface Vessel Based on Adaptive Sliding Mode and Backstepping Control

Directory of Open Access Journals (Sweden)

Fuguang Ding

2013-01-01

Full Text Available The paper studied controlling problem of an underactuated surface vessel with unknown interferences. It proved that the control problem of underactuated surface vessel can be transformed into the stabilization analysis of two small subsystems. This controller was designed by backstepping method and adaptive sliding mode, was suitable for solving the problem of the control of higher systems, can keep the system global asymptotic stability, and can inhibit unknown interference, and boundary layer can weaken the buffeting generated by sliding mode. The unknown interference was estimated by adaptive function. Finally, the simulation results are given to demonstrate the effectiveness of the proposed control laws.

Robust Control and Motion Planning for Nonlinear Underactuated Systems Using H infinity Techniques

National Research Council Canada - National Science Library

Toussaint, Gregory

2000-01-01

This thesis presents new techniques for planning and robustly controlling the motion of nonlinear underactuated vehicles when disturbances are present and only imperfect state measurements are available for feedback...

Stair Climbing Control for 4-DOF Tracked Vehicle Based on Internal Sensors

Directory of Open Access Journals (Sweden)

Daisuke Endo

2017-01-01

Full Text Available In search-and-rescue missions, multi-degrees-of-freedom (DOF tracked robots that are equipped with subtracks are commonly used. These types of robots have superior locomotion performance on rough terrain. However, in teleoperated missions, the performance of tracked robots depends largely on the operators’ ability to control every subtrack appropriately. Therefore, an autonomous traversal function can significantly help in the teleoperation of such robots. In this paper, we propose a planning and control method for 4-DOF tracked robots climbing up/down known stairs automatically based on internal sensors. Experimental results obtained using mockup stairs verify the effectiveness of the proposed method.

Control of underactuated driftless systems using higher-order averaging theory

OpenAIRE

Vela, Patricio A.; Burdick, Joel W.

2003-01-01

This paper applies a recently developed "generalized averaging theory" to construct stabilizing feedback control laws for underactuated driftless systems. These controls exponentialy stabilize in the average; the actual system may orbit around the average. Conditions for which the orbit collapses to the averaged trajectory are given. An example validates the theory, demonstrating its utility.

Control of a perturbed under-actuated mechanical system

KAUST Repository

Zayane, Chadia

2015-11-05

In this work, the trajectory tracking problem for an under-actuated mechanical system in presence of unknown input disturbances is addressed. The studied inertia wheel inverted pendulum falls in the class of non minimum phase systems. The proposed high order sliding mode control architecture including a controller and differentiator allows to track accurately the predefined trajectory and to stabilize the internal dynamics. The robustness of the proposed approach is illustrated through different perturbation and output noise configurations.

Assessment of Myoelectric Controller Performance and Kinematic Behavior of a Novel Soft Synergy-Inspired Robotic Hand for Prosthetic Applications.

Science.gov (United States)

Fani, Simone; Bianchi, Matteo; Jain, Sonal; Pimenta Neto, José Simões; Boege, Scott; Grioli, Giorgio; Bicchi, Antonio; Santello, Marco

2016-01-01

Myoelectric artificial limbs can significantly advance the state of the art in prosthetics, since they can be used to control mechatronic devices through muscular activity in a way that mimics how the subjects used to activate their muscles before limb loss. However, surveys indicate that dissatisfaction with the functionality of terminal devices underlies the widespread abandonment of prostheses. We believe that one key factor to improve acceptability of prosthetic devices is to attain human likeness of prosthesis movements, a goal which is being pursued by research on social and human-robot interactions. Therefore, to reduce early abandonment of terminal devices, we propose that controllers should be designed so as to ensure effective task accomplishment in a natural fashion. In this work, we have analyzed and compared the performance of three types of myoelectric controller algorithms based on surface electromyography to control an underactuated and multi-degrees of freedom prosthetic hand, the SoftHand Pro. The goal of the present study was to identify the myoelectric algorithm that best mimics the native hand movements. As a preliminary step, we first quantified the repeatability of the SoftHand Pro finger movements and identified the electromyographic recording sites for able-bodied individuals with the highest signal-to-noise ratio from two pairs of muscles, i.e., flexor digitorum superficialis/extensor digitorum communis, and flexor carpi radialis/extensor carpi ulnaris. Able-bodied volunteers were then asked to execute reach-to-grasp movements, while electromyography signals were recorded from flexor digitorum superficialis/extensor digitorum communis as this was identified as the muscle pair characterized by high signal-to-noise ratio and intuitive control. Subsequently, we tested three myoelectric controllers that mapped electromyography signals to position of the SoftHand Pro. We found that a differential electromyography-to-position mapping ensured the

Assessment of Myoelectric Controller Performance and Kinematic Behavior of a Novel Soft Synergy-inspired Robotic Hand for Prosthetic Applications

Directory of Open Access Journals (Sweden)

Simone Fani

2016-10-01

Full Text Available Myoelectric-artificial limbs can significantly advance the state of the art in prosthetics, since they can be used to control mechatronic devices through muscular activity in a way that mimics how the subjects used to activate their muscles before limb loss. However, surveys indicate that dissatisfaction with the functionality of terminal devices underlies the widespread abandonment of prostheses. We believe that one key factor to improve acceptability of prosthetic devices is to attain human-likeness of prosthesis movements, a goal which is being pursued by research on social and human-robot interactions. Therefore, to reduce early abandonment of terminal devices, we propose that controllers should be designed such as to ensure effective task accomplishment in a natural fashion. In this work, we have analyzed and compared the performance of three types of myoelectric controller algorithms based on surface electromyography to control an under-actuated and multi-degrees of freedom prosthetic hand, the SoftHand Pro. The goal of the present study was to identify the myoelectric algorithm that best mimics the native hand movements. As a preliminary step, we first quantified the repeatability of the SoftHand Pro finger movements and identified the electromyographic recording sites for able-bodied individuals with the highest signal-to-noise ratio from two pairs of muscles, i.e. flexor digitorum superficialis/extensor digitorum communis, and flexor carpi radialis/extensor carpi ulnaris. Able-bodied volunteers were then asked to execute reach-to-grasp movements, while electromyography signals were recorded from flexor digitorum superficialis/extensor digitorum communis as this was identified as the muscle pair characterized by high signal-to-noise ratio and intuitive control. Subsequently, we tested three myoelectric controllers that mapped electromyography signals to position of the SoftHand Pro. We found that a differential electromyography

The family of DOF transcription factors in Brachypodium distachyon: phylogenetic comparison with rice and barley DOFs and expression profiling

Directory of Open Access Journals (Sweden)

Hernando-Amado Sara

2012-11-01

Full Text Available Abstract Background Transcription factors (TFs are proteins that have played a central role both in evolution and in domestication, and are major regulators of development in living organisms. Plant genome sequences reveal that approximately 7% of all genes encode putative TFs. The DOF (DNA binding with One Finger TF family has been associated with vital processes exclusive to higher plants and to their close ancestors (algae, mosses and ferns. These are seed maturation and germination, light-mediated regulation, phytohormone and plant responses to biotic and abiotic stresses, etc. In Hordeum vulgare and Oryza sativa, 26 and 30 different Dof genes, respectively, have been annotated. Brachypodium distachyon has been the first Pooideae grass to be sequenced and, due to its genomic, morphological and physiological characteristics, has emerged as the model system for temperate cereals, such as wheat and barley. Results Through searches in the B. distachyon genome, 27 Dof genes have been identified and a phylogenetic comparison with the Oryza sativa and the Hordeum vulgare DOFs has been performed. To explore the evolutionary relationship among these DOF proteins, a combined phylogenetic tree has been constructed with the Brachypodium DOFs and those from rice and barley. This phylogenetic analysis has classified the DOF proteins into four Major Cluster of Orthologous Groups (MCOGs. Using RT-qPCR analysis the expression profiles of the annotated BdDof genes across four organs (leaves, roots, spikes and seeds has been investigated. These results have led to a classification of the BdDof genes into two groups, according to their expression levels. The genes highly or preferentially expressed in seeds have been subjected to a more detailed expression analysis (maturation, dry stage and germination. Conclusions Comparison of the expression profiles of the Brachypodium Dof genes with the published functions of closely related DOF sequences from the cereal

Correctness of multi-detector-row computed tomography for diagnosing mechanical prosthetic heart valve disorders using operative findings as a gold standard

Energy Technology Data Exchange (ETDEWEB)

Tsai, I.Chen [Taichung Veterans General Hospital, Department of Radiology, Taichung (China); Institute of Clinical Medicine and Faculty of Medicine, National Yang-Ming University, Taipei (China); Lin, Yung-Kai; Chang, Yen; Wang, Chung-Chi; Hsieh, Shih-Rong; Wei, Hao-Ji; Tsai, Hung-Wen [Taichung Veterans General Hospital, Section of Cardiovascular Surgery, Cardiovascular Center, Taichung (China); Fu, Yun-Ching; Jan, Sheng-Ling [Institute of Clinical Medicine and Faculty of Medicine, National Yang-Ming University, Taipei (China); Taichung Veterans General Hospital, Section of Pediatric Cardiology, Department of Pediatrics, Taichung (China); Wang, Kuo-Yang [Taichung Veterans General Hospital, Section of General Cardiology, Cardiovascular Center, Taichung (China); Chung-Shan Medical University, Department of Medicine, Taichung (China); Chen, Min-Chi; Chen, Clayton Chi-Chang [Taichung Veterans General Hospital, Department of Radiology, Taichung (China); Central Taiwan University of Science and Technology, Department of Radiological Technology, Taichung (China)

2009-04-15

The purpose was to compare the findings of multi-detector computed tomography (MDCT) in prosthetic valve disorders using the operative findings as a gold standard. In a 3-year period, we prospectively enrolled 25 patients with 31 prosthetic heart valves. MDCT and transthoracic echocardiography (TTE) were done to evaluate pannus formation, prosthetic valve dysfunction, suture loosening (paravalvular leak) and pseudoaneurysm formation. Patients indicated for surgery received an operation within 1 week. The MDCT findings were compared with the operative findings. One patient with a Bjoerk-Shiley valve could not be evaluated by MDCT due to a severe beam-hardening artifact; thus, the exclusion rate for MDCT was 3.2% (1/31). Prosthetic valve disorders were suspected in 12 patients by either MDCT or TTE. Six patients received an operation that included three redo aortic valve replacements, two redo mitral replacements and one Amplatzer ductal occluder occlusion of a mitral paravalvular leak. The concordance of MDCT for diagnosing and localizing prosthetic valve disorders and the surgical findings was 100%. Except for images impaired by severe beam-hardening artifacts, MDCT provides excellent delineation of prosthetic valve disorders. (orig.)

Control Algorithms Along Relative Equilibria of Underactuated Lagrangian Systems on Lie Groups

DEFF Research Database (Denmark)

Nordkvist, Nikolaj; Bullo, F.

2008-01-01

We present novel algorithms to control underactuated mechanical systems. For a class of invariant systems on Lie groups, we design iterative small-amplitude control forces to accelerate along, decelerate along, and stabilize relative equilibria. The technical approach is based upon a perturbation...

Control algorithms along relative equilibria of underactuated Lagrangian systems on Lie groups

DEFF Research Database (Denmark)

Nordkvist, Nikolaj; Bullo, Francesco

2007-01-01

We present novel algorithms to control underactuated mechanical systems. For a class of invariant systems on Lie groups, we design iterative small-amplitude control forces to accelerate along, decelerate along, and stabilize relative equilibria. The technical approach is based upon a perturbation...

Grasp planning for a reconfigurable parallel robot with an underactuated arm structure

Directory of Open Access Journals (Sweden)

M. Riedel

2010-12-01

Full Text Available In this paper, a novel approach of grasp planning is applied to find out the appropriate grasp points for a reconfigurable parallel robot called PARAGRIP (Parallel Gripping. This new handling system is able to manipulate objects in the six-dimensional Cartesian space by several robotic arms using only six actuated joints. After grasping, the contact elements at the end of the underactuated arm mechanisms are connected to the object which forms a closed loop mechanism similar to the architecture of parallel manipulators. As the mounting and grasp points of the arms can easily be changed, the manipulator can be reconfigured to match the user's preferences and needs. This paper raises the question, how and where these grasp points are to be placed on the object to perform well for a certain manipulation task.

This paper was presented at the IFToMM/ASME International Workshop on Underactuated Grasping (UG2010, 19 August 2010, Montréal, Canada.

Inverse dynamics of underactuated mechanical systems: A simple case study and experimental verification

Science.gov (United States)

Blajer, W.; Dziewiecki, K.; Kołodziejczyk, K.; Mazur, Z.

2011-05-01

Underactuated systems are featured by fewer control inputs than the degrees-of-freedom, m strategy that forces such a system to complete a set of m specified motion tasks is a challenging task, and the explicit solution existence is conditioned to differential flatness of the problem. The flatness-based solution denotes that all the 2 n states and m control inputs can be algebraically expressed in terms of the m specified outputs and their time derivatives up to a certain order, which is in practice attainable only for simple systems. In this contribution the problem is posed in a more practical way as a set of index-three differential-algebraic equations, and the solution is obtained numerically. The formulation is then illustrated by a two-degree-of-freedom underactuated system composed of two rotating discs connected by a torsional spring, in which the pre-specified motion of one of the discs is actuated by the torque applied to the other disc, n = 2 and m = 1. Experimental verification of the inverse simulation control methodology is reported.

Multi-Axis Prosthetic Knee Resembles Alpine Skiing Movements of an Intact Leg

Science.gov (United States)

Demšar, Ivan; Duhovnik, Jože; Lešnik, Blaž; Supej, Matej

2015-01-01

The purpose of the study was to analyse the flexion angles of the ski boot, ankle and knee joints of an above-knee prosthesis and to compare them with an intact leg and a control group of skiers. One subject with an above-knee amputation of the right leg and eight healthy subjects simulated the movement of a skiing turn by performing two-leg squats in laboratory conditions. By adding additional loads in proportion to body weight (BW; +1/3 BW, +2/3 BW, +3/3 BW), various skiing regimes were simulated. Change of Flexion Angle (CoFA) and Range of Motion (RoM) in the ski boot, ankle and knee joints were calculated and compared. An average RoM in the skiing boot on the side of prosthesis (4.4 ± 1.1°) was significantly lower compared to an intact leg (5.9 ± 1.8°) and the control group (6.5 ± 2.3°). In the ankle joint, the average RoM was determined to be 13.2±2.9° in the prosthesis, 12.7 ± 2.8° in an intact leg and 14.8±3.6 in the control group. However, the RoM of the knee joint in the prosthesis (42.2 ± 4.2°) was significantly larger than that of the intact leg (34.7 ± 4.4°). The average RoM of the knee joint in the control group was 47.8 ± 5.4°. The influences of additional loads on the kinematics of the lower extremities were different on the side of the prosthesis and on the intact leg. In contrast, additional loads did not produce any significant differences in the control group. Although different CoFAs in the ski boot, ankle and knee joints were used, an above-knee prosthesis with a built-in multi-axis prosthetic knee enables comparable leg kinematics in simulated alpine skiing. Key points The RoM in the ski boot on the side of the prosthetic leg was smaller than the RoM of the intact leg and the control group of healthy subjects. The RoM in the ankle joint of prosthetic leg was comparable to that of the intact leg and the control group of healthy subjects. The RoM in the prosthetic knee joint was greater than the RoM in the knee joint of the

Global Practical Stabilization and Tracking for an Underactuated Ship - A Combined Averaging and Backstepping Approach

Directory of Open Access Journals (Sweden)

Kristin Y. Pettersen

1999-10-01

Full Text Available We solve both the global practical stabilization and tracking problem for an underactuated ship, using a combined integrator backstepping and averaging approach. Exponential convergence to an arbitrarily small neighbourhood of the origin and of the reference trajectory, respectively, is proved. Simulation results are included.

Hybrid Taguchi DNA Swarm Intelligence for Optimal Inverse Kinematics Redundancy Resolution of Six-DOF Humanoid Robot Arms

Directory of Open Access Journals (Sweden)

Hsu-Chih Huang

2014-01-01

Full Text Available This paper presents a hybrid Taguchi deoxyribonucleic acid (DNA swarm intelligence for solving the inverse kinematics redundancy problem of six degree-of-freedom (DOF humanoid robot arms. The inverse kinematics problem of the multi-DOF humanoid robot arm is redundant and has no general closed-form solutions or analytical solutions. The optimal joint configurations are obtained by minimizing the predefined performance index in DNA algorithm for real-world humanoid robotics application. The Taguchi method is employed to determine the DNA parameters to search for the joint solutions of the six-DOF robot arms more efficiently. This approach circumvents the disadvantage of time-consuming tuning procedure in conventional DNA computing. Simulation results are conducted to illustrate the effectiveness and merit of the proposed methods. This Taguchi-based DNA (TDNA solver outperforms the conventional solvers, such as geometric solver, Jacobian-based solver, genetic algorithm (GA solver and ant, colony optimization (ACO solver.

Radiometric compensation for cooperative distributed multi-projection system through 2-DOF distributed control.

Science.gov (United States)

Tsukamoto, Jun; Iwai, Daisuke; Kashima, Kenji

2015-11-01

This paper proposes a novel radiometric compensation technique for cooperative projection system based-on distributed optimization. To achieve high scalability and robustness, we assume cooperative projection environments such that 1. each projector does not have information about other projectors as well as target images, 2. the camera does not have information about the projectors either, while having the target images, and 3. only a broadcast communication from the camera to the projectors is allowed to suppress the data transfer bandwidth. To this end, we first investigate a distributed optimization based feedback mechanism that is suitable for the required decentralized information processing environment. Next, we show that this mechanism works well for still image projection, however not necessary for moving images due to the lack of dynamic responsiveness. To overcome this issue, we propose to implement an additional feedforward mechanism. Such a 2 Degree Of Freedom (2-DOF) control structure is well-known in control engineering community as a typical method to enhance not only disturbance rejection but also reference tracking capability, simultaneously. We theoretically guarantee and experimentally demonstrate that this 2-DOF structure yields the moving image projection accuracy that is overwhelming the best achievable performance only by the distributed optimization mechanisms.

Real-time simultaneous and proportional myoelectric control using intramuscular EMG

Science.gov (United States)

Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

2014-12-01

Objective. Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach. We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main results. Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts’ Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts’ Law tasks with high levels of path efficiency. Significance. These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control.

Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

Science.gov (United States)

Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

2017-01-01

Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

Science.gov (United States)

Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

2014-08-10

In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In

A novel integrated 4-DOF radial hybrid magnetic bearing for MSCMG

Energy Technology Data Exchange (ETDEWEB)

Jinji, Sun; Ziyan, Ju [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China); Weitao, Han, E-mail: hanweitaotao@163.com [CRRC Qingdao Sifang CO., LTD, Qingdao 266111 (China); Gang, Liu [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China)

2017-01-01

This paper proposes a novel integrated radial hybrid magnetic bearing (RHMB) for application with the small-sized magnetically suspended control moment gyroscope (MSCMG), which can control four degrees of freedom (4-DOFs), including two radial translational DOFs and two radial tilting DOFs, and provide the axial passive resilience. The configuration and working principle of the RHMB are introduced. Mathematical models of radial force, axial resilience and moment are established by using equivalent magnetic circuit method (EMCM), from which the radial force–radial displacement, radial force–current relationships are derived, as well as axial resilience–axial displacement, moment–tilting angle and moment–current. Finite element method (FEM) is also applied to analyze the performance and characteristics of the RHMB. The analysis results are in good agreement with that calculated by the EMCM, which is helpful in designing, optimizing and controlling the RHMB. The comparisons between the performances of the integrated 4-DOF RHMB and the traditional 4-DOF RHMB are made. The contrast results indicate that the proposed integrated 4-DOF RHMB possesses better performance compared to the traditional structure, such as copper loss, current stiffness, and tilting current stiffness. - Highlights: • An integrated 4-DOF RHMB is proposed for the small-sized MSCMG. • The 4-DOF RHMB has good linear force–displacement and force–current characteristics. • The RHMB has good linear moment–current and the moment–tilting angle characteristic.

Synchronized motion control and precision positioning compensation of a 3-DOFs macro-micro parallel manipulator fully actuated by piezoelectric actuators

Science.gov (United States)

Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu

2017-11-01

The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.

Prosthetics in Paediatric Dentistry

Directory of Open Access Journals (Sweden)

Vulićević Zoran

2017-07-01

Full Text Available Premature loss of teeth in children may lead to both functional and esthetic problems. Missing teeth in both anterior and posterior regions may cause malfunctions in mastication and proper pronunciation. If the missing teeth are not replaced, further complications may occur, including adjacent tooth migration, loss of alveolar bone, and irregular occlusion. Considering the sensitive nature of children, loss of teeth may cause the development of insecurities and low self esteem problems. Due to dynamic nature of growth in children and adolescents, prosthetic appliances must not hinder development of orofacial system, and must meet adequate esthetic and functional standards. Dental prosthetic appliances in paediatrics must be planned with respect to the special conditions that led to tooth loss or damage. Multi-disciplinary approach is needed, under constant supervision of paediatric dentist and orthodontist, as well as regular checkups with clinical and radiographical examinations.

Trajectory tracking control for underactuated stratospheric airship

Science.gov (United States)

Zheng, Zewei; Huo, Wei; Wu, Zhe

2012-10-01

Stratospheric airship is a new kind of aerospace system which has attracted worldwide developing interests for its broad application prospects. Based on the trajectory linearization control (TLC) theory, a novel trajectory tracking control method for an underactuated stratospheric airship is presented in this paper. Firstly, the TLC theory is described sketchily, and the dynamic model of the stratospheric airship is introduced with kinematics and dynamics equations. Then, the trajectory tracking control strategy is deduced in detail. The designed control system possesses a cascaded structure which consists of desired attitude calculation, position control loop and attitude control loop. Two sub-loops are designed for the position and attitude control loops, respectively, including the kinematics control loop and dynamics control loop. Stability analysis shows that the controlled closed-loop system is exponentially stable. Finally, simulation results for the stratospheric airship to track typical trajectories are illustrated to verify effectiveness of the proposed approach.

A compliant underactuated hand with suction flow for underwater mobile manipulation

KAUST Repository

Stuart, Hannah S.

2014-05-01

© 2014 IEEE. Fingertip suction is investigated using a compliant, underactuated, tendon-driven hand designed for underwater mobile manipulation. Tendon routing and joint stiffnesses are designed to provide ease of closure while maintaining finger rigidity, allowing the hand to pinch small objects, as well as secure large objects, without diminishing strength. While the hand is designed to grasp a range of objects, the addition of light suction flow to the fingertips is especially effective for small, low-friction (slippery) objects. Numerical simulations confirm that changing suction parameters can increase the object acquisition region, providing guidelines for future versions of the hand.

A compliant underactuated hand with suction flow for underwater mobile manipulation

KAUST Repository

Stuart, Hannah S.; Wang, Shiquan; Gardineer, Bayard; Christensen, David L.; Aukes, Daniel M.; Cutkosky, Mark

2014-01-01

© 2014 IEEE. Fingertip suction is investigated using a compliant, underactuated, tendon-driven hand designed for underwater mobile manipulation. Tendon routing and joint stiffnesses are designed to provide ease of closure while maintaining finger rigidity, allowing the hand to pinch small objects, as well as secure large objects, without diminishing strength. While the hand is designed to grasp a range of objects, the addition of light suction flow to the fingertips is especially effective for small, low-friction (slippery) objects. Numerical simulations confirm that changing suction parameters can increase the object acquisition region, providing guidelines for future versions of the hand.

Proportional Retarded Controller to Stabilize Underactuated Systems with Measurement Delays: Furuta Pendulum Case Study

Directory of Open Access Journals (Sweden)

T. Ortega-Montiel

2017-01-01

Full Text Available The design and tuning of a simple feedback strategy with delay to stabilize a class of underactuated mechanical systems with dead time are presented. A linear time-invariant (LTI model with time delay of fourth order and a Proportional Retarded (PR controller are considered. The PR controller is shown as an appealing alternative to the application of observer-based controllers. This paper gives a step forward to obtain a better understanding of the effect of output delays and related phenomena in mechatronic systems, making it possible to design resilient control laws under the presence of uncertain time delays in measurements and obtain an acceptable performance without using a derivative action. The Furuta pendulum is a standard two-degrees-of-freedom benchmark example from the class of underactuated mechanical systems. The configuration under study includes an inherent output delay due to wireless communication used to transmit measurements of the pendulum’s angular position. Our approach offers a constructive design and a procedure based on a combination of root loci and Mikhailov methods for the analysis of stability. Experiments over a laboratory platform are reported and a comparison with a standard linear state feedback control law shows the advantages of the proposed scheme.

Effect of suspension kinematic on 14 DOF vehicle model

Science.gov (United States)

Wongpattananukul, T.; Chantharasenawong, C.

2017-12-01

Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.

Polynomial fuzzy model-based approach for underactuated surface vessels

DEFF Research Database (Denmark)

Khooban, Mohammad Hassan; Vafamand, Navid; Dragicevic, Tomislav

2018-01-01

The main goal of this study is to introduce a new polynomial fuzzy model-based structure for a class of marine systems with non-linear and polynomial dynamics. The suggested technique relies on a polynomial Takagi–Sugeno (T–S) fuzzy modelling, a polynomial dynamic parallel distributed compensation...... surface vessel (USV). Additionally, in order to overcome the USV control challenges, including the USV un-modelled dynamics, complex nonlinear dynamics, external disturbances and parameter uncertainties, the polynomial fuzzy model representation is adopted. Moreover, the USV-based control structure...... and a sum-of-squares (SOS) decomposition. The new proposed approach is a generalisation of the standard T–S fuzzy models and linear matrix inequality which indicated its effectiveness in decreasing the tracking time and increasing the efficiency of the robust tracking control problem for an underactuated...

Morphologically intelligent underactuated robot for underwater hull cleaning

DEFF Research Database (Denmark)

Souto, Daniel; Faina, Andres; López-Peña, Fernando

2015-01-01

In this paper we discuss a new type of robot for underwater hull cleaning on ships with non-magnetic hulls. This robot is based on the concept that cleaning hulls regularly, without waiting to take them out of the water, will improve the efficiency of the ships and will permit a reduction...... in the use of the chemicals that are usually employed to prevent the growth of marine life on the hull and which are generally harmful to the environment. The robot described in this paper is an underactuated morphologically adapted robot that through an appropriate morphology and making use of the forces...... and constraints of the environment solves the most difficult problems that arise when moving along hulls. Some of these are changing planes, negotiating appendices, avoiding portholes, passing corners, and other elements. This greatly simplifies the control mechanisms that are required for its operation making...

Dynamic Modeling and Simulation of an Underactuated System

International Nuclear Information System (INIS)

Duarte Madrid, Juan Libardo; Querubín, E González; Henao, P A Ospina

2017-01-01

In this paper, is used the Lagrangian classical mechanics for modeling the dynamics of an underactuated system, specifically a rotary inverted pendulum that will have two equations of motion. A basic design of the system is proposed in SOLIDWORKS 3D CAD software, which based on the material and dimensions of the model provides some physical variables necessary for modeling. In order to verify the results obtained, a comparison the CAD model simulated in the environment SimMechanics of MATLAB software with the mathematical model who was consisting of Euler-Lagrange’s equations implemented in Simulink MATLAB, solved with the ODE23tb method, included in the MATLAB libraries for the solution of systems of equations of the type and order obtained. This article also has a topological analysis of pendulum trajectories through a phase space diagram, which allows the identification of stable and unstable regions of the system. (paper)

Virtual Control of Prosthetic Hand Based on Grasping Patterns and Estimated Force from Semg

Directory of Open Access Journals (Sweden)

Zhu Gao-Ke

2016-01-01

Full Text Available Myoelectric prosthetic hands aim to serve upper limb amputees. The myoelectric control of the hand grasp action is a kind of real-time or online method. Thus it is of great necessity to carry on a study of online prosthetic hand electrical control. In this paper, the strategy of simultaneous EMG decoding of grasping patterns and grasping force was realized by controlling a virtual multi-degree-freedom prosthetic hand and a real one-degree-freedom prosthetic hand simultaneously. The former realized the grasping patterns from the recognition of the sEMG pattern. The other implemented the grasping force from sEMG force decoding. The results show that the control method is effective and feasible.

TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems

Energy Technology Data Exchange (ETDEWEB)

Belcher, AH; Liu, X; Grelewicz, Z; Wiersma, R [The University of Chicago, Chicago, IL (United States)

2016-06-15

Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recorded independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.

Advanced upper limb prosthetic devices: implications for upper limb prosthetic rehabilitation.

Science.gov (United States)

Resnik, Linda; Meucci, Marissa R; Lieberman-Klinger, Shana; Fantini, Christopher; Kelty, Debra L; Disla, Roxanne; Sasson, Nicole

2012-04-01

The number of catastrophic injuries caused by improvised explosive devices in the Afghanistan and Iraq Wars has increased public, legislative, and research attention to upper limb amputation. The Department of Veterans Affairs (VA) has partnered with the Defense Advanced Research Projects Agency and DEKA Integrated Solutions to optimize the function of an advanced prosthetic arm system that will enable greater independence and function. In this special communication, we examine current practices in prosthetic rehabilitation including trends in adoption and use of prosthetic devices, financial considerations, and the role of rehabilitation team members in light of our experiences with a prototype advanced upper limb prosthesis during a VA study to optimize the device. We discuss key challenges in the adoption of advanced prosthetic technology and make recommendations for service provision and use of advanced upper limb prosthetics. Rates of prosthetic rejection are high among upper limb amputees. However, these rates may be reduced with sufficient training by a highly specialized, multidisciplinary team of clinicians, and a focus on patient education and empowerment throughout the rehabilitation process. There are significant challenges emerging that are unique to implementing the use of advanced upper limb prosthetic technology, and a lack of evidence to establish clinical guidelines regarding prosthetic prescription and treatment. Finally, we make recommendations for future research to aid in the identification of best practices and development of policy decisions regarding insurance coverage of prosthetic rehabilitation. Copyright © 2012 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Application of multi-modality image coregistration in paediatric prosthetic endocarditis

International Nuclear Information System (INIS)

Kitsos, T.; Chung, D.K.; Howman-Giles, R.; Lau, Y.H.; University of Technology, Sydney, NSW

2003-01-01

This is a case where coregistration of Gallium and chest CT scans provided important clinical information which had a significant impact on management decisions. A 13-year-old girl from Noumea was transferred to our hospital for further management of S.haemolyticus bacteraemia. She had a history of complex congenital heart disease, requiring several cardiac surgical procedures. Seven months earlier she had a patch repair of the ventricular septum and formation of a right ventricle to pulmonary artery conduit. On admission she was generally unwell and had hemoptysis. She had fever to 39.9 deg C, oximetry of 83 per cent on room air, finger clubbing and a cardiac murmur. Chest X-ray and CT scans showed widespread pulmonary consolidation with bilateral pleural effusions. An echocardiogram showed no evidence of endocarditis. The crucial diagnostic dilemma was whether she had pneumonia or prosthetic endocarditis: the latter was more ominous and entailed high risk surgery. A Gallium whole body scan with chest SPECT showed focal localisation in the right mid chest. However, its location could not be confidently defined. A specifically developed computer program was used to co-register the Gallium SPECT and chest CT scans. The co-registered images conclusively localised the Gallium scan lesion to the prosthetic pulmonary outflow conduit, consistent with endocarditis. This triggered referral for cardiac MRI, which confirmed the diagnosis. In summary co-registration allowed precise structural localisation of focal Gallium uptake in the prosthetic pulmonary outflow conduit, with profound impact on the patient's diagnosis and subsequent management. This is an example of the potential benefits of co-registering structural and functional imaging modalities. Copyright (2002) The Australian and New Zealand Society of Nuclear Medicine Inc

Position calibration of a 3-DOF hand-controller with hybrid structure

Science.gov (United States)

Zhu, Chengcheng; Song, Aiguo

2017-09-01

A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.

Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

Science.gov (United States)

Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

2009-11-01

DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

Multi-Disciplinary Antimicrobial Strategies for Improving Orthopaedic Implants to Prevent Prosthetic Joint Infections in Hip and Knee

Science.gov (United States)

Getzlaf, Matthew A.; Lewallen, Eric A.; Kremers, Hilal M.; Jones, Dakota L.; Bonin, Carolina A.; Dudakovic, Amel; Thaler, Roman; Cohen, Robert C.; Lewallen, David G.; van Wijnen, Andre J.

2016-01-01

Like any foreign object, orthopaedic implants are susceptible to infection when introduced into the human body. Without additional preventative measures, the absolute number of annual prosthetic joint infections will continue to rise, and may exceed the capacity of health care systems in the near future. Bacteria are difficult to eradicate from synovial joints due to their exceptionally diverse taxonomy, complex mechanistic attachment capabilities, and tendency to evolve antibiotic resistance. When a primary orthopaedic implant fails from prosthetic joint infection, surgeons are generally challenged by limited options for intervention. In this review, we highlight the etiology and taxonomic groupings of bacteria known to cause prosthetic joint infections, and examine their key mechanisms of attachment. We propose that antimicrobial strategies should focus on the most harmful bacteria taxa within the context of occurrence, taxonomic diversity, adhesion mechanisms, and implant design. Patient-specific identification of organisms that cause prosthetic joint infections will permit assessment of their biological vulnerabilities. The latter can be targeted using a range of antimicrobial techniques that exploit different colonization mechanisms including implant surface attachment, biofilm formation, and/or hematogenous recruitment. We anticipate that customized strategies for each patient, joint, and prosthetic component will be most effective at reducing prosthetic joint infections, including those caused by antibiotic-resistant and polymicrobial bacteria. PMID:26449208

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

Directory of Open Access Journals (Sweden)

Yong Guo

Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

A Contrast on Conductor Galloping Amplitude Calculated by Three Mathematical Models with Different DOFs

Directory of Open Access Journals (Sweden)

Bin Liu

2014-01-01

Full Text Available It is pivotal to find an effective mathematical model revealing the galloping mechanism. And it is important to compare the difference between the existing mathematical models on the conductor galloping. In this paper, the continuum cable model for transmission lines was proposed using the Hamilton principle. Discrete models of one DOF, two DOFs, and three DOFs were derived from the continuum model by using the Garlekin method. And the three models were compared by analyzing the galloping vertical amplitude and torsional angle with different influence factors. The influence factors include wind velocity, flow density, span length, damping ratio, and initial tension. The three-DOF model is more accurate at calculating the galloping characteristics than the other two models, but the one-DOF and two-DOF models can also present the trend of galloping amplitude change from the point view of qualitative analysis. And the change of the galloping amplitude relative to the main factors was also obtained, which is very essential to the antigalloping design applied in the actual engineering.

Research of a New 6-Dof Force Feedback Hand Controller System

Directory of Open Access Journals (Sweden)

Xin Gao

2014-01-01

Full Text Available The field of teleoperation with force telepresence has expanded its scope to include manipulation at different scales and in virtual worlds, and the key component of which is force feedback hand controller. This paper presents a novel force feedback hand controller system, including a 3-dof translational and 3-dof rotational hand controllers, respectively, to implement position and posture teleoperation of the robot end effector. The 3-dof translational hand controller adopts innovative three-axes decoupling structure based on the linear motor; the 3-dof rotational hand controller adopts serial mechanism based on three-axes intersecting at one point, improving its overall stiffness. Based on the kinematics, statics, and dynamics analyses for two platforms separately, the system applies big closed-loop force control method based on the zero force/torque, improving the feedback force/torque accuracy effectively. Experimental results show that self-developed 6-dof force feedback hand controller has good mechanical properties. The translational hand controller has the following advantages: simple kinematics solver, fast dynamic response, and better than 0.05 mm accuracy of three-axis end positioning, while the advantages of the rotational hand controller are wide turning space, larger than 1 Nm feedback, greater than 180 degrees of operating space of three axes, respectively, and high operation precision.

Kinematics and Dynamics Analysis of a 3-DOF Upper-Limb Exoskeleton with an Internally Rotated Elbow Joint

OpenAIRE

Xin Wang; Qiuzhi Song; Xiaoguang Wang; Pengzhan Liu

2018-01-01

The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF) upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parame...

Application of 2DOF controller for reactor power control. Verification by numerical simulation

International Nuclear Information System (INIS)

Ishikawa, Nobuyuki; Suzuki, Katsuo

1996-09-01

In this report the usefulness of the two degree of freedom (2DOF) control is discussed to improve the reference response characteristics and robustness for reactor power control system. The 2DOF controller consists of feedforward and feedback elements. The feedforward element was designed by model matching method and the feedback element by solving the mixed sensitivity problem of H ∞ control. The 2DOF control gives good performance in both reference response and robustness to disturbance and plant perturbation. The simulation of reactor power control was performed by digitizing the 2DOF controller with the digital control periods of 10[msec]. It is found that the control period of 10[msec] is enough not to make degradation of the control performance by digitizing. (author)

Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.

Science.gov (United States)

Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant

2014-07-01

This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Modeling and controller design of a 6-DOF precision positioning system

Science.gov (United States)

Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan

2018-05-01

A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.

Development of 6-DOF painting robot control system

Science.gov (United States)

Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang

2017-01-01

With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.

On non-linear dynamics of coupled 1+1DOF versus 1+1/2DOF Electro-Mechanical System

DEFF Research Database (Denmark)

Darula, Radoslav; Sorokin, Sergey

2014-01-01

The electro-mechanical systems (EMS) are used from nano-/micro-scale (NEMS/MEMS) up to macro-scale applications. From mathematical view point, they are modelled with the second order differential equation (or a set of equations) for mechanical system, which is nonlinearly coupled with the second...... or the first order differential equation (or a set of equations) for electrical system, depending on properties of the electrical circuit. For the sake of brevity, we assume a 1DOF mechanical system, coupled to 1 or 1/2DOF electrical system (depending whether the capacitance is, or is not considered......). In the paper, authors perform a parametric study to identify operation regimes, where the capacitance term contributes to the non-linear behaviour of the coupled system. To accomplish this task, the classical method of multiple scales is used. The parametric study allows us to assess for which applications...

Design and control of five fingered under-actuated robotic hand

Science.gov (United States)

Sahoo, Biswojit; Parida, Pramod Kumar

2018-04-01

Now a day's research regarding humanoid robots and its application in different fields (industry, household, rehabilitation and exploratory) is going on entire the globe. Among which a challenging topic is to design a dexterous robotic hand which not only can perform as a hand of a robot but also can be used in re habilitation. The basic key concern is a dexterous robot hand which can be able to mimic the function of biological hand to perform different operations. This thesis work is regarding design and control of a under-actuated robotic hand consisting of four under actuated fingers (index finger, middle finger, little finger and ring finger ) , a thumb and a dexterous palm which can copy the motions and grasp type of human hand which having 21degrees of freedom instead of 25Degree Of Freedom.

An Approach for Pattern Recognition of EEG Applied in Prosthetic Hand Drive

Directory of Open Access Journals (Sweden)

Xiao-Dong Zhang

2011-12-01

Full Text Available For controlling the prosthetic hand by only electroencephalogram (EEG, it has become the hot spot in robotics research to set up a direct communication and control channel between human brain and prosthetic hand. In this paper, the EEG signal is analyzed based on multi-complicated hand activities. And then, two methods of EEG pattern recognition are investigated, a neural prosthesis hand system driven by BCI is set up, which can complete four kinds of actions (arm’s free state, arm movement, hand crawl, hand open. Through several times of off-line and on-line experiments, the result shows that the neural prosthesis hand system driven by BCI is reasonable and feasible, the C-support vector classifiers-based method is better than BP neural network on the EEG pattern recognition for multi-complicated hand activities.

An Evaluation of Dental Prosthetic Status and Prosthetic Needs ...

African Journals Online (AJOL)

present cross‑sectional study aimed to evaluate the dental prosthetic status and prosthetic needs among eunuchs .... who consented to become part of the study guided us to the .... to the reason that our study population comprised of adults with low SES. ... Arora M, Schwarz E, Sivaneswaran S, Banks E. Cigarette smoking.

Degrees of Freedom of Asymmetrical Multi-Way Relay Networks

DEFF Research Database (Denmark)

Sun, Fan; De Carvalho, Elisabeth

2011-01-01

In this paper, we introduce an asymmetrical multi-way relay channel where a base station conveys independent symbols to K different users while receiving independent symbols from the users. In this network, user i Shas Mi antennas (i ∈ [1, ..., K]), the base station has Σi=1K Mi antennas and the ......In this paper, we introduce an asymmetrical multi-way relay channel where a base station conveys independent symbols to K different users while receiving independent symbols from the users. In this network, user i Shas Mi antennas (i ∈ [1, ..., K]), the base station has Σi=1K Mi antennas...... and the relay is equipped with NR antennas. To study the capacity of this network, the degree of freedom (DOF) is characterized to be 2 Σi=1K Mi if NR ≥ Σi=1K Mi. The DOF implies that the number of symbols any transmitter can deliver and receive is equivalent to its number of antennas. The DOF is achievable...

Kinematics and Workspace of a 4-DOF Hybrid Palletizing Robot

Directory of Open Access Journals (Sweden)

Yong Tao

2014-06-01

Full Text Available We presented the kinematical analysis of a 4-DOF hybrid palletizing robot. The palletizing robot structure was proposed and the arm model of the robot was presented. The kinematical analysis of the end robotic manipulator was given. As a result, the position, velocity, and acceleration curves as well as the maximum workspace were demonstrated by simulation in Matlab. This study would be useful for the kinematical characteristics of the 4-DOF palletizing robot in space.

Rocking motion of structures under earthquakes. Overturning of 2-DOF system

International Nuclear Information System (INIS)

Kobayashi, Koichi; Watanabe, Tetsuya; Tanaka, Kihachiro; Tomoda, Akinori

2011-01-01

In recent years, huge earthquakes happen, for example, The South Hyogo prefecture Earthquake in 1995, The Mid Niigata Prefecture Earthquake in 2004, The Iwate-Miyagi Nairiku Earthquake in 2008. In The Niigataken Chuetsu-oki Earthquake in 2007, hundreds of drums fell down and water spilled out. A lot of studies about rocking behavior of rigid body had been performed from 1960's. However, these studies were only for a specific condition of the structure size or input vibration characteristics. Therefore, generalizes fall condition for earthquake is required. This paper deals with the analytical and the experimental study of the rocking vibration of 1-DOF rocking system, 2-DOF vibration-rocking system and 2-DOF rocking system under earthquakes. In this study, the equation of motion for each rocking systems are developed. The numerical model of 2-DOF rocking system is evaluated by free rocking experiment. In this paper, 'Overturning Map' which can distinguish whether structures falls or not is proposed. The overturning map of each rocking systems excited by the artificial earthquake wave calculated from the design spectrum is shown. As the result, overturning condition of structures is clarified. (author)

Kinematics and Dynamics Analysis of a 3-DOF Upper-Limb Exoskeleton with an Internally Rotated Elbow Joint

Directory of Open Access Journals (Sweden)

Xin Wang

2018-03-01

Full Text Available The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parameters of the 3-DOF upper-limb exoskeleton were determined, and the differences and singularities of the two exoskeletons were analyzed. The workspace, the joint torques and the power consumption of two exoskeletons were analyzed by kinematics and dynamics, and an exoskeleton prototype experiment was performed. The results showed that, compared with a typical anthropomorphic upper-limb exoskeleton, the non-anthropomorphic 3-DOF upper-limb exoskeleton had the same actual workspace; eliminated singularities within the workspace; improved the elbow joint force situation; and the maximum elbow joint torque, elbow external-flexion/internal-extension and shoulder flexion/extension power consumption were significantly reduced. The proposed non-anthropomorphic 3-DOF upper-limb exoskeleton can be applied to a power-assisted upper-limb exoskeleton in industrial settings.

Simulated Energy Usage for a Novel 6 DOF Articulated Robot

International Nuclear Information System (INIS)

Shaik, A A; Tlale, N; Bright, G

2014-01-01

The serial robot architecture is widespread in modern day manufacturing, and over the last few decades the technology has matured and settled to its current state. One drawback from the architecture however is the location of motors and gearboxes which are either at the joint it controls or close by. A novel hybrid 6 DOF robot was designed to move all the actuators to the robot base, and to control the desired axis through a set of connected links and gears, while maintaining the same workspace and dexterity. This would reduce the inertia of the movable part of the robot and some of the moment arms on the 3 axes required for translation of the 3 DOF spherical wrist. Doing so would decrease the energy requirements when compared to a 6 DOF serial robot. This paper focuses on the mathematical modelling and simulation of the novel hybrid machine design and compares it to an equivalent serial robot

TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

Energy Technology Data Exchange (ETDEWEB)

Belcher, AH; Liu, X; Wiersma, R [The University of Chicago, Chicago, IL (United States)

2016-06-15

Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

International Nuclear Information System (INIS)

Belcher, AH; Liu, X; Wiersma, R

2016-01-01

Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

Prosthetic Leg Control in the Nullspace of Human Interaction.

Science.gov (United States)

Gregg, Robert D; Martin, Anne E

2016-07-01

Recent work has extended the control method of virtual constraints, originally developed for autonomous walking robots, to powered prosthetic legs for lower-limb amputees. Virtual constraints define desired joint patterns as functions of a mechanical phasing variable, which are typically enforced by torque control laws that linearize the output dynamics associated with the virtual constraints. However, the output dynamics of a powered prosthetic leg generally depend on the human interaction forces, which must be measured and canceled by the feedback linearizing control law. This feedback requires expensive multi-axis load cells, and actively canceling the interaction forces may minimize the human's influence over the prosthesis. To address these limitations, this paper proposes a method for projecting virtual constraints into the nullspace of the human interaction terms in the output dynamics. The projected virtual constraints naturally render the output dynamics invariant with respect to the human interaction forces, which instead enter into the internal dynamics of the partially linearized prosthetic system. This method is illustrated with simulations of a transfemoral amputee model walking with a powered knee-ankle prosthesis that is controlled via virtual constraints with and without the proposed projection.

Developing a multi-joint upper limb exoskeleton robot for diagnosis, therapy, and outcome evaluation in neurorehabilitation.

Science.gov (United States)

Ren, Yupeng; Kang, Sang Hoon; Park, Hyung-Soon; Wu, Yi-Ning; Zhang, Li-Qun

2013-05-01

Arm impairments in patients post stroke involve the shoulder, elbow and wrist simultaneously. It is not very clear how patients develop spasticity and reduced range of motion (ROM) at the multiple joints and the abnormal couplings among the multiple joints and the multiple degrees-of-freedom (DOF) during passive movement. It is also not clear how they lose independent control of individual joints/DOFs and coordination among the joints/DOFs during voluntary movement. An upper limb exoskeleton robot, the IntelliArm, which can control the shoulder, elbow, and wrist, was developed, aiming to support clinicians and patients with the following integrated capabilities: 1) quantitative, objective, and comprehensive multi-joint neuromechanical pre-evaluation capabilities aiding multi-joint/DOF diagnosis for individual patients; 2) strenuous and safe passive stretching of hypertonic/deformed arm for loosening up muscles/joints based on the robot-aided diagnosis; 3) (assistive/resistive) active reaching training after passive stretching for regaining/improving motor control ability; and 4) quantitative, objective, and comprehensive neuromechanical outcome evaluation at the level of individual joints/DOFs, multiple joints, and whole arm. Feasibility of the integrated capabilities was demonstrated through experiments with stroke survivors and healthy subjects.

Fused Filament Fabrication of Prosthetic Components for Trans-Humeral Upper Limb Prosthetics

Science.gov (United States)

Lathers, Steven M.

Presented below is the design and fabrication of prosthetic components consisting of an attachment, tactile sensing, and actuator systems with Fused Filament Fabrication (FFF) technique. The attachment system is a thermoplastic osseointegrated upper limb prosthesis for average adult trans-humeral amputation with mechanical properties greater than upper limb skeletal bone. The prosthetic designed has: a one-step surgical process, large cavities for bone tissue ingrowth, uses a material that has an elastic modulus less than skeletal bone, and can be fabricated on one system. FFF osseointegration screw is an improvement upon the current two-part osseointegrated prosthetics that are composed of a fixture and abutment. The current prosthetic design requires two invasive surgeries for implantation and are made of titanium, which has an elastic modulus greater than bone. An elastic modulus greater than bone causes stress shielding and overtime can cause loosening of the prosthetic. The tactile sensor is a thermoplastic piezo-resistive sensor for daily activities for a prosthetic's feedback system. The tactile sensor is manufactured from a low elastic modulus composite comprising of a compressible thermoplastic elastomer and conductive carbon. Carbon is in graphite form and added in high filler ratios. The printed sensors were compared to sensors that were fabricated in a gravity mold to highlight the difference in FFF sensors to molded sensors. The 3D printed tactile sensor has a thickness and feel similar to human skin, has a simple fabrication technique, can detect forces needed for daily activities, and can be manufactured in to user specific geometries. Lastly, a biomimicking skeletal muscle actuator for prosthetics was developed. The actuator developed is manufactured with Fuse Filament Fabrication using a shape memory polymer composite that has non-linear contractile and passive forces, contractile forces and strains comparable to mammalian skeletal muscle, reaction

Real-time myoelectric control of a multi-fingered hand prosthesis using principal components analysis

Directory of Open Access Journals (Sweden)

Matrone Giulia C

2012-06-01

Full Text Available Abstract Background In spite of the advances made in the design of dexterous anthropomorphic hand prostheses, these sophisticated devices still lack adequate control interfaces which could allow amputees to operate them in an intuitive and close-to-natural way. In this study, an anthropomorphic five-fingered robotic hand, actuated by six motors, was used as a prosthetic hand emulator to assess the feasibility of a control approach based on Principal Components Analysis (PCA, specifically conceived to address this problem. Since it was demonstrated elsewhere that the first two principal components (PCs can describe the whole hand configuration space sufficiently well, the controller here employed reverted the PCA algorithm and allowed to drive a multi-DoF hand by combining a two-differential channels EMG input with these two PCs. Hence, the novelty of this approach stood in the PCA application for solving the challenging problem of best mapping the EMG inputs into the degrees of freedom (DoFs of the prosthesis. Methods A clinically viable two DoFs myoelectric controller, exploiting two differential channels, was developed and twelve able-bodied participants, divided in two groups, volunteered to control the hand in simple grasp trials, using forearm myoelectric signals. Task completion rates and times were measured. The first objective (assessed through one group of subjects was to understand the effectiveness of the approach; i.e., whether it is possible to drive the hand in real-time, with reasonable performance, in different grasps, also taking advantage of the direct visual feedback of the moving hand. The second objective (assessed through a different group was to investigate the intuitiveness, and therefore to assess statistical differences in the performance throughout three consecutive days. Results Subjects performed several grasp, transport and release trials with differently shaped objects, by operating the hand with the myoelectric

BALCO 6/7-DoF trajectory model

NARCIS (Netherlands)

Wey, P.; Corriveau, D.; Saitz, T.A.; Ruijter, W. de; Strömbäck, P.

2016-01-01

BALCO is a six- and seven-degree-of-freedom trajectory simulation program based on the mathematical model defined by the NATO Standardization Recommendation 4618. The primary goal of BALCO is to compute high-fidelity trajectories for both conventional and precision-guided projectiles. The 6-DoF

Prevention of Prosthetic Dentistry

Directory of Open Access Journals (Sweden)

Eremin O.V.

2011-03-01

Full Text Available Prevention in prosthetic dentistry is not just a regular oral hygiene and the prevention of caries in the early stages of its development. The initial goal of orthopedic and dental should be the ability to convey to the patient's sense of pros-thetics that proteziruya one saved more. An example is included prosthetic dental arch defects with bridges or single artificial crowns on implants that will prevent movement of teeth and the continuity of the dentition

New developments in prosthetic arm systems

Directory of Open Access Journals (Sweden)

Vujaklija I

2016-07-01

Full Text Available Ivan Vujaklija,1 Dario Farina,1 Oskar C Aszmann2 1Institute of Neurorehabilitation Systems, Bernstein Focus Neurotechnology Göttingen, University Medical Center Göttingen, Georg-August University, Göttingen, Germany; 2Christian Doppler Laboratory for Restoration of Extremity Function, Division of Plastic and Reconstructive Surgery, Department of Surgery, Medical University of Vienna, Vienna, Austria Abstract: Absence of an upper limb leads to severe impairments in everyday life, which can further influence the social and mental state. For these reasons, early developments in cosmetic and body-driven prostheses date some centuries ago, and they have been evolving ever since. Following the end of the Second World War, rapid developments in technology resulted in powered myoelectric hand prosthetics. In the years to come, these devices were common on the market, though they still suffered high user abandonment rates. The reasons for rejection were trifold – insufficient functionality of the hardware, fragile design, and cumbersome control. In the last decade, both academia and industry have reached major improvements concerning technical features of upper limb prosthetics and methods for their interfacing and control. Advanced robotic hands are offered by several vendors and research groups, with a variety of active and passive wrist options that can be articulated across several degrees of freedom. Nowadays, elbow joint designs include active solutions with different weight and power options. Control features are getting progressively more sophisticated, offering options for multiple sensor integration and multi-joint articulation. Latest developments in socket designs are capable of facilitating implantable and multiple surface electromyography sensors in both traditional and osseointegration-based systems. Novel surgical techniques in combination with modern, sophisticated hardware are enabling restoration of dexterous upper limb

Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards

Science.gov (United States)

Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei

2018-04-01

Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.

Control of 4-DOF MR haptic master for medical application

Science.gov (United States)

Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok

2014-03-01

In this work, magnetorheological (MR) based haptic master for robot-assisted minimally invasive surgery (RMIS) is proposed and analyzed. Using a controllable MR fluid, the masters can generate a reflection force with the 4-DOF motion. The proposed master consists of two actuators: MR clutch featuring gimbal mechanism for 2-DOF rotational motion (X and Y axes) and MR clutch attached at gripper of gimbal structures for 1-DOF rotational motion (Z axis) and 1-DOF translational motion. After analyzing the dynamic motion by integrating mechanical and physical properties of the actuators, torque model of the proposed haptic master is derived. For realization of master-slave system, an encoder which can measure position information is integrated with the MR haptic master. In the RMIS system, the measured position is converted as a command signal and sent to the slave robot. In this work, slave and organ of patient are modeled in virtual space. In order to embody a human organ into virtual space, a volumetric deformable object is mathematically formulated by a shape retaining chain linked (S-chain) model. Accordingly, the haptic architecture is established by incorporating the virtual slave with the master device in which the reflection force and desired position originated from the object of the virtual slave and operator of the master, respectively, are transferred to each other. In order to achieve the desired force trajectories, a proportional-integral-derivative (PID) controller is designed and implemented. It has been demonstrated that the effective tracking control performance for the desired motion of reflection force is well presented in time domain.

Design and Calibration of a New 6 DOF Haptic Device

Directory of Open Access Journals (Sweden)

Huanhuan Qin

2015-12-01

Full Text Available For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed.

Design and Calibration of a New 6 DOF Haptic Device

Science.gov (United States)

Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe

2015-01-01

For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449

Type synthesis for 4-DOF parallel press mechanism using GF set theory

Science.gov (United States)

He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong

2015-07-01

Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.

Integrated 6-DOF Orbit-Attitude Dynamical Modeling and Control Using Geometric Mechanics

Directory of Open Access Journals (Sweden)

Ling Jiang

2017-01-01

Full Text Available The integrated 6-DOF orbit-attitude dynamical modeling and control have shown great importance in various missions, for example, formation flying and proximity operations. The integrated approach yields better performances than the separate one in terms of accuracy, efficiency, and agility. One challenge in the integrated approach is to find a unified representation for the 6-DOF motion with configuration space SE(3. Recently, exponential coordinates of SE(3 have been used in dynamics and control of the 6-DOF motion, however, only on the kinematical level. In this paper, we will improve the current method by adopting exponential coordinates on the dynamical level, by giving the relation between the second-order derivative of exponential coordinates and spacecraft’s accelerations. In this way, the 6-DOF motion in terms of exponential coordinates can be written as a second-order system with a quite compact form, to which a broader range of control theories, such as higher-order sliding modes, can be applied. For a demonstration purpose, a simple asymptotic tracking control law with almost global convergence is designed. Finally, the integrated modeling and control are applied to the body-fixed hovering over an asteroid and verified by a simulation, in which absolute motions of the spacecraft and asteroid are simulated separately.

Transcriptome-Based Analysis of Dof Family Transcription Factors and Their Responses to Abiotic Stress in Tea Plant (Camellia sinensis

Directory of Open Access Journals (Sweden)

Hui Li

2016-01-01

Full Text Available Tea plant (Camellia sinensis (L. O. Kuntze is affected by abiotic stress during its growth and development. DNA-binding with one finger (Dof transcription factors (TFs play important roles in abiotic stress tolerance of plants. In this study, a total of 29 putative Dof TFs were identified based on transcriptome of tea plant, and the conserved domains and common motifs of these CsDof TFs were predicted and analyzed. The 29 CsDof proteins were divided into 7 groups (A, B1, B2, C1, C2.1, C2.2, and D2, and the interaction networks of Dof proteins in C. sinensis were established according to the data in Arabidopsis. Gene expression was analyzed in “Yingshuang” and “Huangjinya” under four experimental stresses by qRT-PCR. CsDof genes were expressed differentially and related to different abiotic stress conditions. In total, our results might suggest that there is a potential relationship between CsDof factors and tea plant stress resistance.

Kinematic Analysis of 3-DOF Planer Robot Using Artificial Neural Network

Directory of Open Access Journals (Sweden)

Jolly Atit Shah

2012-07-01

Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the forward and inverse kinematics of 3-DOF robotic manipulator with revolute joints. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Also forward and inverse kinematics solution has been achieved using Artificial Neural Networks for 3-DOF robotic manipulator. It shows that by using artificial neural network the solution we get is faster, acceptable and has zero error.

Design and development of a bio-inspired, under-actuated soft gripper.

Science.gov (United States)

Hassan, Taimoor; Manti, Mariangela; Passetti, Giovanni; d'Elia, Nicolò; Cianchetti, Matteo; Laschi, Cecilia

2015-08-01

The development of robotic devices able to perform manipulation tasks mimicking the human hand has been assessed on large scale. This work stands in the challenging scenario where soft materials are combined with bio-inspired design in order to develop soft grippers with improved grasping and holding capabilities. We are going to show a low-cost, under-actuated and adaptable soft gripper, highlighting the design and the manufacturing process. In particular, a critical analysis is made among three versions of the gripper with same design and actuation mechanism, but based on different materials. A novel actuation principle has been implemented in both cases, in order to reduce the encumbrance of the entire system and improve its aesthetics. Grasping and holding capabilities have been tested for each device, with target objects varying in shape, size and material. Results highlight synergy between the geometry and the intrinsic properties of the soft material, showing the way to novel design principles for soft grippers.

GIANT PROSTHETIC VALVE THROMBUS

Directory of Open Access Journals (Sweden)

Prashanth Kumar

2015-04-01

Full Text Available Mechanical prosthetic valves are predisposed to bleeding, thrombosis & thromboembolic complications. Overall incidence of thromboembolic complications is 1% per year who are on oral anticoagulants, whereas bleeding complications incidence is 0.5% to 6.6% per year. 1, 2 Minimization of Scylla of thromboembolic & Charybdis of bleeding complication needs a balancing act of optimal antithrombotic therapy. We are reporting a case of middle aged male patient with prosthetic mitral valve presenting in heart failure. Patient had discontinued anticoagulants, as he had subdural hematoma in the past. He presented to our institute with a giant prosthetic valve thrombus.

Prosthetic Joint Infections

Science.gov (United States)

Aslam, Saima; Darouiche, Rabih O.

2012-01-01

Prosthetic joint infections represent a major therapeutic challenge for both healthcare providers and patients. This paper reviews the predisposing factors, pathogenesis, microbiology, diagnosis, treatment and prophylaxis of prosthetic joint infection. The most optimal management strategy should be identified based on a number of considerations including type and duration of infection, antimicrobial susceptibility of the infecting pathogen, condition of infected tissues and bone stock, patient wishes and functional status. PMID:22847032

ThDof1.4 and ThZFP1 constitute a transcriptional regulatory cascade involved in salt or osmotic stress in Tamarix hispida.

Science.gov (United States)

Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng

2017-07-01

Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.

Experimental Study of Real-Time Classification of 17 Voluntary Movements for Multi-Degree Myoelectric Prosthetic Hand

Directory of Open Access Journals (Sweden)

Trongmun Jiralerspong

2017-11-01

Full Text Available The myoelectric prosthetic hand is a powerful tool developed to help people with upper limb loss restore the functions of a biological hand. Recognizing multiple hand motions from only a few electromyography (EMG sensors is one of the requirements for the development of prosthetic hands with high level of usability. This task is highly challenging because both classification rate and misclassification rate worsen with additional hand motions. This paper presents a signal processing technique that uses spectral features and an artificial neural network to classify 17 voluntary movements from EMG signals. The main highlight will be on the use of a small set of low-cost EMG sensor for classification of a reasonably large number of hand movements. The aim of this work is to extend the capabilities to recognize and produce multiple movements beyond what is currently feasible. This work will also show and discuss about how tailoring the number of hand motions for a specific task can help develop a more reliable prosthetic hand system. Online classification experiments have been conducted on seven male and five female participants to evaluate the validity of the proposed method. The proposed algorithm achieves an overall correct classification rate of up to 83%, thus, demonstrating the potential to classify 17 movements from 6 EMG sensors. Furthermore, classifying 9 motions using this method could achieve an accuracy of up to 92%. These results show that if the prosthetic hand is intended for a specific task, limiting the number of motions can significantly increase the performance and usability.

Pregnancy after Prosthetic Aortic Valve Replacement: How Do We Monitor Prosthetic Valvular Function during Pregnancy?

Directory of Open Access Journals (Sweden)

Nicole Sahasrabudhe

2018-01-01

Full Text Available Background. With modern medicine, many women after structural heart repair are deciding to experience pregnancy. There is a need for further study to identify normal echocardiographic parameters to better assess prosthetic valvular function in pregnancy. In addition, a multidisciplinary approach is essential in managing pregnant patients with complex cardiac conditions. Case. A 22-year-old nulliparous woman with an aortic valve replacement 18 months prior to her pregnancy presented to prenatal care at 20-week gestation. During her prenatal care, serial echocardiography showed a significant increase in the mean gradient across the prosthetic aortic valve. Multidisciplinary management and a serial echocardiography played an integral role in her care that resulted in a successful spontaneous vaginal delivery without complications. Conclusion. Further characterization of the normal echocardiographic parameters in pregnant patients with prosthetic valves is critical to optimize prenatal care for this patient population. This case report is novel in that serial echocardiograms were obtained throughout prenatal care, which showed significant changes across the prosthetic aortic valve. Teaching Points. (1 Further study is needed to identify normal echocardiographic parameters to best assess prosthetic valvular function in pregnancy. (2 Multidisciplinary management is encouraged to optimize prenatal care for women with prosthetic aortic valve replacements.

A geometrical optimization of a magneto-rheological rotary brake in a prosthetic knee

International Nuclear Information System (INIS)

Gudmundsson, K H; Jonsdottir, F; Thorsteinsson, F

2010-01-01

Magneto-rheological (MR) fluids have been successfully introduced to prosthetic devices. One such device is a biomechanical prosthetic knee that uses MR fluids to actively control its rotary stiffness. The brake is rotational, utilizing the MR fluid in shear mode. In this study, the geometrical design of the MR brake is addressed. This includes the design of the magnetic circuit and the geometry of the fluid chamber. Mathematical models are presented that describe the rotary torque of the brake. A novel perfluorinated polyether (PFPE)-based MR fluid is introduced, whose properties are tailored for the prosthetic knee. On-state and off-state rheological measurements of the MR fluid are presented. The finite element method is used to evaluate the magnetic flux density in the MR fluid. The design is formulated as an optimization problem, aiming to maximize the braking torque. A parametric study is carried out for several design parameters. Subsequently, a multi-objective optimization problem is defined that considers three design objectives: the field-induced braking torque, the off-state rotary stiffness and the weight of the brake. Trade-offs between the three design objectives are investigated which provides a basis for informed design decisions on furthering the success of the MR prosthetic knee

Conceptual design of EAST multi-purpose maintenance deployer system

International Nuclear Information System (INIS)

Pan, Hongtao; He, Kaihui; Cheng, Yong; Song, Yuntao; Yang, Yang; Villedieu, Eric; Shi, Shanshuang; Yang, Songzhu

2017-01-01

Highlights: • A redundant 11-DOF articulated robot for EAST in-vessel maintenance is presented. • A new modular joint developed to optimize the yaw joint actuator for the robot is described. • A 3-DOF gripper integrated with cameras and torque sensor is developed. - Abstract: EAST multi-purpose maintenance deployer (EMMD) system, being collaboratively developed by ASIPP and CEA-IRFM, is built as upgrades for EAMA. Updated kinematics parameters such as DOF distribution and joint angle for EMMD robot are performed and verified in a simulation platform. A new modular joint has been developed to optimize the yaw joint actuator for easy assembly and flexibility reduction. A 3-DOF gripper with cameras and torque sensor has been designed to provide inspection and dexterous handling of small fragments inside the EAST chamber. A conceptual upgrade for EAMA-CASK has been developed for the purpose of protecting the end-effector's sensors which do not have temperature-resistant qualification. The high temperature and vacuum compatible solutions and validation experiments have been presented in this paper.

Conceptual design of EAST multi-purpose maintenance deployer system

Energy Technology Data Exchange (ETDEWEB)

Pan, Hongtao [Institute of Plasma Physics, Chinese Academy of Sciences, 350 Shushanhu Rd, Hefei, Anhui (China); University of Science and Technology of China, Hefei, Anhui 230022 (China); He, Kaihui, E-mail: hekh@iterchina.cn [China International Nuclear Fusion Energy Program Execution Center, Beijing 100862 (China); Cheng, Yong [Institute of Plasma Physics, Chinese Academy of Sciences, 350 Shushanhu Rd, Hefei, Anhui (China); Song, Yuntao [Institute of Plasma Physics, Chinese Academy of Sciences, 350 Shushanhu Rd, Hefei, Anhui (China); University of Science and Technology of China, Hefei, Anhui 230022 (China); Yang, Yang [Institute of Plasma Physics, Chinese Academy of Sciences, 350 Shushanhu Rd, Hefei, Anhui (China); Villedieu, Eric [CEA-IRFM, F-13108 Saint-Paul-Lez-Durance (France); Shi, Shanshuang; Yang, Songzhu [Institute of Plasma Physics, Chinese Academy of Sciences, 350 Shushanhu Rd, Hefei, Anhui (China)

2017-05-15

Highlights: • A redundant 11-DOF articulated robot for EAST in-vessel maintenance is presented. • A new modular joint developed to optimize the yaw joint actuator for the robot is described. • A 3-DOF gripper integrated with cameras and torque sensor is developed. - Abstract: EAST multi-purpose maintenance deployer (EMMD) system, being collaboratively developed by ASIPP and CEA-IRFM, is built as upgrades for EAMA. Updated kinematics parameters such as DOF distribution and joint angle for EMMD robot are performed and verified in a simulation platform. A new modular joint has been developed to optimize the yaw joint actuator for easy assembly and flexibility reduction. A 3-DOF gripper with cameras and torque sensor has been designed to provide inspection and dexterous handling of small fragments inside the EAST chamber. A conceptual upgrade for EAMA-CASK has been developed for the purpose of protecting the end-effector's sensors which do not have temperature-resistant qualification. The high temperature and vacuum compatible solutions and validation experiments have been presented in this paper.

Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

Directory of Open Access Journals (Sweden)

Karen Junius

2017-01-01

Full Text Available A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton.

Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

Science.gov (United States)

Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk

2017-01-01

A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799

Prosthetic vascular graft infection and prosthetic joint infection caused by Pseudomonas stutzeri.

Science.gov (United States)

Bonares, Michael J; Vaisman, Alon; Sharkawy, Abdu

2016-01-01

Pseudomonas stutzeri is infrequently isolated from clinical specimens, and if isolated, more likely represents colonization or contamination rather than infection. Despite this, there are dozens of case reports which describe clinically significant P. stutzeri infections at variable sites. A 69-year-old man had a P. stutzeri infection of a prosthetic vascular graft infection, which he received in Panama City. He was successfully treated with a single antipseudomonal agent for 6 weeks and the removal of the infected vascular graft. A 70-year-old man had a P. stutzeri infection of a prosthetic joint, which was successfully treated with a single anti-pseudomonal agent for 6 weeks. There is only one other documented case of a prosthetic vascular graft infection secondary to P. stutzeri . There are 5 documented cases of P. stutzeri prosthetic joint infections. The previous cases were treated with antibiotics and variably, source control with the removal of prosthetic material. Most cases of P. stutzeri infection are due to exposure in health care settings. Immunocompromised states such as HIV or hematological and solid tumor malignancies are risk factors for P. stutzeri infection. Infections caused by P. stutzeri are far less frequent and less fatal than those caused by P. aeruginosa. The etiology of a P. stutzeri infection could be exposure to soil and water, but also contaminated material in the health care setting or an immunocompromised state. Iatrogenic infections that are secondary to health care tourism are a potential cause of fever in the returned traveler.

Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

Science.gov (United States)

da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

2016-01-01

The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

Isolated Lactobacillus chronic prosthetic knee infection.

Science.gov (United States)

Bennett, David M; Shekhel, Tatyana; Radelet, Matt; Miller, Michael D

2014-01-01

Lactobacillus is a gram-positive rod bacteria found primarily in the gastrointestinal and female genital tracts. Prosthetic infections in implants are being increasingly reported. The authors present a case of a 58-year-old patient with Lactobacillus septic prosthetic knee joint infection. To the authors’ knowledge, this is the first reported case of chronic prosthetic knee infection with isolated Lactobacillus species. Lactobacillus has been most commonly implicated with bacteremia and endocarditis and rarely with pneumonia, meningitis, and endovascular infection, and a vast majority of the cases are reported in immunocompromised patients. In the current case, diabetes mellitus, hepatitis, malnutrition, anemia, and liver failure were comorbid conditions, placing the patient at increased risk of infection. The findings suggest that further case series are necessary to establish the significance of Lactobacillus as an etiologic agent in chronic low-virulence, and potentially vancomycin-resistant, prosthetic joint infection. The need also exists for further research aimed at the risk of prosthetic joint infection with oral intake of certain probiotic foods and supplements. The goal of this case report is to bring to light the potential of this organism to be a cause of subtle chronic prosthetic joint infection.

Computer Aided Facial Prosthetics Manufacturing System

Directory of Open Access Journals (Sweden)

Peng H.K.

2016-01-01

Full Text Available Facial deformities can impose burden to the patient. There are many solutions for facial deformities such as plastic surgery and facial prosthetics. However, current fabrication method of facial prosthetics is high-cost and time consuming. This study aimed to identify a new method to construct a customized facial prosthetic. A 3D scanner, computer software and 3D printer were used in this study. Results showed that the new developed method can be used to produce a customized facial prosthetics. The advantages of the developed method over the conventional process are low cost, reduce waste of material and pollution in order to meet the green concept.

Human Factors Risk Analyses of a Doffing Protocol for Ebola-Level Personal Protective Equipment: Mapping Errors to Contamination.

Science.gov (United States)

Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T

2018-03-05

Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.

Adaptive Controller for 6-DOF Parallel Robot Using T-S Fuzzy Inference

Directory of Open Access Journals (Sweden)

Xue Jian

2013-02-01

Full Text Available 6-DOF parallel robot always appears in the form of Stewart platform. It has been widely used in industry for the benefits such as strong structural stiffness, high movement accuracy and so on. Space docking technology makes higher requirements of motion accuracy and dynamic performance to the control method on 6-DOF parallel robot. In this paper, a hydraulic 6-DOF parallel robot was used to simulate the docking process. Based on this point, this paper gave a thorough study on the design of an adaptive controller to eliminate the asymmetric of controlled plant and uncertain load force interference. Takagi-Sugeno (T-S fuzzy inference model was used to build the fuzzy adaptive controller. With T-S model, the controller directly imposes adaptive control signal on the plant to make sure that the output of plant could track the reference model output. The controller has simple structure and is easy to implement. Experiment results show that the controller can eliminate asymmetric and achieve good dynamic performance, and has good robustness to load interference.

Energy storage and release of prosthetic feet. Part 1: biomechanical analysis related to user benefits

NARCIS (Netherlands)

Postema, K.; Hermens, Hermanus J.; de Vries, J.; de Vries, J.; Koopman, Hubertus F.J.M.; Eisma, W.H.

1997-01-01

The energy storing and releasing behaviour of 2 energy storing feet (ESF) and 2 conventional prosthetic feet (CF) were compared (ESF: Otto Bock Dynamic Pro and Hanger Quantum; CF: Otto Bock Multi Axial and Otto Bock Lager). Ten trans-tibial amputees were selected. The study was designed as a

Establishing an Improved Kane Dynamic Model for the 7-DOF Reconfigurable Modular Robot

Directory of Open Access Journals (Sweden)

Xiao Li

2017-01-01

Full Text Available We propose an improved Kane dynamic model theory for the 7-DOF modular robot in this paper, and the model precision is improved by the improved function T′it. We designed three types of progressive modular joints for reconfigurable modular robot that can be used in industrial robot, space robot, and special robot. The Kane dynamic model and the solid dynamic model are established, respectively, for the 7-DOF modular robot. After that, the experimental results are obtained from the simulation experiment of typical task in the established dynamic models. By the analysis model of error, the equation of the improved torque T′it is derived and proposed. And the improved Kane dynamic model is established for the modular robot that used T′it. Based on the experimental data, the undetermined coefficient matrix is five-order linear that was proved in 7-DOF modular robot. And the explicit formulation is solved of the Kane dynamic model and can be used in control system.

The role of osteoblasts in peri-prosthetic osteolysis.

LENUS (Irish Health Repository)

O'Neill, S C

2013-08-01

Peri-prosthetic osteolysis and subsequent aseptic loosening is the most common reason for revising total hip replacements. Wear particles originating from the prosthetic components interact with multiple cell types in the peri-prosthetic region resulting in an inflammatory process that ultimately leads to peri-prosthetic bone loss. These cells include macrophages, osteoclasts, osteoblasts and fibroblasts. The majority of research in peri-prosthetic osteolysis has concentrated on the role played by osteoclasts and macrophages. The purpose of this review is to assess the role of the osteoblast in peri-prosthetic osteolysis. In peri-prosthetic osteolysis, wear particles may affect osteoblasts and contribute to the osteolytic process by two mechanisms. First, particles and metallic ions have been shown to inhibit the osteoblast in terms of its ability to secrete mineralised bone matrix, by reducing calcium deposition, alkaline phosphatase activity and its ability to proliferate. Secondly, particles and metallic ions have been shown to stimulate osteoblasts to produce pro inflammatory mediators in vitro. In vivo, these mediators have the potential to attract pro-inflammatory cells to the peri-prosthetic area and stimulate osteoclasts to absorb bone. Further research is needed to fully define the role of the osteoblast in peri-prosthetic osteolysis and to explore its potential role as a therapeutic target in this condition.

Structural Synthesis of 3-DoF Spatial Fully Parallel Manipulators

Directory of Open Access Journals (Sweden)

Alfonso Hernandez

2014-07-01

Full Text Available In this paper, the architectures of three degrees of freedom (3-DoF spatial, fully parallel manipulators (PMs, whose limbs are structurally identical, are obtained systematically. To do this, the methodology followed makes use of the concepts of the displacement group theory of rigid body motion. This theory works with so-called ‘motion generators’. That is, every limb is a kinematic chain that produces a certain type of displacement in the mobile platform or end-effector. The laws of group algebra will determine the actual motion pattern of the end-effector. The structural synthesis is a combinatorial process of different kinematic chains’ topologies employed in order to get all of the 3-DoF motion pattern possibilities in the end-effector of the fully parallel manipulator.

Proposed Robot Scheme with 5 DoF and Dynamic Modelling Using Maple Software

Directory of Open Access Journals (Sweden)

Shala Ahmet

2017-11-01

Full Text Available In this paper is represented Dynamical Modelling of robots which is commonly first important step of Modelling, Analysis and Control of robotic systems. This paper is focused on using Denavit-Hartenberg (DH convention for kinematics and Newton-Euler Formulations for dynamic modelling of 5 DoF - Degree of Freedom of 3D robot. The process of deriving of dynamical model is done using Software Maple. Derived Dynamical Model of 5 DoF robot is converted for Matlab use for future analysis, control and simulations.

Scale-up for model verification; design, modeling and control of an elastic parallel kinematic 6-DOFs manipulator

NARCIS (Netherlands)

Huijts, Martijn; Brouwer, Dannis Michel; van Dijk, Johannes

2009-01-01

Manipulators with guidance constructions based on elastic mechanisms are of interest for the increasing number of precision vacuum applications. Previously, the design of an elastic MEMS-based 6-DOFs manipulator was presented. Characterization in six degrees of freedom (DOFs) of a manipulator the

Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.

Science.gov (United States)

Lujan, J Luis; Crago, Patrick E

2009-01-01

This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.

Path following of an Underactuated AUV Based on Fuzzy Backstepping Sliding Mode Control

Directory of Open Access Journals (Sweden)

Xiao Liang

2016-06-01

Full Text Available This paper addresses the path following problem of an underactuated autonomous underwater vehicle (AUV with the aim of dealing with parameter uncertainties and current disturbances. An adaptive robust control system was proposed by employing fuzzy logic, backstepping and sliding mode control theory. Fuzzy logic theory is adopted to approximate unknown system function, and the controller was designed by combining sliding mode control with backstepping thought. Firstly, the longitudinal speed was controlled, then the yaw angle was made as input of path following error to design the calm function and the change rate of path parameters. The controller stability was proved by Lyapunov stable theory. Simulation and outfield tests were conducted and the results showed that the controller is of excellent adaptability and robustness in the presence of parameter uncertainties and external disturbances. It is also shown to be able to avoid the chattering of AUV actuators.

Pre-prosthetic surgery: Mandible

Directory of Open Access Journals (Sweden)

Veeramalai Naidu Devaki

2012-01-01

Full Text Available Pre-prosthetic surgery is that part of oral and maxillofacial surgery which restores oral function and facial form. This is concerned with surgical modification of the alveolar process and its surrounding structures to enable the fabrication of a well-fitting, comfortable, and esthetic dental prosthesis. The ultimate goal of pre-prosthetic surgery is to prepare a mouth to receive a dental prosthesis by redesigning and smoothening bony edges.

Guide to prosthetic cardiac valves

International Nuclear Information System (INIS)

Morse, D.; Steiner, R.M.; Fernandez, J.

1985-01-01

This book contains 10 chapters. Some of the chapter titles are: The development of artificial heart valves: Introduction and historical perspective; The radiology of prosthetic heart valves; The evaluation of patients for prosthetic valve implantation; Pathology of cardiac valve replacement; and Bioengineering of mechanical and biological heart valve substitutes

A Novel Integral 5-DOFs Hybrid Magnetic Bearing with One Permanent Magnet Ring Used for Turboexpander

Directory of Open Access Journals (Sweden)

Bangcheng Han

2014-01-01

Full Text Available We propose a novel combined five-degrees-of-freedom (5-DOFs hybrid magnetic bearing (HMB with only one permanent magnet ring (PMR used for turboexpanders. It has two radial magnetic bearing (RMB units; each has four poles and one thrust magnetic bearing (TMB to control 5-DOFs. Based on one PMR, the bias flux of the two radial magnetic bearing units and the one thrust magnetic bearing unit is constructed. As a result, ultra-high-speed, lower power loss, small size, and low cost can be achieved. Furthermore, the equivalent magnetic circuit method and 3D finite element method (FEM are used to model and analyze the combined 5-DOFs HMB. The force-current, force-position, torque-coil currents, the torque-angle position, and the stiffness models of the combined 5-DOFs HMB are given. Moreover, its coupling problems between the RMB units and the AMB unit are also proposed in this paper. An example is given to clarify the mathematical models and the coupling problems, and the linearized models are proposed for the follow-up controller design.

Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs

Directory of Open Access Journals (Sweden)

Muhammad Masood ul Hassan

2009-04-01

Full Text Available High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1µm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /o/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 x 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron

Adaptive tuning of a 2DOF controller for robust cell manipulation using IPMC actuators

International Nuclear Information System (INIS)

McDaid, A J; Aw, K C; Haemmerle, E; Xie, S Q; Shahinpoor, M

2011-01-01

Rapid advancement in medicine and bioscience is causing demand for faster, more accurate and dexterous as well as safer and more reliable micro-manipulators capable of handling biological cells. Current micro-manipulation techniques commonly damage cell walls and membranes due to their stiffness and rigidity. Ionic polymer-metal composite (IPMC) actuators have inherent compliance and with their ability to operate well in fluid and cellular environments they present a unique solution for safe cell manipulation. The reason for the downfall of IPMCs is that their complex behaviour makes them hard to control precisely in unknown environments and in the presence of sizeable external disturbances. This paper presents a novel scheme for adaptively tuning IPMC actuators for precise and robust micro-manipulation of biological cells. A two-degree-of-freedom (2DOF) controller is developed to allow optimal performance for both disturbance rejection (DR) and set point (SP) tracking. These criteria are optimized using a proposed IFT algorithm which adaptively updates the controller parameters, with no model or prior knowledge of the operating conditions, to achieve a compliant manipulation system which can precisely track targets in the presence of large external disturbances, as will be encountered in real biological environments. Experiments are presented showing the performance optimization of an IPMC actuator in the presence of external mechanical disturbances as well as the optimization of the SP tracking. The IFT algorithm successfully tunes the DR and SP to an 85% and 69% improvement, respectively. Results are also presented for a one-degree-of-freedom (1DOF) controller tuned first for DR and then for SP, for a comparison with the 2DOF controller. Validation has been undertaken to verify that the 2DOF controller does indeed outperform both 1DOF controllers over a variety of operating conditions.

Comparison of FOLFOX and DOF regimens as first-line treatment in East Asian patients with advanced gastric cancer

Directory of Open Access Journals (Sweden)

Liu M

2018-01-01

Full Text Available Mengyao Liu,1,2 Guofang Hu,2 Yuan Wang,2 Jun Guo,2 Liyan Liu,2 Xiao Han,2 Zhehai Wang2 1School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong, 2Department of Oncology, Shandong Cancer Hospital, affiliated to Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong, People’s Republic of China Background: Our study retrospectively assesses the safety and efficacy of the FOLFOX (oxaliplatin, fluorouracil, and leucovorin versus DOF (docetaxel, oxaliplatin, and fluorouracil regimens in untreated locally advanced gastric cancer (AGC.Patients and methods: A total of 108 patients underwent DOF (N=58 and FOLFOX (N=50 regimens. The end points were overall response rate (ORR, survival, and toxicity. Kaplan–Meier curve was used to estimate overall survival (OS and progression-free survival (PFS and Cox regression for multivariate analysis.Results: The ORRs were 50% for DOF and 30% for FOLFOX groups (P<0.05, and disease control rates were 91.4% and 72%, respectively. The median PFS and OS in DOF group were significantly better than FOLFOX group (8.2 versus 6.4 months, P<0.05; 16.3 versus 11.2 months, P<0.001. Both groups showed acceptable toxicity; all grades and grade 3–4 toxicity had no significant differences (P=0.071; P=0.247. However, the incidence of grade 3–4 peripheral neuropathy was significantly higher in DOF group (10.3% versus 2%, P<0.05. In the subgroup analysis for elderly AGC patients (≥65 years, administration of DOF also resulted in a superior PFS (8.5 versus 5.9 months; P=0.038 and OS (15.3 versus 9.8 months; P=0.004 compared with FOLFOX. However, DOF regimen was associated with more neutropenia (67% versus 30%; P<0.05, thrombocytopenia (61% versus 52%; P<0.05, and peripheral neuropathy (49% versus 22%; P<0.05.Conclusion: DOF regimen was more effective than FOLFOX for AGC, both in younger and older patients. The adverse effects of the two regimens were

Severe prosthetic joint infection in an immunocompetent male patient due to a therapy refractory Pseudallescheria apiosperma.

NARCIS (Netherlands)

Lackner, M.; Man, F.H. de; Eygendaal, D.; Wintermans, R.G.; Kluytmans, J.A.; Klaassen, C.H.; Meis, J.F.G.M.

2011-01-01

Prosthetic joint infections (PJI) are rarely due to fungal agents and if so they are mainly caused by Candida strains. This case represents a PJI caused by a multi-drug resistant Pseudallescheria apiosperma, with poor in vivo response to itraconazole and voriconazole. This case differs also by the

Admittance Control of a Multi-Finger Arm Based on Manipulability of Fingers

Directory of Open Access Journals (Sweden)

Jian Huang

2011-09-01

Full Text Available In the previous studies, admittance control and impedance control for a finger-arm robot using the manipulability of the finger were studied and methods of realizing the controls have been proposed. In this study, two 3-DOF fingers are attached to the end-effector of a 6-DOF arm to configure a multi-finger arm robot. Based on the previous methods, the authors have proposed an admittance control for a multi-finger arm robot using the manipulability of the fingers in this study. Algorithms of the averaging method and the mini-max method were introduced to establish a manipulability criterion of the two fingers in order to generate a cooperative movement of the arm. Comparison of the admittance controls combined with the top search method and local optimization method for the multi-finger arm robot was made and features of the control methods were also discussed. The stiffness control and damping control were experimentally evaluated to demonstrate the effectiveness of the proposed methods.

Prosthetic status and prosthetic need among the patients attending various dental institutes of ahmedabad and gandhinagar district, gujarat.

Science.gov (United States)

Shah, Vrinda R; Shah, Darshana N; Parmar, Chaitanya H

2012-09-01

The oral health being an integral part for the healthy living, necessity of disability limitation and rehabilitation in oral health has taken a paramount role. To assess the prosthetic status and to evaluate the prosthetic needs of the patients attending various institutes of Ahmedabad and Gandhinagar district. A total of 510 (264 males and 246 females) subjects at various dental institutes were examined in the study. A survey proforma was prepared with the help of WHO oral health assessment form (1997). Prosthetic status and prosthetic treatment need was recorded. Out of 510, any type of Edentulousness was 322 (63 %). Among them, 254 (49.8 %) were partially edentulous while 68 (13.3 %) were completely edentulous. Only 69 (13 %) were having any prosthesis in upper arch while only 80 (16 %) were having any prosthesis in lower arch. Need for any type of prosthesis in upper and lower arch was 55 and 60 % in males and females, respectively. In lower social class group need of prosthesis in upper and lower arch was 62 and 63 %, respectively. It was found that prosthetic status and prosthetic treatment need increased with increase in age. Steps should be taken to overcome this disparity and more emphasis should be given to meet the felt need of the people through government and non government organizations to improve the oral health. The unmet prosthetic treatment need should be met to rehabilitate needy people so that their disability may be limited.

Optimal design of an alignment-free two-DOF rehabilitation robot for the shoulder complex.

Science.gov (United States)

Galinski, Daniel; Sapin, Julien; Dehez, Bruno

2013-06-01

This paper presents the optimal design of an alignment-free exoskeleton for the rehabilitation of the shoulder complex. This robot structure is constituted of two actuated joints and is linked to the arm through passive degrees of freedom (DOFs) to drive the flexion-extension and abduction-adduction movements of the upper arm. The optimal design of this structure is performed through two steps. The first step is a multi-objective optimization process aiming to find the best parameters characterizing the robot and its position relative to the patient. The second step is a comparison process aiming to select the best solution from the optimization results on the basis of several criteria related to practical considerations. The optimal design process leads to a solution outperforming an existing solution on aspects as kinematics or ergonomics while being more simple.

IKO: A Five Actuated DoF Upper Limb Exoskeleton Oriented to Workplace Assistance

Directory of Open Access Journals (Sweden)

Felix Martinez

2009-01-01

Full Text Available IKerlan’s Orthosis (IKO is an upper limb exoskeleton oriented to increasing human force during routine activity at the workplace. Therefore, it can be considered as a force-amplification device conceived to work in collaboration with the human arm and implementing biomimetic principles. The aim of the proposed design is to find the best compromise between maximum reachable workspace and minimum moving mass, which are the key factors for obtaining an ergonomic, wearable exoskeleton. It consists of five actuated degree of freedom (DoF to move the human arm and three non-actuated DoF between the back and shoulder to allow relative displacement of the sterno-clavicular joint. Conventional electrical motors are used for most of the DoF and pneumatic muscles for one of them (forearm rotation. Power transmission is based on Bowden cables. This paper presents the IKO design, the mechanical structure of a first prototype and the redesign process from an aesthetic point of view. Controller set-up and control strategies are also shown, together with dynamic performance from experimental results.

Circuit For Control Of Electromechanical Prosthetic Hand

Science.gov (United States)

Bozeman, Richard J., Jr.

1995-01-01

Proposed circuit for control of electromechanical prosthetic hand derives electrical control signals from shoulder movements. Updated, electronic version of prosthesis, that includes two hooklike fingers actuated via cables from shoulder harness. Circuit built around favored shoulder harness, provides more dexterous movement, without incurring complexity of computer-controlled "bionic" or hydraulically actuated devices. Additional harness and potentiometer connected to similar control circuit mounted on other shoulder. Used to control stepping motor rotating hand about prosthetic wrist to one of number of angles consistent with number of digital outputs. Finger-control signals developed by circuit connected to first shoulder harness transmitted to prosthetic hand via sliprings at prosthetic wrist joint.

Factors Associated with Prosthetic Looseness in Lower Limb Amputees.

Science.gov (United States)

Phonghanyudh, Thong; Sutpasanon, Taweesak; Hathaiareerug, Chanasak; Devakula, M L Buddhibongsa; Kumnerddee, Wipoo

2015-12-01

To determine the factors associated with prosthetic looseness in lower limb amputees in Sisaket province. The present was a cross-sectional descriptive study. Subjects were lower limb amputees who previously obtained prostheses and required prosthetic replacements at the mobile prosthetic laboratory unit under the Prostheses Foundation of H.R.H. the Princess Mother at Khun Han Hospital, Sisaket province, in February 2013. Data including participant characteristics, prosthetic looseness data, and various variables were collected by direct semi-structured interview. Energy expenditures in physical activities were measured using the Thai version of the short format international physical activity questionnaire. Data between participants with and without prosthetic looseness were compared to determine prosthetic loosening associated factors. Among 101 participants enrolled, 33 (32.7%) had prosthetic looseness with average onset of 1.76 ± 1.67 years. Diabetes mellitus was the only significant factor associated with prosthetic looseness from both univariate and multivariate analyses (HR = 7.05, p = 0.002 and HR = 5.93, p = 0.007 respectively). Among the lower limb amputees in Sisaket province, diabetes mellitus was the only factor associated with prosthetic looseness. Therefore, diabetic screening should be supplemented in lower limb amputee assessment protocol. In addition, we recommend that amputees with diabetes mellitus should receive prosthesis check out at approximately

Structural Design of a 6-DoF Hip Exoskeleton using Linear Series Elastic Actuators

OpenAIRE

Li, Xiao

2017-01-01

A novel hip exoskeleton with six degrees of freedom (DoF) was developed, and multiple prototypes of this product were created in this thesis. The device was an upper level of the 12-DoF lower-body exoskeleton project, which was known as the Orthotic Lower-body Locomotion Exoskeleton (OLL-E). The hip exoskeleton had three motions per leg, which were roll, yaw, and pitch. Currently, the sufferers of hemiplegia and paraplegia can be addressed by using a wheelchair or operating an exoskeleton wi...

The Impact of Environmental Design on Doffing Personal Protective Equipment in a Healthcare Environment: A Formative Human Factors Trial.

Science.gov (United States)

Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T

2017-06-01

OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.

Optimising the prescription of prosthetic technologies (opptec): Outcome measures for evidence based prosthetic practice and use

LENUS (Irish Health Repository)

Ryall, Dr Nicola

2010-01-01

This study provided a forum for patients and service providers to voice their opinions in what they believe to be the important predictors and outcomes involved in successful rehabilitation following limb loss. To develop a consensus on the most important outcomes and factors to address for both the lower limb and upper limb prosthetic prescription process, the above data relating to lower limb and upper prosthetics were subsequently used in the next phase of the research involving two Delphi surveys of 23 and 53 experts within the lower limb and upper limb amputation and prosthetic field respectively, including users, service providers and researchers.\\r\

Vascular complications of prosthetic inter-vertebral discs

OpenAIRE

Daly, Kevin J.; Ross, E. Raymond S.; Norris, Heather; McCollum, Charles N.

2006-01-01

Five consecutive cases of prosthetic inter-vertebral disc displacement with severe vascular complications on revisional surgery are described. The objective of this case report is to warn spinal surgeons that major vascular complications are likely with anterior displacement of inter-vertebral discs. We have not been able to find a previous report on vascular complications associated with anterior displacement of prosthetic inter-vertebral discs. In all five patients the prosthetic disc had e...

Sensor module design and forward and inverse kinematics analysis of 6-DOF sorting transferring robot

Science.gov (United States)

Zhou, Huiying; Lin, Jiajian; Liu, Lei; Tao, Meng

2017-09-01

To meet the demand of high strength express sorting, it is significant to design a robot with multiple degrees of freedom that can sort and transfer. This paper uses infrared sensor, color sensor and pressure sensor to receive external information, combine the plan of motion path in advance and the feedback information from the sensors, then write relevant program. In accordance with these, we can design a 6-DOF robot that can realize multi-angle seizing. In order to obtain characteristics of forward and inverse kinematics, this paper describes the coordinate directions and pose estimation by the D-H parameter method and closed solution. On the basis of the solution of forward and inverse kinematics, geometric parameters of links and link parameters are optimized in terms of application requirements. In this way, this robot can identify route, sort and transfer.

Advanced Prosthetic Gait Training Tool

Science.gov (United States)

2015-12-01

modules to train individuals to distinguish gait deviations (trunk motion and lower-limb motion). Each of these modules help trainers improve their...AWARD NUMBER: W81XWH-10-1-0870 TITLE: Advanced Prosthetic Gait Training Tool PRINCIPAL INVESTIGATOR: Dr. Karim Abdel-Malek CONTRACTING...study is to produce a computer-based Advanced Prosthetic Gait Training Tool to aid in the training of clinicians at military treatment facilities

MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

International Nuclear Information System (INIS)

Mian, Muhammad Umer; Khir, M. H. Md.; Tang, T. B.; Dennis, John Ojur; Riaz, Kashif; Iqbal, Abid; Bazaz, Shafaat A.

2015-01-01

Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used

MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

Energy Technology Data Exchange (ETDEWEB)

Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B. [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Dennis, John Ojur [Department of Fundamental & Applied Sciences, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Riaz, Kashif; Iqbal, Abid [Faculty of Electronics Engineering, GIK Institute of Engineering Sciences and Technology, Topi, Khyber Pakhtunkhaw (Pakistan); Bazaz, Shafaat A. [Department of Computer Science, Center for Advance Studies in Engineering, Islamabad (Pakistan)

2015-07-22

Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.

Active Disturbance Rejection with Sliding Mode Control Based Course and Path Following for Underactuated Ships

Directory of Open Access Journals (Sweden)

Ronghui Li

2013-01-01

Full Text Available The compound control of active-disturbance-rejection control (ADRC with sliding mode is proposed to improve the performance of the closed-loop system and deal with the constraint condition problem of a surface ship. The advantages of ADRC with sliding mode were verified by ship course control simulations. Meanwhile, to solve the path-following problem of underactuated surface ships with uncertainties of internal dynamic and external disturbances, the ADRC controller with sliding mode is introduced to steer the ship to follow the desired path. In order to overcome the cross-track error caused by wind and current, drift angle is compensated in the controller by designing a coordinate transformation equation. Simulations were performed on a nonlinear kinematics model of a training ship to validate the stability and excellent robustness of the proposed path-following controller.

A statically balanced and bi-stable compliant end effector combined with a laparoscopic 2DoF robotic arm

NARCIS (Netherlands)

Lassooij, J.; Tolou, N.; Tortora, G.; Caccavaro, S.; Menciassi, A.; Herder, J.L.

2012-01-01

This article presents the design of a newly developed 2DoF robotic arm with a novel statically balanced and bi-stable compliant grasper as the end effector for laparoscopic surgery application. The arm is based on internal motors actuating 2 rotational DoFs: pitch and roll. The positive stiffness of

A NEW GENERAL 3DOF QUASI-STEADY AERODYNAMIC INSTABILITY MODEL

DEFF Research Database (Denmark)

Gjelstrup, Henrik; Larsen, Allan; Georgakis, Christos

2008-01-01

but can generally be applied for aerodynamic instability prediction for prismatic bluff bodies. The 3DOF, which make up the movement of the model, are the displacements in the XY-plane and the rotation around the bluff body’s rotational axis. The proposed model incorporates inertia coupling between...

Fiber-array based optogenetic prosthetic system for stimulation therapy

Science.gov (United States)

Gu, Ling; Cote, Chris; Tejeda, Hector; Mohanty, Samarendra

2012-02-01

Recent advent of optogenetics has enabled activation of genetically-targeted neuronal cells using low intensity blue light with high temporal precision. Since blue light is attenuated rapidly due to scattering and absorption in neural tissue, optogenetic treatment of neurological disorders may require stimulation of specific cell types in multiple regions of the brain. Further, restoration of certain neural functions (vision, and auditory etc) requires accurate spatio-temporal stimulation patterns rather than just precise temporal stimulation. In order to activate multiple regions of the central nervous system in 3D, here, we report development of an optogenetic prosthetic comprising of array of fibers coupled to independently-controllable LEDs. This design avoids direct contact of LEDs with the brain tissue and thus does not require electrical and heat isolation, which can non-specifically stimulate and damage the local brain regions. The intensity, frequency, and duty cycle of light pulses from each fiber in the array was controlled independently using an inhouse developed LabView based program interfaced with a microcontroller driving the individual LEDs. While the temporal profile of the light pulses was controlled by varying the current driving the LED, the beam profile emanating from each fiber tip could be sculpted by microfabrication of the fiber tip. The fiber array was used to stimulate neurons, expressing channelrhodopsin-2, in different locations within the brain or retina. Control of neural activity in the mice cortex, using the fiber-array based prosthetic, is evaluated from recordings made with multi-electrode array (MEA). We also report construction of a μLED array based prosthetic for spatio-temporal stimulation of cortex.

Prosthetic Engineering

Science.gov (United States)

... the household and community environments may lead to falls and injuries. This research aims to develop an ankle that can invert and evert and thereby control the center of pressure under the prosthetic foot; enhancing balance and stability of lower limb amputees. Foot-Ankle ...

Second-site prosthetic joint infection in patients with multiple prosthetic joints.

Science.gov (United States)

Clesham, Kevin; Hughes, Andrew J; O' hEireamhoin, Sven; Fleming, Catherine; Murphy, Colin G

2018-04-10

Prosthetic joint infections (PJIs) are among the most serious complications in arthroplasty. A second-site PJI in patients with multiple prosthetic joints increases morbidity, with many requiring further revision procedures. We aimed to establish why some patients with multiple joints develop second-site infections. Our institution's arthroplasty database was reviewed from 2004 to 2017. All PJIs were identified, and all patients with more than one prosthetic joint in situ were included. We recorded risk factors, causative organisms, number of procedures and length of stay. Forty-four patients meeting the criteria were identified. Four patients (9.1%) developed second-site infection. Eight patients (18.2%) developed re-infection of the primary PJI. Positive MRSA carrier status and PJI of a total knee replacement were associated with an increased risk of a second episode of infection. Patients who developed further infection had more frequent admission and longer lengths of stay than isolated PJIs. Higher morbidity and use of hospital resources are associated with this cohort of patients. PJIs in total knee replacements and positive MRSA status are associated with higher rates of second infection. Identifying this vulnerable cohort of patients at an early stage is critical to ensure measures are taken to reduce the risks of further infection.

Prosthetic joint infection: A pluridisciplinary multi-center audit bridging quality of care and outcome.

Science.gov (United States)

Roger, P-M; Tabutin, J; Blanc, V; Léotard, S; Brofferio, P; Léculé, F; Redréau, B; Bernard, E

2015-06-01

Care to patients with prosthetic joint infections (PJI) is provided after pluridisciplinary collaboration, in particular for complex presentations. Therefore, to carry out an audit in PJI justifies using pluridisciplinary criteria. We report an audit for hip or knee PJI, with emphasis on care homogeneity, length of hospital stay (LOS) and mortality. Fifteen criteria were chosen for quality of care: 5 diagnostic tools, 5 therapeutic aspects, and 5 pluridisciplinary criteria. Among these, 6 were chosen: surgical bacterial samples, surgical strategy, pluridisciplinary discussion, antibiotic treatment, monitoring of antibiotic toxicity, and prevention of thrombosis. They were scored on a scale to 20 points. We included PJI diagnosed between 2010 and 2012 from 6 different hospitals. PJI were defined as complex in case of severe comorbid conditions or multi-drug resistant bacteria, or the need for more than 1 surgery. Eighty-two PJI were included, 70 of which were complex (85%); the median score was 15, with a significant difference among hospitals: from 9 to 17.5 points, P < 0.001. The median LOS was 17 days, and not related to the criterion score; 16% of the patients required intensive care and 13% died. The cure rate was 41%, lost to follow-up 33%, and therapeutic failure 13%. Cure was associated with a higher score than an unfavorable outcome in the univariate analysis (median [range]): 16 [9-18] vs 13 [4-18], P = 0.002. Care to patients with PJI was heterogeneous, our quality criteria being correlated to the outcome. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Secure Microprocessor-Controlled Prosthetic Leg for Elderly Amputees: Preliminary Results

Directory of Open Access Journals (Sweden)

S. Krut

2011-01-01

Full Text Available We introduce a new prosthetic leg design, adapted to elderly trans-femoral amputees. Technical progress in prosthesis design mainly concerns active individuals. An important number of elderly amputees are not very mobile, tire easily, present reduced muscle strength, and have difficulties managing their balance. Therefore, the needs and characteristics of this specific population are very different from those of younger ones and the prosthetic solutions are not adapted. Our artificial knee has been designed to fulfill the specific requirements of this population in terms of capabilities, transfer assistance, security, intuitiveness, simplicity of use, and types of physical activity to be performed. We particularly focused our efforts on ensuring safe and secure stand-to-sit transfers. We developed an approach to control the different states of the prosthetic joint (blocked, free, resistant, associated with different physical activities. Amputee posture and motion are observed through a single multi-axis force sensor embedded in the prosthesis. The patient behaves naturally, while the controller analyses his movements in order to detect his intention to sit down. The detection algorithm is based on a reference pattern, calibrated individually, to which the sensor data are compared, and submitted to a set of tests allowing the discrimination of the intention to sit down from other activities. Preliminary validation of the system has been performed in order to verify the applicability of the prosthesis to different tasks: walking, standing, sitting down, standing up, picking up an object from a chair, slope and stair climbing.

Prosthetics / Limb Loss

Science.gov (United States)

... implant to encourage the sealing process. Implanting titanium prosthetic components avoids the need for a socket. But preventing bacterial invasion and infection is a key challenge, one that this research ...

Review of Prosthetic Joint Infection from Listeria monocytogenes.

Science.gov (United States)

Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

2016-12-01

Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

Development of a simple system for simultaneously measuring 6DOF geometric motion errors of a linear guide.

Science.gov (United States)

Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You

2013-11-04

A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.

Pannus-related prosthetic valve dysfunction. Case report.

Science.gov (United States)

Moldovan, Maria-Sînziana; Bedeleanu, Daniela; Kovacs, Emese; Ciumărnean, Lorena; Molnar, Adrian

2016-01-01

Pannus-related prosthetic valve dysfunction, a complication of mechanical prosthetic valve replacement, is rare, with a slowly progressive evolution, but it can be acute, severe, requiring surgical reintervention. We present the case of a patient with a mechanical single disc aortic prosthesis, with moderate prosthesis-patient mismatch, minor pannus found on previous ultrasound examinations, who presented to our service with angina pain with a duration of 1 hour, subsequently interpreted as non-ST segment elevation myocardial infarction (NSTEMI) syndrome. Coronarography showed normal epicardial coronary arteries, an ample movement of the prosthetic disc, without evidence of coronary thromboembolism, and Gated Single-Photon Emission Computerized Tomography (SPECT) with Technetium (Tc)-99m detected no perfusion defects. Transthoracic echocardiography (TTE) evidenced a dysfunctional prosthesis due to a subvalvular mass; transesophageal echocardiography (TOE) showed the interference of this mass, with a pannus appearance, with the closure of the prosthetic disc. Under conditions of repeated angina episodes, under anticoagulant treatment, surgery was performed, with the intraoperative confirmation of pannus and its removal. Postoperative evolution was favorable. This case reflects the diagnostic and therapeutic management problems of pannus-related prosthetic valve dysfunction.

Passive prosthetic hands and tools: A literature review.

Science.gov (United States)

Maat, Bartjan; Smit, Gerwin; Plettenburg, Dick; Breedveld, Paul

2018-02-01

The group of passive prostheses consists of prosthetic hands and prosthetic tools. These can either be static or adjustable. Limited research and development on passive prostheses has been performed although many people use these prosthesis types. Although some publications describe passive prostheses, no recent review of the peer-reviewed literature on passive prostheses is available. Review the peer-reviewed literature on passive prostheses for replacement of the hand. Literature review. Four electronic databases were searched using a Boolean combination of relevant keywords. English-language articles relevant to the objective were selected. In all, 38 papers were included in the review. Publications on passive prosthetic hands describe their users, usage, functionality, and problems in activities of daily living. Publications on prosthetic tools mostly focus on sport, recreation, and vehicle driving. Passive hand prostheses receive little attention in prosthetic research and literature. Yet one out of three people with a limb deficiency uses this type of prosthesis. Literature indicates that passive prostheses can be improved on pulling and grasping functions. In the literature, ambiguous names are used for different types of passive prostheses. This causes confusion. We present a new and clear classification of passive prostheses. Clinical relevance This review provides information on the users of passive prosthetic hands and tools, their usage and the functionality. Passive prostheses receive very little attention and low appreciation in literature. Passive prosthetic hands and tools show to be useful to many unilateral amputees and should receive more attention and higher acceptance.

Validation of the prosthetic esthetic index

DEFF Research Database (Denmark)

Özhayat, Esben B; Dannemand, Katrine

2014-01-01

OBJECTIVES: In order to diagnose impaired esthetics and evaluate treatments for these, it is crucial to evaluate all aspects of oral and prosthetic esthetics. No professionally administered index currently exists that sufficiently encompasses comprehensive prosthetic esthetics. This study aimed...... to validate a new comprehensive index, the Prosthetic Esthetic Index (PEI), for professional evaluation of esthetics in prosthodontic patients. MATERIAL AND METHODS: The content, criterion, and construct validity; the test-retest, inter-rater, and internal consistency reliability; and the sensitivity...... furthermore distinguish between participants and controls, indicating sufficient sensitivity. CONCLUSION: The PEI is considered a valid and reliable instrument involving sufficient aspects for assessment of the professionally evaluated esthetics in prosthodontic patients. CLINICAL RELEVANCE...

Candida infection of a prosthetic shoulder joint

Energy Technology Data Exchange (ETDEWEB)

Lichtman, E.A.

1983-09-01

A heroin addict developed a Candida parapsilosis infection in a prosthetic shoulder joint. Radiographs showed loose fragments of cement with prosthetic loosening. The patient was treated with removal of the prosthesis and intravenous amphotericin B followed by oral ketoconazole.

Design and clinical outcome of a novel 3D-printed prosthetic joint replacement for the human temporomandibular joint.

Science.gov (United States)

Ackland, David; Robinson, Dale; Lee, Peter Vee Sin; Dimitroulis, George

2018-05-11

Stock prosthetic temporomandibular joint replacements come in limited sizes, and do not always encompass the joint anatomy that presents clinically. The aims of this study were twofold. Firstly, to design a personalized prosthetic total joint replacement for the treatment of a patient's end-stage temporomandibular joint osteoarthritis, to implant the prosthesis into the patient, and assess clinical outcome 12-months post-operatively; and secondly, to evaluate the influence of changes in prosthetic condyle geometry on implant load response during mastication. A 48-year-old female patient with Grade-5 osteoarthritis to the left temporomandibular joint was recruited, and a prosthesis developed to match the native temporomandibular joint anatomy. The prosthesis was 3D printed, sterilized and implanted into the patient, and pain and function measured 12-months post-operatively. The prosthesis load response during a chewing-bite and maximum-force bite was evaluated using a personalized multi-body musculoskeletal model. Simulations were performed after perturbing condyle thickness, neck length and head sphericity. Increases in prosthetic condyle neck length malaligned the mandible and perturbed temporomandibular joint force. Changes in condylar component thickness greatly influenced fixation screw stress response, while a more eccentric condylar head increased prosthetic joint-contact loading. Post-operatively, the prosthetic temporomandibular joint surgery reduced patient pain from 7/10 to 1/10 on a visual analog scale, and increased intercisal opening distance from 22 mm to 38 mm. This study demonstrates effectiveness of a personalized prosthesis that may ultimately be adapted to treat a wide-range of end-stage temporomandibular joint conditions, and highlights sensitivity of prosthesis load response to changes in condylar geometry. Copyright © 2018 Elsevier Ltd. All rights reserved.

Candida infection of a prosthetic shoulder joint

International Nuclear Information System (INIS)

Lichtman, E.A.; Veterans Administration Medical Center, New York

1983-01-01

A heroin addict developed a Candida parapsilosis infection in a prosthetic shoulder joint. Radiographs showed loose fragments of cement with prosthetic loosening. The patient was treated with removal of the prosthesis and intravenous amphotericin B followed by oral ketoconazole. (orig.)

Management of Prosthetic Joint Infection.

Science.gov (United States)

Tande, Aaron J; Gomez-Urena, Eric O; Berbari, Elie F; Osmon, Douglas R

2017-06-01

Although uncommon, prosthetic joint infection is a devastating complication. This challenging condition requires a coordinated management approach to achieve good patient outcomes. This review details the general principles to consider when managing patients with prosthetic joint infection. The different medical/surgical treatment strategies and how to appropriately select a strategy are discussed. The data to support each strategy are presented, along with discussion of antimicrobial strategies in specific situations. Copyright © 2017 Elsevier Inc. All rights reserved.

Which prosthetic foot to prescribe?

OpenAIRE

De Asha, AR; Barnett, CT; Struchkov, V; Buckley, JG

2017-01-01

Introduction: \\ud Clinicians typically use findings from cohort studies to objectively inform judgements regarding the potential (dis)advantages of prescribing a new prosthetic device. However, before finalising prescription a clinician will typically ask a patient to 'try out' a change of prosthetic device while the patient is at the clinic. Observed differences in gait when using the new device should be the result of the device’s mechanical function, but could also conceivably be due to pa...

Real-time control of the 3-DOF sled dynamics of a null-flux Maglev System with a passive sled

NARCIS (Netherlands)

Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.

2006-01-01

The real-time control of the three degrees of freedom (DOF) dynamics of an electrodynamic (EDS) Maglev vehicle is presented. The design is based on a 5-DOF state-space model of the sled dynamics that uses a simple algebraic model to describe the interaction between the -flux coils on the track and

Bruxism and prosthetic treatment: a critical review.

Science.gov (United States)

Johansson, Anders; Omar, Ridwaan; Carlsson, Gunnar E

2011-07-01

Based on the findings from available research on bruxism and prosthetic treatment published in the dental literature, an attempt was made to draw conclusions about the existence of a possible relationship between the two, and its clinical relevance. MEDLINE/PubMed searches were conducted using the terms 'bruxism' and 'prosthetic treatment', as well as combinations of these and related terms. The few studies judged to be relevant were critically reviewed, in addition to papers found during an additional manual search of reference lists within selected articles. Bruxism is a common parafunctional habit, occurring both during sleep and wakefulness. Usually it causes few serious effects, but can do so in some patients. The etiology is multifactorial. There is no known treatment to stop bruxism, including prosthetic treatment. The role of bruxism in the process of tooth wear is unclear, but it is not considered a major cause. As informed by the present critical review, the relationship between bruxism and prosthetic treatment is one that relates mainly to the effect of the former on the latter. Bruxism may be included among the risk factors, and is associated with increased mechanical and/or technical complications in prosthodontic rehabilitation, although it seems not to affect implant survival. When prosthetic intervention is indicated in a patient with bruxism, efforts should be made to reduce the effects of likely heavy occlusal loading on all the components that contribute to prosthetic structural integrity. Failure to do so may indicate earlier failure than is the norm. Copyright © 2011 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

Multi-Axis Prosthetic Knee Resembles Alpine Skiing Movements of an Intact Leg

Directory of Open Access Journals (Sweden)

Ivan Demšar, Jože Duhovnik, Blaž Lešnik, Matej Supej

2015-12-01

Full Text Available The purpose of the study was to analyse the flexion angles of the ski boot, ankle and knee joints of an above-knee prosthesis and to compare them with an intact leg and a control group of skiers. One subject with an above-knee amputation of the right leg and eight healthy subjects simulated the movement of a skiing turn by performing two-leg squats in laboratory conditions. By adding additional loads in proportion to body weight (BW; +1/3 BW, +2/3 BW, +3/3 BW, various skiing regimes were simulated. Change of Flexion Angle (CoFA and Range of Motion (RoM in the ski boot, ankle and knee joints were calculated and compared. An average RoM in the skiing boot on the side of prosthesis (4.4 ± 1.1° was significantly lower compared to an intact leg (5.9 ± 1.8° and the control group (6.5 ± 2.3°. In the ankle joint, the average RoM was determined to be 13.2±2.9° in the prosthesis, 12.7 ± 2.8° in an intact leg and 14.8±3.6 in the control group. However, the RoM of the knee joint in the prosthesis (42.2 ± 4.2° was significantly larger than that of the intact leg (34.7 ± 4.4°. The average RoM of the knee joint in the control group was 47.8 ± 5.4°. The influences of additional loads on the kinematics of the lower extremities were different on the side of the prosthesis and on the intact leg. In contrast, additional loads did not produce any significant differences in the control group. Although different CoFAs in the ski boot, ankle and knee joints were used, an above-knee prosthesis with a built-in multi-axis prosthetic knee enables comparable leg kinematics in simulated alpine skiing.

A Six-DOF Buoyancy Tank Microgravity Test Bed with Active Drag Compensation

Science.gov (United States)

Sun, Chong; Chen, Shiyu; Yuan, Jianping; Zhu, Zhanxia

2017-10-01

Ground experiment under microgravity is very essential because it can verify the space enabling technologies before applied in space missions. In this paper, a novel ground experiment system that can provide long duration, large scale and high microgravity level for the six degree of freedom (DOF) spacecraft trajectory tracking is presented. In which, the most gravity of the test body is balanced by the buoyancy, and the small residual gravity is offset by the electromagnetic force. Because the electromagnetic force on the test body can be adjusted in the electromagnetic system, it can significantly simplify the balancing process using the proposed microgravity test bed compared to the neutral buoyance system. Besides, a novel compensation control system based on the active disturbance rejection control (ADRC) method is developed to estimate and compensate the water resistance online, in order to improve the fidelity of the ground experiment. A six-DOF trajectory tracking in the microgravity system is applied to testify the efficiency of the proposed compensation controller, and the experimental simulation results are compared to that obtained using the classic proportional-integral-derivative (PID) method. The simulation results demonstrated that, for the six-DOF motion ground experiment, the microgravity level can reach to 5 × 10-4 g. And, because the water resistance has been estimated and compensated, the performance of the presented controller is much better than the PID controller. The presented ground microgravity system can be applied in on-orbit service and other related technologies in future.

Graft-Sparing Strategy for Thoracic Prosthetic Graft Infection.

Science.gov (United States)

Uchino, Gaku; Yoshida, Takeshi; Kakii, Bunpachi; Furui, Masato

2018-04-01

 Thoracic prosthetic graft infection is a rare but serious complication with no standard management. We reported our surgical experience on graft-sparing strategy for thoracic prosthetic graft infection.  This study included patients who underwent graft-sparing surgery for thoracic prosthetic graft infection at Matsubara Tokushukai Hospital in Japan from January 2000 to October 2017.  There were 17 patients included in the analyses, with a mean age at surgery of 71.0 ± 10.5 years; 11 were men. In-hospital mortality was observed in five patients (29.4%).  Graft-sparing surgery for thoracic prosthetic graft infection is an alternative option particularly for early graft infection after hemiarch replacement. Georg Thieme Verlag KG Stuttgart · New York.

Multi-Objective Motion Control Optimization for the Bridge Crane System

Directory of Open Access Journals (Sweden)

Renxin Xiao

2018-03-01

Full Text Available A novel control algorithm combining the linear quadratic regulator (LQR control and trajectory planning (TP is proposed for the control of an underactuated crane system, targeting position adjustment and swing suppression. The TP is employed to control the swing angle within certain constraints, and the LQR is applied to achieve anti-disturbance. In order to improve the accuracy of the position control, a differential-integral control loop is applied. The weighted LQR matrices representing priorities of the state variables for the bridge crane motion are searched by the multi-objective genetic algorithm (MOGA. The stability proof is provided in order to validate the effectiveness of the proposed algorithm. Numerous simulation and experimental validations justify the feasibility of the proposed method.

Echocardiographic evaluation of heart valve prosthetic dysfunction

Directory of Open Access Journals (Sweden)

Yuriy Ivaniv

2018-02-01

Full Text Available Patients with replaced heart valve submitted to echocardiographic examination may have symptoms related either to valvular malfunction or ventricular dysfunction from different causes. Clinical examination is not reliable in a prosthetic valve evaluation and the main information regarding its function could be obtained using different cardiac ultrasound modalities. This review provides a description of echocardiographic and Doppler techniques useful in evaluation of prosthetic heart valves. For the interpretation of echocardiography there is a need in special knowledge of prosthesis types and possible reasons of prosthetic function deterioration. Echocardiography allows to reveal valve thrombosis, pannus formation, vegetation and such complications of infective endocarditis as valve ring abscess or dehiscence. Transthoracic echocardiography requires different section plane angles and unconventional views. Transesophageal echocardiography is more often used than in native valve examination due to better visualization of prosthetic valve structure and function. Three-dimensional echocardiography could provide more detailed visual information especially in the assessment of paravalvular regurgitation or valve obstruction.

Prosthetic management of deciduous teeth

OpenAIRE

Bassil, Jean

2015-01-01

Projeto de Pós-Graduação/Dissertação apresentado à Universidade Fernando Pessoa como parte dos requisitos para obtenção do grau de Mestre em Medicina Dentária Introduction: Situations of single or multiple edentulous are not an exception during childhood. Prosthetic management is necessary in case of absence of replacing tooth or when its eruption is planned too far in time. Indications of prosthetic rehabilitation for children are multiple and rise from the etiologic factors caus...

100 top-cited scientific papers in limb prosthetics.

Science.gov (United States)

Eshraghi, Arezoo; Osman, Noor Azuan Abu; Gholizadeh, Hossein; Ali, Sadeeq; Shadgan, Babak

2013-11-17

Research has tremendously contributed to the developments in both practical and fundamental aspects of limb prosthetics. These advancements are reflected in scientific articles, particularly in the most cited papers. This article aimed to identify the 100 top-cited articles in the field of limb prosthetics and to investigate their main characteristics. Articles related to the field of limb prosthetics and published in the Web of Knowledge database of the Institute for Scientific Information (ISI) from the period of 1980 to 2012. The 100 most cited articles in limb prosthetics were selected based on the citation index report. All types of articles except for proceedings and letters were included in the study. The study design and level of evidence were determined using Sackett's initial rules of evidence. The level of evidence was categorized either as a systematic review or meta-analysis, randomized controlled trial, cohort study, case-control study, case series, expert opinion, or design and development. The top cited articles in prosthetics were published from 1980 to 2012 with a citation range of 11 to 90 times since publication. The mean citation rate was 24.43 (SD 16.7) times. Eighty-four percent of the articles were original publications and were most commonly prospective (76%) and case series studies (67%) that used human subjects (96%) providing level 4 evidence. Among the various fields, rehabilitation (47%), orthopedics (29%), and sport sciences (28%) were the most common fields of study. The study established that studies conducted in North America and were written in English had the highest citations. Top cited articles primarily dealt with lower limb prosthetics, specifically, on transtibial and transradial prosthetic limbs. Majority of the articles were experimental studies.

Lightweight custom composite prosthetic components using an additive manufacturing-based molding technique.

Science.gov (United States)

Leddy, Michael T; Belter, Joseph T; Gemmell, Kevin D; Dollar, Aaron M

2015-01-01

Additive manufacturing techniques are becoming more prominent and cost-effective as 3D printing becomes higher quality and more inexpensive. The idea of 3D printed prosthetics components promises affordable, customizable devices, but these systems currently have major shortcomings in durability and function. In this paper, we propose a fabrication method for custom composite prostheses utilizing additive manufacturing, allowing for customizability, as well the durability of professional prosthetics. The manufacturing process is completed using 3D printed molds in a multi-stage molding system, which creates a custom finger or palm with a lightweight epoxy foam core, a durable composite outer shell, and soft urethane gripping surfaces. The composite material was compared to 3D printed and aluminum materials using a three-point bending test to compare stiffness, as well as gravimetric measurements to compare weight. The composite finger demonstrates the largest stiffness with the lowest weight compared to other tested fingers, as well as having customizability and lower cost, proving to potentially be a substantial benefit to the development of upper-limb prostheses.

Responsiveness of the Prosthetic Esthetic Scale

DEFF Research Database (Denmark)

Øzhayat, Esben Boeskov

2017-01-01

Objectives The aim of the study was to evaluate the responsiveness of the Prosthetic Esthetic Index (PEI) in a population who received prosthetic replacements. Materials and methods Fifty-seven patients who received prosthetic replacement of at least one tooth by means of fixed or removable...... prosthesis were professionally esthetically evaluated using the PEI and the Dental Aesthetic Index (DAI) before and after treatment. The participants further evaluated their oral esthetics using the Oral Health Impact Profile Aesthetic (OHIP-Aes) and Orofacial Esthetic Index (OES). Responsiveness......-Aes and OES scores. The PEI was more consistent in responsiveness than the DAI. Conclusions The PEI shows sufficient responsiveness for use in longitudinal studies and for use as a follow-up measure in clinical practice. Clinical relevance The PEI can in a standardized manner monitor and document esthetic...

Stiffness and hysteresis properties of some prosthetic feet

OpenAIRE

van Jaarsveld, H.W.L.; Grootenboer, H.J.; de Vries, J.; Koopman, Hubertus F.J.M.

1990-01-01

A prosthetic foot is an important element of a prosthesis, although it is not always fully recognized that the properties of the foot, along with the prosthetic knee joint and the socket, are in part responsible for the stability and metabolic energy cost during walking. The stiffness and the hysteresis, which are the topics of this paper, are not properly prescribed, but could be adapted to improve the prosthetic walking performance. The shape is strongly related to the cosmetic appearance a...

Control method for prosthetic devices

Science.gov (United States)

Bozeman, Richard J., Jr. (Inventor)

1995-01-01

A control system and method for prosthetic devices is provided. The control system comprises a transducer for receiving movement from a body part for generating a sensing signal associated with that movement. The sensing signal is processed by a linearizer for linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part. The linearized sensing signal is normalized to be a function of the entire range of body part movement from the no-shrug position of the moveable body part. The normalized signal is divided into a plurality of discrete command signals. The discrete command signals are used by typical converter devices which are in operational association with the prosthetic device. The converter device uses the discrete command signals for driving the moveable portions of the prosthetic device and its sub-prosthesis. The method for controlling a prosthetic device associated with the present invention comprises the steps of receiving the movement from the body part, generating a sensing signal in association with the movement of the body part, linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part, normalizing the linear signal to be a function of the entire range of the body part movement, dividing the normalized signal into a plurality of discrete command signals, and implementing the plurality of discrete command signals for driving the respective moveable prosthesis device and its sub-prosthesis.

Towards frameless maskless SRS through real-time 6DoF robotic motion compensation

Science.gov (United States)

Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.

2017-12-01

Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and

Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.

Science.gov (United States)

Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D

2017-11-13

Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS

Tomographic and echocardiographic diagnosis of mitral prosthetic valve thrombosis

International Nuclear Information System (INIS)

Sainz Gonzalez de la Penna, Benito; Ramos Gutierrez, Luis Benito; Gonzalez Artiles, Iovank

2010-01-01

Despite the progress achieved in the design of mechanical prosthetic valves, prosthetic valve thrombosis remains a frequent cause of morbidity, usually due to incorrect anticoagulation. A patient was presented with mitral prosthetic thrombosis one year after implantation, who had been diagnosed by transthoracic transesophageal echocardiography imaging and 64-slice computed tomography. Thrombolytic therapy was successful and led to the satisfactory evolution of the patient

Prosthetic Consideration in Implant-supported Prosthesis: A Review of Literature.

Science.gov (United States)

Gowd, Manga Snigdha; Shankar, Thatapudi; Ranjan, Rajeev; Singh, Arpita

2017-06-01

Modern dentistry has changed tremendously with implant therapy. For the successful implant therapy, making a proper treatment plan considering both surgical and prosthetic part in mind is the key of success. Often practitioners tend to create a treatment plan overlooking the basic principles of prosthetic part. This present review has discussed various prosthetic consideration of implant-supported prosthesis. A step-by-step detailed prosthetic option with their indications has been discussed to help all dental implant practitioners in making of an optimal treatment plan for each case.

The role of vision processing in prosthetic vision.

Science.gov (United States)

Barnes, Nick; He, Xuming; McCarthy, Chris; Horne, Lachlan; Kim, Junae; Scott, Adele; Lieby, Paulette

2012-01-01

Prosthetic vision provides vision which is reduced in resolution and dynamic range compared to normal human vision. This comes about both due to residual damage to the visual system from the condition that caused vision loss, and due to limitations of current technology. However, even with limitations, prosthetic vision may still be able to support functional performance which is sufficient for tasks which are key to restoring independent living and quality of life. Here vision processing can play a key role, ensuring that information which is critical to the performance of key tasks is available within the capability of the available prosthetic vision. In this paper, we frame vision processing for prosthetic vision, highlight some key areas which present problems in terms of quality of life, and present examples where vision processing can help achieve better outcomes.

Antithrombotic Therapy in Patients with Prosthetic Heart Valves

Directory of Open Access Journals (Sweden)

Mohamed HA

2009-01-01

Full Text Available Patients with mechanical valve prostheses require a lifelong anticoagulant treatment. The combined use of Warfarin and low-dose aspirin appears to reduce the risk of valve thrombosis and systemic embolism at a low risk of bleeding. The management of women with prosthetic heart valves during pregnancy poses a particular challenge, as there are no available controlled clinical trials to provide guidelines for effective antithrombotic therapy. Oral anticoagulants, such as Warfarin, cause foetal embryopathy; unfractionated heparin and low-molecular-weight heparin have been reported to be ineffective in preventing thromboembolic complications.This article discusses the available data and the most recent guidelines in the antithrombotic management of patients with prosthetic valves, and antithrombotic therapy in various clinical situations such as pregnant women with prosthetic heart valves, and patients with prosthetic heart valves undergoing noncardiac surgery.

Amputation and Prosthetics

Science.gov (United States)

... All Topics A-Z Videos Infographics Symptom Picker Anatomy Bones Joints Muscles Nerves Vessels Tendons About Hand Surgery What is a Hand Surgeon? What is a Hand Therapist? Media Find a Hand Surgeon Home Anatomy Amputation and Prosthetics Email to a friend * required ...

38 CFR 17.150 - Prosthetic and similar appliances.

Science.gov (United States)

2010-07-01

... appliances. 17.150 Section 17.150 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Prosthetic, Sensory, and Rehabilitative Aids § 17.150 Prosthetic and similar appliances... appliances including invalid lifts and therapeutic and rehabilitative devices, and special clothing made...

Viability of Controlling Prosthetic Hand Utilizing Electroencephalograph (EEG) Dataset Signal

Science.gov (United States)

Miskon, Azizi; A/L Thanakodi, Suresh; Raihan Mazlan, Mohd; Mohd Haziq Azhar, Satria; Nooraya Mohd Tawil, Siti

2016-11-01

This project presents the development of an artificial hand controlled by Electroencephalograph (EEG) signal datasets for the prosthetic application. The EEG signal datasets were used as to improvise the way to control the prosthetic hand compared to the Electromyograph (EMG). The EMG has disadvantages to a person, who has not used the muscle for a long time and also to person with degenerative issues due to age factor. Thus, the EEG datasets found to be an alternative for EMG. The datasets used in this work were taken from Brain Computer Interface (BCI) Project. The datasets were already classified for open, close and combined movement operations. It served the purpose as an input to control the prosthetic hand by using an Interface system between Microsoft Visual Studio and Arduino. The obtained results reveal the prosthetic hand to be more efficient and faster in response to the EEG datasets with an additional LiPo (Lithium Polymer) battery attached to the prosthetic. Some limitations were also identified in terms of the hand movements, weight of the prosthetic, and the suggestions to improve were concluded in this paper. Overall, the objective of this paper were achieved when the prosthetic hand found to be feasible in operation utilizing the EEG datasets.

Distal anastomotic vein adjunct usage in infrainguinal prosthetic bypasses.

Science.gov (United States)

McPhee, James T; Goodney, Philip P; Schanzer, Andres; Shaykevich, Shimon; Belkin, Michael; Menard, Matthew T

2013-04-01

). The DVA group had a higher rate of completion angiogram performed (55.7% vs 37.5%; P =.002) and were more likely to be discharged on coumadin (53.4% vs 37.1%; P =.01). By multivariable analysis, use of a distal DVA was protective against MALEs (hazard ratio, 0.36; 95% confidence interval, 0.14-0.90; P = .03). This contemporary multi-institutional propensity-matched study demonstrates that patients that receive distal anastomotic vein adjuncts as part of infrainguinal prosthetic bypass operations in general have more extreme comorbidities and more technically challenging operations based on level of target vessel and prior bypass attempts. After propensity-matched analysis, the use of a DVA may protect against MALEs in prosthetic bypass surgery and should be considered when feasible. Copyright © 2013 Society for Vascular Surgery. Published by Mosby, Inc. All rights reserved.

Pre-prosthetic surgical alterations in maxillectomy to enhance the prosthetic prognoses as part of rehabilitation of oral cancer patient.

Science.gov (United States)

El Fattah, H; Zaghloul, A; Pedemonte, E; Escuin, T

2012-03-01

After maxillectomy, prosthetic restoration of the resulting defect is an essential step because it signals the beginning of patient's rehabilitation. The obturator used to restore the defect should be comfortable, restore adequate speech, deglutition, mastication, and be cosmetically acceptable, success will depend on the size and location of the defect and the quantity and integrity of the remaining structures, in addition to pre-prosthetic surgical preparation of defect site. Preoperative cooperation between the oncologist surgeon and the maxillofacial surgeon may allow obturation of a resultant defect by preservation of the premaxilla or the tuberosity on the defect side and maintaining the alveolar bone or teeth adjacent to the defect. This study evaluates the importance of pre-prosthetic surgical alterations at the time maxillectomy on the enhancement of the prosthetic prognoses as part of the rehabilitation of oral cancer patient. The study was carried out between 2003- 2008, on 66 cancer patients(41 male-25 female) age ranged from 33 to 72 years, at National Cancer Institute, Cairo University, whom underwent maxillectomy surgery to remove malignant tumor as a part of cancer treatment. Patients were divided in two groups. Group A: Resection of maxilla followed by preprosthetic surgical preparation. Twenty-four cancer patients (13 male - 11 female). Group B: Resection of maxilla without any preprosthetic surgical preparation. Forty-two cancer patients (28 male-14 female). Outcome variables measured included facial contour and aesthetic results, speech understandability, ability to eat solid foods, oronasal separation, socializing outside the home, and return-to-work status. Flap success and donor site morbidity were also studied. To improve the prosthetic restoration of maxillary defect resulting maxillary resection as part treatment of maxillofacial tumor depends on the close cooperation between prosthodontist and surgeon, by combination of pre-prosthetic

Rotationplasty with vascular reconstruction for prosthetic knee joint infection.

Science.gov (United States)

Fujiki, Masahide; Miyamoto, Shimpei; Nakatani, Fumihiko; Kawai, Akira; Sakuraba, Minoru

2015-01-01

Rotationplasty is used most often as a function-preserving salvage procedure after resection of sarcomas of the lower extremity; however, it is also used after infection of prosthetic knee joints. Conventional vascular management during rotationplasty is to preserve and coil major vessels, but recently, transection and reanastomosis of the major vessels has been widely performed. However, there has been little discussion regarding the optimal vascular management of rotationplasty after infection of prosthetic knee joints because rotationplasty is rarely performed for this indication. We reviewed four patients who had undergone resection of osteosarcomas of the femur, placement of a prosthetic knee joint, and rotationplasty with vascular reconstruction from 2010 to 2013. The mean interval between prosthetic joint replacement and rotationplasty was 10.4 years and the mean interval between the diagnosis of prosthesis infection and rotationplasty was 7.9 years. Rotationplasty was successful in all patients; however, in one patient, arterial thrombosis developed and necessitated urgent surgical removal and arterial reconstruction. All patients were able to walk independently with a prosthetic limb after rehabilitation. Although there is no consensus regarding the most appropriate method of vascular management during rotationplasty for revision of infected prosthetic joints, vascular transection and reanastomosis is a useful option.

Control System for Prosthetic Devices

Science.gov (United States)

Bozeman, Richard J. (Inventor)

1996-01-01

A control system and method for prosthetic devices is provided. The control system comprises a transducer for receiving movement from a body part for generating a sensing signal associated with that of movement. The sensing signal is processed by a linearizer for linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part. The linearized sensing signal is normalized to be a function of the entire range of body part movement from the no-shrug position of the moveable body part through the full-shrg position of the moveable body part. The normalized signal is divided into a plurality of discrete command signals. The discrete command signals are used by typical converter devices which are in operational association with the prosthetic device. The converter device uses the discrete command signals for driving the moveable portions of the prosthetic device and its sub-prosthesis. The method for controlling a prosthetic device associated with the present invention comprises the steps of receiving the movement from the body part, generating a sensing signal in association with the movement of the body part, linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part, normalizing the linear signal to be a function of the entire range of the body part movement, dividing the normalized signal into a plurality of discrete command signals, and implementing the plurality of discrete command signals for driving the respective moveable prosthesis device and its sub-prosthesis.

Successful thrombolysis of aortic prosthetic valve thrombosis during ...

African Journals Online (AJOL)

Successful thrombolysis of aortic prosthetic valve thrombosis during first trimester of pregnancy. A Shukla, AP Raval, R Shah. Abstract. Prosthetic heart valve thrombosis during pregnancy is life-threatening. Standard surgical treatment using cardiopulmonary bypass carries high maternal and fetal complications. Here we ...

Welding of Prosthetic Alloys

Directory of Open Access Journals (Sweden)

Wojciechowska M.

2015-04-01

Full Text Available This paper presents the techniques of joining metal denture elements, used in prosthetic dentistry: the traditional soldering technique with a gas burner and a new technique of welding with a laser beam; the aim of the study was to make a comparative assessment of the quality of the joints in view of the possibility of applying them in prosthetic structures. Fractographic examinations were conducted along with tensile strength and impact strength tests, and the quality of the joints was assessed compared to the solid metal. The experiments have shown that the metal elements used to make dentures, joined by the technique which employs a laser beam, have better strength properties than those achieved with a gas burner.

Prosthetic above-knee femoropopliteal bypass grafting: five-year results of a randomized trial.

Science.gov (United States)

Green, R M; Abbott, W M; Matsumoto, T; Wheeler, J R; Miller, N; Veith, F J; Money, S; Garrett, H E

2000-03-01

This trial was designed to identify factors affecting patency rates of primary prosthetic above-knee femoropopliteal bypass grafts at 5 years. A multi-institutional, prospective trial randomized 240 patients to compare patency rates of Gore-tex and Hemashield above-knee femoropopliteal bypass grafts at 5 years. Univariate comparisons of patency between levels of each prognostic variable were made with the Kaplan-Meier method. Variables that had a univariate P value less than.25 or those known to be important were submitted to a Cox regression analysis. The patient survival rate at 5 years was 59.4%. There were no differences in primary or secondary patency rates at 5 years between the two graft materials (primary, 45% vs 43% and secondary, 68% vs 68%). The risk for graft occlusion was significantly increased for patients younger than 65 years (2.1; P =.001) and for grafts with a diameter less than 7 mm (1.65; P =.0219). Variables with no apparent independent effect on patency rates were smoking status, runoff, diabetes mellitus, sex, presenting symptoms, and postoperative treatment with aspirin or Coumadin. Noninvasive test results were not predictive of subsequent graft function. Although the type of prosthetic used for above-knee femoropopliteal bypass grafts does not affect 5-year patency rates, age and graft size do influence results. These factors should be considered before a prosthetic bypass grafting procedure. Furthermore, these data should serve as a contemporary standard, with which evolving and conventional procedures can be compared.

Chattering-Free Neuro-Sliding Mode Control of 2-DOF Planar Parallel Manipulators

Directory of Open Access Journals (Sweden)

Tien Dung Le

2013-01-01

Full Text Available This paper proposes a novel chattering free neuro-sliding mode controller for the trajectory tracking control of two degrees of freedom (DOF parallel manipulators which have a complicated dynamic model, including modelling uncertainties, frictional uncertainties and external disturbances. A feedforward neural network (NN is combined with an error estimator to completely compensate the large nonlinear uncertainties and external disturbances of the parallel manipulators. The online weight tuning algorithms of the NN and the structure of the error estimator are derived with the strict theoretical stability proof of the Lyapunov theorem. The upper bound of uncertainties and the upper bound of the approximation errors are not required to be known in advance in order to guarantee the stability of the closed-loop system. The example simulation results show the effectiveness of the proposed control strategy for the tracking control of a 2-DOF parallel manipulator. It results in its being chattering-free, very small tracking errors and its robustness against uncertainties and external disturbances.

Ten questions on prosthetic shoulder infection.

Science.gov (United States)

Pinder, Elizabeth M; Ong, Joshua Cy; Bale, R Stephen; Trail, Ian A

2016-07-01

Prosthetic shoulder infection can cause significant morbidity secondary to pain and stiffness. Symptoms may be present for years before diagnosis because clinical signs are often absent and inflammatory markers may be normal. An emerging common culprit, Propionibacterium acnes, is hard to culture and so prolonged incubation is necessary. A negative culture result does not always exclude infection and new synovial fluid biochemical markers such as α defensin are less sensitive than for lower limb arthroplasty. A structured approach is necessary when assessing patients for prosthetic shoulder joint infection. This includes history, examination, serum inflammatory markers, plain radiology and aspiration and/or biopsy. A classification for the likelihood of prosthetic shoulder infection has been described based on culture, pre-operative and intra-operative findings. Treatment options include antibiotic suppression, debridement with component retention, one-stage revision, two-stage revision and excision arthroplasty. Revision arthroplasty is associated with the best outcomes.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

Science.gov (United States)

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

OpenAIRE

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

21 CFR 890.3025 - Prosthetic and orthotic accessory.

Science.gov (United States)

2010-04-01

... (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3025... intended for medical purposes to support, protect, or aid in the use of a cast, orthosis (brace), or prosthesis. Examples of prosthetic and orthotic accessories include the following: A pelvic support band and...

Undergraduate prosthetics and orthotics teaching methods: A baseline for international comparison.

Science.gov (United States)

Aminian, Gholamreza; O'Toole, John M; Mehraban, Afsoon Hassani

2015-08-01

Education of Prosthetics and Orthotics is a relatively recent professional program. While there has been some work on various teaching methods and strategies in international medical education, limited publication exists within prosthetics and orthotics. To identify the teaching and learning methods that are used in Bachelor-level prosthetics and orthotics programs that are given highest priority by expert prosthetics and orthotics instructors from regions enjoying a range of economic development. Mixed method. The study partly documented by this article utilized a mixed method approach (qualitative and quantitative methods) within which each phase provided data for other phases. It began with analysis of prosthetics and orthotics curricula documents, which was followed by a broad survey of instructors in this field and then a modified Delphi process. The expert instructors who participated in this study gave high priority to student-centered, small group methods that encourage critical thinking and may lead to lifelong learning. Instructors from more developed nations placed higher priority on student's independent acquisition of prosthetics and orthotics knowledge, particularly in clinical training. Application of student-centered approaches to prosthetics and orthotics programs may be preferred by many experts, but there appeared to be regional differences in the priority given to different teaching methods. The results of this study identify the methods of teaching that are preferred by expert prosthetics and orthotics instructors from a variety of regions. This treatment of current instructional techniques may inform instructor choice of teaching methods that impact the quality of education and improve the professional skills of students. © The International Society for Prosthetics and Orthotics 2014.

Experimental Analysis and Full Prediction Model of a 5-DOF Motorized Spindle

Directory of Open Access Journals (Sweden)

Weiyu Zhang

2017-01-01

Full Text Available The cost and power consumption of DC power amplifiers are much greater than that of AC power converters. Compared to a motorized spindle supported with DC magnetic bearings, a motorized spindle supported with AC magnetic bearings is inexpensive and more efficient. This paper studies a five-degrees-of-freedom (5-DOF motorized spindle supported with AC hybrid magnetic bearings (HMBs. Most models of suspension forces, except a “switching model”, are quite accurate, but only in a particular operating area and not in regional coverage. If a “switching model” is applied to a 5-DOF motorized spindle, the real-time performance of the control system can be significantly decreased due to the large amount of data processing for both displacement and current. In order to solve this defect, experiments based on the “switching model” are performed, and the resulting data are analyzed. Using the data analysis results, a “full prediction model” based on the operating state is proposed to improve real-time performance and precision. Finally, comparative, verification and stiffness tests are conducted to verify the improvement of the proposed model. Results of the tests indicate that the rotor has excellent characteristics, such as good real-time performance, superior anti-interference performance with load and the accuracy of the model in full zone. The satisfactory experimental results demonstrate the effectiveness of the “full prediction model” applied to the control system under different operating stages. Therefore, the results of the experimental analysis and the proposed full prediction model can provide a control system of a 5-DOF motorized spindle with the most suitable mathematical models of the suspension force.

On Virtual Integrated Model of a 6DoF Manipulator Arm for Emergency Cases Interventions

Directory of Open Access Journals (Sweden)

Gigi Naidin

2011-09-01

Full Text Available This research deals with a virtual integrated model for a 6DoF manipulator arm dedicated to use for emergency situations intervention. The virtual model can simulates both the entire structural and mechanical configuration of the manipulator, and the driving system with automated command unit. The basic idea supposes to develop a complex simulator for kinematical and dynamic behavior analysis of 6DoF robot manipulator, and for facilely cross correlation and comparative evaluation between essential parameters and extremely bearing cases defining the manipulator working state. The analysis was developed in Matlab© - SimScape© software. The conclusions dignify the main functional capability of the manipulator supposing the capacity of driving system and mechanical structure.

Rehabilitation and Prosthetic Services

Science.gov (United States)

... Review Resources AT Education Blind Rehab Chiropractic Service Polytrauma/TBI Prosthetics & Sensory Aids Recreation Therapy More Health ... Military Sexual Trauma PTSD Research (MIRECC) Military Exposures Polytrauma Rehabilitation Spinal Cord Injury Telehealth Womens Health Issues ...

Stiffness and hysteresis properties of some prosthetic feet

NARCIS (Netherlands)

van Jaarsveld, H.W.L.; Grootenboer, H.J.; de Vries, J.; Koopman, Hubertus F.J.M.

1990-01-01

A prosthetic foot is an important element of a prosthesis, although it is not always fully recognized that the properties of the foot, along with the prosthetic knee joint and the socket, are in part responsible for the stability and metabolic energy cost during walking. The stiffness and the

Particularities of fully-parallel manipulators in 6-DOFs robots design: a review of critical aspects

Directory of Open Access Journals (Sweden)

Milica Lucian

2017-01-01

Full Text Available A whole range of industrial applications requires the presence of parallel mechanisms with six degrees of freedom (6-DOF which have been developed in the last fifteen years, and one of the reasons why they still are a current topic is that present-day computers are capable of performing real-time motion laws of great complexity associated with these types of parallel mechanisms. The present work underlines particularities of parallel manipulators and their importance in the design of 6-DOF robots. The paper reveals the progress made in the last twenty years in the development of 6-DOF parallel manipulators, which increasingly find a wide scope of applications in different industrial areas such as robotics, manufacture and assisted medicine. It also emphasizes the need to determine singular configurations and the effect of cinematic redundancy which can increase the working space of the manipulators by adding active joints in one or more branches of the manipulator. Throughout the work, there were outlined three types of singularities encountered in the modelling of different types of parallel manipulators, and three types of redundancy. Furthermore, an analysis was made of the dimension of the workspace for a series of parallel manipulators, highlighting a number of factors that influence its size.

Successful Management of Prosthetic Valve Brucella Endocarditis with Antibiotherapy Alone

Directory of Open Access Journals (Sweden)

José Pedro Fonseca

2018-01-01

Full Text Available Objectives: To report a case of mechanical aortic prosthesis Brucella endocarditis successfully treated with antibiotics alone. Materials and methods: We describe a clinical case and present a review of the literature. Results: A 60-year-old female farmer with a mechanical aortic prosthetic valve presented with low back pain and fever. She was diagnosed with prosthetic valve Brucella mellitensis endocarditis and was cured with antibiotic therapy alone. Few cases of successfully treated prosthetic valve Brucella endocarditis without surgery have been reported. Conclusion: Prosthetic valve Brucella endocarditis usually requires surgical valve replacement. However, selected patients may be successfully treated with antibiotic therapy alone.

Electrical coupling suppression and transient response improvement for a microgyroscope using ascending frequency drive with a 2-DOF PID controller

International Nuclear Information System (INIS)

Cui, J; Guo, Z Y; Yang, Z C; Hao, Y L; Yan, G Z

2011-01-01

In this paper, we demonstrate a novel control strategy for the drive mode of a microgyroscope using ascending frequency drive (AFD) with an AGC-2DOF PID controller, which drives a resonator with a modulation signal not at the resonant frequency and senses the vibration signal at the resonant frequency, thus realizing the isolation between the actual mechanical response and electrical coupling signal. This approach holds the following three advantages: (1) it employs the AFD signal instead of the resonant frequency drive signal to excite the gyroscope in the drive direction, suppressing the electrical coupling from the drive electrode to the sense electrode; (2) it can reduce the noise at low frequency and resonant frequency by shifting flicker noise to the high-frequency part; (3) it can effectively improve the performance of the transient response of the closed-loop control with a 2-DOF (degree of freedom) PID controller compared with the conventional 1-DOF PID. The stability condition of the whole loop is investigated by utilizing the averaging and linearization method. The control approach is applied to drive a lateral tuning fork microgyroscope. Test results show good agreement with the theoretical and simulation results. The non-ideal electrical antiresonance peak is removed and the resonant peak height increases by approximately 10 dB over a 400 Hz span with a flicker noise reduction of 30 dB within 100 Hz using AFD. The percent overshoot is reduced from 36.2% (1DOF PID) to 8.95% (2DOF PID, about 75.3% overshoot suppression) with 15.3% improvement in setting time

Cost analysis of debridement and retention for management of prosthetic joint infection.

Science.gov (United States)

Peel, T N; Dowsey, M M; Buising, K L; Liew, D; Choong, P F M

2013-02-01

Prosthetic joint infection remains one of the most devastating complications of arthroplasty. Debridement and retention of the prosthesis is an attractive management option in carefully selected patients. Despite this, there are no data investigating the cost of this management modality for prosthetic joint infections. The aim of this case-control study was to calculate the cost associated with debridement and retention for management of prosthetic joint infection compared with primary joint replacement surgery without prosthetic joint infection. From 1 January 2008 to 30 June 2010, there were 21 prosthetic joint infections matched to 42 control patients. Controls were matched to cases according to the arthroplasty site, age and sex. Cases had a greater number of unplanned readmissions (100% vs. 7.1%; p prosthetic joint infection the total cost, including index operation and costs of management of the prosthetic joint infection, was 3.1 times the cost of primary arthoplasty; the mean cost for cases was Australian dollars (AUD) $69,414 (±29,869) compared with $22,085 (±8147) (p prosthetic joint infections will also increase, placing significant burden on the health system. Our study adds significantly to the growing body of evidence highlighting the substantial costs associated with prosthetic joint infection. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

[Localized purpura revealing vascular prosthetic graft infection].

Science.gov (United States)

Boureau, A S; Lescalie, F; Cassagnau, E; Clairand, R; Connault, J

2013-07-01

Prosthetic graft infection after vascular reconstruction is a rare but serious complication. We report a case of infection occurring late after implantation of an iliofemoral prosthetic vascular graft. The Staphylococcus aureus infection was revealed by vascular purpura localized on the right leg 7 years after implantation of a vascular prosthesis. This case illustrates an uncommonly late clinical manifestation presenting as an acute infection 7 years after the primary operation. In this situation, the presentation differs from early infection, which generally occurs within the first four postoperative months. Diagnosis and treatment remain a difficult challenge because prosthetic graft infection is a potentially life-threatening complication. Morbidity and mortality rates are high. Here we detail specific aspects of the clinical and radiological presentation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Salmonella Typhimurium gastroenteritis leading to chronic prosthetic vascular graft infection.

Science.gov (United States)

Cullinan, Milo; Clarke, Michael; Dallman, Tim; Peart, Steven; Wilson, Deborah; Weiand, Daniel

2017-08-01

Introduction. It is estimated up to 6 % of prosthetic vascular grafts become infected. Staphylococcus aureus is predominant in early infection and coagulase-negative staphylococci are predominant in late infections. Enterobacteriaceae cause 14-40 % of prosthetic vascular graft infections. This is, to our knowledge the first reported case of Salmonella gastroenteritis causing chronic prosthetic vascular graft infection (PVGI). Case presentation. A 57 years old lady presented with signs and symptoms of prosthetic vascular graft infection. Three years earlier, she had undergone a prosthetic axillo-femoral bypass graft for critical limb ischaemia. The infected prosthetic vascular graft was removed and Salmonella Typhimurium was isolated on culture. In the intervening period, Salmonella Typhimurium was isolated from a faecal specimen, collected during an episode of acute gastroenteritis. Whole-genome sequencing (WGS) showed that the respective Salmonella Typhimurium isolates differed by only a single nucleotide polymorphism (SNP). Salmonella Typhimurium was not isolated on culture of a faecal specimen collected five days following cessation of antimicrobial therapy. Six months after removal of the prosthetic graft, the patient remains under follow-up for her peripheral vascular disease, which currently requires no further surgical intervention. Conclusion. This case has clear implications for the management of chronic PVGI. It is vital to collect high-quality surgical specimens for microbiological analysis and empirical choices of antibiotics are unlikely to cover all potential pathogens. It may also be prudent to enquire about a history of acute gastroenteritis when assessing patients presenting with chronic PVGI.

Provision of Prosthetic Services Following Lower Limb Amputation in Malaysia

Science.gov (United States)

Arifin, Nooranida; Hasbollah, Hasif Rafidee; Hanafi, Muhammad Hafiz; Ibrahim, Al Hafiz; Rahman, Wan Afezah Wan Abdul; Aziz, Roslizawati Che

2017-01-01

The incidence of lower limb amputation is high across the globe and continues to be a major threat to morbidity and mortality. Consequently, the provision of high quality and effective prosthetics services have been known as an essential component for a successful rehabilitation outcome. In Malaysia, amputation prevalence has been increasing in which several main components of service delivering aspects (such as service intervention, prosthetic personnel) should be anticipated to accommodate for the increasing demand. This article highlights the hurdles experienced in providing prosthetic services in Malaysia from multiple aspects such as financial burden to acquire the prosthesis and lack of expertise to produce quality prosthesis. This paramount issues consequently justify for the urgency to carry out national level survey on the current statistics of lower limb amputation and to ascertain the available workforce to provide a quality prosthetics services. Only with accurate and current information from the national survey, strategies and policies aimed at enhancing the outcome from prosthetics services can be achieved. PMID:29386978

Design Optimization of a Cable-Driven Two-DOF Flexible Joint Module

Directory of Open Access Journals (Sweden)

Zhao Zhang

2012-11-01

Full Text Available This paper focuses on the kinematics, kinetostatics and design optimization of a 2-DOF cable-driven flexible joint module. Based on the motion characteristics of the 2-DOF joint module, the concept of instantaneous screw axis in conjunction with the Product-Of-Exponentials (POE formula is proposed to formulate its kinematic model. However, as the instantaneous screw axis is unfixed, the Lie group method is employed to derive the instantaneous kinematic model of the joint module. In order to generate the feasible workspace subject to positive tension constraint, the kinetostatics of the joint module is addressed, where the stiffness resulting from both the driving cables and the flexible backbone are considered. A numerical orientation workspace evaluation method is proposed based on an equi-volumetric partition in its parametric space and the volume-element associated integral factor. A global singular value (GSV index, which considers the minimum singular value of the stiffness matrix of joint module over the achievable workspace, is employed to optimize the geometric size of joint module. The simulation results demonstrate the effectiveness of the proposed GSV optimization algorithm.

Prosthetic Status and Prosthetic Need Among the Patients Attending Various Dental Institutes of Ahmedabad and Gandhinagar District, Gujarat

OpenAIRE

Shah, Vrinda R.; Shah, Darshana N.; Parmar, Chaitanya H.

2012-01-01

The oral health being an integral part for the healthy living, necessity of disability limitation and rehabilitation in oral health has taken a paramount role. To assess the prosthetic status and to evaluate the prosthetic needs of the patients attending various institutes of Ahmedabad and Gandhinagar district. A total of 510 (264 males and 246 females) subjects at various dental institutes were examined in the study. A survey proforma was prepared with the help of WHO oral health assessment ...

Calculation and analysis of whiplash effect in multi-DOF system

Science.gov (United States)

Chen, Gong; Qi, Qunfu; Yang, Hongmei; Li, Ling

2017-04-01

The response of structural vibration depends on the degree of freedomss, mass, stiffness, external effect of the structure. Natural frequency of structure is its inherent property, also it is related to its own factors, but not related to the external factors. Firstly the nature and characteristics of resonance effect and whiplash effect are analyzed. Secondly whiplash effect of multi-degree freedomss system is analyzed, then orthogonality in main models is used to verify the results of calculation. Then the improvements of whiplash effect are proposed, also the improved models are analyzed. Finally the conclusions are made.

Mechanical design and performance specifications of anthropomorphic prosthetic hands: a review.

Science.gov (United States)

Belter, Joseph T; Segil, Jacob L; Dollar, Aaron M; Weir, Richard F

2013-01-01

In this article, we set forth a detailed analysis of the mechanical characteristics of anthropomorphic prosthetic hands. We report on an empirical study concerning the performance of several commercially available myoelectric prosthetic hands, including the Vincent, iLimb, iLimb Pulse, Bebionic, Bebionic v2, and Michelangelo hands. We investigated the finger design and kinematics, mechanical joint coupling, and actuation methods of these commercial prosthetic hands. The empirical findings are supplemented with a compilation of published data on both commercial and prototype research prosthetic hands. We discuss numerous mechanical design parameters by referencing examples in the literature. Crucial design trade-offs are highlighted, including number of actuators and hand complexity, hand weight, and grasp force. Finally, we offer a set of rules of thumb regarding the mechanical design of anthropomorphic prosthetic hands.

Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master

Science.gov (United States)

Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok

2017-04-01

In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.

Analysis of Underactuated Dynamic Locomotion Systems Using Perturbation Expansion: The Twistcar Toy Example

Science.gov (United States)

Chakon, Ofir; Or, Yizhar

2017-08-01

Underactuated robotic locomotion systems are commonly represented by nonholonomic constraints where in mixed systems, these constraints are also combined with momentum evolution equations. Such systems have been analyzed in the literature by exploiting symmetries and utilizing advanced geometric methods. These works typically assume that the shape variables are directly controlled, and obtain the system's solutions only via numerical integration. In this work, we demonstrate utilization of the perturbation expansion method for analyzing a model example of mixed locomotion system—the twistcar toy vehicle, which is a variant of the well-studied roller-racer model. The system is investigated by assuming small-amplitude oscillatory inputs of either steering angle (kinematic) or steering torque (mechanical), and explicit expansions for the system's solutions under both types of actuation are obtained. These expressions enable analyzing the dependence of the system's dynamic behavior on the vehicle's structural parameters and actuation type. In particular, we study the reversal in direction of motion under steering angle oscillations about the unfolded configuration, as well as influence of the choice of actuation type on convergence properties of the motion. Some of the findings are demonstrated qualitatively by reporting preliminary motion experiments with a modular robotic prototype of the vehicle.

Adaptive sports technology and biomechanics: prosthetics.

Science.gov (United States)

De Luigi, Arthur Jason; Cooper, Rory A

2014-08-01

With the technologic advances in medicine and an emphasis on maintaining physical fitness, the population of athletes with impairments is growing. It is incumbent upon health care practitioners to make every effort to inform these individuals of growing and diverse opportunities and to encourage safe exercise and athletic participation through counseling and education. Given the opportunities for participation in sports for persons with a limb deficiency, the demand for new, innovative prosthetic designs is challenging the clinical and technical expertise of the physician and prosthetist. When generating a prosthetic prescription, physicians and prosthetists should consider the needs and preferences of the athlete with limb deficiency, as well as the functional demands of the chosen sporting activity. The intent of this article is to provide information regarding the current advancements in the adaptive sports technology and biomechanics in the field of prosthetics, and to assist clinicians and their patients in facilitating participation in sporting activities. Copyright © 2014 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

Periprosthetic joint infection: are patients with multiple prosthetic joints at risk?

Science.gov (United States)

Jafari, S Mehdi; Casper, David S; Restrepo, Camilo; Zmistowski, Benjamin; Parvizi, Javad; Sharkey, Peter F

2012-06-01

Patients who present with a periprosthetic joint infection in a single joint may have multiple prosthetic joints. The risk of these patients developing a subsequent infection in another prosthetic joint is unknown. Our purposes were (1) to identify the risk of developing a subsequent infection in another prosthetic joint and (2) to describe the time span and organism profile to the second prosthetic infection. We retrospectively identified 55 patients with periprosthetic joint infection who had another prosthetic joint in place at the time of presentation. Of the 55 patients, 11 (20%) developed a periprosthetic joint infection in a second joint. The type of organism was the same as the first infection in 4 (36%) of 11 patients. The time to developing a second infection averaged 2.0 years (range, 0-6.9 years). Copyright © 2012 Elsevier Inc. All rights reserved.

Uncemented allograft-prosthetic composite reconstruction of the proximal femur

Directory of Open Access Journals (Sweden)

Li Min

2014-01-01

Full Text Available Background: Allograft-prosthetic composite can be divided into three groups names cemented, uncemented, and partially cemented. Previous studies have mainly reported outcomes in cemented and partially cemented allograft-prosthetic composites, but have rarely focused on the uncemented allograft-prosthetic composites. The objectives of our study were to describe a surgical technique for using proximal femoral uncemented allograft-prosthetic composite and to present the radiographic and clinical results. Materials and Methods: Twelve patients who underwent uncemented allograft-prosthetic composite reconstruction of the proximal femur after bone tumor resection were retrospectively evaluated at an average followup of 24.0 months. Clinical records and radiographs were evaluated. Results: In our series, union occurred in all the patients (100%; range 5-9 months. Until the most recent followup, there were no cases with infection, nonunion of the greater trochanter, junctional bone resorption, dislocation, allergic reaction, wear of acetabulum socket, recurrence, and metastasis. But there were three periprosthetic fractures which were fixed using cerclage wire during surgery. Five cases had bone resorption in and around the greater trochanter. The average Musculoskeletal Tumor Society (MSTS score and Harris hip score (HHS were 26.2 points (range 24-29 points and 80.6 points (range 66.2-92.7 points, respectively. Conclusions: These results showed that uncemented allograft-prosthetic composite could promote bone union through compression at the host-allograft junction and is a good choice for proximal femoral resection. Although this technology has its own merits, long term outcomes are yet not validated.

Prosthetic implant treatment of the edentulous maxilla with overdenture.

Science.gov (United States)

Inversini, M

2006-10-01

The literature concerning the success of prosthetic implant treatment with maxillary overdenture is reviewed, and variables affecting treatment from the implant and prosthetic standpoint are analysed. Guidelines for the fabrication of maxillary overimplants comparable to those for mandibular overimplants are still lacking, as are evidence-based prosthetic design concepts. Individual methods and techniques have been described, but evaluation standards for the outcome of maxillary prosthetic-implant treatment are lacking or individually interpreted. The biomechanics involved in the proposed system are described, together with the advantages of telescopic crowns for the retention of removable partial prosthesis supported by maxillary implants. The positive influence, in terms of long-term prognosis, of the perio-protective design of removable partial prostheses supported by maxillary overimplants is also discussed. The proposed system not only provides stability, support and retention for removable partial prostheses supported by maxillary implants, but also enables implant survival rates to be improved, both for biomechanical reasons and due to improved oral hygiene. The simplification of fabrication procedures, repair, rebasing and re-operating also reduce the cost of follow-up and improve the cost/benefit ratio. However, additional studies are needed to clarify the number and most appropriate distribution of implants, as well as the most favourable prosthetic designs for maxillary overimplants.

Adaptive PSO for optimal LQR tracking control of 2 DoF laboratory helicopter

NARCIS (Netherlands)

Vinodh Kumar, E.; Ganapathy Subramanian, R.; Jerome, J.

2016-01-01

This paper deals with the attitude tracking control problem for a 2 DoF laboratory helicopter using optimal linear quadratic regulator (LQR). As the performance of the LQR controller greatly depends on the weighting matrices (Q and R), it is important to select them optimally. However, normally the

Surgical-prosthetic treatment of large mandibular cysts

Directory of Open Access Journals (Sweden)

Džambas Ljubiša D.

2003-01-01

Full Text Available This paper presents a combined surgical-prosthetic procedure of reconstructing mandibular bone defect in a 53 year old patient, following enucleation of a mandibular cyst (Cystectomy Partsch II. After a thorough diagnostic evaluation, a surgical procedure was planned with the particular attention to the nature of the disease, patient’s condition, size and extension of the cyst, tissue loss, and the possibilities of prosthetic management of a mandibular bone defect with partial postresection dental prosthesis. It is of great importance to point to the significance of teamwork of a maxillofacial surgeon and a specialist in prosthodontics. This kind of cooperation provided very effective and less risky soft tissue, as well as bone tissue regeneration (osteogenesis. The patient’s recovery was fast, and he could return to his daily activities and work without significant changes regarding quality of life after surgery and prosthetic treatment.

Custom-made laser-welded titanium implant prosthetic abutment.

Science.gov (United States)

Iglesia-Puig, Miguel A

2005-10-01

A technique to create an individually modified implant prosthetic abutment is described. An overcasting is waxed onto a machined titanium abutment, cast in titanium, and joined to it with laser welding. With the proposed technique, a custom-made titanium implant prosthetic abutment is created with adequate volume and contour of metal to support a screw-retained, metal-ceramic implant-supported crown.

Prosthetic Rehabilitation in Children: An Alternative Clinical Technique

Directory of Open Access Journals (Sweden)

Nádia Carolina Teixeira Marques

2013-01-01

Full Text Available Complete and partial removable dentures have been used successfully in numerous patients with oligodontia and/or anodontia. However, there is little information in the literature regarding the principles and guidelines to prosthetic rehabilitation for growing children. This case report describes the management of a young child with oligodontia as well as the treatment planning and the prosthetic rehabilitation technique.

Mesofluidic controlled robotic or prosthetic finger

Science.gov (United States)

Lind, Randall F; Jansen, John F; Love, Lonnie J

2013-11-19

A mesofluidic powered robotic and/or prosthetic finger joint includes a first finger section having at least one mesofluidic actuator in fluid communication with a first actuator, a second mesofluidic actuator in fluid communication with a second actuator and a second prosthetic finger section pivotally connected to the first finger section by a joint pivot, wherein the first actuator pivotally cooperates with the second finger to provide a first mechanical advantage relative to the joint point and wherein the second actuator pivotally cooperates with the second finger section to provide a second mechanical advantage relative to the joint point.

Simultaneous and Continuous Estimation of Shoulder and Elbow Kinematics from Surface EMG Signals

Directory of Open Access Journals (Sweden)

Qin Zhang

2017-05-01

Full Text Available In this paper, we present a simultaneous and continuous kinematics estimation method for multiple DoFs across shoulder and elbow joint. Although simultaneous and continuous kinematics estimation from surface electromyography (EMG is a feasible way to achieve natural and intuitive human-machine interaction, few works investigated multi-DoF estimation across the significant joints of upper limb, shoulder and elbow joints. This paper evaluates the feasibility to estimate 4-DoF kinematics at shoulder and elbow during coordinated arm movements. Considering the potential applications of this method in exoskeleton, prosthetics and other arm rehabilitation techniques, the estimation performance is presented with different muscle activity decomposition and learning strategies. Principle component analysis (PCA and independent component analysis (ICA are respectively employed for EMG mode decomposition with artificial neural network (ANN for learning the electromechanical association. Four joint angles across shoulder and elbow are simultaneously and continuously estimated from EMG in four coordinated arm movements. By using ICA (PCA and single ANN, the average estimation accuracy 91.12% (90.23% is obtained in 70-s intra-cross validation and 87.00% (86.30% is obtained in 2-min inter-cross validation. This result suggests it is feasible and effective to use ICA (PCA with single ANN for multi-joint kinematics estimation in variant application conditions.

Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot

Science.gov (United States)

Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio

2012-12-01

In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.

Compact and low-cost humanoid hand powered by nylon artificial muscles.

Science.gov (United States)

Wu, Lianjun; Jung de Andrade, Monica; Saharan, Lokesh Kumar; Rome, Richard Steven; Baughman, Ray H; Tadesse, Yonas

2017-02-03

This paper focuses on design, fabrication and characterization of a biomimetic, compact, low-cost and lightweight 3D printed humanoid hand (TCP Hand) that is actuated by twisted and coiled polymeric (TCP) artificial muscles. The TCP muscles were recently introduced and provided unprecedented strain, mechanical work, and lifecycle (Haines et al 2014 Science 343 868-72). The five-fingered humanoid hand is under-actuated and has 16 degrees of freedom (DOF) in total (15 for fingers and 1 at the palm). In the under-actuated hand designs, a single actuator provides coupled motions at the phalanges of each finger. Two different designs are presented along with the essential elements consisting of actuators, springs, tendons and guide systems. Experiments were conducted to investigate the performance of the TCP muscles in response to the power input (power magnitude, type of wave form such as pulsed or square wave, and pulse duration) and the resulting actuation stroke and force generation. A kinematic model of the flexor tendons was developed to simulate the flexion motion and compare with experimental results. For fast finger movements, short high-power pulses were employed. Finally, we demonstrated the grasping of various objects using the humanoid TCP hand showing an array of functions similar to a natural hand.

Embodied prosthetic arm stabilizes body posture, while unembodied one perturbs it.

Science.gov (United States)

Imaizumi, Shu; Asai, Tomohisa; Koyama, Shinichi

2016-10-01

Senses of ownership (this arm belongs to me) and agency (I am controlling this arm) originate from sensorimotor system. External objects can be integrated into the sensorimotor system following long-term use, and recognized as one's own body. We examined how an (un)embodied prosthetic arm modulates whole-body control, and assessed the components of prosthetic embodiment. Nine unilateral upper-limb amputees participated. Four frequently used their prosthetic arm, while the others rarely did. Their postural sway was measured during quiet standing with or without their prosthesis. The frequent users showed greater sway when they removed the prosthesis, while the rare users showed greater sway when they fitted the prosthesis. Frequent users reported greater everyday feelings of postural stabilization by prosthesis and a larger sense of agency over the prosthesis. We suggest that a prosthetic arm maintains or perturbs postural control, depending on the prosthetic embodiment, which involves sense of agency rather than ownership. Copyright © 2016 Elsevier Inc. All rights reserved.

Psychophysical testing of visual prosthetic devices: a call to establish a multi-national joint task force

Science.gov (United States)

Rizzo, Joseph F., III; Ayton, Lauren N.

2014-04-01

Recent advances in the field of visual prostheses, as showcased in this special feature of Journal of Neural Engineering , have led to promising results from clinical trials of a number of devices. However, as noted by these groups there are many challenges involved in assessing vision of people with profound vision loss. As such, it is important that there is consistency in the methodology and reporting standards for clinical trials of visual prostheses and, indeed, the broader vision restoration research field. Two visual prosthesis research groups, the Boston Retinal Implant Project (BRIP) and Bionic Vision Australia (BVA), have agreed to work cooperatively to establish a multi-national Joint Task Force. The aim of this Task Force will be to develop a consensus statement to guide the methods used to conduct and report psychophysical and clinical results of humans who receive visual prosthetic devices. The overarching goal is to ensure maximum benefit to the implant recipients, not only in the outcomes of the visual prosthesis itself, but also in enabling them to obtain accurate information about this research with ease. The aspiration to develop a Joint Task Force was first promulgated at the inaugural 'The Eye and the Chip' meeting in September 2000. This meeting was established to promote the development of the visual prosthetic field by applying the principles of inclusiveness, openness, and collegiality among the growing body of researchers in this field. These same principles underlie the intent of this Joint Task Force to enhance the quality of psychophysical research within our community. Despite prior efforts, a critical mass of interested parties could not congeal. Renewed interest for developing joint guidelines has developed recently because of a growing awareness of the challenges of obtaining reliable measurements of visual function in patients who are severely visually impaired (in whom testing is inherently noisy), and of the importance of

Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.

Science.gov (United States)

Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R

2012-01-01

This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

Fixed prosthetic treatment in patients with cleft lip and palate

Directory of Open Access Journals (Sweden)

Bajevska Jagoda

2017-01-01

Full Text Available Introduction. The prosthetic treatment of patients with cleft palate includes various treatment options such as fixed partial dentures, removable partial prosthesis, etc. The type of prosthetic appliance is determined by the oral health of each individual and the circumstances. We presented three adult patients with the cleft lip and palate subjected to prosthetic treatment. Case report. From the possible prosthetic solutions according to the conditions in the oral cavity and the circumstances, fixed partial dentures veneered with composite or ceramic were chosen. A proper relationship between the teeth was reached with the fixed partial dentures, and function established, the phonetics improved and satisfying aesthetics effect accomplished improving the profile appearance of the patient’s face. Plastic surgery of the nose was performed after that. Conclusion. Multidisclipinary treatment is necessary for favourable long-term outcome in cleft lip and palate patients.

Quantum wave packet study of D+OF reaction

International Nuclear Information System (INIS)

Kurban, M.; Karabulut, E.; Tutuk, R.; Goektas, F.

2010-01-01

The quantum dynamics of the D+OF reaction on the adiabatic potential energy surface of the ground 1 3 A ' state has been studied by using a time-dependent quantum real wave packet method. The state-to-state and state-to-all reaction probabilities for total angular momentum J = 0 have been calculated. The probabilities for J > 0 have been calculated by J-shifting the J = 0 results by means of capture model. Then, the integral cross sections and initial state selected rate constants have been calculated. The initial state-selected reaction probabilities and reaction cross section show threshold but not manifest any resonances and the initial state selected rate constants are sensitive to the temperature.

Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid

Directory of Open Access Journals (Sweden)

Oh Jong-Seok

2015-02-01

Full Text Available This work presents a torque measurement method of 3-degree-of-freedom (3-DOF haptic master featuring controllable electrorheological (ER fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.

Prosthetic Mitral Valve Leaflet Escape

Science.gov (United States)

Kim, Darae; Hun, Sin Sang; Cho, In-Jeong; Shim, Chi-Young; Ha, Jong-Won; Chung, Namsik; Ju, Hyun Chul; Sohn, Jang Won

2013-01-01

Leaflet escape of prosthetic valve is rare but potentially life threatening. It is essential to make timely diagnosis in order to avoid mortality. Transesophageal echocardiography and cinefluoroscopy is usually diagnostic and the location of the missing leaflet can be identified by computed tomography (CT). Emergent surgical correction is mandatory. We report a case of fractured escape of Edward-Duromedics mitral valve 27 years after the surgery. The patient presented with symptoms of acute decompensated heart failure and cardiogenic shock. She was instantly intubated and mechanically ventilated. After prompt evaluation including transthoracic echocardiography and CT, the escape of the leaflet was confirmed. The patient underwent emergent surgery for replacement of the damaged prosthetic valves immediately. Eleven days after the surgery, the dislodged leaflet in iliac artery was removed safely and the patient recovered well. PMID:23837121

Adapting to change: influence of a microprocessor-controlled prosthetic knee on gait adaptations

NARCIS (Netherlands)

Prinsen, Erik Christiaan

2016-01-01

Advancement in prosthetic knee design have led to the introduction of microprocessor-controlled prosthetic knees (MPKs). MPKs incorporate sensors that are able to measure prosthetic loading, the knee angle, and knee angular velocity. Based on the sensor information, MPKs determine the optimal level

Novel Adaptive Forward Neural MIMO NARX Model for the Identification of Industrial 3-DOF Robot Arm Kinematics

Directory of Open Access Journals (Sweden)

Ho Pham Huy Anh

2012-10-01

Full Text Available In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3-DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model-based identification process using experimental input-output training data. This paper proposes a novel use of a back propagation (BP algorithm to generate the forward neural MIMO NARX (FNMN model for the forward kinematics of the industrial 3-DOF robot arm. The results show that the proposed adaptive neural NARX model trained by a Back Propagation learning algorithm yields outstanding performance and perfect accuracy.

Development of a 3D-Printed Robotic Prosthetic Arm

Energy Technology Data Exchange (ETDEWEB)

Gomez Martinez, M.; Garcia-Miquel, A.; Vidal Martinez, N.

2016-07-01

Current prostheses are not affordable to the general public. 3D printing technology may allow low-cost production of such devices, making them more readily accessible to people in need. This contribution presents the set-up and the considerations that have to be taken into account to develop a functional artificial upper limb prototype. The robotic prosthetic arm reported herein was produced entirely using 3D printing technology to demonstrate its feasibility on a limited budget. The project was developed to integrate two different functional modes: a prosthetic application and a remote application. The prosthetic application is intended to emulate existing prosthetic devices using myoelectric sensors. The remote application is conceived as a tool for prevention, by providing the general public with a device that could carry out activities that entail a risk of severe physical injury. This is achieved using a hand-tracking system that allows the robotic arm to copy the user’s movements remotely and in real time. The outcome of the validation tests has been considerably successful for both applications and the total costs are on target. (Author)

Decoupled Sliding Mode Control for a Novel 3-DOF Parallel Manipulator with Actuation Redundancy

Directory of Open Access Journals (Sweden)

Niu Xuemei

2015-05-01

Full Text Available This paper presents a decoupled nonsingular terminal sliding mode controller (DNTSMC for a novel 3-DOF parallel manipulator with actuation redundancy. According to kinematic analysis, the inverse dynamic model for a novel 3-DOF redundantly actuated parallel manipulator is formulated in the task space using Lagrangian formalism and decoupled into three entirely independent subsystems under generalized coordinates to significantly reduce system complexity. Based on the dynamic model, a decoupled sliding mode control strategy is proposed for the parallel manipulator; the idea behind this strategy is to design a nonsingular terminal sliding mode controller for each subsystem, which can drive states of three subsystems to the original equilibrium points simultaneously by two intermediate variables. Additionally, a RBF neural network is used to compensate the cross-coupling force and gravity to enhance the control precision. Simulation and experimental results show that the proposed DNTSMC can achieve better control performances compared with the conventional sliding mode controller (SMC and the DNTSMC without compensator.

Image segmentation for enhancing symbol recognition in prosthetic vision.

Science.gov (United States)

Horne, Lachlan; Barnes, Nick; McCarthy, Chris; He, Xuming

2012-01-01

Current and near-term implantable prosthetic vision systems offer the potential to restore some visual function, but suffer from poor resolution and dynamic range of induced phosphenes. This can make it difficult for users of prosthetic vision systems to identify symbolic information (such as signs) except in controlled conditions. Using image segmentation techniques from computer vision, we show it is possible to improve the clarity of such symbolic information for users of prosthetic vision implants in uncontrolled conditions. We use image segmentation to automatically divide a natural image into regions, and using a fixation point controlled by the user, select a region to phosphenize. This technique improves the apparent contrast and clarity of symbolic information over traditional phosphenization approaches.

A MYOELECTRIC PROSTHETIC ARM CONTROLLED BY A SENSOR-ACTUATOR LOOP

Directory of Open Access Journals (Sweden)

Patrik Kutílek

2014-06-01

Full Text Available This paper describes new methods and systems designed for application in upper extremity prostheses. An artificial upper limb with this system is a robot arm controlled by EMG signals and a set of sensors. The new multi-sensor system is based on ultrasonic sensors, infrared sensors, Hall-effect sensors, a CO2 sensor and a relative humidity sensor. The multi-sensor system is used to update a 3D map of objects in the robot’s environment, or it directly sends information about the environment to the control system of the myoelectric arm. Occupancy grid mapping is used to build a 3D map of the robot’s environment. The multi-sensor system can identify the distance of objects in 3D space, and the information from the system is used in a 3D map to identify potential collisions or a potentially dangerous environment, which could damage the prosthesis or the user. Information from the sensors and from the 3D map is evaluated using a fuzzy expert system. The control system of the myoelectric prosthetic arm can choose an adequate reaction on the basis of information from the fuzzy expert system. The systems and methods were designed and verified using MatLab/Simulink. They are aimed for use as assistive technology for disabled people.

Control-Oriented Modeling and System Identification for Nonlinear Trajectory Tracking Control of a Small-Scale Unmanned Helicopter

Science.gov (United States)

Pourrezaei Khaligh, Sepehr

Model-based control design of small-scale helicopters involves considerable challenges due to their nonlinear and underactuated dynamics with strong couplings between the different degrees-of-freedom (DOFs). Most nonlinear model-based multi-input multi-output (MIMO) control approaches require the dynamic model of the system to be affine-in-control and fully actuated. Since the existing formulations for helicopter nonlinear dynamic model do not meet these requirements, these MIMO approaches cannot be applied for control of helicopters and control designs in the literature mostly use the linearized model of the helicopter dynamics around different trim conditions instead of directly using the nonlinear model. The purpose of this thesis is to derive the 6-DOF nonlinear model of the helicopter in an affine-in-control, non-iterative and square input-output formulation to enable many nonlinear control approaches, that require a control-affine and square model such as the sliding mode control (SMC), to be used for control design of small-scale helicopters. A combination of the first-principles approach and system identification is used to derive this model. To complete the nonlinear model of the helicopter required for the control design, the inverse kinematics of the actuating mechanisms of the main and tail rotors are also derived using an approach suitable for the real-time control applications. The parameters of the new control-oriented formulation are identified using a time-domain system identification strategy and the model is validated using flight test data. A robust sliding mode control (SMC) is then designed using the new formulation of the helicopter dynamics and its robustness to parameter uncertainties and wind disturbances is tested in simulations. Next, a hardware-in-the-loop (HIL) testbed is designed to allow for the control implementation and gain tuning as well as testing the robustness of the controller to external disturbances in a controlled

Implant salvage in breast reconstruction with severe peri-prosthetic infection.

Science.gov (United States)

Meybodi, Farid; Sedaghat, Negin; French, James; Keighley, Caitlin; Mitchell, David; Elder, Elisabeth

2017-12-01

Although treatment of mild peri-prosthetic infection in implant-based breast reconstruction results in high rates of resolution, successful management of severe peri-prosthetic infection remains a significant challenge. In this case series, a protocol utilizing a novel dressing - negative pressure wound therapy with instillation (NPWTi) - for the management of severe peri-prosthetic infection in breast reconstruction patients is described. This is an operative technique involving: (i) explantation of the breast prosthesis and application of the NPWTi dressing to the implant pocket; (ii) change of the NPWTi dressing; (iii) intraoperative fluid/tissue cultures; and (iv) reimplantation of the breast prosthesis when cultures yield no growth. This protocol was utilized in six cases of severe peri-prosthetic infection in five patients with immediate breast reconstruction for breast cancer or risk-reducing surgery. Cultures of fluid/tissue grew typical and/or unusual organisms. Only one case did not yield an organism. The hospital length of stay upon completion of the protocol ranged from 7-16 days (mean, 12 days). Successful implant salvage was achieved in five of six cases. The protocol was aborted in one case to allow for completion of adjuvant chemotherapy. Early findings from this case series suggest that in cases of severe peri-prosthetic infection this novel operative protocol may result in successful implant salvage for breast reconstruction patients. Further studies are needed to more fully elaborate the role of NPWTi to achieve implant salvage in challenging cases of peri-prosthetic infection. © 2015 Royal Australasian College of Surgeons.

Development of novel 3D-printed robotic prosthetic for transradial amputees.

Science.gov (United States)

Gretsch, Kendall F; Lather, Henry D; Peddada, Kranti V; Deeken, Corey R; Wall, Lindley B; Goldfarb, Charles A

2016-06-01

Upper extremity myoelectric prostheses are expensive. The Robohand demonstrated that three-dimensional printing reduces the cost of a prosthetic extremity. The goal of this project was to develop a novel, inexpensive three-dimensional printed prosthesis to address limitations of the Robohand. The prosthesis was designed for patients with transradial limb amputation. It is shoulder-controlled and externally powered with an anthropomorphic terminal device. The user can open and close all five fingers, and move the thumb independently. The estimated cost is US$300. After testing on a patient with a traumatic transradial amputation, several advantages were noted. The independent thumb movement facilitated object grasp, the device weighed less than most externally powered prostheses, and the size was easily scalable. Limitations of the new prosthetic include low grip strength and decreased durability compared to passive prosthetics. Most children with a transradial congenital or traumatic amputation do not use a prosthetic. A three-dimensional printed shoulder-controlled robotic prosthesis provides a cost effective, easily sized and highly functional option which has been previously unavailable. © The International Society for Prosthetics and Orthotics 2015.

Sliding mode control of a "Soft" 2-DOF Planar Pneumatic Manipulator

Science.gov (United States)

Van Damme, M.; Vanderborght, B.; Beyl, P.; Versluys, R.; Vanderniepen, I.; Van Ham, R.; Cherelle, P.; Daerden, F.; Lefeber, D.

2008-10-01

This paper presents a sliding mode controller for a "Soft" 2-DOF Planar Pneumatic Manipulator actuated by pleated pneumatic artificial muscle actuators. Since actuator dynamics is not negligible, an approximate model for pressure dynamics was taken into account, which made it necessary to perform full input-output feedback linearization in order to design a sliding mode controller. The design of the controller is presented in detail, and experimental results obtained by implementing the controller are discussed

Prosthetic prescription in the Netherlands: An interview with clinical experts

NARCIS (Netherlands)

Van Der Linde, H.; Geertzen, J.H.B.; Hofstad, C.J.; Van Limbeek, Jacques; Postema, K.

2004-01-01

In the process of guideline development for prosthetic prescription in the Netherlands the authors made a study of the daily clinical practice of lower limb prosthetics. Besides the evidence-based knowledge from literature the more implicit knowledge from clinical experts is of importance for

PLANNING OF IMPLANTO‐PROSTHETIC STRUCTURES IN TOTAL EDENTATION ACCORDING TO BIOMECHANICAL CRITERIA

Directory of Open Access Journals (Sweden)

N. VASILE

2013-07-01

Full Text Available Scope of the study: Analysis of the biomechanical aspects of the implanto‐prosthetic structures for planning the treatment in cases of total edentation.Materials and method: The study was performed in the Clinics of Prosthetics and Oral Implantology, Military Emergency Hospital of Sibiu, on a group of mandibularly totally edentated patients. Planning of the implanto‐pros‐ thetic treatment had in view the peculiarities of total man‐ dibular edentation and observance of the biomechanical principles. Selection of the type of occlusion restoration considered the presence of parafunctions and the nature of the antagonistic arch. Special attention was paid to the direction and intensity of the forces acting in the region of the future prosthetic work. When bruxism was manifested, its preimplantary removal was compulsory.Results and discussion: In fixed prosthetic restaurati‐ ons applied on implants, distribuition of forces obviously depend on the quality of osteo‐acceptance, as well, and also on the elasticity degree of the prosthetic work. In the case of mobilized prosthetic restorations supported on implants, rigidization of implants from the anterior region of the mandible may be obtained by means of a bar. In decreasing order of their elasticity, the materials employed are: acrylate, composites, noble and seminoble alloys, other metals, ceramics. Ceramics confers maximum stability to implants, yet without redeeming the forces. For amortizing the forces and for a progressive charging of the implants, it is recommended that the first (temporary prosthetic restorations should be made of either acrylate or compo‐ sites.Conclusions. Observance of the occlusological princi‐ ples in cases of occlusal reconstruction represents the determining element which assures the osteo‐acceptance of implants and the integrity of prosthetic restaurations.

Myoelectric control of prosthetic hands: state-of-the-art review

Directory of Open Access Journals (Sweden)

Geethanjali P

2016-07-01

Full Text Available Purushothaman Geethanjali School of Electrical Engineering Department of Control and Automation VIT University, Vellore, Tamil Nadu, India Abstract: Myoelectric signals (MES have been used in various applications, in particular, for identification of user intention to potentially control assistive devices for amputees, orthotic devices, and exoskeleton in order to augment capability of the user. MES are also used to estimate force and, hence, torque to actuate the assistive device. The application of MES is not limited to assistive devices, and they also find potential applications in teleoperation of robots, haptic devices, virtual reality, and so on. The myoelectric control-based prosthetic hand aids to restore activities of daily living of amputees in order to improve the self-esteem of the user. All myoelectric control-based prosthetic hands may not have similar operations and exhibit variation in sensing input, deciphering the signals, and actuating prosthetic hand. Researchers are focusing on improving the functionality of prosthetic hand in order to suit the user requirement with the different operating features. The myoelectric control differs in operation to accommodate various external factors. This article reviews the state of the art of myoelectric prosthetic hand, giving description of each control strategy. Keywords: EMG, assistive device, amputee, myoelectric control, electric powered, body ­powered, bioelectric signal control

Effects of a flat prosthetic foot rocker section on balance and mobility.

Science.gov (United States)

Hansen, Andrew; Nickel, Eric; Medvec, Joseph; Brielmaier, Steven; Pike, Alvin; Weber, Marilyn

2014-01-01

Previous studies have shown that the effective rocker shape of the physiologic ankle-foot system during standing and fore-aft swaying is much flatter than that used during walking, which indicates a more stable base of support for the standing/swaying activity. Previous work suggests that flat regions within the effective rocker shapes of prosthetic ankle-foot systems could provide enhanced stability for standing balance tasks. An experimental prosthetic foot was altered to provide three different flat region lengths within its effective rocker shape. It was hypothesized that longer flat regions of the effective rocker shape would lead to improved standing balance outcomes and reduced walking performance for unilateral transtibial prosthesis users. However, no significant changes were seen in the balance and mobility outcomes of 12 unilateral transtibial prosthesis users when using the three prosthetic foot conditions. Subjects in the study significantly preferred prosthetic feet with relatively low to moderate flat regions over those with long flat regions. All the subjects without loss of light touch or vibratory sensation selected the prosthetic foot with the shortest flat region. More work is needed to investigate the effects of prosthetic foot properties on balance and mobility of prosthesis users.

Vascular complications of prosthetic inter-vertebral discs.

Science.gov (United States)

Daly, Kevin J; Ross, E Raymond S; Norris, Heather; McCollum, Charles N

2006-10-01

Five consecutive cases of prosthetic inter-vertebral disc displacement with severe vascular complications on revisional surgery are described. The objective of this case report is to warn spinal surgeons that major vascular complications are likely with anterior displacement of inter-vertebral discs. We have not been able to find a previous report on vascular complications associated with anterior displacement of prosthetic inter-vertebral discs. In all five patients the prosthetic disc had eroded into the bifurcation of the inferior vena cava and the left common iliac vein. In three cases the aortic bifurcation was also involved. The fibrosis was so severe that dissecting out the arteries and veins to provide access to the relevant disc proved impossible. Formal division of the left common iliac vein and artery with subsequent repair was our solution. Anterior inter-vertebral disc displacement was associated with severe vascular injury. Preventing anterior disc displacement is essential in disc design. In the event of anterior displacement, disc removal should be planned with a Vascular Surgeon.

Initial Clinical Evaluation of the Modular Prosthetic Limb

Directory of Open Access Journals (Sweden)

Briana N. Perry

2018-03-01

Full Text Available The Modular Prosthetic Limb (MPL was examined for its feasibility and usability as an advanced, dexterous upper extremity prosthesis with surface electromyography (sEMG control in with two individuals with below-elbow amputations. Compared to currently marketed prostheses, the MPL has a greater number of sequential and simultaneous degrees of motion, as well as wrist modularity, haptic feedback, and individual digit control. The MPL was successfully fit to a 33-year-old with a trans-radial amputation (TR01 and a 30-year-old with a wrist disarticulation amputation (TR02. To preserve anatomical limb length, we adjusted the powered degrees of freedom of wrist motion between users. Motor training began with practicing sEMG and pattern recognition control within the virtual integration environment (VIE. Prosthetic training sessions then allowed participants to complete a variety of activities of daily living with the MPL. Training and Motion Control Accuracy scores quantified their ability to consistently train and execute unique muscle-to-motion contraction patterns. Each user also completed one prosthetic functional metric—the Southampton Hand Assessment Procedure (SHAP for TR01 and the Jebsen-Taylor Hand Function Test (JHFT for TR02. Haptic feedback capabilities were integrated for TR01. TR01 achieved 95% accuracy at 84% of his VIE sessions. He demonstrated improved scores over a year of prosthetic training sessions, ultimately achieving simultaneous control of 13 of the 17 (76% attempted motions. His performance on the SHAP improved from baseline to final assessment with an increase in number of tasks achieved. TR01 also used vibrotactile sensors to successfully discriminate between hard and soft objects being grasped by the MPL hand. TR02 demonstrated 95% accuracy at 79% of his VIE sessions. He demonstrated improved scores over months of prosthetic training sessions, however there was a significant drop in scores initially following a mid

Structural Integration and Control of Peerless Human-like Prosthetic Hand

Science.gov (United States)

Dave, Ankit; Muthu, P.; Karthikraj, V.; Latha, S.

2018-04-01

Limb damage can create severe disturbance in movement and operative abilities wherein the prosthetic rehabilitation has the potential to replace function and enhance the quality of life. This paper presents a humanlike prosthetic hand using such unique design concept of hand model using artificial bones, ligaments, and tendons controlled using Arduino. Amongst various platforms available, Arduino is known for its adaptability, adoration and low cost. The design of prosthetic hand has a unique structure with all carpal, metacarpal, and phalanges which are bones of the hand. These bones are attached to each other following the pattern of human hand using the polymeric rubber as a functioning ligament. Furthermore, this structure of finger is driven by tendons attached to all fingers and passes through the ligaments working as pulley resulting in more degrees of freedom. The motor can twitch the tendons to achieve the action of fingers. Thus the servos, controlled by an Arduino, are used to regulate the movement mechanism of the prosthetic hand.

Control system and method for prosthetic devices

Science.gov (United States)

Bozeman, Richard J., Jr. (Inventor)

1992-01-01

A control system and method for prosthetic devices is provided. The control system comprises a transducer for receiving movement from a body part for generating a sensing signal associated with that movement. The sensing signal is processed by a linearizer for linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part. The linearized sensing signal is normalized to be a function of the entire range of body part movement from the no-shrug position of the movable body part through the full-shrug position of the movable body part. The normalized signal is divided into a plurality of discrete command signals. The discrete command signals are used by typical converter devices which are in operational association with the prosthetic device. The converter device uses the discrete command signals for driving the movable portions of the prosthetic device and its sub-prosthesis. The method for controlling a prosthetic device associated with the present invention comprises the steps of receiving the movement from the body part, generating a sensing signal in association with the movement of the body part, linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part, normalizing the linear signal to be a function of the entire range of the body part movement, dividing the normalized signal into a plurality of discrete command signals, and implementing the plurality of discrete command signals for driving the respective movable prosthesis device and its sub-prosthesis.

A computational method for comparing the behavior and possible failure of prosthetic implants

Energy Technology Data Exchange (ETDEWEB)

Nielsen, C.; Hollerbach, K.; Perfect, S.; Underhill, K.

1995-05-01

Prosthetic joint implants currently in use exhibit high Realistic computer modeling of prosthetic implants provides an opportunity for orthopedic biomechanics researchers and physicians to understand possible in vivo failure modes, without having to resort to lengthy and costly clinical trials. The research presented here is part of a larger effort to develop realistic models of implanted joint prostheses. The example used here is the thumb carpo-metacarpal (cmc) joint. The work, however, can be applied to any other human joints for which prosthetic implants have been designed. Preliminary results of prosthetic joint loading, without surrounding human tissue (i.e., simulating conditions under which the prosthetic joint has not yet been implanted into the human joint), are presented, based on a three-dimensional, nonlinear finite element analysis of three different joint implant designs.

Gonococcal Prosthetic Joint Infection.

Science.gov (United States)

Gassiep, Ian; Gilpin, Bradley; Douglas, Joel; Siebert, David

2017-01-01

Neisseria gonorrhoea is a common sexually transmitted infection worldwide. Disseminated gonococcal infection is an infrequent presentation and rarely can be associated with septic arthritis. Incidence of this infection is rising, both internationally and in older age groups. We present the first documented case of N. gonorrhoea prosthetic joint infection which was successfully treated with laparoscopic debridement and antimicrobial therapy.

Rehand: Realistic electric prosthetic hand created with a 3D printer.

Science.gov (United States)

Yoshikawa, Masahiro; Sato, Ryo; Higashihara, Takanori; Ogasawara, Tsukasa; Kawashima, Noritaka

2015-01-01

Myoelectric prosthetic hands provide an appearance with five fingers and a grasping function to forearm amputees. However, they have problems in weight, appearance, and cost. This paper reports on the Rehand, a realistic electric prosthetic hand created with a 3D printer. It provides a realistic appearance that is same as the cosmetic prosthetic hand and a grasping function. A simple link mechanism with one linear actuator for grasping and 3D printed parts achieve low cost, light weight, and ease of maintenance. An operating system based on a distance sensor provides a natural operability equivalent to the myoelectric control system. A supporter socket allows them to wear the prosthetic hand easily. An evaluation using the Southampton Hand Assessment Procedure (SHAP) demonstrated that an amputee was able to operate various objects and do everyday activities with the Rehand.

[Application and outlook of three-dimensional printing in prosthetic dentistry].

Science.gov (United States)

Sun, Y C; Li, R; Zhou, Y S; Wang, Y

2017-06-09

At present, three-dimensional (3D) printing has been applied in many aspects in the field of prosthodontics, such as dental models, wax patterns, guide plates, dental restoration and customized implants. The common forming principles include light curing, sintering and melting-condensation, the materials include pure wax, resin, metal and ceramics. However, the printing precision and the strength of multi-material integrated forming, remains to be improved. In addition, as a technology by which the internal structure of a material can be customized manufacturing, further advantage of 3D printing used in the manufacture of dental restoration lies in the customization functional bionic micro-structures, but the related research is still in its infancy. The review briefly summarizes the commonly used 3D printing crafts in prosthetic dentistry, and details clinical applications and evaluations, provides references for clinical decision and further research.

Micro-vision servo control of a multi-axis alignment system for optical fiber assembly

International Nuclear Information System (INIS)

Chen, Weihai; Yu, Fei; Qu, Jianliang; Chen, Wenjie; Zhang, Jianbin

2017-01-01

This paper describes a novel optical fiber assembly system featuring a multi-axis alignment function based on micro-vision feedback control. It consists of an active parallel alignment mechanism, a passive compensation mechanism, a micro-gripper and a micro-vision servo control system. The active parallel alignment part is a parallelogram-based design with remote-center-of-motion (RCM) function to achieve precise rotation without fatal lateral motion. The passive mechanism, with five degrees of freedom (5-DOF), is used to implement passive compensation for multi-axis errors. A specially designed 1-DOF micro-gripper mounted onto the active parallel alignment platform is adopted to grasp and rotate the optical fiber. A micro-vision system equipped with two charge-coupled device (CCD) cameras is introduced to observe the small field of view and obtain multi-axis errors for servo feedback control. The two CCD cameras are installed in an orthogonal arrangement—thus the errors can be easily measured via the captured images. Meanwhile, a series of tracking and measurement algorithms based on specific features of the target objects are developed. Details of the force and displacement sensor information acquisition in the assembly experiment are also provided. An experiment demonstrates the validity of the proposed visual algorithm by achieving the task of eliminating errors and inserting an optical fiber to the U-groove accurately. (paper)

Modeling the 3-DOF dynamics of an electrodynamic Maglev suspension system with a passive sled

NARCIS (Netherlands)

Boeij, de J.; Gutierrez, H.M.; Agarwal, R.; Steinbuch, M.

2003-01-01

A model that describes the 3-DOF dynamics of a passively levitated electro-dynamic maglevsystem is presented. The model is based on the flux-current-force interactions and the geometricrelationships between the levitation coils and the permanent magnets on the sled. The model ispresented in a

Prosthetic hand sensor placement: Analysis of touch perception during the grasp

Directory of Open Access Journals (Sweden)

Mirković Bojana

2014-01-01

Full Text Available Humans rely on their hands to perform everyday tasks. The hand is used as a tool, but also as the interface to “sense” the world. Current prosthetic hands are based on sophisticated multi-fingered structures, and include many sensors which counterpart natural proprioceptors and exteroceptors. The sensory information is used for control, but not sent to the user of the hand (amputee. Grasping without sensing is not good enough. This research is part of the development of the sensing interface for amputees, specifically addressing the analysis of human perception while grasping. The goal is to determine the small number of preferred positions of sensors on the prosthetic hand. This task has previously been approached by trying to replicate a natural sensory system characteristic for healthy humans, resulting in a multitude of redundant sensors and basic inability to make the patient aware of the sensor readings on the subconscious level. We based our artificial perception system on the reported sensations of humans when grasping various objects without seeing the objects (obstructed visual feedback. Subjects, with no known sensory deficits, were asked to report on the touch sensation while grasping. The analysis included objects of various sizes, weights, textures and temperatures. Based on this data we formed a map of the preferred positions for the sensors that is appropriate for five finger human-like robotic hand. The final map was intentionally minimized in size (number of sensors.

Kinematic modelling of a five-DOFs spatial manipulator used in robot-assisted surgery

Directory of Open Access Journals (Sweden)

Shakti Singh

2016-09-01

Full Text Available Since last three decades, research in the field of robot kinematics is boosted-up among different researchers worldwide. This is mainly due to their increased use in various challenging fields of engineering and science. One such challenging application is the use of master–slave concept in a robot-assisted surgery. The authors have already performed the kinematic study and gravity balancing of seven degrees-of-freedom (DOFs surgeon-side manipulator (Singh et al., 2015a, 2015b. To meet these challenging demands, the most important aspect of a robotic manipulator is to develop an accurate kinematic model. In this direction, different researchers in the literature have made significant contributions. Out of these, the most prominent one is D–H parameters method, which was proposed by Denavit and Hartenberg in 1955. In the present work, this method is applied to a five-DOFs spatial manipulator, named as patient-side manipulator, which tracks the motion of surgeon-side manipulator during a robot-assisted surgery. The prototype considered in this work is a spatial serial manipulator, being developed at CSIR-CSIO Chandigarh. Experimental validations are performed and results are found to be in close agreement.

Residual limb fluid volume change and volume accommodation: Relationships to activity and self-report outcomes in people with trans-tibial amputation.

Science.gov (United States)

Sanders, Joan E; Youngblood, Robert T; Hafner, Brian J; Ciol, Marcia A; Allyn, Katheryn J; Gardner, David; Cagle, John C; Redd, Christian B; Dietrich, Colin R

2018-02-01

Fluctuations in limb volume degrade prosthesis fit and require users to accommodate changes using management strategies, such as donning and doffing prosthetic socks. To examine how activities and self-report outcomes relate to daily changes in residual limb fluid volume and volume accommodation. Standardized, two-part laboratory protocol with an interim observational period. Participants were classified as "accommodators" or "non-accommodators," based on self-report prosthetic sock use. Participants' residual limb fluid volume change was measured using a custom bioimpedance analyzer and a standardized in-laboratory activity protocol. Self-report health outcomes were assessed with the Socket Comfort Score and Prosthesis Evaluation Questionnaire. Activity was monitored while participants left the laboratory for at least 3 h. They then returned to repeat the bioimpedance test protocol. Twenty-nine people were enrolled. Morning-to-afternoon percent limb fluid volume change per hour was not strongly correlated to percent time weight-bearing or to self-report outcomes. As a group, non-accommodators ( n = 15) spent more time with their prosthesis doffed and reported better outcomes than accommodators. Factors other than time weight-bearing may contribute to morning-to-afternoon limb fluid volume changes and reported satisfaction with the prosthesis among trans-tibial prosthesis users. Temporary doffing may be a more effective and satisfying accommodation method than sock addition. Clinical relevance Practitioners should be mindful that daily limb fluid volume change and prosthesis satisfaction are not dictated exclusively by activity. Temporarily doffing the prosthesis may slow daily limb fluid volume loss and should be investigated as an alternative strategy to sock addition.

Towards holonomic electro-elastomer actuators with six degrees of freedom

International Nuclear Information System (INIS)

Conn, A T; Rossiter, J

2012-01-01

Functionally efficient six degree of freedom (DOF) actuators have not yet been developed in a scale-invariant and inherently compliant unified form. This has primarily been due to the use of conventional serial or parallel kinematical configurations and electromagnetic motors, pneumatics and hydraulics. Contrary to traditional technologies, utilizing electro-active elastomers enables multi-DOF actuation and holonomic operation with minimal structural complexity. Conical dielectric elastomer actuators (DEAs) are compact multi-DOF actuator–sensors that are scalable and can be entirely polymeric, making them suitable for a variety of applications including minimally invasive medical devices. In this paper, cone DEAs are developed towards integrated 6-DOF actuation with muscle-like performance from a single structure. This is achieved by demonstrating the feasibility of holonomic 6-DOF actuation and through experimental characterization of a 5-DOF prototype. The 5-DOF prototype (50 mm length, 60 mm diameter) produced rotational actuation outputs of ±21.7° and ±9.42 mN m and linear actuation outputs of ±4.45 mm (±9.1%) and ±0.55 N. Finally, combined multi-DOF actuation is demonstrated as part of development towards scalable holonomic electro-active elastomer actuators. (paper)

Towards holonomic electro-elastomer actuators with six degrees of freedom

Science.gov (United States)

Conn, A. T.; Rossiter, J.

2012-03-01

Functionally efficient six degree of freedom (DOF) actuators have not yet been developed in a scale-invariant and inherently compliant unified form. This has primarily been due to the use of conventional serial or parallel kinematical configurations and electromagnetic motors, pneumatics and hydraulics. Contrary to traditional technologies, utilizing electro-active elastomers enables multi-DOF actuation and holonomic operation with minimal structural complexity. Conical dielectric elastomer actuators (DEAs) are compact multi-DOF actuator-sensors that are scalable and can be entirely polymeric, making them suitable for a variety of applications including minimally invasive medical devices. In this paper, cone DEAs are developed towards integrated 6-DOF actuation with muscle-like performance from a single structure. This is achieved by demonstrating the feasibility of holonomic 6-DOF actuation and through experimental characterization of a 5-DOF prototype. The 5-DOF prototype (50 mm length, 60 mm diameter) produced rotational actuation outputs of ±21.7° and ±9.42 mN m and linear actuation outputs of ±4.45 mm (±9.1%) and ±0.55 N. Finally, combined multi-DOF actuation is demonstrated as part of development towards scalable holonomic electro-active elastomer actuators.

ORAL HYGIENE OF PROSTHETIC DENTURE USER IN KODINGARENG ISLAND

OpenAIRE

NUR, NURUL KUSUMADEWI S.KG

2008-01-01

Objectives:to determine the level of oral hygiene for prosthetic denture user, especially for full-denture in Kodingareng Island. This researchincluded the distribution level of prosthetic denture user based on age and education.Methods: the method that used in this research is observational descriptive withcross sectional-studyas the research design. Variable result of the research determined in to 3, those are bad, middle, and good. Result:the highest percentage o...

Design and Evaluation of a Prosthetic Knee Joint Using the Geared Five-Bar Mechanism.

Science.gov (United States)

Sun, Yuanxi; Ge, Wenjie; Zheng, Jia; Dong, Dianbiao

2015-11-01

This paper presents the mechanical design, dynamics analysis and ankle trajectory analysis of a prosthetic knee joint using the geared five-bar mechanism. Compared with traditional four-bar or six-bar mechanisms, the geared five-bar mechanism is better at performing diverse movements and is easy to control. This prosthetic knee joint with the geared five-bar mechanism is capable of fine-tuning its relative instantaneous center of rotation and ankle trajectory. The centrode of this prosthetic knee joint, which is mechanically optimized according to the centrode of human knee joint, is better in the bionic performance than that of a prosthetic knee joint using the four-bar mechanism. Additionally, the stability control of this prosthetic knee joint during the swing and stance phase is achieved by a motor. By adjusting the gear ratio of this prosthetic knee joint, the ankle trajectories of both unilateral and bilateral amputees show less deviations from expected than that of the four-bar knee joint.

Identification of motion from multi-channel EMG signals for control of prosthetic hand

International Nuclear Information System (INIS)

Geethanjali, P.; Ray, K.K.

2011-01-01

Full text: The authors in this paper propose an effective and efficient pattern recognition technique from four channel electromyogram (EMG) signals for control of multifunction prosthetic hand. Time domain features such as mean absolute value, number of zero crossings, number of slope sign changes and waveform length are considered for pattern recognition. The patterns are classified using simple logistic regression (SLR) technique and decision tree (DT) using J48 algorithm. In this study six specific hand and wrist motions are identified from the EMG signals obtained from ten different able-bodied. By considering relevant dominant features for pattern recognition, the processing time as well as memory space of the SLR and DT classifiers is found to be less in comparison with neural network (NN), k-nearest neighbour model 1 (kNN Model-1), k-nearest neighbour model 2 (kNN-Model-2) and linear discriminant analysis. The classification accuracy of SLR classifier is found to be 91 ± 1.9%. (author)

Reduced prosthetic stiffness lowers the metabolic cost of running for athletes with bilateral transtibial amputations.

Science.gov (United States)

Beck, Owen N; Taboga, Paolo; Grabowski, Alena M

2017-04-01

Inspired by the springlike action of biological legs, running-specific prostheses are designed to enable athletes with lower-limb amputations to run. However, manufacturer's recommendations for prosthetic stiffness and height may not optimize running performance. Therefore, we investigated the effects of using different prosthetic configurations on the metabolic cost and biomechanics of running. Five athletes with bilateral transtibial amputations each performed 15 trials on a force-measuring treadmill at 2.5 or 3.0 m/s. Athletes ran using each of 3 different prosthetic models (Freedom Innovations Catapult FX6, Össur Flex-Run, and Ottobock 1E90 Sprinter) with 5 combinations of stiffness categories (manufacturer's recommended and ± 1) and heights (International Paralympic Committee's maximum competition height and ± 2 cm) while we measured metabolic rates and ground reaction forces. Overall, prosthetic stiffness [fixed effect (β) = 0.036; P = 0.008] but not height ( P ≥ 0.089) affected the net metabolic cost of transport; less stiff prostheses reduced metabolic cost. While controlling for prosthetic stiffness (in kilonewtons per meter), using the Flex-Run (β = -0.139; P = 0.044) and 1E90 Sprinter prostheses (β = -0.176; P = 0.009) reduced net metabolic costs by 4.3-4.9% compared with using the Catapult prostheses. The metabolic cost of running improved when athletes used prosthetic configurations that decreased peak horizontal braking ground reaction forces (β = 2.786; P = 0.001), stride frequencies (β = 0.911; P < 0.001), and leg stiffness values (β = 0.053; P = 0.009). Remarkably, athletes did not maintain overall leg stiffness across prosthetic stiffness conditions. Rather, the in-series prosthetic stiffness governed overall leg stiffness. The metabolic cost of running in athletes with bilateral transtibial amputations is influenced by prosthetic model and stiffness but not height. NEW & NOTEWORTHY We measured the

Clinical Effectiveness of Using Aesthetic Fixed Prosthetic Appliances with Combined Occlusal Surface

OpenAIRE

Andrii Biben; Zinovii Ozhohan

2017-01-01

The objective of the research was to evaluate the clinical effectiveness of using aesthetic fixed prosthetic appliances with combined occlusal surface. Materials and methods. The study included 30 patients who were divided into 2 groups: Group I included 20 patients with combined occlusal surface of the crowns; Group II included 22 patients with ceramic occlusal surface of the crowns. The patients were observed 3, 6 and 12 months after prosthetic repair. Results. 6 months after prosthet...

Clinical Presentation, Risk Factors, and Outcomes of Hematogenous Prosthetic Joint Infection in Patients with Staphylococcus aureus Bacteremia.

Science.gov (United States)

Tande, Aaron J; Palraj, Bharath Raj; Osmon, Douglas R; Berbari, Elie F; Baddour, Larry M; Lohse, Christine M; Steckelberg, James M; Wilson, Walter R; Sohail, M Rizwan

2016-02-01

Staphylococcus aureus bacteremia is a life-threatening condition that may lead to metastatic infection, including prosthetic joint infection. To assess clinical factors associated with hematogenous prosthetic joint infection, we retrospectively reviewed all patients with a joint arthroplasty in place at the time of a first episode of S. aureus bacteremia over a 5-year period at our institution. Patients with postsurgical prosthetic joint infection without hematogenous prosthetic joint infection were excluded. There were 85 patients (143 arthroplasties) with either no prosthetic joint infection (n = 50; 58.8%) or hematogenous prosthetic joint infection in at least one arthroplasty (n = 35; 41.2%). The odds of hematogenous prosthetic joint infection was significantly increased among patients with community-acquired S. aureus bacteremia (odds ratio [OR] 18.07; 95% confidence interval [CI] 2.64-infinity; P = .001), as compared with nosocomial S. aureus bacteremia, in which there were no patients with hematogenous prosthetic joint infection. After adjusting for S. aureus bacteremia classification, the presence of ≥3 joint arthroplasties in place was associated with a nearly ninefold increased odds of hematogenous prosthetic joint infection as compared with those with 1-2 joint arthroplasties in place (OR 8.55; 95% CI 1.44-95.71; P = .012). All but one joint with prosthetic joint infection demonstrated at least one clinical feature suggestive of infection. There were 4 additional S. aureus prosthetic joint infections diagnosed during a median of 3.4 years of follow-up post hospitalization for S. aureus bacteremia. Prosthetic joint infection is frequent in patients with existing arthroplasties and concomitant S. aureus bacteremia, particularly with community-acquired S. aureus bacteremia and multiple prostheses. In contrast, occult S. aureus prosthetic joint infection without clinical features suggestive of prosthetic joint infection at the time of S. aureus bacteremia

Clinical characteristics, microbiology, and outcomes of prosthetic joint infection in Taiwan.

Science.gov (United States)

Tsai, Jen-Chih; Sheng, Wang-Huei; Lo, Wan-Yu; Jiang, Ching-Chuan; Chang, Shan-Chwen

2015-04-01

Prosthetic joint infection (PJI) after total knee or hip replacement is a devastating complication associated with substantial morbidity and economic cost. The incidence of prosthetic joint infection is increasing as the use of mechanical joint replacement increases. The treatment approach to prosthetic joint infection is based on different clinical situations such as a patient's comorbidities, epidemic microbiology data, and surgical procedures. The aim of our study was to understand clinical characteristics of prosthetic joint infection, the microbiology of the prosthetic joint infection, and the outcomes of different treatment strategies during 2006-2011. We retrospectively collected cases of prosthetic joint infection in the National Taiwan University Hospital between January 1, 2006 and December 31, 2011. The patients' characteristics, microbiology, outcomes, and factors associated with treatment success were recorded. One hundred and forty-four patients were identified as having PJI. Of these, 92 patients were entered into per-protocol analysis. Staphylococcus aureus was the most common causative organism (29.9%), followed by coagulase-negative Staphylococci (16.7%), and Enterococci (9.7%). The overall treatment success rate was 50%. Patients who received a two-stage revision had a better outcome, compared to patients who underwent other types of surgeries (70% vs. 32.7%, respectively; p < 0.001). In multivariate analysis, the two-stage revision was significantly associated with treatment success (odds ratio = 3.923, 95% confidence interval = 1.53-10.04). Our study demonstrates that Staphylococcus aureus was the most common causative organisms in PJI. Performing two-stage revisions was significantly associated with a better outcome. Copyright © 2013. Published by Elsevier B.V.

A mechanism to compensate undesired stiffness in joints of prosthetic hands

NARCIS (Netherlands)

Smit, G.; Plettenbrug, D.H.; Van der Helm, F.C.T.

2014-01-01

Background: Cosmetic gloves that cover a prosthetic hand have a parasitic positive stiffness that counteracts the flexion of a finger joint. Objectives: Reducing the required input torque to move a finger of a prosthetic hand by compensating the parasitic stiffness of the cosmetic glove. Study

Granulicatella adiacens prosthetic hip joint infection after dental treatment.

Science.gov (United States)

Aweid, Osama; Sundararajan, Sabapathy; Teferi, Abraham

2016-06-01

Granulicatella adiacens is a Gram-positive bacteria and a normal component of oral flora. It is also found in dental plaques, endodontic abscesses and can rarely cause more serious infections. We describe a prosthetic hip joint infection in an 81-year-old fit and healthy man due to Granulicatella adiacens who underwent a prolonged dental intervention two days earlier without antibiotic prophylaxis. The infection was successfully treated with surgical intervention and a combination of antibiotics. The patient eventually succumbed to severe community-acquired pneumonia two months later. Current guidelines recommend avoidance of antibiotic prophylaxis prior to dental treatment in patients who have no co-morbidities and no prior operation on the index prosthetic joint. This case report indicates that infections of prosthetic joints may be associated with dental procedures even in fit and healthy patients without the recognized risk factors.

[Tuberculous prosthetic knee joint infection: a case report and literature review].

Science.gov (United States)

Lara-Oya, A; Liébana-Martos, M C; Rodríguez-Granger, J; Sampedro-Martínez, A; Aliaga-Martínez, L; Gutierrez-Fernández, J; Navarro-Marí, J M

2016-08-01

Prosthetic late infection occurs in the second month after surgery in the context of haematogenous spread from another source. Prosthetic mycobacterial infection is a rare complication whose clinical management is not standardized. Patient of 77 years with no personal history except for diabetes and a prosthetic replacement of right knee with osteoarthritis three years ago. Patient goes to hospital emergency box for 6 months pain in the right knee with mechanical inflammatory signs but no fever associated. After their return within 5 days and clinical worsening is reporting growth of Mycobacterium tuberculosis in knee aspirate and antitubercular treatment is established for 9 months. Nuclear magnetic resonance imaging studies also confirmed the diagnosis of tuberculosis spondylitis in the clinical context of the patients. After surgery, M. tuberculosis was again isolated from intraoperative samples and therefore the patient received another batch of treatment for 9 months. After a year of monitoring, the development was acceptable but few months later, the patient died for cardiovascular causes. In the literature review, 15 publications with a total of 17 clinical cases of prosthetic infection by M. tuberculosis were found from 1980 to 2014. Prosthetic tuberculous arthritis, although it is a rare presentation, it should be noted, especially in patients with predisposing conditions with a history of tuberculosis infection.

New Jacobian Matrix and Equations of Motion for a 6 d.o.f Cable-Driven Robot

Directory of Open Access Journals (Sweden)

Ali Afshari

2007-03-01

Full Text Available In this paper, we introduce a new method and new motion variables to study kinematics and dynamics of a 6 d.o.f cable-driven robot. Using these new variables and Lagrange equations, we achieve new equations of motion which are different in appearance and several aspects from conventional equations usually used to study 6 d.o.f cable robots. Then, we introduce a new Jacobian matrix which expresses kinematical relations of the robot via a new approach and is basically different from the conventional Jacobian matrix. One of the important characteristics of the new method is computational efficiency in comparison with the conventional method. It is demonstrated that using the new method instead of the conventional one, significantly reduces the computation time required to determine workspace of the robot as well as the time required to solve the equations of motion.

Control of a powered prosthetic device via a pinch gesture interface

Science.gov (United States)

Yetkin, Oguz; Wallace, Kristi; Sanford, Joseph D.; Popa, Dan O.

2015-06-01

A novel system is presented to control a powered prosthetic device using a gesture tracking system worn on a user's sound hand in order to detect different grasp patterns. Experiments are presented with two different gesture tracking systems: one comprised of Conductive Thimbles worn on each finger (Conductive Thimble system), and another comprised of a glove which leaves the fingers free (Conductive Glove system). Timing tests were performed on the selection and execution of two grasp patterns using the Conductive Thimble system and the iPhone app provided by the manufacturer. A modified Box and Blocks test was performed using Conductive Glove system and the iPhone app provided by Touch Bionics. The best prosthetic device performance is reported with the developed Conductive Glove system in this test. Results show that these low encumbrance gesture-based wearable systems for selecting grasp patterns may provide a viable alternative to EMG and other prosthetic control modalities, especially for new prosthetic users who are not trained in using EMG signals.

Prosthetic valve endocarditis caused by Staphylococcus capitis: report of 4 cases

Directory of Open Access Journals (Sweden)

Wada Yuko

2011-10-01

Full Text Available Abstract Although Staphylococcus capitis is considered to be a rare causative organism for prosthetic valve endocarditis, we report 4 such cases that were encountered at our hospital over the past 2 years. Case 1 was a 79-year-old woman who underwent aortic valve replacement with a bioprosthetic valve and presented with fever 24 days later. Transesophageal echocardiography revealed an annular abscess in the aorto-mitral continuity and mild perivalvular regurgitation. We performed emergency surgery 5 days after the diagnosis of prosthetic valve endocarditis was made. Case 2 was a 79-year-old woman presenting with fever 40 days after aortic valve replacement with a bioprosthesis. Transesophageal echocardiography showed vegetation on the valve, and she underwent urgent surgery 2 days after prosthetic valve endocarditis was diagnosed. In case 3, a 76-year-old man presented with fever 53 days after aortic valve replacement with a bioprosthesis. Vegetation on the prosthetic leaflet could be seen by transesophageal echocardiography. He underwent emergency surgery 2 days after the diagnosis of prosthetic valve endocarditis was made. Case 4 was a 68-year-old woman who collapsed at her home 106 days after aortic and mitral valve replacement with bioprosthetic valves. Percutaneous cardiopulmonary support was started immediately after massive mitral regurgitation due to prosthetic valve detachment was revealed by transesophageal echocardiography. She was transferred to our hospital by helicopter and received surgery immediately on arrival. In all cases, we re-implanted another bioprosthesis after removal of the infected valve and annular debridement. All patients recovered without severe complications after 2 months of antibiotic treatment, and none experienced re-infection during 163 to 630 days of observation. Since the time interval between diagnosis of prosthetic valve endocarditis and valve re-replacement ranged from 0 to 5 days, early surgical removal

LOW-MOLECULAR-WEIGHT HEPARIN TREATMENT FAILURE IN PREVENTION OF PROSTHETIC MITRAL VALVE THROMBOSIS

OpenAIRE

David Šuran; Vojko Kanič; Tatjana Golob Gulič; Husam Franjo Naji; Robert Lipovec

2009-01-01

Background Prosthetic heart valve thrombosis (PHVT) represents a dangerous postoperative complication following prosthetic heart valve replacement. Incidence varies according to different data from 0.5–4 % per year following mitral or aortic valve replacement in spite of adequate oral anticoagulation with coumarins. Case report We are presenting a case of prosthetic mitral valve thrombosis as a result of 6-month lowmolecular-weight heparin (LMWH) (nadroparine) treatment failure. Our pat...

Obtention of a prosthetic group for labelling of radioiodinated proteins

International Nuclear Information System (INIS)

Santos, Josefina da S.; Colturato, Maria Tereza; Araujo, Elaine B. de

2000-01-01

Antibodies and peptides labeled with radionuclides has been extensively used in radioimmunotherapy and radioimmunodetection. The principal problem with the use of radioiodinated proteins is the in vivo dehalogenation. The use of prosthetic groups for indirect labeling of proteins with radioiodine has showed to be useful on labeling proteins with greater in vivo stability. A procedure is described for the preparation of an radioiodinated prosthetic group (N-succinimidyl 4-radioiodine-benzoate-SIB), using procedure described by Stocklin et al, with the iodination of p-bromo-benzoic acid and subsequent reaction with TSTU. Preliminary labeling results showed that the prosthetic group can be obtained in a good yield. The coupling of the SIB to the protein will be studied using human IgG as protein model. (author)

Tuning of PID Controllers for Quadcopter System using Cultural Exchange Imperialist Competitive Algorithm

Directory of Open Access Journals (Sweden)

Nizar Hadi Abbas

2018-02-01

Full Text Available Quadrotors are coming up as an attractive platform for unmanned aerial vehicle (UAV research, due to the simplicity of their structure and maintenance, their ability to hover, and their vertical take-off and landing (VTOL capability. With the vast advancements in small-size sensors, actuators, and processors, researchers are now focusing on developing mini UAV’s to be used in both research and commercial applications. This work presents a detailed mathematical nonlinear dynamic model of the quadrotor which is formulated using the Newton-Euler method. Although the quadrotor is a 6 DOF under-actuated system, the derived rotational subsystem is fully actuated, while the translational subsystem is under-actuated. The derivation of the mathematical model was followed by the development of the controller to control the altitude, attitude, heading and position of the quadrotor in space, which is, based on the linear Proportional-Derivative- Integral (PID controller; thus, a simplified version of the model is obtained. The gains of the controllers will be tuned using optimization techniques to improve the system's dynamic response. The standard Imperialist Competitive Algorithm (ICA was applied to tune the PID parameters and then it was compared to Cultural Exchange Imperialist Competitive algorithm (CEICA tuning, and the results show improvement in the proposed algorithm. The objective function results were enhanced by (23.91% in the CEICA compared with ICA.

Experimental Investigation on the Positioning Accuracy of the Translation Module of a 6-DOF Industrial Robot

Directory of Open Access Journals (Sweden)

Zoltan-Iosif Korka

2016-12-01

Full Text Available The paper presents an experimental investigation regarding the positioning accuracy and kinematical parameters of the base translation module of a 6-DOF industrial robot. The positioning error of the translation module was computed for two cases: one way movement and reversed movement.

A qualitative study of the challenges of providing pre-prosthetic rehabilitation in rural South Africa.

Science.gov (United States)

Ennion, Liezel; Johannesson, Anton

2018-04-01

There is a known shortage of rehabilitation staff in rural settings and a sharp increase in the number of lower limb amputations being performed. A lack of adequate pre-prosthetic rehabilitation will result in worse physical and psychological outcomes for a person with a lower limb amputation, and they will not be eligible to be fitted with a prosthesis. To explore therapists' experiences with providing pre-prosthetic rehabilitation in a rural setting. A qualitative descriptive approach was used to collect and analyse data. Data were collected from 17 purposively sampled therapists in five district hospitals in a rural community in South Africa. Data were collected in two rounds of focus groups to explore the challenges of providing pre-prosthetic rehabilitation in rural South Africa. The main themes identified in the study were (1) a lack of government health system support, (2) poor socioeconomic circumstances of patients and (3) cultural factors that influence rehabilitation. These themes all negatively influence the therapists' ability to follow up patients for pre-prosthetic rehabilitation after discharge from hospital. A lack of adequate pre-prosthetic rehabilitation is a substantial barrier to prosthetic fitting in rural South Africa. Patients who do not receive pre-prosthetic rehabilitation have a poorly shaped residuum or other complications such as knee or hip joint contractures which disqualifies them from being referred to prosthetic services. Therapists involved in this study identified the most important barriers to patients having access to prosthetic services. Clinical relevance Pre-prosthetic rehabilitation provides care of the residuum; maintenance or improvement of physical strength, joint range of motion and referral to a prosthetist. By exploring the challenges known to exist in this service, we can identify potential ways to reduce these barriers and improve the lives of those who use it.

Prosthetic design directives: Low-cost hands within reach.

Science.gov (United States)

Jones, G K; Rosendo, A; Stopforth, R

2017-07-01

Although three million people around the world suffer from the lack of one or both upper limbs 80% of this number is located within developing countries. While prosthetic prices soar with technology 3D printing and low cost electronics present a sensible solution for those that cannot afford expensive prosthetics. The electronic and control design of a low-cost prosthetic hand, the Touch Hand II, is discussed. This paper shows that sensorless techniques can be used to reduce design complexities, costs, and provide easier access to the electronics. A closing and opening finite state machine (COFSM) was developed to handle the actuated digit joint control state and a supervisory switching control scheme, used for speed and grip strength control. Three torque and speed settings were created to be preset for specific grasps. The hand was able to replicate ten frequently used grasps and grip some common objects. Future work is necessary to enable a user to control it with myoelectric signals (MESs) and to solve operational problems related to electromagnetic interference (EMI).

Anaerobic prosthetic joint infection.

Science.gov (United States)

Shah, Neel B; Tande, Aaron J; Patel, Robin; Berbari, Elie F

2015-12-01

In an effort to improve mobility and alleviate pain from degenerative and connective tissue joint disease, an increasing number of individuals are undergoing prosthetic joint replacement in the United States. Joint replacement is a highly effective intervention, resulting in improved quality of life and increased independence [1]. By 2030, it is predicted that approximately 4 million total hip and knee arthroplasties will be performed yearly in the United States [2]. One of the major complications associated with this procedure is prosthetic joint infection (PJI), occurring at a rate of 1-2% [3-7]. In 2011, the Musculoskeletal Infectious Society created a unifying definition for prosthetic joint infection [8]. The following year, the Infectious Disease Society of America published practice guidelines that focused on the diagnosis and management of PJI. These guidelines focused on the management of commonly encountered organisms associated with PJI, including staphylococci, streptococci and select aerobic Gram-negative bacteria. However, with the exception of Propionibacterium acnes, management of other anaerobic organisms was not addressed in these guidelines [1]. Although making up approximately 3-6% of PJI [9,10], anaerobic microorganisms cause devastating complications, and similar to the more common organisms associated with PJI, these bacteria also result in significant morbidity, poor outcomes and increased health-care costs. Data on diagnosis and management of anaerobic PJI is mostly derived from case reports, along with a few cohort studies [3]. There is a paucity of published data outlining factors associated with risks, diagnosis and management of anaerobic PJI. We therefore reviewed available literature on anaerobic PJI by systematically searching the PubMed database, and collected data from secondary searches to determine information on pathogenesis, demographic data, clinical features, diagnosis and management. We focused our search on five commonly

A clinical survey about commercial games in lower limb prosthetic rehabilitation.

Science.gov (United States)

Imam, Bita; Miller, William C; Finlayson, Heather C; Eng, Janice J; Jarus, Tal

2018-06-01

Despite the popularity of commercial games in lower limb prosthetic rehabilitation, data about their prevalence of use as well as therapists' perspectives about these games are still lacking. To learn about the prevalence of use of commercial games in lower limb prosthetic rehabilitation and therapists' perspectives about these games. Cross-sectional. An online survey was sent to physical and occupational therapists across prosthetic rehabilitation facilities in Canada. The survey had questions about the use of commercial games and therapists' perspectives. Data were collected from 82 therapists. Overall, 46.3% (38/82) reported that they use commercial games; of those, 94.7% (36/38) used the Nintendo Wii Fit. The most reported perceived benefits were the Wii Fit helping to improve weight shifting ( n = 76/82, 92.7%) and balance ( n = 75/82, 91.5%), and being motivating and complementing traditional therapy ( n = 75/82, 91.5%). The most reported perceived barriers/challenges were lack of time and familiarity with the games ( n = 58/82, 70.7%). Commercial games, particularly the Wii Fit, are commonly used in lower prosthetic rehabilitation in Canada. Most of the queried therapists view the Wii Fit positively. Knowledge translation activities and developing standard treatment protocols would be helpful in minimizing the barriers identified in this study. Clinical relevance The Wii Fit is prevalent in lower limb prosthetic rehabilitation in Canada and it is viewed positively by therapists as having the potential to improve balance and weight bearing, making rehabilitation more motivating, and complementing traditional therapy. Future studies should investigate the efficacy of the Wii Fit in prosthetic rehabilitation.

Quality Assessment of Prosthetic Rehabilitation Using Aesthetic Fixed Restorations

Directory of Open Access Journals (Sweden)

Zinovii Ozhohan

2018-04-01

Full Text Available The objective of the research was to study and assess the quality of prosthetic treatment using aesthetic fixed restorations. Materials and methods. The study included 79 patients without a comorbidity who underwent prosthetic rehabilitation. All the patients were divided into 3 groups: Group I included 25 patients with metal-plastic restorations; Group II comprised 34 patients with porcelain-fused-to-metal restorations; Group III consisted of 20 patients with a combined occlusal surface of prosthetic restorations. The patients were observed 6 months after prosthetic repair. Only patients with single molar and premolar crowns were examined. Bridge prostheses were not taken into account in order to eliminate the effect of masticatory force redistribution on the abutment crowns. Results. In Group I, 11 (44% patients were satisfied with the results of prosthetic treatment. In Group II, 25 (78.12% patients reported that they were satisfied with their treatment. In Group III, there were 17 (85% patients satisfied with their outcome. However, the patients’ complaints are often subjective and do not fully reflect the objective state of the dentoalveolar system. An objective examination revealed that in indirect restorations, marginal periodontium pathology is typical. Conclusions. Aesthetic fixed restorations with a combined occlusal surface have demonstrated good clinical results, even at long-term follow-up. Combining positive properties of two different construction materials, namely zirconium dioxide and ceramics, they reduce the risk of complications such as marginal periodontium pathology and chipping along the occlusal surface as well as contribute to minimal abrasion of the occlusal surfaces of the antagonistic teeth. We cannot recommend metal-plastic restorations due to their low clinical effectiveness, poor aesthetic qualities as well as a high level of marginal periodontium pathology.

Effect of Modifying Prosthetic Socket Base Materials by Adding Nanodiamonds

Directory of Open Access Journals (Sweden)

Lifang Ma

2015-01-01

Full Text Available The curing process of prosthetic socket base materials requires attention owing to a series of associated problems that are yet to be addressed and solved. However, to date, few relevant studies have been reported. In this paper, nanodiamonds modified with a silane coupling agent were dispersed into a prosthetic socket base material, and the performance of the modified base materials was investigated. Adding a predetermined amount of nanodiamonds to the prosthetic socket base material increased the glass transition temperature, improved the mechanical properties of the cured base material, and reduced the influence of the volatile gas formed during the curing process on the environment. With increasing nanodiamond contents, the glass transition temperature increased and the mechanical properties improved slightly. Owing to the high thermal conductivity of the nanodiamonds, the localized heat, as a result of the curing process, could be dissipated and released. Thus, adding nanodiamonds led to a more uniform temperature field forming in the curing system. This improved the curing process and reduced the formation of volatile monomers, thereby decreasing the adverse impact of the generated volatile gases on the environment. All of these provide a potential strategy for modifying prosthetic socket base materials.

Strength evaluation of prosthetic check sockets, copolymer sockets, and definitive laminated sockets.

Science.gov (United States)

Gerschutz, Maria J; Haynes, Michael L; Nixon, Derek; Colvin, James M

2012-01-01

A prosthesis encounters loading through forces and torques exerted by the person with amputation. International Organization for Standardization (ISO) standard 10328 was designed to test most lower-limb prosthetic components. However, this standard does not include prosthetic sockets. We measured static failure loads of prosthetic sockets using a modified ISO 10328 and then compared them with the criteria set by this standard for other components. Check socket (CS) strengths were influenced by thickness, material choice, and fabrication method. Copolymer socket (CP) strengths depended on thickness and fabrication methods. A majority of the CSs and all of the CPs failed to pass the ISO 10328 ductile loading criterion. In contrast, the strengths of definitive laminated sockets (DLs) were influenced more by construction material and technique. A majority of the DLs failed to pass the ISO 10328 brittle loading criterion. Analyzing prosthetic sockets from a variety of facilities demonstrated that socket performance varies considerably between and within facilities. The results from this article provide a foundation for understanding the quality of prosthetic sockets, some insight into possible routes for improving the current care delivered to patients, and a comparative basis for future technology.

Computed Tomography of Prosthetic Heart Valves

NARCIS (Netherlands)

Habets, J.

2012-01-01

Prosthetic heart valve (PHV) dysfunction is an infrequent but potentially life-threatening disease with a heterogeneous clinical presentation. Patients with PHV dysfunction clinically can present with symptoms of congestive heart failure (dyspnea, fatigue, edema), fever, angina pectoris, dizziness

A two DoF finger for a biomechatronic artificial hand.

Science.gov (United States)

Carrozza, M C; Massa, B; Dario, P; Zecca, M; Micera, S; Pastacaldi, P

2002-01-01

Current prosthetic hands are basically simple grippers with one or two degrees of freedom, which barely restore the capability of the thumb-index pinch. Although most amputees consider this performance as acceptable for usual tasks, there is ample room for improvement by exploiting recent progresses in mechatronics design and technology. We are developing a novel prosthetic hand featured by multiple degrees of freedom, tactile sensing capabilities, and distributed control. Our main goal is to pursue an integrated design approach in order to fulfill critical requirements such as cosmetics, controllability, low weight, low energy consumption and noiselessness. This approach can be synthesized by the definition "biomechatronic design", which means developing mechatronic systems inspired by living beings and able to work harmoniously with them. This paper describes the first implementation of one single finger of a future biomechatronic hand. The finger has a modular design, which allows to obtain hands with different degrees of freedom and grasping capabilities. Current developments include the implementation of a hand comprising three fingers (opposing thumb, index and middle) and an embedded controller.

Coronary artery assessment by multidetector computed tomography in patients with prosthetic heart valves

International Nuclear Information System (INIS)

Habets, Jesse; Mali, Willem P.T.M.; Budde, Ricardo P.J.; Brink, Renee B.A. van den; Uijlings, Ruben; Spijkerboer, Anje M.; Chamuleau, Steven A.J.

2012-01-01

Patients with prosthetic heart valves may require assessment for coronary artery disease. We assessed whether valve artefacts hamper coronary artery assessment by multidetector CT. ECG-gated or -triggered CT angiograms were selected from our PACS archive based on the presence of prosthetic heart valves. The best systolic and diastolic axial reconstructions were selected for coronary assessment. Each present coronary segment was scored for the presence of valve-related artefacts prohibiting coronary artery assessment. Scoring was performed in consensus by two observers. Eighty-two CT angiograms were performed on a 64-slice (n = 27) or 256-slice (n = 55) multidetector CT. Eighty-nine valves and five annuloplasty rings were present. Forty-three out of 1160 (3.7%) present coronary artery segments were non-diagnostic due to valve artefacts (14/82 patients). Valve artefacts were located in right coronary artery (15/43; 35%), left anterior descending artery (2/43; 5%), circumflex artery (14/43; 32%) and marginal obtuse (12/43; 28%) segments. All cobalt-chrome containing valves caused artefacts prohibiting coronary assessment. Biological and titanium-containing valves did not cause artefacts except for three specific valve types. Most commonly implanted prosthetic heart valves do not hamper coronary assessment on multidetector CT. Cobalt-chrome containing prosthetic heart valves preclude complete coronary artery assessment because of severe valve artefacts. circle Most commonly implanted prosthetic heart valves do not hamper coronary artery assessment circle Prosthetic heart valve composition determines the occurrence of prosthetic heart valve-related artefacts circle Bjoerk-Shiley and Sorin tilting disc valves preclude diagnostic coronary artery segment assessment. (orig.)

Evaluation of 3D printed anatomically scalable transfemoral prosthetic knee.

Science.gov (United States)

Ramakrishnan, Tyagi; Schlafly, Millicent; Reed, Kyle B

2017-07-01

This case study compares a transfemoral amputee's gait while using the existing Ossur Total Knee 2000 and our novel 3D printed anatomically scalable transfemoral prosthetic knee. The anatomically scalable transfemoral prosthetic knee is 3D printed out of a carbon-fiber and nylon composite that has a gear-mesh coupling with a hard-stop weight-actuated locking mechanism aided by a cross-linked four-bar spring mechanism. This design can be scaled using anatomical dimensions of a human femur and tibia to have a unique fit for each user. The transfemoral amputee who was tested is high functioning and walked on the Computer Assisted Rehabilitation Environment (CAREN) at a self-selected pace. The motion capture and force data that was collected showed that there were distinct differences in the gait dynamics. The data was used to perform the Combined Gait Asymmetry Metric (CGAM), where the scores revealed that the overall asymmetry of the gait on the Ossur Total Knee was more asymmetric than the anatomically scalable transfemoral prosthetic knee. The anatomically scalable transfemoral prosthetic knee had higher peak knee flexion that caused a large step time asymmetry. This made walking on the anatomically scalable transfemoral prosthetic knee more strenuous due to the compensatory movements in adapting to the different dynamics. This can be overcome by tuning the cross-linked spring mechanism to emulate the dynamics of the subject better. The subject stated that the knee would be good for daily use and has the potential to be adapted as a running knee.

The radiology of prosthetic heart valves

International Nuclear Information System (INIS)

Steiner, R.M.; Flicker, S.

1985-01-01

The development of prosthetic heart valves in the late 1950s ushered in a new era in the treatment of heart disease. The radiologist has an important role to play preoperatively in the diagnosis of valvular heart disease. Radiology is valuable in identification of the implanted prosthetic valve and recognition of complications associated with valve implantation. Radiologists must be familiar with the imaging techniques best suited to evaluate the function of the valve prosthesis in question. In this chapter the authors discuss the radiographic approach to the evaluation of the status of patients for valve replacement and the imaging problems peculiar to the types of valves in current use. The relative value of plain-film radiography, fluoroscopy, videorecording and cinerecording, and aortography is addressed, as well as the potential value of magnetic resonance imaging and subsecond dynamic computed tomography

Functional and Psychosocial Outcomes of Hand Transplantation Compared with Prosthetic Fitting in Below-Elbow Amputees: A Multicenter Cohort Study.

Directory of Open Access Journals (Sweden)

Stefan Salminger

Full Text Available Hand-transplantation and improvements in the field of prostheses opened new frontiers in restoring hand function in below-elbow amputees. Both concepts aim at restoring reliable hand function, however, the indications, advantages and limitations for each treatment must be carefully considered depending on level and extent of amputation. Here we report our findings of a multi-center cohort study comparing hand function and quality-of-life of people with transplanted versus prosthetic hands.Hand function in amputees with either transplant or prostheses was tested with Action Research Arm Test (ARAT, Southampton Hand Assessment Procedure (SHAP and the Disabilities of the Arm, Shoulder and Hand measure (DASH. Quality-of-life was compared with the Short-Form 36 (SF-36.Transplanted patients (n = 5 achieved a mean ARAT score of 40.86 ± 8.07 and an average SHAP score of 75.00 ± 11.06. Prosthetic patients (n = 7 achieved a mean ARAT score of 39.00 ± 3.61 and an average SHAP score of 75.43 ± 10.81. There was no significant difference between transplanted and prosthetic hands in ARAT, SHAP or DASH. While quality-of-life metrics were equivocal for four scales of the SF-36, transplanted patients reported significantly higher scores in "role-physical" (p = 0.006, "vitality" (p = 0.008, "role-emotional" (p = 0.035 and "mental-health" (p = 0.003.The indications for hand transplantation or prosthetic fitting in below-elbow amputees require careful consideration. As functional outcomes were not significantly different between groups, patient's best interests and the route of least harm should guide treatment. Due to the immunosuppressive side-effects, the indication for allotransplantation must still be restrictive, the best being bilateral amputees.

Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator

Directory of Open Access Journals (Sweden)

Qingcheng Chen

2015-10-01

Full Text Available Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics solution by introducing the screw theory. Unlike other methods, the proposed method only establishes two coordinates, namely the inertial coordinate and the tool coordinate; the screw motion of each link is carried out based on the inertial coordinate, ensuring definite geometric meaning. Furthermore, we adopt a new inverse kinematics algorithm, developing an improved sub-problem method along with Paden-Kahan sub-problems. This method has high efficiency and can be applied in real-time industrial operation. It is convenient to select the desired solutions directly from among multiple solutions by examining clear geometric meaning. Finally, the effectiveness and reliability performance of the new algorithm are analysed and verified in comparative experiments carried out on the six-DOF serial robot “Qianjiang I”.

Re-operation for aortic and mitral prosthetic dysfunctions.

Science.gov (United States)

Kaul, T K; Sastry, M R; Mercer, J L; Meade, J B

1985-01-01

The overall incidence of re-operation and prosthetic valve endocarditis was low in the present series as mechanical prostheses were used predominantly. The prosthetic dysfunctions were less frequent following the primary implantation with Bjork Shiley prostheses, but high operative risk was associated with the clotted Bjork Shiley prostheses. We also had unusual experience of strut fracture and sticking of Bjork Shiley discs in the closed position in both aortic and mitral positions. The early deaths were nil since the use of cardioplegic protection. Intra-operative bleeding due to adhesions can be minimised by using synthetic or heterologous pericardium during the primary operation.

Future Research Opportunities in Peri-Prosthetic Joint Infection Prevention.

Science.gov (United States)

Berbari, Elie; Segreti, John; Parvizi, Javad; Berríos-Torres, Sandra I

Peri-prosthetic joint infection (PJI) is a serious complication of prosthetic joint arthroplasty. A better understanding and reversal of modifiable risk factors may lead to a reduction in the incidence of incisional (superficial and deep) and organ/space (e.g., PJI) surgical site infections (SSI). Recently, the Centers for Disease Control and Prevention (CDC) and the Healthcare Infection Control Practices Advisory Committee (HICPAC) published the Guideline for Prevention of Surgical Site Infection. This targeted update applies evidence-based methodology in drafting recommendations for potential strategies to reduce the risk of SSI both across surgical procedures and specifically in prosthetic joint arthroplasty. A panel of PJI content experts identified nine PJI prevention research opportunities based on both evidence gaps identified through the guideline development process (transfusion, immunosuppressive therapy, anticoagulation, orthopedic space suit, and biofilm) and expert opinion (anesthesia, operative room environment, glycemic control, and Staphylococcus aureus nasal screening and decolonization. This article offers a road map for PJI prevention research.

Experiences of providing prosthetic and orthotic services in Sierra Leone--the local staff's perspective.

Science.gov (United States)

Magnusson, Lina; Ahlström, Gerd

2012-01-01

In Sierra Leone, West Africa, there are many people with disabilities in need of rehabilitation services after a long civil war. The aim of this qualitative study was to explore the experiences of prosthetic and orthotic service delivery in Sierra Leone from the local staff's perspective. Fifteen prosthetic and orthotic technicians working at all the rehabilitation centres providing prosthetic and orthotic services in Sierra Leone were interviewed. The interviews were transcribed and subjected to latent content analysis. One main theme emerged: sense of inability to deliver high-quality prosthetic and orthotic services. This main theme was generated from eight sub-themes: Desire for professional development; appraisals of work satisfaction and norms; patients neglected by family; limited access to the prosthetic and orthotic services available; problems with materials and machines; low public awareness concerning disabilities; marginalisation in society and low priority on the part of government. The findings illustrated traditional beliefs about the causes of disability and that the public's attitude needs to change to include and value people with disabilities. Support from international organisations was considered necessary as well as educating more prosthetic and orthotic staff to a higher level.

Capnocytophaga canimorsus: a rare case of conservatively treated prosthetic valve endocarditis.

Science.gov (United States)

Jalava-Karvinen, Päivi; Grönroos, Juha O; Tuunanen, Helena; Kemppainen, Jukka; Oksi, Jarmo; Hohenthal, Ulla

2018-05-01

We describe a rare case of prosthetic valve endocarditis caused by the canine bacterium Capnocytophaga canimorsus in a male aged 73 years. The diagnosis of infective endocarditis was unequivocal, as it blood cultures were positive for C. canimorsus and vegetations were detected on transesophageal echocardiography; the modified Duke criteria were fulfilled. PET-CT showed intense 18 F-FDG uptake of the prosthetic valve area. The patient was treated with antibiotics alone (no surgery), and is now on life-long suppressive antibiotic therapy. To our knowledge, this is the third reported case of prosthetic valve endocarditis caused by C. canimorsus and the first one to have been treated conservatively. © 2018 APMIS. Published by John Wiley & Sons Ltd.

Composite Material Testing Data Reduction to Adjust for the Systematic 6-DOF Testing Machine Aberrations

Science.gov (United States)

Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson

2012-01-01

This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...

Mitral Prosthetic Valve Obstruction and Its Complications

Directory of Open Access Journals (Sweden)

Rajesh Rajan

2015-12-01

Full Text Available Prosthetic Valve Obstruction (PVO is a serious complication which is associated with increased morbidity and mortality. This could result from thrombus formation, development of pannus, or a combination of both. Patients with this complication often present with symptoms and signs of heart failure, systemic embolism, acute cardiovascular collapse, and sudden death. Transesophageal echocardiography and cine fluoroscopy play a vital role in diagnosis of this potentially lethal condition. Herein, we reported a 56-year-old male patient who presented with severe heart failure and was found to have obstructed ATS27 bileaflet mitral prosthetic valve. Thrombolysis and redo surgery are two important options for treating this condition although guidelines for choosing between the two are not very definite.

Utilization of penile prosthesis and male incontinence prosthetics in Saudi Arabia

Directory of Open Access Journals (Sweden)

Amjad Alwaal

2017-01-01

Conclusions: There is an increased utilization of penile prosthetics in Saudi Arabia. The private sector performs the majority of penile prosthesis procedures, and most of them are of the semirigid type. The governmental sector is more likely to perform inflatable penile prosthesis and male incontinence device procedures. Male incontinence prosthetics' use is very limited in Saudi Arabia.

Geometric technique for the kinematic modeling of a 5 DOF redundant manipulator

CSIR Research Space (South Africa)

Makondo, N

2012-11-01

Full Text Available ,? Dipartimento di Elettronica, Informatica e Sistemistica (DEIS), Universit a di Bologna [Online]; Available at: http://www- lar.deis.unibo.it/people/cmelchiorri/Files Robotica/FIR 04 Kinem.pdf[31 October 2012] [18] Manocha, D.; Canny, J.F.; , ?Efficient... to the inverse kinematics of the Pioneer 2 robotic arm ?, Robotica, 2005, vol.23, pp.123, DOI: 10.1017/S0263574704000529 [20] De Xu, Carlos A. Acosta Calderon, John Q. Gan etc .An Analysis of the Inverse Kinematics for a 5-DOF Manipulator, International...

Remote transient Lactobacillus animalis bacteremia causing prosthetic hip joint infection: a case report.

Science.gov (United States)

Somayaji, R; Lynch, T; Powell, J N; Gregson, D

2016-11-04

Lactobacillus spp. are uncommon pathogens in immunocompetent hosts, and even rarer causes of prosthetic device infections. A case of chronic hip prosthetic joint infection (PJI) caused by L. animalis is described. This occurred 5 years after a transient bacteremia with the same organism. Whole genome sequencing of both isolates proved this PJI infection resulted from this remote bacteremia. We document that prosthetic joint infections may be a consequence of bacteremia as much as 3 years before the onset of symptoms.

DME Prosthetics Orthotics, and Supplies Fee Schedule

Data.gov (United States)

U.S. Department of Health & Human Services — Durable Medical Equipment, Prosthetics-Orthotics, and Supplies Fee Schedule. The list contains the fee schedule amounts, floors, and ceilings for all procedure codes...

Occlusion properties of prosthetic contact lenses for the treatment of amblyopia.

Science.gov (United States)

Collins, Randall S; McChesney, Megan E; McCluer, Craig A; Schatz, Martha P

2008-12-01

The efficacy of opaque contact lenses as occlusion therapy for amblyopia has been established in the literature. Prosthetic contact lenses use similar tints to improve cosmesis in scarred or deformed eyes and may be an alternative in occlusion therapy. To test this idea, we determined the degree of vision penalization elicited by prosthetic contact lenses and their effect on peripheral fusion. We tested 19 CIBA Vision DuraSoft 3 Prosthetic soft contact lenses with varying iris prints, underprints, and opaque pupil sizes in 10 volunteers with best-corrected Snellen distance visual acuity of 20/20 or better in each eye. Snellen visual acuity and peripheral fusion using the Worth 4-Dot test at near were measured on each subject wearing each of the 19 lenses. Results were analyzed with 3-factor analysis of variance. Mean visual acuity through the various lenses ranged from 20/79 to 20/620. Eight lenses allowed preservation of peripheral fusion in 50% or more of the subjects tested. Iris print pattern and opaque pupil size were significant factors in determining visual acuity (p occlusion with prosthetic contact lenses a viable therapy for amblyopia. The degree of penalization can be varied and different iris print patterns and pupil sizes, using peripheral fusion, can be preserved with some lenses. Prosthetic contact lenses can be more cosmetically appealing and more tolerable than other amblyopia treatment modalities. These factors may improve compliance in occlusion therapy.

Sistem Kontrol Robot Arm 5 DOF Berbasis Pengenalan Pola Suara Menggunakan Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inference System (ANFIS

Directory of Open Access Journals (Sweden)

WS Mada Sanjaya

2016-12-01

Full Text Available Telah dilakukan penelitian yang menggambarkan implementasi pengenalan pola suara untuk mengontrol gerak robot arm 5 DoF dalam mengambil dan menyimpan benda. Dalam penelitian ini metode yang digunakan adalah Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inferense System (ANFIS. Metode MFCC digunakan untuk ekstraksi ciri sinyal suara, sedangkan ANFIS digunakan sebagai metode pembelajaran untuk pengenalan pola suara. Pada proses pembelajaran ANFIS data latih yang digunakan sebanyak 6 ciri. Data suara terlatih dan data suara tak terlatih digunakan untuk pengujian sistem pengenalan pola suara. Hasil pengujian menunjukkan tingkat keberhasilan, untuk data suara terlatih sebesar 87,77% dan data tak terlatih sebesar 78,53%. Sistem pengenalan pola suara ini telah diaplikasikan dengan baik untuk mengerakan robot arm 5 DoF berbasis mikrokontroler Arduino. Have been implemented of sound pattern recognition to control 5 DoF of Arm Robot to pick and place an object. In this research used Mel-Frequency Cepstrum Coefficients (MFCC and Adaptive Neuro-Fuzzy Interferense System (ANFIS methods. MFCC method used for features extraction of sound signal, meanwhile ANFIS used to learn sound pattern recognition. On ANFIS method data learning use 6 features. Trained and not trained data used to examine the system of sound pattern identification. The result show the succesfull level, for trained data 87.77% and for not trained data 78.53%. Sound pattern identification system was appliedto controlled 5 DoF arm robot based Arduino microcontroller.

[Virtual Planning of Prosthetic Treatment of the Orbit].

Science.gov (United States)

Veit, Johannes A; Thierauf, Julia; Egner, Kornelius; Wiggenhauser, Paul Severin; Friedrich, Daniel; Greve, Jens; Schuler, Patrick J; Hoffmann, Thomas K; Schramm, Alexander

2017-06-01

Optimal positioning of bone-anchored implants in the treatment of patients with orbital prosthesis is challenging. The definition of implant axis as well as the positioning of the implants is important to prevent failures in prosthetic rehabilitation in these patients. We performed virtual planning of enossal implants at a base of a standard fan beam CT scan using the software CoDiagnostiX™ (DentalWings, Montréal, Canada). By 3D-printing a surgical guide for drilling and implant insertion was manufactured (Med-610™, Stratasys, Rehovot, Israel). An orbital exenteration was performed in a patient after shrinkage of the eyelids 20 years after enucleation and radiation of the orbit due to rhabdomyosarcoma. 4 Vistafix-3 implants (Cochlear™, Cochlea, Centennial, USA) were primarily inserted after resection with the help of the 3D-surgical guide. Prosthetic rehabilitation could be achieved as preplanned to a predictable result. The individual prosthesis of the orbit showed good functional and esthetic outcome. The virtual 3D-planning of endosseous implants for prosthetic orbital and periorbital reconstruction is easy to use and facilitates optimal placement of implants especially in posttherapeutically altered anatomic situations. © Georg Thieme Verlag KG Stuttgart · New York.

Development of inexpensive prosthetic feet for high-heeled shoes using simple shoe insole model.

Science.gov (United States)

Meier, Margrit R; Tucker, Kerice A; Hansen, Andrew H

2014-01-01

The large majority of prosthetic feet are aimed at low-heeled shoes, with a few models allowing a heel height of up to 5 cm. However, a survey by the American Podiatric Medical Association indicates that most women wear heels over 5 cm; thus, current prosthetic feet limit most female prosthesis users in their choice. Some prosthetic foot components are heel-height adjustable; however, their plantar surface shapes do not change to match the insole shapes of the shoes with different heel heights. The aims of the study were therefore (1) to develop a model that allows prediction of insole shape for various heel height shoes in combination with different shoe sizes and (2) to develop and field-test low-cost prototypes of prosthetic feet whose insole shapes were based on the new model. An equation was developed to calculate insole shapes independent of shoe size. Field testing of prototype prosthetic feet fabricated based on the equation was successful and demonstrated the utility of the equation.

Development of a prototype over-actuated biomimetic prosthetic hand.

Directory of Open Access Journals (Sweden)

Matthew R Williams

Full Text Available The loss of a hand can greatly affect quality of life. A prosthetic device that can mimic normal hand function is very important to physical and mental recuperation after hand amputation, but the currently available prosthetics do not fully meet the needs of the amputee community. Most prosthetic hands are not dexterous enough to grasp a variety of shaped objects, and those that are tend to be heavy, leading to discomfort while wearing the device. In order to attempt to better simulate human hand function, a dexterous hand was developed that uses an over-actuated mechanism to form grasp shape using intrinsic joint mounted motors in addition to a finger tendon to produce large flexion force for a tight grip. This novel actuation method allows the hand to use small actuators for grip shape formation, and the tendon to produce high grip strength. The hand was capable of producing fingertip flexion force suitable for most activities of daily living. In addition, it was able to produce a range of grasp shapes with natural, independent finger motion, and appearance similar to that of a human hand. The hand also had a mass distribution more similar to a natural forearm and hand compared to contemporary prosthetics due to the more proximal location of the heavier components of the system. This paper describes the design of the hand and controller, as well as the test results.

Prosthetic Hip Loosening Due to Brucellar Infection: Case Report and Literature Review

Directory of Open Access Journals (Sweden)

Anis Tebourbi

2016-12-01

Full Text Available Context: Brucellosis is actually considered to be the commonest zoonotic infection worldwide; conversely prosthetic infection due to brucella is extremely rare. Although diagnostic is easily achieved, management of such situations is extremely challenging. Aims: To report the case of prosthetic hip loosening due to brucellar infection, discuss management manners and to summarize data about 19 cases reported in the literature. Methods: We report the case of a 73-year-old woman with brucellar prosthetic hip loosening treated with 2-stage exchange of the prosthesis and prolonged double antibiotherapy Results: At two years follow up the patient is pain free with total functional recovery and no clinical and radiographic signs of prosthetic loosening Conclusions: Brucella should be evocated as a cause of total joint arthroplasty infection especially in patients from endemic regions and with occupational exposure. Antibiotic treatment alone can be followed if there are no signs of implant loosening. Tow stage revision should be considered in other cases.

System for simultaneously measuring 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser.

Science.gov (United States)

Cui, Cunxing; Feng, Qibo; Zhang, Bin; Zhao, Yuqiong

2016-03-21

A novel method for simultaneously measuring six degree-of-freedom (6DOF) geometric motion errors is proposed in this paper, and the corresponding measurement instrument is developed. Simultaneous measurement of 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser is accomplished for the first time to the best of the authors' knowledge. Dual-frequency laser beams that are orthogonally linear polarized were adopted as the measuring datum. Positioning error measurement was achieved by heterodyne interferometry, and other 5DOF geometric motion errors were obtained by fiber collimation measurement. A series of experiments was performed to verify the effectiveness of the developed instrument. The experimental results showed that the stability and accuracy of the positioning error measurement are 31.1 nm and 0.5 μm, respectively. For the straightness error measurements, the stability and resolution are 60 and 40 nm, respectively, and the maximum deviation of repeatability is ± 0.15 μm in the x direction and ± 0.1 μm in the y direction. For pitch and yaw measurements, the stabilities are 0.03″ and 0.04″, the maximum deviations of repeatability are ± 0.18″ and ± 0.24″, and the accuracies are 0.4″ and 0.35″, respectively. The stability and resolution of roll measurement are 0.29″ and 0.2″, respectively, and the accuracy is 0.6″.

Mechanical design of a shape memory alloy actuated prosthetic hand.

Science.gov (United States)

De Laurentis, Kathryn J; Mavroidis, Constantinos

2002-01-01

This paper presents the mechanical design for a new five fingered, twenty degree-of-freedom dexterous hand patterned after human anatomy and actuated by Shape Memory Alloy artificial muscles. Two experimental prototypes of a finger, one fabricated by traditional means and another fabricated by rapid prototyping techniques, are described and used to evaluate the design. An important aspect of the Rapid Prototype technique used here is that this multi-articulated hand will be fabricated in one step, without requiring assembly, while maintaining its desired mobility. The use of Shape Memory Alloy actuators combined with the rapid fabrication of the non-assembly type hand, reduce considerably its weight and fabrication time. Therefore, the focus of this paper is the mechanical design of a dexterous hand that combines Rapid Prototype techniques and smart actuators. The type of robotic hand described in this paper can be utilized for applications requiring low weight, compactness, and dexterity such as prosthetic devices, space and planetary exploration.

A 3-DOF haptic master device for minimally invasive surgery

Science.gov (United States)

Nguyen, Phuong-Bac; Oh, Jong-Seok; Choi, Seung-Bok

2012-04-01

This paper introduces a novel 3-DOF haptic master device for minimally invasive surgery featuring magneto-rheological (MR) fluid. It consists of three rotational motions. These motions are constituted by two bi-directional MR (BMR) plus one conventional MR brakes. The BMR brake used in the system possesses a salient advantage that its range of braking torque varies from negative to positive values. Therefore, the device is expected to be able sense in a wide environment from very soft tissues to bones. In this paper, overall of the design of the device is presented from idea, modeling, optimal design, manufacturing to control of the device. Moreover, experimental investigation is undertaken to validate the effectiveness of the device.

Remote transient Lactobacillus animalis bacteremia causing prosthetic hip joint infection: a case report

Directory of Open Access Journals (Sweden)

R. Somayaji

2016-11-01

Full Text Available Abstract Background Lactobacillus spp. are uncommon pathogens in immunocompetent hosts, and even rarer causes of prosthetic device infections. Case presentation A case of chronic hip prosthetic joint infection (PJI caused by L. animalis is described. This occurred 5 years after a transient bacteremia with the same organism. Whole genome sequencing of both isolates proved this PJI infection resulted from this remote bacteremia. Conclusions We document that prosthetic joint infections may be a consequence of bacteremia as much as 3 years before the onset of symptoms.

Mathematical model of the 5-DOF sled dynamics of an electrodynamic Maglev system with a passive sled

NARCIS (Netherlands)

Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.

2005-01-01

A model that describes the five-degrees-of-freedom (5-DOF) dynamics of a passively levitated electrodynamic maglev system is presented. The model is based on the flux-current-force interactions and the geometric relationships between the levitation coils and the permanent magnets on the sled. The

Telerobotic control of a dextrous manipulator using master and six-DOF hand-controllers for space assembly and servicing tasks

Science.gov (United States)

O'Hara, John M.

1987-01-01

Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.

In vitro adherence of bacteria to prosthetic grafting materials

International Nuclear Information System (INIS)

Brewer, A.R.; Stromberg, B.V.

1990-01-01

Adherence of bacteria to prosthetic grafting material is thought to play an important role in the ultimate development of prosthetic infections. To evaluate the role of bacterial adherence in the initiation and colonization of prosthetic materials, Proplast II, Gore-Tex, and silicone were evaluated for adherence of Escherichia coli and Staphylococcus aureus. Bacteria were radiolabeled and incubated with the study material. Adherence was determined by scintillation. Adherence to Proplast II and Gore-Tex reached a maximum at approximately 45 minutes of incubation and demonstrated a detachment phenomenon with E. coli. Similar results were noted with S. aureus, but with a maximal attachment at approximately 30 minutes. Interestingly, bacterial attachment to silicone continued to increase throughout the time of the incubation. In addition, adherence of S. aureus was at a faster rate than E. coli. Attachment of bacteria is a multifactorial process. However, the PTFE graft demonstrates a slower rate of attachment, lower total number of attached bacteria, and faster detachment. The importance of this phenomenon may help explain the foreign body effect of increased susceptibility to infection of foreign materials

Exophiala (Wangiella dermatitidis Prosthetic Aortic Valve Endocarditis and Prosthetic Graft Infection in an Immune Competent Patient

Directory of Open Access Journals (Sweden)

Jay S. Berger

2017-01-01

Full Text Available Exophiala (Wangiella dermatitidis is an emerging dematiaceous fungus associated with high mortality rates and is a rare cause of endocarditis. We describe the first case of E. dermatitidis endocarditis of a prosthetic aortic valve and aortic graft in an immune competent patient with no clear risk factors of hematological acquisition.

Combined computed tomography and fluorodeoxyglucose positron emission tomography in the diagnosis of prosthetic valve endocarditis: a case series.

Science.gov (United States)

Bartoletti, Michele; Tumietto, Fabio; Fasulo, Giovanni; Giannella, Maddalena; Cristini, Francesco; Bonfiglioli, Rachele; Raumer, Luigi; Nanni, Cristina; Sanfilippo, Silvia; Di Eusanio, Marco; Scotton, Pier Giorgio; Graziosi, Maddalena; Rapezzi, Claudio; Fanti, Stefano; Viale, Pierluigi

2014-01-13

The diagnosis of prosthetic valve endocarditis is challenging. The gold standard for prosthetic valve endocarditis diagnosis is trans-esophageal echocardiography. However, trans-esophageal echocardiography may result in negative findings or yield images difficult to differentiate from thrombus in patients with prosthetic valve endocarditis. Combined computed tomography and fluorodeoxyglucose positron emission tomography is a potentially promising diagnostic tool for several infectious conditions and it has also been employed in patients with prosthetic valve endocarditis but data are still scant. We reviewed the charts of 6 patients with prosthetic aortic valves evaluated for suspicion of prosthetic valve endocarditis, at two different hospital, over a 3-year period. We found 3 patients with early-onset PVE cases and blood cultures yielding Pseudomonas aeruginosa, Staphylococcus epidermidis and Staphylococcus lugdunensis, respectively; and 3 late-onset cases in the remaining 3 patients with isolation in the blood of Streptococcus bovis, Candida albicans and P. aeruginosa, respectively. Initial trans-esophageal echocardiography was negative in all the patients, while fluorodeoxyglucose positron emission tomography showed images suspicious for prosthetic valve endocarditis. In 4 out of 6 patients valve replacement was done with histology confirming the prosthetic valve endocarditis diagnosis. After an adequate course of antibiotic therapy fluorodeoxyglucose positron emission tomography showed resolution of prosthetic valve endocarditis in all the patients. Our experience confirms the potential role of fluoroseoxyglucose positron emission tomography in the diagnosis and follow-up of prosthetic valve endocarditis.

On the Necessity of Including Joint Passive Dynamics in the Impedance Control of Robotic Legs

Directory of Open Access Journals (Sweden)

Juan Carlos Arevalo

2014-07-01

Full Text Available Bioinspired quadruped robots are among the best robot designs for field missions over the complex terrain encountered in extraterrestrial landscapes and disaster scenarios caused by natural and human-made catastrophes, such as those caused by nuclear power plant accidents and radiological emergencies. For such applications, the performance characteristics of the robots should include high mobility, adaptability to the terrain, the ability to handle a large payload and good endurance. Nature can provide inspiration for quadruped designs that are well suited for traversing complex terrain. Horse legs are an example of a structure that has evolved to exhibit good performance characteristics. In this paper, a leg design exhibiting the key features of horse legs is briefly described. This leg is an underactuated mechanism because it has two actively driven degrees of freedom (DOFs and one passively driven DOF. In this work, two control laws intended to be use in the stan ce phase are described: a control law that considers passive mechanism dynamics and a second law that neglects these dynamics. The performance of the two control laws is experimentally evaluated and compared. The results indicate that the first control law better achieves the control goal; however, the use of the second is not completely unjustified.

Diagnostic performance of FDG PET or PET/CT in prosthetic infection after arthroplasty: a meta-analysis

International Nuclear Information System (INIS)

Jin, H.; Yuan, L.; Li, C.; Kan, Y.; Yang, J.; Hao, R.

2014-01-01

The purpose of this study was to systematically review and perform a meta-analysis of published data regarding the diagnostic performance of positron emission tomography (PET) or PET/computed tomography (PET/CT) in prosthetic infection after arthroplasty. A comprehensive computer literature search of studies published through May 31, 2012 regarding PET or PET/CT in patients suspicious of prosthetic infection was performed in PubMed/MEDLINE, Embase and Scopus databases. Pooled sensitivity and specificity of PET or PET/CT in patients suspicious of prosthetic infection on a per prosthesis-based analysis were calculated. The area under the receiver-operating characteristic (ROC) curve was calculated to measure the accuracy of PET or PET/CT in patients with suspicious of prosthetic infection. Fourteen studies comprising 838 prosthesis with suspicious of prosthetic infection after arthroplasty were included in this meta-analysis. The pooled sensitivity of PET or PET/CT in detecting prosthetic infection was 86% (95% confidence interval [CI] 82-90%) on a per prosthesis-based analysis. The pooled specificity of PET or PET/CT in detecting prosthetic infection was 86% (95% CI 83-89%) on a per prosthesis-based analysis. The area under the ROC curve was 0.93 on a per prosthesis-based analysis. In patients suspicious of prosthetic infection, FDG PET or PET/CT demonstrated high sensitivity and specificity. FDG PET or PET/CT are accurate methods in this setting. Nevertheless, possible sources of false positive results and influcing factors should kept in mind.

Diagnostic performance of FDG PET or PET/CT in prosthetic infection after arthroplasty: a meta-analysis.

Science.gov (United States)

Jin, H; Yuan, L; Li, C; Kan, Y; Hao, R; Yang, J

2014-03-01

The purpose of this study was to systematically review and perform a meta-analysis of published data regarding the diagnostic performance of positron emission tomography (PET) or PET/computed tomography (PET/CT) in prosthetic infection after arthroplasty. A comprehensive computer literature search of studies published through May 31, 2012 regarding PET or PET/CT in patients suspicious of prosthetic infection was performed in PubMed/MEDLINE, Embase and Scopus databases. Pooled sensitivity and specificity of PET or PET/CT in patients suspicious of prosthetic infection on a per prosthesis-based analysis were calculated. The area under the receiver-operating characteristic (ROC) curve was calculated to measure the accuracy of PET or PET/CT in patients with suspicious of prosthetic infection. Fourteen studies comprising 838 prosthesis with suspicious of prosthetic infection after arthroplasty were included in this meta-analysis. The pooled sensitivity of PET or PET/CT in detecting prosthetic infection was 86% (95% confidence interval [CI] 82-90%) on a per prosthesis-based analysis. The pooled specificity of PET or PET/CT in detecting prosthetic infection was 86% (95% CI 83-89%) on a per prosthesis-based analysis. The area under the ROC curve was 0.93 on a per prosthesis-based analysis. In patients suspicious of prosthetic infection, FDG PET or PET/CT demonstrated high sensitivity and specificity. FDG PET or PET/CT are accurate methods in this setting. Nevertheless, possible sources of false positive results and influcing factors should kept in mind.

Rapidly growing non-tuberculous mycobacteria infection of prosthetic knee joints: A report of two cases.

Science.gov (United States)

Kim, Manyoung; Ha, Chul-Won; Jang, Jae Won; Park, Yong-Beom

2017-08-01

Non-tuberculous mycobacteria (NTM) cause prosthetic knee joint infections in rare cases. Infections with rapidly growing non-tuberculous mycobacteria (RGNTM) are difficult to treat due to their aggressive clinical behavior and resistance to antibiotics. Infections of a prosthetic knee joint by RGNTM have rarely been reported. A standard of treatment has not yet been established because of the rarity of the condition. In previous reports, diagnoses of RGNTM infections in prosthetic knee joints took a long time to reach because the condition was not suspected, due to its rarity. In addition, it is difficult to identify RGNTM in the lab because special identification tests are needed. In previous reports, after treatment for RGNTM prosthetic infections, knee prostheses could not be re-implanted in all cases but one, resulting in arthrodesis or resection arthroplasty; this was most likely due to the aggressiveness of these organisms. In the present report, two cases of prosthetic knee joint infection caused by RGNTM (Mycobacterium abscessus) are described that were successfully treated, and in which prosthetic joints were finally reimplanted in two-stage revision surgery. Copyright © 2017 Elsevier B.V. All rights reserved.

Dutch evidence-based guidelines for amputation and prosthetics of the lower extremity : Rehabilitation process and prosthetics. Part 2

NARCIS (Netherlands)

Geertzen, Jan; van der Linde, Harmen; Rosenbrand, Kitty; Conradi, Marcel; Deckers, Jos; Koning, Jan; Rietman, Hans S.; van der Schaaf, Dick; van der Ploeg, Rein; Schapendonk, Johannes; Schrier, Ernst; Duijzentkunst, Rob Smit; Spruit-van Eijk, Monica; Versteegen, Gerbrig; Voesten, Harrie

2015-01-01

Background: A structured, multidisciplinary approach in the rehabilitation process after amputation is needed that includes a greater focus on the involvement of both (para)medics and prosthetists. There is considerable variation in prosthetic prescription concerning the moment of initial prosthesis

A simple 5-DoF MR-compatible motion signal measurement system.

Science.gov (United States)

Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae

2011-09-01

The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.

Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator

OpenAIRE

Chen, Qingcheng; Zhu, Shiqiang; Zhang, Xuequn

2015-01-01

Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H) notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics...

Quality of life after maxillectomy and prosthetic obturator rehabilitation.

Science.gov (United States)

Chigurupati, Radhika; Aloor, Neelam; Salas, Richard; Schmidt, Brian L

2013-08-01

Surgical resection of midface neoplasms and subsequent reconstruction have been shown to have significant negative effects on quality of life (QOL). The purpose of this pilot study was to assess individuals' health-related QOL after maxillectomy and reconstruction with a prosthetic obturator. The QOL of 25 of 43 patients who underwent maxillectomy and prosthetic obturator reconstruction at the University of California-San Francisco was assessed using 3 questionnaires: University of Washington Quality of Life version 4 (UWQOL), Obturator Functioning Scale (OFS), and Mental Health Inventory (MHI). The response rate to the QOL questionnaires was 92% (23 of 25 patients). Time elapsed from maxillectomy and prosthetic obturator reconstruction to the QOL survey response ranged from 0.3 to 6.6 years (mean, 2.7 years; standard deviation [SD], 1.9 years). The post-treatment mean QOL scores were 77.3 (SD, 13.6) for UWQOL, 72.0 (SD, 12.6) for OFS, and 4.5 (SD, 0.9) for Mental Health Inventory. Individuals who received adjuvant radiation scored lower for speech and appearance (OFS, P = .05, P = .03, respectively) as well as for saliva and overall QOL (UWQOL, P = .02, P = .08, respectively). There was a strong correlation between QOL scores in OFS and UWQOL questionnaires (r = 0.78, P maxillectomy and prosthetic obturator reconstruction. There is further need for a multicenter trial with a larger sample to identify how factors affecting QOL of patients after maxillectomy might influence the choice of reconstruction. Copyright © 2013 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

A Statistical Perspective on Running with Prosthetic Lower-Limbs: An Advantage or Disadvantage?

Directory of Open Access Journals (Sweden)

Hossein Hassani

2014-11-01

Full Text Available Technological developments have led to the increased use of carbon fiber and prosthetic lower-limbs in running events at the Paralympic Games. This study aims to exploit a series of statistical techniques in order to prepare a response to the vital question of whether utilizing prosthetic feet can affect an athletes ability when running competitively at the Paralympics Games by comparing both within and between different classifications. The study also considers the differences between running on biological limbs and prosthetic lower-limbs from a mechanical point of view. The results from the male 100 m, 200 m and 400 m at the 2012 London Paralympic Games have been the source of this investigation. The investigation provides statistical evidence to propose that the number of prosthetic limbs used and the structure of such limbs have a significant impact on the outcome of track events at the Paralympic Games.

A real-time comparison between direct control, sequential pattern recognition control and simultaneous pattern recognition control using a Fitts' law style assessment procedure.

Science.gov (United States)

Wurth, Sophie M; Hargrove, Levi J

2014-05-30

Pattern recognition (PR) based strategies for the control of myoelectric upper limb prostheses are generally evaluated through offline classification accuracy, which is an admittedly useful metric, but insufficient to discuss functional performance in real time. Existing functional tests are extensive to set up and most fail to provide a challenging, objective framework to assess the strategy performance in real time. Nine able-bodied and two amputee subjects gave informed consent and participated in the local Institutional Review Board approved study. We designed a two-dimensional target acquisition task, based on the principles of Fitts' law for human motor control. Subjects were prompted to steer a cursor from the screen center of into a series of subsequently appearing targets of different difficulties. Three cursor control systems were tested, corresponding to three electromyography-based prosthetic control strategies: 1) amplitude-based direct control (the clinical standard of care), 2) sequential PR control, and 3) simultaneous PR control, allowing for a concurrent activation of two degrees of freedom (DOF). We computed throughput (bits/second), path efficiency (%), reaction time (second), and overshoot (%)) and used general linear models to assess significant differences between the strategies for each metric. We validated the proposed methodology by achieving very high coefficients of determination for Fitts' law. Both PR strategies significantly outperformed direct control in two-DOF targets and were more intuitive to operate. In one-DOF targets, the simultaneous approach was the least precise. The direct control was efficient in one-DOF targets but cumbersome to operate in two-DOF targets through a switch-depended sequential cursor control. We designed a test, capable of comprehensively describing prosthetic control strategies in real time. When implemented on control subjects, the test was able to capture statistically significant differences (p�

Diagnostic flowcharts in osteomyelitis, spondylodiscitis and prosthetic joint infection

International Nuclear Information System (INIS)

Jutte, P.; Lazzeri, E.; Sconfienza, L. M.; Cassar-Pullicino, V.; Trampuz, A.; Petrosillo, N.; Signore, A.

2014-01-01

Infections of the bone, spine and prosthetic joints are serious and complex conditions to diagnose and to treat. Structured diagnostic workup may very well improve the accuracy and speed of diagnosis, thereby improving the outcome since treatment may very well be more successful and less harmful if timely management is started. Literature shows no uniform advise on diagnosis. The EANM organized a consensus meeting with representatives from the involved disciplines in order to develop common flowcharts for the diagnosis of osteomyelitis, spondylodiscitis and prosthetic joint infections. In this report the proceedings of this consensus meeting, including the proposed flowcharts for diagnosis, are published.

Mobility function of a prosthetic knee joint with an automatic stance phase lock.

Science.gov (United States)

Andrysek, Jan; Klejman, Susan; Torres-Moreno, Ricardo; Heim, Winfried; Steinnagel, Bryan; Glasford, Shane

2011-06-01

There is a need for a prosthetic knee joint design that is technologically and functionally appropriate for use in developing countries. To develop and clinically evaluate a new type of stance phase controlled prosthetic knee joint that provides stance phase stability without inhibiting swing phase flexion. A crossover repeated measures study design comparing the new knee joint to the participant's conventional low- or high-end prosthetic knee joint. The new knee joint was fitted to fourteen individuals aged 15 to 67 years with unilateral lower limb amputations. Walk tests were performed to measure walking speed. Energy expenditure was estimated using the physiological cost index (PCI). Walking speeds with the new knee joint were on average 0.14 m/s faster than conventional low-end knees (p < 0.0001), but 0.07 m/s slower than conventional high-end prosthetic knees (p = 0.008). The PCI was similar across all three knee joint technologies (p = 0.276). Mobility function with the new knee joint, in terms of walking speed, was more closely matched to high-end than low-end prosthetic knee joints. Therefore, given its relatively simple design, the new stance phase control mechanism may offer a functional and cost effective solution for active transfemoral amputees. This paper describes a new type of prosthetic knee joint mechanism that is intended to be cost-effective while providing high-level stance phase function to active individuals with a transfemoral amputation. Initial clinical testing suggests that the new knee joint may have some functional advantages over existing technologies in this category.

Prosthetics socket that incorporates an air splint system focusing on dynamic interface pressure.

Science.gov (United States)

Razak, Nasrul Anuar Abd; Osman, Noor Azuan Abu; Gholizadeh, Hossein; Ali, Sadeeq

2014-08-01

The interface pressure between the residual limb and prosthetic socket has a significant effect on an amputee's satisfaction and comfort. This paper presents the design and performance of a new prosthetic socket that uses an air splint system. The air splint prosthetic socket system was implemented by combining the air splint with a pressure sensor that the transhumeral user controls through the use of a microcontroller. The modular construction of the system developed allows the FSR pressure sensors that are placed inside the air splint socket to determine the required size and fitting for the socket used. Fifteen transhumeral amputees participated in the study. The subject's dynamic pressure on the socket that's applied while wearing the air splint systems was recorded using F-socket transducers and microcontroller analysis. The values collected by the F-socket sensor for the air splint prosthetic socket system were determined accordingly by comparing the dynamic pressure applied using statically socket. The pressure volume of the air splint fluctuated and was recorded at an average of 38 kPa (2.5) to 41 kPa (1.3) over three hours. The air splint socket might reduce the pressure within the interface of residual limb. This is particularly important during the daily life activities and may reduce the pain and discomfort at the residual limb in comparison to the static socket. The potential development of an auto-adjusted socket that uses an air splint system as the prosthetic socket will be of interest to researchers involved in rehabilitation engineering, prosthetics and orthotics.

Development of inexpensive prosthetic feet for high-heeled shoes using simple shoe insole model

OpenAIRE

Margrit R. Meier, PhD; Kerice A. Tucker, BSc; Andrew H. Hansen, PhD

2014-01-01

The large majority of prosthetic feet are aimed at low-heeled shoes, with a few models allowing a heel height of up to 5 cm. However, a survey by the American Podiatric Medical Association indicates that most women wear heels over 5 cm; thus, current prosthetic feet limit most female prosthesis users in their choice. Some prosthetic foot components are heel-height adjustable; however, their plantar surface shapes do not change to match the insole shapes of the shoes with different heel height...

A global perspective on mechanical prosthetic heart valve thrombosis: Diagnostic and therapeutic challenges

Science.gov (United States)

Gürsoy, Mustafa Ozan; Kalçık, Macit; Yesin, Mahmut; Karakoyun, Süleyman; Bayam, Emrah; Gündüz, Sabahattin; Özkan, Mehmet

2016-01-01

Prosthetic valve thrombosis is one of the major causes of primary valve failure, which can be life-threatening. Multimodality imaging is necessary for determination of leaflet immobilization, cause of underlying pathology (thrombus versus pannus or both), and whether thrombolytic therapy attempt in the patient would be successful or surgery is needed. Current guidelines for the management of prosthetic valve thrombosis lack definitive class I recommendations due to lack of randomized controlled trials, and usually leave the choice of treatment to the clinician’s experience. In this review, we aimed to summarize the pathogenesis, diagnosis, and management of mechanical prosthetic valve thrombosis. PMID:28005024

Echocardiographic Evaluation of Tricuspid Prosthetic Valves: An Update

Directory of Open Access Journals (Sweden)

Dimitrios Maragiannis, MD, FASE, FACC

2016-05-01

Full Text Available This review focuses on the diagnostic value of novel echocardiographic techniques and the clinical application of recently described algorithms to assess tricuspid prosthetic valve function.

Prosthetic hip joint infection due to Campylobacter fetus.

OpenAIRE

Bates, C J; Clarke, T C; Spencer, R C

1994-01-01

A case of postoperative prosthetic hip joint infection due to Campylobacter fetus subsp. fetus is described. Difficulties in isolation and antimicrobial susceptibility testing of this organism are discussed.

Finite element analysis of the contact interface between trans-femoral stump and prosthetic socket.

Science.gov (United States)

Zhang, Linlin; Zhu, Ming; Shen, Ling; Zheng, Feng

2013-01-01

Transfemoral amputees need prosthetic devices after amputation surgery, and the interface pressure between the residual limb and prosthetic socket has a significant effect on an amputee's satisfaction and comfort. The purpose of this study was to build a nonlinear finite element model to investigate the interface pressure between the above-knee residual limb and its prosthetic socket. The model was three-dimensional (3D) with consideration of nonlinear boundary conditions. Contact analysis was used to simulate the friction conditions between skin and the socket. The normal stresses up to 80.57 kPa at the distal end of the soft tissue. The longitudinal and circumferential shear stress distributions at the limb-socket interface were also simulated. This study explores the influences of load transfer between trans-femoral residual limb and its prosthetic socket.

Design of a novel 6-DOF planar maglev system

International Nuclear Information System (INIS)

Lai, Y.-C.; Yen, J.-Y.

2006-01-01

This paper describes a novel single-deck and six degree-of-freedom (DOF) planar maglev positioning system design. The proposed design uses an array of solenoids to levitate and to hold a permanent magnet carrier in place. The solenoids are excited separately to generate restoring forces when the permanent magnet carrier is displaced from its equilibrium position. The research uses the ANSOFT finite element analysis simulation to analyze the solenoid restoring forces and to motivate a suitable permanent magnets arrangement. Active control on the solenoid currents is then used to maintain the carrier position. The system identification is carried out by perturbing the experimental set-up from its equilibrium position. The simulation results based on the identification models show that simple control is effective for maintaining the carrier position. Initial implementation has also showed that the concept is feasible

Experimental measurement of flexion-extension movement in normal and corpse prosthetic elbow joint.

Science.gov (United States)

TarniŢă, Daniela; TarniŢă, DănuŢ Nicolae

2016-01-01

This paper presents a comparative experimental study of flexion-extension movement in healthy elbow and in the prosthetic elbow joint fixed on an original experimental bench. Measurements were carried out in order to validate the functional morphology and a new elbow prosthesis type ball head. The three-dimensional (3D) model and the physical prototype of our experimental bench used to test elbow endoprosthesis at flexion-extension and pronation-supination movements is presented. The measurements were carried out on a group of nine healthy subjects and on the prosthetic corpse elbow, the experimental data being obtained for flexion-extension movement cycles. Experimental data for the two different flexion-extension tests for the nine subjects and for the corpse prosthetic elbow were acquired using SimiMotion video system. Experimental data were processed statistically. The corresponding graphs were obtained for all subjects in the experimental group, and for corpse prosthetic elbow for both flexion-extension tests. The statistical analysis has proved that the flexion angles of healthy elbows were significantly close to the values measured at the prosthetic elbow fixed on the experimental bench. The studied elbow prosthesis manages to re-establish the mobility for the elbow joint as close to the normal one.

The effect of prosthetic foot push-off on mechanical loading associated with knee osteoarthritis in lower extremity amputees.

Science.gov (United States)

Morgenroth, David C; Segal, Ava D; Zelik, Karl E; Czerniecki, Joseph M; Klute, Glenn K; Adamczyk, Peter G; Orendurff, Michael S; Hahn, Michael E; Collins, Steven H; Kuo, Art D

2011-10-01

Lower extremity amputation not only limits mobility, but also increases the risk of knee osteoarthritis of the intact limb. Dynamic walking models of non-amputees suggest that pushing-off from the trailing limb can reduce collision forces on the leading limb. These collision forces may determine the peak knee external adduction moment (EAM), which has been linked to the development of knee OA in the general population. We therefore hypothesized that greater prosthetic push-off would lead to reduced loading and knee EAM of the intact limb in unilateral transtibial amputees. Seven unilateral transtibial amputees were studied during gait under three prosthetic foot conditions that were intended to vary push-off. Prosthetic foot-ankle push-off work, intact limb knee EAM and ground reaction impulses for both limbs during step-to-step transition were measured. Overall, trailing limb prosthetic push-off work was negatively correlated with leading intact limb 1st peak knee EAM (slope=-.72±.22; p=.011). Prosthetic push-off work and 1st peak intact knee EAM varied significantly with foot type. The prosthetic foot condition with the least push-off demonstrated the largest knee EAM, which was reduced by 26% with the prosthetic foot producing the most push-off. Trailing prosthetic limb push-off impulse was negatively correlated with leading intact limb loading impulse (slope=-.34±.14; p=.001), which may help explain how prosthetic limb push-off can affect intact limb loading. Prosthetic feet that perform more prosthetic push-off appear to be associated with a reduction in 1st peak intact knee EAM, and their use could potentially reduce the risk and burden of knee osteoarthritis in this population. Published by Elsevier B.V.

Prosthetic valves in adult patients with congenital heart disease : Rationale and design of the Dutch PROSTAVA study

NARCIS (Netherlands)

Freling, H. G.; van Slooten, Y. J.; van Melle, J. P.; Mulder, B. J. M.; van Dijk, A. P. J.; Hillege, H. L.; Post, M. C.; Sieswerda, G. Tj; Jongbloed, M. R. M.; Willems, T. P.; Pieper, P. G.

2012-01-01

Data on long-term complications in adult patients with congenital heart disease (ACHD) and a prosthetic valve are scarce. Moreover, the influence of prosthetic valves on quality of life (QoL) and functional outcome in ACHD patients with prosthetic valves has not been studied. The primary objective

Advances for prosthetic technology from historical perspective to current status to future application

CERN Document Server

LeMoyne, Robert

2016-01-01

This book focuses on the advances in transtibial prosthetic technology and targets research in the evolution of the powered prosthesis such as the BiOM, which was derived from considerable research and development at the Massachusetts Institute of Technology. The concept of the book spans the historical evolution of prosthetic applications from passive to new and futuristic robotic prosthetic technologies.  The author describes the reasons for amputation, surgical procedures, and an historical perspective of the prosthesis for the lower limb. He also addresses the phases and sub-phases of gait and compensatory mechanisms arising for a transtibial prosthesis and links the compensatory mechanisms to long-term morbidities.  The general technologies for gait analysis central to prosthetic design and the inherent biomechanics foundations for analysis are also explored.  The book reports on recent-past to current-term applications with passive elastic prostheses.  The core of the book deals with futuristic robo...

End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm

OpenAIRE

Jolly Atit Shah; S.S. Rattan; B.C. Nakra

2013-01-01

Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H) model is used to m...

Multimodality Imaging Assessment of Prosthetic Heart Valves

NARCIS (Netherlands)

Suchá, D.; Symersky, Petr; Tanis, W; Mali, Willem P Th M; Leiner, Tim; van Herwerden, LA; Budde, Ricardo P J

Echocardiography and fluoroscopy are the main techniques for prosthetic heart valve (PHV) evaluation, but because of specific limitations they may not identify the morphological substrate or the extent of PHV pathology. Cardiac computed tomography (CT) and magnetic resonance imaging (MRI) have

Prosthetic Joint Infection

Science.gov (United States)

Tande, Aaron J.

2014-01-01

SUMMARY Prosthetic joint infection (PJI) is a tremendous burden for individual patients as well as the global health care industry. While a small minority of joint arthroplasties will become infected, appropriate recognition and management are critical to preserve or restore adequate function and prevent excess morbidity. In this review, we describe the reported risk factors for and clinical manifestations of PJI. We discuss the pathogenesis of PJI and the numerous microorganisms that can cause this devastating infection. The recently proposed consensus definitions of PJI and approaches to accurate diagnosis are reviewed in detail. An overview of the treatment and prevention of this challenging condition is provided. PMID:24696437

Can We Achieve Intuitive Prosthetic Elbow Control Based on Healthy Upper Limb Motor Strategies?

Directory of Open Access Journals (Sweden)

Manelle Merad

2018-02-01

Full Text Available Most transhumeral amputees report that their prosthetic device lacks functionality, citing the control strategy as a major limitation. Indeed, they are required to control several degrees of freedom with muscle groups primarily used for elbow actuation. As a result, most of them choose to have a one-degree-of-freedom myoelectric hand for grasping objects, a myoelectric wrist for pronation/supination, and a body-powered elbow. Unlike healthy upper limb movements, the prosthetic elbow joint angle, adjusted prior to the motion, is not involved in the overall upper limb movements, causing the rest of the body to compensate for the lack of mobility of the prosthesis. A promising solution to improve upper limb prosthesis control exploits the residual limb mobility: like in healthy movements, shoulder and prosthetic elbow motions are coupled using inter-joint coordination models. The present study aims to test this approach. A transhumeral amputated individual used a prosthesis with a residual limb motion-driven elbow to point at targets. The prosthetic elbow motion was derived from IMU-based shoulder measurements and a generic model of inter-joint coordinations built from healthy individuals data. For comparison, the participant also performed the task while the prosthetic elbow was implemented with his own myoelectric control strategy. The results show that although the transhumeral amputated participant achieved the pointing task with a better precision when the elbow was myoelectrically-controlled, he had to develop large compensatory trunk movements. Automatic elbow control reduced trunk displacements, and enabled a more natural body behavior with synchronous shoulder and elbow motions. However, due to socket impairments, the residual limb amplitudes were not as large as those of healthy shoulder movements. Therefore, this work also investigates if a control strategy whereby prosthetic joints are automatized according to healthy individuals

Radiological visualization of prosthetic heart valves in situ

International Nuclear Information System (INIS)

Hoffmeister, H.M.; Pirschel, J.

1986-01-01

To determine the radiographic appearance of prosthetic heart valves 15 different models were investigated in situ. Fluoroscopy with detail radiographs and standard chest-radiographs were used for identification of the specific type of the prosthesis, for determination of details of the valve apparatus and for evaluation of the motion of the valve disc/ball. - Fluoroscopy and routine radiographs provided sufficient information to identify all prosthetic heart valves with exception of the Xenomedica bioprosthesis. If radiopaque material was used for the valve disc/ball, fluoroscopic assessment of the function of the valve was possible. Thus, in most types of disc or ball valves the opening/closing of the valve can be visualized, whereas in bioprosthesis a radiological determination of the mechanical function is not possible. (orig.) [de

Case study: survey of patient satisfaction with prosthesis quality and design among below-knee prosthetic leg socket users.

Science.gov (United States)

Mohd Hawari, Nurhanisah; Jawaid, Mohammad; Md Tahir, Paridah; Azmeer, Raja Ahmad

2017-11-01

The aim of this case study was to explore patient satisfaction with the quality of prosthetic leg sockets intended for persons with lower limb amputations. A qualitative study based on in-depth interviews, preceded by a questionnaire session, was carried out with patients from the Rehabilitation Center and Hospital in Malaysia. Twelve out-patient and in-patient amputees with lower limb amputations, specifically below-knee amputations, were chosen randomly. The analysis of patients' narratives aimed to identify the functional and esthetic characteristics of currently used prosthetic leg sockets and any problems related to them. The obtained results indicated that out of the 12 participants, 41.7% and 25% were satisfied and somewhat satisfied with their current prosthetic sockets. Durability and comfort were rated by the participants as the most important characteristics of prosthetic sockets, with 83.3%. As regards the esthetic appearance of the socket, 66.7% of the respondents considered that the most important feature was the material from which the socket was fabricated. Thus, we conclude that current satisfaction levels with the quality of prosthetic sockets among amputees in Malaysia are suitable, prosthesis being preferred by many amputees. The results can be used to direct future research on cosmesis and functionality of prosthetic socket design. Implications for Rehabilitation Case study will help participants to get cost effective prosthetic leg socket. Develop prosthetic leg socket comfortable as comparative to existing one. Help Malaysian government to make policy to develop local prosthetic leg socket at affordable price.

Factors influencing the cost of prosthetic joint infection treatment.

Science.gov (United States)

Peel, T N; Cheng, A C; Lorenzo, Y P; Kong, D C M; Buising, K L; Choong, P F M

2013-11-01

Prosthetic joint infection (PJI) is associated with significant costs to the healthcare system. Current literature examines the cost of specific treatment modalities without assessing other cost drivers for PJI. To examine the overall cost of the treatment of PJI and to identify factors associated with management costs. The costs of treatment of prosthetic joint infections were examined in 139 patients across 10 hospitals over a 3-year period (January 2006 to December 2008). Cost calculations included hospitalization costs, surgical costs, hospital-in-the-home costs and antibiotic therapy costs. Negative binomial regression analysis was performed to model factors associated with total cost. The median cost of treating prosthetic joint infection per patient was Australian $34,800 (interquartile range: 20,305, 56,929). The following factors were associated with increased treatment costs: septic revision arthroplasty (67% increase in treatment cost; P = 0.02), hypotension at presentation (70% increase; P = 0.03), polymicrobial infections (41% increase; P = 0.009), surgical treatment with one-stage exchange (100% increase; P = 0.002) or resection arthroplasty (48% increase; P = 0.001) were independently associated with increased treatment costs. Culture-negative prosthetic joint infections were associated with decreased costs (29% decrease in treatment cost; P = 0.047). Treatment failure was associated with 156% increase in treatment costs. This study identifies clinically important factors influencing treatment costs that may be of relevance to policy-makers, particularly in the setting of hospital reimbursement and guiding future research into cost-effective preventive strategies. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Increased risk of prosthetic joint infection associated with esophago-gastro-duodenoscopy with biopsy.

Science.gov (United States)

Coelho-Prabhu, Nayantara; Oxentenko, Amy S; Osmon, Douglas R; Baron, Todd H; Hanssen, Arlen D; Wilson, Walter R; Steckelberg, James M; Baddour, Larry M; Harmsen, William S; Mandrekar, Jay; Berbari, Elie F

2013-02-01

There are no prospective data regarding the risk of prosthetic joint infection following routine gastrointestinal endoscopic procedures. We wanted to determine the risk of prosthetic hip or knee infection following gastrointestinal endoscopic procedures in patients with joint arthroplasty. We conducted a prospective, single-center, case-control study at a single, tertiary-care referral center. Cases were defined as adult patients hospitalized for prosthetic joint infection of the hip or knee between December 1, 2001 and May 31, 2006. Controls were adult patients with hip or knee arthroplasties but without a diagnosis of joint infection, hospitalized during the same time period at the same orthopedic hospital. The main outcome measure was the odds ratio (OR) of prosthetic joint infection after gastrointestinal endoscopic procedures performed within 2 years before admission. 339 cases and 339 controls were included in the study. Of these, 70 cases (21%) cases and 82 controls (24%) had undergone a gastrointestinal endoscopic procedure in the preceding 2 years. Among gastrointestinal procedures that were assessed, esophago-gastro-duodenoscopy (EGD) with biopsy was associated with an increased risk of prosthetic joint infection (OR = 3, 95% CI: 1.1-7). In a multivariable analysis adjusting for sex, age, joint age, immunosuppression, BMI, presence of wound drain, prior arthroplasty, malignancy, ASA score, and prothrombin time, the OR for infection after EGD with biopsy was 4 (95% CI: 1.5-10). EGD with biopsy was associated with an increased risk of prosthetic joint infection in patients with hip or knee arthroplasties. This association will need to be confirmed in other epidemiological studies and adequately powered prospective clinical trials prior to recommending antibiotic prophylaxis in these patients.

Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

Science.gov (United States)

Boku, Kazuhiko; Nakamura, Taro

2009-02-01

.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

International Nuclear Information System (INIS)

Boku, Kazuhiko; Nakamura, Taro

2009-01-01

Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

Energy Technology Data Exchange (ETDEWEB)

Boku, Kazuhiko; Nakamura, Taro [Chuo University, Faculty of Science and Engineering, Department of Precision Mechanics, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551 (Japan)], E-mail: k_boku@bio.mech.chuo-u.ac.jp

2009-02-01

Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

A smartphone photogrammetry method for digitizing prosthetic socket interiors.

Science.gov (United States)

Hernandez, Amaia; Lemaire, Edward

2017-04-01

Prosthetic CAD/CAM systems require accurate 3D limb models; however, difficulties arise when working from the person's socket since current 3D scanners have difficulties scanning socket interiors. While dedicated scanners exist, they are expensive and the cost may be prohibitive for a limited number of scans per year. A low-cost and accessible photogrammetry method for socket interior digitization is proposed, using a smartphone camera and cloud-based photogrammetry services. 15 two-dimensional images of the socket's interior are captured using a smartphone camera. A 3D model is generated using cloud-based software. Linear measurements were comparing between sockets and the related 3D models. 3D reconstruction accuracy averaged 2.6 ± 2.0 mm and 0.086 ± 0.078 L, which was less accurate than models obtained by high quality 3D scanners. However, this method would provide a viable 3D digital socket reproduction that is accessible and low-cost, after processing in prosthetic CAD software. Clinical relevance The described method provides a low-cost and accessible means to digitize a socket interior for use in prosthetic CAD/CAM systems, employing a smartphone camera and cloud-based photogrammetry software.

Ergonomic workplace assessment in orthotic and prosthetic workshops.

Science.gov (United States)

Salmani Nodooshan, H; Koohi Booshehri, S; Daneshmandi, H; Choobineh, A R

2016-10-17

In Iranian orthotic and prosthetic workshops, the majority of activities are carried out by manpower and the tasks are labor-intensive. In these workshops, ergonomic aspects of working conditions are seldom considered. This study was conducted in orthotic and prosthetic workshops with the objectives of determination of prevalence rate of MSDs among employees and assessment of ergonomics working conditions. In this cross-sectional study, all employees (n = 42; 29 males and 13 females) in 11 active orthotic and prosthetic production centers of Shiraz city participated. Data were collected using Nordic Musculoskeletal disorders Questionnaire (NMQ) and observational technique by an ergonomics checklist for assessment of working conditions. The means (SD) of age and job tenure (years) in the study individuals were 37.26 (10.21) and 12.8 (9.39), respectively. The most prevalent MSD symptoms in the past 12 months were reported in the lower back (42.9%), shoulders (40.5%) and knees (40.5%). Working conditions assessment showed that the main ergonomic problems in the workshops studied originated from awkward working posture, improper workstation design, poorly designed hand tools and incorrect manual material handling. Any interventional program for working conditions improvement should, therefore, focus on these areas.

The relevance of aortic endograft prosthetic infection

NARCIS (Netherlands)

Cernohorsky, Paul; Reijnen, Michel M. P. J.; Tielliu, Ignace F. J.; van Sterkenburg, Steven M. M.; van den Dungen, Jan J. A. M.; Zeebregts, Clark J.

Background: Vascular prosthetic graft infection is a severe complication after open aortic aneurysm repair. Reports of infected endografts are scarce. General treatment consensus with infected graft material is that it should be removed completely. The objective of this study was to describe the

Good quality of life outcomes after treatment of prosthetic joint infection with debridement and prosthesis retention.

Science.gov (United States)

Aboltins, Craig; Dowsey, Michelle; Peel, Trish; Lim, Wen K; Choong, Peter

2016-05-01

Patients treated for early prosthetic joint infection (PJI) with surgical debridement and prosthesis retention have a rate of successful infection eradication that is similar to patients treated with the traditional approach of prosthesis exchange. It is therefore important to consider other outcomes after prosthetic joint infection treatment that may influence management decisions, such as quality of life (QOL). Our aim was to describe infection cure rates and quality of life for patients with prosthetic joint infection treated with debridement and prosthesis retention and to determine if treatment with this approach was a risk factor for poor quality of life outcomes. Prospectively collected pre and post-arthroplasty data were available for 2,134 patients, of which PJI occurred in 41. For patients treated for prosthetic joint infection, the 2-year survival free of treatment failure was 87% (95%CI 84-89). Prosthetic joint infection cases treated with debridement and retention had a similar improvement from pre-arthroplasty to 12-months post-arthroplasty as patients without PJI in QOL according to the SF-12 survey. Prosthetic joint infection treated with debridement and retention was not a risk factor for poor quality of life on univariate or multivariate analysis. Prosthetic joint infection treated with debridement and prosthesis retention results in good cure rates and quality of life. Further studies are required that directly compare quality of life for different surgical approaches for prosthetic joint infection to better inform management decisions. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:898-902, 2016. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Overview: Mechanism and Control of a Prosthetic Arm.

Science.gov (United States)

Kulkarni, Tushar; Uddanwadiker, Rashmi

2015-09-01

Continuous growth in industrialization and lack of awareness in safety parameters the cases of amputations are growing. The search of safer, simpler and automated prosthetic arms for managing upper limbs is expected. Continuous efforts have been made to design and develop prosthetic arms ranging from simple harness actuated to automated mechanisms with various control options. However due the cost constraints, the automated prosthetic arms are still out of the reach of needy people. Recent data have shown that there is a wide scope to develop a low cost and light weight upper limb prosthesis. This review summarizes the various designs methodologies, mechanisms and control system developed by the researchers and the advances therein. Educating the patient to develop acceptability to prosthesis and using the same for the most basic desired functions of human hand, post amputation care and to improve patient's independent life is equally important. In conclusion it can be interpreted that there is a wide scope in design in an adaptive mechanism for opening and closing of the fingers using other methods of path and position synthesis. Simple mechanisms and less parts may optimize the cost factor. Reduction in the weight of the prosthesis may be achieved using polymers used for engineering applications. Control system will remain never ending challenge for the researchers, but it is essential to maintain the simplicity from the patients perspective.

Smartphones as image processing systems for prosthetic vision.

Science.gov (United States)

Zapf, Marc P; Matteucci, Paul B; Lovell, Nigel H; Suaning, Gregg J

2013-01-01

The feasibility of implants for prosthetic vision has been demonstrated by research and commercial organizations. In most devices, an essential forerunner to the internal stimulation circuit is an external electronics solution for capturing, processing and relaying image information as well as extracting useful features from the scene surrounding the patient. The capabilities and multitude of image processing algorithms that can be performed by the device in real-time plays a major part in the final quality of the prosthetic vision. It is therefore optimal to use powerful hardware yet to avoid bulky, straining solutions. Recent publications have reported of portable single-board computers fast enough for computationally intensive image processing. Following the rapid evolution of commercial, ultra-portable ARM (Advanced RISC machine) mobile devices, the authors investigated the feasibility of modern smartphones running complex face detection as external processing devices for vision implants. The role of dedicated graphics processors in speeding up computation was evaluated while performing a demanding noise reduction algorithm (image denoising). The time required for face detection was found to decrease by 95% from 2.5 year old to recent devices. In denoising, graphics acceleration played a major role, speeding up denoising by a factor of 18. These results demonstrate that the technology has matured sufficiently to be considered as a valid external electronics platform for visual prosthetic research.

ARM-based visual processing system for prosthetic vision.

Science.gov (United States)

Matteucci, Paul B; Byrnes-Preston, Philip; Chen, Spencer C; Lovell, Nigel H; Suaning, Gregg J

2011-01-01

A growing number of prosthetic devices have been shown to provide visual perception to the profoundly blind through electrical neural stimulation. These first-generation devices offer promising outcomes to those affected by degenerative disorders such as retinitis pigmentosa. Although prosthetic approaches vary in their placement of the stimulating array (visual cortex, optic-nerve, epi-retinal surface, sub-retinal surface, supra-choroidal space, etc.), most of the solutions incorporate an externally-worn device to acquire and process video to provide the implant with instructions on how to deliver electrical stimulation to the patient, in order to elicit phosphenized vision. With the significant increase in availability and performance of low power-consumption smart phone and personal device processors, the authors investigated the use of a commercially available ARM (Advanced RISC Machine) device as an externally-worn processing unit for a prosthetic neural stimulator for the retina. A 400 MHz Samsung S3C2440A ARM920T single-board computer was programmed to extract 98 values from a 1.3 Megapixel OV9650 CMOS camera using impulse, regional averaging and Gaussian sampling algorithms. Power consumption and speed of video processing were compared to results obtained to similar reported devices. The results show that by using code optimization, the system is capable of driving a 98 channel implantable device for the restoration of visual percepts to the blind.

A 6-DOF vibration isolation system for hydraulic hybrid vehicles

Science.gov (United States)

Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul

2006-03-01

This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of

Dynamic elasticity measurement for prosthetic socket design.

Science.gov (United States)

Kim, Yujin; Kim, Junghoon; Son, Hyeryon; Choi, Youngjin

2017-07-01

The paper proposes a novel apparatus to measure the dynamic elasticity of human limb in order to help the design and fabrication of the personalized prosthetic socket. To take measurements of the dynamic elasticity, the desired force generated as an exponential chirp signal in which the frequency increases and amplitude is maintained according to time progress is applied to human limb and then the skin deformation is recorded, ultimately, to obtain the frequency response of its elasticity. It is referred to as a Dynamic Elasticity Measurement Apparatus (DEMA) in the paper. It has three core components such as linear motor to provide the desired force, loadcell to implement the force feedback control, and potentiometer to record the skin deformation. After measuring the force/deformation and calculating the dynamic elasticity of the limb, it is visualized as 3D color map model of the limb so that the entire dynamic elasticity can be shown at a glance according to the locations and frequencies. For the visualization, the dynamic elasticities measured at specific locations and frequencies are embodied using the color map into 3D limb model acquired by using 3D scanner. To demonstrate the effectiveness, the visualized dynamic elasticities are suggested as outcome of the proposed system, although we do not have any opportunity to apply the proposed system to the amputees. Ultimately, it is expected that the proposed system can be utilized to design and fabricate the personalized prosthetic socket in order for releasing the wearing pain caused by the conventional prosthetic socket.

38 CFR 17.122 - Payment or reimbursement of the expenses of repairs to prosthetic appliances and similar devices...

Science.gov (United States)

2010-07-01

... of the expenses of repairs to prosthetic appliances and similar devices furnished without prior... Payment or reimbursement of the expenses of repairs to prosthetic appliances and similar devices furnished without prior authorization. The expenses of repairs to prosthetic appliances, or similar appliances...

Utilization of penile prosthesis and male incontinence prosthetics in Saudi Arabia.

Science.gov (United States)

Alwaal, Amjad; Al-Sayyad, Ahmad J

2017-01-01

Erectile dysfunction is a prevalent disease affecting over 50% of men between the ages of 40 and 70 years. Penile prosthesis represents the end of the line treatment when other less invasive therapies fail or are contraindicated. Male stress urinary incontinence can significantly diminish quality of life and lead to embarrassment and social withdrawal. Surgical therapies, such as male urethral slings and artificial urinary sphincters (AUS), are considered effective and safe treatments for male stress incontinence. No data exist on the utilization of penile prosthesis or male incontinence surgical treatment in Saudi Arabia. Generally, urological prosthetic surgery is performed either in private hospitals or in government hospitals. Our aim was to assess the trend of penile prosthesis and male incontinence device utilization in Saudi Arabia. We utilized sales' data of penile prosthetics, male slings, and AUS from the only two companies selling these devices in Saudi Arabia (AMS ® and Coloplast ® ), from January 2013 to December 2016. There were 2599 penile prosthesis implantation procedures done in the study period, with 67% of them performed in private institutions. There was a progressively increased use of penile prosthetics which nearly doubled from 2013 to 2016. The main type of prosthesis utilized was the semirigid type 70% versus 11% of the 2-piece inflatable and 17% of the 3-piece inflatable device. Only 10 slings and 31 AUS were inserted during the same study period. There is an increased utilization of penile prosthetics in Saudi Arabia. The private sector performs the majority of penile prosthesis procedures, and most of them are of the semirigid type. The governmental sector is more likely to perform inflatable penile prosthesis and male incontinence device procedures. Male incontinence prosthetics' use is very limited in Saudi Arabia.

Acinetobacter Prosthetic Joint Infection Treated with Debridement and High-Dose Tigecycline.

Science.gov (United States)

Vila, Andrea; Pagella, Hugo; Amadio, Claudio; Leiva, Alejandro

2016-12-01

Prosthesis retention is not recommended for multidrug-resistant Acinetobacter prosthetic joint infection due to its high failure rate. Nevertheless, replacing the prosthesis implies high morbidity and prolonged hospitalization. Although tigecycline is not approved for the treatment of prosthetic joint infection due to multidrug resistant Acinetobacter baumannii, its appropriate use may preclude prosthesis exchange. Since the area under the curve divided by the minimum inhibitory concentration is the best pharmacodynamic predictor of its efficacy, we used tigecycline at high dose, in order to optimize its efficacy and achieve implant retention in 3 patients who refused prosthesis exchange. All patients with prosthetic joint infections treated at our Institution are prospectively registered in a database. Three patients with early prosthetic joint infection of total hip arthroplasty due to multidrug resistant A. baumannii were treated with debridement, antibiotics and implant retention, using a high maintenance dose of tigecycline (100 mg every 12 hours). The cases were retrospectively reviewed. All patients signed informed consent for receiving off-label use of tigecycline. Tigecycline was well tolerated, allowing its administration at high maintenance dose for a median of 40 days (range 30-60). Two patients were then switched to minocycline at standard doses for a median of 3.3 months in order to complete treatment. Currently, none of the patients showed relapse. Increasing the dose of tigecycline could be considered as a means to better attain pharmacodynamic targets in patients with severe or difficult-to-treat infections. Tigecycline at high maintenance dose might be useful when retention of the implant is attempted for treatment for prosthetic joint infections due to multidrug resistant Acinetobacter. Although this approach might be promising, off-label use of tigecycline should be interpreted cautiously until prospective data are available. Tigecycline is

Evaluation of prosthetic heart valves by transesophageal echocardiography: problems, pitfalls, and timing of echocardiography

NARCIS (Netherlands)

van den Brink, Renee B. A.

2006-01-01

Transesophageal echocardiography (TEE) is especially suitable for examination of prosthetic valves because of the proximity of the esophagus to the heart and absence of interference with lungs and ribs. This article reviews normal and abnormal morphologic characteristics of prosthetic valves such as

Output Error Analysis of Planar 2-DOF Five-bar Mechanism

Science.gov (United States)

Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang

2018-03-01

Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.

Towards Kilo-Hertz 6-DoF Visual Tracking Using an Egocentric Cluster of Rolling Shutter Cameras.

Science.gov (United States)

Bapat, Akash; Dunn, Enrique; Frahm, Jan-Michael

2016-11-01

To maintain a reliable registration of the virtual world with the real world, augmented reality (AR) applications require highly accurate, low-latency tracking of the device. In this paper, we propose a novel method for performing this fast 6-DOF head pose tracking using a cluster of rolling shutter cameras. The key idea is that a rolling shutter camera works by capturing the rows of an image in rapid succession, essentially acting as a high-frequency 1D image sensor. By integrating multiple rolling shutter cameras on the AR device, our tracker is able to perform 6-DOF markerless tracking in a static indoor environment with minimal latency. Compared to state-of-the-art tracking systems, this tracking approach performs at significantly higher frequency, and it works in generalized environments. To demonstrate the feasibility of our system, we present thorough evaluations on synthetically generated data with tracking frequencies reaching 56.7 kHz. We further validate the method's accuracy on real-world images collected from a prototype of our tracking system against ground truth data using standard commodity GoPro cameras capturing at 120 Hz frame rate.

CRITERIA FOR THE EVALUATION AND ESTIMATION OF IATROGENIC PROSTHETIC FACTORS – SEMIOLOGY AND SYMPTOMATOLOGY

Directory of Open Access Journals (Sweden)

G. LUCA

2013-12-01

Full Text Available Introduction: The principles lying at the basis of a balanced dental occlusion cannot be analyzed separately, but only if considering the teeth (and, implicitly, dental occlusion as integrated into the masticatory system, which includes the masticatory muscles, the temporo-mandibu‑ lary joint and the maxillary bones. Scope: The scope of the present study was to correlate and establish the interde‑ pendence between the morpholgically-incorrect prosthetic works and the tissular and functional damages suffered by the neighbouring structures, as a result of some incor‑ rectly-made prosthetic works. Also, the study aims at iden‑ tifying the factors and limits responsible for a prolongued maintenance of such irreversible pathological modificati‑ ons within an asymptomatic zone for the patient. Materials and method: The working hypothesis of the present inves‑ tigation started from the analysis of the various objective signs, versus the morphology of the incorrectly performed prosthetic works. The study, initiated as early as 2009, in a private stomatological clinics (DentEstet, Bucuresti, includes a number of 500 patients (250 women and 250 men, selected among the patients having addressed the stomatological office from various reasons (not always related to the prosthetic pathology of the cases here under investigation. Included in the study have been only the patients with fixed prosthetic works associated with one or several of the previously described objective signs, potentially induced by the iatrogeneicity of the prosthetic works. Results: The pathological effects of the iatrogenic works here under analysis, upon both the antagonistic and prosthetic support teeth, may be clinically identified during a minute examination performed prior to produ‑ cing irreversible final effects (abrasions, fractures, dental mobility, etc.. Such noxious effects of the iatrogenic pros‑ thetic works appear as a false masticatory comfort and as a

Pre-operative Asymptomatic Bacteriuria: A Risk Factor For Prosthetic Joint Infection?

Science.gov (United States)

Weale, R; El-Bakri, F; Saeed, Kordo

2018-04-13

Infection is a rare complication following implantation of prosthetic material into a joint. The impact of asymptomatic bacteriuria (ASB) before elective operations and the subsequent risk of prosthetic joint infection (PJI) are not well understood. • Assess the prevalence of ASB amongst patients undergoing total arthroplasty of the hip and knee. • Determine the rates of PJI diagnosed within two years of the arthroplasty and if ASB is an independent risk factor for developing PJI. Patients who had total/unicondylar knee or total hip arthroplasty were retrospectively reviewed over a five-year period. Pre-operative urine samples within one year of surgery were analysed and those with ASB identified. Primary outcome was prosthetic joint infection (PJI) within the first postoperative year. 5542 patients were included. 4368 had a pre-operative urine culture recorded. The prevalence of ASB was 140 of 4368 (3.2%). The overall PJI rate was 56 of 5542 (1.01%). Of those with a PJI, 33 had a pre-operative urine sample recorded. The infection rate in the ASB group was 5% (7 of 140), in the no-ASB group it was 0.61% (26 of 4228) and in the group without a urine sample it was 1.96% (23 of 1174) (p value prosthetic joint, suggestive the relationship is unlikely causal. Copyright © 2018. Published by Elsevier Ltd.

Prosthetics & Orthotics Manufacturing Initiative (POMI)

Science.gov (United States)

2012-12-21

suspension system, socket- ankle /knee interface, etc.) associated with a complete prosthetic system. More specific, the purpose of these deliverables was...strap. The waist belt consists of an adjustable belt utilizing polypropylene buckles and a 2‖ elastic suspension strap which descends to the anchor ...Superior View. Step 8: The suspension component consists of a 1’ anchor strap with a buckle and a 5’ – 6’ long shoulder strap with hook and

Single-stage revision for fungal peri-prosthetic joint infection: a single-centre experience.

Science.gov (United States)

Klatte, T O; Kendoff, D; Kamath, A F; Jonen, V; Rueger, J M; Frommelt, L; Gebauer, M; Gehrke, T

2014-04-01

Fungal peri-prosthetic infections of the knee and hip are rare but likely to result in devastating complications. In this study we evaluated the results of their management using a single-stage exchange technique. Between 2001 and 2011, 14 patients (ten hips, four knees) were treated for a peri-prosthetic fungal infection. One patient was excluded because revision surgery was not possible owing to a large acetabular defect. One patient developed a further infection two months post-operatively and was excluded from the analysis. Two patients died of unrelated causes. After a mean of seven years (3 to 11) a total of ten patients were available for follow-up. One patient, undergoing revision replacement of the hip, had a post-operative dislocation. Another patient, undergoing revision replacement of the knee, developed a wound infection and required revision 29 months post-operatively following a peri-prosthetic femoral fracture. The mean Harris hip score increased to 74 points (63 to 84; p prosthetic infection is feasible, with an acceptable rate of a satisfactory outcome.

Aerogel Use as a Skin Protective Liner In Space Suits and Prosthetic Limbs Project

Science.gov (United States)

Roberson, Luke Bennett

2014-01-01

Existing materials for prosthetic liners tend to be thick and airtight, causing perspiration to accumulate inside the liner and potentially causing infection and injury. The purpose of this project was to examine the suitability of aerogel for prosthetic liner applications for use in space suits and orthopedics. Three tests were performed on several types of aerogel to assess the properties of each material, and our initial findings demonstrated that these materrials would be excellent candidates for liner applications for prosthetics and space suits. The project is currently on hold until additional funding is obtained for application testing at the VH Hospitals in Tampa

EEG Mind Controlled Smart Prosthetic Arm – A Comprehensive Study

Directory of Open Access Journals (Sweden)

Taha Beyrouthy

2017-06-01

Full Text Available Recently, the field of prosthetics has seen many accomplishments especially with the integration of technological advancements. In this paper, different arm types (robotic, surgical, bionic, prosthetic and static are analyzed in terms of resistance, usage, flexibility, cost and potential. Most of these techniques have some problems; they are extremely expensive, hard to install and maintain and may require surgery. Therefore, our work introduces the initial design of an EEG mind controlled smart prosthetic arm. The arm is controlled by the brain commands, obtained from an electroencephalography (EEG headset, and equipped with a network of smart sensors and actuators that give the patient intelligent feedback about the surrounding environment and the object in contact. This network provides the arm with normal hand functionality, smart reflexes and smooth movements. Various types of sensors are used including temperature, pressure, ultrasonic proximity sensors, accelerometers, potentiometers, strain gauges and gyroscopes. The arm is completely 3D printed built from various lightweight and high strength materials that can handle high impacts and fragile elements as well. Our project requires the use of nine servomotors installed at different places in the arm. Therefore, the static and dynamic modes of servomotors are analyzed. The total cost of the project is estimated to be relatively cheap compared to other previously built arms. Many scenarios are analyzed corresponding to the actions that the prosthetic arm can perform, and an algorithm is created to match these scenarios. Experimental results show that the proposed EEG Mind-controlled Arm is a promising alternative for current solutions that require invasive and expensive surgical procedures.

Successful Thrombolysis of Aortic Prosthetic Valve Thrombosis ...

African Journals Online (AJOL)

Arun Kumar Agnihotri

patients with valvular heart disease). Endorsed by the Society of Cardiovascular. Anesthesiologists, Society for Cardiovascular. Angiography and Interventions, and Society of. Thoracic Surgeons. J Am Coll Cardiol. 2008;52(13):e1-142. 5. Elkayam U, Bitar F. Valvular heart disease and pregnancy. Part II: prosthetic valves.

Consumer satisfaction in prosthetics and orthotics facilities

NARCIS (Netherlands)

Geertzen, J.H.B.; Gankema, H.G.J.; Groothoff, J.W.; Dijkstra, P.U.

The aim of this study was to assess consumer/patient satisfaction with the services of the prosthetics and orthotics (P&O) facilities in the north of the Netherlands, using a modified SERVQUAL questionnaire. In this questionnaire, consumer interests and experiences are assessed on a 5-point Likert

Prosthetic valve obstruction: Redo surgery or fibrinolysis?

Directory of Open Access Journals (Sweden)

Avinash Inamdar

2017-01-01

Full Text Available Objective: The aim of this study was to compare the efficacy and safety of surgery versus fibrinolytic therapy in patients with prosthetic valve obstruction. Materials and Methods: We compared 15 patients of prosthetic valve thrombosis treated by surgical line of management and another 15 patients treated by thrombolysis. All patients were initially assessed by clinical evaluation and diagnosis confirmed by transthoracic and transesophageal two-dimensional echocardiography. Depending on hemodynamic stability, pannus, or thrombus on transesophageal echocardiography, the patients were assigned surgical or medical line of management. Results: Patients mortality rate was 40% in fibrinolytic group and 13.33% in surgical group. Recurrence was 40% in fibrinolytic group while there was no recurrence till date in surgery group. Complications were more in fibrinolytic group as opposed to surgery group patient. Conclusion: From our experience, we conclude that redo surgery is effective and definitive treatment, especially in patients with stable hemodynamic conditions.

Self-cleaning skin-like prosthetic polymer surfaces

Science.gov (United States)

Simpson, John T [Clinton, TN; Ivanov, Ilia N [Knoxville, TN; Shibata, Jason [Manhattan Beach, CA

2012-03-27

An external covering and method of making an external covering for hiding the internal endoskeleton of a mechanical (e.g., prosthetic) device that exhibits skin-like qualities is provided. The external covering generally comprises an internal bulk layer in contact with the endoskeleton of the prosthetic device and an external skin layer disposed about the internal bulk layer. The external skin layer is comprised of a polymer composite with carbon nanotubes embedded therein. The outer surface of the skin layer has multiple cone-shaped projections that provide the external skin layer with superhydrophobicity. The carbon nanotubes are preferably vertically aligned between the inner surface and outer surface of the external skin layer in order to provide the skin layer with the ability to transmit heat. Superhydrophobic powders may optionally be used as part of the polymer composite or applied as a coating to the surface of the skin layer to enhance superhydrophobicity.

Is the Prosthetic Homologue Necessary for Embodiment?

Science.gov (United States)

Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

2016-01-01

Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

An evaluation of prosthetic status and treatment needs among institutionalized elderly individuals of Delhi, India

OpenAIRE

Nisha Yadav; Roma Yadav; Meetika Pahuja; Sanchit Pardhan; Sahiba Miglani; Tamanna Malik

2017-01-01

Context: Oral health is essential for elderly person's general health and well-being. The most common oral problem in elderly is tooth loss which results due to periodontal diseases and caries. Prosthetic status is very important as it is related to dietary intake and maintaining nutritional status. Hence, to promote the oral health of the elderly, we need to know their prosthetic status and need. Aims: The aim of this study is to find the prosthetic status and need of 65–74 years old elderly...

Smart Prosthetic Hand Technology - Phase 2

Science.gov (United States)

2011-05-01

functional magnetic resonance imaging (f- MRI ) was used to analyze the reciprocal adaptation between the human brain and the prosthetic hand by the...Schmidt PC. Influence of compacted hydrophobic and hydrophilic colloidal silicon dioxide on tableting properties of pharmaceutical excipients. Drug Dev...nanoparticles, and manganese nanoparticles) in magnetic resonance imaging ( MRI ) in the detection and staging of cancer [2]. 2.1 Iron Oxide

Immediate effects of a new microprocessor-controlled prosthetic knee joint: a comparative biomechanical evaluation.

Science.gov (United States)

Bellmann, Malte; Schmalz, Thomas; Ludwigs, Eva; Blumentritt, Siegmar

2012-03-01

To investigate the immediate biomechanical effects after transition to a new microprocessor-controlled prosthetic knee joint. Intervention cross-over study with repeated measures. Only prosthetic knee joints were changed. Motion analysis laboratory. Men (N=11; mean age ± SD, 36.7±10.2y; Medicare functional classification level, 3-4) with unilateral transfemoral amputation. Two microprocessor-controlled prosthetic knee joints: C-Leg and a new prosthetic knee joint, Genium. Static prosthetic alignment, time-distance parameters, kinematic and kinetic parameters, and center of pressure. After a half-day training and an additional half-day accommodation, improved biomechanical outcomes were demonstrated by the Genium: lower ground reaction forces at weight acceptance during level walking at various velocities, increased swing phase flexion angles during walking on a ramp, and level walking with small steps. Maximum knee flexion angle during swing phase at various velocities was nearly equal for Genium. Step-over-step stair ascent with the Genium knee was more physiologic as demonstrated by a more equal load distribution between the prosthetic and contralateral sides and a more natural gait pattern. When descending stairs and ramps, knee flexion moments with the Genium tended to increase. During quiet stance on a decline, subjects using Genium accepted higher loading of the prosthetic side knee joint, thus reducing same side hip joint loading as well as postural sway. In comparision to the C-Leg, the Genium demonstrated immediate biomechanical advantages during various daily ambulatory activities, which may lead to an increase in range and diversity of activity of people with above-knee amputations. Results showed that use of the Genium facilitated more natural gait biomechanics and load distribution throughout the affected and sound musculoskeletal structure. This was observed during quiet stance on a decline, walking on level ground, and walking up and down ramps and

Prosthetic joint infection caused by Pasteurella multocida: a case series and review of literature.

Science.gov (United States)

Honnorat, Estelle; Seng, Piseth; Savini, Hélène; Pinelli, Pierre-Olivier; Simon, Fabrice; Stein, Andreas

2016-08-20

Pasteurella multocida is a well-recognized zoonotic agent following dog or cat bites or scratches. Nevertheless, prosthetic joint infection caused by P. multocida are rarely reported. We report here a series of six cases of prosthetic joint infection caused by P. multocida managed at a referral centre for the treatment of bone and joint infection in southern France. We also reviewed the 26 cases reported in literature. The mean age of our cases was 74 years [±8.2, range 63-85]. In majority of our cases (5 cases) were associated with knee prostheses and one case with a hip prosthesis. Most of cases occurred after cat or dog scratches or licks or contact. Diagnoses of prosthetic joint infection caused by P. multocida were made by positive cultures of surgical biopsies or needle aspiration. Mean time delay between prosthetic joint implantation and infection onset was 7.6 years (±5.12 years, range 2-17). Local inflammation, which occurred in all six cases, was the most frequent clinical symptom, followed by pain in five cases, fever and swollen joints in four cases, and a fistula with purulent discharge inside the wound in two cases. The mean time of antibiotic therapy was 8 months. Surgical treatment with prosthesis removal was performed in three cases. Six of our cases were in remission without apparent relapse at 3 years after end of treatment. Prosthetic joint infections caused by P. multocida usually occur after animal scratches or bites, but can occasionally occur after a short animal lick. These infections are usually resulting from a contiguous infection and localized in the knee. An early antibiotic therapy after surgical debridement could avoid prosthetic withdrawal, notably in elderly patients. Patients with prosthetic joints should be warned that animals are potential sources of serious infection and urgent medical advice should be sought if they are bitten or scratched.

Systematic variation of prosthetic foot spring affects center-of-mass mechanics and metabolic cost during walking.

Science.gov (United States)

Zelik, Karl E; Collins, Steven H; Adamczyk, Peter G; Segal, Ava D; Klute, Glenn K; Morgenroth, David C; Hahn, Michael E; Orendurff, Michael S; Czerniecki, Joseph M; Kuo, Arthur D

2011-08-01

Lower-limb amputees expend more energy to walk than non-amputees and have an elevated risk of secondary disabilities. Insufficient push-off by the prosthetic foot may be a contributing factor. We aimed to systematically study the effect of prosthetic foot mechanics on gait, to gain insight into fundamental prosthetic design principles. We varied a single parameter in isolation, the energy-storing spring in a prototype prosthetic foot, the controlled energy storage and return (CESR) foot, and observed the effect on gait. Subjects walked on the CESR foot with three different springs. We performed parallel studies on amputees and on non-amputees wearing prosthetic simulators. In both groups, spring characteristics similarly affected ankle and body center-of-mass (COM) mechanics and metabolic cost. Softer springs led to greater energy storage, energy return, and prosthetic limb COM push-off work. But metabolic energy expenditure was lowest with a spring of intermediate stiffness, suggesting biomechanical disadvantages to the softest spring despite its greater push-off. Disadvantages of the softest spring may include excessive heel displacements and COM collision losses. We also observed some differences in joint kinetics between amputees and non-amputees walking on the prototype foot. During prosthetic push-off, amputees exhibited reduced energy transfer from the prosthesis to the COM along with increased hip work, perhaps due to greater energy dissipation at the knee. Nevertheless, the results indicate that spring compliance can contribute to push-off, but with biomechanical trade-offs that limit the degree to which greater push-off might improve walking economy. © 2011 IEEE

The Prosthetic Experience Between Body and Technology

DEFF Research Database (Denmark)

Søndergaard, Morten

2018-01-01

In this paper, I argue that a prosthetic aesthetic instigated by experimental art practices operate with and within a ‘second nature’ – in-between science and art. Drawing on theories from Dewey and Edelman and examples from Da Vinci, Brancusi, Man Ray, Dali and Stelarc, I am calling...

Aortic allografts in treatment of aortic valve and ascending aorta prosthetic endocarditis

Directory of Open Access Journals (Sweden)

S.V. Spiridonov

2017-03-01

Full Text Available The aim – to assess short- and long-term results of aortic root replacement using aortic allografts in patients with prosthetic endocarditis. Materials and methods. Since February 2009 until June 2016 aortic valve and ascending aorta replacement using aortic allografts was performed in 26 patients with prosthetic endocarditis. In 50 % of cases at initial operation aortic valve replacement was performed, in another 50 % of cases – aortic valve and ascending aorta replacement. Echocardiography was performed 10 days, 3, 6 and 12 months, 2, 3 and 5 years after surgery. Analysis of long-term results included all cases of deaths, prosthesis-related complications and recurrence of endocarditis. Results. 30-day mortality was 23.1 %. Extracorporeal membranous oxygenation (ECMO was used only in 5 patients (19.2 %. Four patients were weaned from ECMO. We did not observe any allograft-related complications. During follow-up period there were no cases of reoperation due to structural allograft failure. Relapse of infection occurred in 1 patient (3.8 % four years after the operation and led to lethal outcome. Conclusion. Reoperations using allografts are an effective surgical treatment of prosthetic endocarditis. In majority of cases prosthetic endocarditis was caused by gram-positive cocci (Staphylococcus. In 84.6 % of cases it was associated with destruction of paravalvular structures and abscesses formation. Heart failure was a causative factor of different complications in these patients, which required ECMO in 19.2 % of patients. In 80 % of cases patients were weaned from ECMO. Allografts using for the treatment of prosthetic endocarditis is associated with high resistance to infection and with a significant rate of freedom from recurrence of endocarditis within 3 years after surgery.

Selected applications for current polymers in prosthetic dentistry - state of the art.

Science.gov (United States)

Kawala, Maciej; Smardz, Joanna; Adamczyk, Lukasz; Grychowska, Natalia; Wieckiewicz, Mieszko

2018-05-10

Polymers are widely applied in medicine, including dentistry, i.e. in prosthodontics. The following paper is aimed at demonstrating the applications of selected modern polymers in prosthetic dentistry based on the reported literature. The study was conducted using the PubMed, SCOPUS and CINAHL databases in relation to documents published during 1999-2017. The following keywords were used: polymers with: prosthetic dentistry, impression materials, denture base materials, bite registration materials, denture soft liners, occlusal splint materials and 3D printing. Original papers and reviews which were significant from the modern clinical viewpoint and practical validity in relation to the possibility of using polymeric materials in prosthetic dentistry, were presented. Denture base materials were most commonly modified polymers. Modifications mainly concerned antimicrobial properties and reinforcement of the material structure by introducing additional fibers. Antimicrobial modifications were also common in case of relining materials. Polymeric materials have widely been used in prosthetic dentistry. Modifications of their composition allow achieving new, beneficial properties that affect quality of patients' life. Progress in science allows for a more methodologically-advanced research on the synthesis of new polymeric materials and incorporation of new substances into already known polymeric materials, that will require systematization and appropriate classification. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Characterization of microbes in prosthetic joint specimens by culture-independent molecular methods

DEFF Research Database (Denmark)

Xu, Yijuan; Rudkjøbing, Vibeke Børsholt; Simonsen, Ole

Prosthetic joint infection (PJI) is one of the most challenging complications of joint alloplasty. Formation of biofilm is a prominent feature of PJIs and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study was to inves......Prosthetic joint infection (PJI) is one of the most challenging complications of joint alloplasty. Formation of biofilm is a prominent feature of PJIs and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study...... was to investigate the microbial diversity in surgical samples (eg. synovial fluid, periprosthetic tissue, removed prosthesis) from 22 prosthetic patients using a range of culture-independent molecular methods including broad range 16S rRNA gene PCR, cloning, phylogeny, quantitative PCR (qPCR), and fluorescence...

Novel implant for peri-prosthetic proximal tibia fractures.

Science.gov (United States)

Tran, Ton; Chen, Bernard K; Wu, Xinhua; Pun, Chung Lun

2018-03-01

Repair of peri-prosthetic proximal tibia fractures is very challenging in patients with a total knee replacement or arthroplasty. The tibial component of the knee implant severely restricts the fixation points of the tibial implant to repair peri-prosthetic fractures. A novel implant has been designed with an extended flange over the anterior of tibial condyle to provide additional points of fixation, overcoming limitations of existing generic locking plates used for proximal tibia fractures. Furthermore, the screws fixed through the extended flange provide additional support to prevent the problem of subsidence of tibial component of knee implant. The design methodology involved extraction of bone data from CT scans into a flexible CAD format, implant design and structural evaluation and optimisation using FEM as well as prototype development and manufacture by selective laser melting 3D printing technology with Ti6Al4 V powder. A prototype tibia implant was developed based on a patient-specific bone structure, which was regenerated from the CT images of patient's tibia. The design is described in detail and being applied to fit up to 80% of patients, for both left and right sides based on the average dimensions and shape of the bone structure from a wide range of CT images. A novel tibial implant has been developed to repair peri-prosthetic proximal tibia fractures which overcomes significant constraints from the tibial component of existing knee implant. Copyright © 2018 Elsevier Ltd. All rights reserved.

Trajectory Planning of 7-DOF Space Manipulator for Minimizing Base Disturbance

Directory of Open Access Journals (Sweden)

Qiang Zhang

2016-03-01

Full Text Available In the free-floating mode, there is intense dynamic coupling existing between the space manipulator and the base, and the base attitude may change while performing a motion with its manipulator. Therefore, it is necessary to reduce the interference that resulted from the manipulator movement. For planning trajectories of the space manipulator with 7 degrees of freedom (7-DOF, simulated annealing particle swarm optimization (SAPSO algorithm is presented in the paper. Firstly, kinematics equations are setup. Secondly, the joint functions are parameterized by sinusoidal functions, and the objective function is defined according to the motion constraints of manipulator and accuracy requirements of the base attitude. Finally, SAPSO algorithm is used to search the optimal trajectory. The simulation results verify the proposed method.

Measurement system and model for simultaneously measuring 6DOF geometric errors.

Science.gov (United States)

Zhao, Yuqiong; Zhang, Bin; Feng, Qibo

2017-09-04

A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.

Workspace optimization and kinematic performance evaluation of 2-DOF parallel mechanisms

International Nuclear Information System (INIS)

Nam, Yun Joo; Park, Myeong Kwan

2006-01-01

This paper presents the kinematics and workspace optimization of the two different 2-DOF (Degrees-of-Freedom) planar parallel mechanisms: one (called 2-RPR mechanism) with translational actuators and the other (called 2-RRR mechanism) with rotational ones. First of all, the inverse kinematics and Jacobian matrix for each mechanism are derived analytically. Then, the workspace including the output-space and the joint-space is systematically analyzed in order to determine the geometric parameters and the operating range of the actuators. Finally, the kinematic optimization of the mechanisms is performed in consideration of their dexterity and rigidity. It is expected that the optimization results can be effectively used as a basic material for the applications of the presented mechanisms to more industrial fields

The influence of environmental and personal factors on participation of lower-limb prosthetic users in low-income countries: prosthetists' perspectives.

Science.gov (United States)

Kam, Season; Kent, Mallory; Khodaverdian, Alin; Daiter, Liane; Njelesani, Janet; Cameron, Debra; Andrysek, Jan

2015-05-01

To examine the environmental and personal factors in low-income countries (LICs) that influence prosthetic rehabilitation of adults with lower-limb (LL) amputations and their ability to participate in daily activities. In this qualitative descriptive study, 11 prosthetists participated in semi-structured interviews by telephone or Skype. Qualitative thematic analysis was guided by the International Classification of Function. Facilitating continuity of care, consideration of physical environments and usage, prosthetic quality including durability and socket fit, and minimizing the visibility of disability, were found to be important factors affecting the provision of prosthetic services in LICs. Environmental and personal factors must be considered when providing prosthetic rehabilitation for adults with LL amputations in LICs in order to optimize participation in activities. Results from this study provide new insights about some of the factors that influence the ability of individuals with LL amputations to rehabilitate to a level where they are able to participate in meaningful activities within their communities. There are unique environmental and personal components that can influence activity and participation of lower-limb (LL) prosthetic users in low-income countries (LICs). These components are often overlooked in the design of prosthetic devices and provision of prosthetic services. Continuity of care, condition of the post-surgical residuum, outdoor environments of common occupations, aesthetics and durability of prostheses, and user comfort should all be considered when providing prosthetic rehabilitation to adults with LL amputations in LICs to promote activity and participation. Results of our study can inform the practice of prosthetists in LICs by highlighting their contributions in enabling participation for LL prosthetic users. Our results can also inform the design of durable and comfortable prostheses and the provision of more appropriate

Nitinol for Prosthetic and Orthotic Applications

Science.gov (United States)

Henderson, Emma; Buis, Arjan

2011-07-01

As global populations age, conditions such as stroke and diabetes require individuals to use rehabilitation technology for many years to come due to chronic musculoskeletal, sensory, and other physical impairments. One in four males currently aged 45 will experience a stroke within 40 years and will often require access to prolonged rehabilitation. In addition, worldwide, one individual loses a limb every 30 s due to the complications of diabetes. As a result, innovative ideas are required to devise more effective prosthetic and orthotic devices to enhance quality of life. While Nitinol has already found much favor within the biomedical industry, one area, which has not yet exploited its unique properties, is in the field of physical rehabilitation, ranging from prosthetic and orthotic devices to assistive technology such as wheelchairs. Improved intervention capabilities based on materials such as Nitinol have the potential to vastly improve patients' quality of life and in the case of orthoses, may even reduce the severity of the condition over time. It is hoped that this study will spark discussion and interest for the materials community in a field which has yet to be fully exploited.

Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

Science.gov (United States)

Nabeel, Hafiz Muhammad; Azher, Anum; Usman Ali, Syed M.; Wahab Mughal, Abdul

2013-12-01

In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface.

Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

International Nuclear Information System (INIS)

Nabeel, Hafiz Muhammad; Azher, Anum; Ali, Syed M Usman; Mughal, Abdul Wahab

2013-01-01

In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface

A survey of prosthetic eye wearers to investigate mucoid discharge

Directory of Open Access Journals (Sweden)

Pine K

2012-05-01

Full Text Available Keith Pine1, Brian Sloan2, Joanna Stewart3, Robert J Jacobs11Department of Optometry and Vision Science, 2Department of Ophthalmology, New Zealand National Eye Centre, 3Section of Epidemiology and Biostatistics, School of Population Health, University of Auckland, Auckland, New ZealandBackground: This study aimed to better understand the causes and treatments of mucoid discharge associated with prosthetic eye wear by reviewing the literature and surveying anophthalmic patients.Methods: An anonymous questionnaire was completed by 429 prosthetic eye wearers who used visual analog scales to self-measure their discharge experience for four discharge characteristics: frequency, color, volume, and viscosity. These characteristics were analyzed with age, ethnicity, years wearing a prosthesis, eye loss cause, removal and cleaning regimes, hand-washing behavior, age of current prosthesis, and professional repolishing regimes as explanatory variables. Eighteen ocularists’ Web sites containing comments on the cause and treatment of discharge were surveyed.Results: Associations were found between discharge frequency and cleaning regimes with more frequent cleaning accompanying more frequent discharge. Color was associated with years of wearing and age, with more years of wearing and older people having less colored discharge. Volume was associated with cleaning regimes with more frequent cleaners having more volume. Viscosity was associated with cleaning regimes and years of wearing with more frequent cleaning and shorter wearing time accompanying more viscous discharge. No associations were found between discharge characteristics and ethnicity, eye loss cause, hand washing, age of current prosthesis, or repolishing regimes. Forty-seven percent of ocularists’ Web sites advised that discharge was caused by surface deposits on the prosthesis, 29% by excessive handling of the prosthesis, and 24% by other causes.Conclusions: A standardized treatment

DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

Directory of Open Access Journals (Sweden)

Cominelli Eleonora

2011-11-01

Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.

Evaluation of head-collision safety of a 7-DOF manipulator according to posture variation

Energy Technology Data Exchange (ETDEWEB)

Kim, Ki Hong, E-mail: rome582@khu.ac.kr; Park, In Jun, E-mail: demianjun@gmail.com; Choi, Jin-Hwan, E-mail: jhchoi@khu.ac.kr; Rhim, Sungsoo, E-mail: ssrhim@khu.ac.kr [Kyung Hee University, Department of Mechanical Engineering (Korea, Republic of)

2016-05-15

As the need for the improvement of the productivity in the manufacturing process grows, industrial robots are brought out of the safety fences and used in the direct collaborative operation with human workers. Consequently, the intended and/or unintended contact between the human and the robot in the collaborative operation is no longer an extraordinary event and is a mundane possibility. The level of the risk of the collision depends on various quantities associated with the collision, for example, inertia, velocity, stiffness, and so on. MSI (manipulator safety index) which is based on HIC (head injury criteria) conventionally used in the automotive industry is one of the practically available measures to estimate the risk of the collision between the human and the manipulator. In this paper MSI is applied to evaluate the collision safety of a 7-DOF articulated human-arm-like manipulator. The risk of the collision could be reduced by choosing different postures without deviating from the given end-effector trajectory using the redundant degree of freedom in the 7-DOF manipulator. The paper shows how the redundant degree of the freedom is utilized to design safer trajectories and/or safer manipulator configurations among many available. A parametric analysis and simulation results for a given trajectory illustrate the usefulness of the concept of the trajectory design for alleviating the risk of the manipulator operation in the human–robot coexisting workspace.

Prosthetic management of an ocular defect

Directory of Open Access Journals (Sweden)

Siddesh Kumar Chintal

2010-01-01

Full Text Available The disfigurement associated with the loss of an eye can cause significant physical and emotional problems. Various treatment modalities are available, one of which is implants. Although implant has a superior outcome, it may not be advisable in all patients due to economic factors. The present article describes the prosthetic management of an ocular defect with a custom-made ocular prosthesis.

LEUKOCYTE AND BACTERIA IMAGING IN PROSTHETIC JOINT INFECTION

NARCIS (Netherlands)

Glaudemans, Andor W. J. M.; Galli, Filippo; Pacilio, Marta; Signore, Alberto

2013-01-01

There has been a significant increase in the number of joint prosthesis replacements worldwide. Although relatively uncommon, complications can occur with the most serious being an infection. Various radiological and nuclear imaging techniques are available to diagnose prosthetic joint infections

Esthetic, functional, and prosthetic outcomes with implant-retained finger prostheses.

Science.gov (United States)

Aydin, Cemal; Nemli, Secil Karakoca; Yilmaz, Handan

2013-04-01

Traumatic amputation of fingers results in a serious impairment of hand function and affects the psychological status of the patients. The implant-retained finger prostheses are an alternative treatment. The aim of this case report is to represent the use of osseointegrated implants for retention of finger prostheses in a patient with amputated thumb and index finger. Dental implants were placed in the residual bone of the fingers using two-stage surgery. Custom-made attachments were used to provide retention between implants and silicone prostheses. Prosthetic fingernails were made of composite resin material. After 6 months, implants were clinically successful, and the patient was satisfied with the appearance and the function of the prostheses. The complications of broken prosthetic nail and mild discoloration were observed. Reconstruction of amputated fingers with implant-retained prosthesis is a worthwhile treatment providing esthetic, functional, and psychological benefits, although some complications might be experienced. Clinical relevance Implant-retained finger prostheses are an acceptable treatment modality for patients with amputated fingers. Evaluating implant prognosis, functional results and prosthetic results of the patients are necessary to address the benefits and complications of the treatment.

Nuclear Medicine in Diagnosis of Prosthetic Valve Endocarditis: An Update

Science.gov (United States)

Musso, Maria; Petrosillo, Nicola

2015-01-01

Over the past decades cardiovascular disease management has been substantially improved by the increasing introduction of medical devices as prosthetic valves. The yearly rate of infective endocarditis (IE) in patient with a prosthetic valve is approximately 3 cases per 1,000 patients. The fatality rate of prosthetic valve endocarditis (PVE) remains stable over the years, in part due to the aging of the population. The diagnostic value of echocardiography in diagnosis is operator-dependent and its sensitivity can decrease in presence of intracardiac devices and valvular prosthesis. The modified Duke criteria are considered the gold standard for diagnosing IE; their sensibility is 80%, but in clinical practice their diagnostic accuracy in PVE is lower, resulting inconclusively in nearly 30% of cases. In the last years, these new imaging modalities have gained an increasing attention because they make it possible to diagnose an IE earlier than the structural alterations occurring. Several studies have been conducted in order to assess the diagnostic accuracy of various nuclear medicine techniques in diagnosis of PVE. We performed a review of the literature to assess the available evidence on the role of nuclear medicine techniques in the diagnosis of PVE. PMID:25695043

The effects of a controlled energy storage and return prototype prosthetic foot on transtibial amputee ambulation.

Science.gov (United States)

Segal, Ava D; Zelik, Karl E; Klute, Glenn K; Morgenroth, David C; Hahn, Michael E; Orendurff, Michael S; Adamczyk, Peter G; Collins, Steven H; Kuo, Arthur D; Czerniecki, Joseph M

2012-08-01

The lack of functional ankle musculature in lower limb amputees contributes to the reduced prosthetic ankle push-off, compensations at other joints and more energetically costly gait commonly observed in comparison to non-amputees. A variety of energy storing and return prosthetic feet have been developed to address these issues but have not been shown to sufficiently improve amputee biomechanics and energetic cost, perhaps because the timing and magnitude of energy return is not controlled. The goal of this study was to examine how a prototype microprocessor-controlled prosthetic foot designed to store some of the energy during loading and return it during push-off affects amputee gait. Unilateral transtibial amputees wore the Controlled Energy Storage and Return prosthetic foot (CESR), a conventional foot (CONV), and their previously prescribed foot (PRES) in random order. Three-dimensional gait analysis and net oxygen consumption were collected as participants walked at constant speed. The CESR foot demonstrated increased energy storage during early stance, increased prosthetic foot peak push-off power and work, increased prosthetic limb center of mass (COM) push-off work and decreased intact limb COM collision work compared to CONV and PRES. The biological contribution of the positive COM work for CESR was reduced compared to CONV and PRES. However, the net metabolic cost for CESR did not change compared to CONV and increased compared to PRES, which may partially reflect the greater weight, lack of individualized size and stiffness and relatively less familiarity for CESR and CONV. Controlled energy storage and return enhanced prosthetic push-off, but requires further design modifications to improve amputee walking economy. Published by Elsevier B.V.

The influence of staff training and education on prosthetic and orthotic service quality: A scoping review.

Science.gov (United States)

Forghany, Saeed; Sadeghi-Demneh, Ebrahim; Trinler, Ursula; Onmanee, Pornsuree; Dillon, Michael P; Baker, Richard

2018-06-01

Education and training in prosthetics and orthotics typically comply with International Society for Prosthetics and Orthotics standards based on three categories of prosthetic and orthotic professionals. This scoping study sought to describe the evidence base available to answer the question, How are prosthetic and orthotic services influenced by the training of staff providing them? Scoping review. A structured search of the peer-reviewed literature catalogued in major electronic databases yielded 3039 papers. Following review of title and abstract, 93 articles were considered relevant. Full-text review reduced this number to 25. Only two articles were identified as providing direct evidence of the effects of training and education on service provision. While both suggested that there was an impact, it is difficult to see how the more specific conclusions of either could be generalised. The other 23 articles provide a useful background to a range of issues including the specification of competencies that training programmes should deliver (3 articles), descriptions of a range of training programmes and the effects of training and education on student knowledge and skills. Although it is considered axiomatic, the service quality is dependent on practitioner education and training. There is insufficient evidence to establish whether levels of training and education in prosthetics and orthotics have an effect on the quality of prosthetic and orthotic services. Clinical relevance There is very little evidence about the effects of training and education of prosthetists and orthotists on service quality. While this is a somewhat negative finding, we feel that it is important to bring this to the attention of the prosthetics and orthotics community.

First-in-man demonstration of a fully implanted myoelectric sensors system to control an advanced electromechanical prosthetic hand.

Science.gov (United States)

Pasquina, Paul F; Evangelista, Melissa; Carvalho, A J; Lockhart, Joseph; Griffin, Sarah; Nanos, George; McKay, Patricia; Hansen, Morten; Ipsen, Derek; Vandersea, James; Butkus, Josef; Miller, Matthew; Murphy, Ian; Hankin, David

2015-04-15

Advanced motorized prosthetic devices are currently controlled by EMG signals generated by residual muscles and recorded by surface electrodes on the skin. These surface recordings are often inconsistent and unreliable, leading to high prosthetic abandonment rates for individuals with upper limb amputation. Surface electrodes are limited because of poor skin contact, socket rotation, residual limb sweating, and their ability to only record signals from superficial muscles, whose function frequently does not relate to the intended prosthetic function. More sophisticated prosthetic devices require a stable and reliable interface between the user and robotic hand to improve upper limb prosthetic function. Implantable Myoelectric Sensors (IMES(®)) are small electrodes intended to detect and wirelessly transmit EMG signals to an electromechanical prosthetic hand via an electro-magnetic coil built into the prosthetic socket. This system is designed to simultaneously capture EMG signals from multiple residual limb muscles, allowing the natural control of multiple degrees of freedom simultaneously. We report the status of the first FDA-approved clinical trial of the IMES(®) System. This study is currently in progress, limiting reporting to only preliminary results. Our first subject has reported the ability to accomplish a greater variety and complexity of tasks in his everyday life compared to what could be achieved with his previous myoelectric prosthesis. The interim results of this study indicate the feasibility of utilizing IMES(®) technology to reliably sense and wirelessly transmit EMG signals from residual muscles to intuitively control a three degree-of-freedom prosthetic arm. Copyright © 2014 Elsevier B.V. All rights reserved.

Impact of pannus formation on hemodynamic dysfunction of prosthetic aortic valve: pannus extent and its relationship to prosthetic valve motion and degree of stenosis.

Science.gov (United States)

Koo, Hyun Jung; Ha, Hojin; Kang, Joon-Won; Kim, Jeong A; Song, Jae-Kwan; Kim, Hwa Jung; Lim, Tae-Hwan; Yang, Dong Hyun

2018-02-19

Although pannus is an important cause of prosthetic valve dysfunction, the minimum pannus size that can induce hemodynamic dysfunction has not yet been determined. This study investigated the correlation between the limitation of motion (LOM) of the prosthetic valve and pannus extent and determined the pannus extent that could induce severe aortic stenosis. This study included 49 patients who underwent mechanical aortic valve replacement (AVR) and showed pannus on cardiac computed tomography (CT). Pannus width, ratio of pannus width to valve diameter, pannus area, effective orifice area, encroachment ratio by pannus, pannus involvement angle and percent LOM of mechanical valves were evaluated on CT. Transvalvular peak velocity (TPV) and transvalvular pressure gradient (TPG) were measured by transesophageal echocardiography to determine the degree of aortic stenosis. The relationship between percent LOM of the prosthetic valve and pannus extent and the cut-off of pannus extent required to induce severe aortic stenosis were evaluated. The mean interval between AVR and pannus formation was 11 years and was longer in patients with than without severe aortic stenosis (14.0 vs. 7.3 years). On CT, the percent LOM of the prosthetic valve was significantly associated with the extent of pannus only in patients with pannus involvement angle > 180° (r = 0.55-0.68, P Pannus width, effective orifice area, and encroachment ratio were significantly associated with increased TPV and TPG (r = 0.51-0.62, P Pannus width > 3.5 mm, pannus width/valve inner diameter > 0.15, and encroachment ratio > 0.14 were significantly associated with severe aortic stenosis (TPV > 4 m/s; mean TPG ≥ 35 mmHg), with c-indices of 0.74-079 (P pannus extent parameters are good indicators of significant hemodynamic changes with increased TPV and mean TPG.

The clinical significance of perivalvular pannus in prosthetic mitral valves: Can cardiac CT be helpful?

Science.gov (United States)

Chang, Suyon; Suh, Young Joo; Han, Kyunghwa; Kim, Jin Young; Kim, Young Jin; Chang, Byung-Chul; Choi, Byoung Wook

2017-12-15

The clinical significance of pannus in the prosthetic mitral valve (MV) is not well documented. To investigate the clinical significance of pannus on cardiac computed tomography (CT) in patients with a prosthetic MV. A total of 130 patients with previous MV replacement who underwent cardiac CT were retrospectively included in this study. The presence of pannus, paravalvular leak (PVL) around the prosthetic MV and limitation of motion (LOM) of the MV were analyzed using CT. Between patients with MV pannus and those without pannus, CT, echocardiographic, and redo-surgery findings were compared. The diagnostic performance of CT and transesophageal echocardiography (TEE) for the detection of MV pannus was also compared, using surgical findings as a standard reference. MV pannus was observed on cardiac CT in 32.3% of the study population. Patients with MV pannus detected on CT more commonly had LOM (28.2% vs. 15.2%) and less frequently had PVL of the prosthetic MV (16.7% vs. 25%) than patients without MV pannus (P>0.05). Prosthetic valve obstruction (PVO) due prosthetic MV pannus requiring redo-surgery was present in only five patients (11.9%). Cardiac CT detected MV pannus with sensitivity of 65.2% and specificity of 80.9% and showed better diagnostic performance than TEE (Ppannus can frequently be seen on cardiac CT. However, its clinical significance should be assessed with careful consideration, because PVO due to MV pannus is relatively uncommon, and pannus can be seen in patients without any clinical problems. Copyright © 2017 Elsevier B.V. All rights reserved.

An evaluation of prosthetic status and treatment needs among institutionalized elderly individuals of Delhi, India

Directory of Open Access Journals (Sweden)

Nisha Yadav

2017-01-01

Full Text Available Context: Oral health is essential for elderly person's general health and well-being. The most common oral problem in elderly is tooth loss which results due to periodontal diseases and caries. Prosthetic status is very important as it is related to dietary intake and maintaining nutritional status. Hence, to promote the oral health of the elderly, we need to know their prosthetic status and need. Aims: The aim of this study is to find the prosthetic status and need of 65–74 years old elderly residing in old age homes of Delhi, India. Settings and Design: A cross-sectional study was conducted among a total of 464 residents of 20 old age homes of Delhi, India. Material and Methods: Residents with age group of 64–75 were included in the study. The prosthetic status with treatment need was recorded using the World Health Organization Oral Health Assessment Form (1997. Statistical Analysis Used: Chi-square test and t-test were used to find significance of variables. P < 0.05 was considered significant. Results: Full removable dentures were worn by 7.30% of participants with predominance in upper arch, and one bridge was seen in 9.10% of participants with predominance in lower arch. Full removable denture was required in 25.20% of participants. Most of participants required multiunit prosthesis in both upper as well as lower arch (42.20% and 36.20%, respectively. Conclusion: The present study underlines a considerable need for dental treatment in elderly as the prosthetic status of participants was poor, and prosthetic needs were high.

Prosthetic Smart Socket Technology to Improve Patient Interaction, Usability, Comfort, Fit and Function

Science.gov (United States)

2017-10-01

impact on society beyond science and technology ? Nothing to report at this time. 5. CHANGES/PROBLEMS: Changes in approach and reasons for...AWARD NUMBER: W81XWH-16-1-0785 TITLE: Prosthetic Smart Socket Technology to Improve Patient Interaction, Usability, Comfort, Fit and Function...2016 - 29 Sep 2017 4. TITLE AND SUBTITLE Prosthetic Smart Socket Technology to Improve Patient Interaction, Usability, Comfort, Fit and Function 5a

From satisfaction to expectation: the patient's perspective in lower limb prosthetic care.

Science.gov (United States)

Van der Linde, Harmen; Hofstad, Cheriel J; Geertzen, Jan H B; Postema, Klaas; Van Limbeek, Jacques

2007-07-15

To obtain information about the wishes and experiences of patients with a lower limb amputation with regard to prosthetic prescription and their exchange of information with the healthcare providers. Cross-sectional questionnaire. Outpatient clinic of a Rehabilitation Centre. A random sample of patients with a lower limb amputation (n = 81). In analogy with the QUOTE questionnaire a focus group technique was used. Prosthetic users formulated 24 specific items, which were of importance according to them. The items were divided into 4 categories: (i) service demand, (ii) prosthetic prescription, (iii) information, (iv) insurance aspects. The questionnaire consisted of two sets (A and B) of 24 items rating importance of items and experience in everyday practice. To identify different dimensions within the 24 items, a factor analysis in SPSS was performed for lists A and B followed by a varimax rotation. Impact factors were calculated by multiplying the mean score of importance on an item with the percentage of patients that experienced this item as negative. A total of 113 questionnaires were sent by e-mail with a response of 73%. The outcomes of the questionnaires resulted in 2 sets of information: One concerning the importance of several items in the process of prosthetic prescription, the other the experience of the prosthetic user about those items. By multiplying the scores on importance by the percentage of negative experience per item (impact score) points of improvement for clinical practice were formulated. A discrepancy between the needs of patients and what they experience in their contacts with clinical professionals as the most important dimension was noticed. A questionnaire with specific items for a homogeneous target group is a good method to formulate points of improvement for clinical practice in healthcare.

Object discrimination using optimized multi-frequency auditory cross-modal haptic feedback.

Science.gov (United States)

Gibson, Alison; Artemiadis, Panagiotis

2014-01-01

As the field of brain-machine interfaces and neuro-prosthetics continues to grow, there is a high need for sensor and actuation mechanisms that can provide haptic feedback to the user. Current technologies employ expensive, invasive and often inefficient force feedback methods, resulting in an unrealistic solution for individuals who rely on these devices. This paper responds through the development, integration and analysis of a novel feedback architecture where haptic information during the neural control of a prosthetic hand is perceived through multi-frequency auditory signals. Through representing force magnitude with volume and force location with frequency, the feedback architecture can translate the haptic experiences of a robotic end effector into the alternative sensory modality of sound. Previous research with the proposed cross-modal feedback method confirmed its learnability, so the current work aimed to investigate which frequency map (i.e. frequency-specific locations on the hand) is optimal in helping users distinguish between hand-held objects and tasks associated with them. After short use with the cross-modal feedback during the electromyographic (EMG) control of a prosthetic hand, testing results show that users are able to use audial feedback alone to discriminate between everyday objects. While users showed adaptation to three different frequency maps, the simplest map containing only two frequencies was found to be the most useful in discriminating between objects. This outcome provides support for the feasibility and practicality of the cross-modal feedback method during the neural control of prosthetics.

SU-F-T-347: An Absolute Dose-Volume Constraint Based Deterministic Optimization Framework for Multi-Co60 Source Focused Radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Liang, B; Liu, B; Li, Y; Guo, B; Xu, X; Wei, R; Zhou, F [Beihang University, Beijing, Beijing (China); Wu, Q [Duke University Medical Center, Durham, NC (United States)

2016-06-15

Purpose: Treatment plan optimization in multi-Co60 source focused radiotherapy with multiple isocenters is challenging, because dose distribution is normalized to maximum dose during optimization and evaluation. The objective functions are traditionally defined based on relative dosimetric distribution. This study presents an alternative absolute dose-volume constraint (ADC) based deterministic optimization framework (ADC-DOF). Methods: The initial isocenters are placed on the eroded target surface. Collimator size is chosen based on the area of 2D contour on corresponding axial slice. The isocenter spacing is determined by adjacent collimator sizes. The weights are optimized by minimizing the deviation from ADCs using the steepest descent technique. An iterative procedure is developed to reduce the number of isocenters, where the isocenter with lowest weight is removed without affecting plan quality. The ADC-DOF is compared with the genetic algorithm (GA) using the same arbitrary shaped target (254cc), with a 15mm margin ring structure representing normal tissues. Results: For ADC-DOF, the ADCs imposed on target and ring are (D100>10Gy, D50,10, 0<12Gy, 15Gy and 20Gy) and (D40<10Gy). The resulting D100, 50, 10, 0 and D40 are (9.9Gy, 12.0Gy, 14.1Gy and 16.2Gy) and (10.2Gy). The objectives of GA are to maximize 50% isodose target coverage (TC) while minimize the dose delivered to the ring structure, which results in 97% TC and 47.2% average dose in ring structure. For ADC-DOF (GA) techniques, 20 out of 38 (10 out of 12) initial isocenters are used in the final plan, and the computation time is 8.7s (412.2s) on an i5 computer. Conclusion: We have developed a new optimization technique using ADC and deterministic optimization. Compared with GA, ADC-DOF uses more isocenters but is faster and more robust, and achieves a better conformity. For future work, we will focus on developing a more effective mechanism for initial isocenter determination.

Obstructed bi-leaflet prosthetic mitral valve imaging with real-time three-dimensional transesophageal echocardiography.

Science.gov (United States)

Shimbo, Mai; Watanabe, Hiroyuki; Kimura, Shunsuke; Terada, Mai; Iino, Takako; Iino, Kenji; Ito, Hiroshi

2015-01-01

Real-time three-dimensional transesophageal echocardiography (RT3D-TEE) can provide unique visualization and better understanding of the relationship among cardiac structures. Here, we report the case of an 85-year-old woman with an obstructed mitral prosthetic valve diagnosed promptly by RT3D-TEE, which clearly showed a leaflet stuck in the closed position. The opening and closing angles of the valve leaflets measured by RT3D-TEE were compatible with those measured by fluoroscopy. Moreover, RT3D-TEE revealed, in the ring of the prosthetic valve, thrombi that were not visible on fluoroscopy. RT3D-TEE might be a valuable diagnostic technique for prosthetic mitral valve thrombosis. © 2014 Wiley Periodicals, Inc.

Can we close large prosthetic space with orthodontics?

Science.gov (United States)

Mesko, Mauro Elias; Skupien, Jovito Adiel; Valentini, Fernanda; Pereira-Cenci, Tatiana

2013-01-01

For years, the treatment for the replacement of a missing tooth was a fixed dental prosthesis. Currently, implants are indicated to replace missing teeth due to high clinical success and with the advantage of not performing preparations in the adjacent tooth. Another option for space closure is the use of orthodontics associated to miniscrews for anchorage allowing better control of the orthodontic biomechanics and especially making possible closure of larger prosthetic spaces. Thus, this article describes two cases with indications and discussion of the advantages and disadvantages of using orthodontics for prosthetic spaces closure. The cases herein presented show that it is possible to close an space when there are available teeth in the adjacent area. It can be concluded that when a malocclusion is present there will be a strong trend to indicate space closure by orthodontic movement as it preserves natural teeth and seems a more physiological approach.

The History of Nontraditional or Ectopic Placement of Reservoirs in Prosthetic Urology.

Science.gov (United States)

Perito, Paul; Wilson, Steven

2016-04-01

Reservoir placement during implantation of prosthetic urology devices has been problematic throughout the history of the surgical treatment of erectile dysfunction and urinary incontinence. We thought it would be interesting to review the history of reservoir placement leading up to current surgical techniques. To provide an overview of the past and present techniques for reservoir placement and discuss the evolutionary process leading to safe and effective placement of prosthetic reservoirs. We reviewed data pertaining to inflatable penile prosthesis (IPP) reservoirs and pressure-regulating balloons (PRB) in a chronological fashion, spanning 25 years. Main outcomes included a historical review of techniques for IPP reservoir and PRB placement leading to the subsequent incremental improvements in safety and efficacy when performing penile implants and artificial urinary sphincters. Prosthetic urologic reservoirs have traditionally been placed in the retropubic space. Over the years, urologists have attempted use of alternative spaces including peritoneal, epigastric, "ectopic," posterior to transversalis, and high submuscular. Current advances in prosthetic urologic reservoir placement allow safe and effective abdominal wall placement of reservoirs. These novel approaches appear to be so effective that urologists may now be able to cease using the traditional retropubic space for reservoir placement, even in the case of virgin pelves. Copyright © 2016 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

A Control Strategy with Tactile Perception Feedback for EMG Prosthetic Hand

Directory of Open Access Journals (Sweden)

Changcheng Wu

2015-01-01

Full Text Available To improve the control effectiveness and make the prosthetic hand not only controllable but also perceivable, an EMG prosthetic hand control strategy was proposed in this paper. The control strategy consists of EMG self-learning motion recognition, backstepping controller with stiffness fuzzy observation, and force tactile representation. EMG self-learning motion recognition is used to reduce the influence on EMG signals caused by the uncertainty of the contacting position of the EMG sensors. Backstepping controller with stiffness fuzzy observation is used to realize the position control and grasp force control. Velocity proportional control in free space and grasp force tracking control in restricted space can be realized by the same controller. The force tactile representation helps the user perceive the states of the prosthetic hand. Several experiments were implemented to verify the effect of the proposed control strategy. The results indicate that the proposed strategy has effectiveness. During the experiments, the comments of the participants show that the proposed strategy is a better choice for amputees because of the improved controllability and perceptibility.

Multi-technology Integration Based on Low-contrast Microscopic Image Enhancement

Directory of Open Access Journals (Sweden)

Haoge Ma

2014-01-01

Full Text Available Microscopic image enhancement is an important issue of image processing technique, which is used to improve the visual quality of image. This paper describes a novel multi resolution image segmentation algorithm for low DOF images. The algorithm is designed to separate a sharply focused object of interest from other foreground or background objects. The algorithm is fully automatic in that all parameters are image in dependent. A multiscale-approach based on high frequency wavelet coefficients and their statistics is used to perform context dependent classification of individual blocks of the image. Compared with the state of the art algorithms, this new algorithm provides better accuracy at higher speed.

[Microbiological characteristics and patterns of resistance in prosthetic joint infections in a referral hospital].

Science.gov (United States)

Ortega-Peña, Silvestre; Colín-Castro, Claudia; Hernández-Duran, Melissa; López-Jácome, Esaú; Franco-Cendejas, Rafael

2015-01-01

The prosthetic joint infection is the most feared and catastrophic complication for cause severe physical damage to patients and, generates high economic costs. To describe the microbiological characteristics and to determine the resistance pattern in prosthetic joint infections in a reference hospital in Mexico. Patients whose prosthetic devices were withdrawn due to suspicion of septic and aseptic loosening were included. Cultures were performed to identify microorganisms and susceptibility analysis. Of the 111 patients included, 55% were diagnosed with prosthetic joint infection, with the most frequent prosthesis being of the hip (43%). Positive cultures were obtained in 97% of the infected cases, of which 75% were monomicrobial infections. The most frequent bacterial species isolated were: Staphylococcus epidermidis (31%), Enterococcus faecalis (16%), Staphylococcus aureus (13%), and Escherichia coli (8%). The resistance patterns for the Staphylococcus genus were: oxacillin (79%), erythromycin (45%) and ciprofloxacin (37%). Enterococcus faecalis showed a high percentage of resistance to erythromycin and clindamycin (86%), and fluoroquinolones (43%). The large majority (86%) of Escherichia coli were extended spectrum beta-lactamases positive, in addition to having high resistance to fluoroquinolones (86%), trimethoprim/sulfamethoxazole (86%) and gentamicin (72%). The microbiological characteristics found in prosthetic joint infections vary according to the hospitals. In this series, a high proportion of coagulase-negative Staphylococci and Enterococcus spp. were found, as well as a high bacterial resistance. Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

Prosthetic joint infection caused by Granulicatella adiacens: a case series and review of literature.

Science.gov (United States)

Quénard, Fanny; Seng, Piseth; Lagier, Jean-Christophe; Fenollar, Florence; Stein, Andreas

2017-06-23

Bone and joint infection involving Granulicatella adiacens is rare, and mainly involved in cases of bacteremia and infectious endocarditis. Here we report three cases of prosthetic joint infection involving G. adiacens that were successfully treated with surgery and prolonged antimicrobial treatment. We also review the two cases of prosthetic joint infection involving G. adiacens that are reported in the literature. Not all five cases of prosthetic joint infection caused by G. adiacens were associated with bacteremia or infectious endocarditis. Dental care before the onset of infection was observed in two cases. The median time delay between arthroplasty implantation and the onset of infection was of 4 years (ranging between 2 and 10 years). One of our cases was identified with 16srRNA gene sequencing, one case with MALDI-TOF mass spectrometry, and one case with both techniques. Two literature cases were diagnosed by 16srRNA gene sequencing. All five cases were cured after surgery including a two-stage prosthesis exchange in three cases, a one-stage prosthesis exchange in one case, and debridement, antibiotics, irrigation, and retention of the prosthesis in one case, and prolonged antimicrobial treatment. Prosthetic joint infection involving G. adiacens is probably often dismissed due to difficult culture or misdiagnosis, in particular in the cases of polymicrobial infection. Debridement, antibiotics, irrigation, and retention of the prosthesis associated with prolonged antimicrobial treatment (≥ 8 weeks) should be considered as a treatment strategy for prosthetic joint infection involving G. adiacens.

Implementation of impedance trajectory control on a 6-DoF manipulator

Directory of Open Access Journals (Sweden)

Shardyko Igor

2018-01-01

Full Text Available Aiming at enhancing the performance of a robotic system, i.e. of a robot manipulator, it is extremely important to ensure the safety of its functioning and the convenience of operating it. Special attention is required if there is a possibility of a collision, especially with costly equipment or with a person. Among the different means and approaches to prevent or react to such situations, implementation of forcetorque control is considered in this paper. A trajectory task is analysed and an impedance control law is employed to achieve the desired robot behaviour. The effectiveness of the approach has been verified by using a 6-DoF elbow manipulator to perform two types of operations: a peg-in-hole task and path execution with obstacles on the way.

Development of a 6 DOF force-reflecting master input device

International Nuclear Information System (INIS)

Yoon, Ji Sup; Yoon, Ho Sik

1999-05-01

The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis) is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 figs

Development of a 6 DOF force-reflecting master input device

Energy Technology Data Exchange (ETDEWEB)

Yoon, Ji Sup; Yoon, Ho Sik

1999-05-01

The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.

Development of a 6 DOF force-reflecting master input device

Energy Technology Data Exchange (ETDEWEB)

Yoon, Ji Sup; Yoon, Ho Sik

1999-05-01

The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.

[Intra-prosthetic dislocation of the Bousquet dual mobility socket].

Science.gov (United States)

Lecuire, F; Benareau, I; Rubini, J; Basso, M

2004-05-01

The Bousquet system is a dual mobility head-polyethylene polyethylene-metal cup socket. The polyethylene insert retaining the femoral head moves in the noncemented metal cup, increasing both mobility and stability. Between 1989 and 1997, seven cases of intra-prosthetic dislocation (six patients) were observed. The femoral head escaped from the polyethylene insert due to wear. On the average, this complication occurred ten Years after implantation. Risk of dislocation was high in six of the seven hips. All patients had a large sized stem screwed into the femoral neck. There was a characteristic radiological aspect with loss of the concentric head metal cup configuration. The head was applied against the upper wall of the metal cup. Surgical replacement was undertaken early in six patients by simply changing the insert without modifying the other stable components. Outcome remained good at three to eight Years. One patient underwent late surgery. The insert and the cup were replaced with a classical implant. Functional outcome was good but recurrent dislocation occurred. At mid-term, intra-prosthetic dislocation of dual mobility sockets appears to be exceptional. Dislocation results from polyethylene wear leading to failure of the insert to retain the prosthetic head. Wear is favored by direct phenomena (direct contact between neck and insert which can occur early if there is a small difference in the head and neck diameters) or indirect phenomena (factors limiting polyethylene metal-cup mobility). Surgical treatment is necessary. If undertaken early, replacement with a modular head and insert can be sufficient if the prosthesis has not loosened but the metal cup may have to be replaced in the event of metal-metal contact between the head and the cup. Prosthesis loosening, wear of the metal cup, or an identified cause of dislocation imply replacing the failing implants. Implantation of the dual mobility system is particularly interesting for patients with a high risk

Extrinsic mechanism obstructing the opening of a prosthetic mitral valve: an unusual case of suture entrapment.

Science.gov (United States)

Ozkan, Mehmet; Astarcioglu, Mehmet Ali; Karakoyun, Suleyman; Balkanay, Mehmet

2012-02-01

Obstruction to a prosthetic cardiac valve is a well-recognized complication of cardiac valve replacement. Malfunction of the mobile component of a prosthetic valve to open or close correctly may occur in consequence of intrinsic or extrinsic causes (thrombus, vegetation, entrapment of left ventricular myocardium, suture entanglement, and pannus formation) that may result prosthetic valve stenosis and/or insufficiency. In the case we report a 48-year-old female with valve dysfunction occurred early after surgery, as one valve leaflet was only able to partially open due to suture entrapment. © 2011, Wiley Periodicals, Inc.

Prosthetic Management of Patients Presenting with Juvenile ...

African Journals Online (AJOL)

Eighteen were referred for prosthetic replacement. Their age ranged between 18 and 36 years. A total of 24 removable partial dentures were fabricated, 17[70.8%] were kennedy class III type, of which 11[64.7%] had the bounded saddle located in the anterior segment. Majority 8[44.4%] of the patients had 2-4 teeth replaced ...

Pseudotumor of the Hip due to Fungal Prosthetic Joint Infection

Directory of Open Access Journals (Sweden)

Stefano Artiaco

2013-01-01

Full Text Available Pseudotumors associated with total hip arthroplasty have been associated with metal-on-metal and metal-on-polyethylene total hip arthroplasties due to a granulomatous foreign-body reaction to methyl methacrylate, polyethylene, or metal ion release, but they have not been related to prosthetic joint infections. In this paper, we report an unusual case of Candida albicans total hip arthroplasty infection, causing a large inflammatory pseudotumor of the hip joint. Fungal periprosthetic joint infections are a rare clinical entity and difficult to diagnose, and a pseudotumor may be part of their clinical presentation. They should be suspected in immunodeficient host patients when clinical symptoms of prosthetic joint infections are observed.

Retrieval of a leaflet escaped in a Tri-technologies bileaflet mechanical prosthetic valve.

Science.gov (United States)

Cianciulli, Tomás F; Lax, Jorge A; Saccheri, María C; Guidoin, Robert; Salvado, César M; Fernández, Adrián J; Prezioso, Horacio A

2008-01-01

The escape of the prosthetic heart valve disc is one of the causes of prosthetic dysfunction that requires emergency surgery. The removal of the embolized disc should be carried out because of the risk of a progressive extrusion on the aortic wall. Several imaging techniques can be used for the detection of the missing disc localization. In this report we describe a 32-year-old man who underwent mitral valve replacement with a Tri-technologies bileaflet valve three years ago, and was admitted in cardiogenic shock. Transesophageal echocardiography showed acute-onset massive mitral regurgitation. The patient underwent emergency replacement of the prosthetic valve. Only one of the two leaflets remained in the removed prosthetic valve. The missing leaflet could not be found within the cardiac cavity. The abdominal fluoroscopic study and plain radiography were unable to detect the escaped leaflet. The abdominal computed tomography scan and the ultrasound showed the escaped leaflet in the terminal portion of the aortic bifurcation. To retrieve the embolized disc laparotomy and aortotomy were performed three months later. The escaped leaflet shows a fracture of one of the pivot systems caused by structural failure. This kind of failure mode is usually the result of high stress concentration.

Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

OpenAIRE

B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

2016-01-01

We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

Scintigraphic detection of prosthetic joint and soft tissue sepsis secondary to tuberculosis

International Nuclear Information System (INIS)

Zeiger, L.S.; Watters, W.; Sherk, H.

1984-01-01

In a 40-year-old Hispanic woman with pain and swelling in the left knee with a prosthesis, the combination of Ga-67 citrate and Tc-99m methylene diphosphonate (MDP) scans was used to indicate that there was a septic prosthetic joint. At surgery, the joint was infected and a foreign body was found. Cultures positive for tuberculosis were found also. The presence of an incongruent Ga-67 and Tc-99m (MDP) scan pattern suggests infection of the prosthetic joint, as in the following case

Prosthetic prescription in the Netherlands : an observational study

NARCIS (Netherlands)

van der Linde, H; Geertzen, JHB; Hofstad, CJ; Postema, K; Van Limbeek, Jacques

2003-01-01

Prosthetic prescription for lower limb amputees and the methodology used are primarily based on empirical knowledge. Clinical expertise plays an important role that can lead to an adequate prescription; however, a clear evidence based motivation for the choices made cannot be given. This can lead to

Resource-efficient proces chains to manufacture patient-specific prosthetic fingers

Directory of Open Access Journals (Sweden)

Hagedorn-Hansen, D.

2016-05-01

Full Text Available The high cost of quality prostheses, together with the lack of trained prosthetists, makes it challenging to obtain prosthetic devices in developing communities. Modern 3D digitising techniques and additive manufacturing (AM technologies are gaining popularity in the bio-medical industry and, in the case of prosthesis production, reduce the need for a trained prosthetist. The objective of this research was to develop a new resource-efficient process chain for the manufacturing of prosthetic fingers using additive manufacturing technologies, and to compare it with the traditional (Sculptor process chain. Fused deposition modelling (FDM, open-source FDM, 3-dimensional printing (3DP, and stereolithography (SLA were evaluated in terms of their costs, time, material usage, and aesthetic quality. The surface qualities produced with the different additive manufacturing technologies were also compared. The results showed that 3DP was the preferred technology and was the best candidate for the production of prosthesis in terms of cost, quality, and time for developing communities. SLA produced the highest aesthetic quality prosthesis, but was the most expensive. It was concluded that using the additive manufacturing technology process chain to produce prosthetic fingers is faster and more cost effective than the traditional method.

Simulation Techniques and Prosthetic Approach Towards Biologically Efficient Artificial Sense Organs- An Overview

OpenAIRE

Neogi, Biswarup; Ghosal, Soumya; Mukherjee, Soumyajit; Das, Achintya; Tibarewala, D. N.

2011-01-01

An overview of the applications of control theory to prosthetic sense organs including the senses of vision, taste and odor is being presented in this paper. Simulation aspect nowadays has been the centre of research in the field of prosthesis. There have been various successful applications of prosthetic organs, in case of natural biological organs dis-functioning patients. Simulation aspects and control modeling are indispensible for knowing system performance, and to generate an original a...

The use of ceramic in prosthetic hip surgery. The state of the art.

Science.gov (United States)

Toni, A; Terzi, S; Sudanese, A; Tabarroni, M; Zappoli, F A; Stea, S; Giunti, A

1995-01-01

The authors review current knowledge regarding the use of ceramic materials in prosthetic hip surgery, both as constituents of prosthetic components, and as materials used to coat metallic surfaces. A review of the literature defines the advantages and disadvantages to using ceramic-polyethylene or ceramic-ceramic combinations, based on the possibility that alumina coating may favor localized bone demineralization, and on the first promising clinical results of the use of hydroxyapatite coating.

Cyborg beast: a low-cost 3d-printed prosthetic hand for children with upper-limb differences.

Science.gov (United States)

Zuniga, Jorge; Katsavelis, Dimitrios; Peck, Jean; Stollberg, John; Petrykowski, Marc; Carson, Adam; Fernandez, Cristina

2015-01-20

There is an increasing number of children with traumatic and congenital hand amputations or reductions. Children's prosthetic needs are complex due to their small size, constant growth, and psychosocial development. Families' financial resources play a crucial role in the prescription of prostheses for their children, especially when private insurance and public funding are insufficient. Electric-powered (i.e., myoelectric) and body-powered (i.e., mechanical) devices have been developed to accommodate children's needs, but the cost of maintenance and replacement represents an obstacle for many families. Due to the complexity and high cost of these prosthetic hands, they are not accessible to children from low-income, uninsured families or to children from developing countries. Advancements in computer-aided design (CAD) programs, additive manufacturing, and image editing software offer the possibility of designing, printing, and fitting prosthetic hands devices at a distance and at very low cost. The purpose of this preliminary investigation was to describe a low-cost three-dimensional (3D)-printed prosthetic hand for children with upper-limb reductions and to propose a prosthesis fitting methodology that can be performed at a distance. No significant mean differences were found between the anthropometric and range of motion measurements taken directly from the upper limbs of subjects versus those extracted from photographs. The Bland and Altman plots show no major bias and narrow limits of agreements for lengths and widths and small bias and wider limits of agreements for the range of motion measurements. The main finding of the survey was that our prosthetic device may have a significant potential to positively impact quality of life and daily usage, and can be incorporated in several activities at home and in school. This investigation describes a low-cost 3D-printed prosthetic hand for children and proposes a distance fitting procedure. The Cyborg Beast

Indium-granulocyte scanning in the painful prosthetic joint

International Nuclear Information System (INIS)

Pring, D.J.; Henderson, R.G.; Keshavarzian, A.; Rivett, A.G.; Krausz, T.; Coombs, R.R.; Lavender, J.P.

1986-01-01

The value of indium-111-labeled granulocyte scanning to determine the presence of infection was assessed in 50 prosthetic joints (41 of which were painful) in 40 patients. Granulocytes were obtained from the patients' blood and labeled in plasma with indium 111 tropolonate. Abnormal accumulation of indium 111 in the region of the prosthesis was noted. Proven infection occurred in 11 prostheses, and all of the infections were detected by indium-111-labeled granulocyte scanning. Nineteen were not infected (including nine asymptomatic controls) and only two produced false-positive scans. This represents a specificity of 89.5%, sensitivity of 100%, and overall accuracy of 93.2%. These results compare favorably with plain radiography. There was no radiologic evidence of infection in three of the infected prostheses, and 10 of the noninfected prostheses had some radiologic features that suggested sepsis. We conclude that indium-granulocyte scanning can reliably detect or exclude infection in painful prosthetic joints and should prove useful in clinical management

CT Assessment of the axial deviation of the femoral and tibial prosthetic components in total knee arthroplasty

International Nuclear Information System (INIS)

Rimondi, E.; Molinari, M.; Moio, A.; Busacca, M.; Trentani, F.; Trentani, P.; Tigani, D.; Nigrosoli, M.

2000-01-01

CT assessment of the axial deviation of the femoral and tibial prosthetic components in total knee arthroplasty. From January to July 1999, 17 patients, 10 males and 7 females, mean age 66 years (standard deviation plus or minus 4) were examined after total knee arthroplasty. Exclusion criteriawere prosthesis loosening and severe (equal or superior to 7'' varus o valgus deviation. All patients were examined with knee radiography in the standing position completed by axial projection of patella and by CT scanning. It was used a modification of Berger technique and carried out comparative CT scans extended lower limbs and acquisitions perpendicular to the mechanical axis of the knee, from the femoral supracondylar region down to the plane crossing the distal end of the tibial prosthetic component. Reference lines were then drawn electronically on given scanning planes to reckon the axial deviation of the femoral and tibial prosthetic components. Six patients, one female and 5 males with normal rotational values of femoral and tibial prosthetic components presented no clinical symptoms. Eight patients, 4 females and 4 males, with abnormal values presented the following clinical symptoms: medial impingement, (incomplete) dislocation patella, and lateral instability. One female patient with a normal rotational value of femoral prosthetic component and an altered value of tibial prosthetic component presented medial impingement. Finally two patients, one female and one male, were absolutely asymptomatic although the rotational values of the two prosthetic components were beyond the normal range. Total knee arthroplasty is presently a standard treatment for many conditions involving this joint. There are several possible postoperative complications, namely fractures, dislocations (a)septic losening and femoropatellar instability. The latter condition is the most frequent complication among implant failures and is caused by bad orientation of the femoral and tibial

Orthodontic space closure versus prosthetic replacement of missing upper lateral incisors in patients with bilateral cleft lip and palate.

Science.gov (United States)

Oosterkamp, Barbara C M; Dijkstra, Pieter U; Remmelink, Hendrik J; van Oort, Robert P; Sandham, Andrew

2010-11-01

To compare dental aesthetics and function of orthodontic space closure versus prosthetic replacement of upper lateral incisors in patients with bilateral cleft lip and palate. The predominant mode of prosthetic replacement was resin-bonded bridges. The retrospective study group consisted of 17 patients treated with orthodontic space closure (13 men, four women; median age, 27.1 years; interquartile range, 20.6 to 33.3 years) and 10 patients treated with prosthetic replacement (five men, five women; median age, 27.7 years; interquartile range, 20.9 to 39.7 years). Dental aesthetics were evaluated by the patients and by a professional panel. Mandibular function was evaluated by means of the mandibular function impairment questionnaire. The level of mandibular impairment was calculated using the Function Impairment Rating Scale. With respect to dental aesthetics, no significant differences between patients treated with orthodontic space closure and prosthetic replacement were found. With respect to function, the level of mandibular impairment was significantly higher in patients treated with prosthetic replacement compared with patients treated with orthodontic space closure, as indicated by high scores on specific masticatory functions. Orthodontic space closure and prosthetic replacement in bilateral cleft lip and palate patients produce similar results in terms of aesthetics. In terms of function, prosthetic replacement results in significantly more impairment of specific masticatory functions.

Comparative study of radiography and scintigraphy for loosening and infection of prosthetic hip replacement

International Nuclear Information System (INIS)

Park, Mi Sook; Lee, Sun Wha; Choi, Woo Suk; Lim, Joo Won; Song, Han Joon; Ahn, Chi Yul

1987-01-01

Prosthetic hip replacement is associated with certain complications which result in a painful hip. Many of these, e. g. prosthetic dislocation, fracture, trochanteric avulsion, and heterotopic calcification are easily diagnosed by conventional radiography. However, radiographic evaluation for infection and/pr loosening of prosthesis as major complications requiring reoperation often contributes little to the resolution of the diagnostic problem. The authors made a comparative study of plain radiography and scintigraphy of 39 cases performed revision at Kyung Hee University Hospital from Sep. '81-to Aug. '86. The results were as follows: 1. In 39 revised prosthetic hip replacement, 26 cases (67%) of loosening without infection and 11 cases (28%) of infection were proven. 2. In loosening of prosthesis, plain radiography showed true positive rate of 76% and true negative rate of 60%, and scintigraphy showed true positive rate of 75% and true negative rate of 95%. 3. In infection of prosthesis, plain radiography revealed true positive rate of 55% and true negative rate of 96%, and scintigraphy revealed true positive rate of 100% and true negative rate of 83%. 4. Scintigraphy and plain radiography were useful as complementary procedure in evaluating and differentiating loosening and/or infection of prosthetic component

The effects of common footwear on stance-phase mechanical properties of the prosthetic foot-shoe system.

Science.gov (United States)

Major, Matthew J; Scham, Joel; Orendurff, Michael

2018-04-01

Prosthetic feet are prescribed based on their mechanical function and user functional level. Subtle changes to the stiffness and hysteresis of heel, midfoot, and forefoot regions can influence the dynamics and economy of gait in prosthesis users. However, the user's choice of shoes may alter the prosthetic foot-shoe system mechanical characteristics, compromising carefully prescribed and rigorously engineered performance of feet. Observe the effects of footwear on the mechanical properties of the prosthetic foot-shoe system including commonly prescribed prosthetic feet. Repeated-measures, Mechanical characterization. The stiffness and energy return was measured using a hydraulic-driven materials test machine across combinations of five prosthetic feet and four common shoes as well as a barefoot condition. Heel energy return decreased by an average 4%-9% across feet in all shoes compared to barefoot, with a cushioned trainer displaying the greatest effect. Foot designs that may improve perceived stability by providing low heel stiffness and rapid foot-flat were compromised by the addition of shoes. Shoes altered prosthesis mechanical characteristics in the sagittal and frontal planes, suggesting that shoe type should be controlled or reported in research comparing prostheses. Understanding of how different shoes could alter certain gait-related characteristics of prostheses may aid decisions on footwear made by clinicians and prosthesis users. Clinical relevance Shoes can alter function of the prosthetic foot-shoe system in unexpected and sometimes undesirable ways, often causing similar behavior across setups despite differences in foot design, and prescribing clinicians should carefully consider these effects on prosthesis performance.

Tactile Sensing Reflexes for Advanced Prosthetic Hands

Science.gov (United States)

2016-10-01

Jeremy A. Fishel, Member, IEEE Figure 1. A) Custom NumaTac prosthetic fingertip sensor core and foam; B) Ottobock VariPlus Speed hand installed with two...oal – H ardw are P rototype D evelopm ent R   Identify alternatives for outcom e m easures R   E xplore sensor design param eters C Y16 G oals – C

Prosthetic finger phalanges with lifelike skin compliance for low-force social touching interactions

Directory of Open Access Journals (Sweden)

Ge Shuzhi

2011-03-01

Full Text Available Abstract Background Prosthetic arms and hands that can be controlled by the user's electromyography (EMG signals are emerging. Eventually, these advanced prosthetic devices will be expected to touch and be touched by other people. As realistic as they may look, the currently available prosthetic hands have physical properties that are still far from the characteristics of human skins because they are much stiffer. In this paper, different configurations of synthetic finger phalanges have been investigated for their skin compliance behaviour and have been compared with the phalanges of the human fingers and a phalanx from a commercially available prosthetic hand. Methods Handshake tests were performed to identify which areas on the human hand experience high contact forces. After these areas were determined, experiments were done on selected areas using an indenting probe to obtain the force-displacement curves. Finite element simulations were used to compare the force-displacement results of the synthetic finger phalanx designs with that of the experimental results from the human and prosthetic finger phalanges. The simulation models were used to investigate the effects of (a varying the internal topology of the finger phalanx and (b varying different materials for the internal and external layers. Results and Conclusions During handshake, the high magnitudes of contact forces were observed at the areas where the full grasping enclosure of the other person's hand can be achieved. From these areas, the middle phalanges of the (a little, (b ring, and (c middle fingers were selected. The indentation experiments on these areas showed that a 2 N force corresponds to skin tissue displacements of more than 2 mm. The results from the simulation model show that introducing an open pocket with 2 mm height on the internal structure of synthetic finger phalanges increased the skin compliance of the silicone material to 235% and the polyurethane material to

METHODOLOGY OF PROSTHETIC TREATMENT IN PATIENTS WITH MAXILLECTOMY

Directory of Open Access Journals (Sweden)

Ivan Gerdzhikov

2018-06-01

Full Text Available Aim: The aim of the described method is to present the main stages in the prosthetic treatment with hollow bulb obturator, which provides optimum defect hermetization and restoration of the damaged functions. Materials and methods: The clinical case, described is on a 70-years-old patient with edentulous jaws and maxillary defect in the right half of the upper jaw. The preliminary impressions were taken with irreversible hydrocolloid impression material, and the final impressions were taken with additive silicone material. The occlusion height and the centric relations were registered as the classical technique. After the successful trial denture appointment, the surface of the plaster master model was covered by isolation polish. After this procedure, the master model was covered by even wax layer with 5mm thickness. It was designed to be thinner in the area of the resection line. The designed cavity was filled in with silicone impression material and covered with the folio. The base plate with the arranged teeth was fixed to the model, packed in the cuvette and finished from heat-cured acrylic resin with low quantity of residual monomer. After the polymerization process, the silicone material was removed, and the obturators cap was fixed to the denture’s base plate with cold cured acrylic resin. The obturator and the complete denture of the mandible were adjusted and articulated in patient’s mouth in the final clinical stage. Results: The applied prosthetic method allowed successful defect hermetization and helped for the restoration of the speech, feeding and patient’s self-esteem. Conclusion: Prosthetic rehabilitation of patients with maxillary resection is possible only with the application of specific treatment methods.

Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

Directory of Open Access Journals (Sweden)

B Dhawan

2016-01-01

Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

Prosthesis use in adult acquired major upper-limb amputees: patterns of wear, prosthetic skills and the actual use of prostheses in activities of daily life.

Science.gov (United States)

Østlie, Kristin; Lesjø, Ingrid Marie; Franklin, Rosemary Joy; Garfelt, Beate; Skjeldal, Ola Hunsbeth; Magnus, Per

2012-11-01

To describe patterns of prosthesis wear and perceived prosthetic usefulness in adult acquired upper-limb amputees (ULAs). To describe prosthetic skills in activities of daily life (ADL) and the actual use of prostheses in the performance of ADL tasks. To estimate the influence of prosthetic skills on actual prosthesis use and the influence of background factors on prosthetic skills and actual prosthesis use. Cross-sectional study analysing population-based questionnaire data (n = 224) and data from interviews and clinical testing in a referred/convenience sample of prosthesis-wearing ULAs (n = 50). Effects were analysed using linear regression. 80.8% wore prostheses. 90.3% reported their most worn prosthesis as useful. Prosthetic usefulness profiles varied with prosthetic type. Despite demonstrating good prosthetic skills, the amputees reported actual prosthesis use in only about half of the ADL tasks performed in everyday life. In unilateral amputees, increased actual use was associated with sufficient prosthetic training and with the use of myoelectric vs cosmetic prostheses, regardless of amputation level. Prosthetic skills did not affect actual prosthesis use. No background factors showed significant effect on prosthetic skills. Most major ULAs wear prostheses. Individualised prosthetic training and fitting of myoelectric rather than passive prostheses may increase actual prosthesis use in ADL.

Multi-sensor control for precise assembly of optical components

Directory of Open Access Journals (Sweden)

Ma Li

2014-06-01

Full Text Available In order to perform an optical assembly accurately, a multi-sensor control strategy is developed which includes an attitude measurement system, a vision system, a loss measurement system and a force sensor. A 3-DOF attitude measuring method using linear variable differential transformers (LVDT is designed to adjust the relation of position and attitude between the spherical mirror and the resonator. A micro vision feedback system is set up to extract the light beam and the diaphragm, which can achieve the coarse positioning of the spherical mirror in the optical assembly process. A rapid self-correlation method is presented to analyze the spectrum signal for the fine positioning. In order to prevent the damage of the optical components and realize sealing of the resonator, a hybrid force-position control is constructed to control the contact force of the optical components. The experimental results show that the proposed multi-sensor control strategy succeeds in accomplishing the precise assembly of the optical components, which consists of parallel adjustment, macro coarse adjustment, macro approach, micro fine adjustment, micro approach and optical contact. Therefore, the results validate the multi-sensor control strategy.

Kinematics and optimization of 2-DOF parallel manipulator with revolute actuators and a passive leg

International Nuclear Information System (INIS)

Nam, Yun Joo; Park, Myeong Kwan

2006-01-01

In this paper, a 2-DOF planar parallel manipulator with two revolute actuators and one passive constraining leg. The kinematic analysis of the mechanism is analytically performed : the inverse and forward kinematics problems are solved in closed forms, the workspace is derived systematically, and the three kinds of singular configurations are found. The optimal design to determine the geometric parameters and the operating limits of the actuated legs is performed considering the kinematic manipulability and workspace size. These results of the paper show the effectiveness of the presented manipulator

Significance of angular mismatch between vertebral endplate and prosthetic endplate in lumbar total disc replacement.

Science.gov (United States)

Lee, Chong Suh; Chung, Sung Soo; Oh, Sung Kyun; You, Je Wook

2011-05-01

A retrospective study. To determine whether angular mismatch between the vertebral endplate and prosthetic endplate during lumbar total disc replacement (L-TDR) affects the radiological and clinical outcomes. A prosthesis anchored to the vertebral body by using a large central keel carries an inherent risk of angular mismatch between the vertebral endplate and prosthetic endplate at a segment with a greater degree of lordosis, such as L5-S1. Theoretically, this angular mismatch can cause several problems, such as segmental hyperlordosis, anterior positioning of the upper prosthesis, posterior prosthetic edge subsidence, decreased range of motion (ROM), and a poor clinical outcome. This study evaluated 64 prosthetic levels of 56 patients who were implanted with L-TDR between June 2002 and February 2006. There were 38 and 26 prosthetic levels at the L4-5 and L5-S1, respectively. The mean follow-up period was 25.6 (12 to 49) months. The angle of mismatch between the lower endplate of the upper vertebral body and the upper prosthetic plate, segmental flexion/extension ROM, segmental lordosis angle at extension, distance from the posterior wall of the vertebral body to the posterior prosthetic edge were measured by obtaining radiographs. Clinically, the Visual Analogue Scale and Oswestry Disability Index were also evaluated. The angular mismatches between the upper vertebra and prosthesis at L4-5 and L5-S1 were 1.6 degree and 5.6 degree, respectively (P body to the posterior edge of the prosthesis in L5-S1 were 6.8 degree (4 to 13), 12.8 degree (8 to 17), and 3.8 mm (1 to 6 mm) in patients with an angular mismatch of 0.05). Angular mismatch was more common in L5-S1 than in L4-5. L-TDR at the most lordotic level, L5-S1, and implantation of an upper prosthesis with a mismatched angle seem to be the causes of a reduced segmental ROM, increased segmental lordosis, and anterior malpositioning of the prosthesis. However, these changes do not affect the clinical outcomes of

Differential contributions of specimen types, culturing, and 16S rRNA sequencing in diagnosis of prosthetic joint infections

DEFF Research Database (Denmark)

Larsen, Lone Heimann; Khalid, Vesal; Xu, Yijuan

2018-01-01

Prosthetic joint failure is mainly caused by infection, aseptic failure (AF), and mechanical problems. Infection detection has been improved with modified culture methods and molecular diagnostics. However, comparisons between modified and conventional microbiology methods are difficult due...... to variations in specimen sampling. In this prospective, multidisciplinary study of hip or knee prosthetic failures, we assessed the contributions of different specimen types, extended culture incubations, and 16S rRNA sequencing for diagnosing prosthetic joint infections (PJI). Project specimens included joint...... fluid (JF), bone biopsy specimens (BB), soft-tissue biopsy specimens (STB), and swabs (SW) from the prosthesis, collected in situ, and sonication fluid collected from prosthetic components (PC). Specimens were cultured for 6 (conventional) or 14 days, and 16S rRNA sequencing was performed at study...

Diagnostic evaluation of left-sided prosthetic heart valve dysfunction

NARCIS (Netherlands)

Habets, Jesse; Budde, Ricardo P.; Symersky, Petr; van den Brink, Renee B.; de Mol, Bas A.; Mali, Willem P.; van Herwerden, Lex A.; Chamuleau, Steven A.

Prosthetic heart valve (PHV) dysfunction is a rare, but potentially life-threatening, complication. In clinical practice, PHV dysfunction poses a diagnostic dilemma. Echocardiography and fluoroscopy are the imaging techniques of choice and are routinely used in daily practice. However, these

Diagnostic evaluation of left-sided prosthetic heart valve dysfunction

NARCIS (Netherlands)

Habets, Jesse; Budde, Ricardo P.; Symersky, Petr; van den Brink, Renee B.; de Mol, Bas A.; Mali, Willem P.; van Herwerden, Lex A.; Chamuleau, Steven A.

2011-01-01

Prosthetic heart valve (PHV) dysfunction is a rare, but potentially life-threatening, complication. In clinical practice, PHV dysfunction poses a diagnostic dilemma. Echocardiography and fluoroscopy are the imaging techniques of choice and are routinely used in daily practice. However, these

Prosthetic model, but not stiffness or height, affects the metabolic cost of running for athletes with unilateral transtibial amputations.

Science.gov (United States)

Beck, Owen N; Taboga, Paolo; Grabowski, Alena M

2017-07-01

Running-specific prostheses enable athletes with lower limb amputations to run by emulating the spring-like function of biological legs. Current prosthetic stiffness and height recommendations aim to mitigate kinematic asymmetries for athletes with unilateral transtibial amputations. However, it is unclear how different prosthetic configurations influence the biomechanics and metabolic cost of running. Consequently, we investigated how prosthetic model, stiffness, and height affect the biomechanics and metabolic cost of running. Ten athletes with unilateral transtibial amputations each performed 15 running trials at 2.5 or 3.0 m/s while we measured ground reaction forces and metabolic rates. Athletes ran using three different prosthetic models with five different stiffness category and height combinations per model. Use of an Ottobock 1E90 Sprinter prosthesis reduced metabolic cost by 4.3 and 3.4% compared with use of Freedom Innovations Catapult [fixed effect (β) = -0.177; P Run (β = -0.139; P = 0.002) prostheses, respectively. Neither prosthetic stiffness ( P ≥ 0.180) nor height ( P = 0.062) affected the metabolic cost of running. The metabolic cost of running was related to lower peak (β = 0.649; P = 0.001) and stance average (β = 0.772; P = 0.018) vertical ground reaction forces, prolonged ground contact times (β = -4.349; P = 0.012), and decreased leg stiffness (β = 0.071; P running. Instead, an optimal prosthetic model, which improves overall biomechanics, minimizes the metabolic cost of running for athletes with unilateral transtibial amputations. NEW & NOTEWORTHY The metabolic cost of running for athletes with unilateral transtibial amputations depends on prosthetic model and is associated with lower peak and stance average vertical ground reaction forces, longer contact times, and reduced leg stiffness. Metabolic cost is unrelated to prosthetic stiffness, height, and stride kinematic symmetry. Unlike nonamputees who decrease leg stiffness with

Production of radioiodinated prosthetic group for indirect protein labeling

International Nuclear Information System (INIS)

Santos, Josefina da Silva

2001-01-01

Monoclonal antibodies and their fragments and, more recently, radiolabeled peptides have been extensively studied in order to develop radiopharmaceuticals for diagnostic and therapy in Nuclear Medicine. The radioiodination of proteins can be done by a direct method, with radioiodine being incorporated in to a tyrosine residue of the protein by electrophilic substitution. The main problem in the use of radioiodinated proteins, is that they are often dehalogenated in vivo by the action of specific enzymes, probably because of the structural similarity between iodophenyl groups and thyroid hormones. Several protein radioiodination methods have been developed in order to minimize this in vivo dehalogenation using prosthetic groups for indirect labeling. In this case, the radioiodine is first incorporated in to the prosthetic group that is subsequently attached to a terminal amino group or to a ε-amino group of lysine residue. The aim of this work is to obtain a radioiodinated prosthetic group for indirect labeling of proteins. The prosthetic group selected was the N-succinimidyl-4-radioiodine benzoate (SIB), obtained by the iodination of the p-bromobenzoic acid followed by the reaction with TSTU (0-(N-succinimidyl)-N,N,N',N'-tetramethyl uronium tetrafluoroborate) The results of these studies showed that the p-radio iodobenzoic acid was obtained with a radiochemical purity greater than 92% and a labeling yield of about 65%. Some reaction parameters were studied like temperature, time and Cu Cl mass (cataliser). The SIB was quantitatively obtained from p-radio iodobenzoic acid, using basic medium and after removing the water from the reaction using an nitrogen stream. The kinetic of this reaction is very fast with complete consumption of the p-radioiodebenzoic acid after 5 minutes. The coupling of the SIB prosthetic group to the protein was studied using Human Immunoglobulin (IgG) as a protein model. In a comparative way, the same protein was used on direct labeling

Development and testing of new upper-limb prosthetic devices: research designs for usability testing.

Science.gov (United States)

Resnik, Linda

2011-01-01

The purposes of this article are to describe usability testing and introduce designs and methods of usability testing research as it relates to upper-limb prosthetics. This article defines usability, describes usability research, discusses research approaches to and designs for usability testing, and highlights a variety of methodological considerations, including sampling, sample size requirements, and usability metrics. Usability testing is compared with other types of study designs used in prosthetic research.

Design, Sensing and Control of a Robotic Prosthetic Eye for Natural Eye Movement

OpenAIRE

J. J. Gu; M. Meng; A. Cook; P. X. Liu

2006-01-01

Loss of an eye is a tragedy for a person, who may suffer psychologically and physically. This paper is concerned with the design, sensing and control of a robotic prosthetic eye that moves horizontally in synchronization with the movement of the natural eye. Two generations of robotic prosthetic eye models have been developed. The first generation model uses an external infrared sensor array mounted on the frame of a pair of eyeglasses to detect the natural eye movement and to feed the contro...

Tensile strength and impact resistance properties of materials used in prosthetic check sockets, copolymer sockets, and definitive laminated sockets

OpenAIRE

Maria J. Gerschutz, PhD; Michael L. Haynes, MS; Derek M. Nixon, BS; James M. Colvin, MS

2011-01-01

Prosthetic sockets serve as the interface between people with amputations and their prostheses. Although most materials used to make prosthetic sockets have been used for many years, knowledge of these materials' properties is limited, especially after they are subjected to fabrication processes. This study evaluated tensile and impact properties of the current state-of-the-art materials used to fabricate prosthetic check sockets, copolymer sockets, and definitive laminated sockets. Thermolyn...

Biomechanical characteristics, patient preference and activity level with different prosthetic feet: a randomized double blind trial with laboratory and community testing.

Science.gov (United States)

Raschke, Silvia U; Orendurff, Michael S; Mattie, Johanne L; Kenyon, David E A; Jones, O Yvette; Moe, David; Winder, Lorne; Wong, Angie S; Moreno-Hernández, Ana; Highsmith, M Jason; J Sanderson, David; Kobayashi, Toshiki

2015-01-02

Providing appropriate prosthetic feet to those with limb loss is a complex and subjective process influenced by professional judgment and payer guidelines. This study used a small load cell (Europa™) at the base of the socket to measure the sagittal moments during walking with three objective categories of prosthetic feet in eleven individuals with transtibial limb loss with MFCL K2, K3 and K4 functional levels. Forefoot stiffness and hysteresis characteristics defined the three foot categories: Stiff, Intermediate, and Compliant. Prosthetic feet were randomly assigned and blinded from participants and investigators. After laboratory testing, participants completed one week community wear tests followed by a modified prosthetics evaluation questionnaire to determine if a specific category of prosthetic feet was preferred. The Compliant category of prosthetic feet was preferred by the participants (P=0.025) over the Stiff and Intermediate prosthetic feet, and the Compliant and Intermediate feet had 15% lower maximum sagittal moments during walking in the laboratory (P=0.0011) compared to the Stiff feet. The activity level of the participants did not change significantly with any of the wear tests in the community, suggesting that each foot was evaluated over a similar number of steps, but did not inherently increase activity. This is the first randomized double blind study in which prosthetic users have expressed a preference for a specific biomechanical characteristic of prosthetic feet: those with lower peak sagittal moments were preferred, and specifically preferred on slopes, stairs, uneven terrain, and during turns and maneuvering during real world use. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Design of a planar 3-DOF parallel micromanipulator

International Nuclear Information System (INIS)

Lee, Jeong Jae; Dong, Yanlu; Jeon, Yong Ho; Lee, Moon Gu

2013-01-01

A planar three degree-of-freedom (DOF) parallel manipulator is proposed to be applied for alignment during assembly of microcomponents. It adopts a PRR (prismatic-revolute-revolute) mechanism to meet the requirements of high precision for assembly and robustness against disturbance. The mechanism was designed to have a large workspace and good dexterity because parallel mechanisms usually have a narrow range and singularity of motion compared to serial mechanisms. Inverse kinematics and a simple closed-loop algorithm of the parallel manipulator are presented to control it. Experimental tests have been carried out with high-resolution capacitance sensors to verify the performance of the mechanism. The results of experiments show that the manipulator has a large workspace of ±1.0 mm, ±1.0 mm, and ±10 mrad in the X-, Y-, and θ-directions, respectively. This is a large workspace when considering it adopts a parallel mechanism and has a small size, 100 ´ 100 ´ 100 mm3 . It also has a good precision of 2 μm, 3 μm, and 0.2 mrad, in the X-, Y-, and θ- axes, respectively. These are high resolutions considering the manipulator adopts conventional joints. The manipulator is expected to have good dexterity.

Telemedicine consulting in the patient preparation and planning of prosthetic tooth replacement.

Science.gov (United States)

Mladenović, Dragan; Tosić, Goran; Zivković, Dusan; Djindjić, Natasa; Mladenović, Lidija; Mladenović, Sanja; Marković, Ivana

2013-09-01

In the management of edentulous spaces, there is a permanent need of a dentist-prosthetician in charge to consult other specialists. Modern telemedicine, based on powerful computer and telecomunication systems, offers an adequate answer to these challenges, being able to transfer and obtain clinical data and consultation information over large distances. Using smartphone or a computer, the teleconsultant acces the system, downloads and review the data and photographs and gave suggestions. The system then enables direct, real time contact with the consultant, chat, or directs them to contact each other by phone. We presented telemedicine consulting in the patient preparation and planning of prosthetic tooth replacement in 3 cases with different teleconsultation requirements: the first case for prosthetic rehabilitation of his upper teeth, the second one for prosthetic management of his partial edentulousness and "a growth on his gums" in the vestibular region of the frontal teeth and the third one for prosthetic management of total edentulousness of her upper jaw. We used the system of telemedicine in dentistry, established at the Faculty of Medicine in Kosovska Mitrovica. The operation was based on the computer application system XPA3 Online, computer networking and mobile smartphone network. All consultations were succefull with no need for further procedures in regional center. The use of a mobile smartphone has brought about the mobility and availability of teleconsultant specialists in an extent never seen before. Prostheticians are thus able to offer better service to their patients and improve the quality of management of partially or totally edentulous patients, especially in rural areas.

Surface EMG and intra-socket force measurement to control a prosthetic device

Science.gov (United States)

Sanford, Joe; Patterson, Rita; Popa, Dan

2015-06-01

Surface electromyography (SEMG) has been shown to be a robust and reliable interaction method allowing for basic control of powered prosthetic devices. Research has shown a marked decrease in EMG-classification efficiency throughout activities of daily life due to socket shift and movement and fatigue as well as changes in degree of fit of the socket throughout the subject's lifetime. Users with the most severe levels of amputation require the most complex devices with the greatest number of degrees of freedom. Controlling complex dexterous devices with limited available inputs requires the addition of sensing and interaction modalities. However, the larger the amputation severity, the fewer viable SEMG sites are available as control inputs. Previous work reported the use of intra-socket pressure, as measured during wrist flexion and extension, and has shown that it is possible to control a powered prosthetic device with pressure sensors. In this paper, we present data correlations of SEMG data with intra-socket pressure data. Surface EMG sensors and force sensors were housed within a simulated prosthetic cuff fit to a healthy-limbed subject. EMG and intra-socket force data was collected from inside the cuff as a subject performed pre-defined grip motions with their dominant hand. Data fusion algorithms were explored and allowed a subject to use both intra-socket pressure and SEMG data as control inputs for a powered prosthetic device. This additional input modality allows for an improvement in input classification as well as information regarding socket fit through out activities of daily life.

Peri-prosthetic fractures around tumor endoprostheses: a retrospective analysis of eighteen cases.

Science.gov (United States)

Barut, Nicolas; Anract, Philippe; Babinet, Antoine; Biau, David

2015-09-01

Tumour hip and knee endoprostheses have become the mainstay for reconstruction of patients with bone tumours. Fixation into host bone has improved over time. However, some patients present with a peri-prosthetic fracture over follow-up. The objective of this study was to analyse the mode of presentation and survival of implant after a peri-prosthetic fracture around a tumour endoprosthesis. Eighteen peri-prosthetic fractures (17 patients) were included. All patients were treated at a tertiary care center. There were 11 (65%) women; the median age at the time of fracture was 38 years old. All implants were cemented and all knee endoprostheses were fixed-hinge. Twelve (67%) fractures occurred after femoral resection and six (33%) fractures after proximal tibial resection. There were three femoral neck fractures (UCS C), three femoral shaft type C fractures, two femoral shaft type B1, one tibial shaft type B2, three tibial shaft type C, three ankle fractures (UCS C) and three patella fractures (UCS F). Two fractures were treated conservatively and 16 were operated on. Only one patient had the implant revised. There were eight (44%) failures over follow-up; none of the conservative treatment failed. The cumulative probability of failure for any reason was 27% (8-52) and 55% (22-79) at five and ten years, respectively. Peri-prosthetic fractures around massive endoprostheses are different from that of standard implants. There are more type C fractures; internal fixation is an attractive option at the time of presentation but the risk of revision over follow-up is high and patients should be informed accordingly.

Comparative study of radiography and scintigraphy for loosening and infection of prosthetic hip replacement

Energy Technology Data Exchange (ETDEWEB)

Park, Mi Sook; Lee, Sun Wha; Choi, Woo Suk; Lim, Joo Won; Song, Han Joon; Ahn, Chi Yul [College of Medicine, Kyung Hee University, Seoul (Korea, Republic of)

1987-10-15

Prosthetic hip replacement is associated with certain complications which result in a painful hip. Many of these, e. g. prosthetic dislocation, fracture, trochanteric avulsion, and heterotopic calcification are easily diagnosed by conventional radiography. However, radiographic evaluation for infection and/pr loosening of prosthesis as major complications requiring reoperation often contributes little to the resolution of the diagnostic problem. The authors made a comparative study of plain radiography and scintigraphy of 39 cases performed revision at Kyung Hee University Hospital from Sep. '81-to Aug. '86. The results were as follows: 1. In 39 revised prosthetic hip replacement, 26 cases (67%) of loosening without infection and 11 cases (28%) of infection were proven. 2. In loosening of prosthesis, plain radiography showed true positive rate of 76% and true negative rate of 60%, and scintigraphy showed true positive rate of 75% and true negative rate of 95%. 3. In infection of prosthesis, plain radiography revealed true positive rate of 55% and true negative rate of 96%, and scintigraphy revealed true positive rate of 100% and true negative rate of 83%. 4. Scintigraphy and plain radiography were useful as complementary procedure in evaluating and differentiating loosening and/or infection of prosthetic component.

Illusory movement perception improves motor control for prosthetic hands

Science.gov (United States)

Marasco, Paul D.; Hebert, Jacqueline S.; Sensinger, Jon W.; Shell, Courtney E.; Schofield, Jonathon S.; Thumser, Zachary C.; Nataraj, Raviraj; Beckler, Dylan T.; Dawson, Michael R.; Blustein, Dan H.; Gill, Satinder; Mensh, Brett D.; Granja-Vazquez, Rafael; Newcomb, Madeline D.; Carey, Jason P.; Orzell, Beth M.

2018-01-01

To effortlessly complete an intentional movement, the brain needs feedback from the body regarding the movement’s progress. This largely non-conscious kinesthetic sense helps the brain to learn relationships between motor commands and outcomes to correct movement errors. Prosthetic systems for restoring function have predominantly focused on controlling motorized joint movement. Without the kinesthetic sense, however, these devices do not become intuitively controllable. Here we report a method for endowing human amputees with a kinesthetic perception of dexterous robotic hands. Vibrating the muscles used for prosthetic control via a neural-machine interface produced the illusory perception of complex grip movements. Within minutes, three amputees integrated this kinesthetic feedback and improved movement control. Combining intent, kinesthesia, and vision instilled participants with a sense of agency over the robotic movements. This feedback approach for closed-loop control opens a pathway to seamless integration of minds and machines. PMID:29540617

Customized mold radiotherapy with prosthetic apparatus for oral cancers

International Nuclear Information System (INIS)

Noguchi, Tadahide; Tsuchiya, Yoshiyuki; Hayasaka, Junichi; Itoh, Hiroto; Jinbu, Yoshinori; Kusama, Mikio; Takahashi, Satoru; Nakazawa, Masanori

2014-01-01

Eight patients (6 males, 2 females; median age, 78 years; age range, 31-94 years) were treated by mold radiotherapy with a prosthetic apparatus for oral cancers between October 2006 and March 2013. The primary sites were the tongue in 3 cases, hard palate and buccal mucosa in 2 cases each, and oral floor in 1 case. The type of treatment consisted of radical radiotherapy and palliative radiotherapy in 2 cases each, and preoperative radiotherapy, postoperative radiotherapy, additional radiotherapy after external beam radiotherapy and systemic chemotherapy in 1 case each. Patients received 40-50 Gy in 8-10 fractions with mold radiotherapy. Two patients who received radical radiotherapy showed no signs of recurrence or metastasis. The present therapy contributed to patients' palliative, postoperative, and preoperative therapy. Mold radiotherapy with a prosthetic appliance was performed safely and was a useful treatment for several types of oral cancer. (author)

Red flag in the emergency department: fracture and primary failure of a prosthetic valve.

Science.gov (United States)

Ozsarac, Murat; Karcioglu, Ozgur; Ayrik, Cuneyt; Bozkurt, Seyran; Turkcuer, Ibrahim; Gumrukcu, Serhat

2005-07-01

This case report concerns a patient with fracture and primary dysfunction of a prosthetic valve. A 40-year-old man presented to the Emergency Department with a chief complaint of breakthrough pleuritic back pain and shortness of breath. Past surgical history was significant only for an aortic valve replacement and mitral valve replacement performed 16 years prior. The transthoracic echocardiography raised suspicion of prosthesis malposition. The patient was taken to the operating room by cardiothoracic surgeons for valve replacement. Operative findings revealed that a prosthetic valve leaflet in the mitral position had broken off. Primary prosthetic valve failure should not be overlooked in the differential diagnosis of patients with valve replacement and a rapidly deteriorating clinical course. Emergency echocardiography is a guide to convenient diagnosis and management. Early surgical consultation and early reparative surgery might prevent unnecessary morbidity and mortality.

Developing and modeling of voice control system for prosthetic robot arm in medical systems

Directory of Open Access Journals (Sweden)

Koksal Gundogdu

2018-04-01

Full Text Available In parallel with the development of technology, various control methods are also developed. Voice control system is one of these control methods. In this study, an effective modelling upon mathematical models used in the literature is performed, and a voice control system is developed in order to control prosthetic robot arms. The developed control system has been applied on four-jointed RRRR robot arm. Implementation tests were performed on the designed system. As a result of the tests; it has been observed that the technique utilized in our system achieves about 11% more efficient voice recognition than currently used techniques in the literature. With the improved mathematical modelling, it has been shown that voice commands could be effectively used for controlling the prosthetic robot arm. Keywords: Voice recognition model, Voice control, Prosthetic robot arm, Robotic control, Forward kinematic

Dynamic Facial Prosthetics for Sufferers of Facial Paralysis

Directory of Open Access Journals (Sweden)

Fergal Coulter

2011-10-01

Full Text Available BackgroundThis paper discusses the various methods and the materialsfor the fabrication of active artificial facial muscles. Theprimary use for these will be the reanimation of paralysedor atrophied muscles in sufferers of non-recoverableunilateral facial paralysis.MethodThe prosthetic solution described in this paper is based onsensing muscle motion of the contralateral healthy musclesand replicating that motion across a patient’s paralysed sideof the face, via solid state and thin film actuators. Thedevelopment of this facial prosthetic device focused onrecreating a varying intensity smile, with emphasis ontiming, displacement and the appearance of the wrinklesand folds that commonly appear around the nose and eyesduring the expression.An animatronic face was constructed with actuations beingmade to a silicone representation musculature, usingmultiple shape-memory alloy cascades. Alongside theartificial muscle physical prototype, a facial expressionrecognition software system was constructed. This formsthe basis of an automated calibration and reconfigurationsystem for the artificial muscles following implantation, soas to suit the implantee’s unique physiognomy.ResultsAn animatronic model face with silicone musculature wasdesigned and built to evaluate the performance of ShapeMemory Alloy artificial muscles, their power controlcircuitry and software control systems. A dual facial motionsensing system was designed to allow real time control overmodel – a piezoresistive flex sensor to measure physicalmotion, and a computer vision system to evaluate real toartificial muscle performance.Analysis of various facial expressions in real subjects wasmade, which give useful data upon which to base thesystems parameter limits.ConclusionThe system performed well, and the various strengths andshortcomings of the materials and methods are reviewedand considered for the next research phase, when newpolymer based artificial muscles are constructed

Ureaplasma parvum prosthetic joint infection detected by PCR.

Science.gov (United States)

Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

2014-06-01

We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A Prosthetic Foot Emulator to Optimize Prescription of Prosthetic Feet in Veterans and Service Members with Leg Amputations

Science.gov (United States)

2017-09-01

mobility, prosthetic foot preference and walking ability after two weeks of use in the home and community setting. No exclusions based on sex , race...2012 Page 17 of 33 Data collection Photos and video recording With the participant’s explicit consent, we may take video and photos during portions of...this study, for documentation and use in research publications. All videos and photos will exclue the participant’s face and identifying marks will

Bio-inspired mechanical design of a tendon-driven dexterous prosthetic hand.

Science.gov (United States)

Controzzi, Marco; Cipriani, Christian; Jehenne, Beryl; Donati, Marco; Carrozza, Maria Chiara

2010-01-01

This paper presents the preliminary design of a new dexterous upper-limb prosthesis provided with a novel anthropomorphic hand, a compact wrist based on bevel gears and a modular forearm able to cover different levels of upper-limb amputations. The hand has 20 DoFs and 11 motors, with a dexterous three fingered subsystem composed by a fully actuated thumb, and an hybrid index and middle fingers to enable dexterous manipulation and enhance grasp performance.

Three-dimensional flow structures past a bio-prosthetic valve in an in-vitro model of the aortic root

OpenAIRE

Hasler, David; Obrist, Dominik

2018-01-01

The flow field past a prosthetic aortic valve comprises many details that indicate whether the prosthesis is functioning well or not. It is, however, not yet fully understood how an optimal flow scenario would look, i.e. which subtleties of the fluid dynamics in place are essential regarding the durability and compatibility of a prosthetic valve. In this study, we measured and analyzed the 3D flow field in the vicinity of a bio-prosthetic heart valve in function of the aortic root size. The m...

Current standard rules of combined anteversion prevent prosthetic impingement but ignore osseous contact in total hip arthroplasty.

Science.gov (United States)

Weber, Markus; Woerner, Michael; Craiovan, Benjamin; Voellner, Florian; Worlicek, Michael; Springorum, Hans-Robert; Grifka, Joachim; Renkawitz, Tobias

2016-12-01

In this prospective study of 135 patients undergoing cementless total hip arthroplasty (THA) we asked whether six current definitions of combined anteversion prevent impingement and increase postoperative patient individual impingement-free range-of-motion (ROM). Implant position was measured by an independent, external institute on 3D-CT performed six weeks post-operatively. Post-operative ROM was calculated using a CT-based algorithm detecting osseous and/or prosthetic impingement by virtual hip movement. Additionally, clinical ROM was evaluated pre-operatively and one-year post-operatively by a blinded observer. Combined component position of cup and stem according to the definitions of Ranawat, Widmer, Dorr, Hisatome and Yoshimine inhibited prosthetic impingement in over 90 %, while combined osseous and prosthetic impingement still occurred in over 40 % of the cases. The recommendations by Jolles, Widmer, Dorr, Yoshimine and Hisatome enabled higher flexion (p ≤ 0.001) and internal rotation (p ≤ 0.006). Clinically, anteversion rules of Widmer and Yoshimine provided one-year post-operatively statistically but not clinically relevant higher internal rotation (p ≤0.034). Standard rules of combined anteversion detect prosthetic but fail to prevent combined osseous and prosthetic impingement in THA. Future models will have to account for the patient-individual anatomic situation to ensure impingement-free ROM.

Oral health-related quality of life and prosthetic status of nursing home residents with or without dementia.

Science.gov (United States)

Klotz, Anna-Luisa; Hassel, Alexander Jochen; Schröder, Johannes; Rammelsberg, Peter; Zenthöfer, Andreas

2017-01-01

The objective of this cross-sectional study was to evaluate the effect of prosthetic status on the oral health-related quality of life (OHRQoL) of nursing home residents with or without dementia. The study was performed in 14 nursing homes across the federal state of Baden-Württemberg, Germany. All eligible participants were included, and general and medical information and information about their dental and prosthetic statuses were collected. The Geriatric Oral Health Assessment Index (GOHAI) was administered to evaluate OHRQoL. The Mini-Mental State Examination (MMSE) served to classify participants into living or not living with dementia according to the established cutoff value for dementia (MMSE health was also similar in both groups ( P >0.05). The number of teeth (odds ratio [OR]: 2.0), the type of prosthetic status (OR: 6.5), and denture-related treatment needs (OR: 2.4) were the major factors significantly affecting OHRQoL ( P nursing home residents is substantially compromised. Several prosthetic treatment needs for residents living with or without dementia were identified. Edentulism without tooth replacement and having <5 teeth resulted in an increased risk of substantially compromised OHRQoL. Further studies should be conducted to determine whether improvements in prosthetic status can increase OHRQoL.

Swing Phase Control of Semi-Active Prosthetic Knee Using Neural Network Predictive Control With Particle Swarm Optimization.

Science.gov (United States)

Ekkachai, Kittipong; Nilkhamhang, Itthisek

2016-11-01

In recent years, intelligent prosthetic knees have been developed that enable amputees to walk as normally as possible when compared to healthy subjects. Although semi-active prosthetic knees utilizing magnetorheological (MR) dampers offer several advantages, they lack the ability to generate active force that is required during some states of a normal gait cycle. This prevents semi-active knees from achieving the same level of performance as active devices. In this work, a new control algorithm for a semi-active prosthetic knee during the swing phase is proposed to reduce this gap. The controller uses neural network predictive control and particle swarm optimization to calculate suitable command signals. Simulation results using a double pendulum model show that the generated knee trajectory of the proposed controller is more similar to the normal gait than previous open-loop controllers at various ambulation speeds. Moreover, the investigation shows that the algorithm can be calculated in real time by an embedded system, allowing for easy implementation on real prosthetic knees.

Corynebacterium minutissimum vascular graft infection: case report and review of 281 cases of prosthetic device-related Corynebacterium infection.

Science.gov (United States)

Reece, Rebecca M; Cunha, Cheston B; Rich, Josiah D

2014-09-01

Corynebacterium spp. have proven their pathogenic potential in causing infections, particularly in the setting of immunosuppression and prosthetic devices. We conducted a PubMed literature review of all cases of Corynebacterium prosthetic device infections published in the English language through December 2013. The majority of cases involved peritoneal dialysis and central venous catheters, but prosthetic joints and central nervous system shunts/drains were also involved. The management of these cases in terms of retention or removal of the device was not uniform; however, the overall mortality remained the same among both groups. All of these prosthetic device infections pose potential problems in management when the device cannot be removed safely for the patient, especially with the lack of data on the pathogenicity of Corynebacterium species. However with better identification of species and sensitivities, successful treatment is possible even with retention of the device.

Role of CT in patients with prosthetic heart valves

NARCIS (Netherlands)

Suchá, D.

2016-01-01

Valvular heart disease accounts for a substantial part of the cardiovascular disease worldwide with an estimated prevalence of 2.5% in the Western population aged <65 years and over 13% in the population aged >75 years. Surgical prosthetic heart valve (PHV) replacement is the indicated therapy for

Diagnostic flowcharts in osteomyelitis, spondylodiscitis and prosthetic joint infection

NARCIS (Netherlands)

Jutte, P.; Lazzeri, E.; Sconfienza, L. M.; Cassar-Pullicino, V.; Trampuz, A.; Petrosillo, N.; Signore, A.

Infections of the bone, spine and prosthetic joints are serious and complex conditions to diagnose and to treat. Structured diagnostic workup may very well improve the accuracy and speed of diagnosis, thereby improving the outcome since treatment may very well be more successful and less harmful if